sgRNA guide sequence of specific targeting mouse Gaa gene and application thereof
阅读说明：本技术 一种特异靶向小鼠Gaa基因的sgRNA导向序列及其应用 (sgRNA guide sequence of specific targeting mouse Gaa gene and application thereof ) 是由 于鸿浩 付灿 岳鹏鹏 李勇 高进涛 于 2019-11-05 设计创作，主要内容包括：本发明公开了一种特异靶向小鼠Gaa基因的sgRNA导向序列及其应用,属于医学遗传学和分子生物学技术领域。所述sgRNA对应的核苷酸序列为SEQ ID NO.1、SEQ ID NO.2和SEQ ID NO.3中的任意一种序列。本发明还公开了利用上述的特异靶向小鼠Gaa基因的sgRNA导向序列编辑小鼠Gaa基因的方法。本发明的sgRNA导向序列可以介导Cas9蛋白高效地切割靶点DNA,进而用于编辑小鼠Gaa基因,影响小鼠Gaa基因编码蛋白的功能。本发明的sgRNA导向序列可以通过CRISPR/Cas9系统实现高效打靶,效率均为100％。(The invention discloses a sgRNA guide sequence of a specific target mouse Gaa gene and application thereof, belonging to the technical field of medical genetics and molecular biology. The nucleotide sequence corresponding to the sgRNA is any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. The invention also discloses a method for editing the mouse Gaa gene by using the sgRNA guide sequence of the specific target mouse Gaa gene. The sgRNA guide sequence disclosed by the invention can mediate Cas9 protein to efficiently cut target DNA, and further can be used for editing mouse Gaa genes and influencing the functions of mouse Gaa gene coding proteins. The sgRNA guide sequence can realize high-efficiency targeting through a CRISPR/Cas9 system, and the efficiency is 100%.)
1. A sgRNA guide sequence of a specific targeting mouse Gaa gene is characterized in that the corresponding nucleotide sequence of the sgRNA is any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
2. A method for editing a mouse Gaa gene using the sgRNA targeting sequence specifically targeting the mouse Gaa gene of claim 1, comprising the steps of:
step 1: synthesizing a forward oligonucleotide sequence by adding accg to the 5' end of the sgRNA guide sequence of the specific targeted mouse Gaa gene of claim 1;
meanwhile, according to the sgRNA guide sequence of the specific targeted mouse Gaa gene of claim 1, obtaining a corresponding DNA complementary strand, and adding aaac to the 5' end of the DNA complementary strand to synthesize a reverse oligonucleotide sequence;
annealing the forward oligonucleotide sequence and the reverse oligonucleotide sequence to form a double-stranded DNA fragment having a sticky end;
step 2: digesting a target vector pGL3-U6-sgRNA plasmid shown in SEQ ID NO.5 by using Bsa I restriction endonuclease to obtain a digestion product pGL3-U6-sgRNA-Bsa I;
and step 3: connecting the double-stranded DNA fragment with the sticky end obtained in the step 1 with the enzyme digestion product pGL3-U6-sgRNA-Bsa I obtained in the step 2, converting the connection product into competent escherichia coli, coating the competent escherichia coli on an ampicillin-resistant LB culture medium, culturing overnight at 37 ℃ for 20h, selecting a single clone, identifying a positive clone by sequencing with a universal primer U6 shown in SEQ ID No.6, shaking the positive clone, and extracting plasmids to obtain pGL3-U6-Gaa-sgRNA plasmid;
and 4, step 4: co-transfecting a mouse 3T3 cell with the pGL3-U6-Gaa-sgRNA plasmid obtained in the step 3 and a pST1374-NLS-flag-linker-Cas9 expression plasmid shown in SEQ ID NO.7, and obtaining a positive sgRNA-Cas9 co-transfected cell after drug screening;
and 5: carrying out cell lysis on the positive sgRNA-Cas9 cotransfected cells obtained in the step (4), carrying out PCR amplification reaction on the DNA of the targeting site by taking the obtained cell lysis solution as a template, taking the PCR amplification product of the DNA of the targeting site to carry out Sanger sequencing, and if the targeting site has a set peak, primarily confirming that gene editing occurs;
step 6: TA cloning, sequencing and analyzing step 5 preliminarily confirms the genotype of the targeted site with gene editing and obtains mouse cells with the gene editing.
3. The method for editing mouse Gaa gene according to claim 2, wherein in step 1, the annealing reaction system is specifically: 10 μ M forward oligonucleotide, 5 μ L; 10 μ M reverse oligonucleotide, 5 μ L; 10 XT 7 EndonucleaaseI buffer, 2. mu.L; ddH2O, 8 mu L; the reaction procedure is specifically as follows: 95 ℃ for 5 min; 95 ℃ to 85 ℃, and-1 ℃/cycle, for 10 cycles; at 85 deg.C to 25 deg.C, -0.1 deg.C/cycle, for 600 cycles, and storing the annealed product at-20 deg.C.
4. The method for editing mouse Gaa gene according to claim 2, wherein in step 2, the enzyme digestion reaction system specifically comprises: pGL3-U6-sgRNA plasmid, 2. mu.g; 10 Xenzyme digestion buffer, 2 uL; bsa I restriction enzyme, 2. mu.L; supplemental ddH2And O, setting the enzyme digestion reaction system at 37 ℃ for reaction for 3h until the total volume is 20 mu L.
5. The method for editing mouse Gaa gene according to claim 2, wherein the specific method for transforming competent E.coli in step 3 is: adding 5 μ L of the ligation product into 30 μ L of competent Escherichia coli, mixing, standing on ice for 25min, performing water bath heat shock at 42 deg.C for 90s, cooling on ice for 2min, adding 150 μ L of LB liquid culture medium at 220 rpm, activating at 37 deg.C for 30min, and coating on the surface of LB liquid culture medium with ampicillin resistance; in the LB culture medium with ampicillin resistance, the concentration of ampicillin is 50 mug/mL; the temperature of the shake bacteria is 37 ℃, the rotating speed is 220 r/min, and the shake bacteria is inverted and cultured overnight after being coated on a culture medium; the extraction plasmid adopts a kit for extracting endotoxin-removing plasmid.
6. The method for editing mouse Gaa gene according to claim 2, wherein in step 4, the drugs are puromycin at a concentration of 10 μ g/ml and blasticidin at a concentration of 20 μ g/ml; the mouse 3T3 cells were inoculated and cultured in DMEM complete medium containing 5% v/v fetal calf serum at 37 ℃ and 5% CO before transfection2Culturing in an incubator, replacing fresh culture medium every 2d-3d, digesting with 0.25% trypsin after the cell confluence reaches 80-90%, then passing through a 6-well plate, and transfecting after 16-18 h and when the cell confluence reaches 80-90%.
7. The method for editing mouse Gaa gene according to claim 2, wherein in step 5, the PCR amplification reaction of the DNA at the target site is performed in a system comprising: 2 mu L of cell lysate, 1 mu L of upstream primer, 1 mu L of downstream primer, 2 mu L of dNTP mix, 1 mu L of TaKaRa Ex Taq, 2.5 mu L of 10 XEx Taq Buffer and 25 mu L of sterilized water; the PCR amplification reaction of the target site DNA is carried out by the following procedures: 95 ℃ for 5 min; 95 ℃, 20s, 72 ℃, 20s, -1 ℃/cycle, 72 ℃, 25s, for 10 cycles; 25 cycles of 95 ℃, 20s, 62 ℃, 20s, 72 ℃, 25 s; 72 ℃, 5min, 16 ℃, infinity.
8. The method for editing mouse Gaa gene according to claim 7, wherein the sequence of the upstream primer is shown in SEQ ID No. 8; the sequence of the downstream primer is shown as SEQ ID NO. 9.
9. The method for editing mouse Gaa gene according to claim 2, wherein in step 6, the TA cloning sequencing is specifically: performing gel recovery and purification on the PCR amplification product of the targeted site obtained in the step 5, and connecting the purified DNA to a plasmid vector to obtain a connection product; and transforming the ligation products into competent escherichia coli, coating the competent escherichia coli on an LB (lysogeny broth) culture medium with aminobenzyl resistance, performing overnight culture at 37 ℃ for 20 hours, performing colony PCR (polymerase chain reaction) reaction verification, screening positive clones, and performing Sanger sequencing on the positive clones.
