Method for screening B cell lymphocytes
阅读说明：本技术 筛选b细胞淋巴细胞的方法 (Method for screening B cell lymphocytes ) 是由 M·帕克 J·C·布里格斯 J·M·麦克尤恩 R·K·拉梅纳尼 H·基拉蒂纳格尔 K·W· 于 2017-10-23 设计创作，主要内容包括：本文描述了用于在微流体环境中筛选抗体产生细胞的方法。抗体产生细胞可以是B细胞淋巴细胞,其可以是记忆B细胞或浆细胞。可以使目标抗原靠近抗体产生细胞,并且可以监测抗体产生细胞产生的抗体与抗原的结合。还描述了从抗体产生细胞获得测序文库的方法。(Described herein are methods for screening antibody producing cells in a microfluidic environment. The antibody-producing cell may be a B cell lymphocyte, which may be a memory B cell or a plasma cell. The antigen of interest can be brought into proximity with the antibody-producing cell, and binding of the antibody produced by the antibody-producing cell to the antigen can be monitored. Methods of obtaining sequencing libraries from antibody-producing cells are also described.)
1. A method of detecting B cell lymphocytes expressing an antibody that specifically binds an antigen of interest, the method comprising:
introducing a sample comprising B cell lymphocytes into a microfluidic device comprising:
a housing having a flow area and a docking station,
wherein the isolation dock comprises a separation region having a single opening and a connection region providing a fluidic connection between the separation region and the flow region, and wherein the separation region of the support dock is an unswept region of the microfluidic device;
loading B cell lymphocytes from the sample into the isolation region of the isolation dock;
introducing the antigen of interest into the flow region of the housing such that the antigen of interest is in proximity to the B cell lymphocytes; and the number of the first and second electrodes,
monitoring binding of said antigen of interest to said antibody expressed by said B cell lymphocytes,
wherein the separation region of the isolation dock comprises at least one conditioned surface.
2. The method of claim 1, wherein the at least one conditioned surface comprises a layer of covalently linked hydrophilic molecules.
3. The method of claim 2, wherein the hydrophilic molecule comprises a polyethylene glycol (PEG) -containing polymer.
4. The method of any one of claims 1 to 3, wherein the housing of the microfluidic device further comprises a Dielectrophoresis (DEP) configuration.
5. The method of claim 4, wherein the housing of the microfluidic device further comprises a base, a microfluidic conduit structure, and a lid that together define a microfluidic conduit, and wherein the microfluidic conduit comprises the flow region and the isolation dock.
6. The method of claim 5, wherein:
the base includes a first electrode;
the cover comprises a second electrode; and is
The base or the cover comprises an electrode-activated substrate,
wherein the electrode activation substrate has a surface comprising a plurality of DEP electrode regions, and wherein the surface of the electrode activation substrate provides the inner surface of the flow region.
7. The method of claim 1, wherein the width W of the connection regionconFrom about 20 microns to about 60 microns.
8. The method of claim 1, wherein the linking region has a length LconAnd wherein said length L of said connection regionconThe width W of the connection regionconHas a value of at least 1.5.
9. The method of claim 7 or 8, wherein the width W of the separation regionisoIs greater than the width W of the connection regioncon。
10. The method of claim 9, wherein the width W of the separation regionisoFrom about 50 microns to about 250 microns.
11. The method of claim 1, wherein the isolating dock comprises a volume of about 0.5nL to about 2.5 nL.
12. The method of claim 1, wherein the isolated area of the isolation dock comprises at least one surface coated with a coating material.
13. The method of claim 12, wherein the coating material comprises a polymer comprising polyethylene glycol (PEG).
14. The method of claim 1, wherein the sample comprising B cell lymphocytes is a sample of peripheral blood, spleen biopsy, bone marrow biopsy, lymph node biopsy, or tumor biopsy.
15. The method of claim 14, wherein the sample comprising B cell lymphocytes is a peripheral blood sample.
16. The method of claim 14, wherein the sample comprising B cell lymphocytes is a bone marrow biopsy.
17. The method of claim 14 or 15, wherein the B cell lymphocyte is a memory B cell.
18. The method of claim 14 or 16, wherein the B cell lymphocyte is a plasma B cell.
19. The method of claim 1, wherein the sample comprising B cell lymphocytes is obtained from a mammal or an avian animal.
20. The method of claim 19, wherein the sample comprising B cell lymphocytes is obtained from a human, mouse, rat, guinea pig, gerbil, hamster, rabbit, goat, sheep, llama, or chicken.
21. The method of claim 19 or 20, wherein the mammal has been immunized against the antigen of interest, wherein the mammal has been exposed to or infected with a pathogen associated with the antigen of interest, wherein the mammal has a cancer and the cancer is associated with the antigen of interest, or wherein the mammal has an autoimmune disease and the autoimmune disease is associated with the antigen of interest.
22. The method of claim 1, wherein the sample comprising B cell lymphocytes has been depleted of cell types other than B cell lymphocytes.
23. The method of claim 1 or 22, wherein the sample comprising B cell lymphocytes is enriched for B cell lymphocytes expressing CD 27.
24. The method of claim 1 or 22, wherein the sample comprising B cell lymphocytes is enriched for CD138 expressing B cell lymphocytes.
25. The method of claim 1, wherein the sample comprising B cell lymphocytes has been contacted with a dnase enzyme prior to introduction into the microfluidic device.
26. The method of claim 1, wherein a single B cell lymphocyte is loaded into the separation region.
27. The method of claim 1, wherein a plurality of B cell lymphocytes are loaded into the separation region.
28. The method of claim 1, further comprising:
contacting the B cell lymphocyte with a stimulating agent that stimulates B cell activation.
29. The method of claim 28, wherein the stimulating agent comprises a CD40 agonist.
30. The method of claim 29, wherein the stimulating agent comprises one or more CD40L+Feeder cells.
31. The method of claim 29 or 30, wherein the stimulating agent further comprises a B Cell Receptor (BCR) -linked molecule, wherein the BCR-linked molecule comprises protein a or protein G.
32. The method of claim 31, wherein the BCR-linked molecule is linked to a micro-object.
33. The method of claim 28, wherein contacting the B cell lymphocyte with a stimulating agent comprises contacting the B cell lymphocyte with CD40L+Contacting feeder cells with a mixture of protein a conjugated to beads, wherein contacting the B-cell lymphocytes with a stimulating agent comprises loading the mixture into the isolated region of the isolated dock.
34. The method of claim 29, wherein the B cell lymphocytes are contacted with the stimulating agent substantially continuously for a period of 3 to 5 days.
35. The method of claim 29, further comprising:
providing a culture medium to the B cell lymphocytes, wherein the culture medium comprises one or more agents that promote B cell expansion and/or activation.
36. The method of claim 35, wherein the culture medium comprises IL-2, IL-4, IL-6, IL-21, and BAFF or April.
37. The method of claim 35, wherein the culture medium comprises a TLR agonist.
38. The method of claim 37, wherein the TLR agonist is a CpG oligonucleotide.
39. The method of claim 35, wherein the B cell lymphocytes are provided with culture medium for a period of 3 to 5 days.
40. The method of claim 35, wherein said contacting with a stimulating agent and said providing a culture medium are performed over a substantially coextensive period.
41. The method of claim 4, wherein loading the B-cell lymphocytes into the separation region of the isolation dock comprises moving the B-cell lymphocytes into the isolation region using DEP forces.
42. The method of claim 41, wherein the B cell lymphocytes move from the flow region to the isolation region.
43. The method of claim 1, wherein providing the antigen of interest comprises flowing a solution comprising a soluble antigen of interest into or through the flow region.
44. The method of claim 43, wherein the antigen of interest is covalently bound to a first detectable label.
45. The method of claim 43 or 44, further comprising providing a micro-object comprising a first antibody binding agent, wherein the first antibody binding agent binds the antibody expressed by the B-cell lymphocytes without inhibiting binding of a target antigen to the antibody expressed by the B-cell lymphocytes, and wherein monitoring binding of the target antigen to the antibody expressed by the B-cell lymphocytes comprises detecting indirect binding of the target antigen to the micro-object.
46. The method of claim 45, wherein the first antibody binding agent binds to the Fc domain of the antibody expressed by the B cell lymphocytes.
47. The method of claim 45, wherein providing the micro-objects comprises flowing a solution comprising the micro-objects into the flow region and stopping flow while the micro-objects are in proximity to the isolation dock.
48. The method of claim 45, wherein the solution comprising the micro-objects and the solution comprising the soluble target antigen are the same solution.
49. The method of claim 45, further comprising:
providing a second antibody binding agent, wherein the second antibody binding agent comprises a second detectable label; and are
Monitoring indirect binding of the second antibody binding agent to the micro-object,
wherein the first detectable label is different from the second detectable label.
50. The method of claim 49 wherein the second antibody binding agent binds to an IgG antibody.
51. The method of claim 1, wherein providing the antigen of interest comprises providing a micro-object comprising the antigen of interest, wherein the micro-object is a cell, a liposome, a lipid nanoraft, or a bead.
52. The method of claim 51, further comprising:
providing a labelled antibody binding agent prior to or simultaneously with said antigen of interest,
wherein said monitoring binding of said antigen of interest to said antibody expressed by said B cell lymphocytes comprises detecting indirect binding of said labeled antibody binding agent to said antigen of interest.
53. The method of claim 52 wherein the labeled antibody binding agent binds to an anti-IgG antibody.
54. The method of claim 1, wherein monitoring binding of the antigen of interest to the antibody expressed by the B cell lymphocyte comprises imaging all or a portion of the sequestration dock of the microfluidic device.
55. The method of claim 54, wherein said imaging comprises fluorescence imaging.
56. The method of claim 54, wherein said imaging comprises taking a plurality of images.
57. The method of claim 1, wherein the microfluidic device comprises a plurality of the isolated docks, each isolated dock having a separation region and a connection region, each connection region providing a fluidic connection between the separation region and the flow region, the method further comprising:
loading one or more of the plurality of B-cell lymphocytes into the separation region of each of two or more of the plurality of isolation docks;
introducing the antigen of interest into the microfluidic device such that the antigen of interest is proximate to each of the two or more isolated docks loaded with one or more B cell lymphocytes; and is
Monitoring binding of said antigen of interest to said antibody expressed by each of said loaded B cell lymphocytes.
58. The method of claim 57, wherein a single B cell lymphocyte is loaded into the separation region of each of the two or more of the plurality of isolation docks.
59. The method of claim 57, further comprising:
detecting binding of said antigen of interest to said antibody expressed by said loaded B cell lymphocyte or several of said plurality of loaded B cell lymphocytes;
identifying the loaded B-cell lymphocyte or the ones of the plurality of loaded B-cell lymphocytes that express an antibody that specifically binds the antigen of interest.
60. A method of characterizing an antibody that specifically binds to an antigen of interest, the method comprising:
identifying a B cell lymphocyte, or clonal population thereof, that expresses an antibody that specifically binds to said antigen of interest, wherein said identifying is performed according to the method of claim 59;
from said B cell lymphocytes or thereofIsolation of immunoglobulin encoding heavy chain variable region (V) from clonal populationH) And/or immunoglobulin light chain variable region (V)L) The nucleic acid of (1); and are
For encoding the immunoglobulin heavy chain variable region (V)H) At least a part of the nucleic acid of (a) and/or encoding the immunoglobulin light chain variable region (V)L) Sequencing at least a portion of the nucleic acid of (a).
61. The method of claim 60, wherein the immunoglobulin heavy chain variable region (V) is mutatedH) Performing sequencing comprises:
lysing said identified B cell lymphocytes or said clonal population of B cell lymphocytes;
reverse transcribing mRNA isolated from said B cell lymphocytes of said B cell lymphocytes or said clonal population thereof, wherein said mRNA encodes said immunoglobulin heavy chain variable region (V)H) Thereby forming VHcDNA; and are
For the VHAt least a portion of the cDNA is sequenced.
62. The method of claim 60, wherein the immunoglobulin light chain variable region (V) is mutatedL) Performing sequencing comprises:
lysing said identified B cell lymphocytes or said clonal population of B cell lymphocytes;
reverse transcribing mRNA isolated from said B cell lymphocytes or said clonal population thereof, wherein said mRNA encodes said immunoglobulin light chain variable region (V)L) Thereby forming VLcDNA; and are
For the VLAt least a portion of the cDNA is sequenced.
63. The method of claim 61 or 62, wherein reverse transcribing the mRNA comprises contacting the mRNA with a capture/priming oligonucleotide.
64. The method of claim 63, wherein the reverse transcription is performed in the presence of a transcript conversion oligonucleotide.
65. The method of claim 61 or 62, wherein said identified B cell lymphocytes or said B cell lymphocytes of said clonal population thereof are output from said microfluidic device prior to lysis.
66. The method of claim 65, wherein outputting the identified B-cell lymphocytes or the clonal population thereof comprises:
moving the identified B-cell lymphocytes or the B-cell lymphocytes of the clonal population thereof from the isolation region of the isolation dock into the flow region of the microfluidic device; and are
Flowing the identified B cell lymphocytes or the B cell lymphocytes of the clonal population thereof through the flow region and out of the microfluidic device.
67. The method of claim 66, wherein moving said identified B cell lymphocytes or said B cell lymphocytes of said clonal population thereof from said isolated region of said isolation dock comprises capturing and moving said identified B cell lymphocytes or said clonal population using DEP forces.
68. The method of claim 61 or 62, wherein said identified B cell lymphocytes or said B cell lymphocytes of said clonal population thereof are lysed within said microfluidic device.
