阅读说明：本技术 Hsd17b13表达的调节剂 (Modulators of HSD17B13 expression ) 是由 S·M·弗雷尔 S·F·默里 于 2019-12-20 设计创作，主要内容包括：本发明提供了可用于抑制HSD17B13表达的方法、化合物和组合物。这样的化合物、组合物和方法可用于治疗、预防或缓解与HSD17B13相关的疾病。(The present invention provides methods, compounds and compositions useful for inhibiting expression of HSD17B 13. Such compounds, compositions and methods are useful for treating, preventing or ameliorating diseases associated with HSD17B 13.)

1. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence comprising SEQ ID NO: a nucleobase sequence of at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any one of the nucleobase sequences of 8-2896.

2. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence comprising SEQ ID NO: 8-2896 in the sequence of any nucleobase.

3. A compound comprising a modified oligonucleotide having a sequence consisting of SEQ ID NO: 8-2896 in a sequence.

4. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 contiguous nucleobases that is complementary to a nucleobase sequence of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the equivalent length of the nucleobase sequence of 3439-: 2 are at least 85%, at least 90%, at least 95%, or 100% complementary.

5. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence comprising SEQ ID NO: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595 and 819.

6. A compound comprising a modified oligonucleotide having a sequence consisting of SEQ ID NO: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595 and 819.

7. The compound of any one of claims 1-6, wherein the oligonucleotide hybridizes to SEQ ID NO: 2 are at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary.

8. The compound of any one of claims 1-7, wherein the modified oligonucleotide comprises at least one modification selected from: at least one modified internucleoside linkage, at least one modified nucleoside comprising a modified sugar moiety, and at least one modified nucleoside comprising a modified nucleobase.

9. The compound of claim 8, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

10. The compound of claim 8 or 9, wherein at least one nucleoside of the modified oligonucleotide is a 2' -substituted nucleoside or a bicyclic nucleoside.

11. The compound of claim 10, wherein the bicyclic sugar portion of the bicyclic nucleoside is selected from the group consisting of: 4' - (CH)₂)-O-2′(LNA)；4′-(CH₂)₂-O-2' (ENA); and 4' -CH (CH)₃)-O-2′(cEt)。

12. The compound of any one of claims 8-11, wherein the modified nucleoside is a 2' -O-methoxyethyl nucleoside.

13. The compound of any one of claims 8-12, wherein the modified nucleobase is a 5-methylcytosine.

14. The compound of any one of claims 1-13, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the notch segment is positioned immediately adjacent to and between the 5 'wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

15. The compound of any one of claims 1-14, wherein the modified sugar moiety of each nucleoside of each wing segment is selected from the group consisting of 2 'O-Me, 2' -MOE and cEt sugar moieties.

16. The compound of any one of claims 1-15, wherein the modified oligonucleotide comprises:

A gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the nicked segment is located between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

17. The compound of any one of claims 1-16, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the nicked segment is located between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

18. The compound of any one of claims 1-15, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2' -deoxynucleosides;

A 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt nucleoside; wherein the sugar moiety of the nucleoside of the 3 ' wing segment is 5 ' -cEt-MOE-3 '; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

19. The compound of any one of claims 1-15, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt nucleoside; wherein each sugar moiety of the nucleoside of the 3 'wing segment is selected from a cEt and a 2' -MOE sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

20. The compound of any one of claims 1-15, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nicked segment consists of 5 ' -one deoxy, one 2 ' -O-methyl nucleoside, and eight deoxy nucleoside-3 ', wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

21. The compound of any one of claims 1-15, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the notch segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nucleosides of the notch segment are selected from deoxynucleosides, cEt nucleosides, and 2 ' -MOE nucleosides, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

22. The compound of any one of claims 1-21, wherein the compound is single-stranded.

23. The compound of any one of claims 1-21, wherein the modified oligonucleotide hybridizes to a second oligonucleotide to form a double-stranded antisense compound.

24. The compound of any one of claims 1-23, wherein at least one nucleotide of the modified oligonucleotide is a ribonucleotide.

25. The compound of any one of claims 1-23, wherein at least one nucleotide of the modified oligonucleotide is a deoxyribonucleotide.

26. The compound of any one of claims 1-25, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

27. The compound of any one of claims 1-25, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.

28. The compound of any one of claims 1-25, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

29. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595 and 819, wherein the modified oligonucleotide comprises:

A gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

30. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448 and 1595, wherein the modified oligonucleotide comprises a nucleobase sequence of any one of

A gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the notch segment is located between the 5 'wing segment and the 3' wing segment; wherein the 5 'wing segment and the 3' wing segment comprise a cEt saccharide; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

31. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence consisting of SEQ ID NO: 819, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt sugar; wherein the sugar residue of the nucleoside of the 3 ' wing segment is 5 ' -cEt-MOE-3 '; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

32. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence consisting of SEQ ID NO: 1595, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

A 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nicked segment consists of 5 ' -one deoxy, one 2 ' -O-methyl nucleoside, and eight deoxy nucleoside-3 ', wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

33. The compound of any preceding claim, comprising a conjugate group.

34. The compound of claim 33, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

35. The compound of claim 33 or claim 34, wherein the conjugate group comprises a conjugate linker consisting of a single bond.

36. The compound of any one of claims 33-35, wherein the conjugate group comprises a cleavable linker.

37. The compound of any one of claims 33-36, wherein the conjugate group comprises a conjugate linker comprising 1-3 linker nucleosides.

38. The compound of any one of claims 33-37, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

39. The compound of any one of claims 33-37, wherein the conjugate group is attached to the modified oligonucleotide at the 3' terminus of the modified oligonucleotide.

40. A compound according to the chemical structure:

(SEQ ID NO: 286), or a salt thereof.

41. A compound according to the chemical structure:

(SEQ ID NO：286)。

42. a compound according to the chemical structure:

(SEQ ID NO: 817), or a salt thereof.

43. A compound according to the chemical structure:

(SEQ ID NO：817)。

44. a compound according to the chemical structure:

(SEQ ID NO: 983), or a salt thereof.

45. A compound according to the chemical structure:

(SEQ ID NO：983)。

46. a compound according to the chemical structure:

(SEQ ID NO: 1215), or a salt.

47. A compound according to the chemical structure:

(SEQ ID NO：215)。

48. a compound according to the chemical structure:

(SEQ ID NO: 747), or a salt thereof.

49. A compound according to the chemical structure:

(SEQ ID NO：747)。

50. a compound according to the chemical structure:

(SEQ ID NO: 43), or a salt.

51. A compound according to the chemical structure:

(SEQ ID NO：43)。

52. a compound according to the chemical structure:

(SEQ ID NO: 355), or a salt thereof.

53. A compound according to the structure:

(SEQ ID NO：355)。

54. a compound according to the chemical structure:

(SEQ ID NO: 1602), or a salt thereof.

55. A compound according to the chemical structure:

(SEQ ID NO：1602)。

56. a compound according to the chemical structure:

(SEQ ID NO: 201), or a salt.

57. A compound according to the chemical structure:

(SEQ ID NO：201)。

58. a compound according to the chemical structure:

(SEQ ID NO: 734), or a salt thereof.

59. A compound according to the chemical structure:

(SEQ ID NO：734)。

60. a compound according to the chemical structure:

(SEQ ID NO: 1249), or a salt thereof.

61. A compound according to the chemical structure:

(SEQ ID NO：1249)。

62. a compound according to the chemical structure:

(SEQ ID NO: 513), or a salt thereof.

63. A compound according to the chemical structure:

(SEQ ID NO：513)。

64. A compound according to the chemical structure:

(SEQ ID NO: 1449), or a salt thereof.

65. A compound according to the chemical structure:

(SEQ ID NO：1449)。

66. a compound according to the chemical structure:

(SEQ ID NO: 1448), or a salt.

67. A compound according to the chemical structure:

(SEQ ID NO：1448)。

68. a compound according to the chemical structure:

(SEQ ID NO: 1595), or a salt thereof.

69. A compound according to the chemical structure:

(SEQ ID NO：1595)。

70. a compound according to the chemical structure:

(SEQ ID NO: 819), or a salt thereof.

71. A compound according to the chemical structure:

(SEQ ID NO：819)。

72. a compound according to the chemical structure:

(SEQ ID NO: 1595), or a salt thereof.

73. A compound according to the chemical structure:

(SEQ ID NO：1595)。

74. a compound according to the chemical structure:

(SEQ ID NO: 208), or a salt.

75. A compound according to the chemical structure:

(SEQ ID NO：208)。

76. the compound of any one of claims 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, and 74, wherein the compound is a sodium salt.

77. The compound of any one of claims 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, and 74, wherein the compound is a potassium salt.

78. The chirally enriched population of compounds of any of claims 1-77, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

79. The chirally enriched population of claim 78, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Sp) configuration.

80. The chirally enriched population of claim 78 or claim 79, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a (Rp) configuration.

81. The chirally enriched population of claim 78, wherein the population is enriched for compounds having modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

82. The chirally enriched population of claim 81, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having a (Sp) configuration at each phosphorothioate internucleoside linkage.

83. The chirally enriched population of claim 81, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having (Rp) configuration at each phosphorothioate internucleoside linkage.

84. The chirally enriched population of claim 78 or claim 81, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the 5 'to 3' direction with the Sp-Sp-Rp configuration.

85. A population of oligomeric compounds having the modified oligonucleotide of any one of claims 1-84, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotide are atactic.

86. A composition comprising the compound of any one of claims 1-85, and a pharmaceutically acceptable carrier.

87. A composition comprising a compound as claimed in any preceding claim, for use in therapy.

88. A method of treating a disease associated with HSD17B13 in a subject, comprising administering to the subject a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby treating the disease.

89. A method comprising administering to an individual a compound of any one of claims 1-85 or a composition of claim 86 or claim 87.

90. The method of claim 88 or claim 89, wherein the subject has liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

91. The method of claim 88 or claim 89, wherein the compound is an antisense compound.

92. The method of any one of claims 88-91, wherein administering the compound alleviates liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver enlargement, elevated transaminases, or liver fat accumulation in the individual.

93. A method of inhibiting HSD17B13 expression in a cell, comprising contacting said cell with a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby inhibiting HSD17B13 expression in said cell.

94. The method of claim 93, wherein the cell is located in the liver of the individual.

95. The method of claim 94, wherein the individual has or is at risk of having: liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

96. A method of ameliorating liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminase, or liver fat deposition in an individual, the method comprising administering to the individual a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby ameliorating liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminase, or liver fat deposition in the individual.

97. The method of claim 96, wherein the individual has or is at risk of having: liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

98. The method of any one of claims 96-97, wherein the compound is an antisense compound.

99. The method of any one of claims 96-98, wherein the compound is the compound of any one of claims 1-85 or the composition of claim 86 or claim 87.

100. The method of claim 98 or 99, wherein the compound or composition is administered parenterally.

101. Use of a compound comprising a modified oligonucleotide complementary to HSD17B13 for treating a disease associated with HSD17B 13.

102. The use of claim 101, wherein the disease is liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

103. The use of claim 101 or 102, wherein the compound is an antisense compound.

104. The use according to any one of claims 101-103, wherein the compound is a compound according to any one of claims 1-85 or a composition according to claim 86 or claim 87.

105. Use of a compound comprising a modified oligonucleotide complementary to HSD17B13 in the manufacture of a medicament for the treatment of a disease associated with HSD17B 13.

106. The use of claim 105, wherein the disease is liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

107. The use of claim 105 or 106, wherein the compound is an antisense compound.

108. The use of any one of claims 105-107, wherein the compound is a compound of any one of claims 1-85 or a composition of claim 86 or claim 87.

Technical Field

This example provides methods, compounds, and compositions that are useful for inhibiting the expression of hydroxysteroid 17-beta dehydrogenase 13(LOC 345275; 17-beta hydroxysteroid dehydrogenase; HSD17B 13; HSD17 beta 13) and, in some cases, reducing the amount of HSD17B13 protein in a cell or animal, which is useful for treating, preventing, or ameliorating diseases associated with HSD17B 13.

Background

Nonalcoholic fatty liver disease (NAFLD) encompasses a range of liver diseases ranging from steatosis to nonalcoholic steatohepatitis (NASH) and cirrhosis. NAFLD is defined as fat accumulation in the liver of more than 5% by weight, lack of significant alcohol consumption, lipogenic drug therapy or genetic disorders (kotrenen et al, Arterioscler thrombomb. vasc. biol. [ atherosclerosis, thrombosis and vascular biology ]2008, 28: 27-38).

Nonalcoholic steatohepatitis (NASH) is NAFLD with signs of inflammation and liver injury. NASH is histologically defined by vesicular steatosis, hepatocellular ballooning degeneration and lobular inflammatory infiltration (Sanyal, hepatol.res. [ hepatology study ] 2011.41: 670-4). NASH is estimated to affect 2% -3% of the general population. In the presence of other pathologies, such as obesity or diabetes, the estimated prevalence increases to 7% and 62%, respectively (Hashimoto et al, j.gastroenterol. [ J.gastroenterology ]2011.46 (1): 63-69).

Disclosure of Invention

Certain embodiments provided herein are compounds and methods for reducing the amount or activity of HSD17B13 mRNA, and in certain embodiments, HSD17B13 protein in a cell or animal. In certain embodiments, the animal has liver disease. In certain embodiments, the disease is NASH. In certain embodiments, the disease is Alcoholic Steatohepatitis (ASH). In certain embodiments, the disease is NAFLD. In certain embodiments, the disease is hepatic steatosis. In certain embodiments, the disease is cirrhosis. In certain embodiments, the disease is hepatocellular carcinoma. In certain embodiments, the disease is alcoholic liver disease. In certain embodiments, the disease is HCV hepatitis. In certain embodiments, the disease is chronic hepatitis. In certain embodiments, the disease is hereditary hemochromatosis. In certain embodiments, the disease is primary sclerosing cholangitis. Certain compounds provided herein relate to compounds and compositions that reduce liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver enlargement, elevated transaminases, or liver fat accumulation in an animal.

Certain embodiments provided herein relate to potent and tolerable compounds and compositions for inhibiting HSD17B13 expression, which are useful for treating, preventing, ameliorating, or slowing the progression of liver disease. Certain embodiments provided herein relate to compounds and compositions that are more potent or of greater therapeutic value than the disclosed compounds.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of embodiments as claimed. In this document, the use of the singular includes the plural unless explicitly stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records, are directed to, and are expressly incorporated by reference herein in their entirety.

It is understood that the sequences set forth in each SEQ ID NO in the examples contained herein are independent of any modification to the sugar moiety, internucleoside linkage, or nucleobase. Thus, the compounds defined by SEQ ID NOs may independently include one or more modifications to the sugar moiety, the internucleoside linkage, or the nucleobase. The compounds described by ION numbering indicate combinations of nucleobase sequences, chemical modifications, and motifs.

Definition of

Unless otherwise indicated, the following terms have the following meanings:

"2 ' -deoxyfuranosyl sugar moiety" or "2 ' -deoxyfuranosyl sugar" refers to a furanosyl sugar moiety having two hydrogens at the 2 ' -position. The 2 '-deoxyfuranosyl sugar moiety can be unmodified or modified, and can be substituted or unsubstituted at a position other than the 2' -position. In the context of oligonucleotides, the β -D-2 '-deoxyribose sugar moiety is an unsubstituted, unmodified 2' -deoxyfuranosyl group, and is present in natural deoxyribonucleic acid (DNA).

By "2 '-deoxynucleoside" is meant a nucleoside comprising a 2' -h (h) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2' -deoxynucleoside can comprise a modified nucleobase or can comprise an RNA nucleobase (uracil).

"2 ' -O-methoxyethyl" (also known as 2 ' -MOE) means 2 ' -O (CH)₂)₂-OCH₃) A 2' -OH group instead of the ribose ring. The 2' -O-methoxyethyl modified sugar is a modified sugar.

By "2 ' -MOE nucleoside" (also a 2 ' -O-methoxyethyl nucleoside) is meant a nucleoside comprising a 2 ' -MOE modified sugar moiety.

"2 ' -substituted nucleoside" or "2-modified nucleoside" means a nucleoside comprising a 2 ' -substituted or 2 ' -modified sugar moiety. As used herein, "2 '-substituted" or "2-modified" with respect to a sugar moiety means a sugar moiety comprising at least one 2' -substituent group other than H or OH.

By "3 'target site" is meant the nucleotide of the target nucleic acid that is complementary to the most 3' nucleotide of a particular compound.

"5 'target site" refers to a nucleotide of a target nucleic acid that is complementary to the most 5' nucleotide of a particular compound.

"5-methylcytosine" means cytosine having a methyl group attached to the 5-position.

"about" means within ± 10% of a certain value. For example, if "these compounds affect about 70% inhibition of HSD17B 13" is indicated, it implies that HSD17B13 levels are inhibited in the range of 60% and 80%.

"administration" or "administering" refers to the route by which a compound or composition provided herein is introduced into a subject's body to perform its intended function. Examples of routes of administration that may be used include, but are not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

By "simultaneous administration" or "co-administration" is meant the administration of two or more compounds in any way in which the pharmacological effects of the two drugs are manifested in the patient. Simultaneous administration does not require that the two compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or simultaneously. The action of the two compounds need not manifest itself at the same time. These effects need only overlap for a period of time and need not be coextensive. Simultaneous administration or co-administration encompasses concurrent or sequential administration.

"amelioration" refers to an improvement or reduction in at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes delay or slowing of the progression or severity of one or more indicators of a condition or disease. The progression or severity of an index can be determined by subjective or objective measures known to those skilled in the art.

By "animal" is meant a human or non-human animal, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates (including but not limited to monkeys and chimpanzees).

By "antisense activity" is meant any detectable and/or measurable activity attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or the target protein as compared to the level of the target nucleic acid or the level of the target protein encoded by such target nucleic acid in the absence of the antisense compound of the target.

By "antisense compound" is meant a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or an end group. Examples of antisense compounds include single-and double-stranded compounds, such as oligonucleotides, ribozymes, siRNA, shRNA, ssRNA, and occupancy-based compounds.

"antisense inhibition" means a decrease in the level of a target nucleic acid in the presence of an antisense compound that is complementary to the target nucleic acid, as compared to the level of the target nucleic acid in the absence of the antisense compound.

"antisense mechanisms" are all those mechanisms involving hybridization of a compound to a target nucleic acid, wherein the result or effect of hybridization is target degradation or target occupancy, accompanied by a cessation of cellular machinery involved, e.g., transcription or splicing.

"antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid or a region or segment thereof. In certain embodiments, the antisense oligonucleotide can specifically hybridize to a target nucleic acid or a region or segment thereof.

By "bicyclic nucleoside" or "BNA" is meant a nucleoside comprising a bicyclic sugar moiety. By "bicyclic sugar" or "bicyclic sugar moiety" is meant a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

By "branching group" is meant a group of atoms having at least 3 positions capable of forming covalent linkages with at least 3 groups. In certain embodiments, the branching groups provide multiple reactive sites for attaching the tethering ligand to the oligonucleotide via a conjugate linker and/or cleavable moiety.

