阅读说明：本技术 使用可调节内含子的表达控制 (Expression control using regulatable introns ) 是由 格拉哈姆·怀特西德 于 2018-08-22 设计创作，主要内容包括：本发明涉及能够在真核细胞中调节基因表达并且对未折叠蛋白反应(UPR)具有响应性的调节性核酸序列的用途。公开了能够调节基因表达的可调节内含子和UPR诱导型启动子。还公开了包含这样的调节性核酸序列的重组表达构建体,由此可通过在包含所述构建体的真核细胞中引起未折叠蛋白反应(UPR)来诱导所编码的表达产物的表达；使用这样的构建体和相关载体、细胞等的方法。(The present invention relates to the use of regulatory nucleic acid sequences capable of regulating gene expression in eukaryotic cells and responsive to the Unfolded Protein Response (UPR). Regulatable introns and UPR inducible promoters capable of regulating gene expression are disclosed. Also disclosed are recombinant expression constructs comprising such regulatory nucleic acid sequences, whereby expression of the encoded expression product can be induced by eliciting an Unfolded Protein Response (UPR) in a eukaryotic cell comprising the construct; methods of using such constructs and related vectors, cells, and the like.)

1. A synthetic nucleic acid expression construct for producing an expression product in a cell, said nucleic acid expression construct comprising a promoter sequence operably linked to a nucleic acid sequence encoding said expression product, said nucleic acid sequence encoding said expression product comprising a sequence encoding a regulatable intron, said regulatable intron being an intron comprising a excisable sequence that is capable of being spliced out/spliced out of a transcript produced by said synthetic expression construct by an Unfolded Protein Response (UPR) system in the cell, thereby producing a transcript encoding a functional expression product.

2. The synthetic nucleic acid expression construct of claim 1, wherein said regulatable intron is capable of being spliced out by IRE1 protein or a homolog or ortholog thereof.

3. The synthetic nucleic acid expression construct of claim 1 or 2, wherein the expression product is a protein.

4. The synthetic nucleic acid expression construct of any of the preceding claims, wherein splicing out the excisable sequence of the regulatable intron allows for proper translation of a transcript from the nucleic acid sequence encoding the expression product, thereby allowing production of the desired expression product.

5. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the presence of the intron in a transcript from the nucleic acid sequence encoding the expression product results in the translation of a non-functional protein from the transcript.

6. The synthetic nucleic acid expression construct of any preceding claim, wherein splicing out the excisable sequence of the regulatable intron eliminates a premature stop codon in the transcript.

7. The synthetic nucleic acid expression construct of any preceding claim, wherein splicing out the excisable sequence of the regulatable intron results in a shift in reading frame of a sequence in the transcript that is downstream of the regulatable intron.

8. The synthetic nucleic acid expression construct of any of the preceding claims, wherein said excisable sequence is not divisible by 3 in nucleotide length.

9. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the adjustable intron comprises the sequence CNG/CNG-Xn-CNG/CNG, wherein Xn represents a sequence that is n bases in length, wherein/represents a cleavage site, and wherein the sequence CNG-Xn-CNG is cleaved from the transcript.

10. The synthetic nucleic acid expression construct of claim 9, wherein Xn is 10 to 500 nucleotides in length, more preferably 15 to 350 nucleotides, more preferably 15 to 100 nucleotides, more preferably 15 to 35 nucleotides, more preferably 20 to 25 nucleotides.

11. The synthetic nucleic acid expression construct of any preceding claim, wherein the regulatable intron comprises the sequence CNG/CNG-Xn-CNG/CNG [ CG ], wherein Xn represents a sequence of n nucleotides in length, wherein/represents a cleavage site such that the sequence CNG-Xn-CNG can be cleaved from the transcript upon splicing, wherein the nucleotides at the 5' end of sequence Xn are C or G.

12. The synthetic nucleic acid expression construct of any of claims 9-11, wherein Xn comprises sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 1) or a sequence at least 60% identical thereto.

13. The synthetic nucleic acid expression construct of claim 12, wherein Xn comprises or consists of one of the following sequences:

-CACUCAGACUACGUGCACCU(SEQ ID NO：1)；

-CACUCAGACUACGUGCUCCU(SEQ ID NO：2)；

-CACUCAGACUACGUGCCCCU(SEQ ID NO：3)；

-CACUCAGACUACGUGCGCCU (SEQ ID NO: 4); and

-CACUCAGACUAUGUGCACCU(SEQ ID NO：5)。

14. the synthetic nucleic acid expression construct of any of the preceding claims, wherein the regulatable intron comprises the sequence CNG/cngcacucagaccucgugcacuccng/CNGC (SEQ ID NO: 6), or a sequence at least 60% identical thereto.

15. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the regulatable intron comprises or consists of the sequence CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC (SEQ ID NO: 7) or a sequence at least 60% identical thereto.

16. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the regulatable intron comprises or consists of one of the following sequences:

-CNG/CAGCACUCAGACUACGUGCACCUCUG/CNG(SEQ ID NO：8)；

-CNG/CAGCACUCAGACUACGUGCUCCUCUG/CNG(SEQ ID NO：9)；

-CNG/CAGCACUCAGACUACGUGCCCCUCUG/CNG(SEQ ID NO：10)；

-CNG/CAGCACUCAGACUACGUGCGCCUCUG/CNG (SEQ ID NO: 11); and

-CNG/CAGCACUCAGACUAUGUGCACCUCUG/CNG(SEQ ID NO：12)。。

17. the synthetic nucleic acid expression construct of any of the preceding claims, wherein the regulatable intron comprises or consists of one of the following sequences:

-CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC(SEQ ID NO：7)；

-CAG/CAGCACUCAGACUACGUGCUCCUCUG/CUGC(SEQ ID NO：13)；

-CAG/CAGCACUCAGACUACGUGCCCCUCUG/CUGC(SEQ ID NO：14)；

-CAG/CAGCACUCAGACUACGUGCGCCUCUG/CUGC (SEQ ID NO: 15); and

-CAG/CAGCACUCAGACUAUGUGCACCUCUG/CUGC(SEQ ID NO：16)。

18. the synthetic nucleic acid expression construct of any preceding claim, wherein the regulatable intron comprises the sequence CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CUG (SEQ ID NO: 17) or CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CUGG (SEQ ID NO: 27), wherein/represents a cleavage site.

19. The synthetic nucleic acid expression construct of any of the preceding claims, comprising an inducible promoter operably linked to a nucleic acid sequence encoding the expression product.

20. The synthetic nucleic acid expression construct of claim 19, wherein the inducible promoter is an Unfolded Protein Response (UPR) inducible promoter.

21. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the nucleic acid sequence encoding the expression product is a transgene.

22. The synthetic nucleic acid expression construct of any of the preceding claims, wherein the nucleic acid sequence encoding the expression product encodes a protein, suitably wherein the protein is an enzyme, an antibody or antibody fragment, a viral protein, a therapeutic protein, or a toxic protein.

23. A nucleic acid comprising a sequence encoding an expression product comprising a sequence encoding a regulatable intron which is an intron comprising an excisable sequence that can be spliced out of a transcript produced in a synthetic expression construct by an Unfolded Protein Response (UPR) system in a cell to produce a transcript encoding a functional expression product, and wherein the expression product is not XBP1 protein, Hac1 protein, bZIP60 protein, or a homolog thereof.

24. A vector comprising the synthetic nucleic acid expression construct of any one of claims 1 to 22 or the nucleic acid of claim 23.

25. A pharmaceutical composition comprising the nucleic acid expression construct of any one of claims 1 to 22, the nucleic acid of claim 23, or the vector of claim 24.

26. Use of the nucleic acid expression construct according to any one of claims 1 to 22, the nucleic acid according to claim 23 or the vector according to claim 24 for the preparation of a pharmaceutical composition.

27. A cell comprising the nucleic acid expression construct of any one of claims 1 to 22, the nucleic acid of claim 23, or the vector of claim 24.

28. The cell according to claim 27, which is a eukaryotic cell, suitably a fungal cell (e.g. a yeast cell), an animal (metazoan) cell (e.g. a mammalian cell) or a plant cell.

29. The cell of claim 27 or 28, wherein the nucleic acid expression construct of any one of claims 1 to 22, the nucleic acid of claim 23, or the vector of claim 24 encodes an expression product that is toxic to the cell.

30. A method for producing an expression product, the method comprising:

a) providing a population of eukaryotic cells comprising the synthetic nucleic acid expression construct of any one of claims 1 to 22;

b) treating said population of cells to induce an unfolded protein response to splice out said excisable sequence from said regulatable intron;

c) incubating the population of cells under suitable conditions to produce the expression product; and

d) isolating the expression product from the cell population.

31. The method of claim 30, comprising incubating the population of cells under conditions suitable for growth of the cells prior to treating the population of cells to induce an Unfolded Protein Response (UPR) in step b).

32. The method according to claim 30 or 31, wherein step b) comprises applying a stress to the cells, said stress being suitable for inducing UPR.

33. The method according to any one of claims 30 to 32, wherein step b) comprises administering a chemical agent capable of inducing UPR in the cells.

34. The method of claim 33, wherein the chemical agent capable of inducing UPR in the cell comprises one or more of forskolin, Dithiothreitol (DTT), tunicamycin, thapsigargin, a saturated fatty acid, an agent capable of downregulating stearoyl-CoA desaturase enzyme activity.

35. The method of any one of claims 30-32, wherein step b) comprises expressing an inducer protein in the population of eukaryotic cells, thereby inducing a UPR response in the population of cells.

36. The method according to claim 34, wherein step b) comprises transfecting the population of cells with an expression vector capable of expressing an inducer protein, preferably a heterologous protein, in the cells, or wherein:

step b) comprises inducing expression of the inducer protein from an expression vector previously introduced into the cell.

37. The method of any one of claims 30-32, wherein step b) comprises exposing the cells to hypoxia or carbohydrate deprivation.

38. The method of any one of claims 30 to 37, wherein the population of cells comprises fungal cells, animal cells or plant cells, preferably wherein the population of cells comprises mammalian cells.

39. The method of any one of claims 30 to 37, comprising the step of introducing the nucleic acid expression construct into the cell prior to step a).

40. The nucleic acid expression construct according to any one of claims 1 to 22, the nucleic acid according to claim 23, the vector according to claim 24, the pharmaceutical composition according to claim 25 or the cell according to claims 27 to 29 for use in a method of treatment or therapy.

41. Use of the nucleic acid expression construct according to any one of claims 1 to 22, the nucleic acid according to claim 23, the vector according to claim 24, the pharmaceutical composition according to claim 25 for the preparation of a medicament for gene therapy.

42. A method for gene therapy in a subject in need of said gene therapy, comprising:

-introducing into the subject a gene therapy vector comprising a nucleic acid expression construct according to any one of claims 1 to 22, the nucleic acid expression construct comprising a sequence encoding a therapeutic expression product, such that the gene therapy vector delivers the nucleic acid expression construct to a target cell of the subject; and

-expressing a therapeutically effective amount of said functional therapeutic expression product in a target cell of a subject.

43. A synthetic UPR-inducible promoter comprising a synthetic UPR-responsive cis-regulatory element comprising at least one binding site for: ATF6, XBP1, or bZIP60, which drive gene expression as part of a UPR, or a homologous or otherwise equivalent transcription factor.

44. The synthetic UPR inducible promoter of claim 43, comprising at least one synthetic UPR responsive cis regulatory element operably linked to a minimal promoter or a proximal promoter.

45. The synthetic UPR inducible promoter of claim 43 or 44 comprising a UPR responsive cis regulatory element comprising one or more copies of at least one of the following transcription factor target sequences:

-TGACGTG；

-TGACGTGCT；

-TGACGTG[TG]；

-CCAAT-N9-CCACG (designated ERSE1 site) (SEQ ID NO: 18); and

ATTGG-N-CCACG (designated ERSE2 site) (SEQ ID NO: 19).

46. The synthetic UPR inducible promoter of any one of claims 43 to 45, comprising a UPR responsive cis regulatory element comprising one or more copies of the transcription factor target sequence TGACGTG, preferably 3 or more copies of the transcription factor target sequence TGACGTG, and preferably 5 or more copies of the transcription factor target sequence TGACGTG, such as 6 or more copies of the transcription factor target sequence TGACGTG.

47. The synthetic UPR inducible promoter of claim 43, wherein the UPR responsive cis regulatory element comprises a sequence

Wherein S represents an optional spacer sequence.

