Application of binding site of serum inducible gene and Actin

文档序号：1827178 发布日期：2021-11-12 浏览：6次中文

阅读说明：本技术 血清诱导型基因与Actin的结合位点的应用 (Application of binding site of serum inducible gene and Actin ) 是由畅磊杨楠王秀秀纪敏涛于 2021-08-16 设计创作，主要内容包括：本发明公开了血清诱导型基因Kindlin-2与Actin的结合位点在制备抗肿瘤细胞药物中的应用,结合位点如SEQIDNO.1所示,将该位点进行突变,显著抑制了肿瘤细胞的增殖,并促进了肿瘤细胞的凋亡,为临床上癌症的治疗提供了生物治疗基础。(The invention discloses application of a binding site of a serum-induced gene Kindlin-2 and Actin in preparation of an anti-tumor cell medicament, wherein the binding site is shown as SEQ ID NO.1, and the site is mutated, so that proliferation of tumor cells is obviously inhibited, apoptosis of the tumor cells is promoted, and a biological treatment basis is provided for clinical treatment of cancers.)

1. The application of the binding site of the serum inducible gene Kindlin-2 and Actin in preparing an anti-tumor medicament is characterized in that the base sequence of the binding site is as follows: CGGTTCAGCAACATGAAGCAGTGGAATGTCAACTGGGAGATCAAGATGGTCACTGTAGAGTTTGCAGATGAGGTCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGA, as shown in SEQ ID NO. 1.

2. The application of the binding site of the serum-inducible gene Kindlin-2 and Actin in preparing an anti-tumor drug as claimed in claim 1, wherein mutation of the binding site of the serum-inducible gene Kindlin-2 and Actin can destroy the binding of the serum-inducible gene Kindlin-2 and Actin, thereby inhibiting the invasion capacity of tumor cells.

3. The use of the binding site of the serum-inducible gene Kindlin-2 and Actin in the preparation of anti-tumor drugs as claimed in claim 1, wherein the mutation of the binding site of the serum-inducible gene Kindlin-2 and Actin can inhibit the proliferation of tumor cells.

4. The use of the binding site of the serum-inducible gene Kindlin-2 and Actin in the preparation of anti-tumor drugs as claimed in claim 1, wherein the mutation of the binding site of the serum-inducible gene Kindlin-2 and Actin can promote the apoptosis of tumor cells.

Technical Field

The invention relates to the technical field of genetic engineering and biological medicine, in particular to application of a binding site of Kindlin-2 and Actin in preparing a medicament for resisting tumor cells.

Background

Tumors are composed not only of tumor cells, but also of a complex "ecosystem" of many different types of cells and non-cytokines. The tumor stroma is an important component of the tumor microenvironment and plays a crucial role in the development, progression and metastasis of tumors. On the global scale, tumors have become the second leading cause of death, and the incidence and mortality of tumors worldwide are increasing every year. Although research on the treatment of tumors including surgery, radiotherapy and chemotherapy has been advanced, there are still many problems in improving the prognosis of patients with tumors. Accordingly, a scheme of targeted therapy is proposed, and the targeted therapy of tumors is a link leading to malignant transformation of cells, and a brand new biological therapy mode that certain antibodies, ligands and the like capable of being specifically combined with target molecules are used for reversing the malignant biological behavior at a molecular level so as to inhibit the growth of tumor cells and even completely eliminate the malignant biological behavior is an important means for the hot spot of current clinical research and the clinical therapy of tumors.

Kindlin-2 is a novel serum inducible gene that was screened by Wick et al in 1994. Kindlin-2 belongs to the Kindlin family, a class of focal adhesion proteins, which are cytoskeletal proteins. Kindlin-2 can maintain cell-cell junction and cytoskeleton structure, can be combined with integrin, integrin-linked kinase, ankyrin, migfilin, paxillin and the like in cells, and influences proliferation, adhesion, migration, differentiation of cells, participates in activation of integrin and the like. In malignant tumors such as liver cancer, breast cancer, esophageal cancer, prostate cancer and the like, the expression of Kindlin-2 in genes and protein levels is increased, and Kindlin-2 can influence the invasiveness and drug resistance of tumor cells.