By "cell-targeting moiety" is meant a moiety or moieties of a conjugate group that is capable of binding to a particular cell type or cell types.

"cEt" or "constrained ethyl" means a ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4 '-carbon and the 2' -carbon, wherein the bridge is of the formula: 4' -CH (CH)₃) -O-2', and wherein the methyl group of the bridge is in S configuration.

By "cEt nucleoside" is meant a nucleoside comprising a cEt modified sugar moiety.

"chemical modification" in a compound describes a substitution or alteration by a chemical reaction of any unit in the compound, relative to the initial state of such unit. "modified nucleoside" means a nucleoside independently having a modified sugar moiety and/or a modified nucleobase. By "modified oligonucleotide" is meant an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.

"chemically distinct region" refers to a region of a compound that is chemically different to some extent from another region of the same compound. For example, a region with 2 '-O-methoxyethyl nucleotides is chemically different from a region with nucleotides without 2' -O-methoxyethyl modifications.

By "chimeric antisense compound" is meant an antisense compound having at least 2 chemically distinct regions, each position having multiple subunits.

By "cleavable bond" is meant any chemical bond that is capable of being separated. In certain embodiments, the cleavable bond is selected from: an amide, a polyamide, an ester, an ether, a phosphodiester, a phosphate ester, or an ester, a carbamate, a disulfide, or a peptide of one or both.

By "cleavable moiety" is meant a bond or group of atoms that is cleaved under physiological conditions, e.g., in a cell, animal or human.

"complementary" with respect to an oligonucleotide means that the nucleobase sequence of such an oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposite directions. As described herein, nucleobase matching or complementary nucleobases are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (A) ^mC) And guanine (G), unless otherwise indicated. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. In contrast, "complete complementarity" or "100% complementarity" with respect to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

By "conjugate group" is meant a set of atoms attached to an oligonucleotide. The conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

By "conjugate linker" is meant a group of atoms comprising at least one bond connecting the conjugate moiety to the oligonucleotide.

By "conjugate moiety" is meant a group of atoms attached to an oligonucleotide through a conjugate linker.

In the context of oligonucleotides, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages in close proximity to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

"design" or "designed to" refers to the process of designing a compound that specifically hybridizes to a selected nucleic acid molecule.

By "diluent" is meant a component of the composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in the injectable composition may be a liquid, such as a saline solution.

"differently modified" means chemically modified or chemically substituted differently from one another, including the absence of modification. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are "differentially modified," although the DNA nucleoside is unmodified. Likewise, DNA and RNA are "differentially modified", even though both are naturally occurring unmodified nucleosides. The same nucleoside is not modified differently except for containing different nucleobases. For example, a nucleoside comprising a 2 '-OMe modified sugar and an unmodified adenine nucleobase is not differently modified from a nucleoside comprising a 2' -OMe modified sugar and an unmodified thymidylate nucleobase.

By "dose" is meant a specified amount of a compound or agent provided in a single administration, or over a specified period of time. In certain embodiments, the dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume that is not readily provided by a single injection. In such embodiments, two or more injections may be used to achieve the desired dosage. In certain embodiments, the dose may be administered in two or more injections to minimize injection site reactions in the individual. In other embodiments, the compound or agent is administered by infusion over an extended period of time or continuously. The dose may be indicated as the amount of the medicament per hour, day, week or month.

A "dosing regimen" is a combination of doses designed to achieve one or more desired effects.

By "double-stranded antisense compound" is meant an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

By "effective amount" is meant an amount of a compound sufficient to achieve a desired physiological result in a subject in need thereof. The effective amount may vary between individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, the assessment of the medical condition of the individual, and other relevant factors.

By "efficacy" is meant the ability to produce a desired effect.

"expression" includes all functions whereby the coding information of a gene is converted into a structure that is present in and operates in a cell. Such structures include, but are not limited to, products of transcription and translation.

By "Gapmer" is meant an oligonucleotide comprising an inner region of nucleosides that support rnase H cleavage positioned between an outer region having one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from the nucleoside or nucleosides comprising the outer region. The inner region may be referred to as a "gap" and the outer region may be referred to as a "wing".

"HSD 17B 13" means any nucleic acid or protein of HSD17B 13. By "HSD 17B13 nucleic acid" is meant any nucleic acid encoding HSD17B 13. For example, in certain embodiments, the HSD17B13 nucleic acid comprises a DNA sequence encoding HSD17B13, an RNA sequence transcribed from DNA encoding HSD17B13 (including genomic DNA containing introns and exons), and an mRNA sequence encoding HSD17B 13. "HSD 17B13 mRNA" means mRNA encoding HSD17B13 protein. Targets may be represented by upper case letters or lower case letters.

By "HSD 17B 13-specific inhibitor" is meant any agent capable of specifically inhibiting, at the molecular level, the expression or activity of HSD17B13 RNA and/or HSD17B13 protein. For example, HSD17B 13-specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of HSD17B13 RNA and/or HSD17B13 protein.

"hybridization" means annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which may be Watson-Crick (Watson-Crick), Hustein (Hoogsteen), or reverse Hustein hydrogen bonding. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

By "immediately adjacent" is meant that there are no intervening elements between immediately adjacent elements of the same species (e.g., there are no intervening nucleobases between immediately adjacent nucleobases).

By "individual" is meant a human or non-human animal selected for treatment or therapy.

"inhibiting expression or activity" refers to a reduction or blocking of expression or activity relative to expression or activity in an untreated or control sample, and does not necessarily indicate complete abolition of expression or activity.

By "internucleoside linkage" is meant a group or linkage that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. By non-phosphate linkage is meant herein a modified internucleoside linkage.

"extended oligonucleotides" are those having one or more additional nucleosides relative to an oligonucleotide (e.g., a parent oligonucleotide) disclosed herein.

"linked nucleosides" means adjacent nucleosides linked together by internucleoside linkages.

By "linker-nucleoside" is meant a nucleoside that links the oligonucleotide to the conjugate moiety. The linker-nucleoside is located within the conjugate linker of the compound. Linker-nucleosides are not considered part of the oligonucleotide portion of the compound (even if they are contiguous with the oligonucleotide).

"mismatch" or "non-complementary" means that when the first and second oligonucleotides are aligned, the nucleobase of the first oligonucleotide is not complementary to the corresponding nucleobase of the second oligonucleotide or target nucleic acid. For example, a nucleobase (including but not limited to universal nucleobases, inosine, and hypoxanthine) is capable of hybridizing to at least one nucleobase, but is still mismatched or non-complementary relative to the nucleobase to which it hybridizes. As another example, when first and second oligonucleotides are aligned, the nucleobase of the first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of the second oligonucleotide or target nucleic acid is a mismatched or non-complementary nucleobase.

"modulation" refers to altering or modulating a characteristic in a cell, tissue, organ, or organism. For example, modulating HSD17B13 RNA may mean increasing or decreasing the level of HSD17B13 RNA and/or HSD17B13 protein in a cell, tissue, organ, or organism. A "modulator" effects the change in the cell, tissue, organ or organism. For example, HSD17B13 compounds may be modulators that decrease the amount of HSD17B13 RNA and/or HSD17B13 protein in a cell, tissue, organ, or organism.

"MOE" means methoxyethyl.

"monomer" refers to a single unit of oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

"motif" means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages in an oligonucleotide.

"native" or "naturally occurring" means that it is found in nature.

By "non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" is meant a modified sugar moiety that comprises a modification (e.g., substitution) that does not form a bridge between two atoms of the sugar, thereby forming a second ring.

"nucleic acid" refers to a molecule consisting of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

"nucleobase" means a heterocyclic moiety capable of base pairing with another nucleic acid. As used herein, a "naturally occurring nucleobase" is adenine (a), thymine (T), cytosine (C), uracil (U), and guanine (G). A "modified nucleobase" is a chemically modified naturally occurring nucleobase. A "universal base" or "universal nucleobase" is a nucleobase other than a naturally occurring nucleobase and a modified nucleobase, and is capable of pairing with any nucleobase.

"nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

"nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. "modified nucleoside" means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase.

By "oligomeric compound" is meant a compound comprising a single oligonucleotide and optionally one or more additional features (e.g., conjugate groups or end groups).

"oligonucleotide" means a polymer of linked nucleosides, each of which may or may not be modified independently of the other. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. "modified oligonucleotide" means an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. By "unmodified oligonucleotide" is meant an oligonucleotide that does not contain any sugar, nucleobase, or internucleoside modification.

By "parent oligonucleotide" is meant an oligonucleotide whose sequence is used as the basis for the design of further oligonucleotides of similar sequence but of different length, motif, and/or chemistry. The newly designed oligonucleotide may have the same or overlapping sequence as the parent oligonucleotide.

By "parenteral administration" is meant administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration (e.g., intrathecal or intracerebroventricular administration).

By "pharmaceutically acceptable carrier or diluent" is meant any substance suitable for use in administering to an individual. For example, the pharmaceutically acceptable carrier may be a sterile aqueous solution, such as PBS or water for injection.

By "pharmaceutically acceptable salt" is meant a physiologically and pharmaceutically acceptable salt of a compound (e.g., an oligomeric compound or oligonucleotide), i.e., a salt that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.

By "agent" is meant a compound that provides a therapeutic benefit when administered to an individual.

By "pharmaceutical composition" is meant a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can include one or more compounds or salts thereof and a sterile aqueous solution.

"phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced by a sulfur atom. Phosphorothioate internucleoside linkages are modified internucleoside linkages.

"phosphorus moiety" means a group of atoms that includes a phosphorus atom. In certain embodiments, the phosphorus moiety comprises a mono-, di-, or tri-phosphate, or a phosphorothioate.

"portion" means a defined number of consecutive (i.e., connected) nucleobases of a nucleic acid. In certain embodiments, a moiety is a defined number of consecutive nucleobases of a target nucleic acid. In certain embodiments, a moiety is a defined number of consecutive nucleobases of an oligomeric compound.

"preventing" refers to delaying or preventing onset, development or progression of a disease, disorder or condition for a period of time from minutes to indefinite.

By "prodrug" is meant a compound in an extra-corporeal form, which, when administered to an individual, is metabolized to another form within its body or cells. In certain embodiments, the metabolic form is an active, or more active, form of the compound (e.g., drug). Conversion of the prodrug in vivo is typically facilitated by the action of one or more enzymes (e.g., endogenous or viral enzymes) or one or more chemicals present in the cell or tissue, and/or by physiological conditions.

By "reducing" is meant decreasing to a lesser extent, scale, amount, or number.

"RefSeq No." is the only combination of letters and numbers assigned to a sequence, thereby indicating that the sequence is directed against a particular target transcript (e.g., a target gene). Such sequences and information about target genes (collectively referred to as gene records) can be found in genetic sequence databases. Genetic sequence databases include the NCBI reference sequence database, GenBank, european nucleotide archive, and japanese DNA database (the latter three form international nucleotide sequence database cooperation or INSDC).

A "region" is defined as a portion of a target nucleic acid that has at least one identifiable structure, function, or characteristic.

By "RNAi compound" is meant an antisense compound that acts at least in part through RISC or Ago2, rather than through rnase H, to modulate a target nucleic acid and/or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA (including microRNA mimetics).

A "segment" is defined as a smaller region or a sub-portion of a region within a nucleic acid.

By "side effects" is meant physiological diseases and/or conditions attributable to treatment other than the desired effect. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, muscle diseases, and discomfort. For example, an increased level of transaminase in serum may indicate liver toxicity or abnormal liver function. For example, an increase in bilirubin may indicate liver toxicity or liver function abnormality.

By "single stranded" with respect to a compound is meant that the compound has only one oligonucleotide.

By "self-complementary" is meant that the oligonucleotide at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single stranded compound. A single stranded compound is capable of binding to a complementary compound to form a duplex.

A "site" is defined as a unique nucleobase position within a target nucleic acid.

By "specifically hybridizable" is meant an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

By "specifically inhibits" with respect to a target nucleic acid is meant reducing or blocking expression of the target nucleic acid when less, minimal, or no effect is exhibited on non-target nucleic acids. A decrease does not necessarily indicate a complete elimination of the expression of the target nucleic acid.

By "standard cellular assay" is meant one or more of the assays described in the examples and reasonable variations thereof.

By "standard in vivo experiments" is meant one or more of the procedures described in one or more of the examples and reasonable variations thereof.

In the context of populations of molecules having the same molecular formula, "Stereorandom chiral centers" refers to chiral centers having random stereochemical configurations. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but need not be, the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method not designed to control stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

"sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a β -D-ribose moiety found in naturally occurring RNA, or a β -D-2' -deoxyribose moiety found in naturally occurring DNA. As used herein, "modified sugar moiety" or "modified sugar" refers to a sugar substitute or a furanosyl moiety other than β -D-ribose or β -D-2' -deoxyribose. The modified furanosyl sugar moieties may be modified or substituted, substituted or unsubstituted at one or more specific positions on the sugar moiety, and they may or may not have a steric configuration other than β -D-ribosyl. Modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

"sugar substitute" refers to a modified sugar moiety that does not comprise a furanosyl or tetrahydrofuranyl ring (other than a "furanosyl sugar moiety") that can link a nucleobase to another group (e.g., an internucleoside linkage, a conjugate group, or an end group in an oligonucleotide). Modified nucleosides comprising sugar substitutes can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

"synergy" or "synergistic" means that the effect of the combination is greater than the sum of the effects of the individual components at the same dosage.

"target gene" refers to a gene that encodes a target.

By "targeted" is meant specific hybridization of a compound to a target nucleic acid so as to cause the desired effect.

"target nucleic acid," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid capable of being targeted by a compound described herein.

By "target region" is meant the portion of the target nucleic acid targeted by one or more compounds.

By "target segment" is meant the nucleotide sequence of a target nucleic acid targeted by a compound. "5 'target site" refers to the 5' most nucleotide of a target segment. "3 'target site" refers to the 3' most nucleotide of the target segment.

"terminal group" means a chemical group or set of atoms covalently attached to the end of an oligonucleotide.

By "therapeutically effective amount" is meant the amount of a compound, agent, or composition that provides a therapeutic benefit to an individual.

"treating" refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or amelioration of a disease, disorder, or condition in the animal.

Some examples of the invention

Certain embodiments provide methods, compounds, and compositions for inhibiting expression of HSD17B 13.

Certain embodiments provide compounds that target HSD17B13 nucleic acids. In certain embodiments, the HSD17B13 nucleic acid has the sequence set forth in: RefSeq or GENBANK accession No. NM-178135.4 (incorporated by reference herein as SEQ ID NO: 1), GENBANK accession No. NC-000004.12 truncated complement of nucleotides 87301001 to 87326000 (incorporated by reference herein as SEQ ID NO: 2), SEQ ID NO: 3 or GENBANK accession No. NM _001136230.2 (incorporated by reference herein as disclosed as SEQ ID NO: 4). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

Certain embodiments provide compounds comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of 8-2896. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties that differ from the nucleobase sequence of SEQ ID NO: 2, wherein the modified oligonucleotide is complementary to an equivalent length within nucleobases 3095-3369, 3371-7564, 7565-7672, 7673-8777, 8778-8909, 8910-10401, 10402-10508, 10509-12040, 12041-12178, 12179-15641, 15642-15758, 15759-20692 or 20693-22212, wherein the modified oligonucleotide is complementary to a portion of the nucleobase sequence of SEQ ID NO: 2 are at least 85%, at least 90%, at least 95%, or 100% complementary. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties that are complementary to a nucleobase moiety having a nucleobase sequence of SEQ ID NO: 1, 1-46, 58-142, 1-142, 74-89, 154-197, 154-234, 200-232, 218-234, 240-345, 254-269, 354-746, 354-830, 519-534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828, 835-862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1136-1169, 1175-1218, 1180-1217, 1292, 1251-1279, 1296-1146, 1296, 1448, 1441, 1461-1308 1, 1461-1647, 1461-1308 3, 1461-1308 5-1645-1646, 1645-580, 1296-1169, 1074-1132, 1136-1169, 1175-1645-1647, 1647-1292, 1251-1308 1-1645-1-1461-1308 3, 1544-.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties that are complementary to a nucleobase moiety having a nucleobase sequence of SEQ ID NO: 1, 1-46, 58-142, 1-142, 74-89, 154-197, 154-234, 200-232, 218-234, 240-345, 254-269, 354-746, 354-830, 519-534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828, 835-862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1136-1169, 1175-1218, 1180-1217, 1292, 1251-1279, 1296-1146, 1296, 1448, 1441, 1461-1308 1, 1461-1647, 1461-1308 3, 1461-1308 5-1645-1646, 1645-580, 1296-1169, 1074-1132, 1136-1169, 1175-1645-1647, 1647-1292, 1251-1308 1-1645-1-1461-1308 3, 1544-.

In certain embodiments, the compound targets a polypeptide having SEQ ID NO: the nucleobases of the HSD17B13 nucleic acid of 2 comprises the nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3568-3634, 3671-3736, 3676-3717, 3721-3799, 3741-3771, 3750-3770, 82-3799, 3834-3849, 3834-4154, 3877-397, 3917, 3967, 4033, 3788-4180, 4180-3970, 4180-4120, 4220, 414220, 4170, 4389, 4431, 4405, 4449, 4476, 4496, 4517, 4588, 4517, 4552, 4537, 4552, 4572, 4588, 4640, 4678, 4640, 4879, 4641, 4667, 4862, 4879, 4991, 5006, 4991, 5305, 5029, 5098, 5046, 5098, 5104, 5120, 5121, 5125, 5156, 5158, 5223, 5242, 5267, 5319, 5395, 5950, 5646, 5695, 5655, 5712, 5777, 5758, 5782, 5882, 44070, 60599, 6070, 60599, 6070, 606029, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6070, 606029, 6070, 6029, 6070, 606029, 6070, 606029, 609, 6070, 6084-, 7708-, 9476-9555, 9497-9555, 9588-9678, 9588-9681, 9712-9737, 9712-9742, 9751-9811, 9751-10040, 9887-9902, 9908-10017, 10025-10040, 10058-10079, 10112-10160, 10124-10160, 10138-10160, 10180-10227, 10180-, 11384-, 14243-, 16461-16476, 16533-16548, 16755-16770, 16895-1697, 1697-16919, 16901-16984, 16901-17092, 17014-17034, 17135-17159, 17041-17062, 17077-17092, 17135-17159, 17227-17254, 17672-17795, 17675-17872, 17802-17817, 17857-17872, 17909-17909, 17971, 17953-17971, 17954-17971, 17984-18061, 17985-18048, 18075-18117, 18087-18115, 18138-18160, 18193, 18605, 18506, 18519, 18736, 18788-18758, 1958920, 1958958, 195899-201-899, 195899-1899, 195899-201, 195899-1899, 1959, 195899, 19633-19626, 19649-19717, 19649-19726, 19731-19801, 19731-19842, 19815-19875, 19860-19951, 19887-19951, 19970-19985, 19970-20054, 19999-20024, 20037-20061, 20087-20102, 20109-20153, 20087-20207, 20172-20212, 20356-20438, 20248-20437, 20248-20264, 20470-20508, 20481-20507, 20571-20623, 20620571-20644, 20685-20700, 20706-20732, 20772, 20781-20859, 20869-20984, 20990-20933, 21065-21002, 21065-21063-21292, 21576-21532, 21532-2209, 21532, 2209-2129, and 2209-2129.