10. The method for editing mouse Gaa gene according to claim 9, wherein the linked reaction system is: PCR purified product 40ng, Solution I2.5. mu.L and PMD19 carrier 0.5. mu.L, and water is added to make up to 5. mu.L; the specific method for transforming the competent escherichia coli comprises the following steps: adding 5 μ L of the ligation product into 30 μ L of competent Escherichia coli, mixing, standing on ice for 25min, performing water bath heat shock at 42 deg.C for 90s, cooling on ice for 2min, adding 150 μ L of LB liquid culture medium at 220 rpm, activating at 37 deg.C for 30min, and coating on the surface of LB liquid culture medium with ampicillin resistance; in the LB culture medium with ampicillin resistance, the concentration of ampicillin is 50 mug/mL; the colony PCR reaction system comprises: 1 mu L of colony aqueous solution, 5 mu L of Premix Taq enzyme, 0.5 mu L of upstream primer, 0.5 mu L of downstream primer and 3 mu L of sterilized water; the procedure of the colony PCR reaction was: 95 ℃ for 5 min; 95 ℃, 20s, 60 ℃, 20s, 72 ℃, 25s, 26 cycles; 72 ℃ for 5 min; the sequence of the upstream primer is shown as SEQ ID NO. 10; the sequence of the downstream primer is shown as SEQ ID NO. 11.
Technical Field
The invention relates to a sgRNA guide sequence of a specific target mouse Gaa gene and application thereof, belonging to the technical field of medical genetics and molecular biology.
Background
The CRISPR/Cas system was first discovered in bacteria, and it performs an acquired immune function in eubacteria and archaea, resistant to foreign virus and plasmid invasion. People transform the CRISPR/Cas system of the microorganism by means of genetic engineering, thereby creating a targeting system which can be widely applied to gene editing of higher organisms, namely the CRISPR/Cas9 system. Since 2012, the system has injected strong power for life science and biomedical research, and becomes a research hotspot in recent years. Since 2013, researchers successfully edited genomes in mammalian cells by using the DNA binding activity and endonuclease activity of CRISPR/
The name in sgRNA is guide RNA. Cas9 targeted cleavage of DNA in prokaryotes is achieved by the principle that two small RNAs- -crRNA (CRISPR RNA) and tracrRNA (transactivating crRNA) and target sequence complementary recognition are required. At present, the two small RNAs are fused into one RNA, namely sgRNA, by means of genetic engineering. The primary function of sgrnas is to recognize and bind to the target genomic DNA and mediate cleavage of DNA double strands by Cas9 protein. Therefore, whether the sgRNA can efficiently recognize and bind the target gene in a targeted manner is a prerequisite for whether the CRISPR-Cas9 can specifically edit the target gene, especially gene knockout and gene knock-in, and the high efficiency of the sgRNA is very important for the influence of gene targeting. Therefore, the ability to design and prepare sgrnas that efficiently target a target gene is a key to gene editing based on the CRISPR-Cas9 system.
Pompe disease (Pompe disease), also called acid maltose enzyme deficiency or type II glycogen storage disease, is an autosomal recessive genetic disease, the cause of which is lack of acid α -glucosidase in human body, leading to hepatic glycogen undecomposed, according to the onset time, the disease can be classified into an infant type and a late type, infant type patients, namely individuals about 6 months after birth, suffer from the disease, the clinical manifestations of myasthenia gravis, hypertrophy of tongue, heart and liver, dyspnea and developmental retardation are not enough, the disease usually lives are not longer than 2 years old, the late type patients suffer from the disease during about 20-60 years old, the clinical manifestations of progressive myasthenia, shortness of breath, headache and other symptoms.
The research shows that the human GAA gene encodes acid α -glucosidase, which is the main cause of human Pompe disease, the mutation of the GAA gene has high genetic heterogeneity, more than 120 mutations are reported at present, and mutation sites are distributed throughout the whole gene, the mutation types mainly comprise missense mutation, insertion mutation, deletion mutation, nonsense mutation, splice site mutation and the like, the clinical symptoms and clinical manifestations caused by different mutation types are different, therefore, the specific and typical GAA pathogenic mutation sites need to be screened, the mutation sites are positioned on the mouse genome, then the sites are targeted by a CRISPR/Cas9 system, and a GAa gene mutation cell model or an animal model can be established, so that the Pompe disease can be accurately simulated, the important significance is realized for deeply understanding the pathogenic mechanism of the Gaa gene and exploring a feasible therapeutic strategy.
Disclosure of Invention
One of the purposes of the invention is to provide a sgRNA guide sequence specifically targeting a mouse Gaa gene. The sgRNA guide sequence is designed by referring to the pathogenic mutation site of the human Pompe disease GAA gene, then positioning the site on the mouse Gaa gene and according to the positioned site DNA sequence. The sgRNA guide sequence disclosed by the invention can mediate Cas9 protein, efficiently and specifically cuts target DNA, and is further used for editing mouse Gaa genes and influencing the functions of mouse Gaa gene coding proteins. The sgRNA guide sequence can mediate a CRISPR/Cas9 system to realize high-efficiency targeting, and the efficiency is 100%.
The technical scheme for solving the problems is as follows: a sgRNA guide sequence of a specific target mouse Gaa gene, wherein the corresponding nucleotide sequence of the sgRNA is any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
The nucleotide sequence of the sgRNA is as follows:
SEQ ID NO.1：5'-ctgtccagtgaccagcgtac-3'。
SEQ ID NO.2：5'-tcgggccacggccggtacgc-3'。
SEQ ID NO.3：5'-acggccggtacgctggtcac-3'。
the inventors of the present application performed the following work in order to obtain the sgRNA targeting sequence specifically targeting the mouse Gaa gene as described above:
the first step is as follows: and screening the pathogenic mutation site of the human GAA gene, and determining the human GAAp.Tyr609 site as a pseudo mutation site.
Pompe disease is caused by GAA gene mutation, firstly, an OMIM database is used for screening the pathogenic mutation of the human GAA gene, and 16 mutation sites (shown in Table 1) are screened; for more extensive screening of GAA pathogenic mutations, the invention also searches 46 GAA mutations (as shown in FIG. 1 and Table 2, and Table 2 lists 20 mutations in total) by using an ExAC online database; then, the present invention searches the ClinVar database for GAA base deletion mutation, and searches 83 mutations in total to
The second step is that: and (3) positioning the pathogenic mutation site of the mouse Gaa gene, and positioning the DNA coding sequence of the mouse p.Tyr609 site.
Since the gene structure of the same functional gene may be different due to species differences between human and mouse, the inventors of the present application compared human GAA and mouse GAA protein sequences using the Clustal Omega online software and found that the human GAA p.tyr609 site corresponds to the mouse GAA p.tyr609 site (as shown in fig. 2). The mouse Gaa gene sequence was then derived from the Ensembl database, the DNA coding sequence for the p.tyr609 site was located using Vector NTI software, and gene targeting sites were then designed in the vicinity (as shown in figure 3).
The third step: gene editing of pathogenic sites: sites conforming to 5' -N (21) GG sequence features are editing targets of CRISPR/Cas9 system, and then targets near p.Tyr609 sites are found.
The function of ' Find Motifs ' of Vector NTI software is used for searching sites with 5' -N (21) GG sequence characteristics, all sites conforming to the sequence characteristics are considered as editing targets of CRISPR/Cas9 system, and then targets near the coding sequence of p.Tyr609 site are found (as shown in figure 3).
The target sequence of the sgRNA on the Gaa gene conforms to the sequence arrangement rule of 5' -N (21) GG, and the sgRNA can influence the expression and the function of the Gaa protein by changing the coded sequence. The sgRNA is unique in the target sequence on the Gaa gene.
The second object of the present invention is to provide a method for editing a mouse Gaa gene using the sgRNA targeting sequence specifically targeting the mouse Gaa gene. The invention constructs a CRISPR/Cas9 system capable of simulating pathogenic mutation of human GAA gene by utilizing the sgRNA guide sequence of the specific targeted mouse Gaa gene, realizes high-efficiency transfection of mouse 3T3 cells, determines proper positive cell drug screening concentration, realizes genotype analysis of trace cells, is used for non-medical diagnosis or treatment, and has extremely important effect on researching Gaa function, Pompe disease pathogenic mechanism, related treatment methods and the like.
