阅读说明：本技术 增强植物广谱抗病性的转录因子及应用 (Transcription factor for enhancing plant broad-spectrum disease resistance and application thereof ) 是由 何祖华 翟科然 邓一文 李群 于 2019-03-08 设计创作，主要内容包括：本发明涉及增强植物广谱抗病性的转录因子及应用。本发明揭示了PIBP1通过与PigmR和其它广谱抗病R基因直接互作进而促进自身细胞核蛋白的累积,正调控植物的抗病能力。PIBP1和同源基因作为一类非经典的转录因子结合并激活其下游的防卫基因如OsWAK14和OsPAL1的表达。因此,本发明提出了新的转录因子,其通过与R基因直接互作激活下游抗病基因,赋予植物抗病性的新机制。本发明不仅提供了切实有效的植物改良方法,也为植物广谱免疫机制研究和植物抗病育种提供了新的途径。(The invention relates to a transcription factor for enhancing the broad-spectrum disease resistance of plants and application thereof. The invention discloses that PIBP1 directly interacts with PigmR and other broad-spectrum disease-resistant R genes to promote the accumulation of self-nucleus protein and positively regulate the disease-resistant capability of plants. PIBP1 binds to homologous genes as a class of non-canonical transcription factors and activates expression of defense genes downstream thereof, such as OsWAK14 and OsPAL 1. Therefore, the present invention proposes a novel transcription factor which activates a downstream disease resistance gene by directly interacting with an R gene, giving a novel mechanism of disease resistance to plants. The invention not only provides a practical and effective plant improvement method, but also provides a new way for the research of the broad-spectrum immune mechanism of the plant and the breeding of plant disease resistance.)

1. A method of increasing disease resistance of a plant or producing a plant with increased disease resistance comprising:

(a) promoting expression or localization or accumulation of PIBP1 in the nucleus;

(b) promoting the interaction of the PIBP1and downstream genes thereof, thereby improving the expression of the downstream genes, wherein the downstream genes comprise: WAK14, PAL 1;

(c) promoting the interaction of PIBP1and NLR protein, thereby improving the disease resistance mediated by the NLR protein, wherein the NLR protein comprises: PigmR, Pizt;

wherein the PIBP1 includes homologs thereof that include: os06g 02240.

2. The method of claim 1, comprising:

recombinantly expressing PIBP 1to increase the expression level of PIBP1 or promote its localization or accumulation in the nucleus;

PIBP1 is linked to a nuclear localization signal molecule to facilitate localization or accumulation of PIBP1 in the nucleus.

Promoting interaction of NLR protein and PIBP 1to promote positioning or accumulation of PIBP1 in cell nucleus;

recombinantly expressing the PIBP1 and/or genes downstream thereof to promote the interaction of the PIBP1and the genes downstream thereof; or

The PIBP1 and/or NLR protein is recombinantly expressed to facilitate the interaction of PIBP1 with the NLR protein.

3. The method of claim 1, wherein the facilitating the interaction of PIBP1 with its downstream genes is: promotes the interaction of the PIBP1and the promoter of the downstream gene, thereby improving the expression of the downstream gene.

Use of PIBP1 for increasing the disease resistance of a plant or for preparing a plant with increased disease resistance; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

5. A derivative of PIBP1, which is a molecule of PIBP1 linked to a nuclear localization signal molecule; preferably it is a fusion protein, a fusion gene or an expression vector carrying the fusion gene; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

6. An isolated biologically active fragment of PIBP1 comprising a fragment corresponding to amino acids 270-279, particularly amino acid 275, of the PIBP1 protein sequence; preferably, the fragment containing the amino acids corresponding to amino acids 270-279 of the PIBP1 protein sequence comprises: a fragment corresponding to positions 75-284 of the PIBP1 protein and a fragment corresponding to positions 1-279 of the PIBP1 protein; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

7. An isolated protein complex comprising: PIBP1, and NLR protein, which interact; wherein, the NLR protein comprises: PigmR, Pizt; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

8. An isolated protein-nucleic acid complex comprising: PIBP1, and downstream genes of PIBP 1; the two interact with each other; wherein the downstream genes comprise: WAK14, PAL 1; wherein the PIBP1 includes homologs thereof that include: os06g 02240; preferably, in the complex, PIBP1 binds to the promoter region of its downstream gene.

9. Use of the complex of claim 7 or 8 as a target for modulating disease resistance in a plant to produce a plant with enhanced disease resistance; or used as a screening target spot to screen potential substances for improving the disease resistance of the plants.

10. A method of targeted selection of plants with enhanced disease resistance, the method comprising:

identifying the complex of claim 7 or 8 in a test plant, which is a plant with enhanced disease resistance if the complex interaction in the test plant is higher than the average of the complex interactions in the plant; or

Identifying the expression of the PIBP1 in the cells or the location or accumulation of the PIBP1 in the cell nucleus of the plant cells, and if the expression of the PIBP1 in the plant cells is higher than the average value of the PIBP1 in the plant cells, or the location or accumulation of the PIBP 3578 in the cell nucleus is higher than the average value of the plant cells, the plant cells with enhanced disease resistance are identified.

11. A method of screening for a modulator that increases the disease resistance of a plant, the method comprising:

(1) adding a candidate substance to a system comprising the complex of claim 7 or 8;

(2) observing the interaction of PIBP1and NLR protein or the interaction of PIBP1and a downstream gene promoter region in the complex; wherein, if the candidate substance promotes the interaction between the PIBP1and the NLR protein in the complex or the interaction between the PIBP1and the downstream gene promoter region thereof, the candidate substance is an agent for improving the disease resistance of the plant; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

12. A method of screening for a modulator that increases the disease resistance of a plant, the method comprising: (1) adding a candidate substance to a system comprising PIBP 1; (2) observing the expression or activity of PIBP1 in the system; wherein, if the candidate substance promotes the expression or activity of the PIBP1, the candidate substance is a regulator for improving the disease resistance of the plant; wherein the PIBP1 includes homologs thereof that include: os06g 02240.

13. The method of any one of claims 1to 3, the use of claim 4, the derivative of PIBP1 of claim 5, the complex of claim 7 or 8, wherein the PIBP1, further comprises a derivative, variant or biologically active fragment thereof; preferably, the biologically active fragment is a fragment comprising the amino acids at positions 270-279, especially 275, of the corresponding PIBP1 protein sequence; preferably, the derivative is a molecule in which PIBP1 is linked to NLS, or a construct capable of expressing the molecule; preferably, the variant comprises a variant having more than 80% sequence homology with PIBP1 but which corresponds to amino acids 270-279, in particular 275, of the PIBP1 protein sequence.

14. The method of any one of claims 1-3, 10-12, the use of claim 4 or 9, wherein said disease resistance comprises: ability to combat fungal diseases; preferably comprising: the ability to resist rice blast germs.

15. The method according to any one of claims 1to 3 and 11, the complex according to claim 7, wherein the NLR protein comprises a homologue thereof, or a derivative, variant or biologically active fragment thereof; preferably, the biologically active fragment is a fragment comprising amino acids of the coiled-coil domain in the sequence of the corresponding NLR protein or homologue thereof; preferably, the variant is a variant having a sequence homology of more than 80% with the NLR protein or a homologue thereof, but the coiled-coil domain in the sequence corresponding to the NLR protein or a homologue thereof remains conserved; preferably, the NLR protein comprises PigmR or Pizt.

16. The method according to any one of claims 1to 3 and 10 to 12 and the use according to any one of claims 4 to 9, wherein the plant comprises a graminaceous plant.

Technical Field

The invention belongs to the field of molecular biology or botany, and particularly relates to a transcription factor for enhancing plant broad-spectrum disease resistance and application thereof.

Background

Plant diseases can cause great yield reduction and even dead production of crops, and the global grain safety is seriously influenced. Rice, as a major food product in the world, lives nearly more than half of the population. However, the rice is damaged by various pathogenic microorganisms in nature, so that the yield of the rice is reduced to different degrees every year. Among them, fungal diseases such as rice blast (caused by Magnaporthe oryzae) and bacterial diseases such as bacterial leaf blight (caused by Xanthomonas oryzae pv. oryzae) have the most serious influence on yield and quality of rice. The annual reduction in rice blast (Magnaporthe oryzae) alone corresponds to 10-30% of the total production, and can provide a year's food demand for at least 6 million people. In recent years, the large amount and wide use of pesticides have reduced the influence of plant diseases and insect pests to some extent, but also have brought new challenges to the natural environment and food safety. Therefore, the cultivation of new disease-resistant varieties has great significance for improving the yield and the quality of the rice.