In certain embodiments, the compound has at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties that are complementary to a nucleobase sequence having a nucleobase sequence of SEQ ID NO: the nucleobases of the HSD17B13 nucleic acid of 2 comprises the nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3568-3634, 3671-3736, 3676-3717, 3721-3799, 3741-3771, 3750-3770, 82-3799, 3834-3849, 3834-4154, 3877-397, 3917, 3967, 4033, 3788-4180, 4180-3970, 4180-4120, 4220, 414220, 4170, 4389, 4431, 4405, 4449, 4476, 4496, 4517, 4588, 4517, 4552, 4537, 4552, 4572, 4588, 4640, 4678, 4640, 4879, 4641, 4667, 4862, 4879, 4991, 5006, 4991, 5305, 5029, 5098, 5046, 5098, 5104, 5120, 5121, 5125, 5156, 5158, 5223, 5242, 5267, 5319, 5395, 5950, 5646, 5695, 5655, 5712, 5777, 5758, 5782, 5882, 44070, 60599, 6070, 60599, 6070, 606029, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6070, 606029, 6070, 6029, 6070, 606029, 6070, 606029, 609, 6070, 6084-, 7708-, 9476-9555, 9497-9555, 9588-9678, 9588-9681, 9712-9737, 9712-9742, 9751-9811, 9751-10040, 9887-9902, 9908-10017, 10025-10040, 10058-10079, 10112-10160, 10124-10160, 10138-10160, 10180-10227, 10180-, 11384-, 14243-, 16461-16476, 16533-16548, 16755-16770, 16895-1697, 1697-16919, 16901-16984, 16901-17092, 17014-17034, 17135-17159, 17041-17062, 17077-17092, 17135-17159, 17227-17254, 17672-17795, 17675-17872, 17802-17817, 17857-17872, 17909-17909, 17971, 17953-17971, 17954-17971, 17984-18061, 17985-18048, 18075-18117, 18087-18115, 18138-18160, 18193, 18605, 18506, 18519, 18736, 18788-18758, 1958920, 1958958, 195899-201-899, 195899-1899, 195899-201, 195899-1899, 1959, 195899, 19633-19626, 19649-19717, 19649-19726, 19731-19801, 19731-19842, 19815-19875, 19860-19951, 19887-19951, 19970-19985, 19970-20054, 19999-20024, 20037-20061, 20087-20102, 20109-20153, 20087-20207, 20172-20212, 20356-20438, 20248-20437, 20248-20264, 20470-20508, 20481-20507, 20571-20623, 20620571-20644, 20785-20700, 20706-20732, 20772, 20781-20859, 20869-20984, 20990-20933, 21065-21002, 21065-21065, 21063-21292, 21576-21532, 21532-2209, 21532, 2209-2129, and 2209-2129-19831-19870-1989-prize-162-prize-wo 12. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, the compound has an amino acid sequence that is identical to a sequence having SEQ ID NO: 1, the nucleobase sequence complementary to the nucleobases 1323-1338, 1600-1615, 1627-1642 or 1782-1797 of the HSD17B13 nucleic acid.

In certain embodiments, the compound has a nucleobase sequence comprised in a nucleobase sequence having the sequence set forth in SEQ ID NO: 1, of the nucleobase sequence of HSD17B13, is a portion of at least 8, 9, 10, 11, 12, 13, 14, 15 or 16 contiguous nucleobases complementary within a portion of equivalent length of the nucleobases 1323-1338, 1600-1615, 1627-1642 or 1782-1797. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, the compound has a nucleobase sequence that is complementary to a nucleobase sequence having a nucleobase sequence of SEQ ID NO: 2, the nucleobases 3439-3454, 3552-3567, 3754-3769, 3963-3978, 4406-4421, 4123-4138, 4139-4154, 4991-5006, 5045-5060, 5662-5677, 6476-6491, 6478-6493, 17992-18007, 21138-21153, 21415-21430, 21442-21457 or 21597-21612 of the nucleic acid sequence.

In certain embodiments, the compound has a nucleobase sequence comprising a portion having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases that is complementary to a nucleobase sequence having a nucleobase sequence of SEQ ID NO: 2, the nucleobases 3439-3454, 3552-3567, 3754-3769, 3963-3978, 4406-4421, 4123-4138, 4139-4154, 4991-5006, 5045-5060, 5662-5677, 6476-6491, 6478-6493, 17992-18007, 21138-21153, 21415-21430, 21442-21457 or 21597-21612. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, any of the above-described modified oligonucleotides has at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, at least one nucleoside of any of the above-described modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2' -O-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4 '-CH (CH3) -O-2' group, a 4 '-CH 2-O-2' group, or a 4 '- (CH2) 2-O-2' group.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide comprises a modified internucleoside linkage, e.g., a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleobase of any of the above-described modified oligonucleotides comprises a modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the above-described modified oligonucleotides has:

a gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a sequence comprising SEQ ID NO: 8-2896 of any one of the sequences recited herein. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length and has the sequence contained in SEQ ID NO: a nucleobase sequence of a nucleobase sequence recited in any one of 8-2896. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length, having a sequence consisting of SEQ ID NO: 8-2896 in a sequence listing.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of 8-2896, wherein said modified oligonucleotide has

A gap segment consisting of linked 2' -deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a sequence comprising SEQ ID NO: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448 or 1595, wherein the modified oligonucleotide has:

A gap segment consisting of ten linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the notch segment is located between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a sequence comprising SEQ ID NO: 819, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt sugar; wherein the sugar residue of the nucleoside of the 3 ' wing segment is 5 ' -cEt-MOE-3 '; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a sequence comprising SEQ ID NO: 1595 the nucleobase sequence of the sequence listed in any one of the above, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein said gap segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein said gap segment consists of 5 ' -one deoxy, one 2 ' -O-methyl nucleoside and eight deoxy nucleoside-3 ', wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the above embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding HSD17B 13.

In any of the above embodiments, the compound may be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In any of the above embodiments, the compound may consist of: 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, the compounds comprise a modified oligonucleotide, and a conjugate group described herein. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 5' terminus of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 3' terminus of the modified oligonucleotide. In certain embodiments, the conjugate group comprises at least one N-acetylgalactosamine (GalNAc), at least two N-acetylgalactosamines (GalNAc), or at least three N-acetylgalactosamines (GalNAc).

In certain embodiments, the compounds or compositions provided herein comprise a pharmaceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 286), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：286)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 817), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：817)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 983), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：983)。

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1215), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1215)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 747), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：747)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 43), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：43)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 355), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：355)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1602), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1602)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 201), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：201)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 734), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：734)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1249), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1249)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 513), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：513)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1449), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1449)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1448), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1448)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1595), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1595)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 819), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：819)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 1595), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：1595)。

in certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO: 208), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

In certain embodiments, the compounds provided herein are according to the following chemical structure:

(SEQ ID NO：208)。

under certain conditions, certain compounds disclosed herein act as acids. While such compounds may be depicted or described in protonated (free acid) form, or in ionized and bound form with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium between such forms. For example, phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium between free acid, anion and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. In addition, some oligonucleotides have several such linkages, each in equilibrium. Thus, oligonucleotides exist in solution in a variety of forms that are in equilibrium at a variety of positions. The term "oligonucleotide" is intended to include all such forms. The rendered structure must depict a single form. However, unless otherwise indicated, these drawings are intended to include the corresponding forms as well. Herein, the structure of the term "or a salt thereof" following the free acid of the compound specifically includes all such forms that may be fully or partially protonated/deprotonated/associated with a cation. In some cases, one or more specific cations are identified.

In certain embodiments, the modified oligonucleotide or oligomeric compound is in aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve the desired pH. In certain embodiments, a compound or composition as described herein has an in vitro IC of less than 2 μ Μ, less than 1.5 μ Μ, less than 1 μ Μ, less than 0.9 μ Μ, less than 0.8 μ Μ, less than 0.7 μ Μ, less than 0.6 μ Μ, less than 0.5 μ Μ, less than 0.4 μ Μ, less than 0.3 μ Μ, less than 0.2 μ Μ, less than 0.1 μ Μ, less than 0.05 μ Μ, less than 0.04 μ Μ, less than 0.03 μ Μ, less than 0.02 μ Μ, or less than 0.01 μ Μ₅₀At least one of which is active.

In certain embodiments, a compound or composition as described herein is highly tolerable, as evidenced by having at least one of no more than a 4-fold, 3-fold, or 2-fold increase in alanine Aminotransferase (ALT) or aspartate Aminotransferase (AST) value relative to a control animal, or no more than a 30%, 20%, 15%, 12%, 10%, 5%, or 2% increase in liver, spleen, or kidney weight as compared to a control animal. In certain embodiments, a compound or composition as described herein is highly tolerable, as evidenced by no increase in ALT or AST relative to control animals. In certain embodiments, a compound or composition as described herein is highly tolerable, as evidenced by no increase in liver, spleen, or kidney weight relative to a control animal.

Certain embodiments provide a composition comprising a compound described in any one of the aforementioned embodiments, or any pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, a composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100mg/mL, about 125mg/mL, about 150mg/mL, about 175mg/mL, about 200mg/mL, about 225mg/mL, about 250mg/mL, about 275mg/mL, or about 300 mg/mL. In certain embodiments, a composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20 ℃, about 21 ℃, about 22 ℃, about 23 ℃, about 24 ℃, about 25 ℃, about 26 ℃, about 27 ℃, about 28 ℃, about 29 ℃, or about 30 ℃.

Non-limiting numbered examples include:

example 1: certain embodiments provide compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any one of the nucleobase sequences of 8-2896. Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence comprising SEQ ID NO: a nucleobase sequence of at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any one of the nucleobase sequences of 8-2896.

Example 2: certain embodiments provide compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896.

Example 3: certain embodiments provide compounds comprising a modified oligonucleotide having a sequence consisting of SEQ ID NO: 8-2896.

Example 4: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, or consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases that is complementary to a nucleobase sequence of any one of SEQ ID NOs: 2, wherein the nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3668-3634, 3671-3736, 3676-3717, 3721-3799, 3741-3771, 3750-3770, 3782-99, 3834-3849, 3834-4154, 3877-3897, 3902-3917, 3933-3967, 3933-399, 43405, 4380-4123, 4220-4120, 4220, 4255, 4220, 4123-4123, 4220, 439, 4389, 4405, 4449, 4476, 4496, 4517, 4588, 4517, 4537, 4552, 4572, 4588, 4640, 4678, 4640, 4879, 4641, 4667, 4862, 4879, 4991, 5006, 4991, 5305, 5029, 5046, 5098, 514, 5121, 5141, 5125, 5141, 5156, 5256, 5158, 5217, 5223, 5242, 5267, 5319, 5268, 5395, 5950, 5646, 5655, 5858, 5712, 5777, 5782, 5862, 5870, 605870, 60599, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6084-, 7751-, 9497-, 11385-, 14243-, 16533-16548, 16755-16770, 16895-1697, 169905-1697, 16936-16984, 16901-17092, 17014-17034, 17135-17159, 17041-17062, 17077-17092, 17135-17159, 17227-17254, 17672-17795, 17675-17872, 17802-17817, 17857-17872, 17909-945, 17971, 17953-17971, 17984-18061, 17985-18048, 18075-18717, 18087-18115, 18138-18160, 18118118118118118118193, 18505-55, 06-18036, 18500, 19620-18758-18719, 1958958-195899, 1958920, 1958923-20, 1958923, 1958919-201, 195899-201-899, 195899-20, 195899-201-20, 195899-20, 195899-1899, 19749-19717, 19649-19726, 19731-19801, 19731-19842, 19815-19875, 19860-19951, 19887-19951, 19970-19985, 19970-20054, 19999-20024, 20037-20061, 20087-20102, 20109-20153, 20087-20207, 20172-20212, 20356-20438, 20248-20437, 20248-20264, 20470-20508, 20481-20507, 20571-20623, 20571-20644, 20685-20700, 20706-21032, 20706-20772, 20781-20859, 20869-20984, 90-20733, 21065-21102, 21065-21263, 21092-21276, 21532-2159-2209, and the other sequences of SEQ ID-20, and the other sequences of SEQ ID-2209-20, and the other sequences of SEQ ID-20, wherein: 2 are at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 5: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8-80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence set forth in SEQ ID NO: 2, wherein the nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3668-3634, 3671-3736, 3676-3717, 3721-3799, 3741-3771, 3750-3770, 3782-99, 3834-3849, 3834-4154, 3877-3897, 3902-3917, 3933-3967, 3933-399, 43405, 4380-4123, 4220-4120, 4220, 4255, 4220, 4123-4123, 4220, 439, 4389, 4405, 4449, 4476, 4496, 4517, 4588, 4517, 4537, 4552, 4572, 4588, 4640, 4678, 4640, 4879, 4641, 4667, 4862, 4879, 4991, 5006, 4991, 5305, 5029, 5046, 5098, 514, 5121, 5141, 5125, 5141, 5156, 5256, 5158, 5217, 5223, 5242, 5267, 5319, 5268, 5395, 5950, 5646, 5655, 5858, 5712, 5777, 5782, 5862, 5870, 605870, 60599, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6070, 60599, 606029, 6070, 60599, 6084-, 7751-, 9497-, 11385-, 14243-, 16533-16548, 16755-16770, 16895-1697, 169905-1697, 16936-16984, 16901-17092, 17014-17034, 17135-17159, 17041-17062, 17077-17092, 17135-17159, 17227-17254, 17672-17795, 17675-17872, 17802-17817, 17857-17872, 17909-945, 17971, 17953-17971, 17984-18061, 17985-18048, 18075-18717, 18087-18115, 18138-18160, 18118118118118118118193, 18505-55, 06-18036, 18500, 19620-18758-18719, 1958958-195899, 1958920, 1958923-20, 1958923, 1958919-201, 195899-201-899, 195899-20, 195899-201-20, 195899-20, 195899-1899, 19749-19717, 19649-19726, 19731-19801, 19731-19842, 19815-19875, 19860-19951, 19887-19951, 19970-19985, 19970-20054, 19999-20024, 20037-20061, 20087-20102, 20109-20153, 20087-20207, 20172-20212, 20356-20438, 20248-20437, 20248-20264, 20470-20508, 20481-20507, 20571-20623, 20571-20644, 20685-20700, 20706-20732, 20706-20772, 20781-20859, 20869-20984, 90-20733, 21065-21102, 21065-21263, 21092-21276, 21532-2159-2209, 2209-20, and 2209-20, wherein the nucleotide is modified by the method disclosed in 19817-19815-19820, 19823-wo-20-wo-20, and-2209-20-cd-20: 2 are at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 6: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases that is complementary to a nucleobase sequence of a nucleobase of SEQ ID NO: 1, 1-46, 58-142, 1-142, 74-89, 154-234, 200-232, 218-234, 240-345, 254-269, 354-746, 354-830, 519-534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828 835, 862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1074-1132, 1136-1169, 1175-1218, 1180-1217, 1250-1292, 1251-1279, 1296-1146, 1296-1448, 1461, 1481, 1531, 1539, 1531-1461, 1647, 1461-1641, 1641-1463, 1461-1641, 1463-1645, 1641-1645-1643, 1597-1645, 1654-1685, 1654-1817, 1702-1817, 1705-1741, 1748-2211, 2174-2219, 2240-2272, 2244-2272, 2349-2370, 2350-2371 or 2378-2394, and wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the nucleobase sequence of SEQ ID NO: 1 is at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 7: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence set forth in SEQ ID NO: 1, 1-46, 58-142, 1-142, 74-89, 154-234, 200-232, 218-234, 240-345, 254-269, 354-746, 354-830, 519-534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828 835, 862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1074-1132, 1136-1169, 1175-1218, 1180-1217, 1250-1292, 1251-1279, 1296-1146, 1296-1448, 1461, 1481, 1531, 1539, 1531-1461, 1647, 1461-1641, 1641-1463, 1461-1641, 1463-1645, 1641-1645-1643, 1597-1645, 1654-1685, 1654-1817, 1702-1817, 1705-1741, 1748-2211, 2174-2219, 2240-2272, 2244-2272, 2349-2370, 2350-2371 or 2378-2394, and wherein the modified oligonucleotide is complementary to SEQ ID NO: 1 is at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 8: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 contiguous nucleobases that is complementary to a nucleobase sequence of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the equivalent length of the nucleobase sequence of 3439-: 2 are at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 9: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence comprising SEQ ID NO: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595 and 819.

Example 10: certain embodiments provide compounds comprising a modified oligonucleotide having a sequence consisting of SEQ ID NO: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595 and 819.

Example 11: certain embodiments provide the compound of embodiments 1-6, wherein the oligonucleotide hybridizes to SEQ ID NO: 2 is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary.

Example 12: certain embodiments provide the compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises at least one modification selected from at least one modified internucleoside linkage, at least one modified nucleoside comprising a modified sugar moiety, and at least one modified nucleoside comprising a modified nucleobase.

Example 13: certain embodiments provide the compound of embodiment 12, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Example 14: certain embodiments provide the compound of embodiment 12 or 13, wherein at least one nucleoside of the modified oligonucleotide is a 2' -substituted nucleoside or a bicyclic nucleoside.

Example 15: certain embodiments provide the compound of embodiment 14, wherein the bicyclic sugar portion of the bicyclic nucleoside is selected from the group consisting of: 4' - (CH)₂)-O-2′(LNA)；4′-(CH₂)₂-O-2' (ENA); and 4' -CH (CH)₃)-O-2′(cEt)。

Example 16: certain embodiments provide a compound of any one of embodiments 12-15, wherein the modified nucleoside is a 2' -O-methoxyethyl nucleoside.

Example 17: certain embodiments provide the compound of any one of embodiments 12-16, wherein the modified nucleobase is a 5-methylcytosine.

Example 18: certain embodiments provide the compound of any one of embodiments 1-17, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2' -deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

A 3' wing segment consisting of linked nucleosides;

wherein the notch segment is positioned immediately adjacent to and between the 5 'wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar.

Example 19: certain embodiments provide the compound of any one of claims 1-18, wherein the modified sugar moiety of each nucleoside of each wing segment is selected from the group consisting of 2 '-O-Me, 2' -MOE and cEt sugar moieties.

Example 20: certain embodiments provide the compound of any one of claims 1-19, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the nicked segment is located between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 21: certain embodiments provide the compound of any one of claims 1-20, wherein the modified oligonucleotide comprises:

A gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the nicked segment is located between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 22: certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt nucleoside; wherein the sugar moiety of the nucleoside of the 3 ' wing segment is 5 ' -cEt-MOE-3 '; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 23: certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt nucleoside; wherein each sugar moiety of the nucleoside of the 3 'wing segment is selected from a cEt and a 2' -MOE sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 24: certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nicked segment consists of 5 ' -one deoxy, one 2 ' -O-methyl nucleoside, and eight deoxy nucleoside-3 ', wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 25: example 24: certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the notch segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nucleosides of the notch segment are selected from deoxynucleosides, cEt nucleosides, and 2 ' -MOE nucleosides, wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 26: certain embodiments provide a compound according to any one of embodiments 1-25, wherein the compound is single-stranded.

