Vortex mixer and related methods, systems, and apparatus

文档序号：1894312 发布日期：2021-11-26 浏览：25次中文

阅读说明：本技术 涡流混合器及其相关方法、系统和装置 (Vortex mixer and related methods, systems, and apparatus ) 是由 S·柯比 B·格尔德霍夫 K·维克 B·斯金纳于 2020-01-31 设计创作，主要内容包括：一种涡流混合器(400)可具有涡流混合室(450),所述涡流混合室(450)具有第一壁(451)、第二壁(452)以及连接所述第一壁和所述第二壁的侧壁(453)。至少两个入口端口(405、410、415、520)可沿所述侧壁配置,每个入口端口具有与其连接的入口通道。所述至少两个入口端口可围绕所述涡流混合室大致等距间隔开,并与所述涡流混合室切向配置。出口端口(455)可具有与其连接的出口通道。所述出口端口可配置在所述第二壁的径向中心处,且所述出口通道可从所述出口端口并远离所述涡流混合室延伸。(A vortex mixer (400) may have a vortex mixing chamber (450), the vortex mixing chamber (450) having a first wall (451), a second wall (452), and a sidewall (453) connecting the first wall and the second wall. At least two inlet ports (405, 410, 415, 520) may be configured along the sidewall, each inlet port having an inlet channel connected thereto. The at least two inlet ports may be substantially equally spaced around the vortex mixing chamber and arranged tangentially to the vortex mixing chamber. The outlet port (455) may have an outlet channel connected thereto. The outlet port may be disposed at a radial center of the second wall, and the outlet passage may extend from the outlet port and away from the vortex mixing chamber.)

1. A vortex mixer, comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

at least two inlet ports disposed along the sidewall, each inlet port having an inlet passage connected thereto, the at least two inlet ports being substantially equally spaced about the vortex mixing chamber and disposed tangentially to the vortex mixing chamber; and

an outlet port having an outlet passage connected thereto, the outlet port being disposed substantially at a radial center of the second wall, the outlet passage extending from the outlet port and away from the vortex mixing chamber.

2. The vortex mixer of claim 1, wherein the vortex mixing chamber is circular and the sidewall extends around a circumference of the first wall and the second wall.

3. The vortex mixer of claim 1 wherein each inlet channel receives fluid from a single source.

4. The vortex mixer of claim 1 wherein each inlet channel receives fluid from a different source.

5. The vortex mixer of claim 1 wherein the vortex mixer has four inlet ports.

6. The vortex mixer of claim 5 wherein a first two of the four inlet ports receive fluid from a first source and a second two of the four inlet ports receive fluid from a second source.

7. The vortex mixer of claim 6, wherein the first two inlet ports are configured opposite each other and the second two inlet ports are configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart and each of the first two inlet ports is about 90 degrees from each of the second two inlet ports.

8. The vortex mixer of claim 5 wherein each of the four inlet ports receives fluid from a separate source.

9. The vortex mixer of claim 8, wherein a first two of the four inlet ports receive a first fluid and a second two of the four inlet ports receive a second fluid, wherein the first two inlet ports are configured opposite each other and the second two inlet ports are configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart and each of the first two inlet ports is about 90 degrees from each of the second two inlet ports.

10. The vortex mixer of claim 1 wherein the outlet port and the outlet channel are at an angle of about 90 degrees to the second wall.

11. The vortex mixer of claim 1 wherein the height of the sidewall is the same as the height of the at least two inlet ports.

12. The vortex mixer of any one of the preceding claims, wherein the height of the sidewall is greater than the height of the at least two inlet ports.

13. The vortex mixer of claim 1 wherein the outlet port has a diameter x, and wherein:

the first wall and the second wall have a diameter of 5 x;

the height of the sidewall is 1.75 x;

the at least two inlet ports each have a height of 0.75 x.

14. The vortex mixer of claim 13, wherein x may be 1mm, 2mm, 4mm, 5mm, or 0.5 mm.

15. A system comprising n vortex mixers arranged side-by-side in a single plane in a d x w configuration, wherein n, d, and w are integers;

wherein each of said vortex mixers comprises the features recited in any one of the preceding claims.

16. A vortex mixer, comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

at least two primary inlet ports disposed along the sidewall, each primary inlet port having a primary inlet passage connected thereto, the at least two primary inlet ports being substantially equally spaced about the vortex mixing chamber and disposed tangentially to the vortex mixing chamber

A secondary inlet port disposed substantially at a radial center of the first wall, the secondary inlet port having a secondary inlet passage connected thereto; and

17. The vortex mixer of claim 16 wherein the vortex mixing chamber is circular and the sidewall extends around the circumference of the first wall and the second wall.

18. The vortex mixer of claim 16 wherein each inlet channel receives fluid from a single source.

19. The vortex mixer of claim 16 wherein each inlet channel receives fluid from a different source.

20. The vortex mixer of claim 16 wherein the vortex mixer has four primary inlet ports.

21. The vortex mixer of claim 20 wherein a first two of the four primary inlet ports receive fluid from a first source, a second two of the four primary inlet ports receive fluid from a second source, and the secondary inlet port receives fluid from a third source.

22. The vortex mixer of claim 21, wherein the first two primary inlet ports are configured opposite each other and the second two primary inlet ports are configured opposite each other such that the first two primary inlet ports are about 180 degrees apart and the second two primary inlet ports are about 180 degrees apart and each of the first two primary inlet ports is about 90 degrees from each of the second two primary inlet ports.

23. The vortex mixer of claim 20 wherein each of the four primary inlet ports receives fluid from a separate source.

24. The vortex mixer of claim 23 wherein a first two of the four primary inlet ports receive a first fluid and a second two of the four primary inlet ports receive a second fluid, wherein the first two primary inlet ports are configured opposite each other and the second two primary inlet ports are configured opposite each other such that the first two primary inlet ports are about 180 degrees apart and the second two primary inlet ports are about 180 degrees apart and each of the first two primary inlet ports is about 90 degrees from each of the second two primary inlet ports.

25. The vortex mixer of claim 16 wherein the outlet port and the outlet channel are at an angle of approximately 90 degrees to the second wall.

26. The vortex mixer of claim 16 wherein the height of the sidewall is the same as the height of the at least two inlet ports.

27. The vortex mixer of any one of the preceding claims, wherein the height of the sidewall is greater than the height of the at least two inlet ports.

28. The vortex mixer of claim 16 wherein the outlet port has a diameter x, and wherein:

the first wall and the second wall have a diameter of 5 x;

the height of the sidewall is 1.75 x;

the at least two primary inlet ports each have a height of 0.75 x; and is

The secondary inlet port has a diameter of 0.5 x.

29. The vortex mixer of claim 28, wherein x may be 1mm, 2mm, 4mm, 5mm, or 0.5 mm.

30. A system comprising n vortex mixers arranged side-by-side in a single plane in a d x w configuration, wherein n, d, and w are integers;

wherein each of said vortex mixers comprises the features recited in any one of the preceding claims.

31. A mixing system, comprising:

an initial vortex mixer, the initial vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

an outlet port having an outlet channel connected thereto, the outlet port being disposed at a radial center of the second wall, the outlet channel extending from the outlet port and away from the vortex mixing chamber; and

a post vortex mixer, the post vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

an additional ingress port; and

32. The mixing system as recited in claim 31, wherein the additional inlet port is configured at a radial center of the first wall of the subsequent vortex mixer.

33. The mixing system as recited in claim 31 or claim 32, wherein the additional inlet port is connected with the outlet passage extending from the initial vortex mixer outlet port.

34. The mixing system as recited in claim 31, further comprising a flow splitter disposed at an end of the outlet channel extending from the initial vortex mixer outlet port, the flow splitter having a first outlet and a second outlet.

35. The mixing system as recited in claim 34, wherein the first outlet is connected to a first of the at least two inlet ports and the second outlet is connected to a second of the at least two inlet ports.

36. The mixing system as recited in claim 35, wherein an inlet channel connected to the first of the at least two inlet ports is perpendicular to the first outlet and an inlet channel connected to the second of the at least two inlet ports is perpendicular to the second outlet.

37. The mixing system as recited in claim 35, wherein the additional inlet port is connected with an additional inlet channel.

38. The mixing system as recited in claim 37, wherein the additional inlet channel includes a first segment and a second segment, the second segment being connected with the additional inlet port.

39. The mixing system as recited in claim 38, wherein the second section is substantially perpendicular to the first section.

40. The mixing system as recited in claim 38, wherein the second segment is substantially perpendicular to an inlet channel connected to the first of the at least two inlet ports and the second segment is perpendicular to an inlet channel connected to the second of the at least two inlet ports.

41. The mixing system as recited in claim 38, wherein the second segment is substantially parallel to the subsequent vortex mixer outlet channel.

42. The mixing system as recited in claim 36, wherein the subsequent vortex mixer further comprises a second additional inlet port.

43. The mixing system as recited in claim 20, wherein the additional inlet port and the second additional inlet port are disposed along the sidewall, the additional inlet port and the second additional inlet port being spaced approximately equidistant around the subsequent vortex mixing chamber and disposed tangentially to the vortex mixing chamber.

44. The mixing system as recited in claim 21, wherein the subsequent vortex mixer has two inlet ports, the additional inlet port, and the second additional inlet port, each of which is substantially equally spaced around the vortex mixing chamber such that the inlet ports are each about 90 degrees apart.

45. The mixing system of claim 22, further comprising a second flow splitter having a first outlet connected to the additional inlet port and a second outlet connected to the second additional inlet port.

46. The mixing system as recited in claim 35, wherein:

the flow splitter has a third outlet and a fourth outlet,

the subsequent vortex mixer has four inlet ports,

the first outlet is connected to a first of the four inlet ports,

the second outlet is connected to a second of the four inlet ports,

the third outlet is connected to a third one of the four inlet ports, an

The fourth outlet is connected to a fourth of the four inlet ports.

47. The mixing system as recited in claim 35, wherein:

the subsequent vortex mixer has four inlet ports,

the first outlet is connected to a first of the four inlet ports,

the second outlet is connected to a second of the four inlet ports,

the third inlet port is connected with the inlet port, and

the fourth inlet port is connected to an additional inlet port.

48. The mixing system of claim 31, wherein the initial vortex mixer outlet port has a diameter x, and wherein:

the initial vortex first wall and the initial vortex second wall have a diameter of 5 x;

the height of the initial vortex sidewall is 1.75 x;

the at least two initial vortex inlet ports each have a height of 0.75 x.

49. The mixing system as recited in claim 31, wherein the diameter of the subsequent vortex mixer outlet port is y, and wherein:

the diameter of the subsequent vortex mixer first wall and the subsequent vortex mixer second wall is 5x y;

the height of the subsequent vortex mixer sidewall is 1.75 x y;

the at least two subsequent vortex mixer inlet ports each have a height of 0.75x y.

50. The mixing system as recited in claim 31, wherein:

the initial vortex mixer outlet port has a diameter x, and wherein:

the initial vortex first wall and the initial vortex second wall have a diameter of 5 x;

the height of the initial vortex sidewall is 1.75 x;

each of the at least two initial vortex inlet ports has a height of 0.75 x; and is

The diameter of the subsequent vortex mixer outlet port is y, and wherein:

the diameter of the subsequent vortex mixer first wall and the subsequent vortex mixer second wall is 5x y;

the height of the subsequent vortex mixer sidewall is 1.75 x y;

the at least two subsequent vortex mixer inlet ports each have a height of 0.75x y.

51. The mixing system as recited in claim 26, wherein x-y.

52. The mixing system as recited in claim 26, wherein x > y.

53. The mixing system of claim 31, wherein the initial vortex mixer and the subsequent vortex mixer are made from at least one of stainless steel, PEEK, LFEM, acrylic, 3-D print media, and additive manufacturing materials.

54. The mixing system as recited in claim 31 or claim 53, wherein the initial vortex mixer and the subsequent vortex mixer are made of the same material.

55. The mixing system as recited in claim 31, wherein the initial vortex mixer outlet port and the initial vortex outlet channel are at an angle of approximately 90 degrees to the initial vortex second wall, and wherein the subsequent vortex mixer outlet port and the subsequent vortex outlet channel are at an angle of approximately 90 degrees to the subsequent vortex second wall.

56. A mixing system, comprising:

an initial vortex mixer, the initial vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

a post vortex mixer, the post vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

at least two inlet ports, a first of the at least two inlet ports connected with the sidewall, the first inlet port connected with the outlet channel of the initial vortex mixer;

57. The mixing system as recited in claim 56, wherein a second of the at least two inlet ports of the subsequent vortex mixer is connected with the first wall of the vortex mixing chamber of the subsequent vortex mixer.

58. The mixing system as recited in claim 57, wherein a second of the at least two inlet ports of the subsequent vortex mixer is configured at a radial center of the first wall of the vortex mixing chamber of the subsequent vortex mixer.

59. The mixing system as recited in claim 57, wherein a second of the at least two inlet ports of the subsequent vortex mixer is connected with an inlet channel that is parallel to the outlet channel of the subsequent vortex mixer.

60. The mixing system as recited in claim 56, wherein a second of the at least two inlet ports of the subsequent vortex mixer is connected with the sidewall of the vortex mixing chamber of the subsequent vortex mixer.

61. A network of hybrid systems comprising n hybrid systems arranged side by side in a single plane in a d x w configuration, wherein n, d and w are integers;

wherein each of the mixing systems comprises the features recited in any one of claims 31-60.

62. A method of mixing, comprising:

receiving a first fluid at a first vortex mixing chamber and from at least two inlet ports;

receiving a second fluid at the first vortex mixing chamber and from at least two inlet ports;

mixing the first fluid and the second fluid in the first vortex mixing chamber to form a first effluent fluid;

flowing the first effluent fluid out into a first outlet channel;

splitting the first outgoing fluid into at least two channels via a splitter;

receiving the first effluent fluid at a second vortex mixing chamber from at least two inlet ports connected to the at least two channels;

receiving a third fluid at the second vortex mixing chamber;

mixing the effluent fluid and the third fluid in the second vortex mixing chamber to form a second effluent fluid; and are

Flowing the second outflow fluid into a second outlet channel.

63. The mixing method of claim 62, wherein the first fluid comprises a buffer and the second fluid comprises a lipid mixture, and wherein the first effluent fluid comprises empty nanoparticles.

64. The mixing method of claim 63, wherein the third fluid comprises nucleic acids, and wherein the second effluent fluid comprises nanoparticles that retain nucleic acids.

65. The mixing method of claim 64, wherein the nucleic acid is incorporated into the nanoparticle through at least one of hydrophobic interactions and charged interactions.

66. The mixing method of claim 64, wherein forming empty nanoparticles in the initial vortex mixing chamber before the nucleic acid is received in the second vortex mixing chamber prevents the nucleic acid from being directly exposed to the buffer before it is mixed with the lipid mixture.

67. The mixing method of claim 65, wherein preventing direct exposure of the nucleic acid to the buffer prevents at least one of acidification and degradation of the nucleic acid.

68. The mixing method of claim 66, wherein the nucleic acid is RNA.

69. A mixing system, comprising:

a plurality of vortex mixers, each vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

an outlet port having an outlet channel connected thereto, the outlet port being configured at a radial center of the second wall, the outlet channel extending from the outlet port and away from the vortex mixing chamber, wherein the plurality of vortex mixers comprises n vortex mixers arranged side by side in a single plane on a mixing plate in a d x w configuration, wherein n, d and w are integers.

70. The mixing system as recited in claim 69, wherein n-24, d-6, and w-4.

71. The mixing system as recited in claim 69, wherein each vortex mixer has four inlet ports.

72. The mixing system of claim 71, wherein each inlet port is fluidly coupled to a pipette.

73. The mixing system as recited in claim 71, wherein a first two of the four inlet ports of each vortex mixer receive fluid from a first source and a second two of the four inlet ports receive fluid from a second source.

74. The mixing system as recited in claim 71, wherein a first three of the four inlet ports of each vortex mixer receives fluid from a first source and a fourth of the four inlet ports receives fluid from a second source.

75. The mixing system as recited in claim 72, wherein the first two inlet ports of each vortex mixer are configured opposite each other and the second two inlet ports of each vortex mixer are configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart and each of the first two inlet ports is about 90 degrees from each of the second two inlet ports.

76. A mixing system, comprising:

a plurality of mixing subsystems, each mixing subsystem comprising:

an initial vortex mixer, the initial vortex mixer comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

a post-swirl mixer, the post-swirl system comprising:

a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall;

an additional ingress port; and

an outlet port having an outlet channel connected thereto, the outlet port configured at a radial center of the second wall, the outlet channel extending from the outlet port and away from the vortex mixing chamber, wherein the plurality of vortex mixers comprises n mixing subsystems arranged in a side-by-side configuration in a single plane on a mixing plate in a d x w configuration, wherein n, d, and w are integers.

77. The mixing system as recited in claim 76, wherein n-24, d-6, and w-4.

78. The mixing system as recited in claim 76, wherein each initial vortex mixer has four inlet ports.

79. The mixing system of claim 78, wherein each initial vortex mixer inlet port is fluidly coupled to a pipette.

80. The mixing system of claim 79, wherein a first two of the four inlet ports of each initial vortex mixer receive fluid from a first source and a second two of the four inlet ports receive fluid from a second source.

81. The mixing system of claim 79, wherein a first three of the four inlet ports of each initial vortex mixer receives fluid from a first source and a fourth of the four inlet ports receives fluid from a second source.

82. The mixing system as recited in claim 79, wherein the first two inlet ports of each initial vortex mixer are configured opposite each other and the second two inlet ports of each vortex mixer are configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart and each of the first two inlet ports is about 90 degrees from each of the second two inlet ports.

83. The mixing system as recited in any one of claims 69 to 82, further comprising:

a transfer gantry configured to move the product containers, an

A plurality of n product containers configured to receive the mixed product from the mixing plate,

wherein the mixing plate is in a fixed position relative to the transport gantry; and the transfer gantry moves a first product container to a position where the first product container receives product from the mixing plate, and the transfer gantry moves a subsequent n-1 product containers to receive the product from the mixing system;

wherein n is an integer between 2 and 30.

Technical Field

The present disclosure relates to vortex mixers and related methods, systems, and devices.

Background

The vortex mixer rapidly rotates the fluid to cause a change in the fluid. Vortex mixers can receive a plurality of fluids and can be used to mix the plurality of fluids together. In a vortex mixer with multiple inlets, the vortex mixer may receive more than one fluid and may be used to mix the fluids together.

Disclosure of Invention

Some embodiments of the present disclosure provide vortex mixers and related methods, systems, and devices.

In some embodiments, a vortex mixer can have a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall. At least two inlet ports may be disposed along the sidewall, and each inlet port may have an inlet channel connected thereto. The at least two inlet ports may be substantially equally spaced about the vortex mixing chamber and may be arranged tangentially to the vortex mixing chamber. The outlet port has an outlet passage connected thereto, and the outlet port may be arranged at a radial center of the second wall. The outlet passage may extend from the outlet port and away from the vortex mixing chamber.

