阅读说明：本技术 杜梨耐盐基因PbHSF3A及其在植物耐盐遗传改良中的应用 (Du pear salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement ) 是由 黄小三 陈紫龄 董慧珍 张绍铃 于 2021-09-01 设计创作，主要内容包括：本发明公开了一种杜梨耐盐基因PbHSF3A及其在植物耐盐遗传改良中的应用,属于基因工程技术领域,PbHSF3A基因为一种从杜梨(Pyrus betulifolia)中分离、克隆出的热激蛋白,其核苷酸序列如SEQ ID No.1所示。将该基因构建植物超表达载体,并通过农杆菌介导的遗传转化将其分别导入拟南芥和杜梨中,获得转基因植株,经生物学功能验证,表明本发明所克隆的PbHSF3A基因具有提高植物耐盐性的功能。该基因的发现,为植物抗逆分子设计育种提供新的基因资源,能有效提高植物对于非生物逆境的抗性。(The invention discloses a birch pear salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement, belonging to the technical field of genetic engineering.A PbHSF3A gene is a heat shock protein separated and cloned from birch pear (Pyrus betulifolia), and the nucleotide sequence of the gene is shown in SEQ ID No. 1. The gene is used for constructing a plant over-expression vector, and is respectively introduced into arabidopsis thaliana and pyrus betulaefolia through agrobacterium-mediated genetic transformation to obtain transgenic plants, and biological function verification shows that the cloned PbHSF3A gene has the function of improving the salt tolerance of plants. The discovery of the gene provides a new gene resource for designing and breeding plant stress-resistant molecules, and can effectively improve the resistance of plants to abiotic stress.)

1. A pyrus betulaefolia salt-tolerant protein PbHSF3A is characterized in that the amino acid sequence is shown in SEQ ID No. 2.

2. A pyrus betulaefolia salt-tolerant gene PbHSF3A encoding the pyrus betulaefolia salt-tolerant protein PbHSF3A of claim 1.

3. The pyrus betulaefolia salt-tolerant gene PbHSF3A according to claim 2, wherein the nucleotide sequence is shown in SEQ ID No. 1.

4. A plant overexpression vector, which contains the pyrus betulaefolia salt-tolerant gene PbHSF3A of claim 2 or 3.

5. The application of the pyrus betulaefolia salt-tolerant gene PbHSF3A of claim 2 or 3 in improving salt stress tolerance of plants.

6. Use according to claim 5, wherein the plant is selected from the group consisting of pyrus betulaefolia and arabidopsis thaliana.

7. The application of the birch-leaf pear salt-tolerant gene PbHSF3A in controlling the salt-tolerant performance of plants as claimed in claim 2 or 3, wherein the birch-leaf pear salt-tolerant gene PbHSF3A is overexpressed or silenced in plants.

8. A method for improving salt stress tolerance of plants, which is characterized in that the plant overexpression vector of claim 4 is used for introducing a birch salt-tolerant gene PbHSF3A into the plants by an agrobacterium-mediated genetic transformation method.

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a pyrus betulaefolia salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement.

Background

The pear is a fruit tree economic crop widely planted in the world at present, and is popular with the masses due to the unique nutritional flavor, taste and economic value. According to statistics, the pear is one of economic fruit tree species mainly cultivated in the world, but is extremely easily affected by adverse conditions such as complex geographical climate and the like among different regions, such as soil barren, water shortage and freezing damage, high salinization in coastal regions and the like. Therefore, breeding new varieties with strong stress resistance and excellent comprehensive characters becomes the most key factor for the development of the pear industry.

In actual cultivation and production, the plants are often damaged by abiotic stresses such as drought, waterlogging, saline-alkali soil and the like. Saline-alkali soil can influence the normal growth of fruit trees to a great extent, pear trees are no exception, cultivated land is converted into unproductive wasteland due to the fact that salt in the saline-alkali soil continuously increases, and the yield of plants is reduced in a large area due to the fact that salt influences accumulation of a series of physiological and biochemical characteristics such as mineral ion steady state, water balance, nitrogen fixation and photosynthetic capacity in the plants. Therefore, the breeding of pear cultivars with strong salt tolerance is urgent, and the harm of saline-alkali soil to the pear industry can be effectively reduced.

Disclosure of Invention

The invention aims to provide a pyrus betulaefolia salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement, which are used for solving the problems in the prior art, exploring the influence of salt stress on pear germplasm resources, and evaluating the salt tolerance degree of various pear germplasm resources according to morphological indexes and physiological and biochemical indexes, thereby selecting a pear variety with higher salt tolerance degree and providing a theoretical basis for researching the salt-tolerant molecular mechanism of pears and the like.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a pyrus betulaefolia salt-tolerant protein PbHSF3A, wherein the gene is a heat shock protein separated and cloned from pyrus betulaefolia, the gene is named as PbHSF3A, and the amino acid sequence is shown as SEQ ID No. 2:

MSPKDKSHPKSPPTSAEFDPESIGLSGLSEFRLEVSEPLLGSQPIPSFTSPVMEFEAFSSVNPLGAFDFTEKVSIPTSSMGGGGAEDVVVPPQPLECLQGTLVPPFLSKTFDLVEDPSLDSIISWGSGGRSFVVWDPSEFSRFILPRNFKHNNFSSFVRQLNTYIVSKVQFFICMKVDGLTLSSGFRKVDTDKWEFANEAFQKGKRHLLKRIQRRKSPQSLQVGSFTGPSAEAGKSGVEGEIETLQKERSMLMQEVVELQQQQRGTVDRMKVVNQRLQSAEQRQKQMVSFLAKMLQNPAFVARLQQKTGQKDRGSSRVRRKFVKHQQHELSKSDSDMEGQIVKYQPAWRNQIISSTAPDSNPVPFEQSPHYPSQVTTGKLGLDAESTAFQFVDAALDELAITQGFLQTPEQEGEGASSMVTEDPFFKGKSVLSPQQEANPKHYVSFEEDLLKDRTFPELFSPGMESMIKQEDIWSMDFDISAGMSTSMNELLGNPVNYDVPEVGVTGELLDVWDIDPLQEAGGLGINKWPAHESAFDEPQSQGVQSASKTTDP。

the invention also provides a pyrus betulaefolia salt-tolerant gene PbHSF3A for encoding the pyrus betulaefolia salt-tolerant protein PbHSF 3A.