During the interaction and evolution with pathogenic bacteria, plants develop specific immune systems. The defense mechanism can be divided into constitutive type and inducible type. The constitutive physical and chemical barriers comprise physical barriers of wax, cutin, lignin, silicon cells and the like on the surface of the plant, and phenolic substances, sulfides, saponin, antimicrobial protein and the like produced by the plant cells after the infection of pathogenic bacteria. The inducible plant defense system is a series of physiological and biochemical changes and gene expression level changes induced by the infection of plants by pathogenic bacteria, and is also called innate immunity (nature). The innate immune response can be divided into two categories, mechanistically and hierarchically: one is to identify the molecular characteristics existing on the surface of a pathogen through a pathogenic bacteria molecular Pattern Recognition Receptor (PRR) on a cell membrane, namely a pathogen-associated molecular pattern (PAMP; or microbe-associated molecular pattern, MAMP) and trigger a pathogen-associated molecular pattern immune response (PTI); another class is that the specialised resistance proteins (R proteins) present in the cell recognize effector proteins (avirulence) of pathogenic microorganisms, thereby activating downstream specialised defense reaction processes, i.e. effector-induced immune responses (ETI). PTI is an important component of the basic resistance to disease (basal defense) response, which is relatively broad-spectrum, stable, and durable, but can be inhibited by effector proteins secreted by pathogenic microorganisms. ETI is more resistant and specialized, often accompanied by Hypersensitivity (HR) and even cell death (celldeath) at the site of infection, and is now widely used in rice breeding.

Currently, the cloned R genes in rice mainly comprise: XA1, XA27, XA5, XA13(Os8N3 or OsSWEET11), Os11N3(OsSWEET14), XA25 mediating resistance to bacterial blight; pita, Pib, Piz-t, Pikm, Pit, Pid3, Pi2, Pi5, Pi9, Pi36, Pi37, Pb1, Pia, and Pigm, among others, that mediate resistance to rice blast. The R protein can be divided into 5 types according to its structure: serine/threonine protein kinase (STK), intracellular receptor protein (co-colored/Toll or interfacial-1 receptor-like nuclear-binding-rich repeat, CC/TIR-NBS-LRR), transmembrane receptor containing only extracellular LRR domain (LRR-TM), receptor kinase (LRR-TM-STK) and the rest of R protein which does not belong to the structure. Wherein most of the R proteins belong to the CC/TIR-NBS-LRR class of proteins. According to current research, the R gene is thought to have two main functions. Firstly, the effector protein of pathogenic bacteria is identified, and secondly, the downstream immune signal is activated. In this process, the CC or TIR domain of the NLR primarily mediates downstream signaling through the formation of homo-or heteromultimers; the LRR structural domain with protein sequence diversity can enable the NLR protein to inhibit self activity when no pathogenic bacteria are infected, and can activate the NLR protein by changing self protein conformation when the pathogenic bacteria invade, so that the immune process of plants is activated.

The plant R protein induces ETI immunity of plants by recognizing pathogenic bacteria nontoxic protein. At present, the identification of plant disease-resistant protein and nontoxic protein secreted by pathogenic bacteria is mainly divided into 'direct identification' and 'indirect identification'. The 'direct identification' model, namely the disease-resistant R protein can identify pathogenic bacteria through direct interaction with the pathogenic bacteria non-toxic protein. The 'indirect identification' model mainly comprises a 'warning/trapping' model police. The R protein in the "alert model" indirectly recognizes pathogenic bacteria by monitoring the modification of the target protein or its analogous protein by avirulence proteins in the host. In addition, the "bait model" is the interaction of the avirulence protein with the bait protein, causing the disease-resistant R protein to recognize the avirulence protein. The R protein after identifying pathogenic bacteria can further activate ETI immune signal path of plants.

ETI can protect plants from being threatened by pathogenic bacteria through expression regulation of disease-resistant genes. In this process, activation or inhibition of downstream defense genes by transcription factors has important regulatory functions on plant immunity. There are some related studies to date, which indicate that NLRs regulate the transcription level of immune genes through direct interaction with transcription factors. For example, SPL6, as a SQUAMOSA PROMOTER BINDING PROTEIN-LIKE transcription factor, can regulate the immune process of plants by direct interaction with NLRs. The transcription factor bHLH84 responds to the induction of pathogenic bacteria and directly interacts with NLRs to regulate and control the expression of downstream defense genes. NLR MLA10 can cooperatively regulate the immune response process of plants in cell nucleus through the interaction with transcription factors WRKYs and MYB 6. WRKY45 interacts with NLR gene Pb1 in cell nucleus, and further promotes the expression of downstream disease-resistant gene thereof by inhibiting the protein degradation of WRKY45, thereby endowing plant with disease resistance. Meanwhile, more than 100 WRKY transcription factors exist in the rice genome. A plurality of WRKY transcription factors are involved in the rice immune response, and WRKY62 and WRKY76 negatively regulate the XA 21-mediated immune response. Meanwhile, the infection of rice blast germs can induce the specific expression of WRKY53 and WRKY 89. It has also been found that some WRKY transcription factors respond specifically to infestation by one pathogen, while others respond to signals from multiple pathogens. This indicates that there is a crossover downstream of the plant disease-resistant signaling pathways elicited by different pathogenic bacteria.

Although studies have shown that the interaction of NLRs with transcription factors directly regulates the expression of defense genes during ETI reactions, the specific regulatory mechanisms and the involved transcription factors are poorly understood in the art.

Disclosure of Invention

The invention aims to provide a transcription factor for enhancing the broad-spectrum disease resistance of plants and application thereof.

In a first aspect of the present invention, there is provided a method of increasing disease resistance of a plant or producing a plant with increased disease resistance, comprising: (a) promoting expression or localization or accumulation of PIBP1 in the nucleus; (b) promoting the interaction (binding) of PIBP1 with its downstream genes, thereby increasing the expression of the downstream genes, including: WAK14, PAL 1; or (c) promoting the interaction (binding) of PIBP1 with NLR proteins, thereby increasing NLR protein-mediated disease resistance, said NLR proteins comprising: PigmR, Pizt; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In a preferred embodiment, the method comprises the following steps: recombinantly expressing (or overexpressing) PIBP 1to increase the expression level of PIBP1 or to facilitate its localization or accumulation in the nucleus; the PIBP1 is linked to a nuclear localization signal molecule (NLS) (including recombinant expression of a molecule in which PIBP1 is linked to NLS) to promote localization or accumulation of PIBP1 in the nucleus. Promote the interaction (binding) of the NLR protein with PIBP 1to promote the localization or accumulation of PIBP1 in the nucleus; recombinantly expressing (or overexpressing) PIBP1 and/or its downstream genes to facilitate interaction of PIBP1 with its downstream genes; or recombinantly expressing (or overexpressing) PIBP1 and/or NLR protein to facilitate interaction of PIBP1 with NLR protein.

In another preferred example, the interaction of PIBP1 with its downstream genes is promoted by: promotes the interaction (combination) of the PIBP1and the promoter of the downstream gene, thereby improving the expression of the downstream gene.

In another preferred embodiment, plants with increased resistance to disease are prepared by methods including, but not limited to, the agrobacterium method.

In another aspect of the invention, there is provided the use of PIBP1 for increasing the disease resistance of a plant or for making a plant with increased disease resistance; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In another aspect of the invention, there is provided a derivative of PIBP1, which is a molecule of PIBP1 linked to a nuclear localization signal molecule (NLS); preferably it is a fusion protein, a fusion gene or an expression vector carrying the fusion gene; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In a preferred embodiment, the nuclear localization signal molecule comprises the nuclear localization signal molecule encoded by ATGCCTAAGAAGAAGAGAAAGGTTGGAGGA (SEQ ID NO:2) or a degenerate version thereof.

In another aspect of the invention, there is provided an isolated biologically active fragment of PIBP1 comprising a fragment corresponding to amino acids 270-279, particularly 275, of the sequence of a PIBP1 protein; preferably, the fragment containing the amino acids corresponding to amino acids 270-279 of the PIBP1 protein sequence includes (but is not limited to): a fragment corresponding to positions 75-284 of the PIBP1 protein and a fragment corresponding to positions 1-279 of the PIBP1 protein; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In another aspect of the invention, there is provided an isolated protein complex comprising: PIBP1, and NLR proteins, which interact (bind); wherein, the NLR protein comprises: PigmR, Pizt; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In another aspect of the invention, there is provided an isolated protein-nucleic acid complex comprising: PIBP1, and downstream genes of PIBP 1; the two interact (combine); wherein the downstream genes comprise: WAK14, PAL 1; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240; preferably, in the complex, PIBP1 binds to the promoter region of its downstream gene.

In another aspect of the present invention, there is provided a use of the complex as a target for regulating disease resistance of a plant, for preparing a plant with enhanced (improved) disease resistance; or used as a screening target spot to screen potential substances for improving the disease resistance of the plants.

In another aspect of the present invention, there is provided a method for targeted selection of plants with enhanced (increased) disease resistance, the method comprising: identifying said complex in a test plant as a (potentially) disease resistance-enhanced (enhanced) plant if the interaction of said complex in the test plant is higher (significantly higher) than the average of the interactions of the complex in the (or the) plant type; or identifying the expression of PIBP1 in the cell or the localization or accumulation in the nucleus of a plant cell, which is (potentially) a plant with enhanced (increased) disease resistance if its expression is higher (significantly higher) than the average value of the PIBP1 in the plant(s), or its localization or accumulation in the nucleus of a cell is higher (significantly higher) than the average value of the plant(s).