In some embodiments, the vortex mixing chamber may be circular and the sidewall may extend around the circumference of the first wall and the second wall.

Each inlet channel may receive fluid from a single source, or each inlet channel may receive fluid from a different source.

In some embodiments, the vortex mixer may have four inlet ports. A first two of the four inlet ports may receive fluid from a first source, while a second two of the four inlet ports receive fluid from a second source. The first two inlet ports may be configured opposite each other and the second two inlet ports may be configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart, with each of the first two inlet ports being about 90 degrees from each of the second two inlet ports. Alternatively, each of the four inlet ports may receive fluid from a separate source. A first two of the four inlet ports may receive a first fluid and a second two of the four inlet ports may receive a second fluid. The first two inlet ports are configured opposite each other and the second two inlet ports are configured opposite each other such that the first two inlet ports are about 180 degrees apart and the second two inlet ports are about 180 degrees apart and each of the first two inlet ports is about 90 degrees from each of the second two inlet ports.

The outlet port and the outlet channel may be at an angle of about 90 degrees to the second wall.

In some embodiments, the height of the sidewall may be the same as the height of the at least two inlet ports. In other embodiments, the height of the sidewall may be greater than the height of the at least two inlet ports.

In some embodiments, the diameter of the outlet port may be x, the diameter of the first and second walls may be 5x, the height of the side wall may be 1.75 x, and the height of the at least two inlet ports may be 0.75 x. In various embodiments, the value of x may be 1mm, 2mm, 4mm, 5mm, or 0.5 mm.

The mixing system may have an initial vortex mixer and a subsequent vortex mixer. The initial vortex mixer may have a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall. At least two inlet ports may be provided along the side wall, each inlet port having an inlet channel connected thereto. The at least two inlet ports may be equally spaced around the vortex mixing chamber and arranged tangentially to the vortex mixing chamber. The outlet port has an outlet channel connected thereto, and the outlet port may be disposed at a radial center of the second wall. The passage may extend from the outlet port and away from the vortex mixing chamber.

The subsequent vortex mixer may have a vortex mixing chamber having a first wall, a second wall, and a sidewall connecting the first wall and the second wall. At least two inlet ports may be disposed along the sidewall, and each inlet port may have an inlet channel connected thereto. The at least two inlet ports may be substantially equally spaced about the vortex mixing chamber and arranged tangentially to the vortex mixing chamber. The subsequent vortex mixer may also have additional inlet and outlet ports with outlet channels connected thereto. An outlet port may be disposed at a center of the second wall, and a channel may extend from the outlet port and away from the vortex mixing chamber.

In some embodiments, the additional inlet port may be configured at a radial center of the first wall of the subsequent vortex mixer. The additional inlet port may be connected to a channel extending from the initial vortex mixer outlet port.

The flow splitter may be disposed at an end of an outlet channel extending from the initial vortex mixer outlet port, and the flow splitter may have a first outlet and a second outlet. The first outlet may be connected with a first of the at least two inlet ports and the second outlet may be connected with a second of the at least two inlet ports. The additional inlet port may be connected with an additional inlet channel.

In some embodiments, the subsequent vortex mixer may include a second additional inlet port. The additional inlet port and the second additional inlet port may be disposed along the sidewall and may be substantially equally spaced about and disposed tangentially to the vortex mixing chamber. In some embodiments, the subsequent vortex mixer has two inlet ports, an additional inlet port, and a second additional inlet port, each of which is spaced around the vortex mixing chamber such that the inlet ports are each separated by about 90 degrees. Some embodiments further comprise a second flow splitter, wherein the second flow splitter has a first outlet connected to the additional inlet port and a second outlet connected to the second additional inlet port.

The diameter of the initial vortex mixer outlet port may be x, the diameters of the initial vortex first wall and the initial vortex second wall may be 5x, the height of the initial vortex sidewall may be 1.75 x, and the height of each of the at least two initial vortex inlet ports is 0.75 x. The diameter of the subsequent vortex mixer outlet port may be y, wherein the diameter of the subsequent vortex mixer first wall and the subsequent vortex mixer second wall may be 5 y, the height of the subsequent vortex mixer side wall may be 1.75 y, and the height of each of the at least two subsequent vortex mixer inlet ports may be 0.75 y. In some embodiments, x and y may be exactly or approximately equal; in other embodiments, x may be greater than y.

The initial vortex mixer and the subsequent vortex mixer may be made of at least one of stainless steel, PEEK, LFEM, acrylic, 3-D print media, and additive manufacturing materials. The initial vortex mixer and the subsequent vortex mixer may be made of the same material.

The initial vortex mixer outlet port and the initial vortex outlet passage may be at an angle of about 90 degrees to the initial vortex second wall, and the subsequent vortex mixer outlet port and the subsequent vortex outlet passage may be at an angle of about 90 degrees to the subsequent vortex second wall.

A mixing method may include receiving a first fluid from at least two inlet ports at a first vortex mixing chamber and receiving a second fluid from at least two inlet ports at the first vortex mixing chamber. The first fluid and the second fluid may mix in the first vortex mixing chamber to form a first outgoing fluid, and the first outgoing fluid may flow into the first outlet channel. The first outgoing fluid may be split into at least two channels by a splitter. The first outgoing fluid may be received at the second vortex mixing chamber from at least two inlet ports connected with the at least two channels. The third fluid may be received at the second vortex mixing chamber, and the effluent fluid and the third fluid may mix in the second vortex mixing chamber to form a second effluent fluid. The second outgoing fluid may flow into the second outlet channel.

In some embodiments, the first fluid may comprise a buffer, and the second fluid may comprise a lipid mixture, and the first effluent fluid comprises empty nanoparticles. The third fluid may comprise nucleic acids (e.g., RNA), and the second effluent fluid may comprise nanoparticles that retain the nucleic acids. The nucleic acid may be incorporated into the nanoparticle through hydrophobic interactions and/or charged interactions. Forming empty nanoparticles in the initial vortex mixing chamber before the nucleic acid is received in the second vortex mixing chamber may prevent the nucleic acid from being directly exposed to the buffer before the buffer is mixed with the lipid mixture. Preventing direct exposure of the nucleic acid to the buffer may prevent acidification and/or degradation of the nucleic acid.

Summary of some embodiments

This patent or application document contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of the necessary fee.

Fig. 1A-1E show a vortex mixer according to some embodiments.

Figure 2 shows a vortex mixer according to some embodiments.

Fig. 3A-3B show a vortex mixer according to some embodiments.

Fig. 4A-4C show a vortex mixer according to some embodiments.

Fig. 5 shows a two-stage vortex mixer according to some embodiments.

Fig. 6A-6B show a two-stage vortex mixer according to some embodiments.

Fig. 7A-7B show a two-stage vortex mixer according to some embodiments.

Fig. 8 shows a two-stage mixer according to some embodiments.

Fig. 9A-9B show a two-stage vortex mixer according to some embodiments.

Fig. 10 shows a two-stage vortex mixer according to some embodiments.

Figures 11A-D show a system of vortex mixers according to some embodiments.

Figure 12 shows a system of vortex mixers according to some embodiments.

Fig. 13A shows a vortex mixer according to some embodiments.

Fig. 13B shows a time-pressure plot according to some embodiments.

Figure 13C shows mass fractions at the middle chamber and the first and second walls of the vortex mixer according to some embodiments.

Fig. 14A-14B show a vortex mixer according to some embodiments.

FIG. 14C shows a time-pressure diagram of the vortex mixer of FIGS. 13A-13B.

Figures 14D-F show vortex mixers according to some embodiments.

Figures 15A-15C illustrate mixing within vortex mixing chambers of different proportions according to some embodiments.

Fig. 15D shows a plot of mixing timescales as a function of inlet velocity and the results such as shown in fig. 15A-15C according to some embodiments.

FIG. 15E shows the mass fraction of the vortex mixer of FIGS. 14A-14B.

Fig. 16A-16N show various tables and diagrams according to some embodiments.

Fig. 17A-17D show performance characteristics of some embodiments of dual stage mixers.

Fig. 18A-18B illustrate exemplary fluid flow paths in a vortex mixer.

Fig. 19A-19B show the mixing ratio as a function of time.

Detailed description of some embodiments

FIG. 1A shows an exemplary embodiment of a vortex mixer 100. The vortex mixer 100 can have a vortex mixing chamber 150, the vortex mixing chamber 150 having a first wall 151, a second wall 152, and a sidewall 153 connecting the first wall 151 and the second wall 152. In some embodiments, the vortex mixing chamber 150 is circular; the first wall 151 and the second wall 152 are circular, and the side wall 153 extends around the circumference of the circle and connects the outer edges of the first wall 151 and the second wall 152. The vortex mixer 100 of fig. 1A has four inlet channels 105, 110, 115, 120. In other embodiments, the vortex mixer 100 may have more inlet passages or fewer inlet passages. The inlet channels 105, 110, 115, 120 are connected with the side wall 152 of the vortex mixing chamber 150 via inlet ports 125, 130, 135, 140. The inlet ports 125, 130, 135, 140 may be precisely or substantially equally spaced about the vortex mixing chamber 150 such that fluid flowing through the inlet passages 105, 110, 115, 120 enters the vortex mixing chamber 150 tangentially. In other embodiments, the inlet ports 125, 130, 135, 140 and inlet channels 105, 110, 115, 120 may be non-tangentially configured. The inlet ports 125, 130, 135, 140 and inlet passages 105, 110, 115, 120 may be arranged tangentially to the vortex mixing chamber 150, orthogonally to the vortex mixing chamber 150, or at any angle therebetween. An outlet port (not shown) having an outlet passage 160 connected thereto is connected to the second wall 152 of the vortex mixing chamber 150. The outlet port may be disposed at a center, such as a radial center, of the second wall 152. From the vortex mixing chamber 150, the fluid flows through the outlet port and exits via the outlet passage 160. The outlet passage 160 may be configured at a right angle, i.e., about 90 degrees, to the plane of the second wall 152. In some embodiments, inlet port 125 may receive a first fluid, inlet port 130 may receive a second fluid, inlet port 135 may receive a third fluid, and inlet port 140 may receive a fourth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid.

In some embodiments, the inlet channels 105, 110, 115, 120 may receive fluid from a single source. In other embodiments, the inlet channels 105, 110, 115, 120 may receive fluid from different sources. For example, the inlet channels 105, 110, 115, 120 may each receive fluid from a different source, or some inlet channels may receive fluid from the same source while other inlet channels receive fluid from a different source. Thus, in some embodiments, two of the inlet channels may receive fluid from a first source, and the other two inlet channels may receive fluid from a second source. Alternatively, three of the inlet channels may receive fluid from the first source and the fourth inlet channel may receive fluid from the second source, or two of the inlet channels may receive fluid from the first source, the third inlet channel may receive fluid from the second source, and the fourth inlet channel may receive fluid from the third source.

In an exemplary embodiment, two channels receive fluid from a first source and two channels receive fluid from a second source. In such an embodiment, the two channels receiving fluid from the first source may be adjacent to each other or intersect each other. Accordingly, two channels receiving fluid from the second source may be adjacent to each other or intersect each other.

In the embodiment shown in fig. 1A, the first one of the inlet channels 105 and the third one of the inlet channels 115 are configured to cross each other. The first 105 and third 115 inlet channels are each at about 90 degrees to the second 110 of the inlet channels and the fourth 120 of the inlet channels. First inlet channel 105 and third inlet channel 115 carry a first fluid to vortex mixing chamber 150, and second inlet channel 110 and fourth inlet channel 120 carry a second fluid to vortex mixing chamber 150. The first 105 and third 115 inlet channels may receive the first fluid from a common source of the first fluid or from different sources of the first fluid. Similarly, the second 110 and fourth 120 inlet channels may receive a second fluid from a common source of the second fluid or from different sources of the second fluid.

The first and second fluids are received into the vortex mixing chamber 150. In some embodiments, the first fluid and the second fluid rotate within the vortex mixing chamber 150 at least in part because the fluids enter the vortex mixing chamber 150 tangentially via the inlet ports 125, 130, 135, 140. Once the first and second fluids are mixed within the vortex mixing chamber 150, the mixed fluid flows through the outlet port and into the outlet passage 160.

Figure 1B shows an exploded view of an embodiment of vortex mixer 100. As shown in fig. 1B, the vortex mixer 100 is comprised of two components: a cap 165 and a mixer element 170. The cap 165 has inlet ports 166, 167, 168, 169 corresponding to the inlet channels 105, 110, 115, 120. Inlet ports 166, 167, 168, 169 are configured to receive fluid from a fluid source of any configuration as described above with respect to fig. 1A.

FIG. 1C shows an exemplary configuration in which inlet ports 166 and 168 receive fluid from a first source and inlet ports 167 and 169 receive fluid from a second source. Fluid from the first source passes through the first fluid splitter 171 and into inlet ports 166, 168, while fluid from the second source passes through the second fluid splitter 173 and into inlet ports 167, 169.

Fluid passes from inlet ports 166, 167, 168, 169 and into inlet channels 105, 110, 115, 120, after which it passes through inlet channels 105, 110, 115, 120, through inlet ports 125, 130, 135, 140 and into vortex mixing chamber 150. The assembled configuration of FIG. 1B is shown as FIG. 1D. FIG. 1D also shows an outlet port 155 within the vortex mixing chamber 150. FIG. 1E shows a top view of FIG. 1D.

Fig. 2 shows an alternative embodiment of a vortex mixer 200. In this embodiment, the vortex mixer 200 comprises internal flow diverters 271, 273. Internal shunts 271, 273 can be used in place of the external shunts shown in figure 1C. In this embodiment, the cover 265 has two inlet ports 266, 267. The first fluid from inlet port 266 enters diverter channel 272 of internal diverter 271. The flow splitter channel 272 splits the first fluid and carries the first fluid to the inlet channels 205, 215. Simultaneously, the second fluid from the inlet port 267 enters the flow splitter passage 274 of the inner flow splitter 273. The flow splitter passage 274 splits the second fluid and carries the second fluid to the inlet passages 210, 220. Once the first and second fluids enter the inlet passages 205, 210, 215, 220 of the mixer element 270, the vortex mixer 200 operates as discussed above with respect to FIGS. 1A-1E.

Fig. 3A shows an exploded view of the alternative embodiment of fig. 2. In the embodiment of fig. 3A, the operation of the internal flow splitters 371, 373 and the mixer element 370 is similar to the embodiment of fig. 2. However, the cover 365 receives fluid at the inlet ports 366, 367. The first fluid enters the inlet port 366 and is delivered to the inner splitter 371 via an inner fluid channel; similarly, the second fluid enters inlet port 367 and is delivered to inner flow diverter 373 via the inner fluid channel. Once the fluid enters the inner flow splitters 371 and 373 via flow splitter channels 372 and 374, respectively, the fluid is split and enters the inlet channels 305, 310, 315, 320, as discussed above. Vortex mixing chamber 350 and outlet port 355 are also shown and are fluidly coupled with external outlet port 399. Fig. 3B shows the embodiment of fig. 3A with the cap 365, the inner diverters 371, 373, and the mixer element 370 assembled.

Fig. 4A shows an exemplary embodiment of a vortex mixer 400. The vortex mixer 400 can have a vortex mixing chamber 450, the vortex mixing chamber 450 having a first wall 451, a second wall 452, and a sidewall 453 connecting the first wall 451 and the second wall 452. In some embodiments, the vortex mixing chamber 450 is circular; the first wall 451 and the second wall 452 are circular, and the side wall 453 extends around the circumference of the circle and connects the outer edges of the first wall 451 and the second wall 452. The vortex mixer 400 of fig. 4A has four inlet channels 405, 410, 415, 420. In other embodiments, vortex mixer 400 may have more inlet passages or fewer inlet passages. The inlet channels 405, 410, 415, 420 are connected with the sidewall 452 of the vortex mixing chamber 450 via inlet ports 425, 430, 435, 440. The inlet ports 425, 430, 435, 440 may be precisely or substantially equally spaced about the vortex mixing chamber 450 such that fluid flowing through the inlet channels 405, 410, 415, 420 enters the vortex mixing chamber 450 tangentially. In other embodiments, the inlet ports 425, 430, 435, 440 and the inlet channels 405, 410, 415, 420 may be non-tangentially configured. The inlet ports 425, 430, 435, 440 and inlet channels 405, 410, 415, 420 may be arranged tangentially to the vortex mixing chamber 450, orthogonally to the vortex mixing chamber 450, or at any angle therebetween. An outlet port (not shown) having an outlet passage 460 connected thereto is connected to the second wall 452 of the vortex mixing chamber 450. The outlet port may be disposed at a center, such as a radial center, of the second wall 452. From the vortex mixing chamber 450, the fluid flows through the outlet port and exits via the outlet passage 460. The outlet passage 460 may be configured at a right angle, i.e., about 90 degrees, to the plane of the second wall 452.

Fig. 4B and 4C show an embodiment of vortex mixer 400 and an exploded view of the vortex mixer, respectively. The vortex mixer 400 can have a vortex mixing chamber 450, the vortex mixing chamber 450 having a first wall 451, a second wall 452, and a sidewall 453 connecting the first wall 451 and the second wall 452. In some embodiments, the vortex mixing chamber 450 is circular; the first wall 451 and the second wall 452 are circular, and the side wall 453 extends around the circumference of the circle and connects the outer edges of the first wall 451 and the second wall 452. The vortex mixer 400 of fig. 4A has four inlet channels 405, 410, 415, 420. In other embodiments, vortex mixer 400 may have more inlet passages or fewer inlet passages. The inlet channels 405, 410, 415, 420 are connected with the sidewall 452 of the vortex mixing chamber 450 via inlet ports 425, 430, 435, 440. The inlet ports 425, 430, 435, 440 may be precisely or substantially equally spaced about the vortex mixing chamber 450 such that fluid flowing through the inlet channels 405, 410, 415, 420 enters the vortex mixing chamber 450 tangentially. In other embodiments, the inlet ports 425, 430, 435, 440 and the inlet channels 405, 410, 415, 420 may be non-tangentially configured. The inlet ports 425, 430, 435, 440 and inlet channels 405, 410, 415, 420 may be arranged tangentially to the vortex mixing chamber 450, orthogonally to the vortex mixing chamber 450, or at any angle therebetween. An outlet port 455 having an outlet passage 460 connected thereto is connected to the second wall 452 of the vortex mixing chamber 450. The outlet port 455 may be disposed at a center, such as a radial center, of the second wall 452. From the vortex mixing chamber 450, the fluid flows through the outlet port 455 and exits via the outlet passage 460. The outlet passage 460 may be configured at a right angle, i.e., about 90 degrees, to the plane of the second wall 452.