Furthermore, the nucleotide sequence of the pyrus betulaefolia salt-tolerant gene PbHSF3A is shown in SEQ ID No. 1:

ATGAGCCCAAAAGACAAGAGCCACCCAAAGTCTCCACCCACTTCAGCTGAATTCGACCCGGAATCAATTGGGTTATCGGGGTTATCGGAATTTCGACTCGAAGTGTCGGAACCGTTACTGGGTTCTCAGCCGATTCCTTCGTTCACTTCTCCTGTAATGGAATTCGAAGCCTTCTCTTCTGTAAACCCATTGGGTGCTTTTGACTTCACTGAAAAAGTTTCAATTCCAACGTCGTCTATGGGCGGCGGTGGTGCGGAGGACGTCGTTGTTCCGCCGCAGCCACTGGAATGTCTGCAGGGCACTCTGGTGCCTCCATTTCTGTCCAAGACTTTCGATTTGGTCGAGGACCCCTCGCTGGATTCGATCATATCGTGGGGCTCCGGCGGCCGCAGCTTCGTGGTGTGGGACCCATCGGAGTTTTCCAGATTCATCTTACCGAGGAACTTCAAGCACAACAATTTCTCAAGTTTTGTGCGGCAGCTTAATACTTATATTGTAAGCAAGGTTCAGTTCTTCATATGCATGAAAGTTGATGGCCTCACATTGTCTTCTGGTTTTCGCAAGGTTGACACAGATAAGTGGGAGTTTGCGAATGAAGCTTTTCAGAAGGGCAAAAGACATTTGTTGAAGAGGATCCAGAGGCGCAAGTCACCTCAGTCTCTGCAAGTTGGGAGCTTTACTGGGCCTTCTGCGGAAGCAGGGAAGTCTGGAGTCGAAGGTGAGATAGAGACATTGCAGAAAGAGAGGAGTATGTTAATGCAGGAGGTTGTTGAATTGCAGCAGCAGCAGCGGGGCACAGTTGACCGTATGAAGGTAGTGAATCAGAGGCTTCAGTCTGCGGAGCAGAGACAGAAGCAGATGGTTTCTTTCTTGGCCAAGATGCTTCAGAACCCGGCATTCGTGGCCCGACTTCAACAAAAGACTGGACAGAAAGACAGAGGCTCTTCAAGGGTGAGGAGGAAATTTGTTAAGCATCAGCAACATGAACTCAGTAAGTCAGATTCAGATATGGAAGGCCAGATTGTGAAGTACCAGCCTGCTTGGAGAAACCAAATCATATCCTCTACAGCGCCGGATTCAAATCCAGTTCCTTTTGAACAATCTCCTCATTATCCTTCACAAGTTACGACAGGAAAACTGGGTTTGGATGCTGAAAGCACGGCATTCCAATTTGTGGACGCTGCACTAGATGAATTAGCAATCACACAAGGATTTCTTCAAACACCAGAGCAAGAAGGCGAAGGGGCATCAAGCATGGTAACTGAAGATCCTTTTTTCAAAGGGAAGAGTGTTCTAAGCCCACAACAAGAGGCTAATCCCAAGCATTATGTCTCTTTCGAGGAAGATTTGTTGAAGGACAGGACTTTTCCAGAACTGTTTTCTCCAGGGATGGAGAGCATGATTAAACAAGAAGACATATGGAGCATGGATTTTGATATCAGTGCCGGTATGTCAACTTCTATGAATGAGTTATTGGGTAATCCAGTCAACTATGATGTGCCAGAGGTGGGAGTGACCGGTGAATTGTTAGATGTCTGGGATATCGATCCCCTGCAAGAGGCAGGAGGGTTGGGAATCAATAAGTGGCCAGCCCATGAATCTGCATTTGATGAGCCTCAGAGTCAAGGTGTCCAGTCTGCATCTAAAACTACTGATCCGTAG。

the invention also provides a plant overexpression vector which contains the birch salt-tolerant gene PbHSF 3A.

The invention also provides application of the birch-leaf pear salt-tolerant gene PbHSF3A in improving salt stress tolerance of plants.

The PbHSF3A gene is overexpressed in plants by utilizing a conventional mode in the field, so that salt-tolerant transgenic plants can be obtained; the expression of PbHSF3A gene in the plant is silenced, so that transgenic plant with reduced salt tolerance can be obtained.

Further, the plant is selected from pyrus betulaefolia or arabidopsis thaliana.

The invention also provides application of the birch-leaf pear salt-tolerant gene PbHSF3A in controlling the salt-tolerant performance of plants, which is characterized in that the birch-leaf pear salt-tolerant gene PbHSF3A is overexpressed or silenced in the plants.

The PbHSF3A gene is separated and cloned from the birch pear, the gene is overexpressed in arabidopsis thaliana, the salt tolerance of the obtained transgenic plant is obviously improved, and after the gene is silenced in the birch pear, the salt tolerance of the silenced plant is obviously reduced.

The invention also provides a method for improving the salt stress tolerance of plants, which is characterized in that the plant overexpression vector is utilized, and an agrobacterium-mediated genetic transformation method is adopted to introduce the salt tolerance gene PbHSF3A of the pyrus betulaefolia into the plants.

The invention discloses the following technical effects:

the results of the invention show that by analyzing the phenotype and related physiological indexes of the PbHSF3A transgenic line before and after salt treatment: compared with a non-transformed PbHSF3A gene strain, the PbHSF3A transgenic strain has obvious advantages, such as high germination rate, chlorophyll content, Fv/Fm, potassium ion content and superoxide anion content resistance, low electric conductivity, sodium ion content, hydrogen peroxide content and MDA content, and the PbHSF3A transient silencing strain is opposite to the above, which shows that the PbHSF3A gene is a potential salt-tolerant breeding gene and can be used for genetic improvement of plant salt tolerance.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a technical flow diagram of the present invention;

FIG. 2 is a schematic representation of the expression of the heat shock protein PbHSF3A of the present invention under abiotic stress; wherein A is the relative expression quantity of transcription of heat shock protein PbHSF3A under salt treatment; b is the relative expression amount of the transcription level of the heat shock protein PbHSF3A under dehydration treatment; c is the relative expression quantity of the transcription level of the heat shock protein PbHSF3A under low-temperature stress;

FIG. 3 is a schematic diagram of the subcellular localization of the PbHSF3A gene according to the present invention;

FIG. 4 is a schematic diagram of the identification and relative expression analysis of transgenic Arabidopsis thaliana with PbHSF3A gene; wherein A is the detection result of the transgenic positive seedlings; m: marker of DL 2000; -: negative control WT plants; +: a plasmid positive control; 1-4: a transgenic positive Arabidopsis plant; b is the PCR amplification result of the Arabidopsis plant with the over-expression PbHSF3A gene; line1 and Line2 are gel electrophoresis bands of transgenic arabidopsis, WT is an untransformed arabidopsis plant;

FIG. 5 is a resistance analysis of the transgenic Arabidopsis thaliana PbHSF3A of the present invention; wherein A is the seed germination of wild type plants (WT) and transgenic plants (OE5, OE8) at 90mM NaCl concentration; b is the germination rate of Arabidopsis seeds at 90mM NaCl concentration; c is the root length phenotype of wild type plants (WT) and transgenic plants (OE5, OE8) at 90mM NaCl concentration; d is the root length of Arabidopsis plants at 90mM NaCl concentration; e is the conductivity measurement of Arabidopsis plants at 90mM NaCl concentration;