69. The method of claim 68, further comprising:
providing one or more capture beads in close proximity to the identified B cell lymphocytes or the B cell lymphocytes of the clonal population thereof, wherein each of the one or more capture beads comprises a bead capable of binding the VHmRNA and/or the VLAn oligonucleotide of mRNA;
lysing said identified B cell lymphocytes or said clonal population thereof; and is
Allowing the V from the lysed B cell lymphocytes or the lysed B cell lymphocytes from the clonal population thereofHmRNA and/or the VLThe mRNA is bound by the one or more capture beads.
70. The method of claim 69, wherein each capture bead of the one or more capture beads comprises a plurality of capture/priming oligonucleotides.
71. The method of claim 69, wherein the bound VHmRNA and/or said bound VLReverse transcription of mRNA into V upon binding to the one or more capture beadsHcDNA and/or VLcDNA。
72. The method of claim 71, wherein said VHcDNA and/or VLThe cDNA is output from the microfluidic device while bound to the one or more capture beads.
73. The method of claim 61 or 62, further comprising amplifying the V prior to the sequencingHcDNA and/or said VLcDNA。
74. The method of claim 73, wherein said expanding comprises increasing V in reverse transcribed mRNA isolated from said B cell lymphocyteHcDNA and/or VLExpression of cDNA or fragments thereof.
75. The method of claim 74, wherein the amplifying comprises:
a first round of expansion that increases V in reverse transcribed mRNA isolated from the B cell lymphocytesHcDNA and/or VLExpression of cDNA or fragments thereof; and
second round amplification which introduces barcode sequences into V amplified in the first roundHcDNA and/or VLcDNA or a fragment thereof.
Background
It is of interest to screen and identify cells that produce antibodies capable of specifically binding to an antigen of interest, including in the field of hybridoma development. Furthermore, it is of interest to recognize highly expressed antibody producing cells. Providing a suitable environment suitable for the growth environment of the antibody producing cells and providing an environment in which binding/expression assays can be easily monitored has been a formidable challenge. Furthermore, it is desirable to provide a correlation of the assay results with a particular cell that demonstrates the desired expression/binding characteristics of the antibody it secretes. Improvements to these aspects of the field of antibody development are provided herein.
Disclosure of Invention
The present invention is based in part on the following findings: b cell lymphocytes, including primary B cells, can be screened within a microfluidic device to determine whether the B cell lymphocytes express antibodies that specifically bind to an antigen of interest. Thus, in one aspect, a method of detecting expression of an antibody that specifically binds to an antigen of interest by an antibody-producing cell is provided. The method includes the step of introducing antibody-producing cells into a microfluidic device. The antibody-producing cell can be, for example, a B cell lymphocyte, such as a memory B cell or a plasma cell.
For example, a microfluidic device may include a flow region, which may include a microfluidic channel, and at least one microfluidic isolation dock (e.g., a plurality of isolation docks). Each isolation dock may include a separation region and a connection region that fluidly connects the separation region to a flow region (e.g., a microfluidic channel).
Some of the methods of the present disclosure include the following additional steps: loading antibody-producing cells into the isolated region of the sequestration dock; introducing a target antigen into the microfluidic device such that the target antigen is in proximity to the antibody-producing cells; and monitoring binding of the antigen of interest to the antibody expressed by the antibody-producing cell. The loaded cell may be one of a population of cells (e.g., B cells) loaded into a microfluidic device having a plurality of isolated docks. In such embodiments, one or more antibody-producing cells can be loaded into the isolated region of each of the plurality of isolated docks. In some embodiments, a single antibody-producing cell is loaded into each isolation dock. When provided in the vicinity of an antibody-producing cell, the antigen of interest may be solubilized or attached to a micro-object, such as a cell, a liposome, a lipid nanoraft (lipid nanoraft), or a synthetic bead (e.g., a microbead or nanobead). These micro objects can be visualized under a microscope. Monitoring binding between the antigen of interest and the antibody produced by the antibody-producing cell may comprise: providing a labeled target antigen and detecting direct binding of the target antigen (e.g., labeled target antigen); providing a labeled antibody binding agent, and detecting indirect binding of the labeled antibody binding agent to the antigen of interest (e.g., to a micro-object presenting the antigen of interest); and providing an antibody binding agent and detecting indirect binding of the labeled target antigen to the antibody binding agent (e.g., a micro-object attached to a plurality of antibody binding agents). The antibody binding agent can be isotype specific (e.g., an anti-IgG antibody or IgG-binding fragment thereof). The label on the antigen or target or antibody binding agent may be a fluorescent label.
For antibody-producing cells that are recognized as expressing an antigen-binding antibody, the disclosed methods can further comprise the steps of: lysing the identified cells (e.g., B cells); reverse transcription of V from lysed cellsHmRNA and/or VLmRNA to form V respectivelyHcDNA and/or VLcDNA; and for the VHcDNA and/or VLAt least a portion of the cDNA is sequenced. The lysis and reverse transcription steps may be performed within the microfluidic device or external to the microfluidic device. For example, the identified cells may be exported (e.g., as individual cells) for cell lysis and further processing. Alternatively, the recognized cells are lysed in the isolation dock in which they are loaded, the V released after lysisHmRNA and/or VLThe mRNA can be captured on beads (i.e., beads having oligonucleotides attached to their surfaces, wherein the oligonucleotides are capable of specifically binding to VHmRNA and/or VLmRNA) capture. The capture beads may be at the captured VHmRNA and/or captured VLThe mRNA is output from the microfluidic device either before or after reverse transcription.
These and other features and advantages of the method of the present invention will be set forth or will become more fully apparent in the description that follows and in the appended claims. The features and advantages may be realized and obtained by means of the instruments and combinations particularly pointed out in the appended embodiments and claims. Furthermore, the features and advantages of the described systems and methods may be learned by the practice or will be obvious from the description, as set forth hereinafter.
Brief description of the drawings
Fig. 1A illustrates an example of a microfluidic device and system for use with the microfluidic device, including associated control apparatus according to some embodiments disclosed herein.
Fig. 1B and 1C illustrate vertical and horizontal cross-sectional views, respectively, of a microfluidic device according to some embodiments disclosed herein.
Fig. 2A and 2B show vertical and horizontal cross-sectional views, respectively, of a microfluidic device with isolated docks, according to some embodiments of the present invention.
Fig. 2C illustrates a detailed horizontal cross-sectional view of an isolation dock according to some embodiments disclosed herein.
Fig. 2D illustrates a partial horizontal cross-sectional view of a microfluidic device with isolated docks according to some embodiments disclosed herein.
Fig. 2E and 2F show detailed horizontal cross-sectional views of an isolation dock according to some embodiments disclosed herein.
Fig. 2G illustrates a microfluidic device having a flow region comprising a plurality of flow channels, each flow channel fluidically connected to a plurality of isolation docks, according to embodiments disclosed herein.
Fig. 2H illustrates a partial vertical cross-sectional view of a microfluidic device according to embodiments disclosed herein, wherein the inward-facing surface of the base and the inward-facing surface of the lid are conditioned surfaces.
Fig. 3A illustrates a specific example of a system nest configured to be operably connected with a microfluidic device and associated control apparatus, according to some embodiments disclosed herein.
Fig. 3B illustrates an optical train of a system for controlling a microfluidic device according to some embodiments disclosed herein.
Fig. 4 illustrates steps in an exemplary workflow for detecting B cell lymphocytes expressing antibodies that specifically bind to an antigen of interest, according to some embodiments disclosed herein.
Fig. 5A-5C are photographic illustrations of a microfluidic device comprising a plurality of microfluidic channels, each microfluidic channel being fluidically connected to a plurality of sequestration docks, and showing a method of screening for B-cell lymphocytes according to some embodiments disclosed herein.
Fig. 6A is a schematic illustration of a method for activating and screening memory B cells, according to embodiments disclosed herein.
Fig. 6B is an image of individual memory B-cells moved into an isolated dock according to embodiments disclosed herein.
Fig. 6C is a flow diagram of a multiplex assay according to some embodiments disclosed herein.
Fig. 6D is a fluorescence image of memory B cells determined according to embodiments disclosed herein.
Fig. 6E is a schematic diagram of steps in a method for screening memory B cells, according to embodiments disclosed herein, that begins with assaying a polyclonal group of memory B cells, and then separating the memory B cell group into individual sequestration docks for subsequent assays.
Fig. 7A is a schematic illustration of a method for screening plasma cells according to embodiments disclosed herein.
Fig. 7B is a set of bright field and corresponding fluorescence images of plasma cells determined according to embodiments disclosed herein.
Figure 8 is a schematic of a method of generating a BCR sequencing library.
Figure 9A is a graphical representation of electropherographic analysis of the size distribution of cDNA generated by single cell export and mRNA capture.
FIG. 9B is a photographic illustration of an electropherogram generated from single-cell amplicons produced by one embodiment of the methods described herein.
FIGS. 10A-10C are pictorial illustrations of amplicon electropherograms generated from 19 single cell captured mRNA, according to one embodiment of the methods described herein.
Detailed description of the invention
This specification describes exemplary embodiments and applications of the invention. However, the invention is not limited to these exemplary embodiments and applications, nor to the manner in which the exemplary embodiments and applications operate or are described herein. Further, the figures may show simplified or partial views, and the sizes of elements in the figures may be exaggerated or not in proportion. In addition, as the terms "on," "attached to," "connected to," "coupled to" or the like are used herein, an element (e.g., a material, a layer, a substrate, etc.) may be "on," "attached to," "connected to" or "coupled to" another element, whether the element is directly on, attached to, connected to or coupled to the other element, or whether there are one or more intervening elements between the element and the other element. Further, unless the context dictates otherwise, directions (e.g., above, below, top, bottom, side, up, down, below … …, above … …, above, below, horizontal, vertical, "x", "y", "z", etc.) if provided are relative and provided by way of example only and for ease of illustration and discussion and not by way of limitation. In addition, where a list of elements (e.g., elements a, b, c) is referred to, such reference is intended to include any one of the listed elements themselves, any combination of fewer than all of the listed elements, and/or combinations of all of the listed elements. The division of sections in the specification is for ease of review only and does not limit any combination of the elements discussed.
As used herein, "substantially" means sufficient for the intended purpose. Thus, the term "substantially" allows for minor, insignificant variations from absolute or perfect states, dimensions, measurements, results, etc., such as would be expected by one of ordinary skill in the art without significantly affecting overall performance. "substantially" when used in relation to a numerical value or a parameter or characteristic that may be expressed as a numerical value means within ten percent.
The terms "a" and "an" mean more than one.
As used herein, the term "plurality" can be 2,3, 4,5, 6, 7, 8, 9, 10, or more.
As used herein, the term "disposed" includes within its meaning "located".
As used herein, a "microfluidic device" or "microfluidic apparatus" is a device that: comprising one or more separate microfluidic conduits configured to contain a fluid, each microfluidic conduit comprising fluidly interconnected conduit elements including, but not limited to, regions, flow paths, channels, chambers, and/or docks; and at least one port configured to allow fluid (and optionally micro-objects suspended in the fluid) to flow into and/or out of the microfluidic device. Typically, the microfluidic circuit of a microfluidic device will include a flow region (which flow path may include a microfluidic channel) and at least one chamber, and will accommodate a fluid volume of less than about 1mL (e.g., less than about 750, 500, 250, 200, 150, 100, 75, 50, 25, 20, 15, 10, 9, 8, 7,6, 5, 4, 3, or 2 μ Ι _). In certain embodiments, the microfluidic circuit contains about 1-2, 1-3, 1-4, 1-5, 2-8, 2-10, 2-12, 2-15, 2-20, 5-30, 5-40, 5-50, 10-75, 10-100, 20-150, 20-200, 50-250, or 50-300 μ L. The microfluidic circuit may be configured to have a first end in fluid connection with a first port (e.g., inlet) in the microfluidic device and a second end in fluid connection with a second port (e.g., outlet) in the microfluidic device.
As used herein, a "nanofluidic device" or "nanofluidic apparatus" is a microfluidic device having microfluidic tubing containing at least one tubing element configured to accommodate a fluid volume of less than about 1 μ L, e.g., less than about 750, 500, 250, 200, 150, 100, 75, 50, 25, 20, 15, 10, 9, 8, 7,6, 5, 4, 3, 2, 1nL or less. The nanofluidic device may include a plurality of piping elements (e.g., at least 2,3, 4,5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10,000, or more). In certain embodiments, one or more (e.g., all) of the at least one piping element is configured to hold a fluid volume of about 100pL to 1nL, 100pL to 2nL, 100pL to 5nL, 250pL to 2nL, 250pL to 5nL, 250pL to 10nL, 500pL to 5nL, 500pL to 10nL, 500pL to 15nL, 750pL to 10nL, 750pL to 15nL, 750pL to 20nL, 1 to 10nL, 1 to 15nL, 1 to 20nL, 1 to 25nL, or 1 to 50 nL. In other embodiments, one or more (e.g., all) of the at least one piping element is configured to hold a fluid volume of about 20nL to 200nL, 100 to 300nL, 100 to 400nL, 100 to 500nL, 200 to 300nL, 200 to 400nL, 200 to 500nL, 200 to 600nL, 200 to 700nL, 250 to 400nL, 250 to 500nL, 250 to 600nL, or 250 to 750 nL.
Microfluidic devices or nanofluidic devices may be referred to herein as "microfluidic chips" or "chips"; or "nanofluidic chip" or "chip".