Example 27: certain embodiments provide the compound of any one of embodiments 1-25, wherein the modified oligonucleotide hybridizes to a second oligonucleotide to form a double-stranded antisense compound.

Example 28: certain embodiments provide the compound of any one of embodiments 1-27, wherein at least one nucleotide of the modified oligonucleotide is a ribonucleotide.

Example 29: certain embodiments provide the compound of any one of embodiments 1-27, wherein at least one nucleotide of the modified oligonucleotide is a deoxyribonucleotide.

Example 30: certain embodiments provide the compound of any one of embodiments 1-23, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Example 31: certain embodiments provide the compound of any one of embodiments 1-30, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Example 32: certain embodiments provide the compound of any one of embodiments 1-30, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

Example 33: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595, and 819, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked deoxynucleosides;

A 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Example 34: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 286. 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, and 1595, wherein the modified oligonucleotide comprises a nucleobase sequence of any one of

A gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the notch segment is located between the 5 'wing segment and the 3' wing segment; wherein the 5 'wing segment and the 3' wing segment comprise a cEt saccharide; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

Example 35: certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleotide sequence consisting of SEQ ID NO: 819, wherein the modified oligonucleotide comprises:

A gap segment consisting of nine linked 2' -deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of the 5 ' wing segment comprises a cEt sugar; wherein the sugar residue of the nucleoside of the 3 ' wing segment is 5 ' -cEt-MOE-3 '; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 36: certain embodiments provide a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a sequence consisting of SEQ ID NO: 1595, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked nucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of four linked nucleosides;

wherein the nicked segment is located between the 5 ' wing segment and the 3 ' wing segment and wherein the nicked segment consists of 5 ' -one deoxy, one 2 ' -O-methyl nucleoside, and eight deoxy nucleoside-3 ', wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

Example 37: certain embodiments provide a compound as described in any preceding embodiment, comprising a conjugate group.

Example 38: certain embodiments provide the compound of embodiment 37, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

Example 39: certain embodiments provide a compound as described in embodiment 37 or embodiment 38, wherein the conjugate group comprises a conjugate linker consisting of a single bond.

Example 40: certain embodiments provide a compound as described in any one of embodiments 37-39, wherein the conjugate group comprises a cleavable linker.

Example 41: certain embodiments provide a compound of any one of embodiments 37-40, wherein the conjugate group comprises a conjugate linker comprising 1-3 linker-nucleosides.

Example 42: certain embodiments provide the compound of any one of embodiments 37-41, wherein the conjugate group is attached to the modified oligonucleotide at the 5' terminus of the modified oligonucleotide.

Example 42: certain embodiments provide the compound of any one of embodiments 37-41, wherein the conjugate group is attached to the modified oligonucleotide at the 3' terminus of the modified oligonucleotide.

Example 43: certain embodiments provide a compound having the following chemical structure:

example 44: certain embodiments provide a compound having the following chemical structure:

example 45: certain embodiments provide a compound having the following chemical structure:

example 46: certain embodiments provide a compound having the following chemical structure:

example 47: certain embodiments provide a compound having the following chemical structure:

example 48: certain embodiments provide a compound having the following chemical structure:

example 49: certain embodiments provide a compound having the following chemical structure:

example 50: certain embodiments provide a compound having the following chemical structure:

example 51: certain embodiments provide a compound having the following chemical structure:

example 52: certain embodiments provide a compound having the following chemical structure:

example 53: certain embodiments provide a compound having the following chemical structure:

example 54: certain embodiments provide a compound having the following chemical structure:

example 55: certain embodiments provide a compound having the following chemical structure:

Example 56: certain embodiments provide a compound having the following chemical structure:

example 57: certain embodiments provide a compound having the following chemical structure:

example 58: certain embodiments provide a compound having the following chemical structure:

example 59: certain embodiments provide a compound having the following chemical structure:

example 60: certain embodiments provide a compound having the following chemical structure:

example 61: certain embodiments provide a compound of any one of embodiments 43-60, wherein the compound is a sodium salt.

Example 62: certain embodiments provide a compound of any one of embodiments 43-60, wherein the compound is a potassium salt.

Example 63: certain embodiments provide a chirally enriched population of compounds as described in any of embodiments 1-62, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Example 64: certain embodiments provide the chirally enriched population of embodiment 63, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a (Sp) configuration.

Example 65: certain embodiments provide a chirally enriched population as described in example 63 or example 64, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a chemical configuration (Rp).

Example 66: certain embodiments provide the chirally enriched population of claim 63, wherein the population is enriched for compounds having modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

Example 67: certain embodiments provide the chirally enriched population of embodiment 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having (Sp) configuration at each phosphorothioate internucleoside linkage.

Example 68: certain embodiments provide the chirally enriched population of embodiment 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having (Rp) configuration at each phosphorothioate internucleoside linkage.

Example 69: certain embodiments provide the chirally enriched population of embodiments 63 or 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the 5 'to 3' direction with the Sp-Sp-Rp configuration.

Example 70: certain embodiments provide a population of compounds having a modified oligonucleotide as described in any one of embodiments 69, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotide are sterically random.

Example 71: certain embodiments provide compositions comprising a compound according to any one of embodiments 1-70 and a pharmaceutically acceptable carrier.

Example 72: certain embodiments provide a composition comprising a compound as described in any preceding embodiment for use in therapy.

Example 73: certain embodiments provide a method of treating, preventing, or ameliorating a disease associated with HSD17B13 in a subject, the method comprising administering to the subject a compound complementary to HSD17B13, thereby treating, preventing, or ameliorating the disease.

Example 74: certain embodiments provide methods of administering a compound as described in examples 1-70 or a composition as described in example 71 or example 72 to an individual.

Example 75: certain embodiments provide the method of embodiment 73 or 74, wherein the subject has liver disease, NAFLD, NASH, liver steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

Example 76: certain embodiments provide the method of embodiment 73 or embodiment 74, wherein the compound is an antisense compound.

Example 77: certain embodiments provide the method of any one of embodiments 73-76, wherein administering the compound alleviates liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver enlargement, elevated transaminase, or liver fat accumulation in the individual.

Example 78: certain embodiments provide a method of inhibiting HSD17B13 expression in a cell, comprising contacting the cell with a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby inhibiting HSD17B13 expression in the cell.

Example 79: certain embodiments provide the method of embodiment 78, wherein the cell is located in the liver of the individual.

Example 80: certain embodiments provide the method of embodiment 79, wherein the individual has or is at risk of having: liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

Example 81: certain embodiments provide a method of alleviating, reducing, or inhibiting liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver swelling, elevated transaminase, or liver fat deposition in an individual, the method comprising administering to the individual a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby reducing or inhibiting liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver swelling, elevated transaminase, or liver fat deposition in the individual.

Example 82: certain embodiments provide the method of embodiment 81, wherein the individual has or is at risk of having: liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

Example 83: certain embodiments provide the method of any one of embodiments 78-82, wherein the compound is an antisense compound.

Example 84: certain embodiments provide a method as described in any one of embodiments 78-83, wherein the compound is a compound as described in any one of embodiments 1-70 or a composition as described in embodiment 71 or embodiment 72.

Example 85: certain embodiments provide a method as described in embodiment 83 or embodiment 84, wherein the compound or composition is administered parenterally.

Example 86: certain embodiments provide the use of a compound comprising a modified oligonucleotide complementary to HSD17B13 in the treatment, prevention, or amelioration of a disease associated with HSD17B 13.

Example 87: certain embodiments provide the use of embodiment 86, wherein the disease is liver disease, NAFLD, NASH, liver steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

Example 88: certain embodiments provide the use of embodiment 86 or 87, wherein the compound is an antisense compound.

Example 89: certain embodiments provide the use of any one of embodiments 86-88, wherein the compound is a compound as described in any one of embodiments 1-70 or a composition as described in embodiment 71 or embodiment 72.

Example 90: certain embodiments provide the use of a compound comprising a modified oligonucleotide complementary to HSD17B13 in the manufacture of a medicament for treating, preventing, or ameliorating a disease associated with HSD17B 13.

Example 91: certain embodiments provide the use of embodiment 90, wherein the disease is liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing bile duct.

Example 92: certain embodiments provide the use of embodiment 90 or 91, wherein the compound is an antisense compound.

Example 93: certain embodiments provide the use of any one of embodiments 90-92, wherein the compound is a compound as described in any one of embodiments 1-70 or a composition as described in embodiment 71 or embodiment 72.

Certain indications

Certain embodiments provided herein relate to methods of inhibiting HSD17B13 expression by administering a compound targeting HSD17B13, which may be used to treat, prevent, or ameliorate a disease associated with HSD17B13 in an individual. In certain embodiments, the compound may be an HSD17B13 specific inhibitor. In certain embodiments, the compound may be an antisense compound, an oligomeric compound, or an oligonucleotide that targets HSD17B 13.

Examples of diseases associated with HSD17B13 that may be treated, prevented and/or alleviated with the methods provided herein include liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. Certain compounds provided herein relate to compounds and compositions that reduce liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, liver enlargement, elevated transaminases, or liver fat accumulation in an animal.

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with HSD17B13 in a subject comprises administering to the subject a compound comprising an inhibitor specific for HSD17B13, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the subject is identified as having or at risk of having a disease associated with HSD17B 13. In certain embodiments, the disease is a liver disease. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the subject parenterally. In certain embodiments, administration of the compound ameliorates, maintains, or prevents liver injury, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation in the animal.

In certain embodiments, a method of treating, preventing, or ameliorating liver injury, steatosis, liver fibrosis, liver cirrhosis, elevated transaminase, or liver fat accumulation in an animal comprises administering to the individual a compound comprising an inhibitor specific for HSD17B13, thereby treating, preventing, or ameliorating liver injury, steatosis, liver fibrosis, liver cirrhosis, elevated transaminase, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the subject parenterally. In certain embodiments, administration of the compound ameliorates, maintains, or prevents liver injury, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation. In certain embodiments, the subject is identified as having or at risk of having a disease associated with HSD17B 13.

In certain embodiments, a method of inhibiting HSD17B13 expression in a subject having, or at risk of having, a disease associated with HSD17B13 comprises administering to the subject a compound comprising an inhibitor specific for HSD17B13, thereby inhibiting expression of HSD17B13 in the subject. In certain embodiments, administering the compound inhibits expression of HSD17B13 in the liver. In certain embodiments, the disease is a liver disease. In certain embodiments, the individual has or is at risk of having: liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the individual has or is at risk of having: liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the subject parenterally. In certain embodiments, administration of the compound ameliorates, maintains, or prevents liver injury, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation.

In certain embodiments, the method of inhibiting HSD17B13 expression in a cell comprises contacting the cell with a compound comprising an inhibitor specific for HSD17B13, thereby inhibiting HSD17B13 expression in the cell. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is located in the liver of an individual who has or is at risk of having: liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In certain embodiments, a method of reducing or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminase, or liver steatosis in an individual having a disease associated with HSD17B13 or having a disease associated with HSD17B13 comprises administering to the individual a compound comprising an inhibitor specific for HSD17B13, thereby reducing or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminase, or liver steatosis in the individual. In certain embodiments, the individual has or is at risk of having: liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the subject parenterally. In certain embodiments, the subject is identified as having or at risk of having a disease associated with HSD17B 13.

Certain embodiments are drawn to compounds comprising inhibitors specific for HSD17B13 for use in treating diseases associated with HSD17B 13. In certain embodiments, the disease is liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the subject parenterally.

Certain embodiments are drawn to compounds comprising an inhibitor specific for HSD17B13 for use in reducing or inhibiting liver injury, steatosis, liver fibrosis, cirrhosis, elevated transaminase, or liver fat deposition in an individual having or at risk of having: liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

Certain embodiments are drawn to the use of compounds comprising an inhibitor specific for HSD17B13 for the manufacture or preparation of a medicament for the treatment of a disease associated with HSD17B 13. Certain embodiments are drawn to the use of compounds comprising inhibitors specific for HSD17B13 for the manufacture of medicaments for the treatment of diseases associated with HSD17B 13. In certain embodiments, the disease is a liver disease. In certain embodiments, the disease is liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

Certain embodiments relate to the use of a compound comprising an inhibitor specific for HSD17B13 for the manufacture or preparation of a medicament for reducing or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminase, or liver fat deposition in an individual having or at risk of having a disease associated with HSD17B 13. In certain embodiments, the disease is liver disease, NAFLD, NASH, Alcoholic Steatohepatitis (ASH), alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. Certain embodiments are drawn to the use of compounds comprising inhibitors specific for HSD17B13 for the manufacture of medicaments for the treatment of diseases associated with HSD17B 13. In certain embodiments, the disease is liver disease, NAFLD, NASH, alcoholic liver disease, nonalcoholic liver disease, alcoholic cirrhosis, nonalcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B 13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B 13. In certain embodiments, the compound comprises a nucleotide sequence consisting of 8 to 80 linked nucleosides and has an amino acid sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 contiguous nucleobases of any one of the nucleobase sequences of 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a sequence comprising SEQ ID NO: a nucleobase sequence of the nucleobase sequence of any one of 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of SEQ ID NO: 8-2896 in a pharmaceutically acceptable carrier. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In any of the above methods or uses, the compound may be targeted to HSD17B 13. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is identical to SEQ ID NO: 1-4 is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2' -O-methoxyethyl modified sugar, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3 ' wing segment consisting of linked nucleosides, wherein the notch segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the above embodiments, the modified oligonucleotide consists of 12 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 16 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is identical to SEQ ID NO: 1-4 is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited.

In any of the above methods or uses, the compound comprises or consists of a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleotide sequence comprising SEQ ID NO: the nucleobase sequence of any one of 8-2896, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2' -deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In any of the above methods or uses, the compound may be administered parenterally. For example, in certain embodiments, the compound may be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration (e.g., intrathecal or intracerebroventricular administration).

Certain compounds

In certain embodiments, a compound described herein can be an antisense compound. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a target nucleic acid.

In certain embodiments, the compounds described herein comprise or consist of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a target nucleic acid.

In certain embodiments, the compound or antisense compound is single stranded. Such single stranded compounds or antisense compounds include or consist of oligomeric compounds. In certain embodiments, such oligomeric compounds comprise or consist of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the single stranded antisense or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, the compound is double-stranded. Such double stranded compounds include a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymidylate nucleobase in the modified oligonucleotide is replaced with a uracil nucleobase. In certain embodiments, the compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16-30 linked nucleosides in length and the second modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a sequence comprising SEQ ID NO: a nucleobase sequence of at least 8 consecutive nucleobases of any one of 8-2035.

In certain embodiments, the antisense compound is double-stranded. Such double-stranded antisense compounds include a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compounds may be modified or unmodified. Either or both oligomeric compounds of the double-stranded antisense compound can include a conjugate group. These oligomeric compounds of the double-stranded antisense compounds can include non-complementary overhanging nucleosides.

Examples of single-and double-stranded compounds include, but are not limited to, oligonucleotides, sirnas, micrornas targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shrnas), single-stranded sirnas (ssrnas), and microrna mimetics.

In certain embodiments, the compounds described herein have a nucleobase sequence that, when written in the 5 'to 3' direction, comprises the reverse complement of the target segment of the targeted target nucleic acid.

In certain embodiments, the compounds described herein comprise oligonucleotides 12 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides that are 12 to 22 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 14 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 14 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 15 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 15 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 16 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 16 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 17 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 17 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 18 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 18 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides that are 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, or 20 to 30 subunits, respectively, in length. In certain embodiments, the compounds described herein comprise oligonucleotides that are 14 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides that are 16 linked subunits in length. In certain embodiments, the compounds described herein comprise an oligonucleotide 17 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 18 linked subunits in length. In certain embodiments, the compounds described herein comprise an oligonucleotide 19 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides that are 20 linked subunits in length. In other embodiments, the compounds described herein include oligonucleotides 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits in length. In certain such embodiments, the compounds described herein include oligonucleotides 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values. In some embodiments, the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements attached to the oligonucleotide, such as a conjugate group. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where the conjugate group comprises a nucleoside (i.e., the nucleoside to which the conjugate group is attached to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5 'end (5' truncation), or alternatively from the 3 'end (3' truncation). A shortened or truncated compound targeting HSD17B13 nucleic acid may lack two subunits from the 5 'end of the compound, or alternatively, may lack two subunits from the 3' end of the compound. Alternatively, the deleted nucleoside can be dispersed throughout the compound.

When a single additional subunit is present in the elongated compound, the additional subunit may be located at the 5 'or 3' end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound in which two subunits are added to the 5 'end (5' addition) or alternatively to the 3 'end (3' addition) of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound (e.g.an oligonucleotide) and/or to introduce mismatched bases without abolishing the activity (Woolf et al Proc. Natl. Acad. Sci. USA [ Proc. Natl. Acad. Sci. USA ]1992, 89: 7305-. However, it appears that small changes in oligonucleotide sequence, chemistry and motifs can cause major differences in one or more of many properties required for clinical development (Seth et al j.med.chem. [ journal of pharmaceutical chemistry ]2009, 52, 10; Egli et al j.am.chem.soc. [ journal of american chemical society ]2011, 133, 16642).

In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short interfering RNAs or sirnas) and single-stranded RNAi compounds (or ssrnas). Such compounds act, at least in part, through the RISC pathway to degrade and/or sequester target nucleic acids (thus, including microrna/microrna mimetic compounds). As used herein, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules capable of mediating sequence-specific RNAi, such as short interfering rna (siRNA), double-stranded rna (dsrna), micro-rna (mirna), short hairpin rna (shrna), short interfering oligonucleotides, short interfering nucleic acids, short interference-modified oligonucleotides, chemically-modified sirnas, post-transcriptional gene-silencing rna (ptgsrna), and others. In addition, as used herein, the term RNAi is intended to be equivalent to other terms used to describe sequence-specific RNA interference (e.g., post-transcriptional gene silencing, translational suppression, or epigenetics).

In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeting HSD17B13 described herein. In certain embodiments, the compound may be double-stranded. In certain embodiments, the compound comprises a first strand comprising SEQ ID NO: at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties of any one of 8-2035. In certain embodiments, the compound comprises a first strand comprising SEQ ID NO: the nucleobase sequence of any one of 8 to 2035. In certain embodiments, the compound comprises ribonucleotides in which the first strand has an amino acid sequence that replaces SEQ ID NO: uracil (U) of thymine (T) in any one of 8 to 2035. In certain embodiments, the compound comprises (i) a first strand comprising a sequence identical to SEQ ID NO: a nucleobase sequence complementary to the site on HSD17B13 targeted by any one of 8-2035, and (ii) a second strand. In certain embodiments, the compounds include one or more modified nucleotides in which the 2 ' position of the sugar comprises a halogen (e.g., a fluoro group; 2 ' -F) or an alkoxy group (e.g., a methoxy group; 2 ' -OMe). In certain embodiments, the compounds include at least one 2 '-F sugar modification and at least one 2' -OMe sugar modification. In certain embodiments, the at least one 2 '-F sugar modification and the at least one 2' -OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. These compounds may also be chemically modified nucleic acid molecules, as taught in U.S. patent No. 6,673,661. In other embodiments, the compound comprises one or two capping chains, such as WO 00/63364 filed, for example, on month 4 and 19 of 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA follower strand (passenger strand). In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, the compound has 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides per chain length. In certain embodiments, the first or second strand of the compound may comprise a conjugate group.