The fifth inlet passage 478 may be configured to receive a fifth fluid. The third inlet passage 478 may be fluidly connected with the vortex mixing chamber 450 via the fifth inlet port 458. The fifth inlet port 458 may be configured in the first wall 451 of the vortex mixing chamber 450. In some embodiments, the fifth inlet port 458 may be disposed at a center of the first wall 451, such as a radial center of the first wall 451. Fifth inlet port 458 may be configured in second wall 452 of vortex mixing chamber 450. In some embodiments, the fifth inlet port 458 may be disposed at a center of the second wall 452, such as a radial center of the second wall 452. The first wall 451 and the second wall 452 are connected by a sidewall 453. In some embodiments, the diameter of the fifth inlet chamber 478 may be about 0.1x the diameter of the vortex mixer 400. In some embodiments, the diameter of the outlet port 455 may be about 0.2x the diameter of the vortex mixer 400. In some implementations, inlet port 425 may receive the first fluid, inlet port 430 may receive the second fluid, inlet port 435 may receive the third fluid, inlet port 440 may receive the fourth fluid, and inlet port 458 may receive the fifth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid. In some embodiments, the first fluid and the third fluid may comprise a lipid. In some embodiments, the first fluid and the third fluid may comprise ethanol. In some embodiments, the first and third fluids may comprise a lipid. In some embodiments, the second and fourth fluids may comprise nucleic acids. (e.g., RNA). In some embodiments, the second and fourth fluids may comprise ethanol. In some embodiments, the second and fourth fluids may comprise lipids. In some embodiments, the fifth fluid may comprise nucleic acids.

Fig. 5 shows an exemplary embodiment of a two-stage mixer 500. The first stage mixer 501 may be configured similar to any of the vortex mixers discussed above. As shown, the first stage mixer 501 has a vortex mixing chamber 550, the vortex mixing chamber 550 having first and second walls 551, 552 and a sidewall 553 connecting the first and second walls 551, 552. The vortex mixing chamber 550 may have four inlet ports 525, 530, 535, 540 disposed along the sidewall 553. Each of the four inlet ports 525, 530, 535, 540 may receive fluid from a respective inlet channel 505, 510, 515, 520. The first inlet channel 505 and the third inlet channel 515 may receive a first fluid, and the second inlet channel 510 and the fourth inlet channel 520 may receive a second fluid. In some embodiments, each inlet channel 505, 510, 515, 520 may receive fluid from a separate fluid source. In other embodiments, the first inlet channel 505 and the third inlet channel 515 may receive a first fluid from a first fluid source; the first fluid may pass through a first fluid splitter that directs the first fluid to the first inlet channel 505 and the third inlet channel 515. Accordingly, the second inlet channel 510 and the fourth inlet channel 520 may receive a second fluid from a second fluid source; the second fluid may pass through a second fluid flow splitter that directs the second fluid to the second inlet channel 510 and the fourth inlet channel 520. As discussed above, the first and second fluid diverters may be internal or external diverters.

The first fluid flows through the first inlet channel 505 and into the vortex mixing chamber 550 via the first inlet port 525, and flows through the third inlet channel 515 and into the vortex mixing chamber 550 via the third inlet port 535. The first inlet port 525 and the third inlet port 535 may be exactly or substantially 180 degrees from each other and may direct the first fluid such that the first fluid enters the vortex mixing chamber 550 tangentially. In other embodiments, the first inlet port 525 and the third inlet port 535 may direct the first fluid such that the first fluid enters the vortex mixing chamber 550 orthogonally or at an angle between tangential and orthogonal. Similarly, the second fluid flows through the second inlet channel 510 and into the vortex mixing chamber 550 via the second inlet port 530, and flows through the fourth inlet channel 520 and into the vortex mixing chamber 550 via the fourth inlet port 540. Second inlet port 530 and fourth inlet port 540 may be at exactly or approximately 180 degrees from each other and may be at exactly or approximately 90 degrees from first inlet port 525 and third inlet port 535. The second inlet port 530 and the fourth inlet port 540 direct the second fluid such that the second fluid enters the vortex mixing chamber 550 tangentially, orthogonally, or at any angle therebetween. In some embodiments, inlet port 525 may receive a first fluid, inlet port 530 may receive a second fluid, inlet port 535 may receive a third fluid, and inlet port 540 may receive a fourth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid. In some embodiments, the first fluid and the third fluid may comprise a lipid. In some embodiments, the first fluid and the third fluid may comprise ethanol. In some embodiments, the second and fourth fluids may comprise lipids. In some embodiments, the second and fourth fluids may comprise an acidic buffer. In some embodiments, the second and fourth fluids may comprise nucleic acids. (e.g., RNA). In some embodiments, the second and fourth fluids may comprise ethanol.

The vortex mixing chamber 550 may have an outlet port 555 with an outlet channel 560 connected thereto. The outlet port may be disposed on the second wall 552 of the vortex mixing chamber 550. The outlet port may be disposed at a center, such as a radial center, of the second wall 552. The effluent from first stage mixer 501 flows from vortex mixing chamber 550 through outlet port 555 and exits via outlet channel 560.

The first stage mixer effluent exits first stage vortex mixing chamber 550 through outlet passage 560 and enters flow divider 561. Flow splitter 561 splits the first stage mixer outflow and directs the first stage mixer outflow into first inlet channel 575 via inlet port 562 of second stage mixer 502 and into second inlet channel 577 via inlet port 563 of second stage mixer 502. First and second inlet channels 575 and 577 are each connected to second stage vortex mixing chamber 580 via first and second inlet ports 585 and 586, respectively. The first inlet port 585 and the second inlet port 586 may be configured to be exactly or approximately 180 degrees apart and may be configured such that the first stage mixer effluent enters the vortex mixing chamber 580 tangentially from each port 585, 586. In some embodiments, the first inlet port 585 and the second inlet port 586 can be configured such that the first stage mixer effluent enters the vortex mixing chamber 580 at an angle orthogonal to the vortex mixing chamber 580 or at any angle between an orthogonal angle and tangential to the vortex mixing chamber 580. Third inlet passage 578 may be configured to receive the second stage influent fluid. Third inlet channel 578 may be fluidly connected with second stage vortex mixing chamber 580 via a third inlet port 588. The third inlet port 588 may be disposed in the first wall 581 of the vortex mixing chamber 580. In some embodiments, the third inlet port 588 may be disposed in the center of the first wall 581, such as the radial center of the first wall 581. A third inlet port 588 may be provided in the second wall 582 of the vortex mixing chamber 580. In some embodiments, the third inlet port 588 may be disposed in the center of the second wall 582, such as in the radial center of the second wall 582. The first wall 581 and the second wall 582 are connected by a side wall 583. In some embodiments, the third inlet port 588 may receive a fifth fluid. In some embodiments, the fifth fluid may comprise nucleic acids.

Vortex mixing chamber 580 may have a second stage mixer outlet port 589, second stage mixer outlet port 589 having a second stage mixer outlet passage 590 connected thereto. The second stage mixer outlet port may be disposed in a center, such as a radial center, of the second wall 582. The effluent from second stage mixer 502 flows from vortex mixing chamber 580 through second stage mixer outlet port 589 and exits via second stage mixer outlet passage 590.

In some embodiments, the second stage mixer 502 may have the same or substantially similar geometry as the embodiment described in fig. 4A with four inlet channels. In other words, second stage mixer 502 may have a first inlet port 585, a second inlet port 586, a third inlet port (not shown), and a fourth inlet port (not shown). In some embodiments, the third inlet port may be fluidly coupled with a third inlet channel (not shown), and the fourth inlet port may be fluidly coupled with a fourth inlet channel (not shown). In some embodiments, the third and fourth inlet channels may include inlet ports where fluid may be added to the second stage mixer. In some embodiments, the third and fourth inlet channels may be fluidly coupled with a flow splitter 561, in which case the flow splitter 561 would be a four-way flow splitter.

Fig. 6A and 6B illustrate an embodiment of a two-stage vortex mixing system 600. In this embodiment, the operation of the first vortex mixer 601 may be similar to the vortex mixer 300 of fig. 3A-3B. This first vortex mixer 601 includes internal flow splitters 671, 673. Internal shunts 671, 673 may be used in place of the external shunts shown in fig. 6B. In this embodiment, the cover 665 has two inlet ports 666, 667. The first fluid from inlet port 666 enters diverter channel 672 of inner diverter 671. The flow divider channel 672 divides the first fluid and carries the first fluid to the inlet channels 605, 615. Simultaneously, the second fluid from the inlet port 667 enters the flow splitter passage 674 of the inner flow splitter 673. The flow splitter passage 674 splits the second fluid and carries the second fluid to the inlet passages 610, 620. Once the first and second fluids enter the inlet channels 605, 610, 615, 620 of the mixer element 670, the first vortex mixer 601 operates as discussed above with respect to FIGS. 1A-2. After mixing occurs within the initial vortex mixing chamber 650, the mixed fluid exits the initial vortex mixing chamber 650 through the initial vortex mixer outlet port 655 and then through the initial vortex mixer outlet passage 660. The first stage mixer effluent then enters splitter 661. Splitter 661 splits the first stage mixer effluent flow and directs the first stage mixer effluent flow to the second vortex mixer 602 through two inlet ports 662 and 664 in cover 663. Inlet ports 662 and 664 each feed mixed fluid to second stage fluid inlet passages 675 and 677, respectively, located on mixer member 676. Second stage fluid inlet passages 675 and 677 feed fluid to second stage vortex mixing chamber 680. The third inlet passage 678 may be configured to receive a second stage inflow fluid. The third inlet passage 678 may be fluidly connected with the second stage vortex mixing chamber 680 via a third inlet port 688. After mixing occurs within second stage vortex mixing chamber 680, the product fluid may exit second stage vortex mixing chamber 680 through second stage mixer outlet passage 690 via second stage mixer outlet port 689. In some embodiments, the inlet port 666 may receive the first fluid, the inlet port 667 may receive the second fluid, and the inlet port 688 may receive the third fluid.

Fig. 7A shows an exploded view of a hybrid system 700 as an alternative embodiment to fig. 6A. In the embodiment of fig. 7A, the operation of the internal flow splitters 771, 773 and the mixer member 770 are similar to the embodiment of fig. 6. However, the cap 765 receives fluid at the inlet ports 766, 767. The first fluid enters inlet port 766 and is delivered to internal splitter 771 via internal fluid passageways; similarly, the second fluid enters the inlet port 767 and is delivered to the internal flow splitter 773 via the internal fluid passage. Once the fluid enters the inner flow splitters 771 and 773 via flow splitter channels 772 and 774, respectively, the fluid is split and enters the inlet channels 705, 710, 715, 720 as discussed above with reference to fig. 6A. An initial vortex mixing chamber 750 and an outlet port 755 are also shown. The first stage mixer effluent then enters the diverter 761 via diverter channel 759. Flow splitter 761 splits the first stage mixer outflow and directs the first stage mixer outflow to second stage fluid inlet passages 775 and 777 located on mixer assembly 776. Second stage fluid inlet passages 775 and 777 feed second stage vortex mixing chamber 780. The third inlet passage 778 may be configured to receive a second stage inflow fluid. Third inlet passage 778 may be fluidly connected with second stage vortex mixing chamber 780 via third inlet port 788. The third inlet passage 778 is fluidly coupled to the third inlet port 798. The third inlet port 798 may be coupled with the mixer member 770. Second stage vortex mixing chamber 780 has a second stage vortex mixing chamber outlet port 789 that couples with second stage vortex mixing chamber outlet passage 790. Second stage vortex mixing chamber outlet passage 790 is fluidly coupled with an external outlet port 799. Fig. 7B shows the embodiment of fig. 7A with the cap 765, the internal diverters 771, 773, 761, and the mixer components 770, 776 assembled.

In each of these embodiments, the size of the vortex mixer may vary. In some embodiments, all dimensions of the vortex mixer may be linearly and/or scaled.

Additionally, in each of these embodiments, the layers (including but not limited to the cap, flow splitter, mixer components, etc.) may be connected by screwing the layers together, by soft bonding (e.g., using materials that can be fused together using pressure), or by any other means of connection. Alternatively, the layers of each embodiment may be formed by additive manufacturing (e.g., 3-D printing), and thus may be formed as several layers and/or as a single component.

In exemplary embodiments, the first fluid may be a lipid in ethanol (also referred to herein as a lipid master mix) and the second fluid may be a nucleic acid in a buffer. The nucleic acid in the lipid master mix and the buffer can enter the vortex mixing chamber via alternating inlet ports. Thus, in embodiments with four inlet channels/ports, the lipid master mix may flow through the first inlet channel to the vortex mixing chamber via the first inlet port; the nucleic acid in the buffer can flow through the second inlet channel to the vortex mixing chamber via the second inlet port; the lipid master mixture may flow through the third inlet channel to the vortex mixing chamber via the third inlet port; and the nucleic acid in the buffer can flow through the fourth inlet channel to the vortex mixing chamber via the fourth inlet port. The first inlet port may enter the vortex mixing chamber at exactly or approximately 0 degrees; the second inlet port may be exactly or approximately about 90 degrees; the third inlet port may be exactly or substantially 180 degrees; and the fourth inlet port may be exactly or approximately 270 degrees. By mixing the two fluids in a vortex mixing chamber, lipid nanoparticles are formed containing nucleic acids therein.

Fig. 8 shows an embodiment of a two-stage mixer 800. The configuration of first stage mixer 801 may be similar to any of the vortex mixers discussed above. As shown, first stage mixer 801 has a vortex mixing chamber 850, vortex mixing chamber 850 having first and second walls 851, 852 and a sidewall 853 connecting first and second walls 851, 852. The vortex mixing chamber 850 may have four inlet ports 825, 830, 835, 840 arranged along the sidewall 853. Each of the four inlet ports 825, 830, 835, 840 may receive fluid from a respective inlet passage 805, 810, 815, 820. The first inlet channel 805 and the third inlet channel 815 may receive a first fluid, and the second inlet channel 810 and the fourth inlet channel 820 may receive a second fluid. In some embodiments, each inlet channel 805, 810, 815, 820 may receive fluid from a separate fluid source. In other embodiments, the first inlet passage 805 and the third inlet passage 815 may receive a first fluid from a first fluid source; the first fluid may pass through a first fluid splitter that directs the first fluid to the first inlet passage 805 and the third inlet passage 815. Accordingly, the second inlet channel 810 and the fourth inlet channel 820 may receive a second fluid from a second fluid source; the second fluid may pass through a second fluid flow splitter that directs the second fluid to the second inlet channel 810 and the fourth inlet channel 820. As discussed above, the first and second fluid diverters may be internal or external diverters.

The first fluid flows through the first inlet passage 805 and into the vortex mixing chamber 850 via the first inlet port 825, and flows through the third inlet passage 815 and into the vortex mixing chamber 850 via the third inlet port 835. The first inlet port 825 and the third inlet port 835 may be precisely or substantially 180 degrees from each other and may direct the first fluid such that the first fluid enters the vortex mixing chamber 850 tangentially. In other embodiments, the first inlet port 825 and the third inlet port 835 may direct the first fluid such that the first fluid enters the vortex mixing chamber 850 orthogonally or at an angle between tangential and orthogonal. Similarly, the second fluid flows through the second inlet channel 810 and into the vortex mixing chamber 850 via the second inlet port 830, and flows through the fourth inlet channel 820 and into the vortex mixing chamber 850 via the fourth inlet port 840. The second and fourth inlet ports 830, 840 may be exactly or approximately 180 degrees from each other and may be exactly or approximately about 90 degrees from the first and third inlet ports 825, 835. The second inlet port 830 and the fourth inlet port 840 direct the second fluid such that the second fluid enters the vortex mixing chamber 850 tangentially, orthogonally, or at any angle therebetween.

The vortex mixing chamber 850 may have an outlet port (not shown) with an outlet passage 860 connected thereto. The outlet port may be disposed on a second wall 852 of the vortex mixing chamber 850. The outlet port may be disposed at a center, such as a radial center, of the second wall 852. The effluent from first stage mixer 801 flows from vortex mixing chamber 850 through an outlet port and exits via outlet passage 860.

The first stage mixer effluent flows through outlet passage 860 and into second stage mixer 802. In the embodiment shown in fig. 8, second stage mixer 802 has a vortex mixing chamber 880. Vortex mixing chamber 880 has a first wall 881, a second wall 882, and a sidewall 883 connecting first wall 881 and second wall 882. First stage mixer effluent flows out of outlet passage 860 and into vortex mixing chamber 880 via second stage mixer inlet port 875. A second stage mixer inlet port 875 may be configured in the first wall 881 of the vortex mixing chamber 880. In some embodiments, the second stage mixer inlet port 875 may be disposed in the center of the first wall 881, such as the radial center of the first wall 881.

The vortex mixing chamber 880 may have an additional inlet port. In the embodiment shown in fig. 8, the vortex mixing chamber 880 has two additional inlet ports 876, 877. Two additional inlet ports 876, 877 can be configured to receive the second stage influent fluid from two inlet passages 878, 879. The two additional inlet ports 876, 877 may be configured at exactly or approximately 180 degrees from each other and may be configured to direct fluid tangentially into the vortex mixing chamber 880. In other embodiments, the two additional inlet ports 876, 877 can be configured to direct fluid entering the vortex mixing chamber 880 non-tangentially, such as at an orthogonal angle or at any angle between orthogonal and tangential. The second stage influent fluid may be received from two separate fluid sources, or may be received from a single fluid source and split via an internal or external splitter, as discussed above. In some embodiments, inlet port 825 may receive a first fluid, inlet port 830 may receive a second fluid, inlet port 835 may receive a third fluid, and inlet port 840 may receive a fourth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid. In some embodiments, the first fluid and the third fluid may comprise a lipid. In some embodiments, the first fluid and the third fluid may comprise ethanol. In some embodiments, the second and fourth fluids may comprise nucleic acids. In some embodiments, the second and fourth fluids may comprise ethanol. In some implementations, inlet port 876 can receive a fifth fluid and inlet port 877 can receive a sixth fluid. In some embodiments, the fifth fluid may be the same as or substantially similar to the sixth fluid. In some embodiments, the fifth fluid and the sixth fluid may comprise nucleic acids.

Vortex mixing chamber 880 may have a second stage mixer outlet port 889 with a second stage mixer outlet passage 890 connected thereto. The second stage mixer outlet port may be disposed at a center, such as a radial center, of the second wall 882. The effluent from the second stage mixer 802 flows from the vortex mixing chamber 880 through the outlet port and exits via the second stage mixer outlet passage 890.