In another aspect of the present invention, there is provided a method of screening for a modulator that increases disease resistance of a plant, the method comprising: (1) adding a candidate substance to a system comprising said complex; (2) observing the interaction of PIBP1and NLR protein or the interaction of PIBP1and a downstream gene promoter region in the complex; wherein, if the candidate substance promotes (preferably statistically promotes; for example, promotes more than 20%, preferably more than 50%, more preferably more than 80%) the interaction between PIBP1and NLR protein in the complex, or the interaction between PIBP1and the promoter region of the downstream gene thereof, the candidate substance is an agent for improving the disease resistance of the plant; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In another aspect of the present invention, there is provided a method of screening for a modulator that increases disease resistance of a plant, the method comprising: (1) adding a candidate substance to a system comprising PIBP 1; (2) observing the expression or activity of PIBP1 in the system; wherein, if the candidate substance promotes (preferably statistically promotes; such as promotes more than 20%, preferably promotes more than 50%, more preferably promotes more than 80%) the expression or activity of PIBP1, the candidate substance is an agent for improving the disease resistance of the plant; wherein the PIBP1 includes homologs thereof including (but not limited to): os06g 02240.

In a preferred embodiment, the method further comprises setting the control group and the test group to observe the difference between the candidate substance in the test group and the control group.

In another preferred embodiment, the candidate substance includes (but is not limited to): up-regulators, agonists, interfering molecules, nucleic acid inhibitors, binding molecules (such as antibodies or ligands), small molecule compounds (such as hormones) and the like designed against the PIBP1 or homologues thereof, genes downstream of PIBP1 or homologues thereof, NLR proteins, or proteins upstream or downstream thereof.

In another preferred embodiment, the system is selected from: plant cell system (cell culture system), plant subcellular system, solution system, plant tissue system, and plant organ system.

In another preferred example, the method further comprises: further cell experiments and/or transgenic experiments are performed on the obtained potential substances to further determine substances excellent in the effect of improving the disease resistance of plants from the candidate substances.

In another preferred embodiment, in the above method, use or complex, the PIBP1, further comprises a derivative, variant or biologically active fragment thereof; preferably, the biologically active fragment is a fragment comprising the amino acids at positions 270-279, especially 275, of the corresponding PIBP1 protein sequence; preferably, the derivative is a molecule which is PIBP1 linked to NLS, or a construct (such as an expression plasmid) capable of expressing the molecule; preferably, the variants include those having a sequence homology of more than 80% (more preferably more than 85%, more than 90%, more than 95%, more than 98% or more than 99%) with PIBP1, but which are conserved with amino acids 270-279, especially 275, of the sequence of the PIBP1 protein.

In another preferred embodiment, the fragment containing amino acids 270-279 of the corresponding PIBP1 protein sequence includes (but is not limited to): a fragment of PIBP1 from positions 75 to 284, a fragment of PIBP1 from positions 1to 279.

In another preferred example, in the above method, use or complex, the disease resistance includes: ability to combat fungal diseases; preferably comprising: the ability to resist rice blast germs.

In another preferred embodiment, in the above method, use or complex, the NLR protein (PigmR or Pizt) includes its homolog, or its derivative, variant or biologically active fragment; preferably, the biologically active fragment is a fragment comprising amino acids of a coiled-coil (CC) domain of the sequence corresponding to the NLR protein or a homologue thereof (e.g., positions 1-187 in PigmR); preferably, the variant is a variant having more than 80% (more preferably more than 85%, more than 90%, more preferably more than 95%, more than 98% or more than 99%) sequence homology to the NLR protein or its homologue, but the coiled-coil domain in the sequence corresponding to the NLR protein or its homologue remains conserved.

In another preferred embodiment, in the above method, use or complex, the plant comprises gramineae.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

Figure 1, PigmR interacts with and relies on the CC domain of PIBP 1.

(A) Yeast two-hybrid experiments showed that PigmR interacts with PIBP1 through its CC domain. Schematic structural diagram of PigmR protein. CC, helix-helix domain; NBS, nucleic acid binding sequence; LRR, leucine rich repeat. BD, protein binding domain fusion protein; AD, protein activation domain fusion protein; EV, no-load; SD/-L-T-H, minimal medium lacking leucine, tryptophan, histidine; SD/-L-T, minimal medium lacking leucine and tryptophan; 3AT, 3-aminotriazole.

(B) Bimolecular fluorescein complementation experiments validated the interaction of PigmR and PIBP1 in tobacco. Blue to red represent the interaction fluorescence from weak to strong.

(C) The interaction of PigmR-CC and PIBP1 was verified in rice protoplasts using a bimolecular fluorescence complementation experiment. nVenus and cCFP-unloaded and cCFP-PigmR-NBS as negative controls. The NLS-RFP fusion protein is used as a marker protein of cell nucleus. Scale, 5 μm.

(D) The interaction between PigmR-7Myc-6His and PIBP1-GFP, transgenic plants in the background of Nipponbare, was verified by co-immunoprecipitation. The fusion proteins were immunoblotted using GFP and Myc antibodies, respectively.

(E) In vitro pulls down experiments verified the interaction of GST-PigmR-CC and His-PIBP 1. The fusion proteins were immunoblotted with GST and His antibodies, respectively.

Figure 2, PIBP1 positively regulated the PigmR and Pizt mediated disease resistance.

(A) The phenotype of the disease onset of representative strains of NIL-Pigm, PIBP1-RNAi/NIL-Pigm and PIBP1-OE/NIL-Pigm 7 days after inoculation of the rice blast (race TH 12). Nipponbare was used as a control scale for susceptibility, 1cm.

The lesion area 7 days after the rice blast infests the leaves. The values in the figure represent the proportion of the affected area in the whole leaf. And the statistical blade number n is 15. The growth amount of Pyricularia oryzae. The 28S rDNA of the inoculated leaf fungus was calculated by qRT-PCR with rice ACTIN1 as an internal reference.

(B) Yeast two-hybrid assays for PIBP1 interaction with the CC domains of Pish, Pid3, Pi9 and Pizt. EV and no load.

(C) Fluorescein bimolecular complementation experiments verified the interaction of PIBP1/Pizt-CC and PIBP1/Pi9-CC in tobacco. PigmR-NBS was used as a negative control. Blue to red represent the interaction intensity from weak to strong.

(D) The strain PIBP1-KO/Pizt was inoculated with avirulent race CH97, and phenotypic analysis was performed 7 days later. And (4) measuring the length of the scab and analyzing the growth quantity of the rice blast germs. The growth amount of the rice blast is obtained by calculating the 28S rDNA of the inoculated leaf fungus by qRT-PCR with rice ACTIN1 as an internal reference. Scale, 1cm.

Fig. 3, PIBP1, has PigmR-dependent nuclear protein accumulation.

(A) Subcellular localization analysis of PIBP1-YFP in NIL-Pigm and Nipponbare protoplasts. NLS-RFP (RFP) indicates nuclear localization. The right side shows the proportion of cells in different subcellular localization patterns. Scale, 5 μm.

(B) Subcellular localization of PIBP1-GFP in root tips of stably transgenic PIBP1-GFP/Nipponbare and PIBP 1-GFP/NIL-Pigm. The enlarged square picture highlights the nucleus part. DAPI staining indicates the location of the nucleus. The right side shows the proportion of cells in different subcellular localization patterns. Scale, 10 μm.

(C) Analysis of the nuclear protein fraction of PIBP1-GFP in transgenic rice plants PIBP1-GFP/Nipponbare and PIBP 1-GFP/NIL-Pigm. Histone H3 was used as a marker protein for the nucleus and PEPC was used as a marker protein for the cytoplasm. Actin was used as total protein loading control.

(D) In Nipponbare protoplasts, PigmR-CC-CFP promotes nuclear accumulation of PIBP1 protein. CFP served as a negative control. Arrows indicate the location of the nuclei. Scale, 5 μm.

(E) Among NIL-Pigm protoplasts, PIBP1^S275AAnd PIBP1 subcellular localization analysis. The RFP signal indicates the location of the nucleus. Scale, 5 μm.

(F) Distribution of the PIBP1-YFP protein signal in the nucleus. I is_NNuclear signal intensity; i is_TTotal signal strength. Asterisks represent significant differences, Student's t test (. about.p)<0.01). Data were collected from 15 observation cells.

(G) For PIBP1-YFP or PIBP1 expressed in NIL-Pigm protoplast^S275AAnalysis of nuclear protein fraction of YFP with co-expressed YFP as control. PEPC as a cytoplasmic marker protein showed that the extracted nuclear protein was free from cytoplasmic contamination, and Histone H3 as a marker protein for the nucleus. The asterisk shows the PIBP1-YFP target protein.

(H) PIBP1-YFP and PIBP1^S275A-analysis of nuclear protein abundance in NIL-Pigm protoplasts by YFP. Statistical results were calculated from three independent experiments.

Fig. 4, nuclear-localized PIBP1 was associated with its disease resistance.

(A) PIBP1 in NLS-PIBP1-GFP/Nipponbare transgenic root tips has nuclear localization. DAPI staining indicates the location of the nucleus. Scale, 10 μm.