48. The synthetic UPR inducible promoter of claim 43, wherein the UPR responsive cis regulatory element comprises a sequence

Wherein S represents an optional spacer sequence.

49. The synthetic UPR inducible promoter of claim 43, wherein the UPR responsive cis regulatory element comprises a sequence

50. The synthetic UPR inducible promoter of claim 43, wherein the UPR responsive cis regulatory element comprises a sequence

Or a sequence at least 50% identical thereto.

51. The synthetic UPR inducible promoter of claim 43, wherein the UPR inducible promoter comprises one of the following sequences:

or a sequence at least 70% identical thereto;

or a sequence at least 50% identical thereto; and

or a sequence at least 50% identical thereto.

Background

In many cases, it is desirable to modulate gene expression, in which case it may be beneficial or necessary to control the expression level of the expression product. For example, in the case of industrial biotechnology, it would be highly advantageous to be able to induce the production of an expression product (e.g., a protein) at a desired time during fermentation. In another example, in gene therapy, it may be desirable to be able to induce expression of a therapeutic product (e.g., a therapeutic protein) at a location at a desired time and/or location of treatment.

Inducible promoters are known in the art, for example the tetracycline (Tet) -on and-off inducible expression systems (Gossen M & Bujard H.PNAS.1992 Jun 15; 89 (12): 5547-51; Gossen M, Freundbieb S, Bender G, Muller G, Hillen W, & Bujard H.science.1995 Jun 23; 268 (5218)).

Inducible promoters function by regulating expression at the transcriptional level, controlling the amount of mRNA produced by the relevant expression system. While this may provide useful levels of gene expression, there remains a need for other, desirably improved systems for controlling expression.

In particular, there is a need for improved expression control systems for the expression of toxic proteins (i.e., proteins that are toxic to the cells that produce them). In the case of toxic proteins, expression of even small amounts of protein often leads to cell death or very poor production (production).

Furthermore, in the case of genes for cell therapy, systems are needed that allow for the induction of expression of therapeutic proteins or RNAs or other expression products at a desired time and/or location.

The present invention relates to the regulation of expression that plays a role in translation. In particular, it relates to the use of introns that are spliced out as a result of the Unfolded Protein Response (UPR) in eukaryotic cells for controlling expression.

Unfolded Protein Response (UPR) is the cellular response mechanism to endoplasmic reticulum stress. UPRs are activated in response to the accumulation of unfolded or misfolded proteins in the lumen of the Endoplasmic Reticulum (ER). UPRs are intended to restore normal function to cells by a variety of mechanisms. The goal of the UPR is apoptosis if these goals are not met or the disruption time is extended within a certain time frame. UPR can be triggered by increased synthesis and folding of proteins (e.g., production of heterologous proteins) or by other cellular stresses (e.g., chemically induced stresses, such as blocking glycosylation pathways or disulfide bond formation). UPRs are highly conserved in all eukaryotes.

In mammalian cells, there are three mechanisms to sense ER stress and activate UPR:

1) IRE-1 splicing of XBP-1 mRNA

ER stress caused by increased protein folding requirements or by chemical inhibition of the ER process is detected by dissociation of the ER transmembrane protein IRE1 via the chaperone BiP. This dissociation of BiP activates IRE1 by allowing oligomerization and phosphorylation of the protein, resulting in exposure of the ER lumen facing the rnase domain. Subsequently, the RNase domain catalyzes the removal of non-canonical introns (non-canonical intron) from XBP-1 mRNA in a spliceosome-independent manner. Under non-stress conditions, XBP1 mRNA is unspliced (XBP1u), which upon translation forms an ORF of 261 amino acids, a non-functional protein. However, when ER stress is detected, XBP1u is spliced by IRE1 rnase to form XBP1s, which encodes a functional 376 amino acid protein. The functional protein XBP1 is a transcription factor that controls the expression of several genes involved in protein homeostasis, such as chaperones, disulfide isomerases, and enzymes involved in phospholipid biosynthesis. It regulates these processes by binding to specific sequences, ER stress response elements (ERSEs) or Unfolded Protein Response Elements (UPREs) and enhancing gene expression. Thus, gene expression was controlled by removal of mRNA introns from XBP1u by IRE 1. Very similar systems operate in non-mammalian eukaryotic cells.

2)ATF6

The activated transcription factor (ATF 6) ATF6 is a type 2 transmembrane protein with transcription factor domains in the cytoplasmic region. It is synthesized as an inactive precursor and is retained in the ER by association with BiP/GRP 78. In response to stress conditions, ATF6 dissociates and is transported to the golgi apparatus where processing occurs to release the transcription factor domain. This domain is then transported to the nucleus where it can bind to ERSE and UPRE to enhance expression of genes involved in protein homeostasis.

3) Double-stranded RNA activated protein kinase (PERK)

PERK is a type 1 ER transmembrane protein that contains an ER lumen stress sensing element and a cytoplasmic protein kinase domain. PERK is activated in response to endoplasmic reticulum stress and inhibits normal protein translation in the ER of mammalian cells by inactivating the eukaryotic initiation factor (elF2a) via phosphorylation.

Mechanisms 1) and 2) are most relevant to the present invention.

Disclosure of Invention

According to the present invention there is provided a synthetic nucleic acid expression construct for producing an expression product in a cell, the nucleic acid expression construct comprising a promoter sequence operably linked to a nucleic acid sequence encoding the expression product, the nucleic acid sequence encoding the expression product comprising a sequence encoding a regulatable intron, the regulatable intron being an intron comprising a excisable sequence that is capable of being spliced out of a transcript produced by the synthetic expression construct by an Unfolded Protein Response (UPR) system in the cell, thereby producing a transcript encoding a functional expression product.

Thus, the present invention is based on the use of a regulatable intron which can be spliced out of the RNA transcript of the nucleic acid sequence encoding the expression product by the UPR mechanism to regulate expression. The UPR mechanism is ubiquitous in eukaryotes, and both the mechanism and related sequences are well conserved. Thus, the invention can be practiced on all eukaryotic cells. The regulatory intron is preferably capable of being spliced out by the IRE1 protein or a homologue or orthologue thereof (homologues or orthologues of IRE1 are present in all eukaryotes, including fungi, plants and mammals).

The promoter is typically heterologous to the nucleic acid sequence encoding the expression product. That is, the promoter is not naturally found in operative association with the sequence encoding the expression product. For example, a promoter and a nucleic acid sequence encoding an expression product are not typically found together in a naturally occurring gene. In some embodiments of the invention, the promoter is a synthetic promoter, i.e., not a naturally occurring promoter. Constitutive and non-constitutive promoters known in the art to be suitable for use in eukaryotic cells have a wide range and, as non-limiting examples, mention may be made of the CAG promoter, the CMV promoter, SV 40.

In some preferred embodiments, the expression product is a protein. In such embodiments, the unspliced transcript produced from the nucleic acid sequence encoding the expression product encodes a truncated or otherwise defective form (version) of the protein due to the presence of the regulatable intron, but when the transcript is processed by the UPR mechanism in the cell, the excisable sequence of the intron is spliced out and a functional protein can be produced from the transcript. Thus, splicing out of the regulatory intron results in a functional mRNA encoding a functional protein expression product.

However, in some cases, the expression product may be a product other than a protein. Suitably, the expression product may be an RNA molecule, such as a ribozyme, an RNA aptamer, siRNA, antisense RNA or miRNA. In such embodiments, the RNA molecule is produced in a non-functional form as an unspliced transcript, and an excisable portion of the intron is spliced out to convert the RNA molecule to an active form.

In a preferred embodiment of the invention, the excisable sequence from which the regulatable intron is spliced out allows for the correct translation of the transcript from the nucleic acid sequence encoding the expression product, thereby allowing the production of the desired expression product (e.g., protein). In such embodiments, the presence of an intron in a transcript from the nucleic acid sequence encoding the expression product results in the translation of a non-functional protein from the transcript. Typically, this is caused by the insertion of an intron into the translated protein of the encoded amino acid, or more preferably, by the introduction of a stop codon or frameshift (relative to the normal transcript encoding a functional protein) in the 3' of the transcript for the intron. Proteins encoded by unspliced transcripts may be non-functional for a number of reasons, for example:

an intron may cause a frameshift downstream (i.e. in the 3' direction) of the intron. This is often the case when the excisable sequence of the intron is not a multiple of three nucleotides in length. Such a frameshift typically results in the introduction of a stop codon, resulting in a truncated protein. In other cases, it may simply result in a complete change in the encoded amino acid sequence downstream of the intron.

-introduction of a coding sequence, which results in the presence of amino acids in the translated protein, which disrupts the function of the protein. In this case, the amino acid sequence downstream of the intron is not changed, but the amino acid sequence encoded by the intron is present in the translated protein in an unspliced form, which destroys the function of the protein.

-introducing a stop codon in the intron sequence. In this case, the intron itself may contain a stop codon, which will result in premature termination of translation and production of a truncated protein.

In certain preferred embodiments of the invention, the synthetic nucleic acid expression construct is configured such that the excisable sequence from which the intron is spliced out eliminates a premature stop codon in the transcript. In this context, "ahead" means a stop codon that occurs upstream (i.e., in the 5' direction) of the stop codon of a normal transcript (i.e., a transcript encoding a functional protein such as a wild-type mRNA).

Preferably, the regulatable intron is configured such that the excisable sequence from which the intron is spliced out results in a shift in the reading frame of the sequence in the transcript downstream (i.e. 3') from the regulatable intron.

In certain preferred embodiments of the invention, the regulatable intron is configured such that when splicing occurs, sequences that are not multiples of 3 in nucleotide length are excised from the transcript. In other words, the cleavable sequence is n nucleotides in length, where n is not evenly divisible by 3.

In a preferred embodiment of the invention, the adjustable intron comprises the sequence CNG/CNG-Xn-CNG/CNG, wherein Xn represents a sequence n bases in length, wherein/represents a cleavage site, and wherein the sequence CNG-Xn-CNG is cleaved from the transcript.

Thus, in other words, the regulatable intron suitably comprises a central sequence (Xn) flanked by two splice site target sequences, each having the sequence CNG/CNG, where/represents a cleavage site.

CNG/CNG is a consensus splice site sequence that is targeted in a highly conserved manner by the UPR system in eukaryotic cells. As is known in the art, this splice site consensus sequence is targeted by IRE1 protein (a homolog or ortholog thereof is present in all eukaryotes including fungi, plants, and mammals) when a UPR response is induced. In nature, introns with this consensus splice site target sequence are found in mRNA encoding transcription factors activated in UPR, such as XBP1 protein (in metazoans), Hac1 protein (in yeast), and bZIP60 protein (in plants). The endoribonuclease activity of IRE1 or its homologue or ortholog acts to cleave the RNA transcript at the positions indicated/indicated to remove the cleavable intron sequences, and then the cleaved RNAs are ligated together by RNA ligase proteins (RNA ligase Rlg1p in saccharomyces cerevisiae (s. cerevisiae), RNA ligase RtcB in mammalian cells). The UPR system in mammalian, yeast and plant cells has been extensively studied and the mechanism has also been relatively well characterized (see, e.g., Yoshida et al, Cell, Vol.107, 881-891, December 28, 2001; Lu, et al, mol cell.2014 September 4; 55 (5): 758-770; Samali et al, International Journal of Cell biology, Vol.2010, Article ID 830307, page 11 DOI: 10.1155/2010/830307; Chakraborty et al, Appl Biol Chem DOI, 10.1007/s13765-016-0167-6, on 2468 SN 0842, PrisisISSN 2468-0834; and Nagashima et al, Scientific copies 1, artic number 29: 2011/10.1038). Therefore, the mechanism of UPR will not be discussed in depth here. However, it is important to note that, given the high conservation of IRE 1-mediated splicing, introns derived from one species may be successfully spliced by another species that is evolutionarily highly diverse. For example, Yoshida et al (supra) explained that mammalian cells can successfully splice out introns from yeast Hac1 mRNA (corresponding to Hac1 of XBP1 in mammalian cells).

It should be noted that the length of the adjustable intron can vary widely. For example, although variants of 20 and 23 nucleotides have been observed, the XBP1 intron in mammals and plants is typically 26 nucleotides in length. The Hac1 intron in yeast is much longer, typically about 252 nucleotides in length (although as noted above, this much longer Hac1 intron can still be spliced out in mammalian cells).