Fig. 9A-9B show an alternative embodiment of a two-stage mixer 900. First stage mixer 901 is configured like first stage mixer 801 of fig. 8. As shown, the first stage mixer 901 has a vortex mixing chamber 950, the vortex mixing chamber 950 having first and second walls 951 and 952 and a sidewall 953 connecting the first and second walls 951 and 952. The vortex mixing chamber 950 may have four inlets 925, 930, 935, 940 arranged along the sidewall 953. Each of the four inlet ports 925, 930, 935, 940 may receive fluid from a respective inlet passage 905, 910, 915, 920. The first inlet passage 905 and the third inlet passage 915 may receive a first fluid, and the second inlet passage 910 and the fourth inlet passage 920 may receive a second fluid. In some embodiments, each inlet channel 905, 910, 915, 920 can receive fluid from a separate fluid source. In other embodiments, the first inlet passage 905 and the third inlet passage 915 may receive a first fluid from a first fluid source; the first fluid may pass through a first fluid splitter that directs the first fluid to the first inlet passage 905 and the third inlet passage 915. Accordingly, the second inlet passage 910 and the fourth inlet passage 920 may receive a second fluid from a second fluid source; the second fluid may pass through a second fluid flow splitter that directs the second fluid to the second inlet channel 910 and the fourth inlet channel 920. As discussed above, the first and second fluid diverters may be internal or external diverters. However, in the embodiment of fig. 9A-9B, second stage mixer 902 is rotated laterally such that outlet passage 960 from first stage mixer 901 is configured to enter second stage vortex mixing chamber 980 via second stage mixer inlet port 975 configured along sidewall 983 of vortex mixing chamber 980. Second stage mixer inlet port 975 is configured such that first stage mixer effluent enters second stage vortex mixing chamber 980 tangentially. In other embodiments, second stage mixer inlet port 975 may be configured such that first stage mixer effluent enters second stage vortex mixing chamber 980 non-tangentially, such as orthogonal to vortex mixing chamber 980 or at any angle between orthogonal and tangential. In fig. 9A, the second stage mixing chamber 980 also has a second inlet port 976 disposed along a sidewall 983 of the mixing chamber 980. The second inlet port 976 has an inlet passage 978 connected thereto. The second inlet passage 978 receives a second stage inlet fluid. The second stage inlet fluid flows out of the inlet passage 978 via the second inlet port 976 and into the mixing chamber 980. The second inlet port 976 is configured to provide a tangential flow of fluid into the mixing chamber 980. In the embodiment of fig. 9B, the second inlet port 976 is configured orthogonal to the mixing chamber 980, and the second inlet passage 978 connects with the second inlet port 976. In other embodiments, the second inlet port 976 may be configured to cause fluid to flow into the mixing chamber 980 at any angle between orthogonal and tangential angles. The second inlet port 976 may be configured to be exactly or approximately 180 degrees from the inlet port 975. The second stage mixer 902 may have a second stage outlet port (not shown) that directs the second stage effluent fluid to a second stage outlet channel 990. In some embodiments, inlet port 925 may receive a first fluid, inlet port 930 may receive a second fluid, inlet port 935 may receive a third fluid, and inlet port 940 may receive a fourth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid. In some embodiments, the first fluid and the third fluid may comprise a lipid. In some embodiments, the first fluid and the third fluid may comprise ethanol. In some embodiments, the second and fourth fluids may comprise nucleic acids. In some embodiments, the second and fourth fluids may comprise ethanol.

Fig. 10 shows another alternative embodiment of a two-stage mixer 1000. First stage mixer 1001 and second stage mixer 1002 are each configured like first stage mixer 801 of fig. 8. As shown, the first stage mixer 1001 has a vortex mixing chamber 1050, the vortex mixing chamber 1050 having first and second walls 1051, 1052 and a sidewall 1053 connecting the first and second walls 1051, 1052. The vortex mixing chamber 1050 may have four inlet ports 1025, 1030, 1035, 1040 disposed along the sidewall 1053. Each of the four inlet ports 1025, 1030, 1035, 1040 can receive fluid from a respective inlet channel 1005, 1010, 1015, 1020. The first inlet channel 1005 and the third inlet channel 1015 may receive a first fluid, and the second inlet channel 1010 and the fourth inlet channel 1020 may receive a second fluid. In some embodiments, each inlet channel 1005, 1010, 1015, 1020 can receive fluid from a separate fluid source. In other embodiments, the first inlet channel 1005 and the third inlet channel 1015 may receive a first fluid from a first fluid source; the first fluid may pass through a first fluid splitter that directs the first fluid to first inlet channel 1005 and third inlet channel 1015. Accordingly, the second inlet passage 1010 and the fourth inlet passage 1020 may receive the second fluid from the second fluid source; the second fluid may pass through a second fluid flow splitter that directs the second fluid to the second inlet channel 1010 and the fourth inlet channel 1020. As discussed above, the first and second fluid diverters may be internal or external diverters. Here, the first stage mixer effluent flows out of first stage vortex mixing chamber 1050 through outlet passage 1060 and into flow splitter 1061. The flow splitter 1061 splits the first stage mixer effluent flow and directs the first stage mixer effluent flow into the first inlet passage 1075 and the third inlet passage 1077 of the second stage mixer 1002. The second stage influent flows into the second inlet passage 1076 and the fourth inlet passage 1078. The second stage influent fluid may be received from two separate fluid sources, or may be received from a single fluid source and split via an internal or external splitter, as discussed above.

First, second, third, and fourth inlet passages 1075, 1076, 1077, and 1078 may be fluidly connected with second stage vortex mixing chamber 1080 via first, second, third, and fourth inlet ports 1085, 1086, 1087, and 1088, respectively. The first inlet passage 1075 may be disposed in a sidewall 1081 of the vortex mixing chamber 1080. The first, second, third, and fourth inlet ports 1085, 1086, 1087, 1088 may each be separated from one another by approximately 90 degrees about the circumference of the sidewall 1083. First inlet port 1085 and third inlet port 1087 may intersect with one another, i.e., are approximately or exactly 180 degrees apart, and second inlet port 1086 and fourth inlet port 1088 may intersect with one another, i.e., are approximately or exactly 180 degrees apart. First inlet port 1085, second inlet port 1086, third inlet port 1087, and fourth inlet port 1088 may each be configured to direct fluid tangentially with respect to a sidewall 1083 of vortex mixing chamber 1080. In alternative embodiments, inlet ports 1085, 1086, 1087, 1088 may be configured to direct fluid at an orthogonal angle relative to sidewall 1083, or inlet ports 1085, 1086, 1087, 1088 may be configured to direct fluid at any angle between an orthogonal angle and tangential to sidewall 1083. Second stage vortex mixing chamber 1080 may have a second stage mixer outlet port 1089, second stage mixer outlet port 1089 having second stage mixer outlet passage 1090 connected thereto. The second stage mixer outlet port can be disposed at a center, such as a radial center, of the second wall 1082. The effluent from second stage mixer 1002 flows from vortex mixing chamber 1080 through an outlet port and exits via second stage mixer outlet passage 1090. In some implementations, inlet port 1025 can receive a first fluid, inlet port 1030 can receive a second fluid, inlet port 1035 can receive a third fluid, and inlet port 1040 can receive a fourth fluid. In some embodiments, the first fluid is the same as or substantially similar to the third fluid. In some embodiments, the second fluid is the same as or substantially similar to the fourth fluid. In some embodiments, the first fluid and the third fluid may comprise a lipid. In some embodiments, the first fluid and the third fluid may comprise ethanol. In some embodiments, the second and fourth fluids may comprise nucleic acids. In some embodiments, the second and fourth fluids may comprise ethanol. In some implementations, the inlet port 1076 can receive a fifth fluid and the inlet port 1077 can receive a sixth fluid. In some embodiments, the fifth fluid may be the same as or substantially similar to the sixth fluid. In some embodiments, the fifth fluid and the sixth fluid may comprise nucleic acids.

As discussed above, in some embodiments of each of the embodiments shown in fig. 5, 8, 9, and 10, the first stage mixer receives the lipids (lipid master mix) in ethanol and an acidic buffer. After mixing in the first stage vortex mixing chamber, the first stage mixer effluent is empty lipid nanoparticles. The size of the empty lipid nanoparticles depends on a number of mixing parameters, such as turbulent kinetic energy and mixing time (τ)_mix). The fluid containing the empty lipid nanoparticles passes through the first stage mixer outlet channel. When this occurs, the time (τ) elapses_res) Then the first stage of mixingThe outflow from the mixer enters the second stage mixer. As discussed above for each of fig. 5, 8, 9, and 10, the empty lipid nanoparticles enter the second stage mixer; nucleic acids were also introduced into the second stage mixer as described for each of fig. 5, 8, 9 and 10. Thus, the empty lipid nanoparticles are mixed with the nucleic acid in the second stage mixer. The nucleic acid is incorporated into the empty lipid nanoparticle and forms a nanoparticle that retains the nucleic acid. The fluid containing the nucleic acid-retaining nanoparticles then exits the second stage mixer via the second stage mixer outlet port and enters the second stage mixer outlet channel. When scaling up the mixer, the wall effect and inlet flow regime change, but the speed of adjustment can restore the desired mixing characteristics.

Fig. 11A, 11B, 11C, and 11D show a mixing system 1100 according to an embodiment. In some embodiments, mixing system 1100 may have multiple single stage mixers or a multi-stage mixing system. In some embodiments, the mixer can have the same or substantially similar characteristics as the mixers described herein with reference to fig. 1A-1E, fig. 2, fig. 3A-3B, and/or fig. 4A-4C. In some embodiments, the multi-stage mixing system may have the same or substantially similar characteristics as the multi-stage mixing system described herein with reference to fig. 5, 6A-6B, 7A-7B, 8, 9A-9B, and/or 10. In this embodiment, inlet ports 1166, 1167, 1168, 1169 feed inlet channels 1105, 1110, 1115, 1120, respectively. The inlet channels 1105, 1110, 1115, 1120 feed into the vortex mixing chamber 1150 and exit through the outlet port 1155 and outlet channel 1160. In this embodiment, the inlet ports 1166, 1167, 1168, 1169 are pipettes coupled with the mixer plate 1121. The mixing plate 1121 includes n reactors arranged side by side in a d x w configuration in the plane of the mixing plate 1121, where n, d, and w are integers. In the embodiment depicted in fig. 11A and 11B, n is 24, d is 6, and w is 4. In this embodiment, the number of pipettes used is 96, since there are 4 inlet ports on each vortex mixer. In some embodiments, mixing system 1100 may include all single stage mixers as described above in fig. 1A-1E. In some embodiments, mixing system 1100 may include all multi-stage mixing systems as described in fig. 5. In some embodiments, d and/or w can be 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or greater.

Fig. 12 shows a mixing system 1200 with a mixing plate 1221, according to an embodiment. In some embodiments, as described in fig. 11, the mixing plate 1221 can be the same as or substantially similar to the mixing plate 1121 and can be attached to a plurality of pipettes (not shown) to form a mixing system the same as or substantially similar to the mixing system 1100 described above with reference to fig. 11. The mixing plate 1221 may be in a fixed position relative to the transfer gantry 1220. Mixing system 1200 can include a plurality of product containers 1222. After the mixed fluid has moved through the system of single or multiple stages of vortex mixers within mixing plate 1221, the mixed fluid may be deposited into product container 1222. The product container 1222 may have a number of cavities corresponding to the number of single or multi-stage vortex mixers on the mixing plate 1221. Mixing plate 1221 may dispense product from each of its single or multi-stage vortex mixers into product container 1222 one at a time. Once a single product container 1222A has received the desired amount of product fluid, the flow of fluid into the single product container 1222A may be temporarily stopped while the transfer gantry 1220 moves a subsequent product container 1222B to a position such that the subsequent product container 1222B may receive product. This process may continue for n product containers 1222, where n is an integer. In some embodiments, n can be 2,3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or greater. In some embodiments, the mixing system 1200 may be automated.

However, in some embodiments, fouling occurs and foulants accumulate in the vortex mixing chamber. This can lead to pressure rise and spike formation as the accumulated foulant blocks the outlet port. Foulants may also accumulate at or near the sidewalls. At long mixing times, fouling build-up leads to increased differential pressure indicators (PDI) and decreased mixing efficiency. This further results in a reduced mixing quality at or near the side wall of the vortex mixing chamber. This is illustrated in fig. 13A-13C. FIG. 13A shows foulants accumulating in the vortex mixing chamber 1350 of the vortex mixer 1300. Fig. 13B is a graph showing pressure buildup as fouling occurs over time. FIG. 13C shows pressure buildup near the sidewalls of vortex mixing chamber 1350 due to foulant buildup at the middle chamber and first and/or second walls of the vortex mixing chamber.

In some such embodiments, the height of the vortex mixing chamber can be the same as the height of the inlet port and/or inlet channel. This scaling is shown in fig. 14A. However, increasing the height of the vortex mixing chamber was found to reduce fouling and improve mixing quality. Thus, fig. 14B shows an alternative embodiment in which the height of the vortex mixing chamber is increased while the other relative dimensions of the vortex mixer 1400 remain the same. Thus, the height of the vortex mixing chamber is greater than the height of the inlet port and/or inlet channel. In one such embodiment, as shown in fig. 14B, the sidewall 1453 of the vortex mixing chamber 1450 may extend above the top of the inlet ports 1425, 1430, 1435, 1440 and may extend below the bottom of the inlet ports 1425, 1430, 1435, 1440. Thus, the distance between the first wall 1451 and the second wall 1452 of the vortex mixing chamber is greater than the height of the inlet ports 1425, 1430, 1435, 1440. In some embodiments, the inlet ports 1425, 1430, 1435, 1440 may be centered within the height of the sidewall 1453. A comparison of pressure over time in the embodiment of fig. 14A and 14B is shown in the graph of fig. 14C. The baseline pressure decreases and the operating time before the pressure increases.

FIGS. 14D-F show exemplary vortex mixers in different proportions: FIG. 14D shows an exemplary vortex mixer with an outlet port/outlet channel diameter of about 0.3 mm; FIG. 14E shows an exemplary vortex mixer with an outlet port/outlet channel diameter of about 1.0 mm; and figure 14F shows an exemplary vortex mixer with an outlet port/outlet channel diameter of about 4.0 mm. All other dimensions scale accordingly.

For example, in an initial embodiment, the outlet port/outlet channel diameter may be about 1.0mm, and the dimensions may be as follows:

vortex mixer component	1x proportional size
		Diameter of vortex mixing chamber	About 5.00mm
Height of vortex mixing chamber	About 1.75mm
		Inlet channel/inlet port height	About 0.75mm
Inlet channel/inlet port width	About 0.75mm
		Length of inlet channel	About 10.0mm
Outlet channel/outlet port diameter	About 1.00mm
		Length of outlet channel	About 10.0mm

The size of the vortex mixer can be scaled up or down. For example, the dimensions may be 0.25x, 0.5x, 0.75x, 1x, 2x, 2.5x, 3x, 4x, 5x, and/or any other ratio. Exemplary dimensions are shown in the following table:

by varying the dimensions, the flow rates through the inlet channel/inlet port and the outlet channel/outlet port can be scaled. In the exemplary embodiment, the first fluid flows through first inlet channel 1405 to first inlet port 1425 and through third inlet channel 1415 to third inlet port 1435, and the second fluid flows through second inlet channel 1410 to second inlet port 1430 and through fourth inlet channel 1420 to fourth inlet port 1440. The first and second fluids may be directed to each respective inlet channel by separate fluid inlet lines (not shown) or via a flow splitter as discussed above. The first and third inlet ports 1425, 1435 may allow the first fluid to enter the vortex mixing chamber 1450 directly or substantially crosswise to one another. Similarly, the second and fourth inlet ports 1430, 1440 may allow the second fluid to enter the vortex mixing chamber 1450 directly or substantially crosswise to each other. Each of the first, second, third, and fourth inlet ports 1425, 1430, 1435, 1440 may each allow fluid to enter the vortex mixing chamber at exactly or substantially 90 ° from the other inlet ports. As discussed above, the inlet ports 1425, 1430, 1435, 1440 and inlet channels 1405, 1410, 1415, 1420 may be tangential to the vortex mixing chamber 1450, orthogonal to the vortex mixing chamber 1450, or configured at any angle therebetween.

In some embodiments, when the 1x ratio discussed above is employed, the flow rate of the first fluid through each of the first and third inlet channels 1405, 1415 may be 15ml/min and the flow rate of the second fluid through each of the second and fourth inlet channels 1410, 1420 may be 45 ml/min. The flow rate through the outlet channel 1460 may be 120 ml/min. As discussed above, these rates may change as the vortex mixer is scaled up or down. Thus, for example, the flow rate may be varied as follows:

by increasing the height of the vortex mixing chamber as discussed above with respect to fig. 14A-14B, it may be necessary to increase the flow rate in order to maintain a comparable mixing energy. Fig. 15A-15C show mixing in the chamber, where the dark blue is unmixed (or minimally mixed) and the green is fully mixed (or approximately fully mixed). Fig. 15A shows mixing in a 1x ratio vortex mixer at a set inlet speed, while fig. 15B shows mixing in a 4x ratio vortex mixer at the same set inlet speed. The 1x ratio vortex mixer of fig. 15A produces significantly more mixing than the 4x ratio vortex mixer of fig. 15B at the same set inlet speed. Thus, to allow a larger proportion of the vortex mixer to produce more mixing, the inlet velocity is increased, as shown in fig. 15C. Fig. 15D is a graph showing the mixing timescale (in ms) as a function of inlet velocity (m/s) along with fig. 15A-15C.

Further, increasing the height of the vortex mixing chamber such that the vortex mixing chamber height is greater than the height of the inlet arm and inlet port-from the embodiment shown in fig. 14A to the embodiment shown in fig. 14B-results in a reduction in the coefficient of variation while maintaining a center mixing mode. The coefficient of variation (CoV) may be a particular distribution of phases at the outlet port and/or outlet channel, and may be:

in an exemplary embodiment, increasing the height of the vortex mixing chamber results in a reduction in the coefficient of variation from 61 to 35. The corresponding changes at the horizontal midplane, vertical midplane, and first wall of the vortex mixing chamber are shown in figure 15E. The left hand column of fig. 15E shows the mass fraction of the first fluid during mixing for the embodiment discussed in fig. 14A above; the right hand column of fig. 15E shows the mass fraction of the first fluid during mixing for the embodiment discussed above for fig. 14B. In the exemplary embodiments discussed above, FIG. 15E may show the mass fraction of ethanol in the vortex mixer.

Fig. 16A shows exemplary minimum flow rates and minimum and maximum batch sizes for various outlet channel/outlet port diameters. Other dimensions of the vortex mixer may correspond and scale similarly to the previous figures. Fig. 16B is a graph showing the diameter (nm) of nanoparticles formed as a function of total flow rate (ml/min) for 0.3mm, 0.5mm, and 1.0mm outlet channel/outlet port diameters. Fig. 16C shows the diameter (nm) of the nanoparticles formed as a function of inlet velocity (m/s) for 0.3mm, 0.5mm, and 1.0mm outlet channel/outlet port diameters. FIG. 16D shows the diameter (nm) of the formed particles as a function of inlet velocity (m/s) for 1.0mm, 2.0mm, and 4.0mm outlet channel/outlet port diameters.

