Watermelon fusion gene, genetic transformation method and application

文档序号：128427 发布日期：2021-10-22 浏览：33次中文

阅读说明：本技术 西瓜融合基因、遗传转化方法及应用 (Watermelon fusion gene, genetic transformation method and application ) 是由韩志国王伟平张海雯宋姣敏潘文波张华伟章旺根于 2021-08-05 设计创作，主要内容包括：本发明提供了一种西瓜融合基因、遗传转化方法及应用。其中,西瓜融合基因由ClGRF4基因和ClGIF1基因融合而成,该西瓜融合基因能够提高西瓜的遗传转化效率,解决了现有技术中西瓜遗传转化效率低的问题,适用于西瓜遗传转化和育种领域。(The invention provides a watermelon fusion gene, a genetic transformation method and application. The watermelon fusion gene is formed by fusing a ClGRF4 gene and a ClGIF1 gene, can improve the genetic transformation efficiency of watermelon, solves the problem of low genetic transformation efficiency of watermelon in the prior art, and is suitable for the fields of watermelon genetic transformation and breeding.)

1. The watermelon fusion gene is characterized by being formed by fusing ClGRF4 gene and ClGIF1 gene.

2. The watermelon fusion gene according to claim 1, wherein the sequence of ClGRF4 gene is shown in SEQ ID NO: 1, and the sequence of the ClGIF1 gene is shown as SEQ ID NO: 2 is shown in the specification;

preferably, said ClGRF4 gene and said ClGIF1 gene are linked via a linker sequence to form said watermelon fusion gene;

preferably, the connection sequence is: GGCAGCGGCCGC, respectively;

preferably, the sequence of the watermelon fusion gene is shown as SEQ ID NO: 4, respectively.

3. The fusion protein encoded by the watermelon fusion gene of claim 1 or 2.

4. A recombinant vector, which is characterized in that the recombinant vector comprises a watermelon growth regulatory gene and a driving element for driving the expression of the watermelon growth regulatory gene, wherein the watermelon growth regulatory gene is the watermelon fusion gene of claim 1 or 2.

5. The recombinant vector according to claim 4, wherein the driver element comprises a promoter sequence and a terminator sequence;

preferably, the promoter sequence is a promoter for gene expression of dicotyledonous plants; more preferably, the promoter sequence is derived from the UBQ10 promoter sequence of Arabidopsis thaliana or the cauliflower mosaic virus 35s promoter;

preferably, the terminator sequence is a terminator suitable for a plant gene; more preferably, the terminator sequence is selected from the HspT terminator sequence of Arabidopsis thaliana, the Nos terminator or the terminator of cauliflower mosaic virus 35 s.

6. The recombinant vector according to claim 4, wherein the recombinant vector further comprises a transformation target gene;

preferably, the recombinant vector further comprises a reporter gene of the transformation target gene and/or the watermelon fusion gene;

preferably, the reporter gene comprises a resistance gene and/or a gene encoding a fluorescent protein;

more preferably, the resistance gene is selected from any one or more of: kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene and glufosinate resistance gene;

more preferably, the gene encoding the fluorescent protein is selected from any one or more of: red fluorescent protein expression gene DsRed2, green fluorescent protein expression gene GFP, red fluorescent protein expression gene mCherry and yellow fluorescent protein expression gene YFP;

preferably, the recombinant vector is selected from any one of the following: pKSE401, pBSE401, pHSE401, and pAS 083.

7. A non-plant host cell transformed with the recombinant vector of any one of claims 4 to 6.

8. The host cell of claim 7, wherein the host cell is selected from the group consisting of E.coli strain DH5 a, Agrobacterium strain EHA105, LBA4404, AGL1, and GV 3101.

9. A genetic transformation method of watermelon, which is characterized in that the genetic transformation method comprises the following steps:

introducing the watermelon fusion gene of claim 1 or 2 into the genome of watermelon.

10. The genetic transformation method according to claim 9, wherein the watermelon fusion gene is introduced into the watermelon genome by the recombinant vector of claim 4 or 5;

preferably, a transformation target gene and the watermelon fusion gene are together introduced into the watermelon genome; or

The transformation target gene and the fusion gene are co-introduced into the watermelon genome by the recombinant vector of claim 6.

11. The genetic transformation method according to claim 10, wherein the genetic transformation method comprises any one of the following transformation methods: agrobacterium tumefaciens-mediated transformation, biolistic methods, PEG-mediated protoplast transformation, plant virus-mediated transformation, pollen tube channel methods, and ovary injection methods;

preferably, said genetic transformation using agrobacterium infection comprises:

introducing the recombinant vector into an agrobacterium tumefaciens strain to obtain a recombinant strain;

preparing the recombinant bacteria into a dip dyeing solution;

placing the watermelon explant into the dip dyeing solution for dip dyeing to obtain an infected explant;

co-culturing the infected explants to obtain co-cultured explants;

sequentially carrying out antibiotic resistance screening and fluorescence screening on the co-cultured explants to obtain positive transformants;

preferably, the agrobacterium strain is EHA 105;

preferably, the watermelon explant is selected from any one of the following: cotyledons, cotyledons nodes, immature embryos, mature embryos and protoplasts;

preferably, the antibiotic is selected from kanamycin, hygromycin or spectinomycin;

preferably, the fluorescence used for the fluorescence screening is red fluorescence or green fluorescence.

