阅读说明：本技术 用于减少有需要的受试者中nkcc1表达的载体和药物组合物，以及相关的治疗处理方法 (Vectors and pharmaceutical compositions for reducing NKCC1 expression in a subject in need thereof, and related therapeutic treatment methods ) 是由 费代里科·明戈齐 朱塞佩·龙齐蒂 安德烈亚·孔泰斯塔比莱 劳拉·坎切达 于 2018-04-11 设计创作，主要内容包括：本发明涉及基于使用人工microRNA(amiR)减少NKCC1表达的RNA干扰(RNAi)策略。特别地,本发明涉及通过使用人突触蛋白启动子驱动转基因表达来实现针对NKCC1的特异性amiR的神经元特异性表达的载体。(The present invention relates to an RNA interference (RNAi) strategy based on the use of artificial micrornas (amirs) to reduce NKCC1 expression. In particular, the invention relates to vectors that achieve neuron-specific expression of specific amirs against NKCC1 by using the human synaptophin promoter to drive transgene expression.)

1. Use of a vector comprising a polynucleotide encoding an artificial microrna (amiR) capable of reducing NKCC1 expression in a subject, for a therapeutic treatment method of reducing NKCC1 expression in a subject in need thereof, wherein the amiR comprises a sequence selected from the group consisting of SEQ ID NO: 4. 8, 15, 16, 18, 23, 25, 39, 40, 44, 45, 53, 57, 64, 66, 67, 68, 69, 82 and 88.

2. The vector for use according to claim 1, wherein the subject has a disease selected from the group consisting of: down syndrome, Fragile X syndrome, Rett syndrome, tuberous sclerosis, traumatic brain injury, epilepsy, autism, schizophrenia, Parkinson's disease and hypertension.

3. The vector for use according to claim 1 or 2, wherein the amiR consists of: a 5 'flanking region derived from a native miRNA, a TGCT nucleotide overhang, a 5' G + nucleotide sequence derived from hNKCC1 selected from the group consisting of SEQ ID NO: 4. 8, 15, 16, 18, 23, 25, 39, 40, 44, 45, 53, 57, 64, 66, 67, 68, 69, 82 and 88, the loops forming a sequence, the 2 nucleotides derived from hNKCC1 being removed (. DELTA.2) to yield a short 19 nucleotide sense sequence of the internal loop, a CAGG overhang and a 3' flanking region derived from a native miRNA.

4. The vector for use according to any one of claims 1 to 3, wherein the 5' flanking region derived from a native miRNA is SEQ ID NO: 90.

5. the vector for use according to any one of claims 1 to 4, wherein the loop forming sequence is SEQ ID NO: 91.

6. the vector for use according to any one of claims 1 to 5, wherein the 3' flanking region derived from a native miRNA is SEQ ID NO: 92.

7. the vector for use according to any one of claims 1 to 6, wherein said vector is a non-viral vector or a viral vector.

8. The vector for use according to claim 7, wherein the viral vector is an AAV vector.

9. The vector for use according to any one of claims 1 to 8, wherein said vector comprises a neuron-specific promoter.

10. The vector for use according to claim 9, wherein said neuron-specific promoter is selected from the group consisting of synapsin-1 (Syn) promoter, neuron-specific enolase (NSE) promoter, neurofilament light chain gene promoter and neuron-specific vgf gene promoter.

11. The vector for use of any one of claims 1 to 10, wherein the method of therapeutic treatment comprises delivery of the vector to the hippocampus of the subject.

12. The vector for use according to any one of claims 1 to 10, wherein the method of therapeutic treatment comprises delivering the vector to the subject by intravenous injection.

13. The vector for use according to any one of claims 1 to 10, wherein the method of therapeutic treatment comprises delivering the vector to the subject by intrathecal administration.

14. A pharmaceutical composition comprising the vector of any one of claims 1 to 10 for use in a therapeutic treatment method for reducing expression of NKCC1 in a subject in need thereof.

15. A method of reducing NKCC1 expression in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the vector of any one of claims 1 to 10.

Technical Field

The present invention relates to vectors, pharmaceutical compositions and methods for reducing expression of NKCC1 in a subject in need thereof.