FIG. 6 is the salt tolerance analysis of transgenic Arabidopsis thaliana of PbHSF3A of the present invention; wherein A-B is phenotype (A) of wild type strain (WT) and transgenic strain (OE5 and OE8) before 30d normal growth salt stress treatment and phenotype (B) after 10d salt stress treatment; c is Fv/Fm of Arabidopsis thaliana after stress of 90mM NaCl concentration for 10 d; d is a chlorophyll content map of Arabidopsis thaliana after salt stress; e is a chlorophyll phenotype map of Arabidopsis thaliana after salt stress; f is the conductivity of Arabidopsis thaliana after stress for 10 days at 90mM NaCl concentration; g is the MDA content of Arabidopsis thaliana after stress of 90mM NaCl concentration for 10 days;

FIG. 7 shows Na after salt stress of transgenic Arabidopsis thaliana of PbHSF3A of the present invention⁺/K⁺Measuring; wherein A is the content of sodium ions in the wild type strain and the transgenic strain after 10 days of salt stress; b is the content of potassium ions in the wild type strain and the transgenic strain after 10 days of salt stress; c is the ratio of sodium to potassium in the wild type strain and the transgenic strain after 10 days of salt stress;

FIG. 8 is reactive oxygen species analysis of transgenic Arabidopsis thaliana of the invention after salt stress with PbHSF 3A; wherein, A-B is DAB staining after salt stress for 10 days, and H is detected₂O₂NBT staining after 10d of content (A) and salt stress, detection of Anti O^2-The content (B); C-D are corresponding to A and B, respectively, and represent H after 10D of salt stress₂O₂Content determination of (C) and Anti O after 10d salt stress^2-The content measurement (D);

FIG. 9 shows the identification of resistance of the PbHSF3A gene under salt stress of Du pear; wherein A-B is 35d of phenotype (A) before salt stress treatment and phenotype (B) after salt stress treatment of a normally growing birch pear PbHSF3A gene silencing strain by 18 d; c is Fv/Fm after salt stress of PbHSF3A gene silencing strain; d is a chlorophyll content graph of the PbHSF3A gene-silenced strain after salt stress; e is a chlorophyll phenotype map of the PbHSF3A gene-silenced strain after salt stress; f is the conductivity after salt stress for 18 d; g is the MDA content after salt stress for 18 d;

FIG. 10 is a drawing of the present inventionNa after PbHSF3A gene silencing salt stress of Chinese pear⁺/K⁺Measuring; wherein A is the content of sodium ions in the wild type strain and the PbHSF3A gene silencing strain after salt stress for 18 d; b is the content of potassium ions in the wild type strain and the PbHSF3A gene silencing strain after salt stress for 18 d; c is the ratio of sodium to potassium in the wild type strain and the PbHSF3A gene silencing strain after salt stress for 18 d.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1

PbHSF3A gene cloning and overexpression vector construction

1. RNA extraction

Research material birch pears are planted in the pear engineering center of Nanjing agriculture university, and the seedling age of the birch pears is 45 d. Selecting strong birch pear seedlings, randomly weighing 0.1g of samples, and quickly freezing by using liquid nitrogen. The extraction of RNA adopts a total RNA extraction kit of Solebao company, and the specific method is as follows:

(1) sample treatment: grinding fresh or frozen tissue 0.1g at-80 deg.C in liquid nitrogen, adding the powder into 1mL lysate, and mixing to obtain homogenate sample;

(2) placing the treated sample at room temperature for 5min to completely separate nucleic acid protein complexes;

(3) adding 0.2mL of chloroform into the homogenate sample after being placed at room temperature, covering a tube cover, violently oscillating for 15 seconds, and placing at room temperature for 3-5min to obtain a suspension;

(4) centrifuging the suspension at 12000rpm at 2-8 deg.C for 10min to obtain RNA in colorless upper water phase, transferring the water phase to a new tube without sucking precipitate to obtain supernatant;

(5) pretreatment of an adsorption column: adding 500 μ L of column washing solution into adsorption column, standing at room temperature for 2min, centrifuging at 2-8 deg.C and 12000rpm for 2min, and removing waste liquid;

(6) adding 200 μ L of anhydrous ethanol into the supernatant collected in the step 4, mixing, adding into an adsorption column, standing for 2min, centrifuging at 12000rpm for 2min, and discarding the waste liquid;

(7) adding 600 μ L of rinsing solution (before use, checking whether anhydrous ethanol has been added), centrifuging at 12000rpm for 2min, and discarding the waste solution;

(8) adding 600 μ L of rinsing solution into adsorption column, centrifuging at 2-8 deg.C and 12000rpm for 2min, and discarding waste liquid;

(9) centrifuging at 12000rpm for 2min, discarding the collecting tube, placing the adsorption column at room temperature for several minutes, and removing residual rinsing liquid in the adsorption column;

(10) placing the adsorption column in a new tube, and adding 50-100 μ L of RNase free ddH dropwise into the center of the membrane₂And O, standing at room temperature for 5min, and centrifuging at 12000rpm at room temperature for 2min to obtain the pyrus betulaefolia RNA.

The extracted RNA of the pyrus betulaefolia is immediately stored in an ultra-low temperature refrigerator at minus 80 ℃ for standby. 1-2 mu L of birchleaf pear RNA is used for agarose gel electrophoresis, and is detected by a Nano-drop instrument, and the concentration of the RNA is 300 ng/mu L.

2. Gene amplification

Mu.g of Pyrus betulaefolia RNA was treated with 1U of DNase I at 37 ℃ for 30min, immediately placed on ice, 1. mu.L of 50mM EDTA was added, and then placed on ice immediately after being subjected to water bath at 65 ℃ for 10 min. The first strand cDNA is synthesized by referring to the operation manual of TOYOBO reverse transcription kit, and the extracted birch pear RNA is reversely transcribed into cDNA. The obtained first strand cDNA was used for amplification of the PbHSF3A gene. The PCR amplification system is as follows: mu.L of template cDNA, 5. mu.L of PCR buffer, 1. mu.L of dNTP Mix (10mmol/L), 1. mu.L each of the forward and reverse primers, 0.5. mu.L of Taq DNA polymerase (5U), and 10.5. mu.L of ribozyme-free water.

A forward primer: ATGAGCCCAAAAGACAAGAGCC

Reverse primer: CGGATCAGTAGTTTTAGATGCAGAC are provided.

PCR was performed as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 60s, and extension at 72 ℃ for 60s, and after 35 cycles, extension at 72 ℃ for 10 min.

3. Overexpression vector construction

And recovering the amplified product by using an AxyPrep DNA kit for gel recovery. The purified DNA fragment was ligated with an intermediate vector (pEASY), the ligation product was transformed into E.coli competent DH 5. alpha. by hot shock, PCR-verified and sequenced with the target gene sequence primers (completed by Nanjing Nozaki Biotech group) using the large intestine competence produced by Beijing Quanji Biotechnology Ltd. The double enzyme digestion system of the overexpression vector is shown in the table 1, and the connection system is shown in the table 2.

TABLE 1 double enzyme digestion System

TABLE 2 connection System

Coli with the correct sequencing result were subjected to plasmid extraction using AxyPrep plasmid DNA miniprep kit (Axygen, USA), and the plasmid was named PMV-PbHSF 3A. The constructed PMV-PbHSF3A recombinant vector with correct sequencing is transferred into agrobacterium-infected cells (GV3101) for standby by a freeze-thaw method.