(B) The phenotype of the disease onset of representative lines of Nipponbare, PIBP1-GFP/Nipponbare and NLS-PIBP1-GFP/Nipponbare 7 days after inoculation of the rice blast (race TH 12). NIL-Pigm was used as a disease control. Scale, 1cm. And (5) counting the length of disease spots 7 days after the rice blast infects the leaves. And the statistical blade number n is 15. The growth amount of Pyricularia oryzae. The 28S rDNA of the inoculated leaf fungus was calculated by qRT-PCR with rice ACTIN1 as an internal reference. Lower case letters represent significant differences (p < 0.05).

(C) PIBP1 did not interact with PigmS in yeast. PIBP1/PigmR was used as a positive control.

(D) 35S-A decrease in nuclear localization of PIBP1-YFP in PigmS/NIL-Pigm protoplasts. The ratio of nuclear localization of PIBP1, calculated from more than 100 cells, is shown on the right. Arrows indicate the location of the nuclei. The location of the chloroplasts was revealed by autofluorescence (Chl). Scale, 5 μm.

FIG. 5, PIBP1 specifically binds to AT base-rich nucleic acid sequences and has transcriptional activation activity.

(A) Analysis of the binding specificity of PIBP1 for the DNA motif (M1to M4). Different labeled probes were incubated with His-PIBP1 for binding, and corresponding 100-fold unlabeled double-stranded DNA or single-stranded DNA probes were used for competition binding experiments. The arrows in the figure indicate free probes or DNA-protein complexes.

(B) His-PIBP1 was analyzed for relative binding activity of four different DNA motifs. The numbers below the graph indicate the relative binding ratios of the different DNA motifs.

(C) Analysis of the probe binding ability of PIBP 1to different mutation types of DNA motifs (M2 and M4). The base sequence after mutation is marked in red.

(D) Effect of different protein domains of PIBP1 on DNA binding ability. EMSA showed that the RRM domain has no DNA binding activity.

(E) PIBP1 has transcriptional activation activity in yeast and is dependent on its RRM domain. BD, GAL4DNA binding domain; CDS, protein coding sequence; Δ, deletion of the corresponding amino acid. Empty load (EV) served as negative control.

FIG. 6, PIBP1 directly bind and activate the downstream disease-resistant genes OsWAK14 and OsPAL 1.

(A) EMSA demonstrated that His-PIBP1 could bind to OsWAK14 AT-rich promoter regions P1and P2. His protein served as negative control. TSS, transcription start site.

(B) In the transgenic PIBP1-OE/NIL-Pigm, the combination of PIBP1-GFP with the OsWAK14 promoter region in rice is verified by ChIP-qPCR. NIL-Pigm was used as a negative control. Lower case letters represent significant differences (p < 0.05).

(C) NLS-PIBP1 activates expression of OsWAK14 in tobacco. The relative activity of LUCs was calculated from the signals of the internal reference REN.

(D) OsWAK14 induced expression in Nipponbare and NIL-Pigm after inoculation with Magnaporthe oryzae YN 2. Two weeks of rice seedlings after spray inoculation samples were collected at different time points for gene expression analysis. Rice ACTIN1 was used as an internal control.

(E) After the rice blast fungus TH12 is inoculated, the gene expression quantity of OsWAK14 in PIBP1-RNAi/NIL-Pigm, PIBP1-OE/NIL-Pigm and NIL-Pigm is analyzed.

(F) The phenotype of the NIL-Pigm, OsWAK14-KO-1and OsWAK14-KO-9 representative lines was observed 7 days after inoculation of the rice blast (race TH 12). Nipponbare served as a susceptible control. Scale, 1cm.

The lesion area 7 days after the rice blast infests the leaves. The values in the figure represent the proportion of the affected area in the whole leaf. And the statistical blade number n is 15. The growth amount of Pyricularia oryzae. The 28S rDNA of the inoculated leaf fungus was calculated by qRT-PCR with rice ACTIN1 as an internal reference.

(G) EMSA demonstrated that His-PIBP1 could bind to OsPAL1 AT-rich promoter regions P1and P2. His protein served as negative control. TSS, transcription start site.

(H) In the transgenic PIBP1-OE/NIL-Pigm, the PIBP1-GFP can be verified to be combined with the OsPAL1 promoter region in rice by ChIP-qPCR. NIL-Pigm was used as a negative control.

(I) NLS-PIBP1 activates expression of OsWAK14 in tobacco. The relative activity of LUCs was calculated from the signals of the internal reference REN. Lower case letters represent significant differences (p < 0.05).

(J) Gene expression analysis of OsPAL1 in NIL-Pigm, PIBP1-RNAi/NIL-Pigm and PIBP1-OE/NIL-Pigm 36h after inoculation of Magnaporthe grisea (TH 12).

Rice ACTIN1 served as an internal control (D, E and J). Asterisks represent significant differences (Student's t test, # p <0.05, # p < 0.01).

FIG. 7, the PIBP1 homologous gene Os06g02240 is involved in the regulation of PigmR-mediated rice blast resistance as a transcription factor.

(A) The binding activity of the PIBP1 homologous protein on an AT-base-rich DNA sequence (M2, upper; M4, down) was analyzed by EMSA.

(B) Analysis of transcriptional activation activity of PIBP1 homologous gene in yeast revealed that only Os06g02240 had transcriptional activation activity. EV, empty, was used as a negative control.

(C) PigmR-CC and PIBP1 homologous gene Os06g02240 interact specifically in yeast. PIBP1 served as a positive control. EV, no load, as a negative control.

(D) A fluorescein bimolecular complementation experiment in tobacco verifies the interaction between the Os06g02240 and PigmR-CC. Blue to red represent the interaction intensity from weak to strong.

(C) Yeast two-hybrid verified that the CC domains of Os06g02240 and Pi9 and Pizt interacted, and did not interact with the CC domains of Pish and Pid 3.

(D) A fluorescein bimolecular complementation experiment in tobacco verifies the interaction of Os06g02240/Pi9-CC and Os06g 02240/Pizt-CC. Blue to red represent the interaction intensity from weak to strong.

(E) EMSA demonstrated that His-Os06g02240 could bind to OsWAK14 and OsPAL1 AT base-rich promoter regions P1and P2.

(F) NLS-Os06g02240 activates expression of OsWAK14 and OsPAL1 in tobacco. The relative activity of LUCs was calculated from the signals of the internal reference REN. Asterisks indicate significant differences (Student's t test,. p < 0.01).

(G) The blast fungus (TH12) inoculated with two independent lines of Os06g02240-KO/NIL-Pigm, (PIBP1/Os06g02240) -KO/NIL-Pigm and the disease phenotype is 7 days later. Scale, 1cm. And (5) counting the length of disease spots of rice blast infected leaves. And the statistical blade number n is 15. The growth amount of Pyricularia oryzae. The inoculated leaf fungus 28SrDNA was calculated by qRT-PCR with rice ACTIN1 as an internal reference. Lower case letters represent significant differences (p < 0.05).

FIG. 8, PIBP1 homologous gene and PIBP1-PigmR interaction analysis.

(A) The PigmR-7Myc-6His/Nipponbare transgene has rice blast resistance. Two independent bodies are shown in the figure

Resistance of upright Pigm-7Myc-6His/Nipponbare transgenic lines (#6 and #7) to rice blast.

(B) The figure shows the protein identification of the Pigm-7Myc-6His/Nipponbare transgenic line, Nipponbare and NIL-Pigm as protein negative controls. The protein molecular weights (kDa) are identified in the figure. Scale, 1cm.

(C) Alignment analysis of protein sequences of PIBP1and the homologous gene (Sobic.001G115300.1.p, Gh _ D12G1546, AT1G67950.3, Trace _4BS _929BB66A2) using MegAlign software.

(D) Evolutionary tree analysis was performed using Mega 6 software on homologous genes to PIBP1 in rice, sorghum, wheat, and cotton.

(E) Schematic representation of different truncated forms of PIBP1 protein in yeast two-hybrid experiments. Blue represents interaction, grey represents no interaction, white line represents amino acid mutation position.

(F) Detection of different truncated and mutated forms of PIBP1 protein (PIBP 1) by means of the yeast two-hybrid System^S275AAnd PIBP1^{E274A/D277A/E278A}) And PigmR-CC (as shown in FIG. A), and the results showed that the interaction of PIBP1 with PigmR-CC was dependent on its serine at position 275.

(G)PIBP1^S275AProtein expression in yeast. PIBP1^3A(full-Length PIBP1) as a Positive control, fusion proteins BD-PigmR-CC, AD-, PIBP1^S275A，PIBP1^3AImmunoblot hybridization was performed using antibodies for Gal4-BD and Gal4-AD, respectively. Asterisks indicate the corresponding proteins of interest.

Fig. 9, PIBP1 affected the disease resistance of PigmR and Pizt, but had no effect on the function of Pish.

(A) The qRT-PCR identifies the RNA expression quantity of PIBP1 in PIBP1-RNAi/NIL-Pigm (independent strains # 1and #3) and PIBP1-OE/NIL-Pigm (independent strains #7 and #8) transgenic rice, and wild type NIL-Pigm is used as a control.