Background

The Na +, K +, 2 Cl-cotransporter (NKCC), encoded by SLC12a2(NKCC1), belongs to a subfamily of Cationic Chloride Cotransporters (CCCs) that provide electrically neutral transport of sodium, potassium, and chloride across the plasma membrane. Several lines of evidence suggest that NKCC1 is involved in the pathogenesis of various diseases by modulating intracellular chloride concentrations. For example, recent studies have shown that the chloride cotransporter NKCC1 is overexpressed in the brain of DS mouse models and patients with Down syndrome (Deidda et al, 2015; WO2015091857A 1). Down Syndrome (DS) is the most common cause of mental disability in children and adults. Down syndrome is a genetic disorder caused by the presence of all or part of the third copy of human chromosome 21 and is therefore also referred to as trisomy 21 syndrome. Down syndrome is characterized by cognitive impairment, memory impairment and learning difficulties. Thus, drug treatment with NKCC1 inhibitor (also a diuretic FDA approved drug) Bumetanide (Bumetanamide) restores synaptic plasticity and cognitive impairment in the Ts65Dn mouse model of DS (Deidda et al, 2015; WO2015091857A 1). However, some data indicate the need for life-long treatment with bumetanide, potentially causing undesirable over-diuresis (which can impair treatment compliance) and the associated side effects of many electrolytes being chronically unbalanced. In addition, systemic treatment with bumetanide also blocks the activity of NKCC1 in organs other than the brain, which may cause ototoxicity (Ben-Ari et al, 2016). Therefore, there is a need to overcome these limitations of DS therapies based on reduced NKCC1 activity.

Disclosure of Invention

The present invention relates to vectors, pharmaceutical compositions and methods for reducing expression of NKCC1 in a subject in need thereof. The scope of the invention is defined by the appended claims.

Drawings

Fig. 1 represents an amiR construct consisting of: a 5' flanking region derived from a natural miRNA, a TGCT nucleotide overhang, a 5' G + short 21 nucleotide antisense sequence derived from hNKCC1, a loop forming sequence, a short 19 nucleotide sense sequence with 2 nucleotides derived from hNKCC1 removed (Δ 2) to create an internal loop, a CAGG overhang, and a 3' flanking region derived from a natural miRNA.

Figure 2 shows the effect of viral expression of 3 different amiR molecules against mouse NKCC1 on the corresponding NKCC1 protein levels in WT and Ts65Dn neurons in culture. Mouse NKCC1 was expressed more highly in Ts65Dn neurons than WT, as represented by the percentage of WT cells of control amiR (dashed line). Viral expression of 3 different amiR molecules reduced the mouse NKCC1 protein in both WT and Ts65Dn neurons. Histograms represent mean ± SEM. P <0.01, p <0.001, post Tukey test after two-way ANOVA.

FIG. 3 shows hippocampal neurons showing an excitatory response to GABA in cultures from Ts65Dn mice. By applying the GABA bath, the frequency of spikes (spike frequency) was reduced in the WT neurons of the control amiR, while the frequency of spikes was increased in the Ts65Dn neurons. Administration of two different amiR molecules (i.e., amiR #1 and amiR #3 of fig. 2) via viral delivery restored GABA stimulation in Ts65Dn neurons by reducing the spike frequency. Histograms represent mean ± SEM. P <0.01, post Tukey test after two-way repeated measures ANOVA.

Figure 4 shows the effect of hippocampal viral delivery of amiR against mouse NKCC1 on cognitive function in behavioral tasks in Ts65Dn mice. (A) Top, schematic diagram of new object recognition task. Bottom, Ts65Dn mice showed poor novel discrimination compared to WT. Viral delivery of two different amiR molecules (i.e., amiR #1 and amiR #3 of fig. 2) restored subject novel discrimination in Ts65Dn mice. (B) Top, schematic of object position testing. Bottom, Ts65Dn mice showed strong spatial memory impairment compared to WT. Viral delivery of two different amiR molecules restored spatial memory in Ts65Dn mice. (C) Top, schematic of spontaneous alternation test of T-maze. Bottom, Ts65Dn mice showed reduced alternans compared to WT. Viral transmission of two different amiR molecules restored alternating behavior in Ts65Dn mice. (D) Top, schematic diagram of conditional contextual fear testing. Bottom, Ts65Dn mice showed associative memory impairment compared to WT. Viral transmission of two different amiR molecules restored situational learning in Ts65Dn mice. For all panels, the histograms represent mean ± SEM, while the circles represent data from a single animal. For all panels: p <0.05, p <0.01, p <0.001, post Tukey test after two-way ANOVA.