Thus, in various embodiments of the invention, the adjustable intron or Xn can be 10 to 500 nucleotides in length, more preferably 15 to 350 nucleotides in length, more preferably 15 to 100 nucleotides in length, more preferably 15 to 35 nucleotides in length, more preferably 20 to 25 nucleotides in length. The excisable sequence of the regulatory intron is thus suitably 16 to 506 nucleotides in length, more preferably 21 to 356 nucleotides in length, more preferably 21 to 106 nucleotides in length, more preferably 21 to 41 nucleotides in length, and more preferably 26 to 31 nucleotides in length. As mentioned above, in some embodiments of the invention, the length Xn is preferably chosen such that the length of the excisable sequence is not divisible by 3.

There is a great deal of freedom regarding the particular sequence of Xn. Preferred sequences are listed below, but of course many other variants can be used as long as the introns can be regulated to remain functional, i.e., they are spliced out of the transcript at the appropriate level by the UPR system. Of course, certain possible sequences may not be optimal or they interfere with the splicing process, for example due to the formation of undesirable secondary structures, but the effect of any given sequence can be readily assessed by one skilled in the art to determine whether it adversely affects splicing.

Assessment of the functionality of a regulatable intron (i.e., the ability of the regulatable intron to be successfully spliced out of a transcript upon induction of a UPR) can be readily assessed by those skilled in the art using a wide range of methods, and these can be adapted to the particular expression system in which the construct is intended to be used. As a preferred example, the method described in the following examples, such as example 1, may be used. For example, the functionality of any candidate regulatable intron to be evaluated can be replaced with the construct described in example 1 (referred to as SYNP-XBP-01) in place of the exemplary intron used in example 1, and the ability of the intron to be successfully spliced out upon induction of UPR can be measured by evaluating the level of EGFP expression before and after induction of UPR by 2mM DTT, exactly as was done in example 1. A functionally regulatable intron is an intron that can be successfully spliced out upon induction of a UPR to result in the expression of a functional EGFP. Preferably, the functional intron increases expression at least 5-fold, more preferably at least 10-fold, more preferably at least 100-fold, and more preferably at least 1000-fold at 24 hours after induction of UPR with 2mM DTT. Preferably, the expression level of EGFP is minimal, and preferably negligible, prior to induction of UPR. Minimal expression can be defined as, for example, less than 50%, preferably less than 20%, more preferably less than 10%, more preferably less than 5%, more preferably less than 1% of the expression level of a control construct (i.e., a construct without a regulatable intron in which expression of the EGFP-encoding sequence is driven by CMV-mp) as used in example 1. Negligible expression levels are expression levels that are essentially undetectable using the method of example 1.

However, it is to be understood that the skilled person can easily modify the method employed in example 1. For example, this may involve the use of different cell types, the use of different expression products, the use of different indicators of successful splicing (e.g., measuring the level of spliced mRNA encoding a functional expression product, or the use of different reporter proteins), and the use of different UPR inducers. In this improved approach, there remains the case where a functionally regulatable intron is an intron that can be successfully spliced out following UPR induction, thereby expressing a functional expression product following UPR induction. Preferably, this results in at least a 5-fold increase in expression of the transcript encoding the functional expression product 24 hours after UPR induction, more preferably a 10-fold increase, more preferably a 100-fold increase, and more preferably at least a 1000-fold increase. Preferably, the expression level of the transcript encoding the functional expression product is minimal or negligible prior to induction of the UPR.

CNG/CNG [ CG ] is a preferred splice site consensus target sequence for mammalian cells, where the presence of C or G at the indicated positions is preferred (although not required). There is generally a preference for C over G at this position. Thus, in some preferred embodiments of the invention, particularly when the synthetic nucleic acid expression construct is intended for use in a mammalian cell, the intron comprises the sequence CNG/CNG [ CG ] at one, the other or both (preferably both) ends of the intron.

Thus, in some preferred embodiments of the invention, the regulatable intron comprises the sequence CNG/CNG-Xn-CNG/CNG [ CG ], wherein Xn represents a sequence of n nucleotides in length, wherein/represents a cleavage site, such that the cleavable sequence CNG-Xn-CNG is cleaved from the transcript after splicing, wherein the nucleotide at the 5' end of sequence Xn is C or G. Suitable lengths for Xn are shown above.

In some preferred embodiments of the invention, Xn comprises sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 1) or a sequence that is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto.

In some preferred embodiments of the invention, Xn consists of the following sequence: sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 1) or a sequence which is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto.

Sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 1) corresponds to the region of the mammalian XBP1 intron located inside the IRE1 cleavage site as described above. This therefore represents a preferred embodiment of the present invention, in particular when the synthetic nucleic acid expression construct is intended for use in mammalian cells. However, sequences that are highly similar to this are also found within a series of non-mammalian XBP1 introns.

In some embodiments of the invention, Xn comprises or consists of one of the following sequences:

-CACUCAGACUACGUGCACCU(SEQ ID NO：1)；

-CACUCAGACUACGUGCUCCU(SEQ ID NO：2)；

-CACUCAGACUACGUGCCCCU(SEQ ID NO：3)；

-CACUCAGACUACGUGCGCCU (SEQ ID NO: 4); and

-CACUCAGACUAUGUGCACCU(SEQ ID NO：5)。

in other embodiments of the invention, Xn comprises or consists of the following sequence: sequence ACGGGCAACUUUACACGACG (SEQ ID NO: 49) or a sequence which is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto.

In a particularly preferred embodiment of the invention, the regulatable intron comprises or consists of the following sequence: sequence CNG/CNGCACCUCAGACUACGUGCACCUCCNG/CNGC (SEQ ID NO: 6), or a sequence which is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein/represents a cleavage site. In variant sequences according to the above-described level of sequence identity, the splice site target sequence preferably remains CNG/CNGC, and sequence variations occur in other regions.

Suitably, the adjustable intron comprises or consists of the following sequence: the sequence CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC (SEQ ID NO: 7), or a sequence which is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein/represents a cleavage site. In variant sequences according to the above-described level of sequence identity, the splice site target sequence is preferably retained as CAG/CUGC, and sequence variations occur in other regions.

In some preferred embodiments of the invention, the adjustable intron comprises or consists of one of the following sequences:

-CNG/CAGCACUCAGACUACGUGCACCUCUG/CNG(SEQ ID NO：8)；

-CNG/CAGCACUCAGACUACGUGCUCCUCUG/CNG(SEQ ID NO：9)；

-CNG/CAGCACUCAGACUACGUGCCCCUCUG/CNG(SEQ ID NO：10)；

-CNG/CAGCACUCAGACUACGUGCGCCUCUG/CNG (SEQ ID NO: 11); and

-CNG/CAGCACUCAGACUAUGUGCACCUCUG/CNG(SEQ ID NO：12)。

in other preferred embodiments of the invention, the adjustable intron comprises or consists of one of the following sequences:

-CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC(SEQ ID NO：7)；

-CAG/CAGCACUCAGACUACGUGCUCCUCUG/CUGC(SEQ ID NO：13)；

-CAG/CAGCACUCAGACUACGUGCCCCUCUG/CUGC(SEQ ID NO：14)；

-CAG/CAGCACUCAGACUACGUGCGCCUCUG/CUGC (SEQ ID NO: 15); and

-CAG/CAGCACUCAGACUAUGUGCACCUCUG/CUGC(SEQ ID NO：16)。

in another embodiment of the invention, the adjustable intron comprises the sequence CAG-CUGCAGCACUCAGACUACGUGCACCUCUG/CAG (SEQ ID NO: 17) or CAG-CUGCAGCACUCAGACUACGUGCACCUCUG/CUGG (SEQ ID NO: 27), wherein/represents a cleavage site. This sequence is due to the addition of the trinucleotide CUG to the mammalian XBP1 intron sequence at the underlined position. It is believed that the addition of such trinucleotides may result in slightly less optimal splicing of introns to reduce any undesired splicing (and thus background expression of the expressed product) in the cell.

Thus, in some preferred embodiments of the invention, Xn comprises or consists of CAGCACUCAGACUACGUGCACCU (SEQ ID NO: 23).

In another embodiment of the invention, the adjustable intron comprises the sequence: CNG/CAGACGGGCAACUUUACACGACGCUG/CNG (SEQ ID NO: 50), or a sequence which is at least 60% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, and more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein/represents a cleavage site. In variant sequences according to the above-described level of sequence identity, the splice site target sequence preferably remains CNG/CNG, and sequence variations occur in other regions.

For the avoidance of doubt, it should be noted that in the intron sequences of the present invention, it is preferred to restrict the splice site target sequence at each end of the intron to CNG/CNG, more preferably to CNG/CNG [ CG ]. Thus, while these sequences provide some variation in the splice site target sequences, the central sequence located between the two splice site target sequences should accommodate additional variation, if desired.

In some preferred embodiments of the invention, the regulatable intron is the XBP1 intron, the Hac1 intron, the bZIP60 intron, or a homolog thereof. This means that the intron may be the wild-type form of XBP1, Hac1 or bZIP60 intron, or a naturally occurring homologue thereof.

In some embodiments of the invention, it may be preferred that the splice site target sequence in the transcript (i.e. comprising the sequence CNG/CNG) is flanked by sequences capable of interacting to form a stem-loop structure. Thus, the splice site target sequences are preferably flanked by sequences that are complementary to each other such that they will hybridize to each other to form a stem-loop structure, wherein the splice site target sequences are located at least partially, preferably entirely, within the loop region of the stem-loop structure formed in the transcript.

With respect to wild-type XBP1, HAC1, and bZIP60 introns, it has been hypothesized that a stem-loop structure is formed at a splice site in an mRNA transcript. This involves hybridization between an intron and a sequence in an exon adjacent to the splice site target sequence, which is complementary in the nucleotide sequence when read in the opposite direction. Experiments reported herein show that splicing proceeds successfully when introns are inserted into the coding sequence in the expectation that such stem-loop structures would not be formed. Thus, the formation of a stem-loop structure does not appear to be necessary for successful splicing of the regulatable intron of the invention. However, in certain cases, it may be desirable to form a stem-loop structure, as this may, for example, lead to optimal splicing activity. In one alternative, it may be desirable in certain circumstances to avoid providing sequences that can be modified to form stem-loop structures, as this may lead to unwanted active splicing of introns, potentially leading to expression leakages (expresson leakages).

In certain embodiments of the invention, in the case of a stem-loop structure to be formed, the stem-loop structure formed from the transcript preferably comprises a loop of 6 to 9 nucleotides in length and a stem of 3 to 10 nucleotides in length. More preferably, the stem-loop structure comprises a loop of 7 to 8 nucleotides in length and a stem of 4 to 8 nucleotides in length.

In certain embodiments of the invention in which a stem-loop structure is to be formed, the intron may suitably comprise the following sequence at the splice target site:

-Yn-CNG/CNG-A-Zn-

wherein A is a sequence of 0 to 3 nucleotides (preferably 1 or 2 nucleotides) in length,

wherein/represents a cleavage site(s),

and wherein Yn and Zn represent sequences that are complementary in nucleotide sequence when read in opposite directions, and are therefore capable of hybridizing to form a stem-loop structure. The length of Yn and Zn is preferably 3 to 10 nucleotides, more preferably 4 to 8 nucleotides.

In some embodiments, the intron may suitably comprise the following sequence at the splicing target site:

-Zn-CNG/CNG [ CG ] -A-Yn-, wherein the components have the same meaning as above. In this case, a preferably has a length of 0, 1 or 2 nucleotides.

Obviously, providing suitable complementary sequences (e.g., Yn and Zn in the above structures) to provide a stem structure can be achieved by altering the sequence of an intron to provide suitable regions of complementarity to corresponding sequences in the adjacent coding (i.e., exon) sequences. It is also possible or desirable to alter the sequence of the coding region to some extent, for example by exploiting redundancy in the genetic code to alter the nucleic acid sequence without affecting the encoded amino acid sequence; alteration of the amino acid sequence of the expression product should generally be avoided.

In some embodiments of the invention, the nucleic acid expression construct comprises an inducible promoter operably linked to a nucleic acid sequence encoding an expression product comprising a sequence encoding a regulatable intron. As mentioned above, inducible promoters are known in the art. By combining the inducible promoter of the invention with a regulatable intron, dual expression levels, i.e., control at both the transcriptional and translational levels, can be achieved. This may allow very tight expression control, e.g. avoiding any expression "drop-outs". This may be important, for example, in any situation where the background expression level must be kept at an absolute minimum during expression of the toxic protein, or before expression is induced at the desired time.