As used herein, "microfluidic channel" or "flow channel" refers to a flow region of a microfluidic device that is significantly longer than the horizontal and vertical dimensions. For example, the flow channel can be at least 5 times the length of the horizontal or vertical dimension, e.g., at least 10 times the length, at least 25 times the length, at least 100 times the length, at least 200 times the length, at least 500 times the length, at least 1,000 times the length, at least 5,000 times the length, or longer. In some embodiments, the length of the flow channel is in the range of about 50,000 micrometers to about 500,000 micrometers, including any range therebetween. In some embodiments, the horizontal dimension is in a range from about 100 microns to about 1000 microns (e.g., about 150 to about 500 microns) and the vertical dimension is in a range from about 25 microns to about 200 microns, e.g., about 40 to about 150 microns. It should be noted that the flow channels may have a variety of different spatial configurations in the microfluidic device and are therefore not limited to perfectly linear elements. For example, the flow channel may include one or more portions having any of the following configurations: curved, bent, spiral, inclined, descending, forked (e.g., multiple distinct flow paths), and any combination thereof. In addition, the flow channel may have different cross-sectional areas along its path, widening and narrowing to provide the desired fluid flow therein.
As used herein, the term "obstruction" generally refers to a protrusion or similar type of structure that is large enough to partially (but not completely) impede movement of a target micro-object between two different regions or conduit elements in a microfluidic device. The two different regions/pipe elements may for example be a microfluidic isolation dock and a microfluidic channel, or a connection region and a separation region of a microfluidic isolation dock.
As used herein, the term "constriction" generally refers to a narrowing of the width of a conduit element (or the interface between two conduit elements) in a microfluidic device. The constriction may be located, for example, at the interface between the microfluidic isolation dock and the microfluidic channel, or at the interface between the separation region and the connection region of the microfluidic isolation dock.
As used herein, the term "transparent" refers to a material that allows the passage of visible light without substantially changing the light when passed.
As used herein, the term "micro-object" generally refers to any micro-object that can be separated and/or processed according to the present invention. Non-limiting examples of micro-objects include: inanimate micro-objects, such as microparticles; microbeads (e.g., polystyrene beads, Luminex)TMBeads, etc.); magnetic beads; a micron rod; microfilaments; quantum dots, and the like; biological micro-objects, such as cells; a biological organelle; a vesicle or complex; synthesizing vesicles; liposomes (e.g., synthetic or derived from membrane preparations); lipid nanorafts (nanorafts), etc.; or a combination of inanimate and biological micro-objects (e.g., cell-attached microbeads, liposome-coated magnetic beads, etc.). The beads may include covalently or non-covalently attached moieties/molecules, such as fluorescent markers, proteins, carbohydrates, antigens, small molecule signaling moieties, or other chemical/biological substances that can be used in assays. Lipid nanorafts have been described, for example, in Ritchie et al (2009) "Regulation of Membrane Proteins in phospholipid Bilayer Nanodiscs," Methods Enzymol, 464: 211-231.
As used herein, the term "cell" may be used interchangeably with the term "biological cell". "non-limiting examples of biological cells include eukaryotic cells; a plant cell; animal cells, such as mammalian cells, reptile cells, avian cells, fish cells, and the like; a prokaryotic cell; a bacterial cell; a fungal cell; protozoan cells, etc.; cells dissociated from tissue (e.g., muscle, cartilage, fat, skin, liver, lung, neural tissue, etc.); immune cells such as T cells, B cells, natural killer cells, macrophages, and the like; embryos (e.g., fertilized eggs); an oocyte; an ovum; a sperm cell; a hybridoma; a cultured cell; cells from a cell line; cancer cells; infected cells; transfected and/or transformed cells; reporter cells, and the like. The mammalian cell can be, for example, a human, mouse, rat, horse, goat, sheep, cow, primate, and the like.
A colony of biological cells is "clonal" if all living cells in the colony that are capable of multiplying are daughter cells derived from a single parent cell. In certain embodiments, all daughter cells in the clonal colony are derived from a single parent cell no more than 10 divisions. In other embodiments, all daughter cells in the clonal colony are derived from no more than 14 divisions of a single parent cell. In other embodiments, all daughter cells in the clonal colony are from a single parent cell for no more than 17 divisions. In other embodiments, all daughter cells in the clonal colony are derived from a single parent cell no more than 20 divisions. The term "clonal cells" refers to cells of the same clonal colony.
As used herein, a "colony" of biological cells refers to 2 or more cells (e.g., about 2 to about 20, about 4 to about 40, about 6 to about 60, about 8 to about 80, about 10 to about 100, about 20 to about 200, about 40 to about 400, about 60 to about 600, about 80 to about 800, about 100 to about 1000, or greater than 1000 cells).
As used herein, the term "maintaining the cell(s)" refers to providing an environment comprising fluid and gas components and optionally surfaces that provide the conditions necessary to keep the cells viable and/or expanded.
As used herein, the term "expansion" when referring to cells refers to an increase in the number of cells.
A "component" of a fluid medium is any chemical or biochemical molecule present in the medium, including solvent molecules, ions, small molecules, antibiotics, nucleotides and nucleosides, nucleic acids, amino acids, peptides, proteins, sugars, carbohydrates, lipids, fatty acids, cholesterol, metabolites, and the like.
As used herein with respect to a fluid medium, "diffusion" and "diffusion" refer to the thermodynamic movement of components of the fluid medium down a concentration gradient.
The phrase "flow of the medium" means that the fluid medium is moved as a whole primarily due to any mechanism other than diffusion. For example, the flow of the medium may include the fluid medium moving from one point to another due to a pressure difference between the points. Such flow may include continuous, pulsed, periodic, random, intermittent, or reciprocating flow of liquid, or any combination thereof. When one fluid medium flows into another fluid medium, turbulence and mixing of the media may result.
The phrase "substantially no flow" refers to a flow rate of the fluid medium that, on average over time, is less than the rate at which a component of the material (e.g., the analyte of interest) diffuses into or within the fluid medium. The diffusion rate of the components of such materials may depend on, for example, the temperature, the size of the components, and the strength of the interaction between the components and the fluid medium.
As used herein with respect to different regions within a microfluidic device, the phrase "fluidically connected" refers to the fluids in each region being connected to form a single liquid when the different regions are substantially filled with a fluid (e.g., a fluidic medium). This does not mean that the fluids (or fluid media) in the different regions are necessarily identical in composition. In contrast, fluids in different fluidically connected regions of a microfluidic device can have different compositions (e.g., different concentrations of solutes, such as proteins, carbohydrates, ions, or other molecules) that are in change as the solutes move down their respective concentration gradients and/or the fluid flows through the device.
Microfluidic (or nanofluidic) devices may include "swept" areas and "unswept" areas. As used herein, a "swept-out" area includes one or more fluidically interconnected tubing elements of a microfluidic tubing, each tubing element being subjected to a flow of a medium as fluid flows through the microfluidic tubing. The conduit elements that sweep the area may include, for example, areas, channels, and all or part of the chamber. As used herein, an "unswept" region includes one or more fluidically interconnected conduit elements of a microfluidic conduit, each conduit element being substantially free of the flow of fluid as the fluid flows through the microfluidic conduit. The unswept region may be fluidly connected to the swept region, provided that the fluid connection is configured to enable diffusion but substantially no media flow between the swept region and the unswept region. Thus, the microfluidic device may be configured to substantially separate the unswept region from the flow of the medium in the swept region, while substantially only diffusive fluid communication is enabled between the swept region and the unswept region. For example, the flow channel of a microfluidic device is an example of a swept area, while the separation area of a microfluidic device (described in further detail below) is an example of an unswept area.
As used herein, "flow path" refers to one or more fluidly connected conduit elements (e.g., channels, regions, chambers, etc.) that define and are constrained by the trajectory of the media flow. Thus, the flow path is an example of a swept (swept) region of a microfluidic device. Other conduit elements (e.g., unswept areas) may be in fluid connection with the conduit elements comprising the flow path, independent of the flow of the medium in the flow path.
As used herein, "B" is used to denote a single nucleotide, being a nucleotide selected from G (guanosine), C (cytidine), and T (thymidine) nucleotides, but excluding a (adenine).
As used herein, "H" is used to denote a single nucleotide, being a nucleotide selected from A, C and T, but excluding G.
As used herein, "D" is used to denote a single nucleotide, being a nucleotide selected from A, G and T, but excluding C.
As used herein, "K" is used to denote a single nucleotide, being a nucleotide selected from G and T.
As used herein, "N" is used to denote a single nucleotide, being a nucleotide selected from A, C, G and T.
As used herein, "R" is used to denote a single nucleotide, being a nucleotide selected from a and G.
As used herein, "S" is used to denote a single nucleotide, being a nucleotide selected from G and C.
As used herein, "V" is used to denote a single nucleotide, is a nucleotide selected from A, G and C, and does not include T.
As used herein, "Y" is used to denote a single nucleotide, being a nucleotide selected from C and T.
As used herein, "I" is used to indicate that the mononucleotide is inosine.
As used herein, A, C, T, G followed by an "", indicates a phosphorothioate substitution in the phosphate linkage of the nucleotide.
As used herein, IsoG is isoguanosine; IsoC is isocytidine; IsodG is isoguanosine deoxyribonucleotide and IsodC deoxyribonucleotide. Each isoguanosine and isocytidine ribonucleotide or deoxyribonucleotide contains a nucleobase that is isomeric to a guanine nucleobase or a cytosine nucleobase, respectively, which is normally incorporated into RNA or DNA.
As used herein, rG denotes a ribonucleotide contained within a nucleic acid, and otherwise contains a deoxyribonucleotide. A nucleic acid containing all ribonucleotides may not include a label to indicate that each nucleotide is a ribonucleotide, but it is clear from the context.
As used herein, a "priming sequence" is an oligonucleotide sequence that is part of a larger oligonucleotide and can serve as a primer in a DNA (or RNA) polymerization reaction when separated from the larger oligonucleotide such that the priming sequence includes a free 3' end.
As used herein: μ m means micron, μm3Refers to cubic microns, pL refers to picoliters, nL refers to nanoliters, and μ L (oruL) means microliter.
And (4) loading method. Loading biological micro-objects or micro-objects (such as, but not limited to, beads) may involve the use of fluid flow, gravity, Dielectrophoresis (DEP) forces, electrowetting, magnetic forces, or any combination thereof, as described herein. DEP forces can be generated optically (e.g., by an optoelectronic tweezers (OET) configuration) and/or electrically (e.g., by activating electrodes/electrode regions in a temporal/spatial manner). Similarly, the electrowetting force may be provided optically (e.g. by an opto-electrowetting (OEW) configuration) and/or electrically (e.g. by activating the electrodes/electrode areas in a time-space manner).
Microfluidic devices and systems for operating and viewing such devices. Fig. 1A shows an example of a microfluidic device 100 and
As shown generally in fig. 1A, microfluidic circuit 120 is defined by
As shown in fig. 1A, the
The
The
The microfluidic circuit material 116 may be patterned with cavities or the like to define circuit elements and interconnections of the microfluidic circuit 120. The microfluidic circuit material 116 may include a flexible material, such as a flexible polymer (e.g., rubber, plastic, elastomer, silicone, polydimethylsiloxane ("PDMS"), etc.), which may be gas permeable. Other examples of materials from which the microfluidic circuit material 116 may be constructed include molded glass; etchable materials such as silicone (e.g., photo-patternable silicone or "PPS"), photoresist (e.g., SU8), and the like. In some embodiments, such materials (and thus the microfluidic circuit material 116) may be rigid and/or substantially gas impermeable. Regardless, the microfluidic circuit material 116 may be disposed on the
The
In some embodiments, the
Fig. 1A also shows a
The power source 192 may provide power to the microfluidic device 100 and/or the tilting device 190 to provide a bias voltage or current as desired. The power supply 192 may, for example, include one or more Alternating Current (AC) and/or Direct Current (DC) voltage or current sources. The imaging device 194 (part of the imaging module 164, as discussed below) may include a device for capturing images within the microfluidic circuit 120, such as a digital camera. In some cases, the imaging device 194 further includes a detector with a fast frame rate and/or high sensitivity (e.g., for low light applications). The imaging device 194 may also include a mechanism for directing stimulating radiation and/or light beams into the microfluidic circuit 120 and collecting radiation and/or light beams reflected or emitted from the microfluidic circuit 120 (or micro-objects contained therein). The emitted light beam may be in the visible spectrum and may, for example, include fluorescent emissions. The reflected light beam may comprise reflected emissions from an LED or a broad spectrum lamp such as a mercury lamp (e.g. a high pressure mercury lamp) or a xenon arc lamp. As discussed with respect to fig. 3B, the imaging device 194 may further include a microscope (or optical train), which may or may not include an eyepiece.
The
In some cases, the microfluidic device 100 is tilted into a vertical orientation such that the
In some cases, the tilting device 190 tilts the microfluidic device 100 about an axis parallel to the
The
Fig. 1A also shows a simplified block diagram depicting an example of a control and monitoring apparatus 152 that forms part of the
The main controller 154 may include a control module 156 and digital memory 158. The control module 156 may include, for example, a digital processor configured to operate in accordance with machine-executable instructions (e.g., software, firmware, source code, etc.) stored as non-transitory data or signals in the memory 158. Alternatively or additionally, the control module 156 may include hard-wired digital circuitry and/or analog circuitry. Media module 160, motion module 162, imaging module 164, tilt module 166, and/or other modules 168 may be similarly configured. Accordingly, the functions, processes, actions, acts, or steps of the processes discussed herein as being performed with respect to the microfluidic device 100 or any other microfluidic apparatus may be implemented by any one or more of the master controller 154, the substrate module 160, the motion module 162, the imaging module 164, the tilt module 166, and/or the other modules 168 configured as discussed above. Similarly, the master controller 154, the media module 160, the motion module 162, the imaging module 164, the tilt module 166, and/or the other modules 168 may be communicatively coupled to send and receive data used in any of the functions, processes, actions, or steps discussed herein.