FIG. 5 shows dual luciferase sensor plasmids used to screen for different amiR molecules to human NKCC1(hNKCC1) DNA sequence (NM-001046.2). The sensor plasmid expresses firefly luciferase (FLuc) and renilla luciferase (RLuc) from two different promoters. The hNKCC1 DNA sequence was cloned downstream of RLuc and prior to the polyadenylation (pA) signal. When the plasmid was co-transfected into human H293 kidney cells with a different amiR molecule against hNKCC1, the reduction of Rluc/Fluc ratio would reflect the silencing activity of the amiR corresponding sequence.

Figure 6 shows the effect of different amiR molecules against human NKCC1(hNKCC1) on Rluc/Fluc ratio of the dual luciferase hNKCC1 sensor plasmid of figure 6. Control samples were transfected with hNKCC1 sensor plasmid and control amiR sequences. Histograms represent mean ± SEM.

Detailed Description

The inventors have developed an RNA interference (RNAi) strategy based on the use of artificial micrornas (amirs) to reduce NKCC1 expression. An artificial microRNA is constructed by replacing the 21-22 nucleotide antisense targeting sequence (the so-called guide strand) of a naturally occurring primary microRNA (pri-miRNA) scaffold (scaffold) (e.g., mouse microRNA 155; GenBank accession No.: NR _029565.1) with an antisense targeting sequence to hNKCC 1. In particular, the inventors have designed a system that achieves neuron-specific expression of a particular amiR against NKCC1 by using the human synaptophin promoter to drive transgene expression.

Thus, in a first aspect, the present invention relates to a vector comprising a polynucleotide encoding an amiR capable of reducing expression of NKCC1, wherein the amiR comprises a sequence selected from the group consisting of seq id no: 4. 8, 15, 16, 18, 23, 25, 39, 40, 44, 45, 53, 57, 64, 66, 67, 68, 69, 82 and 88.

A second aspect of the invention relates to a pharmaceutical composition for use in a therapeutic method for reducing expression of NKCC1 in a subject in need thereof, the composition comprising a vector according to the invention.

A third aspect of the invention relates to a method of reducing NKCC1 expression in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of a vector according to the invention.

Other features and advantages of the present invention will become apparent from the following detailed description.

As used herein, NKCC for "Na-K-Cl cotransporter" denotes a protein that facilitates active transport of sodium, potassium and chloride into and out of cells. There are several variants or isoforms of the membrane transporter, in particular NKCC1 and NKCC 2. NKCC1 is encoded by the SLC12a2 gene (gene ID 6558) and is widely distributed throughout the body, but also in the brain, and especially in the developing animal and human brains. It acts to increase intracellular chloride in neurons and thus makes GABA more excitable. Numerous studies have shown that blocking NKCC1 reduces intracellular chloride, thereby enhancing GABA inhibition. Exemplary human nucleic and amino acid sequences are represented by NCBI reference sequences NM _001046.2 and NP _001037.1, respectively.

As used herein, the term "subject" refers to both human and animal subjects. Animals include, but are not limited to, mammals, rodents, primates, monkeys (e.g., macaque, rhesus macaque, or pigtail macaque), dogs, cats, cows, pigs, birds (e.g., chickens), mice, rabbits, and rats. In some embodiments, the subject typically means a human.

In some embodiments, the subject has a disease selected from the group consisting of: down syndrome, Fragile X syndrome, Rett syndrome, tuberous sclerosis, traumatic brain injury, epilepsy, autism, schizophrenia, Parkinson's disease, hypertension. Thus, the vectors of the present invention are particularly suitable for the treatment of the above-mentioned diseases.

As used herein, the term "rett syndrome" has its ordinary meaning in the art and refers to X chromosome-linked neurodevelopmental disorders that result in a reversal of development, particularly in terms of expression language and hand use. Clinical features include small hands and feet and a reduced rate of head growth, including microcephaly in some cases. Rett syndrome is associated with neuropathology of dendritic spines, and a reduction in dendritic spine density in hippocampal pyramidal neurons is found, particularly in patients with rett syndrome ((chapeau CA et al, Neurobiol Dis 2009,35(2): 219-33).

As used herein, the term "tuberous sclerosis" or "bernwell's disease" has its general meaning in the art and refers to the neurocutaneous syndrome caused by mutations in either of the two genes TSC1 and TSC2, which encode the protein hamartoma protein (hamatin) and the sarcomeric protein (tuberin), respectively, both of which play a cancer-suppressing role. Tuberous sclerosis results in non-malignant tumor growth of the brain and other vital organs such as the kidneys, heart, eyes, lungs and skin. Different types of dendritic abnormalities have been described in patients with tuberous sclerosis (Machado-Salas JP, ClinNeurophathol 1984,3(2): 52-8).