Cell metabolism is strongly influenced by the stress environment, and studies have shown that hardening of Extracellular matrix (ECM) promotes translocation of Kindlin-2 to mitochondria and interaction with PYCR1, resulting in elevated levels of PYCR1, increased proline synthesis and cell proliferation. Tumor cells are mostly in a hypermetabolic environment and are often in a higher mechanical environment, and therefore, high expression of Kindlin-2 may affect proliferation of tumor cells. Kindlin-2 can interact with F-actin and induce actin aggregation, which can affect integrin internal-external signaling, suggesting that Kindlin-2 can modulate cellular responses. In combination with the above findings, it was concluded that the interaction of Kindlin-2 with Actin affects the biological function of tumor cells, and that this effect is present at specific binding sites.

Therefore, finding and mutating the binding site of Kindlin-2 and Actin accurately, and applying the binding site to antitumor therapy is a problem to be solved by those skilled in the art.

Disclosure of Invention

In view of the above, the invention accurately finds out the binding site of the targeting Kindlin-2 and Actin, and applies the binding site after mutation, thereby obviously inhibiting the proliferation and invasion capacity of tumor cells.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application of the binding site of the serum inducible gene Kindlin-2 and Actin in preparing anti-tumor cell medicines is characterized in that the sequence of the binding site is as follows:

CGGTTCAGCAACATGAAGCAGTGGAATGTCAACTGGGAGATCAAGATGGTCACTGTAGAGTTTGCAGATGAGGTCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGA, as shown in SEQ ID NO. 1.

As a preferred technical scheme, mutation of the binding site of the serum inducible gene Kindlin-2 and Actin can destroy the binding of Kindlin-2 and Actin, thereby inhibiting the invasion capacity of tumor cells.

As a preferred technical scheme of the invention, the mutation of the binding site of the serum inducible gene Kindlin-2 and Actin can inhibit the proliferation of tumor cells.

As a preferred technical scheme of the invention, the mutation of the binding site of the serum inducible gene Kindlin-2 and Actin can promote the apoptosis of tumor cells

According to the technical scheme, compared with the prior art, the plasmid with the mutation binding site is constructed, the plasmid is provided with the red fusion protein, the plasmid is used for transfecting cells, the transfection efficiency can be determined by observing red fluorescence, and the co-localization of Kindlin-2 and Actin can be visually observed. The plasmid derived by the invention can be highly expressed in cells in a short period, shows obvious biological effect, and obviously inhibits the growth and survival of tumor cells after the gene is expressed.

The invention creatively predicts the structure of Kindlin-2 by computer molecular simulation calculation, predicts the most probable key site by analyzing salt bridges, chemical bonds and the like between the Kindlin-2 and Actin, and mutates the site, thereby obviously inhibiting the proliferation of tumor cells, promoting the apoptosis of the tumor cells and providing a biological treatment basis for the clinical treatment of cancers.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a diagram showing the co-immunoprecipitation results before and after mutation of binding site of Kindlin-2 and Actin provided by the invention;

FIG. 2 is a diagram showing the results of immunofluorescence experiments before and after mutation of binding sites of Kindlin-2 and Actin according to the present invention;

FIG. 3 is a diagram showing the tumor cell proliferation potency before and after mutation of binding site of Kindlin-2 and Actin provided by the present invention;

FIG. 4 is a diagram showing the tumor cell proliferation potency before and after mutation of binding site of Kindlin-2 and Actin provided by the present invention;

FIG. 5 is a diagram showing the tumor cell proliferation potency before and after mutation of binding site of Kindlin-2 and Actin provided by the present invention;

FIG. 6 is a diagram showing the tumor cell invasion competence before and after mutation of binding site of Kindlin-2 and Actin provided by the present invention;

FIG. 7 is a diagram showing tumor cell invasion competence before and after mutation of binding site of Kindlin-2 and Actin provided by the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention provides application of a binding site of Kindlin-2 and Actin in preparing anti-tumor cells.