The media module 160 controls the media source 178. For example, the media module 160 may control the media source 178 to input a selected
The motion module 162 may be configured to control the selection, trapping, and movement of micro-objects (not shown) in the microfluidic circuit 120. As discussed below with reference to fig. 1B and 1C, the
The imaging module 164 may control an imaging device 194. For example, the imaging module 164 may receive and process image data from the imaging device 194. The image data from imaging device 194 may include any type of information captured by imaging device 194 (e.g., the presence or absence of micro-objects, drops of media, accumulation of markers (e.g., fluorescent markers), etc.). Using the information captured by imaging device 194, imaging module 164 may further calculate the locations of objects (e.g., micro-objects, media drops) within microfluidic device 100 and/or the rates of motion of these objects.
The tilt module 166 may control the tilting motion of the tilting device 190. Alternatively or additionally, the tilting module 166 may control the tilting rate and timing to optimize the transfer of micro-objects to one or more isolation docks via gravity. Tilt module 166 is communicatively coupled with imaging module 164 to receive data describing the movement of micro-objects and/or media drops in microfluidic circuit 120. Using this data, tilt module 166 can adjust the tilt of microfluidic circuit 120 in order to adjust the rate at which micro-objects and/or media droplets move in microfluidic circuit 120. Tilt module 166 may also use this data to iteratively adjust the position of micro-objects and/or media drops in microfluidic circuit 120.
In the example shown in fig. 1A, microfluidic circuit 120 is shown to include
The microfluidic circuit 120 may include any number of microfluidic isolation docks. Although five isolation docks are shown, microfluidic circuit 120 may have fewer or more isolation docks. As shown, the microfluidic isolation docks 124, 126, 128, and 130 of the microfluidic circuit 120 each include different features and shapes that may provide one or more benefits for screening antibody-producing cells (e.g., separating one antibody-producing cell from another). The microfluidic isolation docks 124, 126, 128, and 130 may provide other benefits, such as facilitating single cell loading and/or growth of colonies of antibody-producing cells (e.g., clonal colonies). In some embodiments, microfluidic circuit 120 includes a plurality of identical microfluidic isolation docks.
In some embodiments, microfluidic circuit 120 includes a plurality of microfluidic isolation docks, wherein two or more of the isolation docks include different structures and/or features that provide different benefits of screening for antibody-producing cells. The microfluidic device for screening antibody-producing cells may include any of the isolated docks 124, 126, 128, and 130, or variations thereof, and/or may include docks similar to the dock configurations shown in fig. 2B, 2C, 2D, 2E, and 2F, as discussed below.
In the embodiment shown in fig. 1A, a
In some cases, microfluidic circuit 120 includes a plurality of
In some embodiments, microfluidic circuit 120 further comprises one or more micro-object wells 132. The wells 132 are generally formed in the walls that border the
The well 132 may also include an opening configured to assist the flow of the target micro-object into the well 132. In some cases, well 132 includes an opening having a height and width approximately equal to the dimensions of a single target micro-object, thereby preventing larger micro-objects from entering the micro-object well. The well 132 may further include other features configured to help retain the target micro-object within the well 132. In some cases, wells 132 are aligned with respect to the opening of the microfluidic isolation dock and are located on opposite sides of
In some embodiments, Dielectrophoretic (DEP) forces are applied to the fluidic medium 180 (e.g., in the flow path and/or in the isolation dock) via one or more electrodes (not shown) to manipulate, transport, separate, and sort micro-objects located therein. For example, in some embodiments, DEP forces are applied to one or more portions of the microfluidic circuit 120 in order to transfer individual micro-objects from the
In other embodiments, an electro-optical wetting (OEW) force is applied to one or more locations (e.g., locations that help define a flow path and/or a plurality of isolation docks) in the support structure 104 (and/or lid 110) of the microfluidic device 100 by one or more electrodes (not shown) to manipulate, transport, separate, and sort droplets located in the microfluidic circuit 120. For example, in some embodiments, OEW forces are applied to one or more locations in the support structure 104 (and/or the lid 110) to transfer individual droplets from the
In some embodiments, DEP and/or OEW forces are combined with other forces (e.g., flow and/or gravity) in order to manipulate, transport, separate, and sort micro-objects and/or droplets within the microfluidic circuit 120. For example, the
Figures 1B, 1C, and 2A-2H illustrate various embodiments of microfluidic devices that can be used to implement the present invention. Fig. 1B depicts an embodiment of an electrokinetic device in which the
Examples of microfluidic devices with docks in which antibody producing cells may be placed, cultured, monitored and/or screened have been described, for example, in US application nos. 14/060,117, 14/520,568 and 14/521,447, each of which is incorporated herein by reference in its entirety. Each of the aforementioned applications further describes a microfluidic device configured to generate Dielectrophoretic (DEP) forces, such as an optoelectronic tweezers (OET), or configured to provide optoelectronic wetting (OEW). For example, the optoelectronic tweezers device shown in fig. 2 of US application No. 14/060,117 is an example of a device that may be used to select and move a single biological micro-object or a group of biological micro-objects in an embodiment of the present invention.
A microfluidic device motion configuration. As mentioned above, the control and monitoring device of the system may comprise a motion module for selecting and moving objects, such as micro-objects or droplets, in the microfluidic circuit of the microfluidic device. Microfluidic devices may have various motion configurations depending on the type of object being moved and other considerations. For example, a Dielectrophoresis (DEP) configuration can be used to select and move micro-objects in a microfluidic circuit. Accordingly, the
One example of a
As shown in fig. 1B, the
In certain embodiments, the
With the
The
In some embodiments, the
In other embodiments, the
Examples of microfluidic devices having electrode-activated substrates including phototransistors have been described, for example, in U.S. Pat. No. 7,956,339(Ohta et al) (see, e.g.,
In some embodiments of DEP configured microfluidic devices, the
With the
In other embodiments, the
As yet another example, the
The dielectric layer (not shown) may include one or more oxide layers and may have a thickness of about 50nm to about 250nm (e.g., about 125nm to about 175 nm). In certain embodiments, the dielectric layer may include an oxide layer, such as a metal oxide (e.g., aluminum oxide or hafnium oxide) layer. In certain embodiments, the dielectric layer may comprise a dielectric material other than a metal oxide, such as silicon oxide or nitride. Regardless of the exact composition and thickness, the dielectric layer may have an impedance of about 10k ohms to about 50k ohms.
In some embodiments, the surface of the dielectric layer facing inward toward the region/chamber 202 is coated with a hydrophobic material. The hydrophobic material may comprise, for example, carbon fluoride molecules. Examples of fluorinated carbon molecules include perfluoropolymers, such as polytetrafluoroethylene (e.g.,
In some embodiments, the
In some embodiments, the
Thus,
In other embodiments, the
Regardless of the configuration of the
Isolating the dock. Non-limiting examples of general isolation docks 224, 226 and 228 are shown within microfluidic device 230 depicted in fig. 2A-2C. Each isolation dock 224, 226, and 228 may include a separation structure 232 defining a
The isolation docks 224, 226 and 228 of fig. 2A-2C each have a single opening that leads directly to the
Thus, the
Fig. 2C shows a detailed view of an example of an isolated dock 224 according to the present invention. An example of a micro-object 246 is also shown.
As is known, the passage of a
Further, as long as the velocity of the
Because the
As described above, the maximum penetration depth D of the
In some embodiments, the dimensions of the
As shown in FIG. 2C, the width W of the
As shown in FIG. 2C, the width W of the
Fig. 2D-2F depict another exemplary embodiment of a
The
Each
As shown in fig. 2E, the
As shown in FIG. 2E, the width W of the channels 264ch(i.e., transverse to the direction of fluid medium flow through the channel, as indicated by
In various embodiments of an isolated dock chamber (e.g., 124, 126, 128, 130, 224, 226, 228, or 266), an isolation region (e.g., 240 or 270) is configured to contain a plurality of micro-objects. In other embodiments, the separation region may be configured to contain only one, two, three, four, five, or a similar relatively small number of micro-objects. Thus, the volume of the separation region may be, for example, at least 5 × 105、8×105、1×106、2×106、4×106、6×106Cubic microns or larger.
In various embodiments of the isolation dock, the width W of the channel (e.g., 122) at the proximal opening (e.g., 234)chMay be in any of the following ranges: about 50-1000 microns, 50-500 microns, 50-400 microns, 50-300 microns, 50-250 microns, 50-200 microns, 50-150 microns, 50-100 microns, 70-500 microns, 70-400 microns, 70-300 microns, 70-250 microns, 70-200 microns, 70-150 microns, 90-400 microns, 90-300 microns, 90-250 microns, 90-200 microns, 90-150 microns, 100-300 microns, 100-250 microns, 100-200 microns, 100-150 microns, 100-120 microns. In some other embodiments, the width W of the channel (e.g., 122) at the proximal opening (e.g., 234)chMay be in the range of about 200-800 microns, 200-700 microns, or 200-600 microns. The above are examples only, and the width W of the
In some embodiments, the height of the isolation dock is about 30 to about 200 microns or about 50 to about 150 microns. In some embodiments, the cross-sectional area of the isolation dock is about
In various implementations of the isolation dock, the height H of the channel (e.g., 122) at the proximal opening (e.g., 234)chMay be in any of the following ranges: 20-100 microns, 20-90 microns, 20-80 microns, 20-70 microns, 20-60 microns, 20-50 microns, 30-100 microns, 30-90 microns, 30-80 microns, 30-70 microns, 30-60 microns, 30-50 microns, 40-100 microns, 40-90 microns, 40-80 microns, 40-70 microns, 40-60 microns, or 40-50 microns. The foregoing are examples only, and the height H of the channel (e.g., 122)chMay be within other ranges (e.g., ranges defined by any of the endpoints listed above). Height H of
In various embodiments of the isolation dock, the cross-sectional area of the channel (e.g., 122) at the proximal opening (e.g., 234) can be within any of the following ranges: 500-50,000 square micron, 500-40,000 square micron, 500-30,000 square micron, 500-25,000 square micron, 500-20,000 square micron, 500-15,000 square micron, 500-10,000 square micron, 500-7,500 square micron, 500-5,000 square micron, 1,000-25,000 square micron, 1,000-20,000 square micron, 1,000-15,000 square micron, 1,000-10,000 square micron, 1,000-7,500 square micron, 1,000-5,000 square micron, 2,000-20,000 square micron, 2,000-15,000 square micron, 2,000-10,000 square micron, 2,000-7,500 square micron, 2,000-6,000 square micron, 3,000-20,000 micron, 3,000 square micron, 10,000 square micron, 3,000-3,000 square micron, 3,000 square micron. The foregoing are examples only, and the cross-sectional area of the channel (e.g., 122) at the proximal opening (e.g., 234) can be within other ranges (e.g., within a range defined by any of the endpoints listed above).
In various embodiments of the isolation dock, the length L of the connection region (e.g., 236)conMay be in any of the following ranges: about 20 to about 300 microns, about 40 to about 250 microns, about 60 to about 200 microns, about 80 to about 150 microns, about 20 to about 500 microns, about 40 to about 400 microns, about 60 to about 300 microns, about 80 to about 200 microns, or about 100 to about 150 microns. The foregoing are examples only, and the length L of the connection region (e.g., 236)conMay be in a different range than the preceding examples (e.g., within a range defined by any of the endpoints listed above).
In various embodiments of the isolation dock, the width W of the connection region (e.g., 236) at the proximal opening (e.g., 234)conMay be in any of the following ranges: about 20 to about 150 microns, about 20 to about 100 microns, about 20 to about 80 microns, about 20 to about 60 microns, about 30 to about 150 microns, about 30 to about 100 microns, about 30 to about 80 microns, about 30 to about 60 microns, about 40 to about 150 microns, about 40 to about 100 microns, about 40 to about 80 microns, about 40 to about 60 microns, about 50 to about 150 microns, about 50 to about 100 microns, about 50 to about 80 microns, about 60 to about 150 microns, about 60 to about 100 microns, about 60 to about 80 microns, about 70 to about 150 microns, about 70 to about 100 microns, about 80 to about 150 microns, and about 80 to about 100 microns. The foregoing are examples only, and the width W of the connection region (e.g., 236) at the proximal opening (e.g., 234)conMay be different from the foregoing examples (e.g., within a range defined by any of the endpoints listed above).
In various embodiments of the isolation dock, the width W of the connection region (e.g., 236) at the proximal opening (e.g., 234)conMay be at least as large as the largest dimension of the micro-object (e.g., biological cell, which may be an immune cell, such as a B cell or T cell, or hybridoma cell, etc.) for which the sequestration dock is intended. For example, the width W of the
In various embodiments of the isolation dock, the length L of the connection region (e.g., 236)conWidth W of the connection region (e.g., 236) at the
In various embodiments of the
In various embodiments of microfluidic devices with isolation docks, the volume of the isolation region (e.g., 240) of the isolation dock can be, for example, at least 5 x 105、8×105、1×106、2×106、4×106、6×106、8×106、1×107Cubic microns or larger. In various embodiments of microfluidic devices with isolation docks, the volume of the isolation dock may be about 5 x 105、6×105、8×105、1×106、2×106、4×106、8×106、1×107Cubic microns or larger. In some other embodiments, the volume of the isolating dock can be about 0.5 nanoliter to about 10 nanoliters, about 1.0 nanoliter to about 5.0 nanoliters, about 1.5 nanoliters to about 4.0 nanoliters, about 2.0 nanoliters to about 3.0 nanoliters, or about 2.5 nanoliters, or any range defined by the two aforementioned endpoints.