The technical scheme for solving the problems is as follows: a method for editing a mouse Gaa gene by using the sgRNA guide sequence of the specific targeted mouse Gaa gene comprises the following steps:
step 1: synthesizing a forward oligonucleotide sequence by adding accg to the 5' end of the sgRNA guide sequence of the specific targeted mouse Gaa gene of
step 2: digesting a target vector pGL3-U6-sgRNA plasmid shown in SEQ ID NO.5 by using Bsa I restriction endonuclease to obtain a digestion product pGL3-U6-sgRNA-Bsa I;
and step 3: connecting the double-stranded DNA fragment with the sticky end obtained in the
and 4, step 4: co-transfecting a mouse 3T3 cell with the pGL3-U6-Gaa-sgRNA plasmid obtained in the
and 5: carrying out cell lysis on the positive sgRNA-Cas9 cotransfected cells obtained in the step (4), carrying out PCR amplification reaction of the DNA of the targeting site by taking the obtained cell lysate as a template, taking the PCR amplification product of the DNA of the targeting site to carry out Sanger sequencing, and if the targeting site has a set peak, primarily confirming that gene editing occurs;
step 6: TA cloning, sequencing and analyzing
On the basis of the technical scheme, the invention can be further improved as follows.
Further, in
The adoption of the further beneficial effects is as follows: by adopting the reaction system and the reaction program, the forward oligonucleotide sequence and the reverse oligonucleotide sequence can be more accurately matched and complemented, so that the double-stranded DNA fragment with the sticky end can be efficiently formed. Wherein-1 ℃/cycle means one cycle for each 1 ℃ reduction; -0.1 ℃/cycle, meaning one cycle per 0.1 ℃ reduction.
Further, in
The adoption of the further beneficial effects is as follows: by using the reaction system, pGL3-U6-sgRNA plasmid can be sufficiently digested.
Further, in
The adoption of the further beneficial effects is as follows: the ligation product can be efficiently transformed into competent Escherichia coli, so that the recombinants are fully activated, and the proportion of positive recombinants is increased.
Further, in
The adoption of the further beneficial effects is as follows: the LB culture medium containing benzyl resistance can effectively kill negative colibacillus and increase the number of positive colonies.
Further, in the
Further, in
The adoption of the further beneficial effects is as follows: by adopting the endotoxin-removing plasmid middle extraction kit, high-quality, high-concentration and endotoxin-free plasmids can be obtained, and the subsequent cell transfection efficiency is improved.
The endotoxin-removing plasmid middle-extracting kit can be purchased in the market, for example, the kit can be purchased from Beijing kang century Biotechnology Co., Ltd, and the product number is CW 2105S.
Further, in
The adoption of the further beneficial effects is as follows: by utilizing puromycin and blasticidin, positive transfected cells of sgRNA-Cas9 can be efficiently screened.
Further, in
The adoption of the further beneficial effects is as follows: mouse 3T3 cells, i.e., mouse fibroblasts. By using mouse 3T3 cells, the sgRNA targeting sequence can be verified to have efficient gene editing efficiency. The mouse 3T cell has the characteristics of easy culture, high DNA transfection efficiency and the like, has higher sensitivity to puromycin and blasticidin, and is convenient for screening positive transfected cells by medicaments.
Mouse 3T3 cells were transfected using LipofectamineTM3000 Transfection Reagent(InvitrogenTM) A kit. The kit can be purchased commercially, e.g., from Thermo Fisher scientificThe company ic, cat # L3000015. At transfection, 2.5 μ g of sgRNA expression plasmid and 2.5 μ g of Cas9 plasmid were transfected per well (diameter 34.8 mm).
The fetal bovine serum and DMEM medium are commercially available, such as from Thermo Fisher scientific, Inc. under the designation 16140071 or 11965118, and all achieve the same results.
Further, in
Wherein, the-1 ℃/cycle means that the cycle is performed once every 1 ℃ reduction.
Furthermore, the sequence of the upstream primer is shown as SEQ ID NO. 8.
SEQ ID NO.8：5'-tggcaaggcttagagtggtga-3'。
Furthermore, the sequence of the downstream primer is shown as SEQ ID NO. 9.
SEQ ID NO.9：5'-agcagtggtcagggtgaaaca-3'。
The upstream primer and the downstream primer are synthesized by Shanghai Bailegg Biotechnology Limited. The dNTPMixture, TaKaRa Ex Taq and 10 XEx Taq Buffer were purchased from Baori physician technology (Beijing) Co., Ltd., product number RR 001A.
Further, in
The further beneficial effects of the adoption are as follows: by TA cloning and sequencing, a single PCR product can be connected to a vector, and the genotype of the targeted site can be obtained through sequencing analysis.
The Solution I and PMD19 vectors described above are commercially available, for example, from Baozi physician technology (Beijing) Inc. under the designation 6013.
Further, the reaction system of the linkage is: PCR purified product 40ng, Solution I2.5. mu.L and PMD19 carrier 0.5. mu.L, and water is added to make up to 5. mu.L; the specific method for transforming the competent escherichia coli comprises the following steps: adding 5 μ L of the ligation product into 30 μ L of competent Escherichia coli, mixing, standing on ice for 25min, performing water bath heat shock at 42 deg.C for 90s, cooling on ice for 2min, adding 150 μ L of LB liquid culture medium, rotating at 220 rpm, activating at 37 deg.C for 30min, and coating on the surface of LB liquid culture medium with ampicillin resistance.
Further, ampicillin was 50. mu.g/mL in the LB medium with ampicillin resistance.
The further beneficial effects of the adoption are as follows: the LB culture medium with ampicillin resistance is adopted, so that negative escherichia coli can be effectively killed, and the number of positive colonies is increased.
Furthermore, the colony PCR reaction system is as follows: 1 mu L of colony aqueous solution, 5 mu L of Premix Taq enzyme, 0.5 mu L of upstream primer, 0.5 mu L of downstream primer and 10 mu L of sterilized water; the procedure of the colony PCR reaction was: 95 ℃ for 5 min; 95 ℃, 20s, 60 ℃, 20s, 72 ℃, 25s, 26 cycles; 72 ℃ for 5 min.
Furthermore, the sequence of the upstream primer is shown as SEQ ID NO. 10.
SEQ ID NO.10：5'-gtaaaacgacggccagt-3'。
Furthermore, the sequence of the downstream primer is shown as SEQ ID NO. 11.
SEQ ID NO.11：5'-caggaaacagctatgac-3'。
The upstream primer and the downstream primer are synthesized by Shanghai Bailegg Biotechnology Limited. The Premix Taq enzyme was purchased from Baori physician technology (Beijing) Ltd, and was assigned a product number of R004Q.
Further, the aqueous solution of colonies was prepared by dissolving a monoclonal colony having a diameter of 1mm in 10. mu.L of sterilized water.
The invention has the beneficial effects that:
(1) the sgRNA guide sequence can mediate Cas9 protein to efficiently and specifically cut target DNA, and further can be used for editing mouse Gaa genes and influencing the functions of mouse Gaa gene coding proteins. The sgRNA guide sequence can realize high-efficiency targeting through a CRISPR/Cas9 system, and the efficiency is 100 percent.
(2) The invention constructs a CRISPR/Cas9 system capable of simulating pathogenic mutation of human Gaa gene by utilizing the sgRNA guide sequence of the specific targeted mouse Gaa gene, realizes high-efficiency transfection of mouse 3T3 cells, determines proper positive cell drug screening concentration, realizes genotype analysis of trace cells, is used for non-medical diagnosis or treatment, and has extremely important effect on researching Gaa function, Pompe disease pathogenic mechanism, related treatment methods and the like.
Drawings
FIG. 1 is a schematic diagram of the exon structure and function inactivation mutation of human GAA gene in ExAC database. The dots in the figure represent the loss of function mutations. The arrow represents the direction of transcription of the gene.