As used herein, the term "traumatic brain injury" or "TBI" has its ordinary meaning in the art and refers to any microscopic or macroscopic injury, wound or injury due to any type of trauma to the head, such as impact or shaking of the head. Traumatic brain injury may be the acquired damage to the brain due to external physical forces. Common causes of traumatic brain injury include, but are not limited to, falls (e.g., falls from a bed, slips in a bathtub, falls over steps, falls from a ladder, and related falls), collisions associated with vehicles (e.g., collisions involving cars, motorcycles, or bicycles, and pedestrians involved in such accidents), violence (e.g., gunshot injuries, household violence, or abuses to children (e.g., shaking infant syndrome), athletic injuries (e.g., occurring in football, boxing, rugby, baseball, lacrosse, skateboarding, hockey, and other high-impact or extreme sports), explosives and other combat injuries (e.g., from penetrating wounds, pounding on the head by shrapnel or debris, and falls following an explosion or physical impact with an object), and the like Brain trauma from surgery, radiation, or other medical procedures.

As used herein, the term "epilepsy" has its ordinary meaning in the art, and refers to a chronic neurological disorder characterized by recurrent grazing seizures. These seizures are transient signs and/or symptoms of abnormal, excessive, or synchronous neuronal activity in the brain. There are over 40 different types of epilepsy including, but not limited to, childhood absence epilepsy, juvenile absence epilepsy, benign rowland (Rolandic) epilepsy, clonic epilepsy, complex partial epilepsy, frontal lobe epilepsy, hyperthermic epilepsy, infantile spasms, juvenile myoclonic epilepsy, lannox-Gastaut syndrome, Landau-Kliffner syndrome, myoclonic epilepsy, mitochondrial disorders associated with seizures, Laforda disease, progressive myoclonic epilepsy, reflex epilepsy and Lasson Mueller syndrome. The types of seizures are also many, including simple partial seizures, complex partial seizures, generalized seizures, secondary generalized seizures, temporal lobe seizures, tonic-clonic seizures, tonic seizures, psychomotor seizures, marginal seizures, status epilepticus, refractory status epilepticus or super-refractory status epilepticus, abdominal seizures, akinesia seizures, autonomic seizures, major bilateral myoclonus, falling seizures, focal seizures, dementia seizures, Jackson seizures (Jacksonian March), motor seizures, multifocal seizures, neonatal seizures, nocturnal seizures, photosensitive seizures, sensory seizures, sylvan seizures, withdrawal seizures and visual reflex seizures.

As used herein, the term "schizophrenia" has its general meaning in the art and denotes a class of neuropsychiatric disorders characterized by dysfunctions of the thought process, such as delusions, hallucinations, and substantial withdrawal of the patient's interest in others. About one percent of all over the world suffers from schizophrenia, and this disorder is associated with high morbidity and mortality.

As used herein, the term "parkinson's disease" or "PD" has its general meaning in the art and refers to neurodegenerative diseases, particularly those affecting prominent dopaminergic neurons of the substantia nigra (pars compacta) and the nigrostriata thereof. As used herein, the terms "parkinson's disease", "parkinson's disease" and "parkinson's disease" are understood to include various forms of the disorder, including idiopathic parkinson's disease, post-encephalitic parkinson's disease, drug-induced parkinson's disease (such as neuroleptic-induced parkinson's disease), and post-ischemic parkinson's disease.

As used herein, the term "hypertension" describes a condition in which abnormally high arterial blood pressure is present; in young people, a hypertensive state typically occurs when the diastolic pressure is greater than 90 mm Hg and the systolic pressure is greater than about 135 to 140 mm Hg.

As used herein, the term "fragile X syndrome" has its ordinary meaning in the art, and refers to the most common genetic form of mental retardation, affecting about 1 per 4000 boys and about 1 per 8000 girls. Fragile X Syndrome (FXS) is a genetic disorder caused by the amplification of the CGG trinucleotide repeat in the 5 'untranslated region (5' -UTR) of the fragile X mental retardation 1(FMR1) gene located on the X chromosome. The mutation results in a reduction or deletion of the expression of fragile X mental retardation protein (FRMP). The major symptoms associated with FXS are mental retardation and learning disabilities, particularly the delay in how to learn to sit down, walk and speak. Therefore, FXS patients often exhibit intense or disorganized speech. Furthermore, FXS patients may lack central executive, working, speech, and/or visuospatial memory; or face recognition is difficult. Behavioral and emotional problems may also be encountered, such as, for example, hyperactivity, stereotyped behavior, anxiety, seizures, impaired social behavior, cognitive delay, irritability, aggressive or self-disabling behavior. In addition, FXS may cause ophthalmic problems including strabismus and recurrent otitis media and sinusitis in early childhood.