Based on the data of fig. 16D, a faster inlet speed was required to achieve the same particle diameter in the larger scale mixer. That is, to obtain the same particle diameter, the inlet velocity in the mixer with the outlet channel/outlet port diameter of 4.0mm is faster compared to the mixer with the outlet channel/outlet port diameter of 2.0mm and the mixer with the outlet channel/outlet port diameter of 1.0 mm. And the inlet speed of the mixer with an outlet channel/outlet port diameter of 2.0mm was slower than that of the mixer with an outlet port/outlet diameter of 4.0m/s and faster than that of the mixer with an outlet port/outlet diameter of l.0 m/s. By comparing the velocities required to obtain the particle diameter, an effective velocity adjustment can be applied. Due to energy losses in larger mixers, a 2.0mm outlet port/outlet diameter mixer loses about or exactly 10% of the energy compared to a 1.0mm outlet port/outlet diameter mixer, and a 4.0mm outlet port/outlet diameter mixer loses about or exactly 30% of the energy compared to a 1.0mm outlet port/outlet diameter mixer. Taking into account this energy loss, an effective speed adjustment can be made to the inlet speed to determine an adjusted inlet speed-hence an effective speed adjustment of 100% for a 1.0mm outlet port/outlet diameter mixer; for a 2.0mm outlet port/outlet diameter mixer, the effective velocity is adjusted to 90% (accounting for 10% energy loss); and for a 4.0mm outlet port/outlet diameter mixer, the effective velocity was adjusted to 70% (accounting for 30% energy loss). These values are shown in the table of fig. 16E.

Fig. 16F shows the graph of fig. 16D after applying the effective speed adjustment of fig. 16E. Thus, FIG. 16F shows particle diameter (nm) as a function of adjusted inlet velocity (m/s). FIG. 16G shows the pressure (psi) within the vortex mixer as a function of adjusted inlet velocity (m/s). This shows that although the particle diameter (nm) can be adjusted by changing the inlet velocity, increased inlet velocity results in higher operating pressures.

FIG. 16H shows the diameter (nm) of nanoparticles formed as a function of the Turbulent Kinetic Energy (TKE) (J/kg) for 0.3mm, 0.5mm, and 1.0mm outlet channel/outlet port diameters. TKE may be the average kinetic energy per unit mass associated with turbulent eddy currents in the flow. Fig. 16I shows the diameter (nm) of the nanoparticles formed as a function of the minimum mixing time (ms) for 0.3mm, 0.5mm and 1.0mm outlet channel/outlet port diameters. As shown, the diameter depends on the turbulent kinetic energy and the minimum mixing time (τ)_mix) And (4) zooming. The time to reach a well-mixed state is defined by the following equation:

e ∈ turbulent energy dissipation rate [ J/kg/s ]

v-kinematic viscosity [ m ═²/s]；

D-diffusion coefficient [ m²/s]

The time that the fluid is held in the vortex mixing chamber should be greater than the micro-mixing timescale. Otherwise, the fluid would be discharged from the mixer before being completely mixed. Thus, the average residence time for the fluid to remain in the chamber should be:

q is the volumetric flow rate [ m³/s]

V is the mixer volume [ m³]

Based on the data of the graphs in FIGS. 16H-16I, it was found that TKE when turbulent kinetic energy is used>2J/kg, mixing time τ_mix<5 ms. When using larger geometries, as discussed above, at constant velocity, it may be desirable to increase TKE and decrease τ in order to achieve complete turbulent distribution in the vortex mixing chamber_mix. TKE (J/kg) as a function of inlet velocity (m/s) for 0.5mm, 1.0mm, 2.0mm and 4.0mm outlet channel/outlet port diameters is shown in FIG. 16J. The minimum mixing time (ms) as a function of inlet velocity (m/s) for these same geometries is shown in fig. 16K.

Fig. 16L shows the minimum total flow rate (ml/min) to achieve adequate mixing for various mixer ratios (mm of outlet port/outlet channel diameter). FIG. 16M is a table showing the minimum total flow rates for a mixer having 0.3mm outlet port/outlet channel diameter, 0.5mm outlet port/outlet channel diameter, 1.0mm outlet port/outlet channel diameter, 2.0mm outlet port/outlet channel diameter, and 4.0mm outlet port/outlet channel diameter.

FIG. 16N shows the inlet Reynolds number as a function of inlet velocity (m/s) for 0.5mm outlet channel/outlet port diameter, 1.0mm outlet channel/outlet port diameter, 2.0mm outlet channel/outlet port diameter, and 4.0mm outlet channel/outlet port diameter.

In some embodiments, the nucleic acids are found to mix prematurely and precipitate when the nucleic acids interact with ethanol. Premature mixing of the nucleic acids affects efficient assembly of the lipid nanoparticles, and precipitation leads to fouling. Thus, as discussed in the above exemplary embodiments, instead of forming lipid nanoparticles having nucleic acids contained therein in a single step, a two-stage vortex mixer may be used. The two-stage vortex mixer may have two mixers in series: a first stage vortex mixer and a second stage vortex mixer. The first stage vortex mixer may mix the lipid in the ethanol (i.e., the lipid master mix) and the acidic buffer to form empty nanoparticles, and the second stage vortex mixer may mix the empty nanoparticles formed in the first stage vortex mixer with the nucleic acid to form nucleic acid-retaining nanoparticles. Thus, there is a time difference between the formation of empty nanoparticles and the addition of nucleic acid to form nanoparticles that retain nucleic acid. As such, empty nanoparticles are completely formed prior to introduction of the nucleic acid. The nucleic acids are not exposed to the non-emulsified buffer, thereby avoiding degradation of the nucleic acids by exposure to acidified buffers. Instead, empty lipid nanoparticles are formed, the nucleic acid is introduced into a second stage vortex mixer, and the nucleic acid is incorporated into the empty lipid nanoparticles by hydrophobic interactions and/or charged interactions. This results in better encapsulation of the nucleic acid in the lipid nanoparticle, which in turn results in a more uniform particle.

Fig. 17A shows a graphical representation of the change in pressure from baseline pressure (psi) over time (min). The green plot shows the pressure change in the single stage mixer, while the orange plot shows the pressure change in the dual stage mixer shown in fig. 10. Fig. 17B is a graphical representation of the change in pressure from baseline pressure (psi) over time (min). FIG. 17B shows the same plot as FIG. 17A, with the green plot showing the pressure change in the single stage mixer and the orange plot showing the pressure change in the dual stage mixer of FIG. 10, but here the pressure change in the dual stage mixer of FIG. 5 is shown in red. This shows that the pressure variation and pressure spikes are greatly reduced in the embodiment of fig. 5 compared to the single and dual stage mixers of fig. 10. This is at least in part because the embodiment of fig. 5 results in much less fouling than the single and dual stage mixers of fig. 10.

Fig. 17C shows the second stage mixer 1002 after a sample testing run of the embodiment in fig. 10. Fig. 17D shows the second stage mixer 502 after a sample testing run of the embodiment in fig. 5. Fig. 17D shows no or little precipitant, meaning no or little fouling occurs, while fig. 17C shows the accumulation of precipitant, meaning fouling occurs, and explains the increased pressure and pressure peaks shown in the green and orange plots of fig. 17A-17B.

FIG. 18A shows a fluid path line in an exemplary vortex mixer receiving two fluids via inlet ports/channels along a sidewall 1853 of a vortex mixing chamber 1850. The first fluid enters the vortex mixing chamber 1850 via the first inlet passage 1805/inlet port 1825 and via the third inlet passage 1815/inlet port 1835, and the second fluid enters the vortex mixing chamber 1850 via the second inlet passage 1810/inlet port 1830 and via the fourth inlet passage 1820/inlet port 1840. FIG. 18A shows the first fluid in blue entering the vortex mixing chamber 1850 via the first inlet passage 1805/inlet port 1825 and the second fluid in red after entering the vortex mixing chamber 1850 via the second inlet passage 1810/inlet port 1830. For ease of viewing, the colors relating to the third and fourth inlet channels/ports are not shown. Once the blue and red fluids are completely mixed, the fluid path lines are shown in yellow. In this embodiment, and as can be seen in fig. 18A, there is a concentration of the first fluid along the sidewall after the first inlet port 1825 and a concentration of the second fluid along the sidewall after the second inlet port 1830. Thus, mixing begins along the sidewall 1853 of the vortex mixing chamber 1850 and the fully mixed fluid moves around the vortex mixing chamber 1850 toward the center of the chamber until the mixed fluid reaches the outlet port and exits via the outlet passage 1860. This configuration may result in significant fouling because so much mixing occurs at the sidewall 1850, and because there is supersaturation of the first fluid after the first and third inlet ports 1825, 1835, and supersaturation of the second fluid after the second and fourth inlet ports 1830, 1840.

Fig. 18B shows the fluid lines in an alternative configuration of a vortex mixer, such as the configuration shown in the second stage mixer 502 of fig. 5 (and discussed above with respect to fig. 17B and 17D). Here, the first fluid may enter the vortex mixing chamber 1880 via at least the first inlet channel 1875/inlet port 1885 and the second inlet channel 1877/inlet port 1886, and the second fluid may enter the vortex mixing chamber 1880 via the third inlet channel 1878/inlet port 1888. The first and second inlet ports 1885, 1886 may be disposed along a sidewall 1883 of the vortex mixing chamber 1880, while the third inlet port 1888 may be disposed on a first wall 1881 of the vortex mixing chamber 1880. The first wall 1881 of the vortex mixing chamber 1880 may be disposed opposite a second wall 1882 of the vortex mixing chamber 1880, wherein the first wall 1881 and the second wall 1882 are parallel (or substantially parallel) to one another and connected via a sidewall 1883. In some embodiments, the third inlet port 1888 may be disposed at or near a radial center of the first wall 1881 and may be opposite the outlet port 1889 disposed at or near a radial center of the second wall 1882. The outlet port 1889 may be connected with an outlet passage 1890.

In fig. 18B, the blue flow line represents the second flow entering the vortex mixing chamber 1880 from the third inlet passage 1878/inlet port 1888. The second fluid mixes with the first fluid (not shown) swirling around vortex mixing chamber 1880. Mixing occurs at or near the center of the vortex mixing chamber 1880. Some, most, or all mixing occurs in the vortex mixing chamber 1880, after which the mixed fluid, shown in yellow, exits the vortex mixing chamber 1880 via the outlet port 1889 and enters the outlet passage 1890. In some embodiments, all or substantially all mixing occurs in the vortex mixing chamber 1880, after which the mixed fluid exits the vortex mixing chamber 1880 via the outlet port 1889 to the outlet passage 1890. In some embodiments, some mixing may occur in the vortex mixing chamber 1880, and mixing may continue as the fluid swirls through the outlet port 1889 and into the outlet passage 1890.

In the embodiment of fig. 18B, mixing occurs at or near the center of the vortex mixing chamber 1880. This configuration results in reduced fouling and reduced mixing time because mixing occurs away from the walls of the vortex mixing chamber 1880 and because it avoids over-saturation of the alternating fluid, as shown in fig. 18A.

Fig. 19A-19B show the mixing ratio as a function of time(s). The mixing ratio denotes the ratio of the first component present in the first fluid to be mixed in the vortex mixer to the second component present in the second fluid to be mixed in the vortex mixer. For example, when mixing lipids and nucleic acids, a local N: P ratio may be employed, where N represents a nitrogen group in the lipid and P represents a phosphorus group in the nucleic acid. Fig. 19A shows the mixing ratio as a function of time(s) in the embodiment of fig. 18A, while fig. 19B shows the mixing ratio as a function of time(s) in the embodiment of fig. 18B. Thus, in the mixer of fig. 18B, the equilibrium (e.g., the ratio of complete mixing) is achieved much faster than in the mixer of fig. 18A. In the embodiment of fig. 18B and 19B, the N: P ratio reaches equilibrium in about 0.002 seconds, while in the embodiment of fig. 18A and 19A, the N: P ratio does not reach equilibrium until about 0.025 seconds.

Although the exemplary embodiments discussed above are directed to the formation of nucleic acid-containing lipid nanoparticles, it should be noted that lipid nanoparticles may also encapsulate other nucleic acids, proteins, and the like.

Each embodiment of the vortex mixer discussed herein may be formed from a number of materials including, but not limited to, stainless steel, LFEM, acrylic, PEEK, 3-D print media, and the like.

Any and all references to publications or other documents provided in this application, including but not limited to patents, patent applications, articles, web pages, books, and the like, are incorporated by reference herein in their entirety.

Definition of

As used herein, the term "about" or "approximately" generally means ± 10% of the stated value, e.g., about 90 degrees will include 81 to 99 degrees, and about 1,000 μm will include 900 to 1,100 μm. In some embodiments, "about" or "approximately" generally means 9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2% or ± 1% of the stated value. In some embodiments, when "about" or "approximately" refers to an angular measurement, these terms generally mean ± 10 degrees, ± 9 degrees, ± 8 degrees, ± 7 degrees, ± 6 degrees, ± 5 degrees, ± 4 degrees, ± 3 degrees, ± 2 degrees, or ± 1 degree of the value. In some embodiments, when "about" or "approximately" refers to distance, these terms generally mean ± 10mm, ± 9mm, ± 8mm, ± 7mm, ± 6mm, ± 5mm, ± 4mm, ± 3mm, ± 2mm, ± lmm, ± 900 μm, ± 800 μm, ± 700 μm, ± 600 μm, ± 500 μm, ± 400 μm, ± 300 μm, ± 200 μm, ± 100 μm, ± 90 μm, ± 80 μm, ± 70 μm, ± 60 μm, ± 50 μm, ± 40 μm, ± 30 μm, ± 20 μm or ± 10 μm of the stated value.

Nucleic acids

In some embodiments, the nucleic acid is a polynucleotide (e.g., a ribonucleic acid or a deoxyribonucleic acid). The term "polynucleotide" in its broadest sense includes any compound and/or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use according to the present disclosure include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including one or more of messenger mrna (mrna), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In some embodiments, the nucleic acid or polynucleotide is RNA. The RNA may be selected from, but is not limited to, the group consisting of short polymers (shortmers), antanemia (antagomir), antisense, ribozymes, small interfering RNAs (sirna), asymmetric interfering RNAs (airna), micro RNAs (mirna), Dicer-substrate RNAs (dsrna), small hairpin RNAs (shrna), transfer RNAs (trna), messenger RNAs (mrna), and mixtures thereof. In some embodiments, the RNA is mRNA.

In some embodiments, the nucleic acid or polynucleotide is mRNA. The mRNA can encode any polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. The polypeptide encoded by the mRNA may be of any size and may have any secondary structure or activity. In some embodiments, a polypeptide encoded by an mRNA can have a therapeutic effect when expressed in a cell.

In some embodiments, the nucleic acid or polynucleotide is an siRNA. The siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, the siRNA can be selected to silence a gene associated with a particular disease, disorder, or condition upon administration of a lipid-containing composition comprising the siRNA to a subject in need thereof. The siRNA may comprise a sequence complementary to an mRNA sequence encoding a gene or protein of interest. In some embodiments, the siRNA can be an immunomodulatory siRNA.

In some embodiments, the nucleic acid or polynucleotide is a sgRNA and/or cas9 mRNA. sgRNA and/or cas9 mRNA can be used as gene editing tools. For example, sgRNA-cas9 complexes can affect mRNA translation of cellular genes.

In some embodiments, the nucleic acid or polynucleotide is a shRNA or a vector or plasmid encoding the same. Upon delivery of the appropriate construct to the nucleus, the shRNA may be produced within the target cell. Constructs and mechanisms associated with shRNA are well known in the relevant art.

Nucleic acids and polynucleotides useful in the present disclosure generally include a first region (e.g., a coding region) of linked nucleosides encoding a polypeptide of interest, a first flanking region (e.g., a 5'-UTR) located at the 5' -end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' -end of the first region, at least one 5 '-cap region, and a 3' -stabilizing region. In some embodiments, the nucleic acid or polynucleotide further comprises a poly a region or a Kozak sequence (e.g., in the 5' -UTR). In some embodiments, a polynucleotide may contain one or more intron nucleotide sequences capable of being cleaved from the polynucleotide. In some embodiments, a polynucleotide or nucleic acid (e.g., mRNA) can include a 5' cap structure, a chain terminating nucleotide, a stem loop, a polya sequence, and/or a polyadenylation signal. Any region of the nucleic acid can include one or more replacement components (e.g., replacement nucleosides). For example, the 3 '-stabilizing region can contain an alternative nucleoside, such as an L-nucleoside, a trans thymidine, or a 2' -O-methyl nucleoside and/or the coding region, a 5'-UTR, a 3' -UTR, or the cap region can include an alternative nucleoside, such as a 5-substituted uridine (e.g., 5-methoxyuridine), a 1-substituted pseudouridine (e.g., 1-methyl-pseudouridine or 1-ethyl-pseudouridine), and/or a 5-substituted cytidine (e.g., 5-methyl-cytidine).

In general, the shortest length of a polynucleotide may be a length sufficient to encode a polynucleotide sequence of a dipeptide. In some embodiments, the polynucleotide sequence is long enough to encode a tripeptide. In some embodiments, the polynucleotide sequence is of sufficient length to encode a tetrapeptide. In some embodiments, the polynucleotide sequence is of sufficient length to encode a pentapeptide. In some embodiments, the polynucleotide sequence is long enough to encode a hexapeptide. In some embodiments, the polynucleotide sequence is long enough to encode a heptapeptide. In some embodiments, the polynucleotide sequence is of sufficient length to encode an octapeptide. In some embodiments, the polynucleotide sequence is of sufficient length to encode a nonapeptide. In some embodiments, the polynucleotide sequence is of sufficient length to encode a decapeptide.

Examples of dipeptides that can be encoded by the alternative polynucleotide sequences include, but are not limited to, carnosine and anserine.

In some embodiments, the polynucleotide is greater than 30 nucleotides in length, greater than 35 nucleotides in length, at least 40 nucleotides in length, at least 45 nucleotides in length, at least 55 nucleotides in length, at least 50 nucleotides in length, at least 60 nucleotides in length, at least 80 nucleotides in length, at least 90 nucleotides in length, at least 100 nucleotides in length, at least 120 nucleotides in length, at least 140 nucleotides in length, at least 160 nucleotides in length, at least 180 nucleotides in length, at least 200 nucleotides in length, at least 250 nucleotides in length, at least 300 nucleotides in length, at least 3500 nucleotides in length, at least 400 nucleotides in length, at least 450 nucleotides in length, at least 500 nucleotides in length, at least 600 nucleotides in length, at least 700 nucleotides in length, at least 800 nucleotides in length, at least 900 nucleotides in length, at least 1000 nucleotides in length, at least 1100 nucleotides in length, at least 1200 nucleotides in length, at least 1300 nucleotides in length, at least 1400 nucleotides in length, at least 200 in length, at least 300 nucleotides in length, at least 200 in length, at least 500 nucleotides in length, at least 500, at least 600, at least 800 nucleotides in length, at least one length, at least one nucleotide in length, at least one nucleotide in length, at least one nucleotide, At least 1500 nucleotides, at least 1600 nucleotides, at least 1800 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 4000 nucleotides, at least 5000 nucleotides, or more than 5000 nucleotides.