Example 2

qRT-PCR analysis of PbHSF3A gene under different stress conditions

In order to analyze the response pattern of the PbHSF3A gene in Du pear to salt (A in FIG. 2), dehydration (B in FIG. 2), and low temperature (C in FIG. 2), the expression pattern of the PbHSF3A gene was analyzed using Real-time PCR technique.

RNA was extracted by a kit method (RNA extraction method in example 1). First strand cDNA synthesis was performed according to the manual of TOYOBO reverse transcription kit from Beijing Quanji Biotech Ltd.

For quantitative PCR detection, 20. mu.L of the reaction system had: 10 μ L of 2 Xmix, 0.1 μ L of cDNA, 5 μ L of primer (ubiqutin as internal reference primer, length 208bp), 4.9 μ L of water.

The procedure for quantitative PCR is shown in Table 3.

TABLE 3 quantitative PCR procedure

The treatment process is as follows:

digging out complete birch pear seedlings from the matrix, cleaning the roots with distilled water, sucking off excess water with clean filter paper to maintain the integrity of the roots of the seedlings, putting the seedlings into a clean culture bottle filled with distilled water, and pre-culturing the seedlings in a culture room at 25 ℃ for 24 hours. And (3) respectively dehydrating, low-temperature treating and salting the pre-cultured birch-leaf pear seedlings. When each factor is processed, at least 20 pear seedlings are selected, the method for collecting the leaves comprises the steps of randomly mixing and sampling, marking after the sampling is finished, quickly putting into liquid nitrogen for quick freezing, and storing the sampled products in an ultra-low temperature refrigerator at minus 80 ℃.

And (3) dehydration treatment: after the root of the pyrus betulaefolia seedling is dried by water, the pyrus betulaefolia seedling is placed on clean filter paper to be respectively dehydrated, and the sampling time is respectively 0h, 1.5h, 6h, 9h, 12h and 24 h;

low-temperature treatment: directly placing the pre-cultured birch-leaf pear material and a tissue culture bottle into a 4 ℃ culture chamber for low-temperature treatment, wherein the sampling time is 0h, 3h, 6h, 24h, 48h and 72h respectively;

salt treatment: putting the pre-cultured birch-leaf pear seedlings into a 200mM/L sodium chloride solution, wherein the sampling time is 0h, 2h, 8h, 12h, 36h and 48h respectively; the salt is solid sodium chloride granules purchased from shouder biotechnology limited in Nanjing, and the specification is as follows: AR500g, relative molecular weight 58.44.

In order to determine the response degree of the PbHSF3A gene in adversity stress, fluorescent quantitative PCR is selected to detect the expression condition. As shown in A in figure 2, when plants are treated by NaCl, the expression level is rapidly increased to a peak value within 8 hours and is rapidly decreased after 12 hours, which indicates that the PbHSF3A gene has strong response to salt stress; in the dehydration treatment (B in FIG. 2), the expression level starts to increase at 6h, reaches the maximum at 9h, and then gradually decreases; when the plants are treated at 4 ℃ and low temperature (C in figure 2), the expression level is lowest in 3h and then gradually rises;

the PbHSF3A gene can play a role in various abiotic stresses, and has obvious influence on improving the drought resistance and salt resistance of plants.

Example 3

Subcellular localization of PbHSF3A gene

1. Construction of subcellular localization vectors

According to the nucleotide sequence of the PbHSF3A gene, two enzyme cutting sites, namely SalI and BamHI, are respectively added at the head and the tail of the gene sequence. The plasmid extracted from the target gene with accurate sequencing result is used as template and PCR amplified with primer added with enzyme cutting site. After the PCR product was detected by 1% agarose gel electrophoresis, the band of interest was recovered with a gel kit. The purified amplified fragment was recovered and cloned into pMD19-T vector and transformed into E.coli competent DH5 α. And detecting the transformed bacterial liquid, sending the bacterial liquid with a positive detection result to sequencing, and extracting the bacterial liquid and the plasmid with accurate sequencing results. The two enzymes were digested with SalI and BamHI, and the digested product PbHSF3A gene and the vector were purified and recovered, respectively. The two were ligated overnight at 16 ℃ and transformed into E.coli competent DH5 α for use.

2. Subcellular localization by onion transformation

(1) Selecting a single clone containing PbHSF3A-GFP, GFP and P19 agrobacterium tumefaciens to activate in an LB culture medium, and placing the single clone in an incubator at 28 ℃ and 220rpm for overnight culture;

(2) taking 10ul of the overnight culture, transferring the overnight culture into 5mL LB-MES culture medium, adding 2ul of 100mM acetosyringone, and culturing in an incubator at 28 ℃ and 220rpm for 16-18 h;

(3) the bacterial solution was collected and treated with 10mM MgCl₂Resuspend PbHSF3A-GFP, GFP and P19, OD₆₀₀When the value is 0.8, mixing the target bacterial liquid with P19 in equal volume;

(4) and (2) adding the following components in a ratio of 500: 1, adding acetosyringone into the mixed bacterial liquid, and placing for 3-4 hours at room temperature in a dark place;

(5) selecting onions with good growth state, cutting the inner epidermis of the second three layers, placing the inner epidermis in the mixed bacterial liquid, infecting for about 10min, then paving the inner epidermis in an MS culture medium, placing the inner epidermis in the dark for 2-3 days, and observing and verifying results.

To determine the subcellular localization of the PbHSF3A gene, GFP was used as a control and was expressed both in the cytoplasm and in the nucleus, whereas PbHSF3A-GFP was expressed only in the nucleus, indicating that the subcellular localization of the PbHSF3A gene was in the nucleus (fig. 3).

Example 4

Genetic transformation and positive identification of Arabidopsis thaliana

1. Genetic transformation of Arabidopsis thaliana

Selecting strong arabidopsis thaliana with the age of 30-40 days for genetic transformation, and cutting off bloomed inflorescences before transformation. The specific operation method comprises the following steps:

(1) activating and culturing Agrobacterium PbHSF3A-GFP strain in resistant LB liquid culture medium, OD₆₀₀Centrifuging at 600rpm for 5min when the speed reaches 0.8-1.0 to collect bacterial liquid;

(2) resuspending the bacteria with 1/2MS solution with the volume twice that of the bacteria solution, and adding a surfactant Silwet L-77 to obtain an infection solution;

(3) inverting the potted arabidopsis with inflorescence cut off in a high-pressure pump with a staining solution, increasing the constant pressure to 0.6PM, closing a valve, and infecting for 5min at high pressure;

(4) and (4) placing the arabidopsis thaliana after the infection is finished in a dark place for 24 hours and then transferring the arabidopsis thaliana into a normal growth environment.