Example 1

Obtaining a complete and accurate Kindlin-2 sequence from NCBI, finding key sites according to the result of early computer molecular simulation, carrying out fragment deletion on the key sites, obtaining the DNA fragments of Kindlin-2 full length and Kindlin-2 mutant by PCR technology, matching the sequencing results, and respectively constructing expression vectors of Kindlin-2-WT (K2) and Kindlin-2-mutation (K2M) by molecular cloning technology.

The full-length sequence of Kindlin-2 is as follows: ATGGCTCTGGACGGGATAAGGATGCCAGATGGCTGCTACGCGGACGGGACGTGGGAACTGAGCGTCCATGTCACGGACCTGAACCGTGATGTCACTCTGAGAGTGACCGGGGAGGTGCACATCGGAGGGGTGATGCTGAAGTTGGTGGAAAAACTCGATGTCAAAAAAGATTGGTCGGACCATGCTCTCTGGTGGGAAAAGAAGAGGACTTGGCTGCTTAAGACACACTGGACCTTGGATAAGTGTGGCATCCAGGCAGATGCCAAGCTCCAGTTCACCCCGCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAACTTCTCTGACCGAGTCTTCAAGGCTGTGTCTGACATCTGCAAGACTTTCAATATAAGACACCCTGAAGAACTTTCTCTCTTAAAAAAACCCAGAGATCCCACAAAGAAAAAAAAGAAAAAGCTAGATGACCAGTCTGAAGACGAAGCGCTTGAGCTGGAAGGACCTCTTATCATGCCTGGATCAGGCACCGATGTTCTTTACATTGGCCCTCTGAAAGGAAGCATATATTCAAGCCCGGGACTTTATAGTAAAACAATGACCCCTACTTACGACGCTCATGATGGAAGCCCTTTGTCACCAACTTCTGCCTGGTTTGGTGACAGTGCCCTGTCAGAAGGCAATCCTGGGATACTTGCTGTCAGTCAGCCAGTAACATCACCAGAAATACTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAACCAACCAAGGGTGGCTAGATTCCTCAAGATCTCTCATGGAGCAAGATGTGAAGGAGAACGAGGCCTTGCTGCTCCGATTCAAGTACTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCCATCAGAATCAATCAGCTTTACGAGCAGGCCAAGTGGGCTCTTCTCCTAGAAGAGATCGAATGCACGGAAGAAGAGATGATGATGTTCGCAGCCTTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAAAATCATTTAAACAACAGTGACAAAGAAGTTGATGAAGTTGACGCTGCCCTTTCTGACCTGGAGATCACTTTGGAAGGCGGGAAAACATCAACAATTCTGGGTGACATTACTTCAATCCCAGAACTTGCTGACTATATTAAAGTTTTCAAGCCGAAGAAGCTGACTTTAAAGGGGTACAAGCAGTACTGGTGCACTTTCAAAGACACGTCCATCTCCTGCTACAAGAGCCGAGAAGAGTCCAGTGGTACACCTGCTCATCAGCTGAACCTCAGAGGATGTGAAGTTACTCCGGATGTAAACATTTCAGGCCAGAAATTTAACATAAAACTCCTAATTCCGGTAGCAGAGGGCATGAATGAGATCTGGCTTCGCTGTGATAACGAGAAGCAGTACGCGCACTGGATGGCAGCTTGCAGGTTAGCCTCCAAAGGCAAGACCATGGCAGACAGTTCTTACAACCTGGAAGTTCAGAACATTCTTTCCTTCCTGAAAATGCAGCATCTGAACCCAGACCCCCAGCTGATCCCTGACCAGATCACAACCGACGTCAACCCCGAGTGTCTGGTGTCCCCGCGGTACCTGAAGAAGTATAAGAGCAAACAGATAACAGCACGGATCTTGGAGGCCCATCAAAATGTAGCCCAGATGAGCCTGATTGAAGCCAAGATGAGATTCATTCAAGCCTGGCAGTCTCTGCCTGAGTTCGGCATCACACACTTCATTGCGAGGTTTCAAGGCGGCAAGAGAGAAGAACTTATTGGAATTGCATACAACAGGTTGATTCGGATGGACGCCAGCACAGGTGACGCCATCAAAACCTGGCGGTTCAGCAACATGAAGCAGTGGAATGTCAACTGGGAGATCAAGATGGTCACTGTAGAGTTTGCAGATGAGGTCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGA, respectively; as shown in SEQ ID NO. 2;