Nucleic acids and polynucleotides may include one or more naturally occurring components, including any of the canonical nucleotides a (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In some embodiments, all or substantially all of the nucleotides comprising (a) a 5'-UTR, (b) an Open Reading Frame (ORF), (C) a 3' -UTR, (d) a poly a tail, and any combination of (a, b, C, or d above) comprise the naturally occurring canonical nucleotides a (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

Nucleic acids and polynucleotides can include one or more surrogate components as described herein that confer useful properties, including increased stability and/or lack of substantial induction of an innate immune response to cells into which the polynucleotide is introduced. For example, a replacement polynucleotide or nucleic acid exhibits reduced degradation in a cell into which the polynucleotide or nucleic acid is introduced relative to a corresponding unaltered polynucleotide or nucleic acid. These surrogate substances may increase the efficiency of protein production, the viability of the intracellular retention and/or contact cells of the polynucleotide, and have reduced immunogenicity.

Polynucleotides and nucleic acids may be naturally or non-naturally occurring. Polynucleotides and nucleic acids can include one or more modified (e.g., altered or substituted) nucleobases, nucleosides, nucleotides, or combinations thereof. Nucleic acids and polynucleotides can include any useful modification or alteration, such as modifications or alterations to nucleobases, sugars, or internucleoside linkages (e.g., to linked phosphate/to phosphodiester linkages/to phosphodiester backbones). In some embodiments, the alteration (e.g., one or more alterations) is present in each of the nucleobase, the sugar and the internucleoside linkage. The alteration according to the present disclosure may be a change from ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), for example a2 '-OH substitution of the ribofuranosyl ring to 2' -H, Threose Nucleic Acid (TNA), diol nucleic acid (GNA), Peptide Nucleic Acid (PNA), Locked Nucleic Acid (LNA) or hybrids thereof. Additional variations are described herein.

Polynucleotides and nucleic acids may or may not vary uniformly along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly altered in a polynucleotide or nucleic acid or in a given predetermined sequence region thereof. In some embodiments, all nucleotides X in a polynucleotide (or a given sequence region thereof) are altered, where X may be any of nucleotides A, G, U, C, or any of the combinations a + G, A + U, A + C, G + U, G + C, U + C, A + G + U, A + G + C, G + U + C or a + G + C.

Different sugar changes and/or internucleoside linkages (e.g., backbone structures) can be present at different positions in a polynucleotide. It will be understood by those of ordinary skill in the art that nucleotide analogs or other changes can be located anywhere in the polynucleotide such that the function of the polynucleotide is not substantially reduced. The alteration may also be a5 '-or 3' -end alteration. In some embodiments, the polynucleotide comprises a change at the 3' -terminus. A polynucleotide may contain about 1% to about 100% alternative nucleotides (relative to total nucleotide content, or relative to any one or more of one or more types of nucleotides, i.e., A, G, U or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, (ii) or any intermediate percentage, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is due to the presence of a canonical nucleotide (e.g., A, G, U or C).

A polynucleotide may contain a minimum of zero and a maximum of 100% substituted nucleotides, or any intermediate percentage, such as at least 5% substituted nucleotides, at least 10% substituted nucleotides, at least 25% substituted nucleotides, at least 50% substituted nucleotides, at least 80% substituted nucleotides, or at least 90% substituted nucleotides. For example, the polynucleotide may contain a substituted pyrimidine, such as a substituted uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the polynucleotide are replaced with a replacement uracil (e.g., a 5-substituted uracil). The substituted uracil can be substituted with a compound having a single unique structure, or can be substituted with a plurality of compounds having different structures (e.g., 2,3, 4, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the polynucleotide are replaced with a replacement cytosine (e.g., a 5-substituted cytosine). The substituted cytosine may be substituted with a compound having a single unique structure, or may be substituted with a plurality of compounds having different structures (e.g., 2,3, 4, or more unique structures).

In some embodiments, the nucleic acid does not substantially induce an innate immune response in cells into which the polynucleotide (e.g., mRNA) is introduced. The features of the induced innate immune response include 1) increased expression of proinflammatory cytokines, 2) activation of intracellular PRR (RIG-I, MDA5, etc.), and/or 3) termination or reduction of protein translation.

The nucleic acid can optionally include other agents (e.g., RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozyme, catalytic DNA, tRNA, RNA that induces triple helix formation, aptamers, vectors). In some embodiments, a nucleic acid may include one or more messenger rnas (mrnas) (i.e., alternative mRNA molecules) having one or more alternative nucleosides or nucleotides.

In some embodiments, a nucleic acid (e.g., mRNA) comprises one or more polynucleotides comprising the features of WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO2006/024518, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO2011026641, WO2011/144358, WO 2019780, WO 2012012012012013333333326, WO 2012082089338, WO 20121135353513, WO 2116816811, WO2012116810, WO 2013503113113113113113112, WO 2013113503501, WO2013113736, WO2013143698, WO 43699, WO 4331700, WO 43312015201520152015201531220153, WO 201312201520152015201520152015201520152015201520152015201520152015201531220152015 2015201520152015201520152015201520152015201520152015201520152015201520152015, WO 20152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015, WO 201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015, WO2, WO 20152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520153, WO2, WO 9, WO 201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015201520152015.

Nucleobase substitutes

Alternative nucleosides and nucleotides can include alternative nucleobases. The nucleobase of the nucleic acid is an organic base, such as a purine or pyrimidine or derivatives thereof. Nucleobases can be canonical bases (e.g., adenine, guanine, uracil, thymine and cytosine). These nucleobases can be altered or completely replaced to provide polynucleotide molecules with enhanced properties, such as increased stability (e.g., resistance to nucleases). Non-canonical or modified bases can include, for example, one or more substitutions or modifications, including but not limited to alkyl, aryl, halo, oxo, hydroxy, alkoxy, and/or thio substitutions; one or more fused or open rings; oxidizing; and/or reduction.

Alternative nucleotide base pairing encompasses not only standard adenine-thymine, adenine-uracil or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides, including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding to be formed between the non-standard base and the standard base or between two complementary non-standard base structures. An example of such non-standard base pairing is base pairing between the substitute nucleotide inosine and adenine, cytosine or uracil.

In some embodiments, the replacement nucleoside or nucleotide is uridine. In some embodiments, the substituted uridine is 1-methylpseuduridine (1m Ψ). In some embodiments, 1-methylpseudouridine (1m Ψ) comprises the structure:

a polynucleotide may contain about 1% to about 100% 1-methylpseudidine (1m Ψ) (relative to the total nucleotide content, or relative to any one or more of one or more types of nucleotides, i.e., A, G, U or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, (ii) or any intermediate percentage, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is due to the presence of a canonical nucleotide (e.g., A, G, U or C).

In some embodiments, the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 1% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 5% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 10% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 15% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 20% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 25% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 30% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 35% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 40% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 45% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 50% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 55% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 60% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 65% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 70% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 75% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 80% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 85% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 90% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 95% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ). In some embodiments, 100% of the uridine has been replaced by 1-methylpseudouridine (1m Ψ).

The term "polynucleotide" in its broadest sense includes any compound and/or substance that is or can be incorporated into an oligonucleotide strand having a uridine to 1-methylpseudidine (1m Ψ) base modification.

In some embodiments, the nucleic acid or polynucleotide is an mRNA with uridine to 1-methylpseudouridine (1m Ψ) base modifications.

In some embodiments, the polynucleotide is greater than 30 nucleotides in length, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the polynucleotide molecule is greater than 35 nucleotides in length, with uridine to 1-methylpseudouridine (1m Ψ) base modifications. In some embodiments, the length is at least 40 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 45 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 55 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 50 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 60 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 80 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 90 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 100 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 120 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 140 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 160 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 180 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 200 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 250 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 300 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 350 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 400 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 450 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 500 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 600 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 700 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 800 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 900 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1000 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1100 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1200 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1300 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1400 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1500 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1600 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 1800 nucleotides, with uridine to 1-methylpseudouridine (1m Ψ) base modifications. In some embodiments, the length is at least 2000 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 2500 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 3000 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 4000 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification. In some embodiments, the length is at least 5000 nucleotides or greater than 5000 nucleotides, with a uridine to 1-methylpseudouridine (1m Ψ) base modification.

The polynucleotide may contain a minimum of zero and a maximum of 100% uridine to 1-methylpseudouridine (1m Ψ) base modifications, or any intermediate percentage, such as at least 5% uridine to 1-methylpseudouridine (1m Ψ) base modifications, at least 10% uridine to 1-methylpseudouridine (1m Ψ) base modifications, at least 25% uridine to 1-methylpseudouridine (1m Ψ) base modifications, at least 50% uridine to 1-methylpseudouridine (1m Ψ) base modifications, at least 80% uridine to 1-methylpseudouridine (1m Ψ) base modifications, or at least 90% uridine to 1-methylpseudouridine (1m Ψ) base modifications. The substituted uracil can be substituted with a compound having a single unique structure, or can be substituted with a plurality of compounds having different structures (e.g., 2,3, 4, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the polynucleotide are replaced with a replacement cytosine (e.g., a 5-substituted cytosine). The substituted cytosine may be substituted with a compound having a single unique structure, or may be substituted with a plurality of compounds having different structures (e.g., 2,3, 4, or more unique structures).

In some embodiments, the nucleobase is a substituted uracil. Exemplary nucleobases and nucleosides with alternative uracils include, but are not limited to, pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil(s)²U), 4-thio-uracils(s)⁴U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho)⁵U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m)³U), 5-methoxy-uracil (mo)⁵U), uracil 5-Oxoacetic acid (cmo)⁵U), uracil 5-Oxoacetic acid methyl ester (mcmo)⁵U), 5-carboxymethyl-uracil (cm)⁵U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm)⁵U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm)⁵U), 5-methoxycarbonylmethyl-uracil (mcm)⁵U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm)⁵s²U), 5-aminomethyl-2-thio-uracil (nm)⁵s²U), 5-methylaminomethyl-uracil (mnm)⁵U), 5-methylaminomethyl-2-thio-uracil (mnm)⁵s²U), 5-methylaminomethyl-2-seleno-uracil (mnm)⁵se²U), 5-carbamoylmethyl-uracil (ncm)⁵U), 5-Carboxymethylaminomethyl-uracil (cmnm)⁵U), 5-Carboxymethylaminomethyl-2-thio-uracil (cmnm)⁵s²U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-tauromethyl-uracil (. tau.m)⁵U), 1-taunomethyl-pseudouridine, 5-taunomethyl-2-thio-uracil (. tau.m)⁵s²U), 1-taunomethyl-4-thio-pseudouridine, 5-methyl-uracil (m)⁵U, i.e. with the nucleobase deoxythymine), 1-methyl-pseudouridine (m)¹Psi), 5-methyl-2-thio-uracil (m)⁵s²U), l-methyl-4-thio-pseudouridine (m)¹s⁴Psi), 4-thio-l-methyl-pseudouridine, 3-methyl-pseudouridine (m)³Psi), 2-thio-l-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thioO-l-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5, 6-dihydrouracil, 5-methyl-dihydrouracil (m)⁵D) 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uracil (acp)³U), l-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp)³Psi), 5- (isopentenylaminomethyl) uracil (inm)⁵U), 5- (isopentenylaminomethyl) -2-thio-uracil (inm)⁵s²U), 5,2' -O-dimethyl-uridine (m)⁵Um), 2-thio-2' -O _ methyl-uridine(s)²Um), 5-methoxycarbonylmethyl-2' -O-methyl-uridine (mcm)⁵Um), 5-carbamoylmethyl-2' -O-methyl-uridine (ncm)⁵Um), 5-carboxymethylaminomethyl-2' -O-methyl-uridine (cmnm)⁵Um), 3,2' -O-dimethyl-uridine (m)³Um) and 5- (isopentenylaminomethyl) -2' -O-methyl-uridine (inm)⁵Um), 1-thio-uracil, deoxythymidine, 5- (2-carbonylmethoxyethyl) -uracil, 5- (carbamoylhydroxymethyl) -uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5- [3- (l-E-propenylamino)]Uracil.

In some embodiments, the nucleobase is a substituted cytosine. Exemplary nucleobases and nucleosides with alternative cytosines include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-nor-pseudoisocytidine, zebularine (zebularine), 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lisoxetine (k2C), 5,2' -O-dimethyl-cytidine (m5Cm), N4-acetyl-2 '-O-methyl-cytidine (ac4Cm), N4,2' -O-dimethyl-cytidine (m4Cm), 5-formyl-2 '-O-methyl-cytidine (f5Cm), N4, N4,2' -O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5- (3-azidopropyl) -cytosine, and 5- (2-azidoethyl) -cytosine.

In some embodiments, the nucleobase is a substituted adenine. Exemplary nucleobases and nucleosides having alternative adenines include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1-methyl-adenine (mlA), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6- (cis-hydroxyisopentenyl) adenine (io6A), 2-methylthio-N6- (cis-hydroxyisopentenyl) adenine (ms2io6A), N6-glycylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonyl carbamoyl-adenine (ms2g6A), N6, N6-dimethyl-adenine (m62A), N6-hydroxy-N-valylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxy-N-valylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2' -O-dimethyl-adenosine (m6Am), N6, N6,2' -O-trimethyl-adenosine (m62Am), 1,2' -O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-adenine, 1-thio-adenine, 8-azido-adenine, N6- (19-amino-pentaoxanonadecyl) -adenine, 2, 8-dimethyl-adenine, N6-formyl-adenine and N6-hydroxymethyl-adenine.

In some embodiments, the nucleobase is a substituted guanine. Exemplary nucleobases and nucleosides with alternative guanines include inosine (I), 1-methyl-inosine (m1I), wynoside (imG), methyl wyomine (mimG), 4-demethyl-wyroside (imG-14), isophytoside (imG2), wy-oside (yW), peroxywy-oside (o2yW), hydroxyl wy-oside (OHyW), under-modified hydroxyl wy-oside (OHyW), 7-deaza-guanine, braided glycoside (Q), epoxybraided glycoside (oQ), galactosyl-braided glycoside (galQ), mannosyl-braided glycoside (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQl), gulin (G +), 7-deaza-8-aza-guanine (preQl), 6-thio-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2, N2-dimethyl-guanine (m22G), N2, 7-dimethyl-guanine (m2,7G), N2, N2, 7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, l-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2, N2-dimethyl-6-thio-guanine, N2-methyl-2' -O-methyl-guanosine (m2Gm), N2, n2-dimethyl-2 ' -O-methyl-guanosine (m22Gm), l-methyl-2 ' -O-methyl-guanosine (mlGm), N2, 7-dimethyl-2 ' -O-methyl-guanosine (m2,7Gm), 2' -O-methyl-inosine (Im), 1,2' -O-dimethyl-inosine (mlIm), 1-thio-guanine and O-6-methyl-guanine.

The substituted nucleobases of the nucleotides can independently be a purine, pyrimidine, purine or pyrimidine analog. For example, the nucleobase may be an alternative to adenine, cytosine, guanine, uracil or hypoxanthine. In some embodiments, nucleobases may also include naturally occurring and synthetic derivatives of bases including pyrazolo [3,4-d ] pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthines, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo [3,4-d ] pyrimidine, imidazo [1,5-a ]1,3,5 triazone, 9-deazapurine, imidazo [4,5-d ] pyrazine, imidazo [4,5-d ] pyrimidine, pyrazin-2-one, 1,2, 4-triazine, pyridazine; or 1,3,5 triazine. When the abbreviation A, G, C, T or U is used to describe a nucleotide, each letter refers to a representative base and/or derivative thereof, e.g., A includes adenine or an adenine analog, e.g., 7-deazaadenine).

Sugar modification

Nucleosides include sugar molecules (e.g., 5-or 6-carbon sugars such as pentoses, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) in combination with nucleobases, while nucleotides are nucleosides containing nucleoside and phosphate groups or substituent groups (e.g., boranophosphate, phosphorothioate, phosphoroselenoate, phosphonate, alkyl, amidate, and glycerol). The nucleoside or nucleotide may be a canonical material, such as a nucleoside or nucleotide that includes a canonical nucleobase, a sugar, and (in the case of a nucleotide) a phosphate group, or may be a replacement nucleoside or nucleotide that includes one or more replacement components. For example, alternative nucleosides and nucleotides can be altered on the sugar of the nucleoside or nucleotide. In some embodiments, the substituted nucleoside or nucleotide comprises the following structure:

in each of formulas IV, V, VI and VII, each of m and n is independently an integer from 0 to 5, and each of U and U' is independently O, S, N (R)^U)_nuOr C (R)^U)_nuWherein nu is an integer of 0 to 2, and each R^UIndependently is H, halo or optionally substituted alkyl;

R^1’、R^2’、R^1”、R^2”、R¹、R²、R³、R⁴and R⁵Each of which, if present, is independently H, halo, hydroxy, thiol, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted aminoalkoxy, optionally substituted alkoxyalkoxy, optionally substituted hydroxyalkoxy, optionally substituted amino, azido, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, optionally substituted aminoalkynyl, or absent; wherein R is³And R^1’、R^1”、R^2’、R^2”Or R⁵A combination of one or more of (e.g., R)^1’And R³Combination of (1), R^1”And R³Combination of (1), R^2’And R³Combination of (1), R^2”And R³Or R is⁵And R³Combinations of (a) or (b) may be linked together to form an optionally substituted alkylene or optionally substituted heteroalkylene group, and taken together with the carbon to which they are attached to provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); wherein R is⁵And R^1’、R^1”、R^2’Or R^2”A combination of one or more of (e.g., R)^1’And R⁵Combination of (1), R^1”And R⁵Combination of (1), R^2’And R⁵Or R is^2”And R⁵Combinations of (a) or (b) may be linked together to form an optionally substituted alkylene or optionally substituted heteroalkylene group, and taken together with the carbon to which they are attached to provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); and wherein R⁴And R^1’、R^1”、R^2’、R^2”、R³Or R⁵A combination of one or more of which may be linked together to form an optionally substituted alkyleneOr optionally substituted heteroalkylene, and taken together with the carbon to which they are attached provides an optionally substituted heterocyclyl (e.g., bicyclic, tricyclic, or tetracyclic heterocyclyl); each of m' and m "is independently an integer from 0 to 3 (e.g., 0 to 2, 0 to 1,1 to 3, or 1 to 2);

Y¹、Y²and Y³Each of which is independently O, S, Se, -NR^N1-, optionally substituted alkylene or optionally substituted heteroalkylene, where R is^N1Is H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, or is absent;

each Y⁴Independently is H, hydroxy, thiol, boryl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted thioalkoxy, optionally substituted alkoxyalkoxy, or optionally substituted amino;

each Y⁵Independently O, S, Se, optionally substituted alkylene (e.g., methylene), or optionally substituted heteroalkylene; and is

B is a modified or unmodified nucleobase. In some embodiments, the 2' -hydroxy (OH) group may be modified or replaced with a number of different substituents. Exemplary substitutions at the 2' -position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted C_1-6Alkyl (e.g., methyl); optionally substituted C_1-6Alkoxy (e.g., methoxy or ethoxy); optionally substituted C_6-10An aryloxy group; optionally substituted C_3-8A cycloalkyl group; optionally substituted C_6-10aryl-C_1-6Alkoxy, optionally substituted C_1-12(heterocyclyl) oxy; a sugar (e.g., ribose, pentose, or any sugar described herein); polyethylene glycol (PEG), -O (CH)₂CH₂O)_nCH₂CH₂OR, wherein R is H OR optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10,0 to 16, 1 to 4, 1 to 8, 1 to 10,1 to 16, 1 to 20, 2 to 4,2 to 8,2 to 10, 2 to 16, 2 to 20, 4 to 8,4 to 10, 4 to 16)And 4 to 20); "locked" nucleic acids (LNA) in which the 2' -hydroxyl group is through C_1-6Alkylene or C_1-6A heteroalkylene bridge is attached to the 4' -carbon of the same ribose sugar, with exemplary bridges including methylene, propylene, ether, or amino bridges; aminoalkyl as defined herein; aminoalkoxy as defined herein; an amino group as defined herein; and an amino acid as defined herein.