2. Screening and identification of transgenic plants

After the arabidopsis thaliana is infected by a high-pressure stable transformation method, seeds of T0 generation are obtained, the seeds of T0 generation are placed in an incubator at 30 ℃ for drying for at least one week, then the dormancy is broken through vernalization at 4 ℃ for 4 days, and after disinfection, the seeds are planted in a culture medium containing hygromycin screening resistance to be observed. The method comprises the following specific steps: weighing 0.1g of arabidopsis thaliana seeds, placing the arabidopsis thaliana seeds in a 1.5mL centrifugal tube, soaking the arabidopsis thaliana seeds in 70% alcohol in an ultra-clean workbench, sucking and beating the seeds for 1min, and then cleaning the arabidopsis thaliana seeds for 3-5 times by using double distilled water; fully oscillating and disinfecting for 5min by using 10% sodium hypochlorite, removing a sodium hypochlorite solution, cleaning for 4-5 times by using double distilled water, finally flatly paving the seeds on an MS solid culture medium containing 50mg/L hygromycin, frequently observing the growth condition of the seeds, and obtaining the arabidopsis seedlings which can normally grow in the culture medium, namely the transgenic positive seedlings. After the resistant seedlings in the culture dish grow up, the resistant seedlings can be transferred into matrix nutrient soil for further verification.

Weighing 0.1g of arabidopsis thaliana leaves growing for about 15 days in a matrix, putting the arabidopsis thaliana leaves into a 2mL centrifuge tube, adding 2-3 steel balls, fully oscillating the arabidopsis thaliana leaves in a box containing liquid nitrogen until the arabidopsis thaliana leaves are powdered, respectively adding 500 mu L of CTAB solution (preheating at 65 ℃) into the arabidopsis thaliana leaves, carrying out constant temperature water bath at 65 ℃ for 30min, and reversing the arabidopsis thaliana leaves from top to bottom for 5-8 times; after the water bath, cooling the sample to room temperature, adding 500 mu L of chloroform into a fume hood, uniformly mixing, and centrifuging at 12000rpm for 10min at room temperature; then transferring the supernatant into a new 1.5mL centrifuge tube, adding an equal volume of isopropanol solution, and centrifuging at 12000rpm for 10min at room temperature; centrifuging, pouring out supernatant, removing white flocculent precipitate at the bottom of the tube, adding 1mL 75% anhydrous ethanol, washing for 2 times, re-suspending the precipitate, and centrifuging at 12000rpm for 1 min; pouring off the supernatant, adding 50 μ L double distilled water after the alcohol is completely volatilized, placing in a constant temperature oven at 65 ℃ for 30min, and detecting the gel after the precipitate is completely dissolved.

The DNA and gene specific primer are used in PCR amplification to identify positive seedling. The reaction procedures and systems are shown in tables 4 and 5, respectively. When the detection is carried out, if a strain with a segment with an expected size and the brightness of the amplified segment is higher than that of the wild type Arabidopsis segment appears, the strain is a positive plant. The primers were designed as follows:

a forward primer F: 5'-ATGAGCCCAAAAGACAAGAGCC-3'

Reverse primer R: 5'-CGGATCAGTAGTTTTAGATGCAGAC-3'

A carrier primer R: 5'-CGTCGTCCTTGAAGAAGATG-3'

TABLE 4 PCR reaction procedure

TABLE 5 PCR reaction System

Stably transforming PbHSF3A gene into Arabidopsis by Agrobacterium mediation method, sterilizing transformed T0 generation Arabidopsis seeds, and then inoculating the seeds in MS culture medium with hygromycin resistance with final concentration of 20mg/L for next screening, wherein the resistant seedlings grow well and grow fast, while the non-resistant seedlings grow slowly and gradually yellow and die, and after the positive seedlings grow to a certain size, transferring the positive seedlings into substrate nutrient soil for culture. DNA was extracted from T0 generation Arabidopsis leaves and wild type Arabidopsis leaves and positive identification was performed, and finally 4 positive plants (A in FIG. 4) were detected.

Identification of overexpression lines in Arabidopsis: RNA extraction and reverse transcription are carried out on positive arabidopsis seedlings obtained by DNA identification, RT-PCR is adopted for overexpression analysis, untreated wild arabidopsis cDNA is used as negative control, gene specific primers are used for amplification, and arabidopsis Actin is used as an internal reference. After the amplification, the expression level of the gene in the transformed shoot was determined by 2% agarose gel electrophoresis and the brightness of the desired band was examined, and the brighter the band, the higher the expression level of PbHSF3A gene (B in FIG. 4). In the experiment, two over-expression plant lines (OE5 and OE8) with high brightness, namely Line1 and Line2 with high expression are selected as female parent Arabidopsis plants in later experiments. Continuously culturing the super expression line plant, collecting seeds and drying.

After vernalization of T1 generation arabidopsis seeds to break dormancy, they were disinfected and grown in MS medium containing hygromycin antibiotics for observation.

Example 5

PbHSF3A salt tolerance analysis and corresponding index determination

1. Resistance analysis of PbHSF3A transgenic plants

To verify the relationship between the overexpression of PbHSF3A gene Arabidopsis thaliana and salt stress, the dried transgenic lines (OE5 and OE8) and Wild Type (WT) seeds were sterilized and then seeded on five NaCl culture media with different concentrations of 80mM, 90mM, 100mM, 110mM and 125mM by using a pipette gun, during which the germination rate of the seeds was carefully observed and recorded. When the NaCl concentration was 90mM, the seeds germinated from the over-expression line were generally more numerous than the seeds germinated from the wild type (A in FIG. 5) and in a 1.5-fold relationship (B in FIG. 5), i.e., the germination rate of the seeds from the transgenic line was about 1.5-fold that of the wild type seeds, and it was preliminarily determined that the 90mM NaCl concentration was the optimum concentration for salt stress of the transgenic line.

The transgenic line and wild seeds are disinfected in the same way and then sowed in an MS solid culture medium, after 8-10 days, arabidopsis thaliana which is almost consistent is picked in an ultra-clean workbench and is spread in five NaCl square culture media with different concentrations, and marking is done. According to observation and statistics, when the concentration of NaCl culture medium is 90mM, the growth speed of the transgenic line Arabidopsis is slightly higher than that of the wild Arabidopsis, and the phenotype difference is more obvious than that of other concentrations (C and D in figure 5). The optimum concentration of the PbHSF3A transgenic line salt stress is further determined by combining the seed germination rate experiment.

After the optimum salt concentration was determined, the conductivities of the salt stress treated transgenic and wild type Arabidopsis thaliana were determined. The relative conductivity of the transgenic lines (OE5 and OE8) was significantly lower than that of the wild-type line (E in FIG. 5), indicating that the PbHSF3A transgenic line suffers less damage after salt stress treatment, i.e., the salt tolerance of the transgenic line is higher than that of the wild-type line.

2. Salt tolerance analysis of PbHSF3A transgenic plants

Transplanting the arabidopsis thaliana seedlings growing to 2-4 leaves in the MS culture medium into substrate nutrient soil for culture, stopping watering when the arabidopsis thaliana seedlings grow to 30-40d, determining specific days according to the growth state of the arabidopsis thaliana, irrigating the arabidopsis thaliana seedlings in groups by using five NaCl solutions with different concentrations of 75mM, 90mM, 100mM, 110mM and 125mM after 3-5d, setting three solutions for each concentration, repeatedly performing salt treatment for 10d, observing the phenotype, and respectively measuring the malondialdehyde content, the chlorophyll content, the hydrogen peroxide content, the superoxide anion content and the sodium potassium ion content in the cells so as to analyze the residual amount of active oxygen in the cells.