12. The genetic transformation method of claim 11, wherein subjecting the co-cultured explants to antibiotic resistance selection and fluorescence selection in sequence to obtain positive transformants comprises:

placing the co-culture explant on a resistance screening culture medium for culture to obtain resistance positive bud tissues;

placing the resistant positive bud tissue in a bud elongation culture medium to be cultured until a new bud head is regenerated, and carrying out fluorescence detection on the regenerated bud head to obtain the positive transformant;

preferably, the resistance screening culture medium is a sterile culture medium consisting of an MS solid culture medium and 6-BA, timentin and kanamycin, wherein the concentrations of the 6-BA, the timentin and the kanamycin in the resistance screening culture medium are respectively 1.5mg/L, 200mg/L and 100mg/L, and the pH is 5.8;

preferably, the bud elongation culture medium is a sterile culture medium consisting of an MS solid culture medium and KT, timentin and kanamycin, wherein the concentrations of the KT, timentin and kanamycin in the bud elongation culture medium are 0.2mg/L, 200mg/L and 100mg/L respectively, and the pH is 5.8.

13. Use of the watermelon fusion gene according to claim 1 or 2, or the recombinant vector according to any one of claims 4-6, or the genetic transformation method according to any one of claims 9-12 for genetic transformation and breeding of watermelon.

Technical Field

The invention relates to the field of watermelon genetic transformation, in particular to a watermelon fusion gene, a genetic transformation method and application.

Background

Watermelon belongs to the genus Citrullus in the family Cucurbitaceae, is an important horticultural crop and is a list of ten fruits living in the world. As the largest watermelon producing country in the world, the planting area of China is about 52.7 percent of the planting area in the world, and the yield reaches 70 percent. Because China is not the country of origin of watermelons, the problems of high homology, narrow genetic base and the like cause that the watermelons are difficult to breed by the conventional breeding means.

The genetic engineering technology is helpful to solve the problems of narrow genetic basis and lack of germplasm resources of the watermelon, and becomes an important supplementary means for conventional breeding. With the continuous development of biotechnology, the artificial operation of genetic materials by using transgenic technology and gene editing technology is widely applied to various plants, and a new method is provided for creating new germplasm.

The transgenic research of cucurbitaceous crops including watermelon is relatively slow, the bottleneck of restriction is the problem of the efficiency of genetic transformation, and the reference documents are seen in Liulifeng, ancient times, watermelon tissue culture and genetic transformation research progress. Fruit tree bulletin, 2017,34(7): 905-916.

Therefore, the method for genetic transformation of the watermelon is an effective means for promoting genetic transformation and breeding of the watermelon, and the genetic transformation efficiency is improved.

Disclosure of Invention

The invention mainly aims to provide a watermelon fusion gene, a genetic transformation method and application, so as to improve the genetic transformation efficiency of watermelon.

To achieve the above object, according to one aspect of the present application, there is provided a watermelon fusion gene, which is fused from ClGRF4 gene and ClGIF1 gene.

Further, the sequence of the ClGRF4 gene is shown as SEQ ID NO: 1, the sequence of the ClGIF1 gene is shown as SEQ ID NO: 2 is shown in the specification; preferably, the ClGRF4 gene and the ClGIF1 gene are linked via a linker sequence to form a watermelon fusion gene; preferably, the connection sequence is: GGCAGCGGCCGC, respectively; preferably, the sequence of the watermelon fusion gene is as shown in SEQ ID NO: 4, respectively.

According to a second aspect of the present application, there is provided a fusion protein encoded by the above-described watermelon fusion gene.

According to a third aspect of the present application, there is provided a recombinant vector, comprising a watermelon growth regulatory gene and a driving element for driving expression of the watermelon growth regulatory gene, wherein the watermelon growth regulatory gene is the above-mentioned watermelon fusion gene.

Further, the driving elements include promoter sequences and terminator sequences; preferably, the promoter sequence is a promoter for gene expression in dicotyledonous plants, more preferably, the promoter sequence is selected from the group consisting of the UBQ10 promoter sequence from arabidopsis thaliana, cauliflower mosaic virus 35s promoter; preferably, the terminator sequence is selected from terminators suitable for plant genes, more preferably, the terminator sequence is selected from HspT terminator sequence derived from Arabidopsis thaliana, Nos terminator or cauliflower mosaic virus 35s polyA.