the sequence of the Kindlin-2 mutant with the amino acid deletion at position 608-680 is as follows: ATGGCTCTGGACGGGATAAGGATGCCAGATGGCTGCTACGCGGACGGGACGTGGGAACTGAGCGTCCATGTCACGGACCTGAACCGTGATGTCACTCTGAGAGTGACCGGGGAGGTGCACATCGGAGGGGTGATGCTGAAGTTGGTGGAAAAACTCGATGTCAAAAAAGATTGGTCGGACCATGCTCTCTGGTGGGAAAAGAAGAGGACTTGGCTGCTTAAGACACACTGGACCTTGGATAAGTGTGGCATCCAGGCAGATGCCAAGCTCCAGTTCACCCCGCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAACTTCTCTGACCGAGTCTTCAAGGCTGTGTCTGACATCTGCAAGACTTTCAATATAAGACACCCTGAAGAACTTTCTCTCTTAAAAAAACCCAGAGATCCCACAAAGAAAAAAAAGAAAAAGCTAGATGACCAGTCTGAAGACGAAGCGCTTGAGCTGGAAGGACCTCTTATCATGCCTGGATCAGGAAGCATATATTCAAGCCCGGGACTTTATAGTAAAACAATGACCCCTACTTACGACGCTCATGATGGAAGCCCTTTGTCACCAACTTCTGCCTGGTTTGGTGACAGTGCCCTGTCAGAAGGCAATCCTGGGATACTTGCTGTCAGTCAGCCAGTAACATCACCAGAAATACTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAACCAACCAAGGGTGGCTAGATTCCTCAAGATCTCTCATGGAGCAAGATGTGAAGGAGAACGAGGCCTTGCTGCTCCGATTCAAGTACTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCCATCAGAATCAATCAGCTTTACGAGCAGGCCAAGTGGGCTCTTCTCCTAGAAGAGATCGAATGCACGGAAGAAGAGATGATGATGTTCGCAGCCTTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAAAATCATTTAAACAACAGTGACAAAGAAGTTGATGAAGTTGACGCTGCCCTTTCTGACCTGGAGATCACTTTGGAAGGCGGGAAAACATCAACAATTCTGGGTGACATTACTTCAATCCCAGAACTTGCTGACTATATTAAAGTTTTCAAGCCGAAGAAGCTGACTTTAAAGGGGTACAAGCAGTACTGGTGCACTTTCAAAGACACGTCCATCTCCTGCTACAAGAGCCGAGAAGAGTCCAGTGGTACACCTGCTCATCAGCTGAACCTCAGAGGATGTGAAGTTACTCCGGATGTAAACATTTCAGGCCAGAAATTTAACATAAAACTCCTAATTCCGGTAGCAGAGGGCATGAATGAGATCTGGCTTCGCTGTGATAACGAGAAGCAGTACGCGCACTGGATGGCAGCTTGCAGGTTAGCCTCCAAAGGCAAGACCATGGCAGACAGTTCTTACAACCTGGAAGTTCAGAACATTCTTTCCTTCCTGAAAATGCAGCATCTGAACCCAGACCCCCAGCTGATCCCTGACCAGATCACAACCGACGTCAACCCCGAGTGTCTGGTGTCCCCGCGGTACCTGAAGAAGTATAAGAGCAAACAGATAACAGCACGGATCTTGGAGGCCCATCAAAATGTAGCCCAGATGAGCCTGATTGAAGCCAAGATGAGATTCATTCAAGCCTGGCAGTCTCTGCCTGAGTTCGGCATCACACACTTCATTGCGAGGTTTCAAGGCGGCAAGAGAGAAGAACTTATTGGAATTGCATACAACAGGTTGATTCGGATGGACGCCAGCACAGGTGACGCCATCAAAACCTGG, respectively; shown as SEQ ID NO. 3.