In a preferred embodiment, the inducible promoter is an Unfolded Protein Response (UPR) inducible promoter, i.e., a promoter that is itself induced by a UPR. In such embodiments, induction of UPR both induces expression in driving transcription and allows expression of functional expression products due to the modulation of splicing of introns.

In some embodiments of the invention, the UPR-inducible promoter suitably comprises at least one binding site for: ATF6, XBP1, bZIP60, or homologous or otherwise equivalent transcription factors that drive gene expression in UPRs.

Suitably, the UPR-inducible promoter comprises at least one copy of one or more of the following sequences:

TGACGTG (ATF6 consensus),

TGACGTGCT (variant of the above),

-TGACGTG [ TG ] (called UPRE site),

-CCAAT-N9-CCACG (designated ERSE1 site) (SEQ ID NO: 18), and

ATTGG-N-CCACG (designated ERSE2 site) (SEQ ID NO: 19).

These sites are bound by ATF6, XBP1 and bZIP 60.

Suitably, the promoter comprises one or more copies of the sequence TGACGTG (optionally as part of TGACGTGCT or TGACGTG [ TG ]), preferably 3 or more copies of the sequence TGACGTG [ TG ] (optionally as part of TGACGTGCT or TGACGTG [ TG ]), and preferably 5 or more copies of the sequence TGACGTG [ TG ] (optionally as part of TGACGTGCT or TGACGTG [ TG ]).

An exemplary UPR inducible promoter sequence comprises the following sequence (SEQ ID NO: 20): TGACGTGCTTGACGTGCTTGACGTGCTTGACGTGCTTGACGTGCTTGACGTGCT are provided.

This sequence contains 6 tandem copies of the UPRE site.

Another exemplary UPR inducible promoter sequence comprises the following sequence (SEQ ID NO: 47):

the sequence contains 6 copies of the UPRE site, each copy separated by 20 nucleotides.

Suitably, the UPR-inducible promoter comprises said at least one linking site for: ATF6, XBP1, or a homologous or otherwise equivalent transcription factor that drives the UPR to be operably linked to a minimal promoter sequence (e.g., CMV minimal promoter). Other suitable minimal promoters are known in the art.

The CMV minimal promoter has the following sequence (SEQ ID NO: 21):

thus, an exemplary inducible promoter comprises a promoter comprising a sequence according to SEQ ID NO: 20 located within a nucleic acid having a sequence according to SEQ ID NO: 21 is upstream of and operably linked to a nucleic acid of the sequence of 21.

For example, an inducible promoter may suitably comprise the following sequence (SEQ ID NO: 22):

more details of UPR-inducible promoters that can be used in conjunction with the regulatable intron are provided below.

The nucleic acid sequence encoding the expression product is suitably a transgene. Transgenes typically encode gene expression products, such as RNA or polypeptides (proteins). The transgene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or mutant thereof having at least some biological activity. The transgene may suitably be a minigene (minigene), i.e. a gene sequence lacking part, most or all of its native intron sequence. The transgene optionally may comprise conventional intron sequences (i.e., in addition to the regulatable intron). Optionally, the transgene may be a hybrid nucleic acid sequence, i.e., a sequence constructed from homologous and/or heterologous cDNA and/or genomic DNA fragments. By "mutant" is meant a nucleic acid sequence comprising one or more nucleotides that are different from the wild-type or naturally occurring sequence, i.e., the mutated nucleic acid sequence comprises one or more nucleotide substitutions, deletions and/or insertions. Nucleotide substitutions, deletions and/or insertions may result in a gene product (i.e., a protein or nucleic acid) whose amino acid/nucleic acid sequence differs from the wild-type amino acid/nucleic acid sequence. In some cases, the transgene may also include a sequence or signal sequence encoding a leader peptide, such that the transgene product will be secreted from the cell.

In addition to the regulatable introns discussed above, conventional (i.e., non-regulatable) introns may also be used in the nucleic acid sequence encoding the expression product. The term "conventional intron" encompasses any portion of the entire intron that is large enough to be recognized and spliced by the nuclear splicing apparatus. In general, short, functional intron sequences are preferred to keep the size of the expression module as small as possible, which facilitates construction and manipulation of the expression module. In some embodiments, the intron is obtained from a gene encoding a protein encoded by a nucleic acid sequence encoding an expression product. Conventional introns may be located 5 'of the expression encoding sequence, 3' of the expression encoding sequence or within the expression encoding sequence. Thus, in some embodiments, the nucleic acid sequence encoding the expression product further comprises a conventional intron. Some non-limiting examples of suitable introns are the mouse parvovirus (MVM) intron, the beta-globin intron (betaVS-II), the Factor IX (FIX) intron A, the simian Virus 40(SV40) small t intron, and the beta-actin intron. As is well known in the art, introns may have benefits in terms of increased expression levels.

In some preferred embodiments of the invention, the nucleic acid sequence encoding the expression product encodes a protein. Essentially any protein can be used, and as non-limiting examples, the protein can be an enzyme, antibody or antibody fragment (e.g., monoclonal antibody), viral protein (e.g., REP-CAP, REV, VSV-G, or RD114), therapeutic protein, or toxic protein (e.g., caspase 3, 8, or 9).

In some preferred embodiments of the invention, the nucleic acid sequence encoding the expression product encodes a toxic protein. In this context, "toxic protein" means a protein that is toxic to the cell in which the expression product is produced in use. For example, the toxic protein may be one of: caspase 3, caspase 8, caspase 9, and toxic viral proteins (e.g., VSV-G or AAV REP proteins).

In some preferred embodiments of the invention, the nucleic acid sequence encoding the expression product encodes a therapeutic expression product. The therapeutic expression product may be a protein, e.g. a secretable protein, such as a blood coagulation factor (e.g. factor IX or VIII), a cytokine, a growth factor, an antibody or nanobody, a chemokine, a plasma factor, insulin, erythropoietin, lipoprotein lipase or a toxic protein.

Alternatively, the therapeutic expression product may be an RNA, such as an siRNA or miRNA. A variety of therapeutic sirnas have been described in the art, and as non-limiting examples, the sirnas can be used to treat FTDP-17 (frontotemporal dementia), DYT1 dystonia, growth hormone deficiency, BACE1 in alzheimer's disease, leukemia (e.g., targeting c-raf, bcl-2), melanoma (e.g., targeting ATF2, BRAF), prostate cancer (e.g., targeting P110B), and pancreatic cancer (e.g., targeting K-Ras). siRNA treatment is summarized in "Therapeutic nucleotides of short interfering RNAs", Appl Microbiol Biotechnol, DOI10.1007/s 00253-017-8433-z. Similarly, for mirnas, various miRNA treatment methods that can be implemented according to the present invention are summarized in "micrornapherapeutics: towards a new era for the management of cancer and other diseases ", Nature Reviews Drug Discovery; 16, 203-.

Suitably, the nucleic acid expression construct comprises a sequence providing or encoding one or more, preferably all, of a ribosome binding site, a start codon, a stop codon, and a transcription termination sequence.

In another aspect, the invention provides a nucleic acid comprising a sequence encoding an expression product (e.g., a gene) comprising a sequence encoding a regulatable intron, the regulatable intron being an intron comprising an excisable sequence that can be spliced out of a transcript produced from a synthetic expression construct by an Unfolded Protein Response (UPR) system in a cell to produce a transcript encoding a functional expression product, and wherein the expression product is not XBP1 protein, Hac1 protein, bZIP60 protein, or a homolog thereof.

Thus, the sequence encoding the expression product is not a gene that naturally contains a regulatable intron according to the invention. In other words, the regulatory intron is heterologous to the sequence encoding the expression product in which it is found.

Preferred features of the regulatable intron and sequences encoding the expression product are as described above.

Such nucleic acids may be inserted into any suitable expression construct, such as an expression vector operably linked to a promoter, and any other elements necessary to drive transcription of the nucleic acid. Expression of the functional expression product will be controlled by a regulatable intron.

In another aspect, the invention provides a vector comprising a synthetic nucleic acid expression construct as described above.

The term "vector" is well known in the art and as used in this application refers to a nucleic acid molecule, e.g. a double stranded DNA, which may have been inserted into a nucleic acid expression construct according to the invention. The vector is suitable for transporting the inserted nucleic acid molecule into a suitable host cell. The vector typically contains all the necessary elements to allow transcription of the inserted nucleic acid molecule, and preferably translation of the transcript into a polypeptide. A vector typically contains all the necessary elements such that, once the vector enters a host cell, the vector can replicate independently of, or in concert with, the host chromosomal DNA; several copies of the vector and its inserted nucleic acid molecule can be generated. The vector of the present invention may be an episomal vector (i.e., it does not integrate into the genome of the host cell), or may be a vector that integrates into the genome of the host cell. This definition includes both non-viral and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS), and pBR322, or derivatives thereof that do not contain bacterial sequences (minicircles), transposon-based vectors (e.g., PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors), and the like). Larger vectors, such as artificial chromosomes (bacteria (BAC), Yeast (YAC), or Human (HAC)), may be used to accommodate larger inserts. Viral vectors are derived from viruses, including but not limited to vectors of the following viruses: retroviruses, lentiviruses, adeno-associated viruses, adenoviruses, herpes viruses, hepatitis viruses, and the like. Typically, but not necessarily, viral vectors are replication-defective in that they have lost the ability to propagate in a given cell because the viral genes necessary for replication have been eliminated from the viral vector. However, some viral vectors may also be adapted to replicate specifically in a given cell (e.g., such as a cancer cell), and are typically used to trigger cell (cancer cell) specific lysis (oncolytic lysis). Virosomes are one non-limiting example of vectors that contain both viral and non-viral components, in particular they combine liposomes with inactivated HIV or influenza virus (Yamada et al, 2003). Another example includes a viral vector mixed with a cationic lipid.

In some preferred embodiments, the vector is a viral vector, such as a retroviral vector, a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector, more preferably an AAV vector. To overcome one of the limiting steps in AAV transduction (i.e., single-stranded to double-stranded AAV transformation), AAV vectors are preferably used as self-complementary double-stranded AAV vectors (scAAV) (McCarty, 2001, 2003; Nathwani et al, 2002, 2006, 2011; Wu et al, 2008), although the use of single-stranded AAV vectors (ssav) is also contemplated herein.

In some preferred embodiments, the vector is a plasmid. Such plasmids may include a variety of other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, a multiple cloning site, and the like.

In some preferred embodiments of the invention, the vector is an expression vector for expression in eukaryotic cells. Some examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXT1 and pSG, available from Stratagene; pSVK3, pBPV, pMSG, and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, pCMV-EGFP, available from Clontech. Many other carriers are well known and commercially available. For mammalian cell adenoviral vectors, the pSV and pCMV series of vectors are particularly well known non-limiting examples. There are many well-known yeast expression vectors, including but not limited to yeast integrative plasmids (YIp) and yeast replicating plasmids (YRp). For plants, Ti plasmids of agrobacterium (agrobacterium) are an exemplary expression vector, and plant viruses also provide suitable expression vectors, such as Tobacco Mosaic Virus (TMV), potato virus X, and cowpea mosaic virus.

In some preferred embodiments, the vector is a gene therapy vector. Various gene therapy vectors are known in the art, and AAV vectors, adenoviral vectors, retroviral vectors, and lentiviral vectors may be mentioned. When the vector is a gene therapy vector, the nucleic acid sequence encoding the expression product suitably encodes a therapeutic protein. The therapeutic protein may be a secretable protein. Non-limiting examples of secretable proteins, particularly secretable therapeutic proteins, include blood clotting factors (e.g., factor VII I or factor IX), insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors, toxic proteins, and the like.

The nucleic acid expression constructs and vectors of the invention can be formulated into pharmaceutical compositions with pharmaceutically acceptable excipients (i.e., one or more pharmaceutically acceptable carrier materials and/or additives, such as buffers, carriers, excipients, stabilizers, and the like). The pharmaceutical composition may be provided in the form of a kit. The term "pharmaceutically acceptable" as used herein is consistent with the art and means compatible with the other ingredients of the pharmaceutical composition and not deleterious to the recipient thereof.

Accordingly, another aspect of the invention provides a pharmaceutical composition comprising a nucleic acid expression construct or vector as described herein.

In another aspect of the invention there is provided the use of nucleic acid expression constructs and vectors according to aspects of the invention for the preparation of pharmaceutical compositions.

According to another aspect of the invention, there is provided a cell comprising a synthetic nucleic acid expression construct or vector according to the invention.