Further, the recombinant vector also comprises a transformation target gene; preferably, the recombinant vector further comprises a reporter gene for transforming the target gene and/or the watermelon fusion gene; preferably, the reporter gene comprises a resistance gene and/or a gene encoding a fluorescent protein; more preferably, the resistance gene is selected from any one or more of: kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene and glufosinate resistance gene; more preferably, the gene encoding the fluorescent protein is selected from any one or more of: red fluorescent protein expression gene DsRed2, GFP gene, mCherry gene and YFP gene; preferably, the recombinant vector is selected from any one of: pKSE401, pBSE401, pHSE401, and pAS 083.

According to a fourth aspect of the present application, there is provided a non-plant host cell transformed with the above recombinant vector.

Further, the host cell is selected from the group consisting of E.coli strain DH5 α, Agrobacterium strain EHA105, LBA4404, AGL1 or GV 3101.

According to a fifth aspect of the present application, there is provided a method for genetic transformation of watermelon, which comprises introducing the above watermelon fusion gene into the genome of watermelon.

Further, the watermelon fusion gene is introduced into a watermelon genome by the recombinant vector; preferably, the transformation target gene and the watermelon fusion gene are together introduced into the watermelon genome; or the transformation target gene and the watermelon fusion gene are jointly introduced into the watermelon genome through the recombinant vector.

Further, the genetic transformation method includes any one of the following transformation methods: agrobacterium tumefaciens-mediated transformation, biolistic methods, PEG-mediated protoplast transformation, plant virus-mediated transformation, pollen tube channel methods, and ovary injection methods; preferably, the genetic transformation using the agrobacterium infection method comprises: introducing the recombinant vector into an agrobacterium tumefaciens strain to obtain a recombinant strain; preparing the recombinant bacteria into a dip dyeing solution; putting the watermelon explant into a dip dyeing solution for dip dyeing to obtain an infected explant; co-culturing the infected explants to obtain co-cultured explants; sequentially carrying out antibiotic resistance screening and fluorescence screening on the co-cultured explants to obtain positive transformants; preferably, the agrobacterium strain is EHA 105; preferably, the watermelon explant is selected from any one of the following: cotyledons, cotyledons nodes, immature embryos, mature embryos and protoplasts; preferably, the antibiotic is selected from kanamycin, hygromycin or spectinomycin; preferably, the fluorescence is red fluorescence or green fluorescence.

Further, sequentially performing antibiotic resistance screening and fluorescence screening on the co-cultured explants to obtain positive transformants comprises: placing the co-culture explant on a resistance screening culture medium for culture to obtain resistance positive bud tissues; placing the resistant positive bud tissue in a bud elongation culture medium for culturing until a new bud head is regenerated, and carrying out fluorescence detection on the regenerated bud head to obtain a positive transformant; preferably, the resistance screening culture medium is a sterile culture medium consisting of an MS solid culture medium and 6-BA, timentin and kanamycin, the concentrations of the 6-BA, timentin and kanamycin in the resistance screening culture medium are respectively 1.5mg/L, 200mg/L and 100mg/L, and the pH is 5.8; preferably, the shoot elongation medium is a sterile medium consisting of MS solid medium and KT, timentin and kanamycin at concentrations of 0.2mg/L, 200mg/L and 100mg/L, respectively, in the shoot elongation medium at pH 5.8.

According to a sixth aspect of the present application, there is provided a use of the genetic transformation method in genetic transformation and breeding of watermelon, which uses the above watermelon fusion gene, recombinant vector or genetic transformation method.

By applying the technical scheme of the invention, the fusion gene obtained by fusing the ClGRF4 and ClGIF1 genes in the watermelon is beneficial to improving the genetic transformation efficiency of the watermelon, so that the watermelon fusion gene and the agrobacterium-mediated transformation method are utilized, and the watermelon fusion gene is used for helping the transformation of the target gene to be introduced into the watermelon genome, thereby improving the genetic transformation efficiency of the watermelon.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

fig. 1 shows the evolutionary tree of the relationship between ClGRF4 and other homologous genes in example 1 of the present invention.

FIG. 2 shows the evolutionary tree of the relationship between ClGIF1 and other homologous genes in example 1 of the present invention.

FIG. 3 shows the luminescence of transgenic and non-transgenic plants under fluorescent illumination in example 3 of the present invention.

Detailed Description

It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present invention will be described in detail with reference to examples.

As mentioned in the background art, because the existing watermelon genetic transformation method has low efficiency, the research on the genetic transformation and breeding of the watermelon is limited, and in order to improve the genetic transformation efficiency of the watermelon, the inventor of the application carries out deep research on the existing watermelon genetic transformation method and provides a watermelon fusion gene which is formed by fusing ClGRF4 gene and ClGIF1 gene.

The ClGRF4 and ClGIF1 in the watermelon fusion gene are homologous genes of wheat GRF4 and GIF1 in watermelon respectively. Specifically, watermelon homologous genes ClGRF4 (gene number Cla97C02G034420, the nucleotide sequence of which is shown in SEQ ID NO: 1) and ClGIF1 (gene number Cla97C11G213520, the nucleotide sequence of which is shown in SEQ ID NO: 2) are found by searching a watermelon genome database through blastP.