Cell culture

(1) Cell culture conditions: hela cells were cultured in DMEM medium containing 10% FBS and 1% penicillin and streptomycin. HCT116 cells were cultured in McCoy's 5A medium containing 10% FBS and 1% penicillin and streptomycin. All cells were incubated at 37 ℃ with 5% volume fraction CO₂The culture is performed in the sterile culture environment of (1).

(2) Cell liquid change: preheating the culture medium and PBS to room temperature, placing the culture dish in a super clean bench, discarding the original culture medium, adding 2ml of PBS, slightly shaking the culture dish, discarding PBS for cleaning once, adding 8ml of fresh culture medium into the culture dish with the diameter of 100mm, and placing the culture dish into an incubator for continuous culture. Each cell was individually replaced to avoid cross-contamination between cells.

(3) Cell passage: when the cell fusion degree is 80% -90%, preheating the culture medium, PBS and pancreatin to room temperature, discarding the original culture medium, adding 2ml of PBS to wash once, adding 1ml of 0.05% pancreatin, slightly shaking the culture dish to uniformly cover pancreatin to all cells, digesting at room temperature until the cells show round white bright spots, and adding 2ml of culture medium to stop digestion. Placing into a low-speed centrifuge, centrifuging at 1000rpm/min for 3min, discarding supernatant, adding 3ml of fresh culture medium to resuspend cells, subculturing according to the proportion of 1:4, and placing into an incubator for culturing. Each cell was passaged individually to avoid cross-contamination between cells.

(4) Cell recovery: preheat the water bath to 37 ℃ and medium to room temperature. The frozen cells were taken out of the freezer at-80 ℃ and quickly placed in a water bath and shaken quickly until thawed. Fresh medium was added, blown up and mixed well before being inoculated into a 60mm diameter petri dish containing 4ml of fresh medium. Mixing, and culturing in incubator.

(5) Freezing and storing cells: collecting the digested cells, centrifuging at 1000rpm/min for 3min, discarding the supernatant, resuspending the cells by using a pre-prepared mixed solution containing 50% FBS, 40% fresh medium and 10% DMSO, uniformly mixing, adding the mixture into a cryopreservation tube, marking the cryopreservation date, the cell name and the cell number on the cryopreservation tube, freezing the cells in a refrigerator at-80 ℃, and transferring the cells to a liquid nitrogen tank for long-term storage within one week.

(6) Cell counting: and taking a proper amount of digested and resuspended cells to a blood counting chamber, counting under a microscope, and calculating the number of the cells per milliliter.

Plasmid transfection

The cells with a degree of fusion of 80% were digested from Hela/HCT116 cells in logarithmic growth phase, and the digestion was stopped by adding 2ml of double antibody-free medium. Taking a culture dish with the diameter of 60mm as an example, the cells are inoculated until the density is about 30-40%, and after the cells are attached to the wall, transfection is carried out. The transfection method comprises the following steps: firstly, respectively taking 250ul of Opti-MEM into two 1.5ml centrifuge tubes; adding 9ul of PEI (PEI) transfection reagent and Opti-MEM into one tube to mix into a transfection compound A solution, and standing for 5 minutes at room temperature; thirdly, adding 3ug of plasmid and Opti-MEM into the other tube to mix into a transfection compound B solution, fully mixing with the A solution, and standing for 15 minutes at room temperature; adding the mixed solution into a culture dish; fifthly, putting the culture dish into an incubator for culturing for 24 hours, discarding the culture medium containing the transfection compound, and replacing with a normal fresh culture medium containing the double antibody to continue culturing cells. The culture dish/plate with different specifications is multiplied or reduced by the dosage of the plasmid and the transfection reagent Pei according to the area of the culture dish/plate.