FIG. 2 is an alignment of the protein sequences encoded by human GAA and mouse Gaa genes. The human 609 tyrosine (TYR, abbreviated Y) site to be mutated corresponds in frame to the mouse 609Y site.
FIG. 3 is a schematic diagram of mouse GAA gene targeting site and its sequence simulating human GAA gene mutation.
FIG. 4 is a peak sequencing plot of pGL3-U6-Gaa-
Fig. 5 shows positive transfected cells after sgRNA1-Cas9 drug screening.
Fig. 6 is a sgRNA1 target gene editing sequence. The shaded portion is the targeting sequence where editing occurs.
Fig. 7 is a sgRNA2 target gene editing sequence. The shaded portion is the targeting sequence where editing occurs.
Fig. 8 is the sgRNA3 target gene editing sequence. The shaded portion is the targeting sequence where editing occurs.
Fig. 9 is an electrophoresis image of PCR products of TA clone of sgRNA1 targeting site. In the figure, M represents Marker, and the number represents the colony number of TA clone.
Detailed Description
The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.
Firstly, screening the pathogenic mutation site of the human GAA gene, and determining the human GAA p.Tyr609 site as a pseudomutation site.
Pompe disease is caused by GAA gene mutation, firstly, an OMIM database is used for screening the pathogenic mutation of the human GAA gene, and 16 mutation sites (shown in Table 1) are screened; for more extensive screening of GAA pathogenic mutations, the invention also searches 46 GAA mutations (as shown in FIG. 1 and Table 2, and Table 2 lists 20 mutations in total) by using an ExAC online database; then, the present invention searches the ClinVar database for GAA base deletion mutation, and searches 83 mutations in total to list 10 mutations (as shown in Table 3). And comprehensively analyzing the results of the three data, and finally determining that the human GAA p.Tyr609 is a pseudomutation site.
TABLE 1 pathogenic mutation status of human GAA Gene in OMIM database
TABLE 2 ExAC database partial loss of function mutations in the human GAA Gene
Note: bold font is the quasi-mutation site; a total of 46 mutations were retrieved and only the top 20 mutations are listed in this table.
TABLE 3 deletion mutation of the human GAA Gene in the ClinVar database
Note: bold font is the quasi-mutation site; a total of 83 mutations were retrieved and the table lists 10 mutations.
Secondly, positioning the pathogenic mutation site of the mouse Gaa gene and positioning the DNA coding sequence of the mouse p.Tyr609 site.
Since the gene structure of the same functional gene may be different due to species differences between human and mouse, the inventors of the present application compared human GAA and mouse GAA protein sequences using the Clustal Omega online software and found that the human GAA p.tyr609 site corresponds to the mouse GAA p.tyr609 site (as shown in fig. 2). The mouse Gaa gene sequence was then derived from the Ensembl database, the DNA coding sequence for the p.tyr609 site was located using Vector NTI software, and gene targeting sites were then designed in the vicinity (as shown in figure 3).
Thirdly, gene editing of pathogenic sites: sites conforming to 5' -N (21) GG sequence features are editing targets of CRISPR/Cas9 system, and then targets near p.Tyr609 sites are found.
The function of ' Find Motifs ' of Vector NTI software is used for searching sites with 5' -N (21) GG sequence characteristics, all sites conforming to the sequence characteristics are considered as editing targets of CRISPR/Cas9 system, and then targets near the coding sequence of p.Tyr609 site are found (as shown in figure 3).
The target sequence of the sgRNA on the Gaa gene conforms to the sequence arrangement rule of 5' -N (21) GG, and the sgRNA can influence the expression and the function of the Gaa protein by changing the coded sequence. The sgRNA is unique in the target sequence on the Gaa gene.
The target sequence of the sgRNA on the Gaa gene conforms to the sequence arrangement rule of 5' -N (21) GG; the sgRNAs can influence the expression and function of the Gaa protein by changing the sequence of a splicing site; the sgRNA is unique in the target sequence on the Gaa gene.
The invention designs sgRNA guide sequences of 4 targeting sites, which are respectively sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
SEQ ID NO. 1: 5'-ctgtccagtgaccagcgtac-3' (hereinafter referred to as "
SEQ ID NO. 2: 5'-tcgggccacggccggtacgc-3' (hereinafter referred to as "
SEQ ID NO. 3: 5'-acggccggtacgctggtcac-3' (hereinafter referred to as "
SEQ ID NO. 4: 5'-ggtacgctggtcactggaca-3' (hereinafter referred to as "
Fourthly, editing mouse Gaa gene by utilizing the sgRNA guide sequence
Step 1: construction of sgRNA expression vector
The forward oligonucleotide sequence (Gaa-M-sg 1) was synthesized by adding accg to the 5' end of the 4 sgRNA targeting sequences+、Gaa-M-sg2+、Gaa-M-sg3+、Gaa-M-sg4+)；
Simultaneously, a corresponding DNA complementary strand is obtained according to the sgRNA guide sequence, and the 5' end of the DNA complementary strand is added with aaac to synthesize a reverse oligonucleotide sequence (Gaa-M-sg 1)-、Gaa-M-sg2-、Gaa-M-sg3-、Gaa-M-sg4-)；
The forward oligonucleotide sequence and the reverse oligonucleotide sequence are annealed to form a double-stranded DNA fragment having a cohesive end. Wherein the annealing reaction system specifically comprises: 10 μ M forward oligonucleotide, 5 μ L; 10 μ M reverse oligonucleotide, 5 μ L; 10 XT 7Endonuclease I buffer, 2. mu.L; ddH2O, 8 mu L; the reaction procedure is specifically as follows: 95 ℃ for 5 min; 95 ℃ to 85 ℃, 1 ℃/cycle (i.e., one cycle for each 1 ℃ reduction), for 10 cycles; at 85 ℃ to 12 ℃, the annealing product is stored at-20 ℃ for 600 cycles at-0.1 ℃/cycle (i.e. one cycle for each 0.1 ℃ reduction).
Chemically synthesized forward and reverse oligonucleotides as shown in table 3.
TABLE 3 chemically synthesized Forward and reverse oligonucleotides
Gaa-M-sg1+
5'-accgctgtccagtgaccagcgtac-3'(SEQ ID NO.12)
Gaa-M-sg1-
5'-aaacgtacgctggtcactggacag-3'(SEQ ID NO.13)
Gaa-M-sg2+
5'-accgtcgggccacggccggtacgc-3'(SEQ ID NO.14)
Gaa-M-sg2-
5'-aaacgcgtaccggccgtggcccga-3'(SEQ ID NO.15)
Gaa-M-sg3+
5'-accgacggccggtacgctggtcac-3'(SEQ ID NO.16)
Gaa-M-sg3-
5'-aaacgtgaccagcgtaccggccgt-3'(SEQ ID NO.17)
Gaa-M-sg4+
5'-accgggtacgctggtcactggaca-3'(SEQ ID NO.18)
Gaa-M-sg4-
5'-aaactgtccagtgaccagcgtacc-3'(SEQ ID NO.19)
Step 2: the target vector pGL3-U6-sgRNA plasmid shown in SEQ ID NO.5 is digested by Bsa I restriction enzyme to obtain a digestion product pGL3-U6-sgRNA-Bsa I. Wherein the enzyme digestion reaction system specifically comprises: pGL3-U6-sgRNA plasmid, 2. mu.g; 10 Xenzyme digestion buffer, 2 uL; bsa I restriction enzyme, 2. mu.L; supplemental ddH2O to the total volume of 20 mu L, placing the enzyme digestion reaction system at 37 ℃ for reactionAnd the time is 3 hours.