After the fact that fusion of GRF4 and GIF1 genes in wheat can improve genetic transformation efficiency of wheat is reported, the inventors also tried to search related homologous genes from different species so as to improve the genetic transformation efficiency of corresponding species. As a result, it was found that although different homologous genes can be found in different species, conservation in different species is not the same based on the functions of the homologous genes, and thus it is unpredictable whether there is the same or similar effect of improving genetic transformation efficiency in the species of interest as in wheat. For example, the inventors fused the GRF4 homologous gene CsaV3_1G040860 (homology: 38%) and the GIF1 homologous gene CsaV3_2G003880 (homology: 60.9%) that have the closest clustering relationship in cucumber and examined the effect of the fused genes on the genetic transformation efficiency of cucumber, and as a result, they found that the improvement of the genetic transformation efficiency was not achieved. Similarly, the GRF4 homologous gene with the closest clustering relation in tomato and the GIF1 gene are fused for genetic transformation, and no obvious improvement effect on the genetic transformation is found.

Thus, the inventors tried to fuse the homologous genes in watermelon in this application to examine whether they could improve the genetic transformation efficiency of watermelon. Experiments prove that the fusion gene of ClGRF4 and ClGIF1 in watermelon can improve the genetic transformation efficiency of watermelon, thereby providing a series of protection schemes of the application.

In the above fusion gene of the present application, the sequence of ClGRF4 gene is as shown in SEQ ID NO: 1, the sequence of the ClGIF1 gene is shown as SEQ ID NO: 2, the method for forming the fusion gene can be constructed by referring to the existing construction method of the fusion gene. Specifically, the ligation may be performed by an existing ligation sequence or may be performed after being appropriately adjusted.

In a preferred embodiment, the linking sequence in the above watermelon fusion gene is GGCAGCGGCCGC. The sequence of the watermelon fusion gene is shown as SEQ ID NO: 4, respectively.

In a second exemplary embodiment of the present application, there is also provided a fusion protein encoded by the above-mentioned watermelon fusion gene, wherein the expression of the fusion protein in watermelon can improve the genetic transformation efficiency of the target gene to be transformed.

In a third exemplary embodiment of the present application, a recombinant vector is provided, which comprises a watermelon growth regulatory gene and a driving element for driving the expression of the watermelon growth regulatory gene, wherein the watermelon growth regulatory gene is the above-mentioned watermelon fusion gene.

As described above, the watermelon fusion gene of the present application can improve the genetic transformation efficiency of a target gene to be transformed, and thus when a recombinant vector carrying the fusion gene is introduced into watermelon, the genetic transformation efficiency of the target gene to be transformed can also be improved.

In the recombinant vector, the driver element includes a promoter sequence and a terminator sequence, and specifically, it can be appropriately selected from known promoters and terminators in commercial recombinant vectors, or obtained by modifying known promoters and terminators.

In a preferred embodiment of the present application, the promoter sequence is a promoter for gene expression of dicotyledonous plants, more preferably, the promoter sequence is selected from the group consisting of the UBQ10 promoter sequence from arabidopsis thaliana, cauliflower mosaic virus 35s promoter; preferably, the terminator sequence is selected from the group consisting of terminators suitable for plant genes, more preferably, the terminator sequence is selected from the group consisting of HspT terminator sequence derived from Arabidopsis thaliana, Nos terminator, cauliflower mosaic virus 35s polyA.

In a preferred embodiment of the present application, the recombinant vector further comprises a transformation target gene; preferably, the recombinant vector further comprises a reporter gene for transforming the target gene and/or the watermelon fusion gene; preferably, the reporter gene comprises a resistance gene and/or a gene encoding a fluorescent protein; more preferably, the resistance gene is selected from any one or more of: kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene and glufosinate resistance gene; more preferably, the gene encoding the fluorescent protein is selected from any one or more of: red fluorescent protein expression gene DsRed2, GFP gene, mCherry gene and YFP gene; preferably, the recombinant vector is selected from any one of: pKSE401, pBSE401, pHSE401, or pAS 083.

In a fourth exemplary embodiment of the present application, a non-plant host cell transformed with any one of the above recombinant vectors is provided.

Specifically, host cells include, but are not limited to, E.coli strain DH5 α, Agrobacterium strain EHA105, LBA4404, AGL1 or GV 3101.

In a fifth exemplary embodiment of the present application, there is provided a method for genetic transformation of watermelon, comprising: the watermelon fusion gene is introduced into the watermelon genome.

In a preferred embodiment, the target gene to be transformed is constructed on the same vector as the improved watermelon fusion gene of the present application, and any of the above recombinant vectors introduces the watermelon fusion gene into the watermelon genome.

In another preferred embodiment, the target gene to be transformed and the improved watermelon fusion gene of this application are constructed on different vectors, respectively, by introducing the recombinant vector carrying the target gene to be transformed and the above-mentioned recombinant vector carrying the watermelon fusion gene into the watermelon genome together.