Construction of overexpression vectors

The vector PCS2(+) is subjected to enzyme digestion by using restriction enzymes BamH I/Xho I to obtain a linearized vector. PCR amplification is carried out to prepare a target gene fragment K2/K2M, so that the sequences of the extreme ends of the 5 'and 3' of the amplification product are completely consistent. Wherein the primer sequences are as follows:

K2-F: 5' -TATGGATCCCGAGCTCGAATGGACTACAAGGACGACGACGACGACAAGATGGCTCTGGACGGGATA AGGATG as shown in SEQ ID NO. 3;

K2-R: 5' -TATCTCGAGGTCGACTCACACCCAACCACTGGTGAGTTTG as shown in SEQ ID NO. 4;

K2M-F: 5' -TATGGATCCCGAGCTCGAATGGACTACAAGGACGACGACGAC as shown in SEQ ID NO. 5;

K2M-R is 5' -TATCTCGAGGTCGACTTACCAGGTTTTGATGGCGTCACC as shown in SEQ ID NO. 6;

and preparing a reaction system by using the linearized vector and the target gene amplification product, and performing recombination reaction to realize in-vitro cyclization of the linearized vector and the target gene fragment. Directly transferring the recombinant product into competent bacteria, then picking single clone on a plate for enzyme digestion identification, and sequencing and analyzing results of positive clones. And performing amplification culture on the correct clone bacterial liquid, and extracting by using a Tiangen endotoxin-free large-extraction kit to obtain a high-purity plasmid K2/K2M for plasmid transfection of the next experiment.

Example 2

To confirm that Kindlin-2 and Actin can interact and that the mutation sites found can affect the interaction between the two, the following experiments were undertaken:

the verification is carried out by adopting a Co-IP (Co-immunoprecipitation) method, and the embodiment is as follows:

firstly, taking 20ul Protein-G/A Beads, washing the Beads in a low-adsorption 1.5ml centrifuge tube twice by PBS, and then washing the Beads once by Lysisbuffer;

adding Anti-Flag 2ul, 10% BSA 10ul and lysine buffer 18ul, mixing uniformly, and incubating magnetic beads on a silent mixer overnight;

thirdly, adding the extracted protein sample into a centrifugal tube containing magnetic beads, and putting the centrifugal tube into a silent mixer for mixing and incubating for 4 hours;

placing the centrifuge tube on a magnetic frame, removing the protein antibody mixed solution in the centrifuge tube after the magnetic beads are completely adsorbed, washing for three times by using a lysine buffer, adding 1Xloadingbuffer40ul diluted by the lysine buffer, and heating for 5 minutes at 95 ℃;

verifying by a western blot method; the results are shown in FIG. 1; demonstrates that Kindlin2-WT and Actin can bind to each other, and that the present invention can disrupt the binding;

in order to verify the interaction and co-localization of Kindlin-2 and Actin, the effect of mutation site inhibition provided by the invention is verified by adopting an immunofluorescence experiment method. The specific implementation of the scheme is as follows: sheet climbing: placing an appropriate number of slides in a 12-well plate; ② sample preparation: after the Hela cells in the logarithmic growth phase are digested, inoculating the Hela cells to a pore plate according to the density of 30% of each pore, and culturing for 24 hours in an incubator by using a culture medium without double antibodies; ③ transfection: after the cells adhere to the wall, the cells are treated according to a plasmid transfection method; fourthly, discarding the old culture medium 24 hours after transfection, and continuously culturing for 24 hours by using the complete culture medium; taking the pore plate out of the incubator, removing the culture medium, washing with PBS for three times, fixing with 4% paraformaldehyde for 10min, removing, and washing with PBS for three times; sixthly, carrying out PBST treatment for 10 minutes by 0.5 percent to rupture a membrane and punch holes, and then washing by PBS for three times; seventhly, blocking for 1 hour by using 10 percent BSA; incubation with primary antibody prepared from 2% BSA at 4 deg.C overnight; ninthly, washing the PBST by 0.1% for three times, and incubating for 1.5h by using a fluorescent secondary antibody configured by 2% BSA; three times of PBST (0.1 percent of red, blue) and three times of PBST (0.1 percent of red, blue.