And step 3: and (2) respectively connecting the double-stranded DNA fragment with the sticky end obtained in the step (1) with the enzyme digestion product pGL3-U6-sgRNA-Bsa I obtained in the step (2), quickly adding 5 mu L of the connection product into 30 mu L of competent escherichia coli, fully and uniformly mixing, standing on ice for 25min, carrying out water bath heat shock at 42 ℃ for 90s, cooling on ice for 2min, adding 150 mu L of LB liquid culture medium, rotating at 220 r/min, and activating at 37 ℃ for 30 min. Then, the cells were plated on the surface of an ampicillin-resistant LB medium (containing 50. mu.g/mL ampicillin) and cultured overnight at 37 ℃ for 20 hours, and then, a single clone was picked up and a positive clone was obtained by PCR with a bacterial solution and agarose gel electrophoresis. Positive clones were cultured overnight with shaking at 37 ℃ and a rotation speed of 220 rpm. Plasmids are extracted by using a kit extracted from endotoxin-free plasmids to obtain pGL3-U6-Gaa-sgRNA1 plasmid, pGL3-U6-Gaa-sgRNA2 plasmid, pGL3-U6-Gaa-sgRNA3 plasmid and pGL3-U6-Gaa-sgRNA4 (shown in figure 3). The above plasmid was sequenced using the universal primer U6 shown in SEQ ID NO.6 to confirm that the target DNA fragment was inserted into a specific site of the vector (as shown in FIG. 4). The endotoxin-removing plasmid middle-extracting kit can be purchased in the market, for example, the kit can be purchased from Beijing kang century Biotechnology Co., Ltd, and the product number is CW 2105S.
SEQ ID NO.6：5'-atggactatcatatgcttaccgta-3'。
And 4, step 4: mouse 3T3 cells were first inoculated and cultured in DMEM complete medium containing 5% v/v fetal bovine serum at 37 ℃ with 5% CO2Culturing in an incubator, replacing fresh culture medium every 2d-3d, and digesting with 0.25% trypsin and passaging after the cell confluence reaches 80% -90%. Then, the cells are distributed into 6-well plates, and after 16-18 h, transfection is carried out when the cell confluence reaches 80% -90%.
Using LipofectamineTM3000Transfection Reagent(InvitrogenTM) The kit is respectively loaded with pGL3-U6-Gaa-sgRNA1 plasmid, pGL3-U6-Gaa-sgRNA2 plasmid, pGL3-U6-Gaa-sgRNA3 plasmid and pST1374-NLS-flag-linker-Cas9 expression plasmid shown in SEQ ID No.7 obtained in the
2.5 μ g and pST1374-NLS-flag-linker-Cas9 expression plasmid 2.5 μ g.
Puromycin with the concentration of 10 mug/ml and blasticidin with the concentration of 20 mug/ml are adopted for drug screening, and positive sgRNA1-Cas9 co-transfected cells (shown in figure 5), sgRNA2-Cas9 co-transfected cells, sgRNA3-Cas9 co-transfected cells and sgRNA4-Cas9 co-transfected cells are obtained respectively. The 4 groups of co-transfected cells were washed 3 times with phosphate buffer, then digested with 0.25% trypsin and collected by centrifugation.
And 5: adopting a TransDirect Animal Tissue PCR kit to carry out centrifugation on the positive sgRNA1-Cas9 co-transfected cells, the positive sgRNA2-Cas9 co-transfected cells, the positive sgRNA3-Cas9 co-transfected cells and the positive sgRNA4-Cas9 co-transfected cells obtained in the
And respectively taking the cell lysates of the 4 groups of cells as templates to perform PCR amplification reaction of the target site DNA. The PCR amplification reaction system of the target site DNA comprises the following steps: 2 μ L of cell lysate, 1 μ L of upstream primer, 1 μ L of downstream primer, 2 μ L of dNTPMixture, 1 μ L of TaKaRa Ex Taq, 2.5 μ L of 10 XEx Taq Buffer, and 25 μ L of sterilized water. The sequence of the upstream primer is shown as SEQ ID NO.8, SEQ ID NO. 8: 5'-tggcaaggcttagagtggtga-3' are provided. The sequence of the downstream primer is shown as SEQ ID NO.9, and the sequence of the downstream primer is shown as SEQ ID NO. 9: 5'-agcagtggtcagggtgaaaca-3' are provided.
The upstream primer and the downstream primer are both synthesized by Shanghai Bailey Biotechnology Limited. The dNTPMixture, TaKaRa Ex Taq and 10 XEx Taq Buffer were purchased from Baori physician technology (Beijing) Co., Ltd., product number RR 001A.
The procedures of PCR amplification reaction of the 4 groups of target site DNAs are as follows: 95 ℃ for 5 min; 95 ℃, 20s, 72 ℃, 20s, -1 ℃/cycle (i.e., one cycle for each 1 ℃ reduction), 72 ℃, 25s, for 10 cycles; 25 cycles of 95 ℃, 20s, 62 ℃, 20s, 72 ℃, 25 s; 72 ℃, 5min, 16 ℃, infinity. 5 μ L of PCR amplification products of the 4 groups of target site DNAs are respectively subjected to agarose gel electrophoresis detection with the mass percentage of 1%.
The PCR products of the 4 groups of target site DNA are respectively taken for Sanger sequencing, and the Sanger sequencing is carried out by Shanghai Baili George Biotech limited. If the target site appears a set peak, the gene editing is preliminarily confirmed. The sequencing results are shown in FIGS. 6-8. Sequencing results show that, in 4 designed targeting sites, gene editing occurs in the sgRNA1, the sgRNA2 and the sgRNA3 (as shown in fig. 6-8), gene editing does not occur in the sgRNA4 target, and the sgRNA1, the sgRNA2 and the sgRNA3 are proved to be reliable gene editing targets, while the sgRNA4 target cannot be used for gene editing.
Step 6: TA cloning, sequencing and analyzing
Carrying out gel recovery and purification on PCR products of the amplified sgRNA1, sgRNA2 and sgRNA3 targets, and connecting the purified DNA, wherein the connecting reaction system is as follows: PCR purified product 40ng, Solution I2.5. mu.L and PMD19 carrier 0.5. mu.L, and water is added to make up to 5. mu.L; then, the reaction mixture was subjected to a metal bath at 16 ℃ for 1 hour to obtain a ligation product. The Solution I and PMD19 vectors described above are commercially available, for example, from Baozi physician technology (Beijing) Inc. under the designation 6013.
Adding 5 μ L of the ligation product into 30 μ L of competent Escherichia coli rapidly, mixing, standing on ice for 25min, performing heat shock in 42 deg.C water bath for 90s, cooling on ice for 2min, adding 150 μ L of LB liquid culture medium, rotating at 220 rpm, and activating at 37 deg.C for 30 min. Then, the cells were plated on the surface of an ampicillin-resistant LB medium (containing 50. mu.g/mL ampicillin) and cultured overnight at 37 ℃ for 20 hours, followed by confirmation of colony PCR reaction. The system of colony PCR reaction is as follows: 1 mu L of colony aqueous solution, 5 mu L of PremixTaq enzyme, 0.5 mu L of upstream primer, 0.5 mu L of downstream primer and 10 mu L of sterilized water. Wherein the colony aqueous solution is prepared by dissolving a monoclonal colony with the diameter of 1mm in 10 mu L of sterilized water. The sequence of the upstream primer is shown as SEQ ID NO.10, and the sequence of the upstream primer is shown as SEQ ID NO. 10: 5'-gtaaaacgacggccagt-3' are provided. The sequence of the downstream primer is shown as SEQ ID NO.11, SEQ ID NO. 11: 5'-caggaaacagctatgac-3' are provided.
The upstream primer and the downstream primer are synthesized by Shanghai Bailegg Biotechnology Limited. The PremixTaq enzyme was purchased from Baori physician technology (Beijing) Ltd, and was assigned a product number of R004Q.
The procedure for colony PCR reaction was: 95 ℃ for 5 min; 95 ℃, 20s, 60 ℃, 20s, 72 ℃, 25s, 26 cycles; and 5min at 72 ℃, and then carrying out electrophoresis identification.
Positive clones were selected and Sanger sequencing was performed on the positive clones. Sanger sequencing was performed by Shanghai Bailey Biotechnology, Inc. The sequencing result and the original sequence alignment analysis show that random insertion and deletion of bases occur at the sgRNA1, sgRNA2 and sgRNA3 target positions, and the editing efficiency is 100% (as shown in tables 5-7).