In the watermelon genetic transformation method of the application, specific genetic transformation methods include but are not limited to any one of the following: agrobacterium-mediated transformation, biolistic methods, PEG-mediated protoplast transformation, plant virus-mediated transformation, pollen tube channel methods, and ovary injection methods. The genetic transformation methods have advantages, for example, agrobacterium-mediated genetic transformation methods can obtain more low-copy inserted transformants, protoplast transformation is used for transient detection, and the like.

The genetic transformation of the watermelon is carried out by utilizing an agrobacterium infection method, and the specific steps are the same as those of the reported genetic transformation method of the watermelon. In a preferred embodiment of the present application, the genetic transformation method comprises: introducing the recombinant vector into an agrobacterium tumefaciens strain to obtain a recombinant strain; preparing the recombinant bacteria into a dip dyeing solution; putting the watermelon explant into a dip dyeing solution for dip dyeing to obtain an infected explant; co-culturing the infected explants to obtain co-cultured explants; and sequentially carrying out antibiotic resistance screening and fluorescence screening on the co-cultured explants to obtain positive transformants.

The specific Agrobacterium strain is also not particularly limited, so long as it is capable of infecting a watermelon and introducing the recombinant vector into the watermelon. In a preferred embodiment, the agrobacterium strain is EHA 105.

The watermelon explant can be reasonably selected according to actual needs, and the watermelon explant in the application comprises but is not limited to any one of the following substances: cotyledons, cotyledons nodes, immature embryos, mature embryos and protoplasts.

Preferably, the antibiotic is selected from kanamycin, hygromycin, spectinomycin or glufosinate; preferably, the fluorescence is red fluorescence, or green fluorescence.

In a preferred embodiment, the co-cultured explants are sequentially subjected to antibiotic resistance screening and fluorescence screening to obtain positive transformants comprising: placing the co-culture explant on a resistance screening culture medium for culture to obtain resistance positive bud tissues; placing the resistant positive bud tissue in a bud elongation culture medium for culturing until a new bud head is regenerated, and carrying out fluorescence detection on the regenerated bud head to obtain a positive transformant; preferably, the resistance screening culture medium is a sterile culture medium consisting of an MS solid culture medium and 6-benzylaminopurine (6-BA), timentin and kanamycin, the concentrations of the 6-BA, timentin and kanamycin in the resistance screening culture medium are respectively 1.5mg/L, 200mg/L and 100mg/L, and the pH is 5.8; preferably, the shoot elongation medium is a sterile medium consisting of MS solid medium and 6-furfurylaminopurine (KT), timentin and kanamycin, and the concentrations of KT, timentin and kanamycin in the shoot elongation medium are 0.2mg/L, 200mg/L and 100mg/L, respectively, and pH is 5.8.

The above fusion gene of the present application was integrated onto a plasmid to construct a recombinant vector: the vector is subjected to enzyme digestion connection based on pKSE401 plasmid to construct a recombinant vector, wherein the recombinant vector comprises a fusion gene ClGRF4-ClGIF1 and a driving element promoter and a terminator for driving the fusion gene ClGRF4-ClGIF1, the promoter is derived from UBQ10 of arabidopsis thaliana, and the terminator is derived from an HspT terminator sequence of arabidopsis thaliana. The recombinant vector contains a transformation target gene DsRed2 and a resistance gene kanamycin resistance gene.

The constructed recombinant vector is introduced into agrobacterium EHA105, and cultured to prepare an infection solution. Selecting watermelon seeds, removing seed shells, planting in the dark, cutting the middle part of cotyledon, and preparing the watermelon explant. And (3) infecting the explant in an infecting solution containing recombinant bacteria. And culturing the infected explants in a co-culture medium and a screening medium to identify the positive buds.

In a fifth exemplary embodiment of the present application, there is provided the use of any one of the above-described watermelon fusion genes, or any one of the above-described recombinant vectors, or any one of the above-described genetic transformation methods for genetic transformation and breeding of watermelon.

The advantageous effects of the present application will be explained in further detail below with reference to specific examples.

Example 1: acquisition of watermelon ClGRF4-ClGIF1 gene fragment

According to the reported protein sequences of wheat GRF4 and GIF1, GRF4 and GIF1 are related to information found in Juan M.Debernardi, David M.Tricolli, Maria F.Ercoli, Sadiye Hayta, Pamela Ronald, Javier F.Palatinik & Joger Dubcovsky.2020, A GRF-GIF chimeric protein improvements the regeneration of gene expression of transgenic plants, Nature Biotechnology volume 38, pages 1274-1279, and BlastP searches the watermelon genome database for watermelon homologous genes ClGRF4 (gene Cla97C02G034420, the nucleotide sequence of which is shown in SEQ ID NO: 1) and ClGIF1 (gene Cla97C11G 520, the nucleotide sequence of which is shown in SEQ ID NO: 2). The NCBI database was searched with the protein ClGRF4, the GRF genes from other species were downloaded, and the evolutionary relationship of FIG. 1 was obtained using the online Clustal Omega software (https:// www.ebi.ac.uk/Tools/msa/clustalo /), and it can be seen that ClGRF4 has the closest relationship to wheat GRF4 (homology: 44%). The NCBI database was searched with the ClGIF1 protein, the GIF1 protein in other species was downloaded, and the evolutionary relationship chart of FIG. 2 was obtained using the online Clustal Omega software, and it can be seen that ClGIF1 has the closest relationship (homology: 51%) to wheat GIF 1. ClGRF4 and ClGIF1 were linked via GGCAGCGGCCGC (shown in SEQ ID NO: 3) to artificially synthesize a ClGRF4-ClGIF1 fusion gene (the nucleotide sequence of which is shown in SEQ ID NO: 4).