Typically, RNA includes a glycosyl ribose, which is a 5-membered ring with oxygen. Exemplary non-limiting substituted nucleotides include substitution of the oxygen in ribose (e.g., with S, Se or an alkylene group, such as methylene or ethylene); the addition of a double bond (e.g., cyclopentenyl or cyclohexenyl substituted for ribose); a ribose ring (e.g., a 4-membered ring forming a cyclobutane or oxetane); an expansile of ribose (e.g., forming a6 or 7 membered ring with additional carbons or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexane, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone)); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as diol nucleic acids (GNA) (e.g., R-GNA or S-GNA in which ribose is replaced by a diol unit linked to a phosphodiester linkage), threose nucleic acids (TNA in which ribose is replaced by α -L-threofuranosyl- (3'→ 2'), and peptide nucleic acids (PNA in which 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone).

In some embodiments, the glycosyl group contains one or more carbons having the opposite stereochemical configuration of the corresponding carbon in the ribose. Thus, a polynucleotide molecule may comprise nucleotides containing, for example, arabinose or L-ribose as a sugar.

In some embodiments, the polynucleotide comprises at least one nucleoside wherein the sugar is L-ribose, 2 '-O-methyl-ribose, 2' -fluoro-ribose, arabinose, hexitol, LNA or PNA.

Changes in internucleoside linkages

The replacement nucleotide may be altered at the internucleoside linkage (e.g., the phosphate backbone). Herein, the phrases "phosphate ester" and "phosphodiester" are used interchangeably in the context of a polynucleotide backbone. The backbone phosphate group may be altered by replacing one or more oxygen atoms with different substituents.

Replacing a nucleotide may comprise replacing the unaltered phosphate moiety with another internucleoside linkage as described herein in bulk. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenoate, boranophosphate, hydrogenphosphonate, phosphoramidate, phosphorodiamidate, alkyl or aryl phosphonate, and phosphotriester. Both non-linking oxygens of the phosphorodithioate are replaced by sulfur. The phosphate linker can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate) and carbon (bridged methylene-phosphonate).

Alternative nucleosides and nucleotides can include the use of borane moieties (BH)₃) Sulfur (thio), methyl, ethyl and/or methoxy in place of one or more non-bridging oxygens. As a non-limiting example, two non-bridging oxygens in the same position (e.g., alpha (α), beta (β), or gamma (γ) position) may be replaced by a sulfur (thio) and a methoxy group.

Substitutions of one or more oxygen atoms at the alpha position of a phosphate moiety (e.g., alpha-phosphorothioate) are provided to confer stability (e.g., against exonucleases and endonucleases) to RNA and DNA through non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance, followed by a longer half-life in the cellular environment.

Other internucleoside linkages, including internucleoside linkages that do not contain a phosphorus atom, that can be used in accordance with the present disclosure are described herein.

Internal ribosome entry site

The polynucleotide may contain an Internal Ribosome Entry Site (IRES). The IRES may serve as a single ribosome binding site, or may serve as one of a plurality of ribosome binding sites of an mRNA. A polynucleotide containing more than one functional ribosome binding site can encode several peptides or polypeptides (e.g., polycistronic mRNA) that are independently translated by the ribosome. When the polynucleotide is provided with an IRES, a second translatable region is further optionally provided. Examples of IRES sequences that can be used according to the present disclosure include, but are not limited to, those from picornavirus (e.g., FMDV), pestivirus (CFFV), Poliovirus (PV), encephalomyocarditis virus (ECMV), Foot and Mouth Disease Virus (FMDV), Hepatitis C Virus (HCV), Classical Swine Fever Virus (CSFV), Murine Leukemia Virus (MLV), Simian Immunodeficiency Virus (SIV), or cricket paralysis virus (CrPV).

5' -cap structure

The polynucleotide (e.g., mRNA) can include a 5' -cap structure. The 5' -cap structure of the polynucleotide is involved in nuclear export and increased polynucleotide stability, and binds to the mRNA Cap Binding Protein (CBP), which is responsible for polynucleotide stability in the cell and the ability to translate through CBP association with the poly a binding protein to form the mature circular mRNA species. The cap further aids in the removal of the 5' -proximal intron during mRNA splicing.

Endogenous polynucleotide molecules may be 5 '-end capped, thereby creating a 5' -ppp-5 '-triphosphate ester linkage between the terminal guanosine cap residue of the polynucleotide and the 5' -terminal transcribed sense nucleotide. This 5' -guanylic acid cap can then be methylated to produce N7-methyl-guanylic acid residues. The ribose sugars of nucleotides transcribed at the terminal and/or the pre-terminal end of the 5 'end of the polynucleotide may also optionally be 2' -O-methylated. Degradation of polynucleotide molecules (e.g., mRNA molecules) can be targeted by 5' -uncapping of the guanylate cap structure by hydrolysis and cleavage.

The alteration of the polynucleotide may result in a non-hydrolyzable cap structure that prevents uncapping and thus increases the half-life of the polynucleotide. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester bond, alternative nucleotides may be used during the capping reaction. For example, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with α -thio-guanosine nucleotides according to the manufacturer's instructions to generate phosphorothioate linkages in the 5' -ppp-5' cap. Additional alternative guanosine nucleotides may be used, such as alpha-methyl-phosphonate and seleno-phosphate nucleotides.

Additional alterations include, but are not limited to, 2 '-O-methylation of the ribose of the 5' -terminal and/or 5 '-pre-terminal nucleotide of the polynucleotide (as described above) on the 2' -hydroxyl of the sugar. A variety of different 5 '-cap structures can be used to generate the 5' -cap of a polynucleotide, such as an mRNA molecule.

5' -cap structures include those described in international patent publications nos. WO2008127688, WO 2008016473, and WO 2011015347, the cap structures of each of which are incorporated herein by reference.

The cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ in chemical structure from the native (i.e., endogenous, wild-type, or physiological) 5' -cap while retaining cap function. The cap analog can be chemically (i.e., non-enzymatically) or enzymatically synthesized and/or linked to the polynucleotide.

For example, an anti-inversion cap analog (ARCA) cap contains two guanosines linked by a 5'-5' -triphosphate group, where one guanosine contains N7-methyl and 3 '-O-methyl (i.e., N7,3' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, m⁷G-3'mppp-G, which may be equivalently referred to as 3' O-Me-m7G (5') ppp (5') G). The other unaltered 3'-O atom of guanosine becomes linked to the 5' -terminal nucleotide of the capped polynucleotide (e.g., mRNA). N7-and 3' -O-methylated guanosine provide terminal portions of the capped polynucleotide (e.g., mRNA).

Another exemplary cap is mCAP, which is similar to ARCA, but has a2 '-O-methyl group on guanosine (i.e., N7,2' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, m⁷Gm-ppp-G)。

The cap may be a dinucleotide cap analogue, non-limiting examples include those described in U.S. patent No. 8,519,110, the cap structure of which is incorporated herein by reference.

Alternatively, the cap analog can be an N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and/or described herein. Non-limiting examples of N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7- (4-chlorophenoxyethyl) -G (5') ppp (5') G and N7- (4-chlorophenoxyethyl) -m3' -OG (5') ppp (5') G cap analogs (see, e.g., Kore et al, Bioorganic & Medicinal Chemistry 201321: 4570-4574, which cap structures are incorporated herein by reference, and methods of synthesizing the cap analogs). In some embodiments, a cap analog useful in a polynucleotide of the present disclosure is a 4-chloro/bromophenyloxyethyl analog.

Although the cap analogs allow for simultaneous capping of polynucleotides in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This, as well as structural differences in the cap analog from the endogenous 5' -cap structure of polynucleotides produced by endogenous cellular transcription mechanisms, can lead to reduced translational capacity and reduced cellular stability.

To produce a more authentic 5' -cap structure, the replacement polynucleotide may also be post-transcriptionally capped using an enzyme. As used herein, the phrase "more authentic" refers to a characteristic that closely reflects or mimics an endogenous or wild-type characteristic in structure or function. That is, a "more authentic" characteristic is more representative of endogenous, wild-type, natural or physiological cellular function and/or structure, or is superior in one or more respects to the corresponding endogenous, wild-type, natural or physiological characteristic, than is a synthetic characteristic or analog of the prior art. Non-limiting examples of more authentic 5' -cap structures that can be used in the polynucleotides of the present disclosure are, inter alia, those that have enhanced binding of cap-binding proteins, increased half-life, reduced sensitivity to 5' -endonucleases, and/or reduced 5' -uncapping compared to synthetic 5' -cap structures known in the art (or to wild-type natural or physiological 5' -cap structures). For example, recombinant vaccinia virus capping enzyme and recombinant 2 '-O-methyltransferase can produce a canonical 5' -5 '-triphosphate linkage between the 5' -terminal nucleotide of the polynucleotide and the guanosine cap nucleotide, where the cap guanosine contains N7-methylation and the 5 '-terminal nucleotide of the polynucleotide contains a 2' -O-methyl group. This structure is referred to as the Cap1 structure. This cap results in higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines compared to other 5' cap analog structures, such as are known in the art. Other exemplary Cap structures include 7mG (5') ppp (5') N, pN2p (Cap 0), 7mG (5') ppp (5') NlmpNp (Cap 1), 7mG (5') -ppp (5') NlmpN2mp (Cap 2), and m (7) gppm (3) (6,6,2') Apm (2') Cpm (2) (3,2') Up (Cap 4).

Because the replacement polynucleotide can be post-transcriptionally capped, and because this process is more efficient, nearly 100% of the replacement polynucleotide can be capped. This is in contrast to-80% when the cap analog is linked to a polynucleotide during an in vitro transcription reaction.

The 5' -end cap may comprise an endogenous cap or cap analog. The 5' -end cap may include a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2' -fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

In some embodiments, the polynucleotide contains a modified 5' -cap. Modifications on the 5' -cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and can increase the efficiency of polynucleotide translation. Modified 5' -caps may include, but are not limited to, one or more of the following modifications: modification at the 2 '-and/or 3' -position of capped Guanosine Triphosphate (GTP), with a methylene moiety (CH)₂) In place of the sugar epoxy (which results in a carbocyclic ring), on the triphosphate bridge portion of the cap structure or on the nucleobase (G) portion.

5’-UTR

The 5' -UTR may be provided as a flanking region of a polynucleotide (e.g., mRNA). The 5' -UTR may be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5' -UTRs may be included in the flanking region and may be the same or different sequences. Any portion (including no portion) of the flanking region may be codon-optimized, and any portion may independently contain one or more different structural or chemical changes before and/or after codon-optimization.

Shown in table 21 of U.S. provisional application No. 61/775,509 and table 21 and table 22 of U.S. provisional application No. 61/829,372, which are incorporated herein by reference, are lists of start and stop sites for replacement polynucleotides (e.g., mrnas). In Table 21, each 5' -UTR (5' -UTR-005 through 5' -UTR 68511) is identified by its start and stop sites relative to its native or wild-type (homologous) transcript (ENST; identifier used in the ENSEMBL database).

To alter one or more properties of a polynucleotide (e.g., mRNA), the 5' -UTR may be engineered to be heterologous to the coding region of the replacement polynucleotide (e.g., mRNA). The polynucleotide (e.g., mRNA) can then be administered to a cell, tissue, or organism, and results such as protein levels, localization, and/or half-life can be measured to assess the beneficial effect that the heterologous 5' -UTR may have on the replacement polynucleotide (mRNA). Variants of the 5' -UTR may be utilized in which one or more nucleotides are added to or removed from the termini, including A, T, C or G. The 5' -UTR may also be codon optimized or altered in any of the ways described herein.

5'-UTR, 3' -UTR and Translational Enhancer Element (TEE)

The 5' -UTR of a polynucleotide (e.g., mRNA) can include at least one translational enhancer element. The term "translational enhancer element" refers to a sequence that increases the amount of a polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the initiation codon. A polynucleotide (e.g., mRNA) having at least one TEE in the 5'-UTR can include a cap at the 5' -UTR. Further, at least one TEE can be located in the 5' -UTR of a polynucleotide (e.g., mRNA) that undergoes cap-dependent or cap-independent translation.

In one aspect, TEE is a conserved element in the UTR that may promote translational activity of the polynucleotide, such as, but not limited to, cap-dependent or cap-independent translation. Panek et al (Nucleic Acids Research,2013,1-10) have previously demonstrated the conservation of these sequences in 14 species, including humans.

In one non-limiting example, known TEEs may be located in the 5' -leader sequence of a Gtx homeodomain protein (Chappell et al, Proc. Natl. Acad. Sci. USA101:9590-9594,2004, TEEs of which are incorporated herein by reference).

In another non-limiting example, TEE is disclosed in U.S. patent publications No. 2009/0226470 and 2013/0177581, WO2009/075886, WO2012/009644, and WO1999/024595, and U.S. patents No. 6,310,197 and 6,849,405, the TEE sequences of each of which are incorporated herein by reference.

In yet another non-limiting example, the TEE can be an Internal Ribosome Entry Site (IRES), HCV-IRES, or IRES element, such as but not limited to those described in U.S. patent No. 7,468,275, U.S. patent publications nos. 2007/0048776 and 2011/0124100, and international patent publications nos. WO2007/025008 and WO2001/055369, the IRES sequences of each of which are incorporated herein by reference. IRES elements can include, but are not limited to, Chappell et al (Proc. Natl. Acad. Sci. USA101:9590-9594,2004) and Zhou et al (PNAS 102:6273-6278,2005) and the Gtx sequences described in U.S. patent publications 2007/0048776 and 2011/0124100 and International patent publication WO2007/025008 (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt), the IRES sequences of each of which are incorporated herein by reference.

A "translational enhancer polynucleotide" is a polynucleotide that includes one or more particular TEE, or a variant, homolog, or functional derivative thereof, exemplified herein and/or disclosed in the art (see, e.g., U.S. patent nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, 20090/226470, 2007/0048776, 2011/0124100, 2009/0093049, 2013/0177581, WO2009/075886, WO2007/025008, WO2012/009644, WO2001/055371, WO1999/024595, and european patent nos. 2610341 and 2610340; the TEE sequences of each of the above-mentioned patent documents are incorporated herein by reference). One or more copies of a particular TEE may be present in a polynucleotide (e.g., mRNA). The TEEs in the translation enhancer polynucleotide may be organized in one or more sequence segments. A sequence segment may comprise one or more particular TEEs exemplified herein, each TEE being present in one or more copies. When multiple sequence segments are present in a translation enhancer polynucleotide, they can be homologous or heterologous. Thus, multiple sequence segments in a translation enhancer polynucleotide can comprise the same or different types of the particular TEE exemplified herein, the same or different copy numbers of each particular TEE, and/or the same or different organization of TEEs within each sequence segment.

Polynucleotides (e.g., mrnas) can include at least one TEE described in international patent publication nos. WO1999/024595, WO2012/009644, WO2009/075886, WO2007/025008, WO1999/024595, european patent publications nos. 2610341 and 2610340, 6,310,197, 6,849,405, 7,456,273, 7,183,395, and us patent publications nos. 2009/0226470, 2011/0124100, 2007/0048776, 2009/0093049, and 2013/0177581, the TEE sequences of each of which are incorporated herein by reference. The TEE can be located in the 5' -UTR of a polynucleotide (e.g., mRNA).

Polynucleotides (e.g., mrnas) may include at least one TEE having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to TEEs described in U.S. patent publication nos. 2009/0226470, 2007/0048776, 2013/0177581, and 2011/0124100, WO1999/024595, WO2012/009644, WO2009/075886, and WO2007/025008, european patent publication nos. 2610341 and 2610340, 6,310,197, 6,849,405, 7,456,273, 7,183,395, the TEE sequences of each of which are incorporated herein by reference.

A 5' -UTR of a polynucleotide (e.g., mRNA) can include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 5' -UTR of a polynucleotide (e.g., mRNA) can be the same or different TEE sequences. The TEE sequence may be a pattern such as ABABAB, AABBAABBAABB or abccabbc or variants thereof repeated one, two or more times. In these patterns, each letter A, B or C represents a different TEE sequence at the nucleotide level.

In some embodiments, the 5' -UTR may include a spacer to separate the two TEE sequences. As a non-limiting example, the spacer can be a 15 nucleotide spacer and/or other spacers known in the art. As another non-limiting example, the 5'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 5' -UTR.

In some embodiments, the spacer separating the two TEE sequences can include other sequences known in the art that can modulate translation of a polynucleotide (e.g., mRNA) of the disclosure, such as, but not limited to, miR sequences (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences can include a different miR sequence or a component of a miR sequence (e.g., a miR seed sequence).

In some embodiments, a TEE in a 5' -UTR of a polynucleotide (e.g., mRNA) can include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of TEE sequences disclosed in the following patent documents: 2009/0226470, 2007/0048776, 2013/0177581, and 2011/0124100 U.S. patent publications, WO1999/024595, WO2012/009644, WO2009/075886, and WO2007/025008 international patent publications, 2610341 and 2610340 european patent publications, and 6,310,197, 6,849,405, 7,456,273, and 7,183,395 U.S. patents, the TEE sequences of each of which are incorporated herein by reference. In some embodiments, the TEE in the 5' -UTR of a polynucleotide (e.g., mRNA) of the present disclosure can include 5-30 nucleotide fragments, 5-25 nucleotide fragments, 5-20 nucleotide fragments, 5-15 nucleotide fragments, 5-10 nucleotide fragments of the TEE sequences disclosed in the following patent documents: 2009/0226470, 2007/0048776, 2013/0177581 and 2011/0124100 U.S. patent publications, WO1999/024595, WO2012/009644, WO2009/075886 and WO2007/025008 international patent publications, 2610341 and 2610340 european patent publications and 6,310,197, 6,849,405, 7,456,273 and 7,183,395 U.S. patents; the TEE sequences of each of the above-mentioned patent documents are incorporated herein by reference.