As used herein, the term "autism" refers to a class of neurodevelopmental disorders characterized by impaired, restricted, and repetitive behaviors of social interaction and communication, with other deficiencies. These signs all began three years before the child was. Autism affects information processing in the brain by altering the connectivity and organization of nerve cells and their synapses; it is not clear how autism occurs. The other two Autism Spectrum Disorders (ASD) are asperger's syndrome with no delay in cognitive development and language, atypical autism, which is diagnosed when the complete criteria for the other two disorders are not met, and PDD-NOS, which is diagnosed when pervasive developmental disorder is not specified.

As used herein, the term "down syndrome" or "trisomy 21 syndrome" refers to a chromosomal disorder caused by the presence of all or a portion of the third copy of chromosome 21. It is usually associated with delays in cognitive ability and physical growth, as well as a specific set of facial features. Cognitive dysfunction in patients with down's syndrome is associated with reduced dendritic branching and complexity and fewer abnormally shaped spines in cortical neurons (Martinez de Lagran, m.et al, Cereb Cortex 2012,22(12): 2867-77).

As used herein, the terms "treatment" or "treating" refer to both prophylactic or preventative treatment as well as curative or disease modifying treatment, including treatment of patients at risk of developing a disease or suspected of having developed a disease as well as patients in a disease state or diagnosed as having a disease or medical condition, and including inhibition of clinical relapse. The treatment can be administered to a subject having a medical condition or who may ultimately have the condition, to prevent, cure, delay the onset of, reduce the severity of, or reduce one or more symptoms of the condition or recurrent condition, or to prolong the survival of the subject more than would be expected in the absence of the treatment. "treatment regimen" refers to a mode of treatment of a disease, such as a mode of administration used during treatment. The treatment regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction phase" refers to a treatment regimen (or a portion of a treatment regimen) for the initial treatment of a disease. The overall goal of the induction regimen is to provide the patient with high levels of medication during the initial phase of the treatment regimen. The induction regimen may (partially or wholly) employ a "loading regimen" which may include administering a greater dose of the drug than the dose used by the physician during the maintenance regimen, administering the drug more frequently than the dose administered by the physician during the maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a treatment regimen (or portion of a treatment regimen) used to maintain a patient during treatment of a disease, e.g., to leave the patient in remission for an extended period of time (months or years). Maintenance regimens may employ continuous therapy (e.g., administration at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., intermittent treatment, recurrent treatment, or treatment to achieve certain predetermined criteria [ e.g., disease manifestation, etc.).

As used herein, the terms "polynucleotide" and "nucleic acid" have their ordinary meaning in the art and refer to DNA or RNA molecules, however, the terms encompass sequences including any known base analogs of DNA and RNA such as, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5- (carboxyhydroxymethyl) uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyl uracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseouracil, 1-methylguanine, 1-methylinosine, 2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethylguanine, 5-methoxyaminopyrimidine, 5-methoxyiminouracil, 5-2-methoxyuracil, 5-methoxyuracil-2-methoxyuracil, 5-2-methoxyuracil, 5-methoxyuracil, 2-methoxyuracil, 5-2-methoxyuracil, 5-2-methoxyuracil, 2-methoxyuracil.

As used, the terms "miR", "microRNA" or "miRNA" have their general meaning in the art and refer to short non-coding RNA sequences of 15-30 nucleotides in length found in eukaryotes involved in RNA-based gene regulation.

As used herein, the term "artificial miRNA" or "amiR" refers to a nucleic acid sequence encoding a pri-miRNA scaffold; a nucleic acid sequence encoding a guide strand; and a nucleic acid sequence encoding a passenger strand, wherein the pri-miRNA scaffold is derived from a naturally-occurring pri-miRNA and comprises at least one flanking sequence and a loop-forming sequence comprising at least 4 nucleotides. Different amiR sequences were constructed by replacing the 21-22 nucleotide guide strand (antisense targeting sequence) of the naturally occurring pri-microRNA scaffold.