In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeting HSD17B13 described herein. In certain embodiments, the compound is single-stranded. In certain embodiments, such compounds are single-stranded rnai (ssrnai) compounds. In certain embodiments, the compound comprises SEQ ID NO: at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase moieties of any one of 8-2035. In certain embodiments, the compound comprises SEQ ID NO: the nucleobase sequence of any one of 8 to 2035. In certain embodiments, the compounds include ribonucleotides in which uracil (U) replaces SEQ ID NO: thymine (T) according to any one of 8 to 2035. In certain embodiments, the compound comprises a compound that hybridizes to SEQ ID NO: 8-2035, or a nucleobase sequence complementary to the site targeted by said target. In certain embodiments, the compounds include one or more modified nucleotides in which the 2 ' position of the sugar comprises a halogen (e.g., a fluoro group; 2 ' -F) or an alkoxy group (e.g., a methoxy group; 2 ' -OMe). In certain embodiments, the compounds include at least one 2 '-F sugar modification and at least one 2' -OMe sugar modification. In certain embodiments, the at least one 2 '-F sugar modification and the at least one 2' -OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. These compounds may also be chemically modified nucleic acid molecules, as taught in U.S. patent No. 6,673,661. In other embodiments, the compound comprises a capping chain, as disclosed in WO 00/63364 filed, for example, on 4/19/2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound may include a conjugate group.

Some mechanisms

In certain embodiments, the compounds described herein comprise or consist of a modified oligonucleotide. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compound comprises an oligomeric compound. In certain embodiments, a compound described herein is capable of hybridizing to a target nucleic acid, thereby generating at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds include nucleobase sequences that hybridize to one or more target nucleic acids, thereby producing one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids or hybridize to one or more non-target nucleic acids in such a manner as to produce significant undesired antisense activities.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of proteins that cleave the target nucleic acid. For example, certain compounds described herein result in rnase H mediated cleavage of a target nucleic acid. Rnase H is a cleavage RNA: cellular endonucleases of the RNA strand of the DNA duplex. Such RNA: the DNA in the DNA duplex need not be unmodified DNA. In certain embodiments, the compounds described herein have sufficient "DNA-like" to cause rnase H activity. Further, in certain embodiments, one or more non-DNA-like nucleosides are tolerated in the notch of the notch body.

In certain antisense activities, a compound or a portion of a compound described herein is loaded into an RNA-induced silencing complex (RISC), which ultimately results in cleavage of a target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. The compounds loaded into RISC are RNAi compounds. The RNAi compound can be double stranded (siRNA) or single stranded (ssRNA).

In certain embodiments, hybridization of a compound described herein to a target nucleic acid does not result in recruitment of proteins that cleave the target nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in an alteration of the splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of the binding interaction between the target nucleic acid and the protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activity can be observed directly or indirectly. In certain embodiments, the observation or detection of antisense activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target nucleic acids, target regions, and nucleotide sequences

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from the group consisting of: mRNA and pre-mRNA, including intron regions, exon regions, and untranslated regions. In certain embodiments, the target RNA is mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, at least 50% of the target region is within an intron.

Nucleotide sequences encoding HSD17B13 include, but are not limited to, the following: RefSeq or GENBANK accession No. NM-178135.4 (incorporated by reference herein as SEQ ID NO: 1), GENBANK accession No. NC-000004.12 truncated complement of nucleotides 87301001 to 87326000 (incorporated by reference herein as SEQ ID NO: 2), SEQ ID NO: 3 or GENBANK accession No. NM _001136230.2 (incorporated by reference herein as disclosed as SEQ ID NO: 4).

Hybridization of

In some embodiments, hybridization occurs between a compound disclosed herein and HSD17B13 nucleic acid. The most common hybridization mechanisms involve hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nucleobases of a nucleic acid molecule.

Hybridization can occur under different conditions. Hybridization conditions are sequence dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein specifically hybridize to HSD17B13 nucleic acids.

Complementarity

When two nucleobase sequences are aligned in opposite directions, the nucleobase sequence of such an oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof, the oligonucleotide being said to be complementary to the other nucleic acid. As described herein, nucleobase matching or complementary nucleobases are limited to the following pairs: adenine (a) and thymine (T), adenine (a) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. When such oligonucleotides have nucleobase matching at each nucleoside without any nucleobase mismatch, the oligonucleotides are fully complementary or 100% complementary.

In certain embodiments, the compounds described herein comprise or consist of a modified oligonucleotide. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compound comprises an oligomeric compound. Non-complementary nucleobases between the compound and the HSD17B13 nucleic acid are acceptable as long as the compound is still capable of specifically hybridizing to the target nucleic acid. In addition, the compound may hybridize to one or more segments of HSD17B13 nucleic acid such that intervening or adjacent segments are not included in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).

In certain embodiments, a compound provided herein, or designated portion thereof, is at least or at most 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an HSD17B13 nucleic acid, target region thereof, target segment, or designated portion. In certain embodiments, a compound provided herein, or designated portion thereof, is complementary to HSD17B13 nucleic acid, target region thereof, target segment, or designated portion thereof, by 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number between these ranges. The percent complementarity of a compound to a target nucleic acid can be determined using conventional methods.

For example, 18 out of 20 nucleobases of a compound are complementary to a target region and thus a compound that specifically hybridizes represents 90% complementarity. In this example, the remaining non-complementary nucleobases may cluster or intersperse with complementary nucleobases and need not be contiguous with each other or with complementary nucleobases. Thus, 18 nuclear base long, with the target nucleic acid completely complementary two region flanking four non-complementary nuclear base compounds and target nucleic acid with 77.8% overall complementarity. The percent complementarity of a compound to a target nucleic acid region can be routinely determined using the BLAST program (basic local alignment search tool) and the PowerBLAST program (Altschul et al, J.mol.biol. [ J.Mol. ], 1990, 215, 403410; Zhang and Madden, Genome Res. [ Genome research ], 1997, 7, 649656) known in the art. Percent homology, Sequence identity or complementarity can be determined using default settings, for example, using the Gap program (Wisconsin Sequence Analysis Package for Unix, version 8, Genetics Computer Group, University Research Park, Madison Wis, Wisconsin) using the algorithm of Smith and Waterman (adv.appl.math. [ applied math progress ], 1981, 2, 482489).

In certain embodiments, a compound described herein, or designated portion thereof, is fully complementary (i.e., 100% complementary) to a target nucleic acid, or designated portion thereof. For example, the compound may be fully complementary to HSD17B13 nucleic acid, or a target region or segment or target sequence thereof. As used herein, "fully complementary" means that each nucleobase of a compound is complementary to a corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a 400 nucleobase long target sequence, as long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Complete complementarity may also be used with respect to a specified portion of the first and/or second nucleic acid. For example, a 30 nucleobase compound of 20 nucleobases part can be 400 nucleobases long target sequence "complete complementary". The 30 nucleobase compound of 20 nucleobases is completely complementary to the target sequence if the target sequence has a corresponding 20 nucleobases portion, each of which is complementary to the 20 nucleobases portion of the compound. Also, the entire 30 nucleobases of the compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, a compound described herein comprises one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatches, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the notch region. In certain such embodiments, the mismatch is at positions 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3' end of the notch region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the flanking region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the flap region. In certain embodiments, the mismatch is specifically located within an oligonucleotide that does not have a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

The non-complementary nucleobases can be at the 5 'end or the 3' end of the compound. Alternatively, the non-complementary nucleobases or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobases are located in the wing segment of the gapmer oligonucleotide.

In certain embodiments, a compound described herein that is 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length or up to in length comprises no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., HSD17B13 nucleic acid) or designated portion thereof.

In certain embodiments, a compound described herein that is 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length or up to length comprises no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., HSD17B13 nucleic acid) or designated portion thereof.

In certain embodiments, compounds described herein also include those that are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of consecutive (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A "moiety" may also refer to a defined number of consecutive nucleobases of a compound. In certain embodiments, these compounds are complementary to at least 8 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 9 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 10 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 11 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 12 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 13 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 14 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 15 nucleobase moieties of the target segment. In certain embodiments, these compounds are complementary to at least 16 nucleobase moieties of the target segment. Also contemplated are compounds that are complementary to at least 9, 10, 17, 18, 19, 20, or more nucleobase moieties of the target segment, or a range defined by any two of these values.

Identity of each other

The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a particular ION number, or portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is identical to a sequence disclosed herein if the compound has the same nucleobase-pairing ability as the sequence disclosed herein. For example, an RNA that contains uracil in place of thymine in the disclosed DNA sequence is considered identical to the DNA sequence because both uracil and thymine pair with adenine. Shortened and lengthened forms of the compounds described herein, as well as compounds having non-identical bases relative to the compounds provided herein, are also contemplated. These non-identical bases may be adjacent to each other or dispersed throughout the compound. The percent identity of a compound is calculated based on the number of bases that have the same base pairing relative to the sequence with which it is being compared.

In certain embodiments, a compound described herein, or portion thereof, is, or is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more of a compound disclosed herein, or SEQ ID NO, or portion thereof. In certain embodiments, a compound described herein has about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any percentage identity between these values, to a particular nucleotide sequence, SEQ ID NO, or a compound represented by a particular ION number, or portion thereof, wherein the compounds comprise oligonucleotides having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

In certain embodiments, the compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an isometric portion of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared to an isometric portion of the target nucleic acid.

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide. In certain embodiments, a portion of the oligonucleotide is compared to an isometric portion of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared to an isometric portion of the target nucleic acid.

Certain modified compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide consisting of linked nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or may be a modified oligonucleotide. A modified oligonucleotide comprises at least one modification (i.e., comprises at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage) relative to unmodified RNA or DNA.

A. Modified nucleosides

Modified nucleosides include a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Modified sugar moieties

In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may include one or more substitutions corresponding to other types of those of the modified sugar moiety.

In certain embodiments, the modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more non-cyclic substituents (including but not limited to substituents at the 2 ', 4 ', and/or 5 ' positions). In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2' -substituent groups for the non-bicyclic modified sugar moiety include, but are not limited to: 2 '-F, 2' -OCH ₃("OMe" or "O-methyl") and 2' -O (CH)₂)₂OCH₃("MOE"). In certain embodiments, the 2' -substituent group is selected from: halogen, allyl, amino, azido, SH, CN, OCN, CF₃、OCF₃、O-C₁-C₁₀Alkoxy, O-C₁-C₁₀Substituted alkoxy, O-C₁-C₁₀Alkyl, O-C₁-C₁₀Substituted alkyl, S-alkyl, N (R)_m) Alkyl, O-alkenyl, S-alkenyl, N (R)_m) Alkenyl, O-alkynyl, S-alkynyl, N (R)_m) Alkynyl, O-alkylene-O-alkyl, alkynyl, alkylaryl, arylalkyl, O-alkylaryl, O-arylalkyl, O (CH)₂)₂SCH₃、O(CH₂)₂ON(R_m)(R_n) Or OCH₂C(＝O)-N(R_m)(R_n) Wherein each R is_mAnd R_nIndependently is H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀Alkyl, and as described in Cook et al, U.S.6,531,584; cook et al, U.S.5,859, 221; and the 2' -substituent group described in Cook et al, U.S.6,005,087. These 2'Certain embodiments of the substituent groups may be further substituted with one or more substituent groups independently selected from: hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, Nitro (NO)₂) Thiols, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl groups. Examples of 4' -substituent groups suitable for linear, non-bicyclic, modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al, WO 2015/106128. Examples of suitable 5' -substituent groups for the non-bicyclic modified sugar moieties include, but are not limited to: 5 ' -methyl (R or S), 5 ' -vinyl, and 5 ' -methoxy. In certain embodiments, the non-bicyclic modified sugar comprises more than one non-bridging sugar substituent, such as a 2 '-F-5' -methyl sugar moiety, as well as the modified sugar moieties and modified nucleosides described in Migawa et al, WO 2008/101157 and Rajeev et al, US 2013/0203836.

In certain embodiments, a 2 ' -substituted nucleoside or a 2 ' -non-bicyclic modified nucleoside includes a sugar moiety comprising a linear 2 ' -substituent group selected from: F. NH (NH)₂、N₃、OCF₃、OCH₃、O(CH2)₃NH₂、CH₂CH＝CH₂、OCH₂CH＝CH₂、OCH₂CH₂OCH₃、O(CH₂)₂SCH₃、O(CH₂)₂ON(R_m)(R_n)、O(CH2)₂O(CH₂)₂N(CH₃)₂And N-substituted acetamides (OCH)₂C(＝O)-N(R_m(R_n) Each R) of which_mAnd R_nIndependently is H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀An alkyl group.

In certain embodiments, a 2 ' -substituted nucleoside or a 2 ' -non-bicyclic modified nucleoside includes a sugar moiety comprising a linear 2 ' -substituent group selected from: F. OCF₃、OCH₃、OCH₂CH₂OCH₃、O(CH₂)₂SCH₃、O(CH₂)₂ON(CH₃)₂、O(CH₂)₂O(CH₂)₂N(CH₃)₂And OCH and₂C(＝O)-N(H)CH₃(“NMA”)。

in certain embodiments, a 2 ' -substituted nucleoside or a 2 ' -non-bicyclic modified nucleoside includes a sugar moiety comprising a linear 2 ' -substituent group selected from: F. OCH (OCH)₃And OCH and₂CH₂OCH₃。

nucleosides comprising a modified sugar moiety (e.g., a non-bicyclic modified sugar moiety) are referred to by one or more substituted positions on the sugar moiety of the nucleoside. For example, nucleosides containing 2 '-substituted or 2-modified sugar moieties are referred to as 2' -substituted nucleosides or 2-modified nucleosides.

Certain modified sugar moieties include bridging sugar substituents that form a second ring, thereby producing a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 'and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4 'to 2' bridging sugar substituents include, but are not limited to: 4' -CH ₂-2′、4′-(CH₂)₂-2′、4′-(CH₂)₃-2′、4′-CH₂-O-2′(“LNA”)、4′-CH₂-S-2′、4′-(CH₂)₂-O-2′(“ENA”)、4′-CH(CH₃) -O-2 '(referred to as "constrained ethyl" or "cEt" when in the S configuration), 4' -CH₂-O-CH₂-2’、4’-CH₂-N(R)-2’、4′-CH(CH₂OCH₃) -O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al, u.s.7,399, 845; bhat et al, U.S.7,569, 686; swayze et al, U.S.7,741,457, and Swayze et al, U.S.8,022,193), 4' -C (CH)₃)(CH₃) -O-2 'and analogs thereof (see, e.g., Seth et al, U.S.8,278,283), 4' -CH₂-N(OCH₃) -2 'and analogs thereof (see, e.g., Prakash et al, U.S.8,278,425), 4' -CH₂-O-N(CH₃) -2' (see, e.g., Allerson)Et al, U.S.7,696,345 and Allerson et al, U.S.8,124,745), 4' -CH₂-C(H)(CH₃) -2' (see, e.g., Zhou et al, j]，2009，74，118-134)、4′-CH₂-C(＝CH₂) -2 'and analogs thereof (see, e.g., Seth et al, U.S.8,278,426), 4' -C (R)_aR_b)-N(R)-O-2’、4’-C(R_aR_b)-O-N(R)-2’、4′-CH₂-O-N (R) -2 ', and 4' -CH₂-N (R) -O-2', each of which R, R_aAnd R_bIndependently is H, a protecting group, or C₁-C₁₂Alkyl (see, e.g., Imanishi et al, U.S.7,427, 672).

In certain embodiments, such 4 'to 2' bridges independently comprise 1 to 4 attached groups independently selected from: - [ C (R)_a)(R_b)]_n-、-[C(R_a)(R_b)]_n-O-、-C(R_a)＝C(R_b)-、-C(R_a)＝N-、-C(＝NR_a)-、-C(＝O)-、-C(＝S)-、-O-、-Si(R_a)₂-、-S(＝O)_x-, and-N (R)_a)-；

Wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

Each R_aAnd R_bIndependently is H, a protecting group, hydroxy, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, substituted heteroaryl, C₅-C₇Alicyclic group, substituted C₅-C₇Alicyclic group, halogen, OJ₁、NJ₁J₂、SJ₁、N₃、COOJ₁Acyl (C ═ O) -H), substituted acyl, CN, sulfonyl (S ═ O)₂-J₁) Or sulfenylAcyloxy (sulfo, S (═ O) -J)₁) (ii) a And each J₁And J₂Independently is H, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, acyl (C (═ O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C₁-C₁₂Aminoalkyl, substituted C₁-C₁₂Aminoalkyl groups, or protecting groups.

Additional bicyclic sugar moieties are known in the art, see, for example: freier et al, Nucleic Acids Research [ Nucleic Acids Research ], 1997, 25(22), 4429-4443; albaek et al, j.org.chem. [ journal of organic chemistry ], 2006, 71, 7731-; singh et al, chem. commun. [ chemical communication ], 1998, 4, 455-; koshkin et al Tetrahedron 1998, 54, 3607-; wahlestedt et al, Proc. Natl. Acad. Sci. U.S.A. [ Proc. Natl. Acad. Sci. ], 2000, 97, 5633-; kumar et al, bioorg.Med.chem.Lett. [ Ku organic chemistry and pharmaceutical chemistry promissory ], 1998, 8, 2219-; singh et al, J.org.chem. [ J.org.chem. ], 1998, 63, 10035-; srivastava et al, J.Am.chem.Soc. [ Prof. Natl. Acad. USA ], 2007, 129, 8362-; elayadi et al, Curr, opinion Invens drugs [ recent points of research for drugs ], 2001, 2, 558-; braasch et al, chem.biol. [ chemi-biological ], 2001, 8, 1-7; orum et al, curr. opinion mol. ther. [ recent concept of molecular therapy ], 2001, 3, 239-; wengel et al, U.S.7,053,207, Imanishi et al, U.S.6,268,490, Imanishi et al, U.S.6,770,748, Imanishi et al, U.S. 44,779; wengel et al, U.S.6,794,499, Wengel et al, U.S.6,670,461; wengel et al, U.S.7,034,133, Wengel et al, U.S.8,080, 644; wengel et al, U.S.8,034, 909; wengel et al, U.S.8,153, 365; wengel et al, U.S.7,572, 582; and Ramasamy et al, U.S. Pat. No. 6,525,191, Torsten et al, WO 2004/106356, Wengel et al, WO 1999/014226; seth et al, WO 2007/134181; seth et al, U.S. Pat. No. 7,547,684; seth et al, U.S. Pat. No. 7,666,854; seth et al, U.S.8,088, 746; seth et al, U.S.7,750, 131; seth et al, U.S.8,030,467; seth et al, U.S.8,268, 980; seth et al, U.S.8,546,556; seth et al, U.S.8,530, 640; migawa et al, U.S.9,012,421; seth et al, U.S.8,501, 805; allerson et al, US 2008/0039618; and Migawa et al, US 2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) can be in the α -L configuration or in the β -D configuration.

alpha-L-methyleneoxy (4' -CH)₂O-2') or alpha-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al, Nucleic Acids Research [ Nucleic Acids Research ]],2003, 21, 6365-6372). The summary of bicyclic nucleosides herein includes two isomeric configurations. When the positions of particular bicyclic nucleosides (e.g., LNA or cEt) are identified in the exemplary embodiments herein, they are in the β -D configuration, unless otherwise specified.