SEQ ID NO: 1 the specific sequence is as follows:

>ClGRF4.Cla97C02G034420

SEQ ID NO：2

>ClGIF1.Cla97C11G213520

atgcagcaaccaccgcaaatgttgcccatgatgccttcatttccccccaccaatatcaccaccgagcagattcaaaagtatcttgatgagaacaaaaagttgatattggccatactggacaaccaaaatctggggaaactagctgaatgtgctcagtaccaagctcaacttcagaagaatttgatgtatttagctgcaattgctgatgcccagccacaggcaccagctatgcctccgcagatggccccacatcctgccatgcagcaagggggttattatatgcagcaccctcaggcagctataatggcccagcaatcaggacttttccctccaaaagttccattgcagttcggcaatccccatcaattacaagatccacagcagcaactacaccaacaacaccagcaagcaatgcaagggcaaatgggactaagacctattggtggggctaacaatggcatgcatcacccacatcatactgagagtacccttgggggtggtgttagtgctggaggccctcctcgaagttcagtgcaaactgatggtcgtggaggtgggaaacaggactcaggtgatgtgggaggtgcaggtgctgatggtcaggggagctcggctggtggtcgtggcggtggtggtgatggtgaggaagctaagtag。

SEQ ID NO：3

>linker

ggcagcggccgc

SEQ ID NO：4

>ClGRF4-ClGIF1

atgaacaacagtggcggtggtggtgaggatgggagtaggacagtagcagcaatagcaagtggaatgatggggatgaataggtcacctttcacagtgttacagtggcaggagctggagcatcaggctctgatcttcaaatatatgatggcaggtctgcccgttccacctgatcttgtactccctattcagaagagcttcgagtccatttctcataggttcttccatcatcccaccatggcttattgttcattctatgggaagaaggtggacccagagcctggaagatgcagaaggactgatggaaagaaatggaggtgctccaaagatgcgtacccagactccaaatactgtgagcgccacatgcaccgtggccgcaatcgttcaagaaagcctgtggaatctcaaactatgacacagtcgtcgtccactgtgacatctcttaccgctaccggaagtagcagcactggaactggaagcttccatggccttccattgaatgccttaagcagttcccagaccactaccactgggaccagtcagcctcattatcccttggactccattccctatggaatcccaagcaaagattataggtatcttcaagggcttagacctgaagctggagtgcatagtttcttttctgaggcatcaggaagcagcagggctgttcaaatggatgcaccaatcgacaacacgtggccaatgatgccatccagatccccgtctttcccggcatcaaaatcaactgaaaactcaatcttccaaagcggatatccgcagcattcgttccttggtggggaatatgcatctggggaaactctgaaacaagagggtcaatctcttcagccgctctttgacgaatggccgagaactagggagtcatggaccggactcgacgatgaaagatccaatcaaacttccttctccacaacacagctgtccatatcaattccaatggcctcatctgacttgtcgaccacaagttcaaaatctcctcatggtggcagcggccgcatgcagcaaccaccgcaaatgttgcccatgatgccttcatttccccccaccaatatcaccaccgagcagattcaaaagtatcttgatgagaacaaaaagttgatattggccatactggacaaccaaaatctggggaaactagctgaatgtgctcagtaccaagctcaacttcagaagaatttgatgtatttagctgcaattgctgatgcccagccacaggcaccagctatgcctccgcagatggccccacatcctgccatgcagcaagggggttattatatgcagcaccctcaggcagctataatggcccagcaatcaggacttttccctccaaaagttccattgcagttcggcaatccccatcaattacaagatccacagcagcaactacaccaacaacaccagcaagcaatgcaagggcaaatgggactaagacctattggtggggctaacaatggcatgcatcacccacatcatactgagagtacccttgggggtggtgttagtgctggaggccctcctcgaagttcagtgcaaactgatggtcgtggaggtgggaaacaggactcaggtgatgtgggaggtgcaggtgctgatggtcaggggagctcggctggtggtcgtggcggtggtggtgatggtgaggaagctaagtag。