Preferably, the cell is a eukaryotic cell. The eukaryotic cell may suitably be a fungal cell (e.g. a yeast cell), an animal (metazoan) cell (e.g. a mammalian cell) or a plant cell.

In some embodiments of the invention, the cell may be a prokaryotic cell; although prokaryotic cells do not have a UPR, prokaryotic cells may still be used in the production of synthetic nucleic acid expression constructs or in other steps for processing synthetic nucleic acid expression constructs.

In some preferred embodiments of the invention, the cells are ex vivo, e.g., in cell culture. In other embodiments of the invention, the cell may be part of a tissue or a multicellular organism.

In some preferred embodiments, the expression product is toxic to the cell in which the construct or vector is present. In one such embodiment, the cell is a cell for cell therapy (e.g., a therapeutic immune cell, such as a therapeutic T cell) comprising a synthetic nucleic acid expression construct of a vector according to the invention, wherein the expression product is toxic to the cell. In such an embodiment, induction of UPR can be used to induce cell death, i.e., as a death switch (killswitch). Suitable toxic expression products include caspases, such as caspase 3, caspase 8 or caspase 9.

The synthetic nucleic acid expression construct may be inserted into the genome of a cell, or may be present in an episomal vector.

In another aspect, the present invention provides a method of producing an expression product, the method comprising:

a) providing a population of eukaryotic cells comprising a synthetic nucleic acid expression construct according to the invention;

b) treating said cell population to induce an unfolded protein response to splice out the cleavable sequence from the regulatable intron;

c) incubating the population of cells under suitable conditions to produce an expression product; and

d) isolating the expression product from the cell population.

This method is a suitable cell culture method. Thus, the cells may be provided under cell culture conditions appropriate for the cell type used. Suitable cell culture conditions are well known to the skilled person.

The synthetic nucleic acid expression construct may be present in the genome or may be episomal.

It is clear that the present invention allows delaying the production of the expression product (or the active form of the expression product) until the desired time in the cell culture process. This may allow, for example, the cell population to expand until a desired cell number or concentration is reached, or a desired growth phase is reached.

For example, in the case of toxic proteins, the production of functional (i.e., toxic) expression products can be avoided until the cell culture system is at the desired stage. Once the toxic protein is expressed, the cell will of course be adversely affected or killed.

The method suitably comprises incubating said population of cells under conditions suitable for growth of said cells prior to treating said population of cells to induce an Unfolded Protein Response (UPR) in step b).

Typically, step b) comprises applying a stress (stress) to the cells, said stress being suitable for inducing UPR. A wide range of stresses are available for inducing UPR and are widely described in the literature.

In some preferred embodiments, the step of inducing UPR suitably comprises administering a chemical agent capable of inducing UPR in the cell (i.e., a chemical agent that induces UPR).

One skilled in the art can readily assess the ability of any particular stress (e.g., chemical agent) to induce UPR. For example, one skilled in the art may suitably apply stress (e.g., by administering a candidate chemical agent) in place of DTT in the method of example 1. The ability of an agent to induce a UPR will be identified by the effect of the application of stress (e.g., a chemical agent) on the expression of a functional expression product (i.e., EGFP, in the case of example 1). Of course, the method of example 1 can be modified, if desired, for example, using different cell types or different constructs. Specifically, example 4 demonstrates how to test the ability of various candidate chemical agents to induce UPR. Various other methods of assessing the ability of stress (e.g., chemical agents) to induce UPR will be apparent to those skilled in the art.

Many chemical agents that induce ER stress and induce UPR are known in the art. UPR-inducing chemical agents capable of inducing the IRE1 pathway are suitable for use in the present invention, as they will result in the modulation of splicing of introns.

Some exemplary UPR-inducing chemicals useful for inducing UPR include:

dithiothreitol (DTT) -this agent reduces the disulfide bridges of the protein. Denatured proteins accumulate inside the ER.

Tunicamycin-this agent inhibits N-linked glycosylation.

Brefeldin a (brefeldin a) -is commonly used as an inducer of the unfolded protein response.

Thapsigargin (thapsigargin) -this agent inhibits Sarco/endoplasmic reticulum Ca²⁺ATPase (Sarco/Endoplasmic Reticulum Ca)²⁺ATPase, SERCA) to ER Ca²⁺And (4) exhausting.

2-deoxyglucose

A23187(CAS number 52665-69-7)

Bortezomib (bortezomib) (Velcade)

Quercetin (quercetin)

Agents that disrupt lipid balance in cells such that UPR is induced, such as saturated fatty acids (e.g. palmitic acid) -i.e. those that induce lipid-induced ER stress/UPR.

Such UPR-inducing chemical agents may be administered at suitable concentrations, and such concentrations can be readily determined by one skilled in the art through routine experimentation and reference to the literature. Suitable administration concentrations of the various agents are as follows: DTT 2 mM; tunicamycin 2.5 to 5 mug/ml; brefeldin A0.5 μ g/ml; thapsigargin 0.1-1 μ M; 4mM of 2-deoxyglucose; a23187(CAS No. 52665-69-7) 0.5. mu.M; bortezomib (Velcade)5 to 30 nM; and palmitic acid (or other fatty acids) 100 μ M. These concentrations refer to the concentration of the agent in the medium to which the cells are exposed.

Another UPR-inducing chemical agent useful in the present invention is forskolin (forskolin). Forskolin (coleonol) is a labdane diterpene (labdane diterpene) produced by the plant coleus humilis (Plectranthus barbatus). Other names for forskolin include pashanabheidi, coleus borealis, makandi, HL-362, and NKH 477.

Dithiothreitol (DTT), tunicamycin and thapsigargin are widely used in the literature to induce UPR and therefore represent preferred UPR-inducing chemical agents in some embodiments of the present invention. Forskolin is another preferred UPR-inducing chemical agent, particularly but not exclusively for its safety in use in vivo.

In a particularly preferred embodiment of the invention, a UPR-inducing chemical agent capable of disrupting lipid balance in the cells is administered to induce UPR. The role of lipids and lipid metabolism in the induction of UPR has been widely reported in the literature and is a phenomenon known as "lipid-induced ER stress/UPR". See, e.g., Iwao and Shidoj, PLOS ONE | DOI: 10.1371/journal. bone.0132761 July 17, 2015; robblee et al, "proven Fatty acids Engag an IRE1a-Dependent Pathway to active the NLRP3 Inflummasome in Myeloid Cells" -Cell Reports 14, 2611-2623, March 22, 2016; ariyama et al, "crack in membrane phosphor doped adsorption indexes" -THEJOURNAL OF BIOLOGICAL CHEMISTRY VOL.285, NO.29, pp.22027-22035, July 16, 2010; basseri and Austin "endogenous diagnostic protocol and Lipid Metabolism: mechanism and Therapeutic patent "-Biochemistry Research International Volume 2012, Article ID 841362, page 13, doi: 10.1155/2012/841362; kitai et al, "Membrane ligation activities IRE1a with out inducing clustering" -Genes to Cells (2013)18, 798-. Thus, suitably, the UPR-inducing chemical agent is capable of altering the lipid balance of the cell in such a way that UPR is induced. There is a wide range of reagents that can achieve this. For example, it has been shown that disruption of lipid balance in cells in such a way as to increase lipid saturation levels (and thus reduce desaturated lipid levels) results in induction of UPR. Thus, suitably, a UPR-inducing chemical agent is capable of altering the lipid balance of a cell in such a way as to increase the level of lipid saturation.

Preferably, the UPR inducing chemical agent is capable of altering the ratio of saturated fatty acids to unsaturated fatty acids in the cell membrane, thereby increasing the proportion of saturated fatty acids. This can be achieved in several ways, for example by introducing saturated fatty acids into the cell or inhibiting the activity of enzymes that convert saturated fatty acids to unsaturated fatty acids.

Thus, in a particularly preferred embodiment, the UPR inducing chemical agent comprises a saturated fatty acid, suitably a medium or long chain saturated fatty acid. In certain embodiments of the invention, the aliphatic chain length of the fatty acid is from 6 to 26 carbons, more preferably from 9 to 22 carbons, more preferably from 12 to 20 carbons, more preferably from 14 to 20 carbons.

Suitably, the UPR-inducing chemical agent comprises at least one fatty acid selected from the group consisting of: caproic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, lauric acid, tridecanoic acid, myristic acid, pentadecanoic acid, palmitic acid, heptadecanoic acid, stearic acid, nonadecanoic acid, eicosanoic acid, heneicosanoic acid, docosanoic acid, tricosanoic acid, tetracosanoic acid, pentacosanoic acid, and hexacosanoic acid. More preferably, the UPR inducing chemical agent comprises at least one fatty acid selected from the group consisting of: pelargonic, capric, undecanoic, lauric, tridecanoic, myristic, pentadecanoic, palmitic, margaric, stearic, nonadecanoic, eicosanoic, heneicosanoic and docosanoic acids. More preferably, the UPR inducing chemical agent comprises at least one fatty acid selected from the group consisting of: lauric acid, tridecanoic acid, myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, nonadecanoic acid, and eicosanoic acid. More preferably, the UPR inducing chemical agent comprises at least one fatty acid selected from the group consisting of: myristic acid, pentadecyl acid, palmitic acid, margaric acid, stearic acid, nonadecanoic acid and eicosanoic acid.

In a particularly preferred embodiment, the UPR-inducing chemical agent comprises palmitic acid or stearic acid.

It should be noted that where fatty acids are mentioned, they may be provided in any suitable form, for example as salts (palmitates, stearates, etc.).

In another preferred embodiment, the UPR-inducing chemical agent comprises an agent capable of down-regulating stearoyl-coa desaturase activity in a cell. Stearoyl-coa desaturase is an ER marker enzyme (residual enzyme) that can introduce double bonds in saturated fatty acids. For example, the UPR-inducing chemical agent suitably comprises an inhibitor of stearoyl-coa desaturase. MF-43 is an example of a suitable inhibitor of stearoyl-CoA desaturase. Alternatively, the chemical agent that induces UPR may be capable of downregulating expression of stearoyl-coa desaturase, for example, by knocking stearoyl-coa desaturase expression down (e.g., via RNA interference), or knocking out the stearoyl-coa desaturase gene. Other genes involved in fatty acid desaturation can also be targeted.

Other exemplary UPR-inducing chemical agents include geranylgeranic acid (GGA), 2, 3-dihydrogga, 9-cis retinoic acid, and all-trans retinoic acid (see-Chieko Iwao and yoshihiro shidoj, PLOS ONE | DOI: 10.1371/joural. po. 0132761 July 17, 2015).

Combinations of several UPR-inducing chemical agents may be used in some embodiments of the invention. For example, a saturated fatty acid (e.g., palmitic acid) may be used in combination with an agent (e.g., MF-43) that is capable of downregulating stearoyl-CoA desaturase activity.

In another embodiment of the invention, inducing a UPR in step b) suitably comprises expressing an inducer protein in said population of eukaryotic cells, thereby inducing a UPR response in the population of cells. Such proteins are referred to as "inducer proteins" because they typically act by generating ER stress to induce a UPR response when expressed in a population of cells. The inducer protein is typically a different protein to that encoded by the synthetic nucleic acid expression construct according to the first aspect of the invention. The inducer protein is suitably a heterologous protein, but in some embodiments it may be an overexpressed homologous protein. Importantly, expression of the inducer protein in the cell induces UPR, which results in the regulated splicing of introns. There are many ways to achieve expression of the inducer protein in a population of cells. In some suitable embodiments, the population of cells is transfected with an expression vector suitable for expressing the inducer protein in the cells. In one embodiment, cells can be infected with a virus, which results in the induction of ER stress and UPR-induced expression of viral proteins. Recombinant viral vectors encoding viral or non-viral proteins may also be used, an example of which is described below, in which AAV is expressed in a cell to induce UPR. This forms a preferred embodiment of the invention. Alternatively, essentially any other form of expression vector (e.g., a plasmid) can be introduced into a cell to express a heterologous protein. Suitable methods for transfecting cells with suitable expression vectors are well known in the art. The nature of the inducer protein is generally not of particular interest, although it is generally preferred that the protein be non-toxic. Conversely, heterologous protein production is important in the stress of ER produced in cells.

In some embodiments, step b) comprises transfecting the population of cells with an expression vector capable of expressing an inducer protein, preferably a heterologous protein, in the cells. Alternatively, step b) may comprise inducing expression of the inducer protein from an expression vector previously introduced (e.g. prior to step a) into the cell.