In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5 ' -substituted and 4 ' -2 ' bridging sugars).

In certain embodiments, the modified sugar moiety is a sugar substitute. In certain such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties further comprise bridging and/or non-bridging substituents described herein. For example, certain sugar substitutes include a 4 ' -sulfur atom and substitutions at the 2 ' -position (see, e.g., Bhat et al, U.S.7,875,733 and Bhat et al, U.S.7,939,677) and/or the 5 ' -position.

In certain embodiments, the sugar substitute comprises a ring having not 5 atoms. For example, in certain embodiments, the sugar substitute comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, cj.bioorg. & med.chem. [ bio-organic and pharmaceutical chemistry ]2002, 10, 841-854), fluoro-HNA:

("F-HNA", see, e.g., Swayze et al, U.S.8,088, 904; Swayze et al, U.S.8,440, 803; and Swayze et al, U.S.9,005,906, F-HNA may also be referred to as F-THP or 3' -fluorotetrahydropyran), as well as nucleosides having the formula:

wherein, independently, for each of the modified THP nucleosides:

bx is a nucleobase moiety;

T₃and T₄Each independently is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, or T₃And T₄One is the internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, and T ₃And T₄The other is H, a hydroxyl protecting group, a linked conjugate group, or a 5 'or 3' end group; q. q.s₁、q₂、q₃、q₄、q₅、q₆And q is₇Each independently is H, C₁-C₆Alkyl, substituted C₁-C₆Alkyl radical, C₂-C₆Alkenyl, substituted C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, or substituted C₂-C₆An alkynyl group; and isR₁And R₂Each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ₁J₂、SJ₁、N₃、OC(＝X)J₁、OC(＝X)NJ₁J₂、NJ₃C(＝X)NJ₁J₂And CN, wherein X is O, S or NJ₁And each J₁、J₂And J₃Independently is H or C₁-C₆An alkyl group.

In certain embodiments, modified THP nucleosides are provided, wherein q is₁、q₂、q₃、q₄、q₅、q₆And q is₇Each is H. In certain embodiments, q₁、q₂、q₃、q₄、q₅、q₆And q is₇At least one of which is different from H. In certain embodiments, q₁、q₂、q₃、q₄、q₅、q₆And q is₇At least one of which is methyl. In certain embodiments, modified THP nucleosides are provided, wherein R is₁And R₂One is F. In certain embodiments, R₁Is F, and R₂Is H. In certain embodiments, R₁Is methoxy, and R₂Is H, and in certain embodiments, R₁Is methoxyethoxy, and R₂Is H.

In certain embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al, Biochemistry [ Biochemistry ], 2002, 41, 4503-4510 and Summerton et al, U.S. Pat. No. 5,698,685; Summerton et al, U.S. Pat. No. 5,166,315; Summerton et al, U.S. Pat. No. 5,185,444; and Summerton et al, U.S. Pat. No. 5,034,506). As used herein, the term "morpholino" means a sugar substitute having the structure:

In certain embodiments, a morpholino can be modified, for example, by the addition or alteration of a different substituent group from the morpholino structure above. Such sugar substitutes are referred to herein as "modified morpholinyl".

In certain embodiments, the sugar substitute comprises a non-cyclic portion. Examples of nucleosides and oligonucleotides comprising such non-cyclic sugar substitutes include, but are not limited to: peptide nucleic acids ("PNAs"), non-cyclic butyl nucleic acids (see, e.g., Kumar et al, org.biomol. chem. [ organic chemistry and biomolecular chemistry ], 2013, 11, 5853-.

Many other bicyclic and tricyclic sugars and sugar substitute ring systems that can be used in modified nucleosides are known in the art.

In certain embodiments, the modified oligonucleotide comprises a 2' -OMe modified nucleoside in the notch of the cEt notch body. In certain embodiments, the 2' -OMe modified nucleoside is at position 2 or 3 of the notch. In certain embodiments, the 2' -OMe modified nucleoside is at position 2 of the notch. In certain embodiments, the modified oligonucleotide has a glycosyl sequence kkdmddddddddkkkkk, wherein each k represents a cEt nucleoside, each D represents a 2 ' - β -D-deoxyribosyl nucleoside, and each m represents a nucleoside comprising a 2 ' -OMe sugar moiety ("2 ' -OMe nucleoside").

In certain embodiments, the modified oligonucleotide has the formula a-B-C, wherein a is the 5 '-region, B is the central region, and C is the 3' -region. In certain embodiments, a and C are each comprised of 1-5 linked nucleosides and B is comprised of 7-11 linked nucleosides. In certain embodiments, a and C consist of 3 linked cEt nucleosides. In certain embodiments, the second nucleoside of the central region comprises a 2 '-OMe modified sugar moiety, and each of the remaining central region nucleosides comprises a 2' - β -D-deoxyribosyl sugar moiety.

In certain embodiments, the modified oligonucleotide comprises a neutral phosphonate linkage at one or more positions. In certain embodiments, the modified oligonucleotide comprises a methoxypropyl phosphonate linkage at one or more positions. In certain embodiments, the sugar sequence of the modified oligonucleotide is a notch body and the internucleoside linkage motif comprises at least one methoxypropylphosphonate linkage in the notch. In certain embodiments, the methoxypropyl phosphonate linkage is located between the second and third nucleosides in the gap. In certain embodiments, the methoxypropyl phosphonate linkage is located between the third and fourth nucleosides in the gap.

2. Modified nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, but functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases can participate in hydrogen bonding. Such nucleobase modifications can confer nuclease stability, binding affinity, or some other beneficial biological property to the antisense compound.

In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, a modified oligonucleotide comprises one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, a modified oligonucleotide comprises one or more nucleosides comprising a modified nucleobase. In certain embodiments, a modified oligonucleotide comprises one or more nucleosides that do not comprise a nucleobase (referred to as abasic nucleosides).

In certain embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl-or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleobase is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C.ident.C-CH) ₃) Uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyalkylBase, 8-aza and other 8-substituted purines, 5-halo (especially 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, extended size bases, and fluorinated bases. Additional modified nucleobases include tricyclic pyrimidines such as 1, 3-diazophenoxazin-2-one, 1, 3-diazophenthiazin-2-one, and 9- (2-aminoethoxy) -1, 3-diazophenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which purine or pyrimidine bases are replaced by other heterocycles, such as 7-deaza-adenine, 7-deaza-guanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those disclosed in Merigan et al, U.S.3,687,808, in The sense Encyclopedia Of Polymer Science And d Engineering ]Kroschwitz, j.i. editors, John william parent-son (John Wiley)&Sons), 1990, 858-; englisch et al, Angewandte Chemie [ applied chemistry]International edition, 1991, 30, 613; sanghvi, Y.S., Chapter 15, Antisense Research and Applications, [ Antisense Research and use]Crook, s.t. and Lebleu, b., editors, CRC press, 1993, 273- "288; and Antisense Drug Technology disclosed in Antisense Drug Technology]Chapters 6 and 15, crook s.t. editions, CRC press, 2008, 163-.

Publications teaching the preparation of some of the modified nucleobases noted above, as well as other modified nucleobases, include, but are not limited to, manohara et al, US 2003/0158403, manohara et al, US 2003/0175906; dinh et al, U.S.4,845,205; spielmogel et al, U.S.5,130, 302; rogers et al, U.S.5,134,066; bischofberger et al, U.S.5,175,273; urdea et al, U.S.5,367,066; benner et al, U.S.5,432, 272; matteucci et al, U.S.5,434,257; gmeiner et al, U.S.5,457,187; cook et al, U.S.5,459,255; froehler et al, U.S.5,484, 908; matteucci et al, U.S.5,502, 177; hawkins et al, U.S.5,525, 711; haralambidis et al, U.S.5,552,540; cook et al, U.S.5,587, 469; froehler et al, U.S.5,594, 121; switzer et al, U.S.5,596, 091; cook et al, U.S.5,614,617; freehler et al, u.s.5,645, 985; cook et al, U.S.5,681, 941; cook et al, U.S.5,811, 534; cook et al, U.S.5,750,692; cook et al, U.S.5,948, 903; cook et al, U.S.5,587,470; cook et al, U.S.5,457,191; matteucci et al, U.S.5,763,588; froehler et al, U.S.5,830,653; cook et al, U.S.5,808,027; cook et al, U.S.6,166,199; and Matteucci et al, U.S.6,005,096.

In certain embodiments, the compound targeting HSD17B13 nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, each cytosine is a 5-methylcytosine.

Modified internucleoside linkages

The internucleoside linkages naturally occurring in RNA and DNA are 3 'to 5' phosphodiester linkages. In certain embodiments, compounds described herein having one or more modified (i.e., non-naturally occurring) internucleoside linkages are selected to be superior to compounds having naturally occurring internucleoside linkages due to desirable properties, such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid, and increased stability in the presence of nucleases.

Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides comprising sterically random internucleoside linkages, or as a population of modified oligonucleotides comprising phosphorothioate linkages in a particular stereochemical configuration. In certain embodiments, the population of modified oligonucleotides comprises phosphorothioate internucleoside linkages, wherein all phosphorothioate internucleoside linkages are sterically random. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as is well known to those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined steric configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, for example the methods described in Oka et al, JACS 125, 8307(2003), Wan et al nuc.acid.res. [ nucleic acid research ]42, 13456(2014), and WO 2017/015555. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate indicator in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulae, respectively, wherein "B" indicates a nucleobase:

Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be either sterically random or in a particular stereochemical configuration.

In certain embodiments, the compound targeting HSD17B13 nucleic acid comprises one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides with modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

In certain embodiments, the nucleosides of the modified oligonucleotides can be linked together using any internucleoside linkage. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphate esters (also known as unmodified or naturally occurring linkages) containing phosphodiester linkages ("P ═ O"), phosphotriesters, methylphosphonate esters, phosphoramidates, and phosphorothioate ("P ═ S") and phosphorodithioate esters ("HS-P ═ S"). Representative non-phosphorus-containing internucleoside linking groups include, but are not limited to, methyleneimino (-CH) ₂-N(CH₃)-O-CH₂) Thiodiester, thiourethane (-O — C (═ O) (NH) -S-); siloxane (-O-SiH)₂-O-); and N, N' -dimethylhydrazine (-CH)₂-N(CH₃)-N(CH₃) -). Modified internucleoside linkages can be used to alter (typically increase) nuclease resistance of an oligonucleotide compared to naturally occurring phosphate linkages. In certain embodiments, the internucleoside linkages having chiral atoms can be prepared as racemic mixtures, or as individual enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphinesAcid esters and thiophosphates. Methods for preparing phosphorus-containing internucleoside linkages and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3' -CH)₂-N(CH₃) -O-5 '), amide-3 (3' -CH)₂-C (═ O) -n (h) -5 '), amide-4 (3' -CH₂-n (h) -C (═ O) -5 '), methylaldehyde (formacetal) (3' -O-CH)₂-O-5 '), methoxypropyl, and thioacetaldehyde (3' -5-CH)₂-O-5'). Additional neutral internucleoside linkages include non-ionic linkages comprising siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxylic acid amides, sulfides, sulfonic acid esters and amides (see, e.g., Carbohydrate Modifications in Antisense studies ](ii) a Edited by y.s.sanghvi and p.d.cook, ACS Symposium Series [ ACS seminar corpus]580; chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include N, O, S and CH comprising a mixture₂Non-ionic attachment of the constituent parts.

In certain embodiments, the oligonucleotide comprises modified internucleoside linkages arranged in a defined pattern or modified internucleoside linkage motif along the oligonucleotide or a region thereof. In certain embodiments, the internucleoside linkages are arranged as a nicked motif. In such embodiments, the internucleoside linkages in each of the two wing regions are different from the internucleoside linkages in the notch region. In certain embodiments, the internucleoside linkage in the flap is a phosphodiester and the internucleoside linkage in the gap is a phosphorothioate. The nucleoside motifs are independently selected, so such an oligonucleotide having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif, and if it does have a gapped nucleoside motif, the wings and the gap lengths may or may not be the same.

In certain embodiments, the oligonucleotide comprises a region having alternating internucleoside linking motifs. In certain embodiments, the oligonucleotide comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises regions that are uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotides are uniformly linked by phosphorothioates. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from the group consisting of a phosphodiester and a phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from the group consisting of phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' terminus of the oligonucleotide.

In certain embodiments, the oligonucleotide comprises one or more methylphosphonate linkages. In certain embodiments, an oligonucleotide having a gapped body nucleoside motif includes a linkage motif that includes all phosphorothioate linkages except one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate is attached in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and location of phosphorothioate internucleoside linkages and the number and location of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be reduced, and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced, and the number of phosphodiester internucleoside linkages can be increased, while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

3. Certain motifs

In certain embodiments, the compounds described herein comprise oligonucleotides. The oligonucleotides may have motifs, such as unmodified and/or modified sugar moieties, nucleobases, and/or patterns of internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and different modified sugar moieties, nucleobases, and/or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the sugar moiety, nucleobase, and internucleoside linkage are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to these nucleobases independent of their sequence).

a. Certain sugar sequences

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, an oligonucleotide comprises one or more types of modified and/or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain instances, such glycosyl sequences include, but are not limited to, any of the sugar modifications discussed herein.

In certain embodiments, the modified oligonucleotide comprises or consists of a region having a notch motif comprising two outer regions or "wings" and a central or inner region or "notch". The three regions of the notch motif (the 5 '-wing, the notch, and the 3' -wing) form a contiguous sequence of nucleosides, wherein at least some of the sugar moieties of the nucleosides of each of the wings are different from at least some of the sugar moieties of the nucleotides of the notch. Specifically, at least the sugar moiety of the nucleoside closest to the notch of each wing (the 3 'most nucleoside of the 5' -wing and the 5 'most nucleoside of the 3' -wing) is different from the sugar moiety of the adjacent notched nucleoside, thus defining a boundary between the wing and the notch (i.e., the wing/notch junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the notch includes one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the notch. In certain embodiments, the glycosyl sequences of the two wings are identical to each other (symmetrical notch body). In certain embodiments, the 5 '-flanking sugar motif is different from the 3' -flanking sugar motif (asymmetric notch body).

In certain embodiments, the wings of the notch body comprise 1-5 nucleosides. In certain embodiments, the wings of the notch body comprise 2-5 nucleosides. In certain embodiments, the wings of the notch body comprise 3-5 nucleosides. In certain embodiments, the nucleosides of the notch body are all modified nucleosides.

In certain embodiments, the notch of the notch body comprises 7-12 nucleosides. In certain embodiments, the notch of the notch body comprises 7-10 nucleosides. In certain embodiments, the notch of the notch body comprises 8-10 nucleosides. In certain embodiments, the notch of the notch body comprises 10 nucleosides. In certain embodiments, each nucleoside of the notch body is an unmodified 2' -deoxynucleoside.

In certain embodiments, the notched body is a deoxygenated notched body. In such embodiments, the nucleoside on the notch side of each wing/notch junction is an unmodified 2' -deoxynucleoside, and the nucleoside on the wing side of each wing/notch junction is a modified nucleoside. In certain such embodiments, each nucleoside of the gap is an unmodified 2' -deoxynucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, the modified oligonucleotide has a fully modified sugar motif, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a consensus modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a consensus modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2' -modification.

b. Certain nucleobase motifs

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotide comprises modified and/or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of these nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' terminus of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' terminus of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' terminus of the oligonucleotide.

In certain embodiments, an oligonucleotide having a notch motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central notch of an oligonucleotide having a notch body motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2' -deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propynylpyrimidine.

c. Certain internucleoside linking motifs

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotide comprises modified and/or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, substantially each internucleoside linking group is a phosphate internucleoside linkage (P ═ O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate (P ═ S). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is independently selected from phosphorothioate and phosphoester internucleoside linkages. In certain embodiments, the sugar sequence of the modified oligonucleotide is a notch and the internucleoside linkages within the notch are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar moiety of the modified oligonucleotide is a notch and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are sterically random. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linking motifs.

4. Certain modified oligonucleotides

In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, these modifications above (sugar, nucleobases, internucleoside linkages) are incorporated into modified oligonucleotides. In certain embodiments, the modified oligonucleotide is characterized by its modifications, motifs, and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapped body sugar motif can be modified or unmodified, and may or may not follow the gapped body modification pattern of these sugar modifications. For example, the internucleoside linkages within the wing regions of the sugar notch body may be the same or different from each other and may be the same or different from the internucleoside linkages of the notch region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobases, independent of the gapmer pattern of sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by a total length or range and by the length or range of lengths of two or more regions (e.g., regions with nucleosides designated sugar modifications). In such cases, the following values may be selected for each range that result in oligonucleotides having a total length outside the specified range. In such cases, two factors must be satisfied. For example, in certain embodiments, the modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions (A, B, and C), wherein region a consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides, where a and C each consist of 6 linked nucleosides, and B consists of 10 linked nucleosides (even if those numbers of nucleosides are allowed within the requirements of A, B, and C), because the total length of such an oligonucleotide would be 22, which exceeds the upper limit of the total length of the modified oligonucleotide (20). Here, if the description of the oligonucleotide is not mentioned with respect to one or more parameters, such parameters are not limited. Thus, a modified oligonucleotide described only as having a gapped body sugar motif without further description can have any length, an internucleoside linkage motif, and a nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

Certain conjugated compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or end groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. The conjugate group may be attached to either or both ends of the oligonucleotide and/or at any internal position. In certain embodiments, the conjugate group is attached to the 2' -position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate groups attached to either or both ends of the oligonucleotide are terminal groups. In certain such embodiments, the conjugate group or end group is attached at the 3 'and/or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or end group) is attached at the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or end group) is attached at the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleobase sequence that is complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger rna (mrna). In certain embodiments, the oligonucleotide is complementary to the pre-mRNA. In certain embodiments, the oligonucleotide is complementary to the sense transcript.

Examples of end groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides.