(B) Identifying the protein levels of PIBP1-GFP and NLS-PIBP1-GFP in different PIBP1 overexpression transgenic plants. Immunoblot hybridization experiments were performed using GFP antibody, Actin as a protein loading control.

(C) qRT-PCR identified the expression level of PigmR in the PIBP1-RNAi/NIL-Pigm (independent strains # 1and #3), PIBP1-OE/NIL-Pigm (independent strains #7 and #8) transgenes, with wild type NIL-Pigm as control.

(D) Representative types of PIBP1 gene knockout strains in the NIL-Pigm background.

(E) Phenotypic analysis of the lines Nipponbare, NIL-Pigm and PIBP1-KO/NIL-Pigm after inoculation of the rice blast fungus TH for 127 days.

(F) The lesion area 7 days after the rice blast infests the leaves. The values in the figure represent the proportion of the affected area in the whole leaf. And the statistical blade number n is 15.

(G) PIBP1 did not interact with Pish in yeast.

(H) Protein expression of PIBP1and Pish in yeast. Fusion proteins pGADT7-, PIBP1-, Pish (left panel), fusion proteins pGBKT7-, Pish, PIBP1 (right panel), immunoblot hybridizations using HA and Myc antibodies, respectively. Asterisks indicate the corresponding proteins of interest.

(I) And qRT-PCR is used for detecting the gene expression quantity of the PIBP1 in wild Nipponbare, PIBP1-RNAi/Nipponbare and PIBP 1-OE/Nipponbare.

(J) The phenotype of the rice blast avirulent race YN 27 days after inoculation of the strains Nipponbare, PIBP1-RNAi/Nipponbare and PIBP 1-OE/Nipponbare.

(K) PIBP1and Pid3 were unable to interact in yeast.

(L) detection of protein expression in Yeast. Upper panel (AD), pDEST22-PIBP1, detected using GAL4-AD antibody; middle panel (BD), pDEST32-Pizt-CC (lane 1), -Pi9-CC (lane 2), -Pid3-CC (lane 3), -Pid3 (lane 4), using GAL4-BD antibody. Ponceau stain was used as a protein loading control. Asterisks represent proteins of interest.

(M) protein alignment of CC domains of PigmR and other NLRs, conserved amino acid sites are marked in black.

Representative type schematic of PIBP1 gene knockout lines in (N) ZH11(Pizt) context.

FIG. 10, expression pattern and subcellular localization analysis of PIBP 1.

(A) Tissue-specific expression pattern of PIBP1 was analyzed by qRT-PCR. L1, leaves of two-week seedlings; l2, leaves of the four-week plantlets; LS1, leaf sheath of two week seedlings; LS2, leaf sheath of four-week plantlets; r1, roots of two-week seedlings; r2, roots of four-week plantlets; p1, young panicles; p2, ear heading, rice ACTIN1 as an internal reference.

(B) NIL-Pigm inoculation of Magnaporthe grisea (TH12) Gene Induction expression analysis of PIBP1 at various time points, using seedlings inoculated with water as a control. Rice ACTIN1 was used as an internal control. Asterisks represent significant differences (Student's t test,. p < 0.01).

(C) Subcellular localization of PIBP1-GFP in the root tip of transgenic plant PIBP 1-GFP/Nipponbare. Subcellular localization of PIBP1 before (upper panel) and after (lower panel) plasmolysis of the 30% sucrose solution.

(D) Subcellular localization of PIBP1-GFP in transgenic PIBP1-GFP/NIL-Pigm and PIBP1-GFP/Nipponbare leaf sheaths. The location of the chloroplasts is revealed by their autofluorescence (Chl). Arrows indicate the location of the nuclei. The right side of the figure shows the proportion of different subcellular locations of PIBP1-GFP against the background of Nipponbare and NIL-Pigm. Scale, 5 μm.

(E) Subcellular localization of PIBP1-YFP in Pizt (ZH11) and Pi9(Ky-Pi9) protoplasts. RFP fluorescence indicates the location of the nucleus. Scale, 5 μm.

(F) After rice blast infection, the subcellular localization of PIBP1 in PIBP1-GFP/NIL-Pigm and PIBP1-GFP/Nipponbare leaf sheath cells was not altered. (TH12 and YN2 are both NIL-Pigm non-toxic species; TH12 is a non-toxic species of Nipponbare; YN2 is a non-toxic species of Nipponbare; water treatment as a control). Arrows indicate the location of infection by rice blast. Scale, 10 μm.

(G) Subcellular localization of PigmR-YFP, PigmR-CC-YFP, and PigmS-YFP in Nipponbare protoplasts. Chloroplast localization was shown by its autofluorescence (Chl). Scale, 5 μm.

(H) Pizt-CC and Pi9-CC promote nuclear accumulation of PIBP1 protein. Pizt-CC-CFP or Pi9-CC-CFP were co-transformed with PIBP1-YFP, respectively, to Nipponbare protoplasts. Arrows indicate the location of the nuclei. The figure shows that PIBP1-YFP has the proportion of nuclear localization cells in transformed cells. Scale, 5 μm.

FIG. 11, PigmS-CC can interact with PIBP 1.

(A) The nuclear protein components of transgenic plants PIBP1-OE/Nipponbare and NLS-PIBP1-OE/Nipponbare were analyzed. PEPC is used as a cytoplasm marker protein, and Histone H3 is used as a marker protein of cell nucleus. Actin served as a loading control for total protein.

(B) PIBP1 interacts with PigmS-CC in yeast.

(C) NIL-Pigm and 35S gene expression analysis of PigmR and PigmS in PigmS/NIL-Pigm. Rice ACTIN1 was used as an internal control.

Fig. 12, verification of nucleic acid binding activity and self-interaction of PIBP 1.

(A) In vitro nucleic acid binding activity assay for PIBP 1. The corresponding fusion proteins were incubated with poly (U), DNA and single-stranded DNA (ssDNA), respectively. Asterisks represent proteins of interest.

(B) Coomassie blue staining for detection of exogenously purified His, His-PIBP1and His-PIBP1^Δ5-74A protein. The concentration of purified protein was calculated from the concentration gradient of BSA. The asterisk indicates the protein of interest. MALDI-TOF identification analysis protein bands 1-6 corresponding to the protein.

(C) After exogenous purification, different PIBP1 products (corresponding to graph A) were analyzed by MALDI-TOF identification, and fragments of PIBP1 protein contained in the corresponding protein were revealed. Blue represents the position of the identified protein fragment corresponding to PIBP1 protein.

(D) RNA EMSA. His-PIBP1 or His-PIBP1^Δ5-74The biotin-labeled total RNA after the treatment with rice blast fungus (TH12) or water treatment was incubated and bound, and the corresponding RNA without biotin-labeling (100-fold) was used in cold probe competition experiments. His protein served as a negative control. The positions of free probe and RNA-protein complex are indicated in the figure.

(E) EMSA validates the DNA segment identified by ChIP-seq that can bind to PIBP 1. Cy 5-labeled probes were each incubated with His-PIBP 1. The corresponding 100-fold unlabeled probe was used for competition binding experiments. In the figure, the arrows indicate free probes or DNA migration bands.

(F) His-PIBP1 showed significant concentration dependence on the binding of DNA motifs 2 and 4. His protein served as negative control. FP, no added protein.

(G) Coomassie brilliant blue staining detection of exogenous purified proteins His, His-PIBP1-RRM, His-PIBP1and His-PIBP1^Δ5-74. Protein concentrations are shown by different concentration gradients of BSA. Asterisks indicate the protein of interest.

(H) Yeast two-hybrid confirmed the self-interaction of PIBP 1. EV and no load.

(I) The interaction of PIBP1 in plants. The self-interaction of the PIBP1 is verified by a fluorescein bimolecular fluorescence complementation experiment in the tobacco. Blue to red represent the change in interaction intensity from weak to strong.

(J) The bimolecular fluorescence complementation experiment in the rice protoplast verifies the self-interaction of the PIBP 1. nVenus and CFP-empty and PigmR-NBS of the unfused protein served as negative controls. The location of the chloroplasts was revealed by autofluorescence (Chl). Scale, 5 μm.

FIG. 13, PIBP1 directly regulated the expression of OsWAK14 and OsPAL 1.

(A) EMSA demonstrated that His-PIBP1 was unable to bind to the promoter segment P3 of OsWAK14, which lacks AT bases. His protein served as negative control.

(B) YFP, PIBP1-YFP and NLS-PIBP1-YFP were sub-cellular localized in tobacco. HTR4-YFP is used as a marker protein of cell nucleus. The enlarged portion of the figure shows the localization of the nuclei in tobacco. Scale, 10 μm.

(C) Schematic vector diagrams of effector and reporter genes in transcriptional activation experiments.

(D) OsWAK14 induced expression in Nipponbare and NIL-Pigm after inoculation with Magnaporthe oryzae YN 2. Two weeks of rice seedlings after spray inoculation samples were collected at different time points for gene expression analysis. Rice ACTIN1 was used as an internal control.

(E) Schematic representation of mutation types of different knock-out lines of OsWAK14 gene (OsWAK14-KO-1and OsWAK14-KO-9) in NIL-Pigm.