In various embodiments, the microfluidic device has isolated docks configured as in any of the embodiments discussed herein, wherein the microfluidic device has about 5 to about 10 isolated docks, about 10 to about 50 isolated docks, about 100 to about 500 isolated docks; about 200 to about 1000 isolated docks, about 500 to about 1500 isolated docks, about 1000 to about 2000 isolated docks, or about 1000 to about 3500 isolated docks. The isolation docks need not all be the same size and may include multiple configurations (e.g., different widths, different features within the isolation dock).
In some other embodiments, the isolation dock of the microfluidic device is configured as any of the embodiments discussed herein, wherein the microfluidic device has from about 1500 to about 3000 isolation docks, from about 2000 to about 3500 isolation docks, from about 2500 to about 4000 isolation docks, from about 3000 to about 4500 isolation docks, from about 3500 to about 5000 isolation docks, from about 4000 to about 5500 isolation docks, from about 4500 to about 6000 isolation docks, from about 5000 to about 6500 isolation docks, from about 5500 to about 7000 isolation docks, from about 6000 to about 7500 isolation docks, from about 6500 to about 8000 isolation docks, from about 7000 to about 8500 isolation docks, from about 7500 to about 9000 isolation docks, from about 8000 to about 9500 isolation docks, from about 8500 to about 10,000 isolation docks, from about 9000 to about 10,500 isolation docks, from about 11,000 isolation docks, from about 9500 to about 9500 isolation docks, from about 11,000 to about 500,000 isolation docks, from about 11,000 isolation docks, from about 11,500 to about 11,000 isolation docks, from about 11,12 to about 500,13, from about 500,000 isolation docks, from about 11,000 isolation docks, from about 500,13, from about 500,000 isolation docks, and about 500,000 isolation docks, About 12,500 to about 14,000 isolated docks, about 13,000 to about 14,500 isolated docks, about 13,500 to about 15,000 isolated docks, about 14,000 to about 15,500 isolated docks, about 14,500 to about 16,000 isolated docks, about 15,000 to about 16,500 isolated docks, about 15,500 to about 17,000 isolated docks, about 16,000 to about 17,500 isolated docks, about 16,500 to about 18,000 isolated docks, about 17,000 to about 18,500 isolated docks, about 17,500 to about 19,000 isolated docks, about 18,000 to about 19,500 isolated docks, about 18,500 to about 20,000 isolated docks, about 19,000 to about 20,500 isolated docks, about 19,500 to about 21,000 isolated docks, or about 20,000 to about 21,500 isolated docks.
Fig. 2G shows a
Fig. 3A-3B illustrate various embodiments of a
As shown in fig. 3A,
Typically, electrical signal generation subsystem 304 will include a waveform generator (not shown). The electrical signal generation subsystem 304 can also include an oscilloscope (not shown) and/or a waveform amplification circuit (not shown) configured to amplify waveforms received from the waveform generator. The oscilloscope (if any) may be configured to measure the waveform supplied to the microfluidic device 320 held by the receptacle 302. In certain embodiments, the oscilloscope measures the waveform at a location near the microfluidic device 320 (and away from the waveform generator), thereby ensuring a more accurate measurement of the waveform actually applied to the device. Data obtained from oscilloscope measurements may be provided, for example, as feedback to a waveform generator, and the waveform generator may be configured to adjust its output based on such feedback. An example of a suitable combined waveform generator and oscilloscope is Red PitayaTM。
In certain embodiments,
In some embodiments,
As shown in fig. 3A, the
In some embodiments,
As discussed above, the
In certain embodiments, the imaging device 194 further comprises a
In certain embodiments, the
In certain embodiments, the imaging device 194 is configured to use at least two light sources. For example, a first
In fig. 3B, the first
In some embodiments, the second
Coating solution and coating agent. Without wishing to be bound by theory, when one or more interior surfaces of the microfluidic device have been conditioned or coated so as to present a layer of organic and/or hydrophilic molecules that provides a primary interface between the microfluidic device and the micro-objects (e.g., biological cells) maintained therein, culturing of biological cells (e.g., immune cells, such as B cells or T cells) within the microfluidic device may be facilitated (i.e., the micro-objects exhibit increased viability, greater expansion, and/or greater portability within the microfluidic device). In some embodiments, one or more internal surfaces of the microfluidic device (e.g., an internal surface of an electrode-activated substrate of the DEP-configured microfluidic device, a surface of a lid and/or tubing material of the microfluidic device) are treated with a coating solution and/or a coating agent to produce the desired layer of organic and/or hydrophilic molecules. In some embodiments, the micro-objects (e.g., biological cells) that are cultured in the microfluidic device and optionally allowed to expand are input into a coating solution comprising one or more coating agents.
In other embodiments, the interior surface of a microfluidic device (e.g., a DEP configured microfluidic device) is treated or "primed" with a coating solution comprising a coating agent prior to introducing the micro-objects (e.g., biological cells) into the microfluidic device. Any convenient coating agent/paint may be usedCoating solutions, including but not limited to: serum or serum factors, Bovine Serum Albumin (BSA), polymers, detergents, enzymes, and any combination thereof. In some specific embodiments, the coating agent will be used to treat the interior surfaces of the microfluidic device. In one example, a polymer containing alkylene ether moieties is included in the coating solution as a coating agent. Many alkylene ether containing polymers may be suitable. One non-limiting exemplary class of alkylene ether-containing polymers is the amphoteric nonionic block copolymers, which comprise blocks of Polyoxyethylene (PEO) and polyoxypropylene (PPO) subunits having different proportions and positions within the polymer chain.
In some embodiments, the coating solution may comprise a plurality of proteins and/or peptides as coating agents. In a particular embodiment, the coating solution used in the present disclosure comprises as coating agent a protein, such as albumin (e.g. BSA) and/or a serum (or a combination of different sera) comprising albumin and/or one or more other similar proteins. The serum may be from any convenient source, including but not limited to fetal bovine serum, sheep serum, goat serum, horse serum, and the like. In certain embodiments, BSA is present in a blocking solution (blocking solution) at a concentration ranging from about 1mg/mL to about 100mg/mL, including 5mg/mL, 10mg/mL, 20mg/mL, 30mg/mL, 40mg/mL, 50mg/mL, 60mg/mL, 70mg/mL, 80mg/mL, 90mg/mL, or any value therebetween. In certain embodiments, serum may be present in the coating solution at a concentration ranging from about 20% (v/v) to about 50% v/v, including 25%, 30%, 35%, 40%, 45%, or higher or any value in between. In some embodiments, BSA may be present as a coating agent in the coating solution at 5mg/mL, while in other embodiments, BSA may be present as a coating agent in the coating solution at 70 mg/mL. In certain embodiments, serum is present at 30% in the coating solution as a coating agent.
And (3) coating materials. Depending on the embodiment, any of the above-described coating agents/coating solutions can be replaced with, or used in combination with, a variety of coating materials for coating one or more interior surfaces of a microfluidic device (e.g., a DEP-configured and/or EW-configured microfluidic device). In some embodiments, at least one surface of the microfluidic device comprises a coating material that provides an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells). In some embodiments, substantially all of the interior surfaces of the microfluidic device comprise a coating material. The coated interior surface may include a flow region (e.g., a channel), a surface of a chamber or isolation dock, or a combination thereof. In some embodiments, each of the plurality of isolated docks has at least one interior surface coated with a coating material. In other embodiments, each of the plurality of flow regions or channels has at least one interior surface coated with a coating material. In some embodiments, at least one interior surface of each of the plurality of isolated docks and each of the plurality of channels is coated with a coating material.
A polymer-based coating material. At least one of the inner surfaces may include a coating material comprising a polymer. The polymer may be covalently or non-covalently bound (or linked) to at least one surface. The polymers can have a variety of structural motifs such as found in block (and copolymers), star (star copolymers), and graft or comb (graft copolymers), all of which can be adapted for use in the methods disclosed herein.
The polymer may comprise a polymer comprising alkylene ether moieties. A wide variety of alkylene ether-containing polymers may be suitable for use in the microfluidic devices described herein. One non-limiting exemplary class of alkylene ether-containing polymers is the amphoteric nonionic block copolymers, which comprise blocks of Polyoxyethylene (PEO) and polyoxypropylene (PPO) subunits having different proportions and positions within the polymer chain.
In other embodiments, the coating material may include a polymer containing carboxylic acid moieties. The carboxylic acid subunits may be subunits containing alkyl, alkenyl or aromatic moieties. One non-limiting example is polylactic acid (PLA).
In other embodiments, the coating material may include a polymer containing sulfonic acid moieties. The sulfonate subunits may be subunits containing alkyl, alkenyl or aromatic moieties. One non-limiting example is polystyrene sulfonic acid (PSSA) or polyanetholesulfonic acid. These latter exemplary polymers are polyelectrolytes and may alter the characteristics of the surface to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects, such as cells, e.g., immune cells (e.g., B cells) or hybridoma cells.
In some embodiments, the coating material may include a urethane moiety-containing polymer, such as, but not limited to, a polyurethane.
In other embodiments, the coating material may include a polymer that includes a phosphate moiety at a terminus of or pendant from the backbone of the polymer.
In other embodiments, the coating material may include a polymer containing sugar moieties. In one non-limiting example, a polysaccharide (e.g., derived from seaweed or a fungal polysaccharide, such as xanthan or dextran) may be suitable for forming a material that can reduce or prevent cell adhesion in a microfluidic device. For example, dextran polymers having a size of about 3kDa may be used to provide a coating material for surfaces within a microfluidic device.
In other embodiments, the coating material may comprise a polymer containing nucleotide moieties, i.e., nucleic acids, which may have ribonucleotide moieties or deoxyribonucleotide moieties. Nucleic acids may contain only natural nucleotide moieties or may contain non-natural nucleotide moieties that comprise nucleobase, ribose, or phosphate moiety analogs, such as, but not limited to, 7-deazaadenine, pentose, methylphosphonate, or phosphorothioate moieties. The nucleic acid-containing polymer may comprise a polyelectrolyte that may provide a layer of organic and/or hydrophilic molecules suitable for maintaining and/or expanding biological micro-objects, such as cells, e.g. immune cells (e.g. B-cells) or hybridoma cells.
In other embodiments, the coating material may include a polymer containing amino acid moieties. Polymers containing amino acid moieties may include polymers containing natural amino acids or polymers containing unnatural amino acids, which may each include peptides, polypeptides, or proteins. In one non-limiting example, the protein can be Bovine Serum Albumin (BSA). In some embodiments, extracellular matrix (ECM) proteins may be provided within the coating material for obtaining optimized cell adhesion to promote cell growth. Cell matrix proteins that may be included in the coating material may include, but are not limited to, collagen, elastin, RGD-containing peptides (e.g., fibronectin), or laminin. In other embodiments, growth factors, cytokines, hormones, or other cell signaling substances may be provided within the coating material of the microfluidic device.
In further embodiments, the coating material can include a polymer containing amine moieties. The polyamino polymer may comprise a natural polyamine polymer or a synthetic polyamine polymer. Examples of natural polyamines include spermine, spermidine and putrescine.
In some embodiments, the coating material can include a polymer that includes more than one of an alkylene oxide moiety, a carboxylic acid moiety, a sulfonic acid moiety, a phosphate moiety, a sugar moiety, a nucleotide moiety, or an amino acid moiety. In other embodiments, the polymer conditioned surface may comprise a mixture of more than one polymer, each polymer having alkylene oxide moieties, carboxylic acid moieties, sulfonic acid moieties, phosphate moieties, sugar moieties, nucleotide moieties, and/or amino acid moieties, which may be incorporated into the coating material independently or simultaneously.
A covalently linked coating material. In some embodiments, at least one internal surface comprises covalently linked molecules that provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) within a microfluidic device to provide a conditioned surface for such cells. The covalently linked molecules include a linking group, wherein the linking group is covalently linked to one or more surfaces of the microfluidic device. The linking group is also covalently attached to a moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological micro-object (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell). The surface to which the linking group is attached can comprise a substrate surface of a microfluidic device, which can comprise silicon and/or silicon dioxide for embodiments in which the microfluidic device comprises a DEP configuration. In some embodiments, the covalently attached coating material coats substantially all of the interior surfaces of the microfluidic device.
In some embodiments, a covalently attached moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological microbial object (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell) may include an alkyl or fluoroalkyl (including perfluoroalkyl) moiety; mono-or polysaccharides (which may include, but are not limited to, dextran); alcohols (including but not limited to propargyl alcohol); polyols, including but not limited to polyvinyl alcohol; alkylene ethers including, but not limited to, polyethylene glycol; polyelectrolytes (including but not limited to polyacrylic acid or polyvinylphosphonic acid); amino groups (including derivatives thereof such as, but not limited to, alkylated amines, hydroxyalkylated amino groups, guanidinium salts, and heterocyclic groups containing a non-aromatic nitrogen ring atom such as, but not limited to, morpholinyl or piperazinyl); carboxylic acids, including but not limited to propiolic acid (which may provide a carboxylate anionic surface); phosphonic acids, including but not limited to ethynylphosphonic acid (which can provide a phosphonate anionic surface); a sulfonate anion; a carboxybetaine; a sulfobetaine; sulfamic acid; or an amino acid.
The covalently linked moieties configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) in a microfluidic device can be any of the polymers described herein, and can include polymers comprising alkylene oxide moieties, carboxylic acid moieties, sugar moieties, sulfonic acid moieties, phosphate moieties, amino acid moieties, nucleotide moieties, or amino moieties.
In other embodiments, a moiety configured to provide covalent attachment of an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological micro-object (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell) in a microfluidic device can include a non-polymeric moiety, such as an alkyl moiety, a substituted alkyl moiety (e.g., a fluoroalkyl moiety (including but not limited to a perfluoroalkyl moiety)), an amino acid moiety, an alcohol moiety, an amino moiety, a carboxylic acid moiety, a phosphonic acid moiety, a sulfonic acid moiety, an aminosulfonic acid moiety, or a sugar moiety.