Table 5 sgRNA1 target genotype analysis
Serial number
Sequence (Sequence)
Insertion or deletion mutation (Indel)
cggccggtacgctggtcactggacaggggatg(SEQ ID NO.20)
1
cggccggtcgctggtcactggacaggggatg(SEQ ID NO.21)
(-1,3/20)
2
cggccggtactggacaggggatg(SEQ ID NO.22)
(-9,3/20)
3
cggccggtagctggtcactggacaggggatg(SEQ ID NO.23)
(-1,4/20)
4
cggccggtactggtcactggacaggggatg(SEQ ID NO.24)
(-2,8/20)
5
cggccggtaggtcactggacaggggatg(SEQ ID NO.25)
(-4,2/20)
Note: bold font represents the target sequence.
Table 6 sgRNA2 target genotype analysis
Serial number
Sequence (Sequence)
Insertion or deletion mutation (Indel)
accttctcgggccacggccggtacgctggtca(SEQ ID NO.26)
1
accttctcgggtca(SEQ ID NO.27)
(-18,5/20)
2
accttctcgggccacggccggtcgctggtca(SEQ ID NO.28)
(-1,5/20)
3
accttctcgggccacggccggtagctggtca(SEQ ID NO.29)
(-1,4/20)
4
accttctcgggccacggccggta(SEQ ID NO.30)
(-9,2/20)
5
accttctcgggccacggccggtactggtca(SEQ ID NO.31)
(-2,2/20)
6
accttctcgggccacggccgcgctggtca(SEQ ID NO.32)
(-3,1/20)
7
accttctcgggccacggccggtaggtca(SEQ ID NO.33)
(-4,1/20)
Note: bold font represents the target sequence.
Table 7 sgRNA3 target genotype analysis
Serial number
Sequence (Sequence)
Insertion or deletion mutation (Indel)
cgggccacggccggtacgctggtcactggaca(SEQ ID NO.34)
1
cgggccacggccggtacgctggaca(SEQ ID NO.35)
(-7,5/18)
2
cgggccacggccggtacgctgcactggaca(SEQ ID NO.36)
(-2,3/18)
3
cgggccacggccggtacgctggtggaca(SEQ ID NO.37)
(-4,3/18)
4
cgggccacggccggtacgctggtactggaca(SEQ ID NO.38)
(-1,2/18)
5
cgggccacggccggtacgctggtctggaca(SEQ ID NO.39)
(-2,2/18)
6
cgggccacggccggtacgctggtttggaca(SEQ ID NO.40)
(-3,+1,2/18)
7
cgggccacggccggtactggaca(SEQ ID NO.41)
(-9,1/18)
Note: bold font represents the target sequence; italicized letters represent the insertion sequence.
Therefore, the sgRNA1, the sgRNA2 and the sgRNA3 guide sequences can mediate the Cas9 protein, efficiently and specifically cut the target DNA, and further be used for editing the mouse Gaa gene to influence the expression of the mouse Gaa gene. The sgRNA guide sequences can realize high-efficiency targeting through a CRISPR/Cas9 system, and the efficiency is 100%.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Guilin medical college
<120> sgRNA guide sequence of specific target mouse Gaa gene and application thereof
<160>81
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
<210>4
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
<210>5
<211>4951
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggtaccgatt agtgaacgga tctcgacggt atcgatcacg agactagcct cgagcggccg 60
cccccttcac cgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 120
ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 180
cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 240
tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 300
tgtggaaagg acgaaacacc gggagaccga gagagggtct cagttttaga gctagaaata 360
gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 420
tttttaaaga attctcgacc tcgagacaaa tggcagtatt catccacaat tttaaaagaa 480
aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 540
tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttcgg gtttattaca 600
gggacagcag agatccactt tggccgcggc tcgagggggt tggggttgcg ccttttccaa 660
ggcagccctg ggtttgcgca gggacgcggc tgctctgggc gtggttccgg gaaacgcagc 720
ggcgccgacc ctgggactcg cacattcttc acgtccgttc gcagcgtcac ccggatcttc 780
gccgctaccc ttgtgggccc cccggcgacg cttcctgctc cgcccctaag tcgggaaggt 840
tccttgcggt tcgcggcgtg ccggacgtga caaacggaag ccgcacgtct cactagtacc 900
ctcgcagacg gacagcgcca gggagcaatg gcagcgcgcc gaccgcgatg ggctgtggcc 960
aatagcggct gctcagcagg gcgcgccgag agcagcggcc gggaaggggc ggtgcgggag 1020
gcggggtgtg gggcggtagt gtgggccctg ttcctgcccg cgcggtgttc cgcattctgc 1080
aagcctccgg agcgcacgtc ggcagtcggc tccctcgttg accgaatcac cgacctctct 1140
ccccaggggg atccaccgga gcttaccatg accgagtaca agcccacggt gcgcctcgcc 1200
acccgcgacg acgtccccag ggccgtacgc accctcgccg ccgcgttcgc cgactacccc 1260
gccacgcgcc acaccgtcga tccggaccgc cacatcgagc gggtcaccga gctgcaagaa 1320
ctcttcctca cgcgcgtcgg gctcgacatc ggcaaggtgt gggtcgcgga cgacggcgcc 1380
gcggtggcgg tctggaccac gccggagagc gtcgaagcgg gggcggtgtt cgccgagatc 1440
ggcccgcgca tggccgagtt gagcggttcc cggctggccg cgcagcaaca gatggaaggc 1500
ctcctggcgc cgcaccggcc caaggagccc gcgtggttcc tggccaccgt cggcgtctcg 1560
cccgaccacc agggcaaggg tctgggcagc gccgtcgtgc tccccggagt ggaggcggcc 1620
gagcgcgccg gggtgcccgc cttcctggaa acctccgcgc cccgcaacct ccccttctac 1680
gagcggctcg gcttcaccgt caccgccgac gtcgaggtgc ccgaaggacc gcgcacctgg 1740
tgcatgaccc gcaagcccgg tgcctgacgc ccgccccacg acccgcagcg cccgaccgaa 1800
aggagcgcac gaccccatgc atcggtacct ttaagaccaa tgacttacaa ggcagctgta 1860
gatcttagcc actttctaga gtcggggcgg ccggccgctt cgagcagaca tgataagata 1920
cattgatgag tttggacaaa ccacaactag aatgcagtga aaaaaatgct ttatttgtga 1980
aatttgtgat gctattgctt tatttgtaac cattataagc tgcaataaac aagttaacaa 2040
caacaattgc attcatttta tgtttcaggt tcagggggag gtgtgggagg ttttttaaag 2100
caagtaaaac ctctacaaat gtggtaaaat cgataaggat ccgtcgaccg atgcccttga 2160
gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac 2220
ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctcttccgct 2280
tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 2340
tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 2400
gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 2460
aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 2520
ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 2580
gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 2640
ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 2700
ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 2760
cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 2820
attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 2880
ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 2940
aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 3000
gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 3060
tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 3120
ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 3180
taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 3240
atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 3300
actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgggaccca 3360
cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 3420
agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 3480
gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 3540
gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 3600
gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 3660
gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 3720
cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 3780
ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 3840
accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 3900
aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 3960
aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 4020
caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 4080
ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 4140
gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 4200
cctgacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 4260
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 4320
gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 4380
tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt 4440
gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 4500
agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat 4560
ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa 4620
tttaacgcga attttaacaa aatattaacg tttacaattt cccattcgcc attcaggctg 4680
cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc tattacgcca gcccaagcta 4740
ccatgataag taagtaatat taaggtacgg gaggtacttg gagcggccgc aataaaatat 4800
ctttattttc attacatctg tgtgttggtt ttttgtgtga atcgatagta ctaacatacg 4860
ctctccatca aaacaaaacg aaacaaaaca aactagcaaa ataggctgtc cccagtgcaa 4920
gtgcaggtgc cagaacattt ctctatcgat a 4951
<210>6
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atggactatc atatgcttac cgta 24
<210>7
<211>9317
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60
acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120
tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180
ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctct 240