(F) OsPAL1 induced expression in Nipponbare and NIL-Pigm after inoculation with Magnaporthe grisea TH 12.

FIG. 14 shows that homologous gene Os06g02240 of PIBP1 is involved in regulation of rice blast resistance as a transcription factor.

(A) Protein sequences of PIBP1and homologous genes Os04g53330, Os06g02240 and Os11g34680 are analyzed in alignment. The RRM region of sequence conservation is marked by the red line.

(B) Subcellular localization of three homologous genes of PIBP1 in NIL-Pigm protoplasts. NLS-RFP serves as a marker protein for the nucleus. Scale, 5 μm.

(C) Coomassie blue staining detects exogenously expressed PIBP1 homologous protein. Asterisks indicate the protein of interest. The concentration of the foreign purified protein is indicated by the concentration gradient of BSA.

(D) The self-interaction identification of the PIBP1 homologous gene in yeast shows that only Os06g02240 has the capability of self-interaction.

(E) A fluorescein bimolecular complementation experiment in tobacco verifies the self-interaction of the Os06g02240 in plants. PigmR-NBS was used as a negative control. Blue to red represent the interaction intensity from weak to strong.

(F) The interaction between the different truncated forms of Os06g02240 protein and PigmR-CC was detected by means of the yeast two-hybrid system, and the results showed that the interaction between Os06g02240 and PigmR-CC was dependent on its C-terminal domain.

(G) Schematic representation of different truncated forms of Os06g02240 protein in yeast two-hybrid experiments. Blue represents interaction, grey represents no interaction, and red represents RRM.

(H) Yeast two-hybrid verified that the CC domains of Os06g02240 and Pi9 and Pizt interacted, and did not interact with the CC domains of Pish and Pid 3.

(I) A fluorescein bimolecular complementation experiment in tobacco verifies the interaction of Os06g02240/Pi9-CC and Os06g 02240/Pizt-CC. PigmR-NBS was used as a negative control. Blue to red represent the interaction intensity from weak to strong.

(J) Oss 06g02240-KO/NIL-Pigm and (PIBP1/Os06g02240) -KO/NIL-Pigm transgenic mutation types are shown schematically. Two independent transgenic strains are respectively selected for pathogen inoculation analysis.

(K) A mechanism model of the PIBP1 transcription factor family for regulating rice blast resistance. PIBP1 promotes the accumulation of self-nuclear proteins through direct interaction with broad-spectrum, disease-resistant PigmR/NLRs. The nucleus-localized PIBP1s as an atypical transcription factor can be combined with promoter regions of disease-resistant genes OsWAK14 and OsPAL1 which are rich in AT bases. Responding to the induction of pathogen infection by an unknown mechanism, activating the expression of downstream defense genes and endowing rice with disease resistance.

Detailed Description

The inventor of the invention has conducted intensive research and reveals that PIBP1and a homologue (homologous gene Os06g02240) thereof are used as a novel transcription factor, and directly interact with a broad-spectrum disease-resistant R gene (pigmR) to promote the accumulation of self-nucleus protein, so as to activate a brand-new mechanism of expression of downstream immune genes. Meanwhile, pathogen recognition mediated by a broad-spectrum immunoreceptor NLR and immune transcription activation are directly linked together. The technical scheme of the invention not only provides a practical and effective plant improvement method, but also provides a new visual angle and means for the research of a plant broad-spectrum immune mechanism and the disease-resistant breeding of plants.

Genes, polypeptides and plants

As used herein, a "plant" is a plant in which the mechanism claimed in the present invention is present, i.e., in which PIBP1 or its homologues (e.g., Os06g02240, etc.), its downstream genes (e.g., WAK14, PAL1) or their homologues, NLR proteins (e.g., PigmR, Pizt) or their homologues are present, and in which there is a mechanism of interaction between them. Preferably, the "plant" includes (but is not limited to): gramineae, such as gramineae Oryza (e.g., rice), gramineae Triticum (e.g., wheat), gramineae Zea (e.g., corn), etc.

In the invention, the PIBP1 can be a polypeptide with a sequence shown in SEQ ID NO. 1, the PigmR can be a polypeptide with a sequence shown in GenBank accession number KU904633, the Pizt can be a polypeptide with a sequence shown in GenBank accession number DQ352040, the WAK14 can be a polypeptide with a sequence shown in GenBank accession number AK241637, and the PAL1 can be a polypeptide with a sequence shown in GenBank accession number AK 102817.

Also included in the invention are variants of the sequences having the same function as PIBP1, PigmR, Pizt, WAK14, PAL1 described above, including: variants, derivatives, fragments, homologues. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1to 20, preferably 1to 10, and more preferably 1to 8, 1to 5) amino acids, and addition or deletion of one or several (for example, up to 20, preferably up to 10, and more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, 1 amino acid substitution is performed. Any protein which has high homology (such as 70% or more homology; preferably 80% or more homology; more preferably 90% or more homology, such as 95%, 98% or 99% homology) with the PIBP1, PigmR, Pizt, WAK14, PAL 1and which retains the same function/activity is also encompassed by the present invention. Polypeptides derived from species other than rice that have greater homology with the PIBP1, PigmR, Pizt, WAK14, PAL1 polypeptide sequences, or that exert the same or similar effects in the same or similar signaling pathways are also encompassed by the invention.

Also included in the invention are biologically active fragments of isolated PIBP1 comprising amino acids corresponding to amino acids 270-279 of the PIBP1 protein sequence, which have been shown to be critical regions for protein-protein interaction, particularly amino acid 275. Preferably, the fragment containing the amino acids corresponding to amino acids 270-279 of the PIBP1 protein sequence includes but is not limited to: a fragment corresponding to positions 75-284 of the PIBP1 protein and a fragment corresponding to positions 1-279 of the PIBP1 protein. It will be appreciated that other protein fragments are also applicable as long as they include amino acids 270-279, in particular 275. The invention also includes nucleic acid molecules encoding the biologically active fragments and expression vectors carrying the nucleic acid molecules. The bioactive fragment can also be applied to establishing an interaction system, and researching or observing the influence of other regulating and controlling substances on the interaction.

In the present invention, also included are molecules of PIBP1 linked to NLS, preferably fusion proteins or fusion genes. Also included are expression vectors carrying the fusion genes. The molecule of PIBP1 linked to NLS can be recombinantly expressed in cells, thereby increasing the nuclear aggregation of PIBP 1.

It is to be understood that although the above proteins or genes, their interactions between them and their mechanisms obtained from a particular species are preferably studied in the present invention, there are mechanisms based on these polypeptides and their interactions in other species, and therefore the corresponding regulatory mechanisms of other species and polypeptides involved in this regulation are also within the contemplation of the present invention.

Method for improving plants and application

The invention discloses a novel mechanism that PIBP1and congeners thereof are used as a novel transcription factor, and the PIBP1and congeners thereof directly interact with PigmR to promote the accumulation of self-nuclear protein so as to activate the expression of downstream immune genes, and the novel mechanism has important application value in theoretical research and plant improvement.