In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the attached oligonucleotide, including but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, for example a fluorophore or reporter group that enables detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al, Proc. Natl.Acad.Sci.USA [ Proc. Natl.Acad.Sci.USA ], 1989, 86, 6553-Proc. Acad.6556), cholic acid (Manohara et al, bioorg.Med.Chem.Lett. [ Bioorganic and medicinal chemical letters ], 1994, 4, 1053-Snap 1060), thioethers, such as hexyl-S-tritylthiol (Manohara et al, Ann.N.Y.Acad.Sci. [ New York scientific college annual identification ], 1992, 660, 306-309; Manohara et al, bioorg.Med.Chem.Lett. [ biological organic and medicinal chemical letters ], 1993, 3, 2765-Snap 2770), mercaptocholesterol (Oberhauser et al, Nucl. Acs.Res. [ nucleic acid research 1992, 20, 533, Saik. fatty acid chains, 1993, 3, 2765-alkyl-diol J.19910, European Union [ European Biochemical letters ], 1992.Acad.Acad.S.S.S., 1990, 259, 327 & 330; svinarchuk et al, Biochimie [ biochemistry ], 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethyl-ammonium 1, 2-di-O-hexadecyl-rac-propanetriyl-3-H-phosphate (Manohara et al, Tetrahedron Lett. [ Tetrahedron letters ], 1995, 36, 3651-; see et al, Nucleic Acids Res. [ Nucleic Acids research ], 1990, 18, 3777-; and Nishina et al, Molecular Therapy [ Molecular Therapy ], 2008, 16, 734-.

1.Conjugate moieties

Conjugate moieties include, but are not limited to, intercalators, reporters, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, mercaptocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

In certain embodiments, the conjugate moiety comprises an active drug, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) -pranoprofen, carprofen, danshenic acid, 2, 3, 5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporins, sulfonamides, antidiabetics, antibacterials, or antibiotics.

2.Conjugate linker

The conjugate moiety is attached to the oligonucleotide through a conjugate linker. In certain compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide by a single bond). In certain compounds, the conjugate moiety is attached to the oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties that are subunits that make up the conjugate linker. In certain embodiments, the conjugate linker comprises an oligomer of chain structures (e.g., hydrocarbyl chains), or repeating units (e.g., ethylene glycol, nucleoside, or amino acid units).

In certain embodiments, the conjugate linker comprises one or more groups selected from: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain such embodiments, the conjugate linker comprises a group selected from: alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

In certain embodiments, conjugate linkers (including those described above) are bifunctional linking moieties, such as those known in the art to be useful for attaching a conjugate group to a parent compound (e.g., an oligonucleotide provided herein). Typically, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound and the other functional group is selected to bind to a conjugate group. Examples of functional groups for use in the bifunctional linking moiety include, but are not limited to, electrophiles for reaction with nucleophilic groups and nucleophiles for reaction with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from: amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3, 6-dioxaoctanoic Acid (ADO), succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), and 6-aminocaproic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C₁-C₁₀Alkyl, substituted or unsubstituted C₂-C₁₀Alkenyl or substituted or unsubstituted C₂-C₁₀Alkynyl, wherein a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides include a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from: a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the group consisting of: uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine and 2-N-isobutyryl guanine. It is often desirable that the linker-nucleoside be cleaved from the compound after it reaches the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the compound through a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.

Herein, linker-nucleosides are not considered part of the oligonucleotide. Thus, in the following examples, wherein the compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid, and the compound further comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides do not account for the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, the compound can include (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of consecutive linked nucleosides in such compounds is more than 30. Alternatively, the compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of consecutive linked nucleosides in such compounds is no more than 30. Unless otherwise indicated, the conjugate linker includes no more than 10 linker-nucleosides. In certain embodiments, the conjugate linker comprises no more than 5 linker-nucleosides. In certain embodiments, the conjugate linker comprises no more than 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises no more than 2 linker-nucleosides. In certain embodiments, the conjugate linker comprises no more than 1 linker-nucleoside.

In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide. For example, in some cases, a compound comprising a particular conjugate moiety is better taken up by a particular cell type, but once the compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cellular or subcellular compartment (e.g., lysosome). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (e.g., a nuclease).

In certain embodiments, the cleavable bond is selected from: one or both of an amide, an ester, an ether diester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one ester or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between the oligonucleotide and the conjugate moiety or conjugate group.

In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and/or to the remainder of the compound through a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2 ' -deoxynucleoside attached to the 3 ' or 5 ' -terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and covalently attached to the conjugate linker or the remainder of the conjugate group by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2' -deoxyadenosine.

3. Certain cell-targeting conjugate moieties

In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

wherein n is from 1 to about 3 (m is 0 when n is 1; m is 1 when n is 2 or greater), j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethering ligand. In certain embodiments, the cell-targeting moiety comprises two tethering ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety comprises three tethering ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising a group selected from: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the branched aliphatic group comprises a group selected from: alkyl, amino, oxo, amide, and ether groups. In certain such embodiments, the branched aliphatic group comprises a group selected from: alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises a group selected from an alkyl group and an ether group. In certain embodiments, the branching group comprises a monocyclic or polycyclic ring system.

In certain embodiments, each tether of the cell-targeting moiety comprises, in any combination, one or more groups selected from: alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from: alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from: alkyl, phosphodiester, ether, amino, oxo, and amide. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from: alkyl, ether, amino, oxo, and amide. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from: alkyl, amino, and oxo. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from alkyl and oxo in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain of about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain of about 10 to about 18 atoms in length. In certain embodiments, each tether comprises a chain length of about 10 atoms.

In certain embodiments, each ligand of the cell-targeting moiety has affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has affinity for at least one type of receptor on the surface of a mammalian hepatocyte. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from the group consisting of galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and trehalose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the cell targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell targeting moiety comprises 1 GalNAc ligand.

In certain embodiments, each ligand of the cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group includes a Carbohydrate Cluster (see, e.g., Maier et al, "Synthesis of Antisense Oligonucleotides Conjugated to a polyvalent Carbohydrate Cluster for cell Targeting ]", Bioconjugate Chemistry [ Bioconjugate Chemistry ], 2003, 14, 18-29, or Rensen et al, "Design and Synthesis of Novel N-acetyl galactosamine-Terminated glycoconjugates for Targeting of lipoteins to the asialoglycoprotein Receptor, journal of Design and Synthesis [ Chemistry 5747, J.J.S. ] for Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins", J.S. 5. 9. c., [ chemical 5708 ] drugs). In certain such embodiments, each ligand is an amino sugar or a thiosugar. For example, the amino sugar may be selected from any number of compounds known in the art, such as sialic acid, α -D-galactosamine, β -muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4, 6-dideoxy-4-carboxamido-2, 3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucopyranose and N-sulfo-D-glucamine, and N-glycolyl- α -neuraminic acid. For example, the thiosugars may be selected from 5-thio- β -D-glucopyranose, methyl 2, 3, 4-tri-O-acetyl-1-thio-6-O-trityl- α -D-glucopyranoside, 4-thio- β -D-galactopyranose, and ethyl 3, 4, 6, 7-tetra-O-acetyl-2-deoxy-1, 5-dithio- α -D-glucoheptopyranoside (heptapyroside).

In certain embodiments, the conjugate group comprises a cell targeting moiety having the formula:

in certain embodiments, the conjugate group comprises a cell targeting moiety having the formula:

in certain embodiments, the conjugate group comprises a cell targeting moiety having the formula:

in certain embodiments, the conjugate group comprises a cell targeting moiety having the formula:

in certain embodiments, the conjugate group comprises a cell targeting moiety having the formula:

in certain embodiments, the compound comprises a conjugate group described herein as "LICA-1". LICA-1 has the following formula:

in certain embodiments, the compounds described herein include LICA-1 and a cleavable moiety within the conjugate linker, the compounds having the formula:

wherein the oligo is an oligonucleotide.

Representative U.S. patents, U.S. patent application publications, international patent application publications, and other publications including, but not limited to, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO 2012/037254, Biessen et al, J.Med.Chem. [ J.J. ] 1995, 38, 1846. acta 1852, Lee et al, Bioorganic & Medicinal Chemistry [ bio-organic Chemistry and Medicinal Chemistry ]2011, 19, 2494. acta 2500, Rensen et al, J.Biol.chem. [ biochemistry ])2001, 37577, 37584, Rensen et al, J.Biol.chem. [ biochemistry ] 276. chem. ], 2001, 37577, and 37584, Rensen et al [ chem., 47, 5798-.

In certain embodiments, the modified oligonucleotide comprises a notch or a fully modified glycosyl sequence and a conjugate group comprising at least one, two, or three GalNAc ligands. In certain embodiments, the compounds include conjugate groups found in any of the following references: lee, carbohydrate Res 1978, 67, 509-; connolly et al, J Biol Chem [ J. Biol. Chem ], 1982, 257, 939-945; pavia et al, Int J Pep Protein Res [ journal of peptide and Protein research International ], 1983, 22, 539-548; lee et al, Biochem [ biochemistry ], 1984, 23, 4255-4261; lee et al, Glycoconjugate J [ J.glycoconjugate ], 1987, 4, 317-328; toyokuni et al Tetrahedron letters 1990, 31, 2673-; biessen et al, J Med Chem [ J.Pharmacochemia ], 1995, 38, 1538-; valentijn et al, Tetrahedron, 1997, 53, 759-S770; kim et al Tetrahedron letters 1997, 38, 3487-; lee et al, bioconjugate Chem [ bioconjugate chemistry ], 1997, 8, 762-; kato et al, Glycobiol [ glycobiology ], 2001, 11, 821-829; rensen et al, J Biol Chem [ journal of biochemistry ], 2001, 276, 37577-37584; lee et al, Methods Enzymol [ Methods of enzymology ], 2003, 362, 38-43; westerling et al, Glycoconj J [ J.Glycoconj ], 2004, 21, 227-241; lee et al, Bioorg Med Chem Lett [ Rapid report of Bioorganic and medicinal chemistry ], 2006, 16(19), 5132-; maierhofer et al, Bioorg Med Chem [ Bioorganic and medicinal chemistry ], 2007, 15, 7661-; khorev et al, Bioorg Med Chem [ organic and medicinal inter-chemistry ], 2008, 16, 5216-; lee et al, Bioorg Med Chem [ Bioorganic and medicinal chemistry ], 2011, 19, 2494-; kornilova et al, Analyt Biochem [ analytical biochemistry ], 2012, 425, 43-46; pujol et al, Angew Chemie Int Ed Engl [ applied chemistry-International English edition ], 2012, 51, 7445-; biessen et al, J Med Chem [ J.Chem.Chem ], 1995, 38, 1846-; sliedregt et al, J Med Chem [ journal of medicinal chemistry ], 1999, 42, 609-618; rensen et al, J Med Chem [ journal of medicinal chemistry ], 2004, 47, 5798-; rensen et al, Arterioscler Thromb Vasc Biol [ arteriosclerotic thrombosis and vascular biology ], 2006, 26, 169-; van Rossenberg et al, Gene Ther [ Gene therapy ], 2004, 11, 457-; sato et al, J Am Chem Soc [ journal of American society for chemistry ], 2004, 126, 14013-; lee et al, J Org Chem [ J. Org. Chem ], 2012, 77, 7564-; biessen et al, FASEB J [ J. Association of American society for laboratory biology ], 2000, 14, 1784-; rajur et al, bioconjugug Chem [ bioconjugate chemistry ], 1997, 8, 935-940; duff et al, Methods Enzymol [ Methods of enzymology ], 2000, 313, 297-; maier et al, bioconjugate Chem [ bioconjugate chemistry ], 2003, 14, 18-29; jayaprakash et al, Org Lett [ organic letters ], 2010, 12, 5410-; ManohaFan, Antisense Nucleic Acid Drug Dev [ Antisense Nucleic Acid Drug development ], 2002, 12, 103-128; merwin et al, bioconjugate Chem 1994, 5, 612- > 620; tomiya et al, Bioorg Med Chem [ Bio-organic chemistry and medicinal chemistry ], 2013, 21, 5275-; international application WO 1998/013381; WO 2011/038356; WO 1997/046098; WO 2008/098788; WO 2004/101619; WO 2012/037254; WO 2011/120053; WO 2011/100131; WO 2011/163121; WO 2012/177947; WO 2013/033230; WO 2013/075035; WO 2012/083185; WO 2012/083046; WO 2009/082607; WO 2009/134487; WO 2010/144740; WO 2010/148013; WO 1997/020563; WO 2010/088537; WO 2002/043771; WO 2010/129709; WO 2012/068187; WO 2009/126933; WO 2004/024757; WO 2010/054406; WO 2012/089352; WO 2012/089602; WO 2013/166121; WO 2013/165816; us patent 4,751,219; 8,552,163, respectively; 6,908,903, respectively; 7,262,177, respectively; 5,994,517, respectively; 6,300,319, respectively; 8,106,022, respectively; 7,491,805, respectively; 7,491,805, respectively; 7,582,744, respectively; 8,137,695, respectively; 6,383,812, respectively; 6,525,031, respectively; 6,660,720, respectively; 7,723,509, respectively; 8,541,548, respectively; 8,344,125, respectively; 8,313,772, respectively; 8,349,308, respectively; 8,450,467, respectively; 8,501,930, respectively; 8,158,601, respectively; 7,262,177, respectively; 6,906,182, respectively; 6,620,916, respectively; 8,435,491, respectively; 8,404,862, respectively; 7,851,615, respectively; published U.S. patent application publications US 2011/0097264; US 2011/0097265; US 2013/0004427; US 2005/0164235; US 2006/0148740; US 2008/0281044; US 2010/0240730; US 2003/0119724; US 2006/0183886; US 2008/0206869; US 2011/0269814; US 2009/0286973; US 201I/0207799; US 2012/0136042; US 2012/0165393; US 2008/0281041; US 2009/0203135; US 2012/0035115; US 2012/0095075; US 2012/0101148; US 2012/0128760; US 2012/0157509; US 2012/0230938; US 2013/0109817; US 2013/0121954: US 2013/0178512; US 2013/0236968; US 2011/0123520: US 2003/0077829; US 2008/0108801; and US 2009/0203132.

In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Compositions and methods for formulating pharmaceutical compositions

The compounds described herein may be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In certain embodiments, these compounds are antisense compounds or oligomeric compounds. In certain embodiments, these compounds comprise or consist of modified oligonucleotides. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile salt solution and one or more compounds. In certain embodiments, such pharmaceutical compositions consist of a sterile salt solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and Phosphate Buffered Saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is a pharmaceutical grade PBS. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.

The compounds described herein that target HSD17B13 nucleic acid may be utilized in pharmaceutical compositions obtained by combining the compounds with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeting HSD17B13 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising the compounds provided herein encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligonucleotide capable of providing (directly or indirectly) a biologically active metabolite or residue thereof after being administered to an animal, including a human. In certain embodiments, these compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Thus, for example, the disclosure also relates to pharmaceutically acceptable salts of the compounds, prodrugs, pharmaceutically acceptable salts of the prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

Prodrugs can include incorporation of additional nucleosides at one or both ends of the compound, which nucleosides are cleaved in vivo by endogenous nucleases to form the active compound.

In certain embodiments, these compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

Examples of the invention

The following example describes a screening process for identifying compounds targeting HSD17B 13.

Non-limiting disclosure and incorporation by reference

Although the sequence listing accompanying this document identifies each sequence as "RNA" or "DNA" as appropriate, in practice those sequences may be modified with any combination of chemical modifications. One skilled in the art will readily recognize that names such as "RNA" or "DNA" describe that modified oligonucleotides are in some cases arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2 ' -OH sugar moiety and a thymine base can be described as a DNA having a modified sugar (2 ' -OH for the native 2 ' -H of the DNA) or an RNA having a modified base (thymine (methylated uracil) for the native uracil of the RNA).

Thus, nucleic acid sequences provided herein (including but not limited to those in the sequence listing) are intended to encompass nucleic acids containing natural or modified RNA and/or DNA in any combination, including but not limited to such nucleic acids having modified nucleobases. By way of further example, and not limitation, an oligonucleotide having a nucleobase sequence "ATCGATCG" encompasses any oligonucleotide having such a nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having the sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "aucgacgatcg", as well as nucleobases having other modifications such as "AT ^mCGAUCG's compound (wherein^mC represents a cytosine base containing a methyl group at the 5-position).

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations, which may be defined in terms of absolute stereochemistry as (R) or (S), or as α or β (as for sugar anomers), or as (D) or (L) (as for amino acids), and the like. Compounds provided herein that are written or described as having certain stereoisomeric configurations include only the compounds shown. The compounds provided herein, written or described with undefined stereochemistry, include all such possible isomers, including their stereorandom and optically pure forms. Likewise, all tautomeric forms of the compounds provided herein are included, unless otherwise specified. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

The compounds described herein include variants in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein containing a hydrogen atom are contemplated for each ¹All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to:²h or³H is substituted for¹H、¹³C or¹⁴Substitution of C¹²C、¹⁵Substitution of N¹⁴N、¹⁷O or¹⁸Substitution of O for¹⁶O, and³³S、³⁴S、³⁵s or³⁶S substitution³²S。

While certain compounds, compositions, and methods described herein have been specifically described according to certain examples, the following examples are intended only to illustrate the compounds described herein and are not intended to limit them. Each reference cited in this application is incorporated herein by reference in its entirety.

Example 1: antisense inhibition of human HSD17B13 in HepaRG cells by cEt notch bodies

Modified oligonucleotides complementary to HSD17B13 nucleic acids were synthesized and tested in vitro for their effect on HSD17B13 RNA levels. These modified oligonucleotides were tested in a series of experiments using the same culture conditions. The following table lists the results of each individual experiment.

These modified oligonucleotides were all 3-10-3 cEt notch bodies (i.e., a central notch segment with 10 2' -deoxynucleosides flanked by flanking segments, each comprising three cEt modified nucleosides). The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P ═ S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosine.

"start site" means the most 5' nucleoside of the target sequence to which the modified oligonucleotide is complementary. "termination site" means the 3' most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides were complementary to: human HSD17B13mRNA (designated herein as SEQ ID NO: 1(GENBANK accession No. NM-178135.4)) or human HSD17B13 genomic sequence (designated herein as SEQ ID NO: 2 (the complement of GENBANK accession No. NC-000004.12 truncated from nucleotides 87301001 to 87326000)) or both. "N/A" means that the modified oligonucleotide is not 100% complementary to a particular target sequence.

Cultured HepaRG cells were transfected with 1,000nM modified oligonucleotide at a density of 20,000 cells per well using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HSD17B13 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS43553 (forward sequence AGACTACAGAAGTTTCTTCCTGAAC, referred to herein as SEQ ID NO: 5; reverse sequence CATCTCTGGCTGGAGCTTATTT, referred to herein as SEQ ID NO: 6; probe sequence TTTGAAGCAGTGGTTGGCCACAAA, referred to herein as SEQ ID NO: 7) was used to measure RNA levels. Such as by HSD17B13 RNA levels were normalized to total RNA content as measured. Results are presented as percent HSD17B13 inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with the modified oligonucleotide does not inhibit HSD17B13 mRNA levels. Asterisks indicate that the modified oligonucleotides were complementary to the target transcripts within the amplicon region of the primer probe set, and therefore the relevant data was unreliable. In this case, additional use of alternative primer probe sets must be made to accurately assess the efficacy and efficacy of such modified oligonucleotides.