In some embodiments, the guide strand of amiR and the follower strand of amiR are at least 50% complementary to NKCC1 nucleic acid sequence, but are not 100% complementary to each other. In some embodiments, the nucleic acid sequence encoding the guide strand and the nucleic acid sequence encoding the follower strand are inserted into the pri-miRNA scaffold between the flanking sequence and the loop-forming sequence, thereby forming a stem.

In some embodiments, the nucleic acid sequence encoding the guide strand of the amiR and the nucleic acid sequence encoding the follower strand of the amiR have at least one base pair mismatch. In some embodiments, the nucleic acid sequence encoding the guide strand and the nucleic acid sequence encoding the follower strand have a two base pair mismatch, a three base pair mismatch, a four base pair mismatch, a five base pair mismatch, a six base pair mismatch, a seven base pair mismatch, an eight base pair mismatch, a nine base pair mismatch, a ten base pair mismatch, an eleven base pair mismatch, a twelve base pair mismatch, a thirteen base pair mismatch, a fourteen base pair mismatch, or a fifteen base pair mismatch. In some embodiments, the nucleic acid sequence encoding the guide strand and the nucleic acid sequence encoding the follower strand have mismatches that do not exceed ten consecutive base pairs. In some embodiments, at least one base pair mismatch is located at the anchor position. In some embodiments, the at least one base pair mismatch is located in the central portion of the stem.

In some embodiments, the amiR scaffolds of the invention are defined by a 5 'flanking region derived from a native miRNA (e.g., from mouse miRNA-155, sequence: tggaggcttgctgaaggctgtatgct), a TGCT nucleotide overhang, a 5' G + selected from the group consisting of SEQ ID NO: 4. 8, 15, 16, 18, 23, 25, 39, 40, 44, 45, 53, 57, 64, 66, 67, 68, 69, 82 and 88, a loop-forming sequence (e.g., GTTTTGGCCACTGACTGAC), a sense sequence (follower strand) of 19 nucleotides short with 2 nucleotides from hNKCC1 removed (. DELTA.2) to form an internal loop, a CAGG overhang and a 3' flanking region from a native miRNA (e.g., from mouse miRNA-155, sequence: caggacacaaggcctgttactagcactcacatggaacaaatggccc). Such a construct is described in U.S. patent publication No.2004/0053876, and is depicted in fig. 1. In some embodiments, the amiR scaffold is derived from a pri-miRNA selected from the group consisting of: pri-MIR-21, pri-MIR-22, pri-MIR-26a, pri-MIR-30a, pri-MIR-33, pri-MIR-122, pri-MIR-375, pri-MIR-199, pri-MIR-99, pri-MIR-194, pri-MIR-155, and pri-MIR-451.

As used herein, the term "vector" has its ordinary meaning in the art and refers to a plasmid, virus, or other vehicle that can be manipulated by insertion or incorporation of a polynucleotide. The vectors of the invention are useful for genetic manipulation to introduce/transfer polynucleotides into cells and to transcribe or translate the inserted polynucleotides in cells. The vector typically contains at least an origin of replication and expression control elements (e.g., a promoter) for propagation in a cell. Control elements present within the vector, including the expression control elements described herein, are included to facilitate proper transcription, and thus proper translation (e.g., splicing signals for introns, maintaining the correct reading frame for the gene to allow in frame translation of mRNA, and stop codons, etc.).