And (3) measuring the MDA content: (1) the kit of Nanjing Takara Shuzo was used, and the operation steps are shown in Table 6. After the operation is finished, uniformly mixing the mixture by shaking in a vortex instrument, carrying out boiling water bath at the temperature of more than 95 ℃ for 20min, taking out the mixture after the reaction is finished, washing the mixture by using running water, cooling the mixture to room temperature, accurately absorbing 0.25mL of reaction liquid of each tube, transferring the reaction liquid to a new 96-hole enzyme label plate, and measuring the absorbance value of each hole by using an enzyme label instrument at 520nm (subtracting the reading of the empty plate during calculation). (2) MDA content (nmol/g) — (measured OD-blank OD)/(standard OD-blank OD-standard OD concentration (10 nmol/mL)/sample concentration (g/mL), note: sample concentration ═ weight of plant tissue (g)/amount of added extract (mL).

H₂O₂And (3) content determination: (1) the kit of Nanjing Takara Shuzo was used, and the operation steps are shown in Table 7. Covering the cover, shaking and mixing the mixture by a vortex instrument, centrifuging the mixture for 5min at the room temperature of 3000-3500rpm, accurately absorbing 0.20mL of reaction liquid in each tube, and accurately adding the reaction liquid into a new 96-hole enzyme label plate by using a liquid transfer gun so as to ensure that the reaction liquid is accurately added into the new 96-hole enzyme label plateThe absorbance of each well was measured at a wavelength of 405nm and an optical path of 1cm using a microplate reader. (2) In tissue H₂O₂Content (mmol/gprot ═ (measured OD-blank OD)/(standard OD-blank OD-standard OD-blank OD concentration (163 mmol/L)/protein concentration of sample to be tested (gprot/L).

Determination of the activity against superoxide anion radicals: (1) the kit of Nanjing Takara Shuzo was used, and the operation steps are shown in Table 8. After the operation is finished, uniformly mixing the mixture by using a vortex instrument in a shaking way, standing the mixture at room temperature for 10min for reaction, absorbing 200 mu L of reaction liquid of each tube by using a liquid transfer gun, adding the reaction liquid into a clean 96-hole enzyme label plate, and measuring the absorbance value of each hole by using an enzyme label instrument at the position of 550nm of wavelength. (2) The unit of antioxidant anion activity (U/gprot) in the tissue (control OD value-measured OD value)/(control OD value-standard OD value) × standard concentration (0.15mg/mL) × 1000 mL/sample protein concentration to be tested (gprot/L).

Na⁺/K⁺The determination of (1): putting the overground and underground parts of the wild type and the transgenic plants into a cow leather bag, sealing, and placing the cow leather bag in a constant-temperature oven at 65 ℃ for drying for 3-5 days until the weight is constant; weighing 0.05g of the dried sample, fully grinding the dried sample in a mortar, putting the ground sample into a 10mL centrifuge tube, adding 2mL concentrated hydrochloric acid, and leaching for 3 days at room temperature; after the leaching is finished, sucking the supernatant into a new 10mL centrifuge tube, diluting with 4 times of double distilled water, and repeating 3 groups for each treatment; and (3) measuring sodium ions and potassium ions in the leaching liquor by using a flame photometer, wherein a sodium-potassium mixing standard curve needs to be configured during measurement, and the concentration of the potassium ions and the sodium ions in the mother liquor is 5 mg/mL.

TABLE 6 determination of MDA content

TABLE 7H₂O₂Content determination procedure

TABLE 8 anti-O^2-Activity measurement procedure

The growth state of the transgenic line and the wild type Arabidopsis seedlings before treatment is basically consistent, and the photosynthetic rate of each pot of Arabidopsis is basically consistent (A in figure 6). After 10 days of salt stress treatment, each group of treated seedlings shows wilting and yellowing phenomena of leaves at different degrees, when the salt concentration is 90mM, the yellowing phenomena of wild arabidopsis thaliana and transgenic arabidopsis thaliana are most obviously different, the difference of photosynthetic efficiency between the wild arabidopsis thaliana and the transgenic arabidopsis thaliana is also most obvious at the moment (B in figure 6), and the leaf growth state of the transgenic arabidopsis thaliana is obviously better than that of the wild arabidopsis thaliana. The photosynthetic efficiency (Fv/Fm) of the transgenic lines showed a clear upward trend compared to the wild type (C in FIG. 6); after measuring the chlorophyll of each line of arabidopsis thaliana after 10D of salt stress, it was found that the chlorophyll of both transgenic lines of arabidopsis thaliana was dark green and not much different (E in fig. 6), but the chlorophyll content was significantly higher than that of the wild-type arabidopsis thaliana that was yellow-green (D in fig. 6). The conductivity of the wild type strain (WT) was higher and about 1.5 times that of the transgenic strains (OE5 and OE8), indicating that the increase in membrane permeability of the transgenic strains was lower than that of the wild type after salt stress, i.e., the membrane damage of the transgenic strains was lower (F in FIG. 6); the content of the malondialdehyde of the transgenic line is found to be obviously reduced by measuring the content of the malondialdehyde, and is about one third of the malondialdehyde content of the wild line (G in figure 6), which indicates that the membrane lipid peroxidation degree of the transgenic arabidopsis thaliana is lower, the damage of the cell membrane under the salt stress is smaller, and the PbHSF3A transgenic line can be obtained by analysis to enhance the photosynthetic rate of the plant and improve the salt tolerance of the plant to a great extent.

3. Na after salt stress of transgenic plants⁺/K⁺Measurement of (2)

After the arabidopsis thaliana is subjected to salt stress for 10 days, the sodium ion content of the transgenic strains (OE5 and OE8) is in a significantly reduced trend compared with that of the wild type strain (WT), and the sodium ion content in the wild type arabidopsis thaliana is about 1.4 times of that of the transgenic strains (A in figure 7); in contrast, the potassium ion content of arabidopsis thaliana of both transgenic lines was increased compared to that of wild type arabidopsis thaliana, and the potassium ion content of transgenic arabidopsis thaliana was about 1.5 times that of wild type arabidopsis thaliana in terms of data (B in fig. 7); comparing the sodium and potassium ion content in arabidopsis thaliana after salt treatment, it can be found that the sodium and potassium ratio in transgenic arabidopsis thaliana is significantly lower than that in wild type arabidopsis thaliana (C in fig. 7). According to the experimental results, under the condition of salt stress, the PbHSF3A transgenic plant discharges excessive sodium ions in vivo in order to maintain the steady state of the potassium ion content in vivo, so that the salt tolerance of the plant is improved, and the normal growth of the plant is maintained as much as possible.