TABLE 1

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 2

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 3

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 4

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 5

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 6

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 7

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 8

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 9

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 10

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 11

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 12

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 13

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 14

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 15

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 16

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 17

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 18

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 19

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 20

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 21

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 22

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 23

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 24

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

TABLE 25

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 26

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Example 2: dose-dependent inhibition of human HSD17B13 in HepaRG cells by cEt notch bodies

Certain modified oligonucleotides described in the above studies, which showed significant in vitro inhibition of HSD17B13 RNA, were selected and tested at different doses in HepaRG cells.

These modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are presented in a separate table as shown below. Heparg cells cultured at a density of 30,000 cells per well were applied with electricityThe perforation method was transfected with modified oligonucleotides diluted to different concentrations as specified in the table below. Following a treatment period of approximately 24 hours, HSD17B13 RNA levels were measured using human HSD17B13 primer probe set RTS43553 as previously described. Such as by HSD17B13RNA levels were normalized to total RNA as measured. The results are presented in the table below as percent inhibition of HSD17B13 relative to untreated control cells.

Half maximal Inhibitory Concentration (IC) of each modified oligonucleotide₅₀) Linear regression calculations were performed in excel using log/linear plots of data, also given in the table below.

Watch 27

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 28

Multi-dose assay for modified oligonucleotides in Heparg cells

Example 3: antisense inhibition of human HSD17B13 in HepaRG cells by cEt notch bodies

Additional modified oligonucleotides complementary to HSD17B13 nucleic acids were synthesized and tested in vitro for their effect on HSD17B13RNA levels. These modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are presented in a separate table as shown below.

Use of 1,000nM modified oligonucleotides for electroporationCultured HepaRG cells were transfected at a density of 30,000 cells per well. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HSD17B13RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS43553 was used to measure RNA levels. Such as by HSD17B13 RNA levels were adjusted based on total RNA content as measured. Results are presented as percent HSD17B13 inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with the modified oligonucleotide does not inhibit HSD17B13mRNA levels. Asterisks indicate that the modified oligonucleotides were complementary to the target transcripts within the amplicon region of the primer probe set, and therefore the relevant data was unreliable. In this case, additional use of alternative primer probe sets must be made to accurately assess the efficacy and efficacy of such modified oligonucleotides.

The modified oligonucleotides described in the following table are 3-10-3 cEt notch bodies. The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P ═ S) linkages. All cytosine residues throughout each modified oligonucleotide are 5-methylcytosine.

"start site" means the most 5' nucleoside of the target sequence to which the modified oligonucleotide is complementary. "termination site" means the 3' most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides were complementary to: human HSD17B13mRNA (designated herein as SEQ ID NO: 1(GENBANK accession No. NM-178135.4)) or human HSD17B13 genomic sequence (designated herein as SEQ ID NO: 2 (the complement of GENBANK accession No. NC-000004.12 truncated from nucleotides 87301001 to 87326000)) or both. "N/A" means that the modified oligonucleotide is not 100% complementary to a particular target sequence.

Watch 29

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 30

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 31

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 32

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 33

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 34

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 35

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 36

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 37

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Watch 38

Targeting SEQ ID NO: inhibition of HSD17B13 RNA by the 3-10-3 cEt notch of 1 and 2

Modified oligonucleotides complementary to HSD17B13 nucleic acids with other chemical modifications were synthesized and tested for their effect on HSD17B13 RNA levels in vitro, as described above. The chemical symbol columns in the table below specify the chemistry of each modified oligonucleotide; wherein subscript ' D ' represents a 2 ' - β -D-deoxyribosyl sugar moiety, subscript ' e ' represents a 2 ' -MOE sugar moiety, subscript ' y ' represents a 2 ' -O-methyl sugar moiety, subscript ' k ' represents a cEt-modified sugar moiety, subscript's ' represents a phosphorothioate internucleoside linkage, and superscript'm ' preceding a cytosine residue represents 5-methylcytosine.

Watch 39

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 40

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Table 41

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 42

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 43

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 44

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

TABLE 45

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

TABLE 46

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 47

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 48

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 49

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Example 4: design and antisense inhibition of human HSD17B13 modified oligonucleotides in HepRG cells

Modified oligonucleotides complementary to HSD17B13 nucleic acids were synthesized and tested in vitro for their effect on HSD17B13 RNA levels. Specifying the chemistry of each modified oligonucleotide; wherein subscript ' D ' represents a 2 ' - β -D-deoxyribosyl sugar moiety, subscript ' e ' represents a 2 ' -MOE sugar moiety, subscript ' y ' represents a 2 ' -O-methyl sugar moiety, subscript ' k ' represents a cEt-modified sugar moiety, subscript's ' represents a phosphorothioate internucleoside linkage, and superscript'm ' preceding a cytosine residue represents 5-methylcytosine. "start site" means the most 5' nucleoside of the target sequence to which the modified oligonucleotide is complementary. "termination site" means the 3' most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides were complementary to: human HSD17B13 mRNA (designated herein as SEQ ID NO: 1(GENBANK accession No. NM-178135.4)) or human HSD17B13 genomic sequence (designated herein as SEQ ID NO: 2 (the complement of GENBANK accession No. NC-000004.12 truncated from nucleotides 87301001 to 87326000)), or both. "N/A" means that the modified oligonucleotide is not 100% complementary to a particular target sequence.

These modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are presented in a separate table as shown below. Cultured HepaRG cells were transfected with 1,000nM modified oligonucleotide at a density of 30,000 cells per well using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HSD17B13 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS43553 was used to measure RNA levels. Such as byHSD17B13 RNA levels were adjusted based on total RNA content as measured. Results are presented as percent HSD17B13 inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with the modified oligonucleotide does not inhibit HSD17B13 mRNA levels.

Watch 50

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Watch 51

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Table 52

Targeting SEQ ID NO: 1 and 2 inhibition of HSD17B13 RNA by modified oligonucleotides

Example 5: dose-dependent inhibition of human HSD17B13 in HepaRG cells by the modified oligonucleotides.

Certain modified oligonucleotides described in the above studies, which showed significant in vitro inhibition of HSD17B13RNA, were selected and tested at different doses in HepaRG cells.

These modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are presented in a separate table as shown below. Heparg cells cultured at a density of 30,000-35,000 cells per well were transfected using electroporation with modified oligonucleotides diluted to different concentrations as specified in the following table. Following a treatment period of approximately 24 hours, HSD17B13RNA levels were measured using human HSD17B13 primer probe set RTS43553 as previously described. HSD17B13RNA levels were normalized to total RNA content as measured by human GAPDH. The results are presented in the table below as percent inhibition of HSD17B13 relative to untreated control cells. Data denoted "n.d. (no data)" means that no data is available for treatment of the compound.

Half maximal Inhibitory Concentration (IC) of each modified oligonucleotide₅₀) Linear regression calculations were performed in excel using log/linear plots of data, also given in the table below.

Watch 53

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 54

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 55

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 56

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 57

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 58

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 59

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 60

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 61

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 62

Multi-dose assay for modified oligonucleotides in Heparg cells

Table 63

Multi-dose assay for modified oligonucleotides in Heparg cells

Table 64

Multi-dose assay for modified oligonucleotides in Heparg cells

Table 65

Multi-dose assay for modified oligonucleotides in Heparg cells

TABLE 66

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 67

Multi-dose assay for modified oligonucleotides in Heparg cells

Table 68

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 69

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 70

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 71

Multi-dose assay for modified oligonucleotides in Heparg cells

Watch 72

Multi-dose assay for modified oligonucleotides in Heparg cells

TABLE 73

Multi-dose assay for modified oligonucleotides in Heparg cells

Table 74

Multi-dose assay for modified oligonucleotides in Heparg cells

TABLE 75 Multi-dose assay of modified oligonucleotides in HepaRG cells

Watch 76

Multi-dose assay for modified oligonucleotides in Heparg cells

Example 6: design of human HSD17B13 modified oligonucleotide

Certain of the modified oligonucleotides described above are further modified by conjugation at the 5' terminus with a LICA-1 moiety. The resulting compounds and their unconjugated counterparts are listed in the table below. These compounds have the same sequence and oligonucleotide chemistry as the "parent compound" described above.

Watch 77

Design of 5' -LICA-1 conjugated modified oligonucleotides targeting human HSD17B13

Example 7: dose-dependent ex vivo inhibition of human HSD17B13 in transgenic mouse hepatocytes

Inhibition of HSD17B13 RNA by the above-described conjugated modified oligonucleotides was tested at different doses in primary mouse hepatocytes extracted from transgenic mice.

A transgenic mouse model was developed internally using Fosmid containing the human HSD17B13 gene (NCBI clone DB ID: ABC8-43206400A 10). The clone was digested at Not1 restriction site (2 different sites) to generate a 19118bp fragment containing the human HSD17B13 gene, including an upstream 12175bp and a downstream 7553bp region. This gene fragment was introduced into fertilized eggs of mice of the C57/BL/6NTac strain by prokaryotic injection to generate huHSD 17469 and 17470 founder lines. Transgenic mice derived from the founder line 17469 were used in the experiments described herein. In this model, human HSD17B13 RNA expression was found in the liver. Mice were sacrificed and hepatocytes were collected for experiments to test conjugated modified oligonucleotides.

These conjugated modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are presented in a separate table as shown below. The primary mouse transgenic hepatocytes described above were plated at a density of 20,000 cells per well and treated by free uptake with conjugated modified oligonucleotides diluted to different concentrations as specified in the table below. After overnight incubation, HSD17B13 RNA levels were measured using human HSD17B13 primer-probe set RTS43553 as previously described herein. HSD17B13 RNA levels were normalized to total GAPDH content. The results are presented in the table below as percent inhibition of HSD17B13 relative to untreated control cells. Half maximal Inhibitory Concentration (IC) of each modified oligonucleotide ₅₀) Linear regression calculations were performed in excel using log/linear plots of data, also given in the table below.

Watch 78

Multi-dose assay for modified oligonucleotides in primary mouse hepatocytes

TABLE 79

Multi-dose assay for modified oligonucleotides in primary mouse hepatocytes

Watch 80

Multi-dose assay for modified oligonucleotides in primary mouse hepatocytes

Example 8: tolerance of modified oligonucleotides complementary to human HSD17B13 in CD-1 mice

CD-1 mice are a multi-purpose mouse model that is frequently used for safety and efficacy testing. In this study, CD-1 mice were treated with conjugated modified oligonucleotides selected from the studies described above, and changes in the levels of different plasma chemical markers were assessed.

Treatment of

Groups of 6 to 8 week old male CD-1 mice were injected subcutaneously with 25mg/kg of conjugated modified oligonucleotide once a week for six weeks (7 treatments total). One group of male CD-1 mice were injected with PBS. Mice were euthanized 48 hours after the last administration.

Study 1

Plasma chemical markers

To assess the effect of conjugated modified oligonucleotides on liver function, plasma levels of Blood Urea Nitrogen (BUN), albumin, alanine Aminotransferase (ALT), aspartate Aminotransferase (AST) and Creatinine (CREA) were determined using an automated clinical chemistry analyzer (hitian olympus AU400c, Melville, n.y.). The results are presented in the table below.

Watch 81

Plasma chemical markers in male CD-1 mice

Body weight and organ weight

The body weights of CD-1 mice were measured on days 1 and 44, and the average body weight of each group is shown in the following table. The weight of the liver, kidney and spleen was measured at the end of the study and is presented in the table below.

Table 82

Body weight and organ weight (in grams)

Hematological assay

Blood was obtained from the mouse group at week 6 and sent to idex BioResearch for Hematocrit (HCT) and platelet count (PLT) measurements. The results are presented in the table below.

Watch 83

Blood cell count of male CD-1 mice

Study 2

Plasma chemical markers

To assess the effect of modified oligonucleotides on liver function, plasma levels of Blood Urea Nitrogen (BUN), albumin, alanine Aminotransferase (ALT), aspartate Aminotransferase (AST) and Creatinine (CREA) were determined using an automated clinical chemistry analyzer (hitian olympus AU400c, Melville, n.y.). The results are presented in the table below.

Watch 84

Plasma chemical markers in male CD-1 mice

Body weight and organ weight

The body weights of CD-1 mice were measured on days 1 and 42, and the average body weight of each group is shown in the following table. The weight of the liver, kidney and spleen was measured at the end of the study and is presented in the table below.

Watch 85

Body weight and organ weight (in grams)

Hematological assay

Blood was obtained from the mouse group at week 6 and sent to idex BioResearch for Hematocrit (HCT), platelet count (PLT), neutrophil count (NEU), reticulocyte count (RET), and lymphocyte count (LYM). The results are presented in the table below.

Watch 86

Blood cell count of male CD-1 mice

Study 3

Plasma chemical markers

To assess the effect of modified oligonucleotides on liver function, plasma levels of Blood Urea Nitrogen (BUN), albumin, alanine Aminotransferase (ALT), aspartate Aminotransferase (AST), Total Bilirubin (TBIL) and Creatinine (CREA) were determined using a fully automated clinical chemistry analyzer (hitian olympus AU400c, Melville, n.y.). The results are presented in the table below.

Watch 87

Plasma chemical markers in male CD-1 mice

Body weight and organ weight

The body weights of CD-1 mice were measured on days 1 and 39, and the average body weight of each group is shown in the following table. The weight of the liver, kidney and spleen was measured at the end of the study and is presented in the table below.

Watch 88

Body weight and organ weight (in grams)

Hematological assay

Blood obtained from the mouse group at week 6 was sent to idex BioResearch for Hematocrit (HCT), platelet count (PLT), neutrophil count (NEU), reticulocyte count (RET), and lymphocyte count (LYM). The results are presented in the table below.

Watch 89

Blood cell count of male CD-1 mice

Example 9: tolerance of modified oligonucleotides targeting human HSD17B13 in Sprague-Dawley rats

The speprala-dawn rat is a multi-purpose model for safety and efficacy assessment. In this study, rats were treated with Ionis conjugated modified oligonucleotides from the study described in the example above, and changes in the levels of different plasma chemical markers were assessed.

Treatment of

Male sprague rats were maintained in a 12 hour light dark cycle and fed normal Purina rat chow at any amount. Groups of 4 Spela-dawn rats were injected subcutaneously with 25mg/kg of conjugated modified oligonucleotide weekly for 6 weeks (total of 7 doses). After 72 hours of the last administration, rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Study 1

Plasma chemical markers

To assess the effect of conjugated modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). Plasma levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) were measured and these results are presented in the table below, expressed in IU/L. Plasma levels of Creatinine (CREA), albumin, and Blood Urea Nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and these results are also presented in the table below.

Watch 90

Plasma chemical markers in speprala-dawley rats

Hematological assay

Blood was obtained from the mouse group at week 6 and sent to idex BioResearch for Hematocrit (HCT) and platelet count (PLT) measurements. The results are presented in the table below.

Watch 91

Blood cell count in Spela-dawn rats

Renal function

To assess the effect of conjugated modified oligonucleotides on renal function, total urinary protein levels and urinary creatinine levels were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). The ratio of total protein to creatinine (P/C ratio) is presented in the table below.

Watch 92

Total protein to creatinine ratio in Sprague rats

ION NO.	Urine P/C ratio
		PBS	0.5
1310535	0.4
		1371966	0.8
1371968	0.7
		1371969	0.6
1371970	0.6
		1371971	1.1
1371972	0.4
		1371973	0.7
1371974	0.8
		1371976	0.7
1371978	0.5
		1371979	0.8

Body weight and organ weight

Body weights of the spera-dawn rats were measured on days 1 and 40, and the average body weight of each group is shown in the following table. The weight of liver, heart, spleen and kidney was measured at the end of the study and is presented in the table below.

Watch 93

Body weight and organ weight (g) of Spila-Dawley rats

Study 2

Plasma chemical markers

To assess the effect of conjugated modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). Plasma levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) were measured and these results are presented in the table below, expressed in IU/L. Plasma levels of Creatinine (CREA), albumin, and Blood Urea Nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and these results are also presented in the table below.

Table 94

Plasma chemical markers in speprala-dawley rats

Hematological assay

Blood obtained from the group of mice at week 6 was sent to idex BioResearch for Hematocrit (HCT), and platelet count (PLT), neutrophil count (NEU), reticulocyte count (RET), and lymphocyte count (LYM) measurements. The results are presented in the table below.

Watch 95

Blood cell count in Spela-dawn rats

Renal function

To assess the effect of Ionis oligonucleotides on renal function, total urine protein levels and urine creatinine levels were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). The ratio of total protein to creatinine (P/C ratio) is presented in the table below.

Watch 96

Total protein to creatinine ratio in Sprague rats

Body weight and organ weight

Body weights of the spera-dawn rats were measured on days 1 and 44, and the average body weight of each group is shown in the following table. The weight of liver, heart, spleen and kidney was measured at the end of the study and is presented in the table below.

Watch 97

Body weight and organ weight (g) of Spila-Dawley rats

Study 3

Plasma chemical markers

To assess the effect of conjugated modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). Plasma levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) were measured and these results are presented in the table below, expressed in IU/L. Plasma levels of Creatinine (CREA), albumin, Total Bilirubin (TBIL) and Blood Urea Nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and these results are also presented in the table below.

Watch 98

Plasma chemical markers in speprala-dawley rats

Hematological assay

Blood was obtained from the mouse group at week 6 and sent to idex BioResearch for Hematocrit (HCT), and platelet count (PLT), neutrophil count (NEU), reticulocyte count (RET), and lymphocyte count (LYM) measurements. The results are presented in the table below.

TABLE 99

Blood cell count in Spela-dawn rats

Renal function

To assess the effect of Ionis oligonucleotides on renal function, total urine protein levels and urine creatinine levels were measured using an automated clinical chemistry analyzer (hitian olympus AU400c, melville, new york). The ratio of total protein to creatinine (P/C ratio) is presented in the table below.

Watch 100

Total protein to creatinine ratio in Sprague rats

Body weight and organ weight

Body weights of the spera-dawn rats were measured on days 1 and 42, and the average body weight of each group is shown in the following table. The weight of liver, heart, spleen and kidney was measured at the end of the study and is presented in the table below.

Watch 101

Body weight and organ weight (g) of Spila-Dawley rats

Example 10: measurement of viscosity of modified oligonucleotides targeted to human HSD17B13 the viscosity of selected conjugated modified oligonucleotides from the above study was measured.

Placing the conjugated modified oligonucleotide (in the range of 32-38 mg) into a separate glass vial; approximately 100 μ L of water was added to each vial, and the conjugated modified oligonucleotide was then dissolved into solution by heating the vial to 55 ℃. A75 μ L portion of the preheated sample was pipetted into a microviscometer (PAC Cambridge viscometer). The temperature of the microviscometer was set to 25 ℃, and the viscosity of the sample was measured. The 75uL portion of each sample was then combined with the remainder of the original sample, which was then diluted for UV reading at 260nM (Cary UV instrument). The data are presented in the table below. Compounds with a viscosity of less than 40cP in this assay are generally suitable for use in therapy.

Watch 102

Viscosity of modified oligonucleotides