In some embodiments, the covalently linked moiety can be an alkyl group comprising carbon atoms that form a straight chain (e.g., a straight chain of at least 10 carbons or at least 14, 16, 18, 20, 22 or more carbons). Thus, the alkyl group may be an unbranched alkyl group. In some embodiments, alkyl groups may include substituted alkyl groups (e.g., some carbons in an alkyl group may be fluorinated or perfluorinated). The alkyl group can include a linear chain of substituted (e.g., fluorinated or perfluorinated) carbons bonded to an unsubstituted carbon. For example, an alkyl group can include a first segment (which can include a perfluoroalkyl group) that is linked to a second segment (which can include an unsubstituted alkyl group). The first and second segments may be linked together directly or indirectly (e.g., via an ether linkage). The first segment of the alkyl group may be located distal to the linking group and the second segment of the alkyl group may be located proximal to the linking group. In other embodiments, the alkyl group may include branched alkyl groups, and may also have one or more arylene groups interrupting the alkyl backbone of the alkyl group. In some embodiments, the branched or arylene interrupted portion of the alkyl or fluoroalkyl group is located distal to the linking group to the surface and the covalent bond.
In other embodiments, the covalently linked moiety may comprise at least one amino acid, which may comprise more than one type of amino acid. Thus, the covalently linked moiety may comprise a peptide or a protein. In some embodiments, the covalently linked moiety may comprise an amino acid, which may provide a zwitterionic surface to support cell growth, viability, portability (portal), or any combination thereof.
The covalently linked moiety may comprise one or more sugars. The covalently linked sugar may be a monosaccharide, disaccharide or polysaccharide. The covalently linked sugar may be modified to introduce reactive pairing moieties that allow coupling or processing for attachment of the surface. Exemplary reactive partner moieties may include aldehyde, alkyne, or halogen moieties. The polysaccharide may be modified in a random manner, wherein each saccharide monomer or only a portion of the saccharide monomers within the polysaccharide may be modified to provide reactive partner moieties that may be coupled directly or indirectly to a surface. One example may include dextran polysaccharides, which may be indirectly coupled to a surface via an unbranched linker moiety.
The covalently linked moiety may include one or more amino groups. The amino group can be a substituted amine moiety, guanidine moiety, nitrogen-containing heterocyclic moiety, or heteroaryl moiety. The amino-containing moiety can have a structure that allows for pH modification of the environment within the microfluidic device and optionally within the sequestration dock and/or flow region (e.g., channel).
The coating material may comprise only one type of covalently linked moiety, or may comprise more than one different type of covalently linked moiety. For example, a fluoroalkyl-conditioned surface (including perfluoroalkyl) may have a plurality of covalently attached moieties that are all the same, e.g., having the same attachment group and covalent attachment to the surface, the same total length, and the same number of fluoromethylene units, including fluoroalkyl moieties. Alternatively, the coating material may have more than one type of covalently linked moiety attached to the surface. For example, the coating material may include molecules having covalently linked alkyl or fluoroalkyl moieties having a specified number of methylene or fluoromethylene units, and may also include another group of molecules having charged moieties covalently linked to alkyl or fluoroalkyl chains having a greater number of methylene or fluoromethylene units. In some embodiments, a coating material having more than one covalently attached moiety can be designed such that a first set of molecules having a greater number of backbone atoms and thus a longer distance from covalent attachment to the surface can provide the ability to present a larger portion on the coated surface, while a second set of molecules having different, less spatially demanding ends and fewer backbone atoms can help to functionalize the entire substrate surface, preventing undesired adhesion or contact with the silicon or aluminum oxide comprising the substrate itself. In another example, the covalently linked moieties can provide a zwitterionic surface that exhibits alternating charges on the surface in a random manner.
Conditioned surface properties. In some embodiments, the covalently linked moieties can form a monolayer when covalently linked to a surface of the microfluidic device (e.g., a substrate surface of a DEP configuration). In some embodiments, the conditioned surface formed by covalently linked moieties can have a thickness of less than 10nm (e.g., less than 5nm, or about 1.5 to 3.0 nm). In other embodiments, the conditioned surface formed by covalently linked moieties may have a thickness of about 10nm to about 50 nm. In some embodiments, the conditioned surface does not require a perfectly formed monolayer to function properly for operation within a DEP configured microfluidic device.
In various embodiments, the coating material of the microfluidic device can provide desired electrical properties. Without wishing to be bound by theory, one factor that affects the robustness of a surface coated with a particular coating material is inherent charge trapping. Different coating materials may trap electrons, which may lead to destruction of the coating material. Defects in the coating material may increase charge trapping and lead to further damage of the coating material. Similarly, different coating materials have different dielectric strengths (i.e., minimum applied electric field that results in dielectric breakdown), which may affect charge trapping. In certain embodiments, the coating material can have a bulk structure (e.g., a close-packed monolayer structure) that reduces or limits the amount of charge trapping.
In addition to the composition of the coating material, other factors, such as the physical (and electrical) thickness of the coating material, can influence the generation of DEP and electrowetting forces by the substrate of the microfluidic device. Various factors may alter the physical and electrical thickness of the coating material, including the manner in which the coating material is deposited on the substrate (e.g., vapor deposition, liquid deposition, spin coating, and electrostatic coating). The physical thickness and uniformity of the coating material can be measured using an ellipsometer.
In addition to its electrical properties, the coating material may have properties that are beneficial for use with biomolecules. For example, coating materials containing fluoro (or perfluoro) alkyl groups may provide benefits in reducing the amount of surface fouling relative to unsubstituted alkyl groups. Surface fouling, as used herein, refers to the amount of any substance deposited on the surface of a microfluidic device, which may include permanent or semi-permanent deposition of biological substances (e.g., proteins and their degradation products, nucleic acids and their degradation products). Such fouling can increase the amount of adhesion of biological micro-objects to the surface.
In addition to the composition of the conditioned surface, other factors (e.g., the physical thickness of the hydrophobic material) may affect the DEP force. Various factors may alter the physical thickness of the conditioned surface, such as the manner in which the conditioned surface is formed on the substrate (e.g., vapor deposition, liquid deposition, spin coating, flooding, and electrostatic coating). The physical thickness and uniformity of the conditioned surface can be measured using an ellipsometer.
In addition to its electrical properties, the conditioned surface may also have properties that are beneficial for use with biomolecules. For example, a conditioned surface containing fluorinated (or perfluorinated) carbon chains may provide benefits in reducing the amount of surface fouling relative to alkyl terminated chains. Surface fouling, as used herein, refers to the amount of any substance deposited on the surface of a microfluidic device, which may include permanent or semi-permanent deposition of biological materials (e.g., proteins and their degradation products, nucleic acids and respective degradation products, and the like).
The following table includes a number of properties of the conditioned surface that can be used in DEP. As shown, for
Table 1. properties of various conditioned surfaces prepared by covalently modifying a surface compared to a non-covalently formed surface CYTOP.
1. Spin coating, non-covalent.
A surface linking group. The covalent linking moieties forming the coating material are attached to the surface via a linking group. The linking group can be a siloxy linking group formed by reaction of a siloxane-containing reagent with an oxide of the substrate surface, which can include silicon oxide (e.g., a substrate for DEP configuration) or aluminum oxide or hafnium oxide (e.g., a substrate for EW configuration). In some other embodiments, the linking group can be a phosphate ester formed by reacting a phosphonic acid-containing reagent with an oxide of the substrate surface.
A multi-part conditioned surface. As described below, the covalently linked coating material may be formed by the reaction of molecules (e.g., alkyl siloxane reagents or fluoro-substituted alkyl siloxane reagents, which may include perfluoroalkyl siloxane reagents) that already contain moieties configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) in a microfluidic device. Alternatively, the covalently linked coating material may be formed by coupling a moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) to a surface modifying ligand, which itself is covalently linked to the surface.
A method of making a covalently linked coating material. In some embodiments, a coating material covalently attached to a surface of a microfluidic device (e.g., at least one surface comprising an isolation dock and/or a flow region) has the structure of
The coating material may be covalently attached to the oxide on the surface of the DEP configured substrate. The DEP configured substrate may comprise silicon or aluminum oxide or hafnium oxide, and the oxide may be present as part of the initial chemical structure of the substrate, or may be introduced as discussed below.
The coating material may be attached to the oxide via a linking group ("LG"), which may be a siloxy or phosphonate group formed from the reaction of a siloxane or phosphonate group with the oxide. The portion configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) in a microfluidic device may be any portion described herein. The linking group LG may be directly or indirectly linked to a moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological micro-object (e.g. a cell, such as an immune cell (e.g. a B cell) or a hybridoma cell) in a microfluidic device. When the linking group LG is directly linked to the moiety, there is no optional linking moiety ("L") and n is 0. When the linking group LG is indirectly linked to the moiety, there is a linking moiety L and n is 1. The linking moiety L may have a linear portion, wherein the backbone of the linear portion may include 1 to 200 non-hydrogen atoms selected from any combination of silicon, carbon, nitrogen, oxygen, sulfur, and phosphorus atoms, subject to chemical bonding limitations known in the art. In some non-limiting examples, it may be interrupted by any combination of one or more moieties that may be selected from ether, amino, carbonyl, amido, or phosphonate groups. In addition, the linking moiety L may have one or more arylene, heteroarylene, or heterocyclyl groups interrupting the backbone of the linking group. In some embodiments, the backbone of the linking moiety L may comprise 10 to 20 atoms. In other embodiments, the backbone of the linking moiety L may comprise from about 5 atoms to about 200 atoms; about 10 atoms to about 80 atoms; about 10 atoms to about 50 atoms; or from about 10 atoms to about 40 atoms. In some embodiments, the backbone atoms are all carbon atoms. In other embodiments, the backbone atoms are not all carbon, and may include any possible combination of silicon, carbon, nitrogen, oxygen, sulfur, and phosphorus atoms, subject to the limitations of chemical bonding known in the art.
When a moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g. cells, such as immune cells (e.g. B cells) or hybridoma cells) in a microfluidic device is added to the substrate surface in a one-step process, the molecules of
part- (L) n-LG.
In some embodiments, the portion configured to provide the layer of organic and/or hydrophilic molecules suitable for maintaining and/or expanding biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) in a microfluidic device may be added to the surface of the substrate in a multi-step process. When the moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding biological micro-objects (e.g. cells such as immune cells (e.g. B-cells) or hybridoma cells) is coupled to the surface in a stepwise manner, the linking moiety L may further comprise a coupling group CG, as shown in
In some embodiments, the coupling group CG is represented by a reactive moiety RxAnd a reactive partner Rpx(i.e., configured to react with the reactive moiety R)xPart of the reaction). For example, a typical coupling group CG may include a carboxamide group that is the result of the reaction of an amino group with a carboxylic acid derivative (e.g., an activated ester, an acid chloride, etc.). Other CGs may include triazolylene, carboxamido, thioamido, oxime, mercapto, disulfide, ether or alkenyl groups, or any other suitable group that may be formed upon reaction of a reactive moiety with its corresponding reactive partner moiety. The coupling group CG may be located at the second end of the linking group L (i.e., adjacent to a region configured to provide a biological microorganism (e.g., a cell, such as an immune cell (e.g., B)) suitable for maintaining and/or expanding in a microfluidic deviceCells) or hybridoma cells) are used in the presence of a hydrophilic molecular layer). In some other embodiments, the coupling group CG may interrupt the backbone of the linking group L. In some embodiments, the coupling group CG is a triazolylene group, which may be obtained by reaction between an alkyne group and an azide group, any of which may be a reactive moiety RxAnd a reactive partner RpxAs known in the art for Click coupling reactions. For example, the dibenzocyclooctenyl-fused triazolylene group may be conjugated to a dibenzocyclooctynyl reactive partner Rpx(ii) an azido-reactive moiety R with a surface-modifying moleculexThe reaction of (a), which is described in more detail in the following paragraphs. A variety of dibenzocyclooctynyl-modified molecules are known in the art, or can be synthesized to incorporate moieties that are configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological microorganism (e.g., a cell, such as an immune cell (e.g., B cell) or a hybridoma cell).
When the coating material is formed in a multi-step process, moieties configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or amplifying biological micro-objects (e.g., cells, such as immune cells (e.g., B cells) or hybridoma cells) in a microfluidic device may be introduced by reacting a reagent containing the moiety (formula 5) with a substrate having a surface modifying ligand covalently attached thereto (formula 6).
The modified surface of
Reactive moiety RxIs present at the end of the surface modifying ligand remote from the covalent attachment of the surface modifying ligand to the surface. Reactive moiety RxIs any suitable reactive moiety that can be used in a coupling reaction to introduce a moiety that provides an organic and/or hydrophilic molecular layer suitable for maintaining and/or expanding a biological micro-object (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell) in a microfluidic device. In some embodiments, the reactive moiety RxCan be an azido, amino, bromo, thiol, activated ester, succinimidyl, or alkynyl moiety.
A reagent containing a moiety. The reagent containing moiety (formula 5) is configured to supply a moiety configured to provide an organic and/or hydrophilic molecular layer suitable for maintaining and/or amplifying a biological micro-object (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell) in a microfluidic device.