agctagaggt cgacggtata cagacatgat aagatacatt gatgagtttg gacaaaccac 300
aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt 360
tgtaaccatt ataagctgca ataaacaagt tggggtgggc gaagaactcc agcatgagat 420
ccccgcgctg gaggatcatc cagccggcgt cccggaaaac gattccgaag cccaaccttt 480
catagaaggc ggcggtggaa tcgaaatctc gtagcacgtg tcagtcctgc tcctcggcca 540
cgaagtgctt agccctccca cacataacca gagggcagca attcacgaat cccaactgcc 600
gtcggctgtc catcactgtc cttcactatg gctttgatcc caggatgcag atcgagaagc 660
acctgtcggc accgtccgca ggggctcaag atgcccctgt tctcatttcc gatcgcgacg 720
atacaagtca ggttgccagc tgccgcagca gcagcagtgc ccagcaccac gagttctgca 780
caaggtcccc cagtaaaatg atatacattg acaccagtga agatgcggcc gtcgctagag 840
agagctgcgc tggcgacgct gtagtcttca gagatgggga tgctgttgat tgtagccgtt 900
gctctttcaa tgagggtgga ttcttcttga gacaaaggct tggccatggt ttagttcctc 960
accttgtcgt attatactat gccgatatac tatgccgatg attaattgtc aacacgtgct 1020
gatcagatcc gaaaatggat atacaagctc ccgggagctt tttgcaaaag cctaggcctc 1080
caaaaaagcc tcctcactac ttctggaata gctcagaggc agaggcggcc tcggcctctg 1140
cataaataaa aaaaattagt cagccatggg gcggagaatg ggcggaactg ggcggagtta 1200
ggggcgggat gggcggagtt aggggcggga ctatggttgc tgactaattg agatgcatgc 1260
tttgcatact tctgcctgct ggggagcctg gggactttcc acacctggtt gctgactaat 1320
tgagatgcat gctttgcata cttctgcctg ctggggagcc tggggacttt ccacacccta 1380
actgacacac attccacaga attaattcgc gttaaatttt tgttaaatca gctcattttt 1440
taaccaatag gccgaaatcg gcaaaatccc ttataaatca aaagaataga ccgagatagg 1500
gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt 1560
caaagggcga aaaaccgtct atcagggcga tggcccacta cgtgaaccat caccctaatc 1620
aagttttttg gggtcgaggt gccgtaaagc actaaatcgg aaccctaaag ggagcccccg 1680
atttagagct tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa 1740
aggagcgggc gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc 1800
cgccgcgctt aatgcgccgc tacagggcgc gtggggatac cccctagagc cccagctggt 1860
tctttccgcc tcagaagcca tagagcccac cgcatcccca gcatgcctgc tattgtcttc 1920
ccaatcctcc cccttgctgt cctgccccac cccacccccc agaatagaat gacacctact 1980
cagacaatgc gatgcaattt cctcatttta ttaggaaagg acagtgggag tggcaccttc 2040
cagggtcaag gaaggcacgg gggaggggca aacaacagat ggctggcaac tagaaggcac 2100
agtcgaggct gatcagcggg tttaaactca atggtgatgg tgatgatgac cggtacgcgt 2160
agaatcgaga ccgaggagag ggttagggat aggcttacct tcgaagggcc cctagtcgcc 2220
gccgagctga gacaggtcga tgcgagtctc gtacagtccg gtaattgact ggtgtatcag 2280
ggtggcatcg agaacttctt tggtagaggt gtaccgcttc ctgtcaatag ttgtatcgaa 2340
atacttgaag gcagcaggag cgcccagatt agtcagagta aagaggtgga taatattctc 2400
tgcttgttcg cgaattggct tgtccctgtg cttattatat gcgctcagca ctttatcgag 2460
gtttgcatcg gccagaataa cccgcttgct gaactcgcta atctgttcaa tgatttcgtc 2520
caggtagtgt ttatgttgct caacaaagag ttgcttctgc tcattgtctt cagggctacc 2580
tttgagtttc tcgtagtggg aggccagata caggaagttc acgtatttgg agggcagagc 2640
cagctcgttt cctttctgca gctctccggc ggaggccagc atccgcttcc taccattctc 2700
cagctcaaag agagagtact tgggcagttt gatgatgaga tctttcttca cttctttata 2760
gcccttagct tccaggaaat cgattggatt cttctcgaag ctggatctct ccataatagt 2820
aattccgagc agctccttaa cagacttgag tttcttggac ttgcctttct ccacttttgc 2880
cacgaccaga acggaataag ccactgtagg ggaatcgaaa ccgccatact tctttgggtc 2940
ccaatctttc ttcctggcga tcagcttgtc agagttccgc tttggcagga tgctctcctt 3000
tgagaatccg ccggtctgca cttcggtctt cttcacgata ttgacttgtg gcatggacag 3060
caccttccgc acagttgcga agtccctgcc tttatcccac acgatttctc ctgtttctcc 3120
gtttgtttcg atcagtgggc gcttccggat ttcgccgtta gccagggtta tctcagtctt 3180
aaagaaattc atgatattag agtagaagaa gtacttggcg gtggctttgc caatctcttg 3240
ctcagacttt gctatcatct tcctcacatc gtagacttta tagtcaccgt acacgaactc 3300
agactccagt ttagggtatt tcttgatcag ggcggtgcca acgacagcat tgagataggc 3360
atcgtgagca tgatggtaat tgtttatttc gcgaactttg tagaattgaa agtccttccg 3420
gaagtcagac accagcttgc tcttcagagt tatcactttc acttccctga tcagcttatc 3480
gttctcatcg tacttagtgt tcatcctaga gtcgaggatt tgtgccacgt gtttggtaat 3540
ctggcgtgtt tcgaccagtt gcctcttaat aaagccggcc ttgtcgagtt cgctcagacc 3600
tcctctttct gccttagtca gattgtcaaa cttccgctgg gtgatcagtt tggcgttgag 3660
gagctgccgc cagtaattct tcatcttctt gaccacctct tctgatggaa cattgtcaga 3720
cttaccgcga ttcttatcgg atctggtcag caccttgttg tcaatggagt catctttgag 3780
gaaggactgt ggaacaatat ggtccacgtc ataatcggac agccggttga tgtcgagttc 3840
ctggtcaacg tacatgtccc gcccgttctg gaggtagtac aggtagagtt tctcgttctg 3900
gagctgtgta ttctccacag ggtgctcctt cagtatctga gatcccagct ccttaattcc 3960
ctcttcgatt cttttcatcc gttcccgaga gttcttctgg cccttctggg tggtttggtt 4020
ctcccttgcc atttcgataa cgatattctc tggcttgtgc cgacccatca ctttgacgag 4080
ttcgtccacg accttgactg tctgcagtat tcccttcttt atggcgggtg atccagcgag 4140
gttggcgatg tgctcgtgca ggctgtcgcc ttgaccgctc acctgtgcct tctggatgtc 4200
ctctttaaat gtcagagagt catcgtgaat cagttgcatg aagttcctgt tagcgaatcc 4260
gtcggatttc aggaaatcca ggatggtctt tccgctctgt ttgtcgcgga tgccgtttat 4320
gagtttcctg gagagtctac cccacccagt gtagcgccgc cgcttgagct gtttcatgac 4380
tttatcgtca aacagatggg cataggtctt caggcgctct tcgatcatct ctctatcctc 4440
gaacagagtc agggtcagca cgatatcttc caggatgtcc tcgttctcct cattatcgag 4500
gaaatctttg tctttgatta tcttcagcag atcatggtaa gtgcccaggc tggcattaaa 4560
gcggtcctcc acgccagaga tttccactga gtcaaagcat tcgatcttct taaagtaatc 4620
ctccttgagc tgcttcactg tcacctttct attagtcttg aagagcagat caacgatagc 4680
cttcttctgc tctccggaca ggaaggcagg cttcctcatg ccctcggtca cgtacttcac 4740
tttagtcagc tcgttataga cggtgaaata ctcgtacagg agtgaatgtt tgggcaggac 4800
cttctcgttg ggcaggttct tatcgaaatt ggtcatccgt tcgatgaatg actgggcgct 4860
tgcgccctta tccacgacct cttcgaagtt ccaaggagta attgtctcct cagatttcct 4920
ggtcatccaa gcgaagcggg agttgcctct agccagaggg ccgacgtaat aagggatcct 4980
gaaggtcagg atcttctcta tcttctcccg gttatccttc aggaaaggat agaaatcctc 5040
ctgcctgcgg aggattgcat gcagctctcc caggtgtatc tgatgtggaa tggagccatt 5100
atcaaaggtc ctctgcttcc tcagcaggtc ctccctgttc agcttcacca gcagctcttc 5160
agtaccgtcc atcttctcga ggattggttt gatgaacttg taaaattctt cctgtgatgc 5220
tccgccatcg atgtatccgg catatccatt cttgctctgg tcgaagaata tctctttgta 5280
cttctctggc agctgttgcc tcacgagggc tttgagcaga gtcaggtctt gatggtgttc 5340
atcatagcgt tttatcatgg aggcgctcag aggtgctttg gtgatctcag tgttgacccg 5400
gagtatgtcg ctcagcagaa tggcgtcgga gagattctta gcagccagaa agagatcggc 5460
gtactggtcg cctatctgtg cgagcaggtt gtccagatca tcgtcatagg tgtccttgga 5520
gagctggagt ttagcatctt cggccagatc aaaattggac ttgaagttag gtgtcaggcc 5580
caggctcagg gcgatgaggt tcccaaacag gccgttcttc ttttctcctg gcagttgggc 5640
aatcagattc tccagtctgc gtgacttgga cagccgagcg gacagaatag ccttggcatc 5700
cacaccagaa gcgtttatgg gattctcctc gaacagttgg ttatatgtct gcaccagttg 5760
aatgaagagt ttatccacat cggaattatc gggattcagg tcgccctcga tcagaaagtg 5820
tcctctaaac tttatcatat gagccagggc cagatagatg agcctcaggt ctgctttatc 5880
ggtgctgtcc accagcttct tcctcagatg gtagattgta ggatactttt catggtaagc 5940
cacctcatcc acgatatttc cgaatatagg gtgcctctcg tgtttcttat cctcctccac 6000
cagaaagctc tcttccaggc ggtgaaagaa ggagtcgtcc accttagcca tttcgttgct 6060
aaagatctct tgcagataac atatccgatt cttgcggcgg gtgtatctcc gccttgcggt 6120
ccgcttcagc cgagtagctt cagcggtttc accggagtcg aagaggagtg ctccgatcag 6180
gttcttcttg attgaatggcggtcagtatt acccagcacc ttgaatttct tgcttggcac 6240
cttatactcg tcggttatga cggcccagcc aacggagttt gtcccgatat ccagtccaat 6300
agagtatttc ttgtctctag tgtgggtccg ctggtgtctg gtcagagcac cagactgaga 6360
gaaagattta ccacactctg ggcatttgta tggcttctcg ccgggttcca gtctagattt 6420
atcgtcgtca tccttgtagt cagcggccgc caccttcctc tttttcttag gtcccatggt 6480
gctagccagc ttgggtctcc ctatagtgag tcgtattaat ttcgataagc cagtaagcag 6540
tgggttctct agttagccag agagctctgc ttatatagac ctcccaccgt acacgcctac 6600
cgcccatttg cgtcaatggg gcggagttgt tacgacattt tggaaagtcc cgttgatttt 6660
ggtgccaaaa caaactccca ttgacgtcaa tggggtggag acttggaaat ccccgtgagt 6720
caaaccgcta tccacgccca ttgatgtact gccaaaaccg catcaccatg gtaatagcga 6780
tgactaatac gtagatgtac tgccaagtag gaaagtccca taaggtcatg tactgggcat 6840
aatgccaggc gggccattta ccgtcattga cgtcaatagg gggcgtactt ggcatatgat 6900
acacttgatg tactgccaag tgggcagttt accgtaaata ctccacccat tgacgtcaat 6960
ggaaagtccc tattggcgtt actatgggaa catacgtcat tattgacgtc aatgggcggg 7020
ggtcgttggg cggtcagcca ggcgggccat ttaccgtaag ttatgtaacg cggaactcca 7080
tatatgggct atgaactaat gaccccgtaa ttgattacta ttaataacta gtcaataatc 7140