As a result, see FIG. 2, it can be seen that Kindlin2-WT was co-localized with Actin, and the mutation site of the present invention greatly reduced co-localization.

Cellular biological Effect

The cell biological effect experiment is carried out by adopting Hela and HCT116 cells, the cells are transfected by over-expressed K2/K2M, the experiment groups are Con, OEK2 and OEK2M, and the process is as follows:

(1) CCK-8 experiment: 48h after transfection, cells were digested in the logarithmic growth phase according to Hela cells 1X10³The density of each well was inoculated in 96-well plates, 100ul of medium per well. 100ul PBS is added into each hole on the periphery of the 96-hole plate to prevent the excessive volatilization from influencing the cell growth, and the 96-hole plate is placed into an incubator for culture after being slightly shaken. And after 24 hours, taking out the 96-well plate, removing the original culture medium, adding 10ul of CCK-8 reagent and 100ul of culture medium into each well, putting the well into an incubator, incubating the well in the incubator for 30min, 1 hour, 2 hours and 3 hours respectively, and detecting the absorbance values of each well at 450nm and 630nm by using an enzyme-labeling instrument. Relative cell viability ═ a treatment/450-a treatment/630)/(a control/450-a control/630). Wherein 450nm is the maximum absorption wavelength of the CCK-8 reagent, and 630nm is the minimum absorption wavelength of the CCK-8 reagent; the results are shown in FIG. 3; as can be seen from FIG. 3, Kindlin2-WT promoted tumor cell proliferation to some extent, while Kindlin2-M inhibited tumor cell proliferation. Indicating that the binding site is effective in inhibiting the proliferation of tumor cells.

(2) Cell proliferation assay: after 48 hours of transfection, cells in the logarithmic growth phase were digested and seeded in 6-well plates at a density of 200 HeLa cells/well in 2ml of medium per well. Culturing in incubator, taking out the pore plate after 14 days, removing the culture medium, washing with PBS for three times, fixing the cells with 70% ethanol for 10-15min, removing ethanol, further dyeing with crystal violet for 15-20min, removing crystal violet, washing the pore plate with running water until no purple appears, reversing the pore plate, and drying at room temperature. Counting the number of cell colonies, wherein the cell proliferation ratio is the number of colored cell colonies/200; the results are shown in fig. 4 and fig. 5, which demonstrate that the binding site can effectively inhibit the proliferation ability of cells and the growth of tumor cells.

(3) Cell migration assay: digesting the cells in logarithmic phase, inoculating the cells into a 12-well plate according to the density of 30% of each well, placing 1ml of a culture medium without double antibody in each well, culturing the cells in an incubator for 24 hours, discarding the old culture medium, respectively treating the cells according to a plasmid transfection method, transfecting the cells for 24 hours, discarding the old culture medium, adding 1ml of the culture medium containing 1% FBS in each well, starving the culture medium for 24 hours, drawing a straight cell-free area at the bottom of the 12-well plate by using a 200ul gun head, shooting the scratched area by using a microscope, shooting 4 visual fields in each well, and placing the cells in the incubator for continuous culture. Cells were photographed every 24h and replaced until the cell scratch area was nearly healed. The width of the scratched area was counted using ImageJ. Cell mobility (%) — (scratch width at different time points-initial scratch width)/initial scratch width × 100%; the results are shown in FIGS. 6 and 7, and the mutations at the surface binding sites show significant growth inhibition and the invasive potential is also significantly affected.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Suzhou university