Typically, the vector is a non-viral vector or a viral vector. A large number of suitable carriers are known to those skilled in the art and are commercially available. Non-viral vectors typically rely on plasmid-based gene delivery systems, where only naked DNA is delivered, possibly in combination with physicochemical methods to facilitate transfection. In some embodiments, the viral vector is an adeno-associated virus, retrovirus, bovine papilloma virus, adenoviral vector, lentiviral vector, vaccinia virus, polyoma virus, or infectious virus. Retroviruses are selected as gene delivery vehicles due to their ability to integrate their genes into the host genome, transfer large amounts of foreign genetic material, infect a wide range of species and cell types, and be packaged in particular cell lines. To construct retroviral vectors, nucleic acids encoding genes of interest are inserted into the viral genome in place of certain viral sequences to produce replication-defective viruses. For the production of virions, packaging cell lines were constructed which contained gag, pol and/or env genes but no LTRs and/or packaging components. When the recombinant plasmid containing the cDNA and the LTRs and packaging sequences of the retrovirus are introduced into the cell line (e.g., by calcium phosphate precipitation), the packaging sequences allow the RNA transcripts of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture medium. The medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are capable of infecting a wide variety of cell types. Lentiviruses are complex retroviruses which contain, in addition to the common retroviral genes gag, pol and env, other genes with regulatory or structural functions. The higher complexity enables the virus to regulate its life cycle, as during latent infection. Some examples of lentiviruses include human immunodeficiency virus (HIV 1, HIV 2) and Simian Immunodeficiency Virus (SIV). Lentiviral vectors have been generated by multiple attenuation of HIV virulence genes, for example, genes env, vif, vpr, vpu, and nef, deleted, thus rendering the vector biologically safe. Lentiviral vectors are known in the art, see, e.g., U.S. Pat. Nos. 6,013,516 and 5,994,136, both of which are incorporated herein by reference. Typically, the vector is configured to carry the necessary sequences for incorporation of the exogenous nucleic acid, for selection, and for transfer of the nucleic acid into the host cell. The gag, pol and env genes of the vector of interest are also known in the art. Thus, the relevant gene is cloned into a selected vector and then used to transform the target cell of interest. Recombinant lentiviruses capable of infecting non-dividing cells are described in U.S. Pat. No.5,994,136, incorporated herein by reference, wherein suitable host cells are transfected with two or more vectors carrying packaging functions, i.e., gag, pol, and env, and rev and tat. In some embodiments, the vector is an AAV vector. As used herein, the term "AAV" refers to more than 30 naturally occurring and available adeno-associated viruses, as well as artificial AAV. In general, the AAV capsids, ITRs and other selected AAV components described herein can be readily selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh10, AAVrh64R1, AAVrh64R2, rh8, rh74, AAV-DJ, AAV2g9, variants of any known or mentioned AAV or an AAV or variant not yet discovered, or mixtures thereof. The genomic sequences of the various serotypes of AAV, as well as the sequences of the natural Terminal Repeats (TR), Rep proteins, and capsid subunits including VP1 protein, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. See, e.g., GenBank accession Nos. NC-002077 (AAV-1), AF063497(AAV-1), NC-001401 (AAV-2), AF043303(AAV-2), NC-001729 (AAV-3), NC-001829 (AAV-4), U89790(AAV-4), NC-006152 (AAV-5), AF513851(AAV-7), AF513852(AAV-8), and NC-006261 (AAV-8); the above disclosures are incorporated herein by reference to teach AAV nucleic acid and amino acid sequences. See also, e.g., Srivistava et al (1983) j.virology 45: 555; chiorini et al (1998) J.Virology71: 6823; chiorini et al (1999) J.virology73: 1309; Bantel-Schaal et al (1999) J.virology73: 939; xiao et al (1999) j.virology73: 3994; muramatsu et al (1996) Virology 221: 208; shade et al, (1986) j.virol.58: 921; gao et al (2002) proc.nat.acad.sci.usa99: 11854; moris et al (2004) Virology33: 375-383; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. patent No.6,156,303. Recombinant AAV vectors of the invention typically comprise 5 'and 3' adeno-associated virus Inverted Terminal Repeats (ITRs), a polynucleotide of interest operably linked to a promoter (i.e., a heterologous polynucleotide). The vectors of the invention are produced using methods known in the art. Briefly, the methods generally comprise (a) introducing an AAV vector into a host cell, (b) introducing an AAV helper construct into the host cell, wherein the helper construct comprises a viral function deleted in the AAV vector, and (c) introducing a helper virus into the host cell. All of the functions of replication and packaging of AAV virions need to be provided in order for the AAV vector to replicate and package into AAV virions. Introduction into the host cell can be carried out simultaneously or sequentially using standard virological techniques. Finally, the host cells are cultured to produce AAV virions and purified using standard techniques such as CsCl gradient or column chromatography. Residual helper virus activity can be inactivated using known methods, such as, for example, heat inactivation. The purified AAV virions can then be used in these methods.

Generally, the vectors of the invention include "control sequences" which collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for replication, transcription, and translation of coding sequences in recipient cells, it is not always necessary for all of these control sequences to be present as long as the selected coding sequence is capable of replication, transcription, and translation in a suitable host Cell Another nucleic acid sequence is a "promoter" sequence, used herein in its usual sense, refers to a nucleotide region comprising DNA regulatory sequences derived from a gene capable of binding RNA polymerase and capable of initiating transcription of downstream (3' direction) coding sequences, transcriptional promoters may include "inducible promoters" (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), "repressible promoters" (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and examples of "promoters" include but are not limited to retroviral promoters of the promoter type "(RSV-promoter), RSV promoter (RSV-10.: RSV-9, RSV-10, RSV-35, a promoter with optional folate-specific promoter for neuro kinase (see the examples of the art: CMV promoter), RSV-9-5. the promoter, a promoter with the specificity for example, a folate-specific promoter, a folate-specific promoter, a folate-promoter, a folate-specific enhancer, a folate-promoter, a folate-specific enhancer, a promoter.