aatgtcaacg cgtatatctg gcccgtacat cgcgaagcag cgcaaaacgc ctaaccctaa 7200
gcagattctt catgcaattg tcggtcaagc cttgccttgt tgtagcttaa attttgctcg 7260
cgcactactc agcgacctcc aacacacaag cagggagcag atactggctt aactatgcgg 7320
catcagagca gattgtactg agagtgcacc ataggggatc gggagatctc ccgatccgtc 7380
gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta 7440
aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata 7500
ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc 7560
ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga 7620
agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct 7680
tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg 7740
tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta 7800
ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat 7860
gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt 7920
acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga 7980
tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga 8040
gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat taactggcga 8100
actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc 8160
aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc 8220
cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg 8280
tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat 8340
cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata 8400
tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct 8460
ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 8520
ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 8580
cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 8640
aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgttcttct 8700
agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 8760
tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 8820
ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 8880
cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 8940
atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 9000
ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 9060
tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 9120
gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 9180
gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 9240
cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 9300
gagcgaggaa gcggaag 9317
<210>8
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tggcaaggct tagagtggtg a 21
<210>9
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
agcagtggtc agggtgaaac a 21
<210>10
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
<210>11
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
<210>12
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
accgctgtcc agtgaccagc gtac 24
<210>13
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
aaacgtacgc tggtcactgg acag 24
<210>14
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
accgtcgggc cacggccggt acgc 24
<210>15
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
aaacgcgtac cggccgtggc ccga 24
<210>16
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
accgacggcc ggtacgctgg tcac 24
<210>17
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
aaacgtgacc agcgtaccgg ccgt 24
<210>18
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
accgggtacg ctggtcactg gaca 24
<210>19
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
aaactgtcca gtgaccagcg tacc 24
<210>20
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
cggccggtac gctggtcact ggacagggga tg 32
<210>21
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
cggccggtcg ctggtcactg gacaggggat g 31
<210>22
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
cggccggtac tggacagggg atg 23
<210>23
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
cggccggtag ctggtcactg gacaggggat g 31
<210>24
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
cggccggtac tggtcactgg acaggggatg 30
<210>25
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
cggccggtag gtcactggac aggggatg 28
<210>26
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>26
accttctcgg gccacggccg gtacgctggt ca 32
<210>27
<211>14
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
<210>28
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>28
accttctcgg gccacggccg gtcgctggtc a 31
<210>29
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
accttctcgg gccacggccg gtagctggtc a 31
<210>30
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
accttctcgg gccacggccg gta 23
<210>31
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
accttctcgg gccacggccg gtactggtca 30
<210>32
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
accttctcgg gccacggccg cgctggtca 29
<210>33
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
accttctcgg gccacggccg gtaggtca 28
<210>34
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
cgggccacgg ccggtacgct ggtcactgga ca 32
<210>35
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>35
cgggccacgg ccggtacgct ggaca 25
<210>36
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>36
cgggccacgg ccggtacgct gcactggaca 30
<210>37
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>37
cgggccacgg ccggtacgct ggtggaca 28
<210>38
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>38
cgggccacgg ccggtacgct ggtactggac a 31
<210>39
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>39
cgggccacgg ccggtacgct ggtctggaca 30
<210>40
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>40
cgggccacgg ccggtacgct ggtttggaca 30
<210>41
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>41
cgggccacgg ccggtactgg aca 23
<210>42
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>42
<210>43
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>43
<210>44
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>44
<210>45
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>45
<210>46
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>46
<210>47
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>47
a 1
<210>48
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>48
<210>49
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>49
<210>50
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>50
<210>51
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>51
<210>52
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>52
<210>53
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>53
a 1
<210>54
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>54
<210>55
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>55
ta 2
<210>56
<211>3
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>56
<210>57
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>57
<210>58
<211>5
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>58
<210>59
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>59
<210>60
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>60
<210>61
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>61
<210>62
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>62
<210>63
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>63
<210>64
<211>3
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>64
<210>65
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>65
<210>66
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>66
<210>67
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>67
a 1
<210>68
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>68
<210>69
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>69
<210>70
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>70
<210>71
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>71
a 1
<210>72
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>72
<210>73
<211>8
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>73
<210>74
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>74
<210>75
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>75
<210>76
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>76
<210>77
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>77
<210>78
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>78
<210>79
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>79
<210>80
<211>1
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>80
<210>81
<211>2
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>81