4. Reactive oxygen analysis of transgenic plants after salt stress

Diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining of PbHSF3A transgenic Arabidopsis was performed to express reactive oxygen species (H) after salt stress in plants₂O₂And O^2-) The rest of the situation. Since the content of active oxygen in plants is closely related to the oxidative stress of plants, the elimination of active oxygen in plants facilitates better growth.

After 30 days old over-expression PbHSF3A gene Arabidopsis thaliana (OE5 and OE8) and wild Arabidopsis thaliana are salt-stressed for 10 days, leaves with basically consistent size are selected and put into DAB (A in figure 8) and NBT (B in figure 8) dye liquor dissolved by phosphate buffer for decolorization. The experimental result shows that the color of the leaf of the Arabidopsis thaliana with the over-expression PbHSF3A gene is lighter than that of the leaf of the wild Arabidopsis thaliana; to verify the reliability of DAB and NBT staining results, we used a kit method to determine the hydrogen peroxide content and the anti-superoxide anion content in salt-treated 10d transgenic lines (OE5 and OE8) and wild-type (WT) Arabidopsis thaliana. The experimental results show that the hydrogen peroxide content of arabidopsis thaliana of the two transgenic lines is lower than that of wild type arabidopsis thaliana (C in fig. 8), and the content of superoxide anion is obviously higher than that of wild type treated seedlings (D in fig. 8). The experimental results show that under the condition of salt stress, the PbHSF3A transgenic arabidopsis thaliana can eliminate toxic oxides in vivo more timely than wild arabidopsis thaliana, so that the plant is less damaged by salt stress, and the salt tolerance of the plant is improved.

Example 6

Resistance identification and corresponding index determination under salt stress of PbHSF3A gene-silenced fructus Pyri

1. The preparation method of the birchleaf pear strain of the transient transformation transcription factor PbHSF3A comprises the following steps: the birchleaf pear (Pyrus ussuriensis) grown in a climatic chamber for about 5 weeks was selected for Agrobacterium infection.

(1) GV3101 Agrobacterium with the plasmid of interest was streaked on LB medium (50mg/L kanamycin +100mg/L rifampicin +50mg/L gentamicin), and Agrobacterium clones were selected and cultured overnight at 28 ℃ in 5mL LB medium.

(2) Determination of Agrobacterium liquid OD₆₀₀After the value, the mixture was centrifuged at 3000rpm for 10min to collect the bacterial liquid, and the supernatant was discarded. With acetosyringone solution [10mM MES (pH 5.6) +10mM MgCl₂+200uM acetosyringone]Suspending, adjusting to OD₆₀₀Standing at room temperature for 3 hr to obtain a solution of 0.8-1.0%.

(3) Agrobacterium containing the plasmid of interest was used for injection of leaves of Pyrus betulaefolia.

(4) Injecting the pear leaves by using a 1mL injector (the needle head is removed), selecting three leaves for injecting each birch seedling, and marking the injected leaves.

(5) And (4) putting the injected pear plants back to the artificial climate chamber for culturing after being protected from light for 2-3 days at room temperature, and observing the result of instantaneous transformation.

2. Resistance analysis of PbHSF3A gene under salt stress of dumpers

In order to further verify that the PbHSF3A gene has the function of positively regulating the growth of plants, a virus-induced gene silencing technology (VIGS) is adopted to inhibit the expression of PbHSF3A in the pyrus betulaefolia so as to weaken the salt tolerance of the plants.

Before salt stress, the growth state of each birch of birch pear seedlings is not obviously different through a fluorescent chlorophyll phenotype chart (A in figure 9); after 18d salt stress treatment, the growth status of the birch plantlets after silencing the PbHSF3A gene was significantly worse than the control group (WT), i.e., pTRV-PbHSF3A plants suffered more salt stress damage (B in fig. 9). The pTRV-PbHSF3A plants had slightly lower primary light energy conversion (Fv/Fm) compared to the control (WT) (C in fig. 9), and it was found by extracting chlorophyll from each treated birch seedling that the contents of pTRV-PbHSF3A plants (pTRV-1 and pTRV-2) were both lower than the chlorophyll content of WT (D in fig. 9), and that the chlorophyll of pTRV-PbHSF3A plants was noticeably yellow-green in color, while the control (WT) was dark green (E in fig. 9). As can be seen by measuring the conductivity of the birch seedlings after salt stress, the conductivity of the birch seedlings of pTRV-2 group was the highest, about 80%, that of the birch seedlings of pTRV-1 group was the next to that of the birch seedlings, while the conductivity of the birch seedlings treated by control group (WT) was the lowest, about 30% (F in fig. 9); it can be seen that under the condition of salt stress, the membrane permeability of the birch pear seedlings which silence the PbHSF3A gene is increased, and the plant is more seriously damaged. By measuring the malondialdehyde content of the birch-leaf pear seedlings treated after 18d of salt stress, it can be found that the malondialdehyde content of the two groups of pTRV-PbHSF3A plants is higher (G in figure 9), i.e. the plants after the PbHSF3A gene silencing are more sensitive to the salt stress environment and are more damaged than the wild type plants.

3. Na after PbHSF3A gene silencing salt stress of Chinese pear⁺/K⁺Measurement of (2)

And (3) determining the change of the sodium and potassium ion content in the pyrus betulaefolia after the PbHSF3A gene is silenced and is subjected to salt stress treatment for 18 d. The sodium ion content of the control (WT) group of the birch seedlings was the lowest, the pTRV-2 group was slightly higher, and the sodium ion content of the birch seedlings of the pTRV-1 group was the highest (A in FIG. 10); after 18d salt treatment, the content of potassium ions in the birch pear seedlings silenced by the PbHSF3A gene is in a descending trend, and the content of potassium ions in the birch pear seedlings in the pTRV-1 group is the lowest (B in a figure 10); as can be seen by comparing the ratio of sodium-potassium content in vivo of three groups of birch seedlings, the sodium-potassium ratio content of pTRV-PbHSF3A birch seedlings (pTRV-1 and pTRV-2) was significantly higher than that of the control (WT) plants (C in FIG. 10). The above experimental results show that the birch pear seedlings after the PbHSF3A gene is silenced are more sensitive to salt in the same salt stress environment and show lower salt tolerance compared with wild birch pear seedlings.