Moiety- (L')m-Rpx
Configured to provide, in a reagent containing a moiety, an organism and/or a cell suitable for maintaining and/or expanding a biological microorganism (e.g., a cell, such as an immune cell (e.g., a B cell) or a hybridoma cell)Part of the hydrophilic molecular layer is formed by a reactive pair RpxWith reactive moieties RxThe reaction of (a) is linked to a surface modifying ligand. Reactive partner RpxIs any suitable reactive group configured to react with a corresponding reactive moiety RxAnd (4) reacting. In a non-limiting example, a suitable reactive partner RpxCan be an alkyne, a reactive moiety RxMay be an azide. Reactive partner RpxMay alternatively be an azide moiety, the corresponding reactive moiety RxMay be an alkyne. In other embodiments, the reactive partner RpxCan be an active ester functional group, a reactive moiety RxMay be an amino group. In other embodiments, the reactive partner RpxMay be an aldehyde, a reactive moiety RxMay be an amino group. Other reactive moiety-reactive partner combination are possible, and these examples are in no way limiting.
The portion of the reagent containing moiety of
The configuration of the reagent containing moieties of
When the reagent containing moieties (formula 5) reacts with the surface having surface modifying ligands (formula 3), a substrate having a conditioned surface of
A surface modifier. The surface modifier is of the structure LG- (L')j-RxA compound of (formula 4). The linking group LG is covalently linked to the oxide on the surface of the substrate. The substrate may be a DEP configured substrate and may comprise silicon or aluminum oxide or hafnium oxide, and the oxide may be present as part of the native chemical structure of the substrate or may be incorporated as discussed herein. The linking group LG can be any linking group described herein, such as a siloxy or phosphonate group, formed from the reaction of a siloxane or phosphonate group with an oxide on the surface of a substrate. Reactive moiety RxAs described above. Reactive moiety RxThe linking group LG may be directly linked to (L ", j ═ 0) or indirectly linked to (j ═ 1) through a linking moiety L". The linking group LG may be linked to a first end of the linking moiety L' and the reactive moiety RxCan be attached to the second end of the linking moiety L', the reactive moiety R once the surface modifying reagent has been attached to the surface as shown in
The linking moiety L "may have a linear portion, wherein the backbone of the linear portion comprises 1 to 100 non-hydrogen atoms selected from any combination of silicon, carbon, nitrogen, oxygen, sulfur and phosphorus atoms. In some non-limiting examples, it may be interrupted by any combination of ether, amino, carbonyl, amido, or phosphonate groups. In addition, the linking moiety L "may have one or more arylene, heteroarylene, or heterocyclic groups that interrupt the backbone of the linking moiety L". In some embodiments, the backbone of the linking moiety L "may comprise 10 to 20 carbon atoms. In other embodiments, the backbone of the linking moiety L "can comprise from about 5 atoms to about 100 atoms; from about 10 atoms to about 80 atoms, from about 10 atoms to about 50 atoms, or from about 10 atoms to about 40 atoms. In some embodiments, all of the backbone atoms are carbon atoms. In other embodiments, the backbone atoms are not all carbon, and may include any possible combination of silicon, carbon, nitrogen, oxygen, sulfur, or phosphorus atoms, subject to the limitations of chemical bonding known in the art.
In some embodiments, the coating material (or surface-modified ligand) is deposited on the inner surface of the microfluidic device using chemical vapor deposition. By chemical vapor deposition, the coating material may achieve a close-packed monolayer, wherein molecules comprising the coating material are covalently bonded to molecules of the inner surface of the microfluidic device. To achieve the desired packing density, molecules comprising, for example, alkyl-terminated siloxanes can be vapor deposited at a temperature of at least 110 ℃ (e.g., at least 120 ℃, 130 ℃, 140 ℃, 150 ℃, 160 ℃, etc.) for at least 15 hours (e.g., at least 20, 25, 30, 35, 40, 45, or more hours). Such vapor deposition is typically carried out under vacuum and in a water source (e.g., hydrated sulfate salts (e.g., MgSO)4·7H2O)) in the presence of oxygen. Generally, increasing the temperature and duration of the vapor deposition results in improved properties of the hydrophobic coating material.
The vapor deposition process can optionally be modified, for example, by pre-cleaning the
In some embodiments, vapor deposition is used to coat the inner surfaces of the
Fig. 2H depicts a cross-sectional view of a
In the embodiment shown in fig. 2H, the
In another particular embodiment, the
In other particular embodiments, the
In another specific embodiment, the coating material may comprise or be chemically modified to provide a hydrophilic coating agent at its end facing the housing. In some embodiments, the coating agent may be an alkylene ether containing polymer, such as PEG. In some embodiments, the coating agent may be a polysaccharide, such as dextran. As with the charged moieties discussed above (e.g., anionic, cationic, and zwitterionic moieties), the hydrophilic coating agent can form strong hydrogen bonds with water molecules, such that the resulting water of hydration acts as a layer (or "shield") separating the core from interactions with non-biological molecules (e.g., silicon and/or silicon oxide of the substrate).
Methods for detecting expression of an antibody. The methods disclosed herein include methods of detecting or identifying biological cells that express antibodies that specifically bind to an antigen of interest. The antigen of interest may be a protein, a carbohydrate group or chain, a biological or chemical agent other than a protein or carbohydrate, or any combination thereof. The antigen of interest can be, for example, an antigen associated with a pathogen (e.g., a virus, a bacterial pathogen, a fungal pathogen, a protozoan pathogen, etc.). Alternatively, the antigen of interest may be associated with a cancer (e.g., lung cancer, breast cancer, melanoma, etc.). In another alternative, the antigen may be associated with an autoimmune disease (e.g., multiple sclerosis or type I diabetes). As used herein, the term "associated with a pathogen" when used with an antigen of interest means that the antigen of interest is produced directly by the pathogen or by an interaction between the pathogen and the host.
Methods of detecting biological cells expressing antibodies that specifically bind to an antigen of interest can be performed in the microfluidic devices described herein. In particular, the microfluidic device may comprise a housing having a flow region that may comprise one or more microfluidic channels and an isolation dock (or multiple isolation docks). The isolation dock may include a separation region and a connection region that provides a fluidic connection between the separation region and the flow region/microfluidic channel. The volume of the isolation dock can be about 0.5nL to about 5.0nL or any range therein (e.g., about 0.5nL to about 1.0nL, about 0.5nL to about 1.5nL, about 0.5nL to about 2.0nL, about 1.0nL to about 1.5nL, about 1.0nL to about 2.0nL, about 1.0nL to about 2.5nL, about 1.5nL to about 2.0nL, about 1.5nL to about 2.5nL, about 1.5nL to about 3.0nL, about 2.0nL to about 2.5nL, about 2.0nL to about 3.0nL, about 2.0nL to about 3.5nL, about 2.5nL to about 3.5nL, about 3.5nL to about 3.0 to about 3.5nL, about 3.5nL to about 3.5nL, about 3.0 to about 3.5nL, about 3.5nL to about 3.5nL, about 3.0 to about 3.5nL). The connection region may have a width W as generally described hereincon(e.g., from about 20 microns to about 100 microns, or from about 30 microns to about 60 microns). Width W of the separation regionisoMay be greater than the width W of the connection regioncon. In certain embodiments, the width W of the separation regionisoFrom about 50 microns to about 250 microns.
The flow region, the isolation dock, and/or the isolation area of the isolation dock may comprise at least one surface coated with a coating material that promotes viability of the biological cells and/or reduces interaction with the biological cells. Thus, for example, the coating material may promote the viability of hybridoma cells, and/or promote the viability of B-cell lymphocytes (e.g., memory B cells or plasma cells), and/or the ability to move any such cells into the microfluidic device. As used herein, "promoting viability" means that the viability of the antibody-expressing biological cells is better on the coated surface compared to an uncoated equivalent surface. In certain embodiments, the flow region, isolation dock, and/or isolation region has a plurality of surfaces, each surface coated with a coating material that promotes viability of and/or reduces interaction with antibody-expressing cells. The coating material can be any suitable coating material known in the art and/or described herein. The coating material may for example comprise hydrophilic molecules. The hydrophilic molecule may be selected from the group consisting of a polymer comprising polyethylene glycol (PEG), a polymer comprising a carbohydrate group, a polymer comprising an amino acid (e.g., a protein, such as BSA), and combinations thereof.
The flow region, the isolation dock, and/or the isolation region of the isolation dock may comprise at least one conditioned surface that promotes viability of the antibody-expressing biological cells and/or reduces interaction with the antibody-expressing biological cells. Thus, for example, the conditioned surface may promote the viability of hybridoma cells, and/or promote the viability of B-cell lymphocytes (e.g., memory B cells or plasma cells), and/or promote the ability to move any cells into the microfluidic device. As used herein, "promoting viability" means that the viability of the antibody-expressing biological cells is better on the conditioned surface compared to an unregulated equivalent surface. In certain embodiments, the flow region, the spacer dock, and/or the separation region has a plurality of conditioned surfaces, each conditioned surface capable of promoting viability of the antibody-expressing cell and/or reducing interaction with the antibody-expressing cell. The conditioned surface may comprise covalently attached molecules. The covalently linked molecule can be any suitable molecule known in the art and/or disclosed herein, including, for example, covalently linked hydrophilic molecules. The hydrophilic molecule may be selected from the group consisting of a polymer comprising polyethylene glycol (PEG), a polymer comprising a carbohydrate group, a polymer comprising an amino acid, and combinations thereof. As described herein, the hydrophilic molecules may form a covalently linked layer of hydrophilic molecules. Alternatively, the covalently linked molecules may comprise perfluoroalkanes (e.g., covalently linked perfluoroalkane layers).
A method of detecting a biological cell expressing an antibody that specifically binds to an antigen of interest may comprise the steps of: introducing a sample containing antibody-expressing biological cells into a microfluidic device; loading antibody-expressing biological cells into a separation region of a separation dock in a microfluidic device; introducing a target antigen into the microfluidic device such that the target antigen is in the vicinity of the antibody-expressing biological cells; and monitoring the binding of the antigen of interest to the antibody expressed by the biological cell.
The antibody-expressing biological cell can be, for example, a hybridoma cell. Alternatively, the antibody-expressing biological cell may be a B cell lymphocyte. The B cell lymphocyte may be, for example, CD27+B cells or CD138+B cells. In some embodiments, the B cell is a memory B cell. In other embodiments, the B cell is a plasma cell.
Introducing the antibody-expressing biological cells into the microfluidic device can involve obtaining a sample containing the antibody-expressing cells. For embodiments in which the antibody-expressing biological cells are B cell lymphocytes, the sample containing B cell lymphocytes can be obtained from a mammal, such as a human, a rodent (e.g., mouse, rat, guinea pig, gerbil, hamster), a rabbit, a ferret, a livestock (e.g., goat, sheep, pig, horse, cow), a llama, a camel, a monkey, or from an avian species, such as a chicken and turkey. In some embodiments, the mammal has been immunized against an antigen of interest. In some embodiments, the animal has been exposed to or infected with a pathogen associated with the antigen of interest. In some embodiments, the animal has a cancer associated with an antigen of interest. In other embodiments, the animal has an autoimmune disease associated with an antigen of interest. The sample containing B cell lymphocytes may be a peripheral blood sample (e.g., PBMCs), spleen biopsy, bone marrow biopsy, lymph node biopsy, tumor biopsy, or any combination thereof.
A sample containing B cell lymphocytes can be processed (e.g., sorted, negative and/or positive) to enrich for desired B cell lymphocytes. In some embodiments, the desired B cell lymphocyte is a memory B cell. In other embodiments, the desired B cell lymphocyte is a plasma cell. In some embodiments, the desired B cell lymphocytes express IgG-type antibodies. Thus, for example, the sample may be depleted of cell types other than B-cell lymphocytes. Methods for depleting non-B cell types from a sample are well known in the art and include, for example, using DYNABEADSTMUnmodified B cell reagent (DYNABEADS)TMUntouched Human B Cells reagent, Thermo Fisher), B Cell Isolation Kit (Miltenyi), easy Sep B Cell Enrichment Kit (easy Sep), Rosetesep Human B Cell Enrichment Cocktain (Rosetesep Human B Cell Enrichment Cocktain, Stem Cell Technologies), and the like. Alternatively, or in addition, samples containing B cell lymphocytes can be sorted by fluorescence-associated cell sorting (FACS) to remove unwanted cell types and enrich for desired cell types. FACS sorting may be negative and/or positive. For example, FACS sorting can deplete B cell lymphocyte samples expressing IgM antibodies, IgA antibodies, IgD antibodies, IgG antibodies, or any combination thereof. Alternatively, or in addition, FACS sorting may enrich a sample for B cell lymphocytes expressing CD27 (or some other memory B cell marker) or B cell lymphocytes expressing CD138 (or some other plasma cell marker). The sample containing B cell lymphocytes can be provided in an enriched state (i.e., pretreated) such that it is not necessary to perform a site of enrichment for the desired B cell lymphocytesAs part of the method. Alternatively, treatment of a sample containing B cell lymphocytes to enrich for desired B cell lymphocytes can be performed as part of the method of the invention.
The sample containing B cell lymphocytes can be treated to reduce cell adhesion to the microfluidic device in the sample. For example, DNase may be used (e.g.Nucleic (Millipore)) treatment of the sample. Preferably, the dnase contains minimal protease activity.
Introduction of the antibody-expressing biological cells into the microfluidic device can be performed by flowing a sample containing the biological cells into an inlet of the microfluidic device and through a portion of a flow region of the microfluidic device. The flow of sample through the microfluidic device can then be stopped to allow loading of antibody-expressing biological cells (e.g., B-cell lymphocytes) into the isolated region of the sequestration dock. Loading of antibody-expressing cells into the separation region can be performed by any technique known in the art or disclosed herein, for example, using gravitational forces and/or DEP forces. In certain embodiments, a single antibody-expressing cell (e.g., a B cell lymphocyte) is loaded into the isolation region. In certain embodiments, a single antibody-expressing cell (e.g., a B-cell lymphocyte) is loaded into a separate region of each of a plurality of isolated docks in a microfluidic device.