example 2: construction of transformation vectors

The plasmid pKSE401 was digested with HindIII, the plasmid information is described in Hui-Li Xing, Li Dong, Zhi-Ping Wang, Hai-Yan Zhang, Chun-Yan Han, Bing Liu, Xue-Chen Wang and Qi-Jun Chen, (2014) BMC Plant Biology,14: 327) 338, and the 14kb fragment was recovered and ligated with T4 ligase. The resulting plasmid was digested with XbaI and SacI, the 4kb Cas9 sequence was removed and replaced with the DsRed2 sequence. A kanamycin-resistant binary vector expressing DsRed2 was obtained. And secondly, amplifying a UBQ10 promoter sequence and an HspT terminator sequence by using an arabidopsis genome as a template, and carrying out seamless cloning on the UBQ10 promoter sequence and the HspT terminator sequence and the HindIII-digested kanamycin-resistant binary vector for expressing DsRed2 to obtain a W500 vector. KpnI digested the W500 vector and simultaneously amplified the synthesized 1.67kb ClGRF4-ClGIF1 fragment, ClGG-KD504-F, with the following primers: gtttttctgattaacagggtaccatgaacaacagtggcggtgg (shown in SEQ ID NO: 5), ClGG-KD 504-R: tcatcttcatcttcatatctacttagcttcctcaccatcac (shown in SEQ ID NO: 6), and performing Seamless cloning, wherein the Seamless cloning is performed by using a Byunnan Seamless cloning kit, mixing the vector fragment and the PCR fragment according to a molar ratio of 1:2, adding an equal volume of 2 × Seamless cloning mix, mixing uniformly, and incubating at 50 ℃ for 30 min. The recombinant plasmid is transformed into an escherichia coli strain DH5 alpha, cultured on a 50 mu g/mL kanamycin solid plate at 37 ℃, single colony is selected, and the sequence correctness is verified by sequencing of Beijing Optimalaceae biotechnology limited. The sequencing result shows that the obtained sequence of the coding region of the ClGRF4-ClGIF1 gene is consistent with the expected sequence, which indicates that the recombinant plasmid is successfully constructed.

EXAMPLE 3 Agrobacterium-mediated genetic transformation of watermelon

The watermelon variety Xinong No. eight female parent, Jingxin female parent and Sugarley are selected for genetic transformation, and the experiment is repeated for 2 times.

And (4) preparing an explant. The method comprises the steps of selecting full and normal-appearance seeds of watermelon variety No. 8 West farmer, and carefully removing seed shells without damaging cotyledons and growing points. After sterilization, the plants were grown in MS solid medium at 28 ℃ in the dark for about 3 days. Plants in a period in which the radicle is elongated but two cotyledons are not yet separated are selected, a part of the middle of the cotyledons is cut, and cut into small pieces of 1.5mm by 1.5mm as explants.

And (4) preparing an invasive dyeing solution. Preparation of recombinant expression vector: a binary vector containing the watermelon growth regulatory gene and the DsRed2 selection marker was constructed according to the above procedure. Preparing a recombinant bacterium: and (3) introducing the recombinant vector into an agrobacterium strain EHA105 to obtain a recombinant strain. Preparing an invasive dyeing solution: activating the recombinant strain and culturing the activated recombinant strain at OD₆₀₀Centrifuging at 0.6-0.8, collecting thallus, resuspending thallus in MS liquid sterile culture medium, and infecting with OD₆₀₀Are all 0.6.

And (4) infection. And (3) placing the obtained explant in an infection liquid containing recombinant bacteria, immersing the explant in the liquid, infecting at room temperature for 10 minutes with intermittent shaking in the infection process, then taking out the explant, and sucking the liquid to dry to obtain the infected explant.

And (4) co-culturing. And (3) placing the infected explants in a co-culture medium, and performing dark culture for 3 days to obtain co-cultured explants. The used co-culture medium is a sterile medium consisting of an MS solid medium and 6-BA, the concentration of the 6-BA in the co-culture medium is 1.5mg/L, and the pH value is 5.8.

And (4) screening. The co-cultured explants were cultured on screening medium, and about 25 explants were placed on each plate. The culture medium is changed once a week, and after about 4 weeks, positive buds can be observed growing from the edge of the cotyledon block, namely, the plant tissue containing buds is obtained. The screening culture medium is a sterile culture medium consisting of an MS solid culture medium and 6-BA, timentin and kanamycin, the concentrations of the 6-BA, timentin and kanamycin in the screening culture medium are respectively 1.5mg/L, 200mg/L and 100mg/L, and the pH is 5.8.

And (5) bud elongation culture. Culturing the plant tissue or bud containing bud in bud elongation culture medium, and replacing culture medium every two weeks until the bud grows up. The bud elongation culture medium is a sterile culture medium consisting of an MS solid culture medium and KT, timentin and kanamycin, the concentrations of the KT, timentin and kanamycin in the bud elongation culture medium are respectively 0.2mg/L, 200mg/L and 100mg/L, and the pH is 5.8.

And (4) identifying the positive buds. The positive plants are detected by a handheld ultraviolet lamp with a LUYOR-3415RG dual-wavelength fluorescent protein excitation light source. According to the instructions of the LUYOR-3410 ultraviolet lamp, the red light source is turned on to excite fluorescence, and the corresponding red filter is used to detect whether red fluorescence is expressed, as shown in FIG. 3.