As can be seen from the above examples, the PbHSF3A gene provided by the invention is involved in the salt stress process of plant abiotic stress and plays an important positive regulation role.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Nanjing university of agriculture

<120> Du pear salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1662

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgagcccaa aagacaagag ccacccaaag tctccaccca cttcagctga attcgacccg 60

gaatcaattg ggttatcggg gttatcggaa tttcgactcg aagtgtcgga accgttactg 120

ggttctcagc cgattccttc gttcacttct cctgtaatgg aattcgaagc cttctcttct 180

gtaaacccat tgggtgcttt tgacttcact gaaaaagttt caattccaac gtcgtctatg 240

ggcggcggtg gtgcggagga cgtcgttgtt ccgccgcagc cactggaatg tctgcagggc 300

actctggtgc ctccatttct gtccaagact ttcgatttgg tcgaggaccc ctcgctggat 360

tcgatcatat cgtggggctc cggcggccgc agcttcgtgg tgtgggaccc atcggagttt 420

tccagattca tcttaccgag gaacttcaag cacaacaatt tctcaagttt tgtgcggcag 480

cttaatactt atattgtaag caaggttcag ttcttcatat gcatgaaagt tgatggcctc 540

acattgtctt ctggttttcg caaggttgac acagataagt gggagtttgc gaatgaagct 600

tttcagaagg gcaaaagaca tttgttgaag aggatccaga ggcgcaagtc acctcagtct 660

ctgcaagttg ggagctttac tgggccttct gcggaagcag ggaagtctgg agtcgaaggt 720

gagatagaga cattgcagaa agagaggagt atgttaatgc aggaggttgt tgaattgcag 780

cagcagcagc ggggcacagt tgaccgtatg aaggtagtga atcagaggct tcagtctgcg 840

gagcagagac agaagcagat ggtttctttc ttggccaaga tgcttcagaa cccggcattc 900

gtggcccgac ttcaacaaaa gactggacag aaagacagag gctcttcaag ggtgaggagg 960

aaatttgtta agcatcagca acatgaactc agtaagtcag attcagatat ggaaggccag 1020

attgtgaagt accagcctgc ttggagaaac caaatcatat cctctacagc gccggattca 1080

aatccagttc cttttgaaca atctcctcat tatccttcac aagttacgac aggaaaactg 1140

ggtttggatg ctgaaagcac ggcattccaa tttgtggacg ctgcactaga tgaattagca 1200

atcacacaag gatttcttca aacaccagag caagaaggcg aaggggcatc aagcatggta 1260

actgaagatc cttttttcaa agggaagagt gttctaagcc cacaacaaga ggctaatccc 1320

aagcattatg tctctttcga ggaagatttg ttgaaggaca ggacttttcc agaactgttt 1380

tctccaggga tggagagcat gattaaacaa gaagacatat ggagcatgga ttttgatatc 1440

agtgccggta tgtcaacttc tatgaatgag ttattgggta atccagtcaa ctatgatgtg 1500

ccagaggtgg gagtgaccgg tgaattgtta gatgtctggg atatcgatcc cctgcaagag 1560

gcaggagggt tgggaatcaa taagtggcca gcccatgaat ctgcatttga tgagcctcag 1620

agtcaaggtg tccagtctgc atctaaaact actgatccgt ag 1662

<210> 2

<211> 553

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Pro Lys Asp Lys Ser His Pro Lys Ser Pro Pro Thr Ser Ala

1 5 10 15

Glu Phe Asp Pro Glu Ser Ile Gly Leu Ser Gly Leu Ser Glu Phe Arg

20 25 30

Leu Glu Val Ser Glu Pro Leu Leu Gly Ser Gln Pro Ile Pro Ser Phe

35 40 45

Thr Ser Pro Val Met Glu Phe Glu Ala Phe Ser Ser Val Asn Pro Leu

50 55 60

Gly Ala Phe Asp Phe Thr Glu Lys Val Ser Ile Pro Thr Ser Ser Met

65 70 75 80

Gly Gly Gly Gly Ala Glu Asp Val Val Val Pro Pro Gln Pro Leu Glu

85 90 95

Cys Leu Gln Gly Thr Leu Val Pro Pro Phe Leu Ser Lys Thr Phe Asp

100 105 110

Leu Val Glu Asp Pro Ser Leu Asp Ser Ile Ile Ser Trp Gly Ser Gly

115 120 125

Gly Arg Ser Phe Val Val Trp Asp Pro Ser Glu Phe Ser Arg Phe Ile

130 135 140

Leu Pro Arg Asn Phe Lys His Asn Asn Phe Ser Ser Phe Val Arg Gln

145 150 155 160

Leu Asn Thr Tyr Ile Val Ser Lys Val Gln Phe Phe Ile Cys Met Lys

165 170 175

Val Asp Gly Leu Thr Leu Ser Ser Gly Phe Arg Lys Val Asp Thr Asp

180 185 190

Lys Trp Glu Phe Ala Asn Glu Ala Phe Gln Lys Gly Lys Arg His Leu

195 200 205

Leu Lys Arg Ile Gln Arg Arg Lys Ser Pro Gln Ser Leu Gln Val Gly

210 215 220

Ser Phe Thr Gly Pro Ser Ala Glu Ala Gly Lys Ser Gly Val Glu Gly

225 230 235 240

Glu Ile Glu Thr Leu Gln Lys Glu Arg Ser Met Leu Met Gln Glu Val

245 250 255

Val Glu Leu Gln Gln Gln Gln Arg Gly Thr Val Asp Arg Met Lys Val

260 265 270

Val Asn Gln Arg Leu Gln Ser Ala Glu Gln Arg Gln Lys Gln Met Val

275 280 285

Ser Phe Leu Ala Lys Met Leu Gln Asn Pro Ala Phe Val Ala Arg Leu

290 295 300

Gln Gln Lys Thr Gly Gln Lys Asp Arg Gly Ser Ser Arg Val Arg Arg

305 310 315 320

Lys Phe Val Lys His Gln Gln His Glu Leu Ser Lys Ser Asp Ser Asp

325 330 335

Met Glu Gly Gln Ile Val Lys Tyr Gln Pro Ala Trp Arg Asn Gln Ile

340 345 350

Ile Ser Ser Thr Ala Pro Asp Ser Asn Pro Val Pro Phe Glu Gln Ser

355 360 365

Pro His Tyr Pro Ser Gln Val Thr Thr Gly Lys Leu Gly Leu Asp Ala

370 375 380

Glu Ser Thr Ala Phe Gln Phe Val Asp Ala Ala Leu Asp Glu Leu Ala

385 390 395 400

Ile Thr Gln Gly Phe Leu Gln Thr Pro Glu Gln Glu Gly Glu Gly Ala

405 410 415

Ser Ser Met Val Thr Glu Asp Pro Phe Phe Lys Gly Lys Ser Val Leu

420 425 430

Ser Pro Gln Gln Glu Ala Asn Pro Lys His Tyr Val Ser Phe Glu Glu

435 440 445

Asp Leu Leu Lys Asp Arg Thr Phe Pro Glu Leu Phe Ser Pro Gly Met

450 455 460

Glu Ser Met Ile Lys Gln Glu Asp Ile Trp Ser Met Asp Phe Asp Ile

465 470 475 480

Ser Ala Gly Met Ser Thr Ser Met Asn Glu Leu Leu Gly Asn Pro Val

485 490 495

Asn Tyr Asp Val Pro Glu Val Gly Val Thr Gly Glu Leu Leu Asp Val

500 505 510

Trp Asp Ile Asp Pro Leu Gln Glu Ala Gly Gly Leu Gly Ile Asn Lys

515 520 525

Trp Pro Ala His Glu Ser Ala Phe Asp Glu Pro Gln Ser Gln Gly Val

530 535 540

Gln Ser Ala Ser Lys Thr Thr Asp Pro

545 550