NLR (Nucleotide-binding domain and leucoine-rich repeat) proteins play an important role in plant immune regulation. However, the mechanisms of immune activation and disease resistance signal transduction mediated by it are not clear. The present inventors previously mapped to the rice blast resistance gene cluster Pigm, which encodes a number of CC (coiled-coil) type NLRs, where the PigmR, which is homomultimerized, has broad spectrum anti-disease function. PigmS can inhibit PigmR disease resistance by competing with PigmR to form a heteromultimer, thereby maintaining a balance between rice yield and disease resistance. To resolve the broad spectrum disease resistance mechanism of PigmR, the present inventors found a series of PigmR Interacting proteins (PimR-Interacting and blast resistance proteins, PIBPs) by yeast screening library. In the invention, a rice site research object finds that the PIBP1 containing an RRM (RNA-homology motif) structural domain can specifically interact with PigmR and broad-spectrum disease-resistant R genes Pizt and Pi9, but does not interact with the microspecies specific resistance R genes Pish and Pid 3. The result of the inoculation of the pathogenic bacteria of the PIBP1 transgenic line shows that the PIBP1 positively regulates the disease resistance of PigmR and Pizt, but does not contribute to the disease resistance function of Pish. Through the research of the rice protoplast and transgenic lines on the subcellular localization of the PIBP1, PigmR and other broad-spectrum disease-resistant NLRs (Pizt and Pi9) can obviously promote the accumulation of the PIBP1 in the cell nucleus, and the nuclear-localized PIBP1 endows the rice with disease resistance. Meanwhile, the process that PigmR promotes the accumulation of PIBP1 nuclear protein can be inhibited by an antagonistic receptor PigmS, and a possible mechanism that PigmS reduces disease resistance is suggested. Interestingly, in vitro nucleic acid binding experiments showed that PIBP1 has both classical RNA binding activity and DNA binding activity. Given that the nuclear localization of PIBP1 is critical for its disease resistance, the inventors subsequently developed further analyses for its DNA binding activity. Through ChIP-Seq and EMSA, it was found that PIBP1 can bind to DNA conserved motifs rich in bases AT and is RRM independent. At the same time, yeast single-hybrid experiments demonstrated that PIBP1 has RRM-dependent transcriptional activation activity and a homo-multimerization pattern of most transcription factors. These results suggest that nuclear-localized PIBP1 may be a novel class of transcription factor. Through the correlation analysis of ChIP-Seq and RNA-Seq, the inventor finds a downstream disease-resistant gene OsWAK14 regulated by PIBP 1. EMSA and ChIP-qPCR confirmed that PIBP1 can bind to the OsWAK14 promoter; Dual-Luc demonstrated that nuclear-localized PIBP1 can significantly activate expression of OsWAK 14; the Pigm locus can obviously improve the RNA level of the rice OsWAK 14; transgenic knockout OsWAK14 significantly reduced the disease resistance of PigmR. By the same method, the inventors also identified another regulatory target OsPAL1 of PIBP 1. This indicates that PigmR influences the resistance of rice to rice blast by promoting the nuclear accumulation of PIBP1and further regulating the expression of OsWAK14 and OsPAL 1. To further investigate whether PIBP1 represents a novel class of transcription factors, the inventors analyzed the transcription factor activity of a PIBP1 homologous protein. Os06g02240 was found to have: nuclear localization, AT motif-rich DNA binding activity, transcriptional activation activity, forms of homo-multimerization, and can also bind and activate OsWAK14 and OsPAL 1. Interestingly, as with PIBP1, Os06g02240 had specific interactions with PigmR, Pizt, Pi9, and Pish, Pid3 did not. Further pathogen inoculation analysis shows that single knockout of Os06g02240 significantly reduces PigmR disease resistance. Interestingly, the material with double mutations of PIBP1and Os06g02240 was more susceptible than the mutation of a single gene, suggesting that PIBP1and Os06g02240 are involved in the immune process of regulating broad spectrum disease-resistant R genes as homogeneous transcription factors and have functional redundancy. Therefore, the invention discloses a novel mechanism that PIBP1and homologous genes Os06g02240 thereof are used as a novel transcription factor, and directly interact with broad-spectrum disease-resistant R genes to promote the accumulation of self-nucleus protein so as to activate the expression of downstream immune genes. Meanwhile, the pathogen recognition mediated by the broad-spectrum immunoreceptor NLR and the immune transcription activation are directly linked together, so that a new visual angle and means are provided for the research of a plant broad-spectrum immune mechanism and the disease-resistant breeding of rice.

Based on the above new findings of the present inventors, the present invention provides a method for improving the disease resistance of a plant by regulating the mechanism of the present invention.

One way, the disease resistance of plants can be improved by promoting the localization or accumulation of PIBP1 in the nucleus of cells. More specifically, this can be done by means including, but not limited to: recombinantly expressing (or overexpressing) PIBP 1to increase the expression level of PIBP1 or to facilitate its localization or accumulation in the nucleus; the PIBP1 is linked to NLS (e.g., recombinantly expressing a molecule in which PIBP1 is linked to NLS) to facilitate localization or accumulation of PIBP1 in the nucleus. As a nuclear localization signal molecule, NLS contributes to the accumulation of PIBP1 in the nucleus; or, promote the interaction (binding) of NLR proteins with PIBP 1to promote the localization or accumulation of PIBP1 in the nucleus.

Alternatively, the disease resistance of the plant can be improved by promoting the interaction (binding) of the PIBP1and the downstream genes (such as WAK14 and PAL1) to improve the expression of the downstream genes. For example, but not limited to, PIBP1 and/or its downstream genes are recombinantly expressed (or overexpressed) to facilitate the interaction of PIBP1 with its downstream genes.

Alternatively, the interaction of PIBP1 with NLR proteins (e.g., PigmR, Pizt) can be promoted, thereby improving NLR protein-mediated disease resistance. For example, but not limited to, recombinantly expressing (or overexpressing) PIBP1 and/or NLR protein to facilitate interaction of PIBP1 with NLR protein.

Various methods well known to those skilled in the art may be employed to up-regulate or increase the expression or activity of PIBP1, PIBP1 and/or genes downstream thereof, PIBP1 and/or NLR proteins, such as, but not limited to: transferring their coding genes or expression constructs or vectors containing the coding genes into plants; or subjecting them to gain-of-function point mutations; or their expression is enhanced by using a strong promoter.

It will be appreciated that, once the nuclear localisation properties of PIBP1, the interaction of PIBP1 with NLR proteins and the interaction of PIBP1 with its downstream genes are known, various methods known to those skilled in the art can be used to modulate the individual genes/proteins involved in this mechanism and in the interaction, as well as their upstream and downstream genes/proteins, to achieve modulation of the plant's disease resistance.

Screening method

After the molecular mechanism of the present invention and the gene or protein involved in the molecular mechanism are known, a substance that promotes the disease resistance of plants can be screened based on this new finding.

The invention provides a method for screening a regulator for improving the disease resistance of a plant, which comprises the following steps: (1) adding a candidate substance to a system comprising said complex; (2) observing the interaction of PIBP1and NLR protein or the interaction of PIBP1and a downstream gene promoter region in the complex; wherein, if the candidate substance promotes the interaction of PIBP1and NLR protein in the complex or the interaction of PIBP1and a downstream gene promoter region thereof, the candidate substance is an agent for improving the disease resistance of the plant.

The invention also provides a method for screening the regulator for improving the disease resistance of the plant, which comprises the following steps: (1) adding a candidate substance to a system comprising PIBP 1; (2) observing the expression or activity of PIBP1 in the system; wherein, if the candidate substance promotes the expression or activity of the PIBP1, the candidate substance is an agent for improving the disease resistance of the plant.

Methods for targeting proteins or specific regions thereof to screen for substances that act on the target are well known to those skilled in the art and all of these methods can be used in the present invention. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptidic compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the skilled person how to select a suitable screening method.

In the present invention, the interaction between proteins and the strength of the interaction can be detected by various techniques known to those skilled in the art, such as GST-sink technique (GST-Pull Down), bimolecular fluorescence complementation assay, yeast two-hybrid system or co-immunoprecipitation.

The present invention also provides a method for the targeted selection of plants with enhanced disease resistance, comprising: identifying said complex (of the PIBP1and the NLR protein complex, or of the genes downstream of the PIBP1and the PIBP1) in the test gramineae, which is a gramineae with enhanced resistance to diseases if the interaction of said complex in the test plant is higher than the average of the interactions of said complex in the species. The average value of the protein-protein, protein-nucleic acid interactions in a plant can be determined by one skilled in the art, for example by randomly collecting a number of such plants, determining such interactions using methods classical in the art, and determining such average values according to statistical rules.

The present invention also provides a method for targeted selection of graminaceous plants with enhanced disease resistance, said method comprising: identifying the expression of the PIBP1 in the cells or the location or accumulation of the PIBP1 in the cell nucleus of the gramineous plant cells, and if the expression of the PIBP1 in the gramineous plant cells is higher than the average expression value of the PIBP1 in the plants, or the location or accumulation of the PIBP 3578 in the cell nucleus is higher than the average location value of the cell nucleus of the plants, the gramineous plant with enhanced disease resistance is obtained.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

1. Plant material, mutant establishment, gene editing and transgenic plant establishment

Rice (Oryza sativa) variety: nipponbare (NIP), ZH11

The rice transgenic plants are obtained by transforming wild type or near isogenic lines with corresponding vectors, and are obtained by referring to a test method. The rice material is planted in Shanghai Songjiang farms in summer and in Hainan Ling water bases in winter in two seasons each year.

Mutant and transgenic plant construction

NIL-Pigm,35S, PigmS/NIL-Pigm: reference is made to the articles Deng, Y., ZHai, K., Xie, Z., Yang, D., Zhu, X., Liu, J., Wang, X, Qin, P., Yang, Y., and Zhang, G., et al, (2017) epigenetics regulation of anti-inflammatory receptors balance with ease of elementary balance, science 355,962 and 965.