Methods of detecting biological cells that express an antibody that specifically binds to an antigen of interest can include the step of contacting a B cell lymphocyte with a stimulating agent that stimulates B cell activation. The stimulating agent may be a CD40 agonist, such as CD40L, a derivative thereof, or an anti-CD 40 antibody. The stimulant may comprise CD40L+Feeder cells, consisting essentially of, or consisting of. CD40L+The feeder cells may be T cells (e.g., Jurkat D1.1 cells) or derivatives thereof. Alternatively, the feeder cells may be cell lines transfected/transformed with the CD40L expression construct (e.g., NIH-3T3 cells). The stimulating agent may further comprise a B Cell Receptor (BCR) superantigen, such as protein a, protein G, or any other BCR superantigen. The BCR superantigen may be linked toMicro-objects such as beads, lipid vesicles, lipid nanorafts, etc. Thus, the superantigen-coated microobjects can interact with CD40L+Feeder cells were mixed. The mixture may have a ratio of about 1:1 feeder cells to micro-objects, or a ratio of about 1:5 feeder cells to micro-objects, or any ratio therebetween. Alternatively, the mixture may have a ratio of about 1:2 feeder cells to micro-objects, or a ratio of about 2:10 feeder cells to micro-objects, or any ratio therebetween. The stimulating agent may further comprise a toll-like receptor (TLR) agonist (e.g., a TLR9 agonist), which may be combined with a CD40 agonist and optionally a BCR superantigen. The TLR agonist may be, for example, a CpG oligonucleotide (e.g., CpG 2006). The CpG oligonucleotide may be used at a concentration of about 1 microgram/mL to about 20 microgram/mL (e.g., about 1.5 to about 15 microgram/mL, about 2.0 to about 10 microgram/mL, or about 2.5 to about 5.0 microgram/mL). The B cell lymphocytes can be contacted (e.g., substantially continuously, or periodically/intermittently) with the stimulating agent for 1 to 10 days (e.g., 2 to 8 days, 3 to 7 days, or 4 to 6 days). B cell lymphocytes can be contacted with a stimulating agent in a sequestration dock into which the B cell lymphocytes are loaded. This contact may occur after the B cell lymphocytes are loaded into the isolation dock.
The method of detecting a biological cell that expresses an antibody that specifically binds to an antigen of interest can further comprise the step of providing the antibody-expressing biological cell (e.g., a B cell lymphocyte) with a culture/activation medium comprising one or more growth inducing agents that promote B cell activation and/or expansion. The one or more growth-inducing agents may include at least one agent selected from the group consisting of CpG oligonucleotides, IL-2, IL-4, IL-6, IL-10, IL-21, BAFF, and April. IL-2 can be provided at a concentration of about 2ng/mL to about 5ug/mL, or about 50ng/mL to about 2ug/mL, or about 100ng/mL to about 1.5ug/mL, or about 500ng/mL to about 1ug/mL, or about 1 ug/mL. IL-4 may be provided at a concentration of about 2ng/mL to about 20ng/mL, or about 5ng/mL to about 10ng/mL, or about 5 ng/mL. IL-6, IL-10 and/or IL-21 may be provided at a concentration of about 2ng/mL to about 50ng/mL, or about 5ng/mL to about 20ng/mL, or about 10 ng/mL. BAFF and/or April may be provided at a concentration of about 10ng/mL to about 100ng/mL, or about 10ng/mL to about 50ng/mL, or about 10ng/mL to about 20ng/mL, or about 10 ng/mL. CpG oligonucleotides may be used at a concentration of about 1 microgram/mL to about 20 microgram/mL, about 1.5 to about 15 microgram/mL, about 2.0 to about 10 microgram/mL, or about 2.0 microgram/mL. In certain embodiments, the antibody-expressing biological cells are provided with culture medium for 1 to 10 days (e.g., 2 to 8 days, 3 to 7 days, or 4 to 6 days). The culture medium may comprise a stimulating agent (e.g., a CD40 agonist and/or a BCR superantigen). Thus, for example, where the antibody-producing cell is a B cell lymphocyte, the providing of the culture medium to the B cell lymphocyte can be performed while contacting the B cell lymphocyte with the activating agent. In certain embodiments, the steps of contacting the B cell lymphocytes with the stimulating agent and providing the culture medium to the B cell lymphocytes are performed within an overlapping time period (e.g., within a substantially coextensive time period).
In certain embodiments, introducing the antigen of interest into the microfluidic device such that the antigen of interest is located in the vicinity of the antibody-expressing biological cell comprises locating the antigen of interest within 1 millimeter (mm) of the biological cell (e.g., within 750 microns, within 600 microns, within 500 microns, within 400 microns, within 300 microns, within 200 microns, within 100 microns, or within 50 microns of the biological cell). In certain embodiments, the method may comprise introducing a micro-object or a plurality of micro-objects into a flow region/microfluidic channel connected to an isolation dock. The micro-object may comprise an antibody-specific binding agent, such as an anti-IgG antibody or other IgG binding agent. See, for example, fig. 6C. In such embodiments, monitoring binding of the antigen of interest to the antibody expressed by the biological cell comprises detecting indirect binding of the labeled antigen of interest to the micro-object via the antibody expressed by the antibody expressing biological cell. The labeled target antigen may be soluble and may include a detectable label, such as a fluorescent label. The micro-objects may be any suitable micro-objects (e.g., cells, liposomes, lipid nanorafts, or beads) known in the art and/or described herein. The step of providing the antigen of interest may comprise placing such micro-objects near or within the connection region of the isolation dock, wherein the antibody-expressing biological cell is located. Alternatively, the step of providing the antigen of interest may comprise loading such micro-objects into separate regions of the sequestration dock, in which the antibody-expressing biological cells are located. The micro-objects and the target antigen may be provided simultaneously as a mixture, or sequentially (if the micro-objects are first placed in a separate dock).
Alternatively, in certain embodiments, the method may comprise introducing a micro-object or a plurality of micro-objects into a flow region/microfluidic channel connected to an isolation dock, wherein the antigen of interest binds to the micro-object. In such embodiments, a soluble labeled antibody-specific binding agent, such as an anti-IgG antibody or other IgG binding agent, can also be provided, and monitoring binding of the antigen of interest to the antibody expressed by the biological cell comprises detecting indirect binding of the labeled antibody-specific binding agent to the micro-object via the antibody expressed by the antibody-expressing biological cell. The labeled antibody-specific binding agent may comprise a detectable label, such as a fluorescent label. The micro-objects may be any suitable micro-objects (e.g., cells, liposomes, lipid nanorafts, or beads) known in the art and/or described herein. The step of providing the antigen of interest may comprise placing such micro-objects near or within the connection region of the isolation dock, in which the antibody-expressing biological cell is located. The step of providing the antigen of interest may further comprise loading such micro-objects into a separate region of the sequestration dock, wherein the antibody-expressing biological cells are located. The micro-objects and antibody-specific binding agent may be provided simultaneously as a mixture, or sequentially (if the micro-objects are first placed in a separate dock). Methods of screening for expression of a molecule of interest (e.g., an antibody) have been described, for example, in U.S. patent publication No. US2015/0151298, which is incorporated by reference herein in its entirety.
In some embodiments, the method further comprises providing a second antibody-specific binding agent prior to or concurrently with the first antibody-specific binding agent. See, e.g., fig. 6C. The second antibody binding agent may be an anti-IgG antibody or other type of antibody binding agent, and may be labeled (e.g., with a fluorescent label). In certain embodiments, the labeled second antibody-specific binding agent is provided in a mixture with the antigen of interest and the first antibody-specific binding agent. In other embodiments, the labeled second antibody-specific binding agent is provided after the antigen of interest and/or the first antibody-specific binding agent is provided.
In certain embodiments, providing the target antigen can include flowing a solution comprising a soluble target antigen through a flow region of the microfluidic device and diffusing the soluble antigen into a sequestration dock in which the antibody-expressing biological cell is located. Such soluble antigen may be covalently bound to a detectable label (e.g., a fluorescent label). A general method of screening for expression of molecules of interest (including antibodies) in this manner has been described in, for example, international application PCT/US2017/027795 filed on 2017, 4/14, which is incorporated herein by reference in its entirety.
In certain embodiments, the method can further comprise detecting binding of an antigen of interest to an antibody expressed by the biological cell (e.g., a B cell lymphocyte), and identifying an antibody-expressing biological cell (e.g., a B cell lymphocyte) that expresses an antibody that specifically binds the antigen of interest.
Obtaining antibody sequences from the recognized B cell lymphocytes. Also disclosed herein are methods of providing sequencing libraries and/or obtaining heavy and light chain antibody sequences from antibody-expressing cells. Alternatively, obtaining a sequencing library from a target B cell lymphocyte can be performed by methods other than those described herein. Other suitable, but non-limiting, methods are described in PCT/US2017/054628, filed on 29/9/2017, and the entirety of which is incorporated herein by reference for all purposes.
Capture/priming oligonucleotides. The capture/priming oligonucleotide may comprise a first priming sequence and a capture sequence. The capture/priming oligonucleotide may comprise a 5 'endmost nucleotide and a 3' endmost nucleotide.
And (5) capturing the sequence. The capture sequence is an oligonucleotide sequence configured to capture nucleic acids from lysed cells. In various embodiments, the capture sequence may be near or include the 3' endmost nucleotide of the capture/priming oligonucleotide. The capture sequence can have from about 6 to about 50 nucleotides. In some embodiments, the capture sequence captures the nucleic acid by hybridizing to the nucleic acid released from the target cell. In some of the methods described herein, the nucleic acid released from the target B cell may be mRNA. The capture sequence that can capture and hybridize to the mRNA can include a polyT sequence, which mRNA has a PolyA sequence at the 3' end of the mRNA. The polyT sequence may have from about 20T nucleotides to more than 100T nucleotides. In some embodiments, the polyT sequence may have from about 30 to about 40 nucleotides. The polyT sequence may further contain two nucleotides VI at its 3' end.
A first priming sequence. The first priming sequence of the capture/priming oligonucleotide may be: 5 'of the capture sequence, proximal to the 5' endmost nucleotide of the capture/priming oligonucleotide; or the 5' endmost nucleotide comprising a capture/priming oligonucleotide. The first priming sequence may be a universal sequence or a sequence specific priming sequence. The first priming sequence may be bound to a primer that, upon binding, primes the reverse transcriptase. The first priming sequence may comprise from about 10 to about 50 nucleotides.
Additional priming and/or adaptor sequences. The capture oligonucleotide may optionally have one or more additional priming/adaptor sequences that provide a landing site for primer extension (which may include extension by a polymerase) or a site for immobilization to a complementary hybridization anchor site within a massively parallel sequencing array or flow cell. In the methods herein, the second (or additional) priming sequence may be a P1 sequence (e.g., AAGCAGTGGTATCAACGCAGAGT (SEQ ID No.1), as used in Illumina sequencing chemistry), but the methods are not so limited. Any suitable priming sequence for use in the preparation of other types of NGS libraries may be included. In some embodiments, when the P1 sequence is included as an additional priming sequence, it may be 5' to the first priming sequence. The P1 additional priming sequence may also be 5' to the capture sequence.
Template switching oligonucleotides. Template switch oligonucleotide as used herein refers to an oligonucleotide that allows terminal transferase activity of a suitable reverse transcriptase, such as but not limited to Moloney Murine Leukemia Virus (MMLV), to anchor the template switch oligonucleotide with added deoxycytidine nucleotides. After base pairing between the template switch oligonucleotide and the additional deoxycytidine, the reverse transcriptase "switches" the template strand from the captured RNA to the template switch oligonucleotide and proceeds to copy to the 5' end of the template switch oligonucleotide. Thus, the entire 5' end of the transcribed NA is included, and additional priming sequences for further amplification may be introduced. In addition, the cDNA is transcribed in a sequence-independent manner.
BCR gene sequence. The B cell receptor gene sequence includes several subregions to include variable (V), diversity (D), junction (J) and constant (C) segments in 5 'to 3' order in the released RNA. The constant region is exactly 5' to the polyA sequence. In many methods of sequencing BCRs, it may be desirable to construct a selection strategy that results in amplicons for sequencing that do not contain poly a sequences (tails). Furthermore, it may be desirable to generate amplicons that retain few constant regions. Limiting amplification to exclude these segments of released nucleic acid sequence may allow for more robust sequencing of V, D (if present) and J segments of BCR.
To better understand this approach, turning to FIGS. 8A-8H, each of FIGS. 8A-8H represents a single species or a set of related double stranded species present at different points in the method of obtaining a BCR sequencing library from a single cell. The method can be multiplexed such that many individual cells can be processed to provide a sequencing library that can be traced back to a particular start site within the well plate. Knowledge of this location can be further traced to a single isolation dock within the microfluidic device from which the cells have been exported. Thus, biological cells can be assayed for the desired ability to produce desired products or stimulate other cells, and then traceably exported, traceably processed to provide sequencing libraries, and the resulting genomic data resulting from the sequencing can be identifiably correlated back to the source cells in the microfluidic device.
In fig. 8A,
In fig. 8B, the initial process of reverse transcription is shown, wherein reverse transcriptase extends the capture/priming
In fig. 8C, a transcript conversion oligonucleotide (TSO)835 is present in the reverse transcription reaction mixture, where the TSO includes
In reverse transcription, the TSO aligns to the 5 'end of
In FIG. 8E,
A first Polymerase Chain Reaction (PCR) is then performed. Fig. 8F shows a schematic of the primer arrangement used to selectively amplify the focus region of the BCR region. The
The selected and
The
Examples
- 上一篇：一种医用注射器针头装配设备
- 下一篇：用于检测大肠癌的生物标志物