The conversion rates of ClGRF4-ClGIF1 in different inbred lines (shown in Table 1) are tested, and the conversion rates of 3 varieties are higher than 20% at present, and the conversion rate of Sugarley is slightly higher than that of the Jingoxin female parent.

In addition, the present application also examined the genetic transformation efficiency of homologous genes in other species, with the following results:

1) after GRF4 homologous gene CsAV3_1G040860 (homology is 38%) and GIF1 homologous gene CsAV3_2G003880 (homology is 60.9%) which have the closest clustering relation in cucumber are fused (the connection sequence is the same as that of the application), the influence of the fused genes on the cucumber genetic transformation efficiency is detected by adopting the same genetic transformation method as that of the application, and the result shows that the transformation efficiency is less than 1% and the effect of improving the genetic transformation efficiency is not achieved.

2) Similarly, GRF4 homologous genes and GIF1 genes which have the closest clustering relation in the tomato are fused and then used for genetic transformation, the transformation efficiency is 16-30%, and no obvious improvement effect is achieved.

Table 1: transformation efficiency of different varieties

From the above description, it can be seen that the above-described embodiments of the present invention achieve the following technical effects: by utilizing the watermelon fusion gene and the agrobacterium-mediated transformation method, the transformation target gene can be guided into the watermelon genome, so that the genetic transformation efficiency of the watermelon is improved.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> modern agriculture research institute of Beijing university

<120> watermelon fusion gene, genetic transformation method and application

<130> PN160748XDNY

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1002

<212> DNA

<213> Citrullus lanatus

<400> 1

atgaacaaca gtggcggtgg tggtgaggat gggagtagga cagtagcagc aatagcaagt 60

ggaatgatgg ggatgaatag gtcacctttc acagtgttac agtggcagga gctggagcat 120

caggctctga tcttcaaata tatgatggca ggtctgcccg ttccacctga tcttgtactc 180

cctattcaga agagcttcga gtccatttct cataggttct tccatcatcc caccatggct 240

tattgttcat tctatgggaa gaaggtggac ccagagcctg gaagatgcag aaggactgat 300

ggaaagaaat ggaggtgctc caaagatgcg tacccagact ccaaatactg tgagcgccac 360

atgcaccgtg gccgcaatcg ttcaagaaag cctgtggaat ctcaaactat gacacagtcg 420

tcgtccactg tgacatctct taccgctacc ggaagtagca gcactggaac tggaagcttc 480

catggccttc cattgaatgc cttaagcagt tcccagacca ctaccactgg gaccagtcag 540

cctcattatc ccttggactc cattccctat ggaatcccaa gcaaagatta taggtatctt 600

caagggctta gacctgaagc tggagtgcat agtttctttt ctgaggcatc aggaagcagc 660

agggctgttc aaatggatgc accaatcgac aacacgtggc caatgatgcc atccagatcc 720

ccgtctttcc cggcatcaaa atcaactgaa aactcaatct tccaaagcgg atatccgcag 780

cattcgttcc ttggtgggga atatgcatct ggggaaactc tgaaacaaga gggtcaatct 840

cttcagccgc tctttgacga atggccgaga actagggagt catggaccgg actcgacgat 900

gaaagatcca atcaaacttc cttctccaca acacagctgt ccatatcaat tccaatggcc 960

tcatctgact tgtcgaccac aagttcaaaa tctcctcatg gt 1002

<210> 2

<211> 657

<212> DNA

<213> Citrullus lanatus

<400> 2

atgcagcaac caccgcaaat gttgcccatg atgccttcat ttccccccac caatatcacc 60

accgagcaga ttcaaaagta tcttgatgag aacaaaaagt tgatattggc catactggac 120

aaccaaaatc tggggaaact agctgaatgt gctcagtacc aagctcaact tcagaagaat 180

ttgatgtatt tagctgcaat tgctgatgcc cagccacagg caccagctat gcctccgcag 240

atggccccac atcctgccat gcagcaaggg ggttattata tgcagcaccc tcaggcagct 300

ataatggccc agcaatcagg acttttccct ccaaaagttc cattgcagtt cggcaatccc 360

catcaattac aagatccaca gcagcaacta caccaacaac accagcaagc aatgcaaggg 420

caaatgggac taagacctat tggtggggct aacaatggca tgcatcaccc acatcatact 480

gagagtaccc ttgggggtgg tgttagtgct ggaggccctc ctcgaagttc agtgcaaact 540

gatggtcgtg gaggtgggaa acaggactca ggtgatgtgg gaggtgcagg tgctgatggt 600

caggggagct cggctggtgg tcgtggcggt ggtggtgatg gtgaggaagc taagtag 657

<210> 3

<211> 12

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(12)

<223> fusion gene connecting sequence

<400> 3

ggcagcggcc gc 12

<210> 4

<211> 1671

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1003)..(1014)

<223> fusion gene connecting sequence

<400> 4