Expression of the inducer protein may be under the control of a constitutive or non-constitutive promoter. An exemplary non-constitutive promoter is an inducible promoter (in which case the inducible promoter will not be a UPR-inducible promoter).

Other methods of inducing an unfolded protein response include exposing the cell to hypoxia or carbohydrate (e.g., glucose) deprivation.

As mentioned above, this method can be performed with any type of eukaryotic cell, given the ubiquitous presence of IRE 1-mediated intron splicing throughout eukaryotes. Thus, the method can be performed, for example, in fungal cells (e.g., yeast cells), animal (metazoan) cells (e.g., mammalian cells), and plant cells.

In certain preferred embodiments, the population of eukaryotic cells is a population of animal (metazoan) cells. Suitably, the animal cell may be a cell from an invertebrate or a vertebrate.

In some preferred embodiments, the population of eukaryotic cells is a population of mammalian cells. A wide range of mammalian cells can be used, including but not limited to Chinese Hamster Ovary (CHO) cells, Human Embryonic Kidney (HEK) cells (e.g., HEK-293), human embryonic retina cells, human amniotic fluid cells, mouse myeloma lymphoblastoid cells. In such embodiments, it may be preferred that the regulatable intron is an intron which comprises the sequence CNG/CNG [ CG ], at one, the other or both (preferably both) ends of the intron, i.e. the mammalian splice target consensus sequence. Suitably, for example, the regulatable intron has a sequence

In other embodiments, the population of eukaryotic cells is a population of insect cells. Suitable insect cells for use in the methods include baculovirus-infected cells and uninfected cells, such as cells from the following insect species: spodoptera frugiperda (Spodoptera frugiperda) (e.g., Sf9 or Sf21), Trichoplusia ni (e.g., Hi-5), Drosophila melanogaster (e.g., Schneider 2 cells and Schneider 3 cells).

In other embodiments of the invention, the population of eukaryotic cells is suitably a population of fungal cells, preferably yeast cells. Suitable fungal cells for use in the present method include, but are not limited to, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus spp, Trichoderma spp, and Myceliophthora thermophila.

In other embodiments of the invention, the population of eukaryotic cells is suitably a population of plant cells or a population of plant protoplasts.

In other embodiments of the invention, the population of eukaryotic cells is suitably a population of protozoan cells, such as Leishmania tarentolae (Leishmania tarentolae).

Step d), i.e.isolation of the expression product from the cell population, may be carried out using conventional techniques well known in the art. Of course, these techniques will vary depending on the nature of the expression product.

The method may suitably comprise the step of introducing the nucleic acid expression construct into a cell. There are many well-known methods of transfecting eukaryotic cells, and the skilled person can readily select a suitable method for any cell type. The nucleic acid expression construct may of course be provided in any suitable vector.

In another aspect, the invention provides a nucleic acid expression construct, vector, cell or pharmaceutical composition according to aspects of the invention for use in a method of treatment or therapy.

As used herein, the term "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Beneficial or desired clinical results include, but are not limited to, prevention of an undesired clinical state or disease, reduction in the incidence of disease, alleviation of symptoms associated with disease, diminishment of extent of disease, stabilization (i.e., not worsening) of the disease state, delay or slowing of disease progression, amelioration or palliation of the disease state, detectable or undetectable remission (whether partial or total), or combinations thereof. "treatment" also means an extended survival time as compared to the expected survival time without treatment.

As used herein, the term "therapeutic treatment" or "treatment" or the like refers to the purpose of: bringing the subject's body or part thereof (element) from an undesirable physiological change or disorder to a desired state, such as a less severe or less unpleasant state (e.g., improved or alleviated), or to its normal healthy state (e.g., restoration of the subject's health, physical integrity and physical well-being); such that it retains the undesired physiological change or disorder (e.g., is stable or does not worsen); or prevent or slow its progression to a more severe or worse state than the undesired physiological change or disorder.

As used herein, the terms "preventing," "prophylactic treatment," or "prophylactic treatment" and the like include preventing the onset of a disease or disorder, including reducing the severity or symptoms of the disease or disorder with which it is associated prior to contracting the disease or disorder. Such prevention or reduction prior to disease refers to administration of a nucleic acid expression construct, vector, or pharmaceutical composition described herein to a patient who does not have symptoms of an apparent disease or disorder at the time of administration. "prevention" also includes prevention of recurrence or relapse prevention of a disease or disorder, e.g., after a period of improvement. In some embodiments, the nucleic acid expression constructs, vectors, or pharmaceutical compositions described herein can be used for gene therapy.

The invention also provides the use of a nucleic acid expression construct, vector or pharmaceutical composition as described herein for the manufacture of a medicament for gene therapy.

Also disclosed herein are methods for gene therapy in a subject in need of said gene therapy comprising:

-introducing into the subject a gene therapy vector comprising a pharmaceutical composition comprising a nucleic acid expression construct of the invention comprising a sequence encoding a therapeutic expression product such that the gene therapy vector delivers the nucleic acid expression construct to a target cell of the subject; and

-expressing a therapeutically effective amount of a functional therapeutic expression product in a target cell of a subject.

It is clear that expression of a therapeutically effective amount of a functional therapeutic expression product occurs only when the expression product is expressed in a cell in which the UPR is active. In many cases, the UPR will be active in cells that are under stress, such as cancer cells or cells infected with a pathogen, such as a virus. Thus, one advantage of the present invention is that expression of a functional therapeutic product (which may be, for example, a toxic protein or other cytotoxic agent) occurs only in cells where the UPR is active. This may be useful to mitigate or avoid undesired off-target expression of functional therapeutic expression products.

Thus, in various aspects of the invention involving treatment, preferably, the condition to be treated is cancer or an infection (e.g., a viral infection).

Alternatively, UPR can be induced in a cell using a suitable UPR inducing agent. Various UPR inducing agents are discussed above, and suitable UPR inducing agents include pharmaceutically acceptable agents that induce UPR (e.g., Bortezomib (Bortezomib), forskolin) and agents that interfere with lipid balance in cells to induce UPR (e.g., the saturated fatty acids discussed above). The UPR inducing agent may be delivered directly to the target site (e.g., by injection) or administered systemically.

The therapeutic expression product may be a polypeptide/protein, e.g. a secretable protein or peptide, such as e.g. a blood coagulation factor (e.g. factor VII I or factor IX), insulin, erythropoietin, lipoprotein lipase, antibody or nanobody, growth factor, cytokine, chemokine, plasma factor, toxic protein, etc. Alternatively, the therapeutic expression product may be an RNA, such as an siRNA or miRNA.

In some preferred embodiments, the therapeutic expression product may be toxic to cells into which the gene therapy vector has been introduced. In such embodiments, induction of UPR may be used to induce toxicity in the cell, e.g., leading to cell death. Thus, induction of UPR and subsequent expression of the therapeutic expression product can be used to induce a switch of life and death in the cell. Suitable toxic expression products, such as proteins, are well known in the art and may be mentioned, for example, caspase 3, caspase 8 and caspase 9.

Suitable gene therapy vectors for use in this aspect of the invention are discussed above.

Gene therapy protocols have been widely described in the art. These include, but are not limited to: intramuscular injection of a suitable carrier; hydrodynamic gene delivery in a variety of tissues including muscle; injecting into the interstitium; instillation in the airway; applied to the endothelium and intrahepatic parenchyma; intravenous or intra-arterial administration. Various devices have been developed to enhance the availability of DNA to target cells. One simple method is to physically contact the target cells with a catheter or implantable material containing DNA. Another approach is to use a needleless jet injection device that projects a column of liquid under high pressure directly into the target tissue. These delivery paradigms may also be used for delivery vehicles. Another approach to targeted gene delivery is the use of molecular conjugates consisting of a protein or synthetic ligand to which a nucleic acid binding agent or DNA binding agent has been attached for specific targeting of nucleic acids to cells (Cristiano et al, 1993).

The terms "subject" and "patient" are used interchangeably herein and refer to an animal, preferably a vertebrate, more preferably a mammal, and specifically includes human patients and non-human mammals. "mammalian" subjects include, but are not limited to, humans. Preferred patients or subjects are human subjects.

As used herein, "therapeutic amount" or "therapeutically effective amount" refers to an amount of an expression product effective to treat a disease or disorder in a subject, i.e., to obtain a desired local or systemic effect. Thus, the term refers to the amount of an expression product that elicits the biological or medical response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. Such amounts will generally depend on the gene product and the severity of the disease, but can be determined by the skilled person, possibly by routine experimentation.

The expression level of an expression product (e.g., a protein) can be measured by a variety of conventional means, such as by antibody-based assays, such as by Western blot or ELISA analysis, for example, to assess whether therapeutic expression of the expression product is achieved. Expression of the expression product can also be measured in a bioassay that detects the enzymatic or biological activity of the gene product.

In another aspect, the present invention provides a synthetic UPR inducible promoter comprising a synthetic UPR responsive cis regulatory element. Suitably, the UPR-responsive cis regulatory element comprises at least one binding site for: ATF6, XBP1, or bZIP60, which drive gene expression as part of a UPR, or a homologous or otherwise equivalent transcription factor.

Such promoters can be used to selectively drive expression of a desired expression product in eukaryotic cells following UPR induction. While it may be advantageous to use such a promoter in combination with the regulatable intron discussed above for tight control of gene expression, in other cases a UPR inducible promoter may be used without the regulatable intron.

A UPR-responsive cis regulatory element is a sequence that comprises a functional Transcription Factor Binding Site (TFBS) for one or more transcription factors that drive gene expression as part of the UPR. As noted above, these include, but are not limited to, ATF6, XBP1, and bZIP 60. UPR responsive cis regulatory elements comprising TFBS against ATF6 are of particular interest in the present invention. Preferably, the UPR-responsive cis regulatory element is UPR-specific, i.e., it enhances expression only during UPR. For example, it is generally preferred that for a transcription factor not involved in UPR, it does not contain any TFBS.

Synthetic UPR inducible promoters typically comprise at least one synthetic UPR responsive cis regulatory element operably linked to a minimal promoter or a proximal promoter. When the cis regulatory element is operably linked to a proximal promoter, the proximal promoter should itself be a UPR-inducible promoter, which when UPR is not induced does not drive transcription of the operably linked gene in eukaryotic cells. Minimal promoters are generally incapable of driving expression without other regulatory elements. Some examples of suitable minimal promoters for use in the present invention include, but are not limited to, the CMV minimal (SEQ ID NO: 21) promoter and the MinTk minimal promoter. Other suitable minimal promoters are known in the art.

Suitably, the UPR-inducible promoter comprises a UPR-responsive cis regulatory element comprising one or more copies of at least one of the following transcription factor target sequences:

TGACGTG (ATF6 transcription factor binding site consensus sequence),

TGACGTGCT (variants of the above)

-TGACGTG [ TG ] (called UPRE site),

-CCAAT-N9-CCACG (designated ERSE1 site) (SEQ ID NO: 18), and

ATTGG-N-CCACG (designated ERSE2 site) (SEQ ID NO: 19).

Suitably, the synthetic UPR responsive cis regulatory element comprises two or more copies, preferably three or more copies, suitably five or more copies of at least one transcription factor target sequence listed above. Alternatively or additionally, the synthetic UPR-responsive cis regulatory element suitably comprises one or more copies of at least two transcription factor target sequences listed above.

The transcription factor target sequences may be directly adjacent to each other (tandem repeats) or may be separated, for example, by a spacer sequence or another functional sequence (e.g., another transcription factor target sequence). Typically, the spacer sequence (if present) is 5 to 50 nucleotides in length, but in some cases may be longer or shorter. For example, the spacer sequence is suitably 2 to 50 nucleotides in length, suitably 4 to 30 nucleotides in length, or suitably 5 to 20 nucleotides in length. It may preferably be a multiple of 5 nucleotides in length, as this provides an integer number of half-turns of the DNA duplex (a complete turn corresponds to about 10 nucleotides in chromatin). A spacer sequence that is a multiple of 10 nucleotides in length may be more preferred because it provides an integer number of complete turns of the DNA duplex. The spacer sequence can have essentially any sequence so long as it does not prevent the UPR responsive cis regulatory element from functioning as desired (e.g., it comprises a silencer sequence, prevents binding of a desired transcription factor, etc.). The spacer sequences between each transcription factor target sequence may be the same or they may be different.