PIBP1-RNAi/Nipponbare, PIBP 1-RNAi/NIL-Pigm: the inventors selected 160bp on PIBP1CDS and 372bp on 3' UTR as target fragments, and inserted the target fragments into RNAi vector PTCK303 after PCR using specific primers. The Agrobacterium EHA105 was used to transform Nipponbare and NIL-Pigm, respectively, to obtain the corresponding transgenic plants. The target DNA segment sequence is as follows (SEQ ID NO: 3):

GGTAGACAGGGCCGAAGAGGAGAGGAAAGCGATCATGTGGGAAGAGAGGAATGGGCTTGTAAGTGATTATGCCAAGATCCATCTTGATGAACCCTCTTCATGGGAGCCTGCAGTTCTTCCGTTGGAATCTGTGGATGAGCAGAAGCTCCAGGCTGTGTGATCTGCACAATCCAATGGTGGTCGTTTCTCTGCACGTCATTCTTTTGTTCATGTCCAATATAGAAGATTGTTTTTCACCGCTGCACGGTAGCAAAAATATTGAGCTTATTGCCTATAGTATGATGTAAATTTTAGAAATTCCCCATGTGTTTTCTTCCAGCTTTGTTATAGACCACTGAAAGGCTTACTTGTTCAGTGTTAGACATGGAAATGAAAGTTGTTCCAGACTTCCAGGCATACCTCTTGTTATGGTAGAACATGTTTCTGTGAGTTATCTCAGAACTATTTGTGCTCTGATATTCTGAAGCTACATGTGTAAGGCCCAAATCTGGGAAATAATCAAGGTCAAAATGAAATGCAGACAATATTTCCT

PIBP1CRISPR/Cas9(PIBP1-KO/NIL-Pigm), PIBP 1-KO/Pizt: the inventor selects a specific sequence TTACATTTAAGGACTCACA (SEQ ID NO:4) on the PIBP1CDS as a target spot, refers to the prior method (Ma, X., et al. (2015). A robust CRISPR/Cas9system for meeting, high-efficiency multiplex gene editing in monocot and dicot plants. mol.plant 8, 1274-strain 1284), and constructs the target spot on a vector of the CRISPR/Cas9 by taking U6a as a promoter. The Agrobacterium EHA105 is used for transforming NIL-Pigm and a rice variety ZH11 containing Pizt respectively to obtain corresponding transgenic plants.

pUBI:: PIBP1-GFP (PIBP1-OE)/Nipponbare, pUBI:: PIBP1-GFP (PIBP 1-OE)/NIL-Pigm: the inventors amplified the full-length CDS of PIBP1 with specific primers and ligated it into the vector PUN 1301-GFP. The Agrobacterium EHA105 was used to transform Nipponbare and NIL-Pigm, respectively, to obtain the corresponding transgenic plants.

pUBI: NLS-PIBP 1-GFP/Nipponbare: the inventors added the nuclear localization signal sequence ATGCCTAAGAAGAAGAGAAAGGTTGGAGGA (SEQ ID NO:1) of NLS before the full-length CDS of PIBP1and ligated into the vector PUN 1301-GFP. The Agrobacterium EHA105 was used to transform Nipponbare and the corresponding transgenic plants were obtained.

pUBI: PigmR-7Myc-6 His/Nipponbare: the inventor amplifies the full-length CDS of PigmR by a specific primer and connects the CDS to a vector PUN1301-7Myc-6 His. The Agrobacterium EHA105 was used to transform Nipponbare and the corresponding transgenic plants were obtained.

OsWAK 14-KO/NIL-Pigm: the inventor selects a specific sequence CTGCAGTCTACGGAGTTGG (SEQ ID NO:5) on the OsWAK14CDS as a target spot, refers to the prior method (Ma et al, 2015), and constructs the target spot on a CRISPR/Cas9 vector by taking U6a as a promoter. The NIL-Pigm is transformed by using the agrobacterium EHA105 to obtain a corresponding transgenic plant.

Os06g 02240-KO/NIL-Pigm: the inventor selects a specific sequence TGCAACTGTGCAAGACATTA (SEQ ID NO:6) on the Os06g02240 CDS as a target spot, refers to the prior method (Ma et al, 2015), and constructs the target spot on a CRISPR/Cas9 vector by taking U3 as a promoter. The NIL-Pigm is transformed by using the agrobacterium EHA105 to obtain a corresponding transgenic plant.

(PIBP1/Os06g02240) -KO/NIL-Pigm: the inventors selected specific sequence TTCATTGAATGCTTCAAAAA (SEQ ID NO:7) on the PIBP1CDS and specific sequence TGCAACTGTGCAAGACATTA (SEQ ID NO:8) on the Os06g02240 CDS as targets, and constructed the target on a CRISPR/Cas9 vector by using U6a and U3 as promoters, respectively, with reference to the conventional method (Ma et al, 2015). The NIL-Pigm is transformed by using the agrobacterium EHA105 to obtain a corresponding transgenic plant.

2. Bacterial strains and culture media

Coli strain (Escherichia coli): DH5 α, Rosetta (DE3) (shanghai, only).

Agrobacterium strain (Agrobacterium tumefaciens): EHA105 (shanghai, only), GV3101 (shanghai, only).

Yeast strain (Saccharomyces cerevisiae): AH109, Y187 (shanghai, only).

Pyricularia oryzae (Magnaporthe oryzae): TH12, YN2 and CH97 are small seeds of the rice blast.

3. Common culture medium

LB medium (1L): 10g of NaCl, 5g of yeast extract and 10g of Tryptone, the pH value is 7.0, and 15g of agar powder is required to be added into solid.

YPDA medium (1L): 10g of yeast extract, 20g of Peptone, 20g of glucose and 15ml of 0.2% Adenine, wherein 20g/L agar powder is added into the solid.

SOB liquid medium (1L): peptone 20g, yeast extract 5g, NaCl 0.5g, KCl 0.186g, pH7.0, before use 5ml 2M MgCl was added₂。

AB liquid medium (1L): KH (Perkin Elmer)₂PO₄3g，NaH₂PO₄1g，NH₄Cl 1g，MgSO₄·7H₂O。

300mg，KCl 150mg，CaCl₂10mg；FeSO₄·7H₂O 2.5mg，Glucose 5g。

NBD medium (1L): NB Basal Medium (PhytoTech)4.1g, sucrose 30g, 1ml 2,4-D solution (1000X), pH 5.8, solids 4.5g Phytagel was added.

MS rice differentiation medium (1L): murashige & Skoog basic Medium with Vitamins (PhytoTech)4.43g, sucrose 30g, 6-BA 3mg/L, NAA 0.5mg/L, pH 5.8, solid 4.5g Phytagel.

1/2MS Rice rooting Medium (1L): murashige & Skoog basic Medium with Vitamins (PhytoTech)2.215g, sucrose 20g, pH 5.8, solid 4.2g Phytagel.

4. Inoculation of Magnaporthe grisea

Activating different rice blast microspecies, culturing at 25 deg.C for about 10 days, washing culture medium with sterilized water, washing spore solution, filtering with 40um filter membrane, detecting spore concentration, and adjusting to 1 × 10⁵Spores/ml.

Field inoculation of rice blast:

rice grows for about 4 weeks with 3-6 tillers, but no heading. The part about 2-3cm below the leaf sheath of the undrawn new leaf is penetrated with a syringe, and the spore solution is injected until the liquid emerges from the center of the new leaf. The phenotype was observed after 7-10 days.

Inoculating in-vitro leaves:

cutting 4 weeks of young seedling leaves to 5-8cm, keeping moisture at two ends, and preventing water loss of leaves. The syringe needle slightly lacerated the surface layer of the blade. Dripping spore liquid to wound, keeping moisture and keeping temperature, and observing phenotype after 5-7 days.

Spray inoculation:

seedlings growing for 10-14 days were sprayed with the spore solution evenly on the leaves using a sprayer. Incubate at 25 ℃ for 24h in the dark followed by 12 h-light/12 h-dark, keep warm and keep moist. Culturing for 5-10 days, and observing the surface property.

The following methods are referenced for the statistics of the growth of rice blast: a certain amount of rice blast infected rice leaves are taken and ground in liquid nitrogen. Adding 400ul of extraction buffer, shaking and mixing. After addition of 400 ul/chloroform (1:1, pH 8.0), shaking vigorously for 10 min. Centrifuge at 14,000rpm for 5min and transfer the supernatant to a new tube. Adding equal volume of isopropanol, and precipitating at-20 deg.C for 5-10 min. Centrifuge at 14,000rpm for 5min and remove the supernatant. Adding 1ml 70% ethanol, washing precipitate, 7500rpm for 5min, removing supernatant, and drying at room temperature. Add 40ul of ddH₂The pellet was dissolved in O or TE solution (containing 10. mu.g/ml RNase). And detecting the relative content of the DNA of the rice blast germs according to a Real-time PCR detection method.

5. RNA in vitro binding assay

1. 25mg of poly (U) -agarose, dsDNA-agarose and ssDNA-agarose were each added to 2mL of ddH₂Resuspend in O and wash twice with Binding buffer.

2. To 100ul of agarose suspension, 5. mu.g of HIS-PIBP1 was added, and the mixture was incubated at 4 ℃ for 1 hour with rotation.

3. After the incubation, 1ml of Wash buffer was added and washed 3-5 times. At the last time, the supernatant was aspirated.

4. 50-100. mu.l of protein loading buffer was added to the pellet. Boiling water bath for 5 min. SDS-PAGE detects proteins.

Binding buffer:50mM Tris-HCl(pH 7.5)，50mM NaCl。

Wash buffer:50mM Tris-HCl(pH 7.5)，50mM NaCl，0.5％Nonidet P-40。

6. Transcriptional activation assay

Yeast transcriptional activation assay

The gene of interest was constructed into the pDEST32(Invitrogen) vector to fuse the DNA binding domains. Yeast transformation the transformed clones were plated on leucine single-deficient medium and leucine/histidine double-deficient medium, respectively, according to the methods described above. After 3 days of incubation at 28 ℃ the colony growth was observed.

Dual luciferase reporter System in tobacco for detecting transcriptional activation

Mixing agrobacterium containing target plasmid according to a certain proportion, and performing tobacco injection according to the method to transiently express the target protein. The fluorescence values of Ren and Luciferase were measured according to the method of Dual-Luciferase Reporter Assay System (Promega).