In some embodiments, the vectors of the invention are delivered in the hippocampus of a subject. In some embodiments, the vectors of the invention are delivered to a subject by intravenous injection. In some embodiments, the vectors of the invention are delivered by intrathecal administration. As used herein, the term "intrathecal administration" refers to administration of a vector into the spinal canal. For example, intrathecal administration may include injection in the cervical region of the spinal canal, in the thoracic region of the spinal canal, or in the lumbar region of the spinal canal. Generally, intrathecal administration is performed by injecting the carrier into the subarachnoid space of the vertebral canal, which is the region between the arachnoid and pia mater of the vertebral canal. The subarachnoid space is occupied by spongy tissue, which is composed of trabeculae (fine connective tissue filaments extending from the arachnoid and incorporated into the pia mater) and interconnecting channels that contain cerebrospinal fluid. In some embodiments, the vectors of the invention are delivered by intracerebroventricular administration. As used herein, the term "intracerebroventricular administration" refers to administration of a vector to the ventricular region of the forebrain of a subject.

In some embodiments, the effective amount is a therapeutically effective amount. By "therapeutically effective amount" is meant a sufficient amount of the carrier to treat the disease at a reasonable benefit/risk ratio. It will be appreciated that the total daily amount of carrier will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the age, weight, general health, sex, and diet of the patient; time of administration, route of administration and rate of excretion of the particular compound employed; the duration of the treatment; drugs combined with or co-administered with the particular polypeptide usedAn agent; and similar factors well known in the medical arts. For example, it is well known in the art to start doses of the compounds at levels below those required to achieve the desired therapeutic effect and to gradually increase the dose until the desired effect is achieved. Thus, the dosage of the carrier can be adjusted according to the disease condition, the subject (e.g., according to his weight, metabolism, etc.), the treatment regimen, and the like. Preferred effective doses in the context of the present invention are those which allow optimal transduction. Typically, 10 doses per dose are administered in mice⁸To 10¹²Individual viral genomes (vg). In general, the dose of AAV vector to be administered in humans can be in the range of 10¹⁰To 10¹⁴vg in the range of vg.

The carrier of the present invention is formulated into a pharmaceutical composition. In addition to carriers, these compositions may contain pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient (i.e., the carrier of the present invention). The precise nature of the carrier or other material can be determined by the skilled person depending on the route of administration. Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions typically include a liquid carrier such as water, petroleum, animal or vegetable oil, mineral oil, or synthetic oil. Physiological saline solution, magnesium chloride, dextrose or other sugar solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. For injection, the active ingredient will be in the form of an aqueous solution, which is pyrogen-free and has suitable pH, isotonicity and stability. Those skilled in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as sodium chloride injection, ringer's injection, lactated ringer's injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included as desired. For delayed release, the carrier may be included in a pharmaceutical composition formulated for slow release according to methods known in the art, such as in microcapsules formed of a biocompatible polymer or in a liposomal carrier system. Typically, the pharmaceutical composition of the invention is provided in a pre-filled syringe. A "ready-to-use syringe" or "pre-filled syringe" is a syringe that is provided in a filled state, i.e. the pharmaceutical composition to be administered is already present in the syringe and ready for administration. Pre-filled syringes have many advantages over separately provided syringes and vials, such as improved convenience, affordability, accuracy, sterility, and safety. The use of pre-filled syringes may improve dose accuracy, reduce the likelihood of needle stick injuries that may occur when drawing medication from a vial, reduce dosing errors due to the need to reconstitute the medication and/or draw medication into the syringe at a predetermined dose, and reduce overfilling of the syringe to reduce costs by minimizing medication waste. In some embodiments, the pH of the liquid pharmaceutical composition of the invention is in the range of 5.0 to 7.0, 5.1 to 6.9, 5.2 to 6.8, 5.3 to 6.7, or 5.4 to 6.6.

The invention will be further illustrated by the following figures and examples. These examples and drawings, however, should not be construed as limiting the scope of the invention in any way.