In a preferred embodiment, the UPR-responsive cis regulatory element comprises one or more copies of the transcription factor target sequence TGACGTG (i.e., ATF6 consensus sequence), preferably 3 or more copies of the transcription factor target sequence TGACGTG, preferably 5 or more copies of the transcription factor target sequence TGACGTG, for example 6 or more copies of the transcription factor target sequence TGACGTG. As mentioned above, these transcription factor target sequences may be repeated in tandem or may be spaced apart from each other. Generally, it is preferred that at least two, and preferably all, of the transcription factor target sequences present in the UPR-responsive cis regulatory element are spaced from each other, e.g., by a spacer sequence as discussed above.

Suitably, the UPR-responsive cis regulatory element comprises one or more copies of the transcription factor target sequence TGACGTGCT, preferably 3 or more copies of the transcription factor target sequence TGACGTGCT, preferably 5 or more copies of the transcription factor target sequence TGACGTGCT, for example 6 or more copies of the transcription factor target sequence TGACGTGCT. As mentioned above, they may be repeated in series or may be spaced apart from each other. Generally, it is preferred that at least two, and preferably all, of the transcription factor target sequences present in the UPR-responsive cis regulatory element are spaced from each other, e.g., by a spacer sequence as discussed above. The transcription factor target sequence TGACGTGCT was found to be particularly effective when used as multiple copies in UPR response cis regulatory elements, whether as tandem repeats or including spacer sequences.

In some embodiments of the invention, the UPR responsive cis regulatory element comprises a sequence

Wherein S represents an optional spacer sequence as defined above. Preferably, a spacer as defined above is present between at least two and preferably all transcription factor target sequences (TGACGTG).

In some embodiments of the invention, the UPR responsive cis regulatory element comprises a sequence

In other embodiments of the invention, the UPR-responsive cis regulatory element comprises a sequence

Wherein S represents an optional spacer sequence as defined above. Preferably, a spacer sequence as defined above is present between at least two, preferably all, transcription factor target sequences.

In other embodiments of the invention, the UPR-responsive cis regulatory element comprises a sequence

Or a sequence which is at least 50% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 85%, 90%, 95%, 98% or 99% identical thereto. It is highly preferred that sequence variations occur only in sequences that are not the transcription factor target sequence (i.e., those having sequence TGACGTGCT). It is generally preferred that sequence variations occur only in the spacer sequence (i.e., those having the sequence GATGATGCGTAGCTAGTAGT (SEQ ID NO: 61)).

In some embodiments of the invention, a UPR-inducible promoter comprises the following sequence

Or a sequence which is at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 90% identical thereto, more preferably at least 95%, 96%, 97%, 98% or 99% identical thereto. The UPR inducible promoter comprises the nucleotide sequence of SEQ ID NO: 20, UPR-responsive cis regulatory element. It is highly preferred that sequence variations occur only in sequences that are not transcription factor target sequences (i.e., those having sequence TGACGTGCT), nor in CMV-MP sequences.

In other embodiments of the invention the UPR inducible promoter comprises the following sequence:

or a sequence which is at least 50% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 85%, 90%, 995%, 98% or 99% identical thereto. The UPR inducible promoter comprises the nucleotide sequence of SEQ ID NO: 56, UPR-responsive cis regulatory element. It is highly preferred that sequence variations occur only in sequences that are not transcription factor target sequences (i.e., those having sequence TGACGTGCT), nor in CMV-MP sequences. It is generally preferred that sequence variations occur only in the spacer sequence (i.e., those having the sequence GATGATGCGTAGCTAGTAGT (SEQ ID NO: 61)).

In other embodiments of the invention, a UPR-inducible promoter comprises the following sequence:

or a sequence which is at least 50% identical thereto, more preferably at least 70% identical thereto, more preferably at least 80% identical thereto, more preferably at least 85%, 90%, 995%, 98% or 99% identical thereto. The UPR inducible promoter comprises the amino acid sequence of SEQ ID NO: 56 is responsive to cis regulatory elements. It is highly preferred that sequence variations occur only in sequences that are not the transcription factor target sequence (i.e., those having sequence TGACGTGCT) and not in the MinTK sequence. It is generally preferred that sequence variations occur only in the spacer sequence (i.e., those having the sequence GATGATGCGTAGCTAGTAGT (SEQ ID NO: 61)).

In the absence of a UPR, a UPR-inducible promoter preferably does not drive transcription of an operably linked gene when present in a eukaryotic cell. When UPR occurs in eukaryotic cells, UPR-inducible promoters drive the transcription of an operably linked gene when present in eukaryotic cells. The skilled artisan can readily assess the ability of a UPR-inducible promoter to selectively drive transcription upon induction of a UPR using a wide range of methods, and these methods can be tailored to the particular expression system in which the construct is intended to be used. As a preferred example, the method described in the following embodiment (e.g., embodiment 8) can be used. For example, any candidate UPR-inducible promoter to be evaluated may be replaced with the construct described in example 8 in place of the exemplary UPR-inducible promoter containing ATF6 used in example 8, and the ability of the candidate UPR-inducible promoter to selectively drive transcription upon induction of UPR may be measured by evaluating the level of luciferase expression before and after induction of UPR by 2mM DTT, exactly the same as that performed in example 8. A UPR-inducible promoter is a promoter that is capable of successfully inducing transcription of an operably linked gene (in the case of example 8, the luciferase gene) following induction of UPR to significantly increase, resulting in expression of the gene. Preferably, a UPR inducible promoter increases expression at least 5-fold, more preferably at least 10-fold, more preferably at least 100-fold, more preferably at least 1000-fold, 24 hours after induction of UPR with 2mM DTT. Preferably, the expression level of a gene (e.g., luciferase) is minimal, and preferably negligible, prior to induction of UPR. Minimal expression can be defined as, for example, an expression level equal to or less than the negative control construct used in example 8 (i.e., a construct without wherein expression of the luciferase-encoding sequence is driven solely by CMV-MP), preferably less than 50%, preferably less than 20%, more preferably less than 10%, more preferably less than 5%, more preferably less than 1% of the expression level of the negative control construct. A negligible expression level is, for example, an expression level that is substantially undetectable using the method of example 8.

The invention also provides an expression construct or vector comprising a synthetic UPR inducible promoter as described above operably linked to a nucleic acid sequence encoding an expression product. The expression construct or vector may be any expression construct or vector as discussed above for other aspects of the invention. The expression product may be any expression product (e.g., encoding a protein) as discussed above for other aspects of the invention.

In some preferred embodiments, the expression product is not a reporter protein, i.e., it does not encode a protein that is conventionally used as an indicator of expression level. Many reporter genes are known in the art, including, inter alia, fluorescent, luminescent and chromogenic proteins. Thus, in some preferred embodiments, the expression product is not a fluorescent or luminescent protein, e.g., it is not a luciferase. As mentioned above, preferred expression products include therapeutic proteins and toxic proteins.

In another aspect, the present invention provides a method for producing an expression product, the method comprising:

a) providing a population of eukaryotic cells comprising a synthetic nucleic acid expression construct comprising a UPR-inducible promoter operably linked to a nucleic acid sequence encoding an expression product according to the invention;

b) treating the population of cells to induce an unfolded protein response, thereby inducing transcription from the UPR-inducible promoter;

c) incubating the population of cells under suitable conditions to produce an expression product; and

d) isolating the expression product from the cell population.

Other optional and preferred features of the methods for producing expression products are discussed above in relation to other aspects of the invention and are applicable to the invention mutatis mutandis. Preferably the expression product is a therapeutic or toxic protein. Preferably, the expression product is not a reporter protein

Thus, another aspect of the invention provides a pharmaceutical composition comprising a nucleic acid expression construct or vector comprising a UPR-inducible promoter operably linked to a nucleic acid sequence encoding an expression product according to the invention. Other optional and preferred features of the pharmaceutical composition are discussed above in relation to other aspects of the invention and are applicable to the invention mutatis mutandis.

In another aspect of the invention, there is provided the use of a nucleic acid expression construct and a vector comprising a UPR inducible promoter operably linked to a nucleic acid sequence encoding an expression product according to the invention for the preparation of a pharmaceutical composition.

According to another aspect of the invention, there is provided a cell comprising a synthetic nucleic acid expression construct or vector comprising a UPR inducible promoter according to the invention. Other optional and preferred features of such cells are discussed above in relation to other aspects of the invention and are applicable to the invention mutatis mutandis.

In another aspect, the invention provides a nucleic acid expression construct, vector, cell or pharmaceutical composition comprising a UPR-inducible promoter according to the invention for use in a method of treatment or therapy. Other optional and preferred features of this method are discussed above with respect to other aspects of the invention, and these features are applicable to the invention mutatis mutandis.

To facilitate an understanding of the present invention, a number of terms are defined below. The terms defined herein have meanings as commonly understood by one of ordinary skill in the art to which this invention pertains. The terms used herein are used to describe specific embodiments of the invention, but their use is not to be construed as limiting the invention unless otherwise set forth in the claims.

The discussion of the background to the invention is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known or part of the common general knowledge in any country as of the priority date of any claim.

Throughout this disclosure, various publications, patents, and published patent specifications are cited by identifying citations. All documents cited in this specification are herein incorporated by reference in their entirety. In particular, the teachings or portions of such documents specifically mentioned herein are incorporated by reference.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. This technique is explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and son Inc, Library of Congress, USA); molecular Cloning: ALaborory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); oligonucleotide Synthesis (m.j. gate ed., 1984); U.S. Pat. No.4,683,195; nucleic Acid Hybridization (Harries and higgins.1984); transformation and transformation (Hames and Higgins eds. 1984); culture of animal Cells (Freshney, Alan r. loss, inc., 1987); immobilized Cells and Enzymes (IRL Press, 1986); perbal, A Practical Guide to Molecular Cloning (1984); the series, Methods in Enzymology (Abelson and Simon, eds. -in-coef, Academic Press, Inc., New York), speciality, Vols.154 and 155(Wu et al eds.), and Vol.185, "Gene expression technology" (Goeddel, ed.); gene Transfer Vectors For Mammalian Cells (Miller and Calos eds., 1987, Cold Spring Harbor Laboratory); immunochemical Methods in cellular Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); handbook of Experimental Immunology, Vols.I-IV (Weir and Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

Nouns without quantitative modification are used to refer to "one or more".

As used herein, the term "comprising" or variants thereof is synonymous with "including" or variants thereof or "containing" or variants thereof, and is inclusive or open-ended and does not exclude additional, non-recited features, elements or method steps.

Recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective range, as well as the recited endpoint.

The term "nucleic acid" as used herein generally refers to an oligomer or polymer (preferably a linear polymer) of any length consisting essentially of nucleotides. The nucleotide unit typically includes a heterocyclic base, a sugar group, and at least one (e.g., one, two, or three) phosphate group, including modified or substituted phosphate groups. Heterocyclic bases may include, inter alia, purine and pyrimidine bases, such as adenine (a), guanine (G), cytosine (C), thymine (T) and uracil (U), which are widely found in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine) and chemically or biochemically modified (e.g., methylated), non-natural or derivatized bases. The sugar groups may in particular comprise pentose (pentofuranose) groups, such as ribose and/or 2-deoxyribose, or arabinose, 2-deoxyarabinose, threose or hexose sugar groups, as well as modified or substituted sugar groups, which are preferably common in naturally occurring nucleic acids. As contemplated herein, a nucleic acid may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. The modified nucleotide can include a modified heterocyclic base, a modified sugar moiety, a modified phosphate group, or a combination thereof. Modifications to phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or other useful properties. The term "nucleic acid" also preferably encompasses DNA, RNA and DNARNA hybrid molecules, including specifically hnRNA, pre-mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA or DNA RNA hybrids. The nucleic acid may be naturally occurring, e.g., occurring in nature or isolated from nature; or may be non-naturally occurring, e.g., recombinant, i.e., produced by recombinant DNA techniques, and/or partially or wholly synthesized chemically or biochemically. A "nucleic acid" may be double-stranded, partially double-stranded, or single-stranded. In the case of single strands, the nucleic acid may be the sense strand or the antisense strand. In addition, the nucleic acid may be circular or linear.

As used herein, "nucleic acid expression construct" refers to a nucleic acid molecule comprising one or more transcriptional control elements (such as, but not limited to, promoters, enhancers and/or regulatory elements, polyadenylation sequences, and introns) that direct expression in one or more desired cell types, tissues, or organs. The nucleic acid expression constructs of the invention are synthetic nucleic acid molecules.