<120> application of binding site of serum inducible gene and Actin

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 222

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cggttcagca acatgaagca gtggaatgtc aactgggaga tcaagatggt cactgtagag 60

tttgcagatg aggtccggtt gtccttcatc tgtaccgaag tagactgcaa ggtggtccac 120

gaattcattg gtggttacat atttctctca actcgtgcga aagaccaaaa tgaaagttta 180

gatgaggaga tgttctacaa actcaccagt ggttgggtgt ga 222

<210> 2

<211> 2076

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggctctgg acgggataag gatgccagat ggctgctacg cggacgggac gtgggaactg 60

agcgtccatg tcacggacct gaaccgtgat gtcactctga gagtgaccgg ggaggtgcac 120

atcggagggg tgatgctgaa gttggtggaa aaactcgatg tcaaaaaaga ttggtcggac 180

catgctctct ggtgggaaaa gaagaggact tggctgctta agacacactg gaccttggat 240

aagtgtggca tccaggcaga tgccaagctc cagttcaccc cgcagcacaa actgctccgc 300

ctgcagcttc ccaacatgaa gtatgtgaag gtgaaagtga acttctctga ccgagtcttc 360

aaggctgtgt ctgacatctg caagactttc aatataagac accctgaaga actttctctc 420

ttaaaaaaac ccagagatcc cacaaagaaa aaaaagaaaa agctagatga ccagtctgaa 480

gacgaagcgc ttgagctgga aggacctctt atcatgcctg gatcaggcac cgatgttctt 540

tacattggcc ctctgaaagg aagcatatat tcaagcccgg gactttatag taaaacaatg 600

acccctactt acgacgctca tgatggaagc cctttgtcac caacttctgc ctggtttggt 660

gacagtgccc tgtcagaagg caatcctggg atacttgctg tcagtcagcc agtaacatca 720

ccagaaatac tggcaaaaat gttcaagcct caagctcttc ttgataaagc aaaaaccaac 780

caagggtggc tagattcctc aagatctctc atggagcaag atgtgaagga gaacgaggcc 840

ttgctgctcc gattcaagta ctacagcttt tttgatttga atccaaagta tgatgccatc 900

agaatcaatc agctttacga gcaggccaag tgggctcttc tcctagaaga gatcgaatgc 960

acggaagaag agatgatgat gttcgcagcc ttgcagtatc atatcaataa gctgtcaatc 1020

atgacatcag aaaatcattt aaacaacagt gacaaagaag ttgatgaagt tgacgctgcc 1080

ctttctgacc tggagatcac tttggaaggc gggaaaacat caacaattct gggtgacatt 1140

acttcaatcc cagaacttgc tgactatatt aaagttttca agccgaagaa gctgacttta 1200

aaggggtaca agcagtactg gtgcactttc aaagacacgt ccatctcctg ctacaagagc 1260

cgagaagagt ccagtggtac acctgctcat cagctgaacc tcagaggatg tgaagttact 1320

ccggatgtaa acatttcagg ccagaaattt aacataaaac tcctaattcc ggtagcagag 1380

ggcatgaatg agatctggct tcgctgtgat aacgagaagc agtacgcgca ctggatggca 1440

gcttgcaggt tagcctccaa aggcaagacc atggcagaca gttcttacaa cctggaagtt 1500

cagaacattc tttccttcct gaaaatgcag catctgaacc cagaccccca gctgatccct 1560

gaccagatca caaccgacgt caaccccgag tgtctggtgt ccccgcggta cctgaagaag 1620

tataagagca aacagataac agcacggatc ttggaggccc atcaaaatgt agcccagatg 1680

agcctgattg aagccaagat gagattcatt caagcctggc agtctctgcc tgagttcggc 1740

atcacacact tcattgcgag gtttcaaggc ggcaagagag aagaacttat tggaattgca 1800

tacaacaggt tgattcggat ggacgccagc acaggtgacg ccatcaaaac ctggcggttc 1860

agcaacatga agcagtggaa tgtcaactgg gagatcaaga tggtcactgt agagtttgca 1920

gatgaggtcc ggttgtcctt catctgtacc gaagtagact gcaaggtggt ccacgaattc 1980

attggtggtt acatatttct ctcaactcgt gcgaaagacc aaaatgaaag tttagatgag 2040

gagatgttct acaaactcac cagtggttgg gtgtga 2076

<210> 3

<211> 1821

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3