In the present application, "synthetic" means a nucleic acid molecule that does not occur in nature. The synthetic nucleic acid expression constructs of the invention are typically produced artificially by recombinant techniques. Such synthetic nucleic acids may comprise naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but they are present in a non-naturally occurring context. For example, a synthetic gene (or portion of a gene) typically comprises one or more nucleic acid sequences that are not substantially contiguous (chimeric sequences), and/or may include substitutions, insertions, and deletions, and combinations thereof.

As used herein, the term "operably linked" or equivalent means an arrangement of various nucleic acid elements relative to one another such that the elements are functionally associated and capable of interacting with one another in the intended manner. Such elements may include, but are not limited to, promoters, enhancers and/or regulatory elements, polyadenylation sequences, one or more introns and/or exons, and coding sequences of the gene of interest to be expressed. The nucleic acid sequence elements function together to modulate the activity of each other when properly oriented or operably linked, and can ultimately affect the expression level of the expression product. Modulation means increasing, decreasing or maintaining the activity level of a particular element. The position of each element relative to other elements can be represented by the 5 'end and 3' end of each element, and the distance between any particular element can be referenced by the number of intervening nucleotides or base pairs between the elements. As understood by those skilled in the art, operably linked means functionally active and is not necessarily linked to a natural position. Indeed, when used in a nucleic acid expression module, the cis-regulatory element will generally be located immediately upstream of the promoter (although this is generally the case, it should never be construed as limiting or excluding positions within the nucleic acid expression module), although this is not necessarily the case in vivo. For example, regulatory element sequences naturally present downstream of a gene, the transcription of which is affected by said sequences, can function in the same way when located upstream of a promoter. Thus, according to a specific embodiment, the adjustment or enhancement of the adjustment element is position-independent.

"consensus sequence" -the meaning of consensus sequences is well known in the art. In the present application, the following symbols are used for consensus sequences, unless the context indicates otherwise. Consider the following exemplary DNA sequences:

A[CT]N{A}YR

a means that A is always found at this position; [ CT ] represents C or T at the position; n represents any base at that position; { A } means that any base other than A is found at this position. Y represents any pyrimidine and R represents any purine.

Unless the context indicates otherwise, a "regulatable intron" in the present application refers to a nucleic acid sequence present in an RNA molecule (typically a transcript) that comprises a excisable sequence flanked by target sites for a ribonuclease (typically IRE1 or a homolog or ortholog), wherein the excisable sequence is excisable from the RNA molecule by the action of the ribonuclease as a result of an unfolded protein reaction. In certain circumstances in the art, the term intron is used only to refer to sequences that are excised (i.e., spliced out) from an RNA molecule, but is less suitable in the case of the regulatable intron of the present invention.

The terms "identity" and "identical" and the like refer to sequence similarity between two polymer molecules, e.g., between two nucleic acid molecules (e.g., two DNA molecules). Sequence alignment and determination of sequence identity can be accomplished, for example, using the Basic Local Alignment Search Tool (BLAST) described initially by Altschul et al 1990(J Mol Biol 215: 403-10), such as the "BLAST 2 sequence" algorithm described by Tatusova and Madden 1999(FEMS Microbiol Lett 174: 247-250).

Methods of sequence alignment for comparison are well known in the art. Various programs and alignment algorithms are described, for example, in the following: smith and Waterman (1981) adv.appl.math.2: 482; needleman and Wunsch (1970) J.mol.biol.48: 443; pearson and Lipman (1988) proc.natl.acad.sci.u.s.a.85: 2444; higgins and Sharp (1988) Gene 73: 237-44; higgins and Sharp (1989) cabaos 5: 151-3; corpet et al (1988) Nucleic Acids Res.16: 10881-90; huang et al (1992) Comp.appl.biosci.8: 155-65 parts; pearson et al (1994) Methods mol. biol. 24: 307-31; tatiana et al (1999) FEMSMiicrobiol. Lett.174: 247-50. Detailed considerations for sequence alignment methods and homology calculations can be found, for example, in Altschul et al (1990) j.mol.biol.215: 403-10.

National Center for Biotechnology Information (NCBI) local sequence alignment search basic tool (BLAST)^TM(ii) a Altschul et al (1990)) are available from several sources, including the national center for biotechnology information (Bethesda, MD), and on the internet, for use in conjunction with several sequence analysis programs. BLAST on the Internet^TMThe "help" section of (1) provides a description of how to determine sequence identity using this procedure. For comparison of nucleic acid sequences, BLAST may be used using default parameters^TM(Blastn) the "Blast 2 sequence" function of the program. Nucleic acid sequences having greater similarity to a reference sequence will exhibit an increased percentage of identity when evaluated by this method. Typically, the percentage of sequence identity is calculated over the entire length of the sequence.

For example, a globally optimal alignment with the following scoring parameters is suitably found by the Needleman-Wunsch algorithm: matching score: +2, mismatch score: -3; gap penalties: the vacancies are open 5 and the vacancies are extended 2. The percent identity of the resulting optimal global alignment is suitably calculated by comparing the number of aligned bases to the total length of the alignment, including both matches and mismatches, multiplied by 100.

As used herein, "cell culture" refers to a cell proliferative mass that may be in an undifferentiated or differentiated state.

As used herein, "cis-regulatory element" or "CRE" is a term known to the skilled artisan; it involves non-coding DNA regions that regulate transcription of adjacent genes (i.e., in cis). CRE typically regulates gene transcription by binding to transcription factors. CRE can be, for example, enhancer, promoter, insulator or silencing. In the present case, UPR-inducible CRE is typically an enhancer element that binds to transcription factors that act as part of the UPR to induce transcription. In this context, when CRE is provided as part of the promoter and the gene encoding the expression product, it is preferred that the UPR-inducible CRE is located 1500 nucleotides or less from the Transcription Start Site (TSS), more preferably 1000 nucleotides or less from the TSS, more preferably 500 nucleotides or less from the TSS, and suitably 250, 200, 150 or 100 nucleotides or less from the TSS.

As used herein, "complementary" or "complementarity" refers to watson-crick base pairing of two nucleic acid sequences. For example, for the sequence 5 '-AGT-3', it binds to the complementary sequence 3 '-TCA-5'. Complementarity between two nucleic acid sequences may be "partial," in which only some of the bases bind to their complementary sequence, or it may be complete when each base in the sequence binds to its complementary base. The degree of complementarity between nucleic acid strands has an important effect on the efficiency and strength of hybridization between nucleic acid strands.

As used herein, "conventional intron" refers to an intron, typically a spliceosomal intron, that is normally present in pre-mRNA, that does not encode protein synthesis information, and that is removed from the mRNA molecule prior to translation of the mRNA. The term is used to separate such introns from the non-canonical regulatory intron regions of the present invention.

"transfection" in this application refers broadly to any process by which nucleic acid is intentionally introduced into a cell, and encompasses the introduction of viral and non-viral vectors, and includes transformation, transduction, and similar terms. Examples include, but are not limited to: transfection with viral vectors; transforming with a plasmid vector; electroporation (Fromm et al (1986) Nature 319: 791-3); lipofectation (Feigner et al (1987) Proc. Natl. Acad. Sci. USA 84: 7413-7); microinjection (Mueller et al (1978) Cell 15: 579-85); agrobacterium-mediated transfer (Fraley et al (1983) Proc. Natl. Acad. Sci. USA 80: 4803-7); direct DNA uptake; whisker-mediated transformation (whisskers-mediated transformation); and the particle gun method (microprojectile Bombardment) (Klein et al (1987) Nature 327: 70).

As used herein, the phrase "transgene" refers to an exogenous nucleic acid sequence. In one example, a transgene is a gene sequence, a gene encoding an industrially or pharmaceutically useful compound or a gene encoding a desired trait. In another example, the transgene is an antisense nucleic acid sequence, wherein expression of the antisense nucleic acid sequence inhibits expression of the target nucleic acid sequence.

As used herein, the phrase "promoter" refers to a region of DNA generally upstream of a nucleic acid sequence to be transcribed, which is required for transcription to occur. A promoter allows for the appropriate activation or repression of transcription of sequences under its control. Promoters generally comprise specific sequences, such as enhancer sequences, that are recognized and bound by transcription factors. The transcription factor binds to the promoter DNA sequence, resulting in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of a gene. Many promoters are known in the art.

As used herein, "minimal promoter" refers to a short segment of DNA that is inactive by itself or mostly inactive, but can mediate strong transcription when combined with other transcription regulatory elements. The minimal promoter sequence can be derived from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters are the dopamine β -hydroxylase gene minimal promoter and Cytomegalovirus (CMV), an early gene minimal promoter (CMV-MP) and herpes thymidine kinase minimal promoter (MinTK).

"RNA transcript" or "transcript" refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When an RNA transcript is a typically perfectly complementary copy of a DNA sequence, it is referred to as a primary transcript, or may be an RNA sequence derived from post-transcriptional processing of a primary transcript, and is referred to as mature RNA.

"messenger RNA" or "(mRNA)" refers to the processed form of transcribed RNA that has no introns and can be translated into protein by a cell.

Embodiments of the invention will now be described, by way of non-limiting examples, with reference to the accompanying drawings.

Drawings

FIG. 1 shows the ratio of GFP fluorescence from SYNP-XBP-01 transfected cells before and after induction by 2mM DTT.

FIG. 2 shows the ratio of GFP fluorescence positive controls before and after induction in panel a). In panel b), fluorescence microscopy of SYNP-XBP-01 with and without 2mM DTT is shown.

FIG. 3 shows GFP expression in both plasmids after induction by 2mM DTT. The number is the ratio to CMV-IE.

FIG. 4 shows the raw data from the expression of SYNP-ATF6-01 before and after the addition of 2mM DTT.

FIG. 5 shows the raw data from the expression of SYNP-ATF6-02 before and after the addition of 2mM DTT.

FIG. 6 shows fluorescence microscopy of HEK293F cells transfected with SYNP-ATF6-01 or SYNP-ATF6-02 before and after treatment with 2mM DTT.

Fig. 7 shows EGFP fluorescence from HEK293F cells before and after induction with wtAAV. Zs Green is a recombinant AAV, producing a variant of GFP that serves AS a control, pre-AS-Green is non-transfected (i.e., blank).

Fig. 8 shows EGFP expression from HEK293F cells before and after wtAAV production.

Fig. 9 shows EGFP expression measured as a ratio relative to CMV-IE. The construct used was SYNP-ATF 6-02; it contains an intron and an ATF6 inducible promoter. HEK293F cells were transfected with Maxcyte reagent. 24 hours after transfection, the inducer was added and GFP expression was followed for the next 24 hours. Inducer concentration: DTT 2mM, palmitic acid 0.5mM, MF-431. mu.M.

FIG. 10 shows a plasmid map of pMA-RQ.

Figure 11 shows a graph of SEAP expression after induction with DTT in CHO and HEK293 cells compared to SEAP expression under the control of the CMV-IE promoter (results shown in HEK 293). (the X-axis shows hours after induction)

FIG. 12 shows a graph of luciferase expression (in hours on the X axis) after induction with DTT or palmitic acid in CHO (A) and HEK293(B) cells. For comparison, expression of luciferase under the control of the CMV-IE promoter and the CMV minimal promoter (CMV-MP) is shown.

FIG. 13 shows a plasmid map of SYNP-CAS9_ INT.

Figure 14A shows a graph of HEK293 cell viability after induction of caspase 9(CASP9) with DTT or forskolin compared to negative control and CASP9 under the control of CMV-IE promoter (X axis shows hours after induction). Figure 14B shows micrographs of the fluorescent marker Spark fused to SASP9 in cells where the expression construct did not contain a regulatable intron (left panel) and in cells where the expression construct contained a regulatable intron (right panel).

FIG. 15 shows a graph of the viability of HEK293 cells after induction of caspase 9 with DTT, compared to negative controls (HEK293 cells plus DTT) and CASP9, under the control of the CMV-IE promoter.

FIGS. 16A-D show predicted secondary structures formed when introns are used for:

A.SEAP(CAG/CAGACGGGCAACTTTACACGACGCTG/CAG)

B.EGFP(CAG/CTGGAGCACTCAGACTACGTGCACCTCTG/CTG)

C.CASP9(CAG/CAGACGGGCAACTTTACACGACGCTG/CTG)

D. luciferase (CCG/CAGACGGGCAACTTTACACGACGCTG/CAG)

FIG. 17 shows a graph of luciferase expression following induction with DDT when a UPR-responsive cis regulatory element containing a 5 × ATF6 binding site was combined with two different minimal promoters (X axis units are hours after induction). Controls were the CMV-IE promoter and the CMV minimal promoter without any other regulatory sequences.

Detailed Description