In certain instances, a TEE in a 5' -UTR of a polynucleotide (e.g., mRNA) of the present disclosure can include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in: supplementary Table 1 and supplementary Table 2 disclosed by Chappell et al (Proc. Natl. Acad. Sci. USA101:9590-9594, 2004) and Zhou et al (PNAS 102:6273-6278,2005), Wellensiek et al (genome-wide profiling of human cap-independent transformation-enhancing elements, Nature Methods, 2013; DOI:10.1038/NMETH. 2522); the TEE sequences of each of the above-mentioned documents are incorporated herein by reference. In some embodiments, in another embodiment, the TEE in the 5' -UTR of a polynucleotide (e.g., mRNA) of the present disclosure may comprise a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment of the TEE sequence disclosed in the following references: supplementary Table 1 and supplementary Table 2 disclosed by Chappell et al (Proc. Natl. Acad. Sci. USA101:9590-9594, 2004) and Zhou et al (PNAS 102:6273-6278,2005), Wellensiek et al (Genome-wide profiling of human cap-independent transformation-engineering elements, Nature Methods, 2013; DOI: 10.1038/NMETH.2522); the TEE sequences of each of the above-mentioned documents are incorporated herein by reference.

In some embodiments, the TEE used in the 5' -UTR of a polynucleotide (e.g., mRNA) is an IRES sequence, such as, but not limited to, those described in U.S. patent No. 7,468,275 and international patent publication No. WO2001/055369, the TEE sequences of each of which are incorporated herein by reference.

In some embodiments, the TEE used in the 5' -UTR of a polynucleotide (e.g., mRNA) can be identified by the methods described in U.S. patent publications nos. 2007/0048776 and 2011/0124100, and international patent publications nos. WO2007/025008 and WO2012/009644, the methods of each of which are incorporated herein by reference.

In some embodiments, the TEE used in the 5' -UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be a transcriptional regulatory element described in U.S. patent nos. 7,456,273 and 7,183,395, 2009/0093049, and international publication No. WO2001/055371, the TEE sequences of each of which are incorporated herein by reference. Transcriptional regulatory elements can be identified by methods known in the art, such as, but not limited to, those described in U.S. patent nos. 7,456,273 and 7,183,395, U.S. patent publication No. 2009/0093049, and international publication No. WO2001/055371, the methods of each of which are incorporated herein by reference.

In still other embodiments, the TEE used in the 5' -UTR of a polynucleotide (e.g., mRNA) is a polynucleotide or portion thereof as described in U.S. patent nos. 7,456,273 and 7,183,395, 2009/0093049, and international publication No. WO2001/055371, the TEE sequences of each of which are incorporated herein by reference.

The 5' -UTR comprising at least one TEE described herein can be incorporated into a monocistronic sequence, such as but not limited to a vector system or a polynucleotide vector. As non-limiting examples, vector systems and polynucleotide vectors may include those described in U.S. patent nos. 7,456,273 and 7,183,395, 2007/0048776, 2009/0093049, and 2011/0124100, and international patent publications nos. WO2007/025008 and WO2001/055371, the TEE sequences of each of which are incorporated herein by reference.

The TEEs described herein can be located in the 5'-UTR and/or 3' -UTR of a polynucleotide (e.g., mRNA). The TEE located in the 3'-UTR may be the same and/or different than the TEE located and/or described for incorporation into the 5' -UTR.

In some embodiments, a 3' -UTR of a polynucleotide (e.g., mRNA) can include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 3' -UTRs of the polynucleotides (e.g., mrnas) of the present disclosure can be the same or different TEE sequences. The TEE sequence may be a pattern such as ABABAB, AABBAABBAABB or abccabbc or variants thereof repeated one, two or more times. In these patterns, each letter A, B or C represents a different TEE sequence at the nucleotide level.

In one instance, the 3' -UTR can include a spacer to separate the two TEE sequences. As a non-limiting example, the spacer can be a 15 nucleotide spacer and/or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 3' -UTR.

In some embodiments, the spacer separating the two TEE sequences can include other sequences known in the art that can modulate translation of a polynucleotide (e.g., mRNA) of the disclosure, such as, but not limited to, miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences can include a different miR sequence or a component of a miR sequence (e.g., a miR seed sequence).

In some embodiments, the incorporation of miR sequences and/or TEE sequences can alter the shape of the stem-loop region, which can increase and/or decrease translation. See, e.g., Kedde et al, Nature Cell Biology 201012 (10):1014-20, incorporated herein by reference in its entirety).

Stem ring

The polynucleotide (e.g., mRNA) can include a stem-loop, such as, but not limited to, a histone stem-loop. The stem-loop may be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as but not limited to those described in international patent publication No. WO2013/103659, which is incorporated herein by reference. The histone stem-loop can be located 3 'relative to the coding region (e.g., at the 3' -end of the coding region). As a non-limiting example, a stem loop may be located at the 3' -end of a polynucleotide described herein. In some embodiments, a polynucleotide (e.g., mRNA) includes more than one stem loop (e.g., two stem loops). Examples of stem-loop sequences are described in international patent publications nos. WO2012/019780 and WO201502667, the stem-loop sequences of which are incorporated herein by reference. In some embodiments, the polynucleotide includes a stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the polynucleotide comprises stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

The stem loop may be located in the second end region of the polynucleotide. As a non-limiting example, the stem loop may be located within an untranslated region (e.g., 3' -UTR) in the second end region.

In some embodiments, a polynucleotide including a histone stem-loop, such as, but not limited to, an mRNA, can be stabilized by the addition of a3 '-stabilizing region (e.g., a 3' -stabilizing region including at least one chain terminating nucleoside). Without wishing to be bound by theory, the addition of at least one chain terminating nucleoside may slow the degradation of the polynucleotide and thus may increase the half-life of the polynucleotide.

In some embodiments, a polynucleotide including a histone stem-loop, such as, but not limited to, an mRNA, can be stabilized by altering the 3' -region of the polynucleotide, which can prevent and/or inhibit the addition of oligo (U) (see, e.g., international patent publication No. WO 2013/103659).

In still other embodiments, a polynucleotide including a histone stem-loop (such as, but not limited to, mRNA) can be stabilized by adding an oligonucleotide terminated with a 3' -deoxynucleoside, a 2',3' -dideoxynucleoside, a 3' -O-methyl nucleoside, a 3-O-ethyl nucleoside, a 3' -arabinoside, and other alternative nucleosides known in the art and/or described herein.

In some embodiments, a polynucleotide of the present disclosure may include a histone stem-loop, a poly a region, and/or a 5' -cap structure. The histone stem-loop may be before and/or after the poly a region. The polynucleotide comprising the histone stem-loop and poly a-region sequences can comprise a chain terminating nucleoside as described herein.

In some embodiments, a polynucleotide of the present disclosure may comprise a histone stem-loop and a 5' -cap structure. The 5' -cap structure can include, but is not limited to, those described herein and/or known in the art.

In some embodiments, the conserved stem-loop region may comprise a miR sequence described herein. As a non-limiting example, the stem-loop region can include a seed sequence of a miR sequence described herein. In another non-limiting example, the stem-loop region can comprise a miR-122 seed sequence.

In certain instances, the conserved stem-loop region can include miR sequences described herein, and can also include TEE sequences.

In some embodiments, the incorporation of miR sequences and/or TEE sequences alters the shape of the stem-loop region, which can increase and/or decrease translation. (see, e.g., Kedde et al, A pulerio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-22access nature Cell biology.2010, incorporated herein by reference in its entirety).

The polynucleotide may include at least one histone stem-loop and a poly-a region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone stem-loop and poly-a region or polyadenylation signal are described in international patent publications nos. WO2013/120497, WO2013/120629, WO2013/120500, WO2013/120627, WO2013/120498, WO2013/120626, WO2013/120499, and WO2013/120628, the sequences of each of which are incorporated herein by reference. In certain instances, the polynucleotides encoding histone stem loops and poly a regions or polyadenylation signals can encode pathogen antigens or fragments thereof, such as polynucleotide sequences described in international patent publications nos. WO2013/120499 and WO2013/120628, the sequences of which are incorporated herein by reference. In some embodiments, the polynucleotide encoding the histone stem-loop and poly-a region or polyadenylation signal can encode a therapeutic protein, such as the polynucleotide sequences described in international patent publications WO2013/120497 and WO2013/120629, the sequences of which are incorporated herein by reference. In some embodiments, the polynucleotide encoding the histone stem-loop and poly-a region or polyadenylation signal can encode a tumor antigen or fragment thereof, such as the polynucleotide sequences described in international patent publications nos. WO2013/120500 and WO2013/120627, the sequences of both of which are incorporated herein by reference. In some embodiments, the polynucleotide encoding the histone stem-loop and poly a-region or polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in international patent publications nos. WO2013/120498 and WO2013/120626, the sequences of which are incorporated herein by reference.

Poly A region

The polynucleotide or nucleic acid (e.g., mRNA) can include a polya sequence and/or a polyadenylation signal. The poly a sequence may consist entirely or mostly of adenine nucleotides or analogs or derivatives thereof. The poly a sequence may be positioned adjacent to the tail of the 3' untranslated region of the nucleic acid.

During RNA processing, long chains of adenosine nucleotides (poly a domains) are typically added to messenger RNA (mrna) to improve the stability of the molecules. Immediately after transcription, the 3 '-end of the transcript is cleaved to release the 3' -hydroxyl group. The poly a polymerase then adds an adenosine nucleotide strand to the RNA. This process is called polyadenylation, which adds a poly a region between 100 and 250 residues in length.

The unique poly a region length may provide certain advantages for the alternative polynucleotides of the present disclosure.

Typically, the poly a region of the present disclosure is at least 30 nucleotides in length. In some embodiments, the length is at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 120 nucleotides, at least 140 nucleotides, at least 160 nucleotides, at least 180 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 350 nucleotides, at least 400 nucleotides, at least 450 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1200 nucleotides, at least 1400 nucleotides, at least 1600 nucleotides, at least 1800 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, or at least 3000 nucleotides.

In some embodiments, the poly a region may be 80 nucleotides, 120 nucleotides, 160 nucleotides in length on the replacement polynucleotide molecule described herein.

In some embodiments, the poly a region may be 20, 40, 80, 100, 120, 140, or 160 nucleotides in length on the replacement polynucleotide molecule described herein.

In some embodiments, the poly a region is designed relative to the length of the total replacement polynucleotide. Such design may be based on the length of the coding region of the replacement polynucleotide, the length of a particular feature or region of the replacement polynucleotide (e.g., mRNA), or on the length of the end product expressed by the replacement polynucleotide. The poly a region can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% greater in length than the additional feature when relative to any feature of the replacement polynucleotide (e.g., other than the portion of the mRNA that includes the poly a region). The poly a region may also be designed as part of the replacement polynucleotide to which it belongs. In this context, the poly a region may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more of the total length of the construct or the total length of the construct minus the poly a region.

In certain instances, engineered binding sites for poly a binding proteins and/or conjugation of polynucleotides (e.g., mRNA) can be used to enhance expression. The engineered binding site may be a sensing sequence that can function as a binding site for a ligand of a local microenvironment of a polynucleotide (e.g., mRNA). As a non-limiting example, a polynucleotide (e.g., mRNA) can include at least one engineered binding site to alter the binding affinity of a polya binding protein (PABP) and analogs thereof. Incorporation of at least one engineered binding site can increase the binding affinity of PABP and its analogs.

In addition, a plurality of different polynucleotides (e.g., mrnas) can be linked together at the 3 '-end to a PABP (poly a binding protein) using alternative nucleotides at the 3' -end of the poly a region. Transfection experiments can be performed in relevant cell lines, and protein production can be measured by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and day 7 post-transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect on binding affinity of PABP or its analogs due to the addition of at least one engineered binding site.

In some cases, the poly a region may be used to regulate translation initiation. While not wishing to be bound by theory, the poly-a region recruits PABP, which in turn may interact with the translation initiation complex and thus may be necessary for protein synthesis.

In some embodiments, poly a regions may also be used in the present disclosure to prevent 3'-5' -exonuclease digestion.

In some embodiments, a polynucleotide (e.g., mRNA) can include a poly a-G quadruplet (quartt). The G-quadruplet is a circular hydrogen bonded array of four guanosine nucleotides that can be formed from G-rich sequences in DNA and RNA. In this embodiment, the G-quadruplexes are incorporated at the ends of the polya region. The stability of the resulting polynucleotide (e.g., mRNA), protein production, and other parameters, including half-life at different time points, can be determined. It has been found that the poly a-G quadruplets result in protein production equivalent to at least 75% of that seen with the 120 nucleotide poly a region alone.

In some embodiments, a polynucleotide (e.g., mRNA) can include a poly a region and can be stabilized by the addition of a 3' -stabilizing region. A polynucleotide (e.g., mRNA) having a poly a region can further include a 5' -cap structure.

In some embodiments, a polynucleotide (e.g., mRNA) can include a poly a-G quadruplet. Polynucleotides (e.g., mRNA) having a poly a-G quadruplet may further comprise a 5' -cap structure.

In some embodiments, 3' -stabilizing regions useful for stabilizing polynucleotides (e.g., mrnas) comprising poly-a regions or poly-a-G quartets may be, but are not limited to, those described in international patent publication No. WO2013/103659, the poly-a regions and poly-a-G quartets of which are incorporated herein by reference. In some embodiments, 3' -stabilizing regions that can be used in the present disclosure include chain terminating nucleosides, such as 3' -deoxyadenosine (cordycepin), 3' -deoxyuridine, 3' -deoxycytosine, 3' -deoxyguanosine, 3' -deoxythymine, 2',3' -dideoxynucleosides, such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine, 2',3' -dideoxythymine, 2' -deoxynucleosides, or O-methylnucleosides.

In some embodiments, a polynucleotide (such as, but not limited to, mRNA) comprising a poly-a region or a poly-a-G quadruplet may be stabilized by altering the 3' -region of the polynucleotide, which may prevent and/or inhibit the addition of oligo (U) (see, e.g., international patent publication No. WO 2013/103659).

In some embodiments, a polynucleotide (such as, but not limited to, an mRNA) comprising a poly a region or a poly a-G quadruplet may be stabilized by adding an oligonucleotide terminated with a 3' -deoxynucleoside, a 2',3' -dideoxynucleoside, a 3' -O-methyl nucleoside, a 3-O-ethyl nucleoside, a 3' -arabinoside, and other alternative nucleosides known in the art and/or described herein.

Chain terminating nucleosides

The nucleic acid may comprise a chain terminating nucleoside. For example, chain terminating nucleosides may include those produced by deoxygenation at the 2 'and/or 3' positions of their sugar groups. Such substances may include 3' -deoxyadenosine (cordycepin), 3' -deoxyuridine, 3' -deoxycytidine, 3' -deoxyguanosine, 3' -deoxythymidine and 2',3' -dideoxynucleosides such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine and 2',3' -dideoxythymine.

Lipids and lipid mixtures

In some embodiments, the lipid is an ionizable lipid.

In some embodiments, the lipid is a phospholipid.

In some embodiments, the lipid is a PEG lipid.

In some embodiments, the lipid is a structural lipid.

In some embodiments, the lipid mixture comprises an ionizable lipid.

In some embodiments, the lipid mixture comprises phospholipids.

In some embodiments, the lipid mixture comprises PEG lipids.

In some embodiments, the lipid mixture comprises a structural lipid.

In some embodiments, the lipid mixture comprises an ionizable lipid, a phospholipid, a PEG lipid, a structural lipid, or any combination thereof.

Ionizable lipids

In some aspects, the ionizable lipid of the present disclosure can be one or more compounds of formula (IL-I):

or an N-oxide thereof or a salt or isomer thereof, wherein:

R¹selected from the group consisting of C_5-30Alkyl radical, C_5-20Alkenyl, -R + YR ", -YR", and-R "M' R";

R²and R³Independently selected from H, C_1-14Alkyl radical, C_2-14Alkenyl, -R-YR ", and-R-OR", OR R²And R³Together with the atoms to which they are attached form a heterocyclic or carbocyclic ring;

R⁴selected from hydrogen, C_3-6Carbocyclic ring, - (CH)₂)_nQ、-(CH₂)_nCHQR、-(CH₂)_oC(R¹⁰)₂(CH₂)_n-oQ、-CHQR、-CQ(R)₂-C (O) NQR and unsubstituted C_1-6Alkyl, wherein Q is selected from the group consisting of carbocycle, heterocycle, -OR, -O (CH)₂)_nN(R)₂、-C(O)OR、-OC(O)R、-CX₃、-CX₂H、-CXH₂、-CN、-N(R)₂、-C(O)N(R)₂、-N(R)C(O)R、-N(R)S(O)₂R、-N(R)C(O)N(R)₂、-N(R)C(S)N(R)₂、-N(R)R⁸、-N(R)S(O)₂R⁸、-O(CH₂)_nOR、-N(R)C(＝NR⁹)N(R)₂、-N(R)C(＝CHR⁹)N(R)₂、-OC(O)N(R)₂、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)₂R、-N(OR)C(O)OR、-N(OR)C(O)N(R)₂、-N(OR)C(S)N(R)₂、-N(OR)C(＝NR⁹)N(R)₂、-N(OR)C(＝CHR⁹)N(R)₂、-C(＝NR⁹)N(R)₂、-C(＝NR⁹)R、-C(O)N(R)OR、-(CH₂)_nN(R)₂and-C (R) N (R)₂C (O) OR, each o is independently selected from 1,2, 3 and 4, and each n is independently selected from 1,2, 3,4 and 5;

each R⁵Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

each R⁶Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

m and M ' are independently selected from the group consisting of-C (O) O-, -OC (O) -M ' -C (O) O-, -C (O) N (R ') -, -N (R ') C (O) -, -C (S) S-, -SC (S) -, -CH (OH) -, -P (O) (OR ') O-, -S (O)₂-, -S-S-, aryl and heteroaryl, wherein M "is a bond, C_1-13Alkyl or C_2-13An alkenyl group;

R⁷selected from the group consisting of C_1-3Alkyl radical, C_2-3Alkenyl and H;

R⁸selected from the group consisting of C_3-6Carbocyclic and heterocyclic rings;

R⁹selected from H, CN, NO₂、C_1-6Alkyl, -OR, -S (O)₂R、-S(O)₂N(R)₂、C_2-6Alkenyl radical, C_3-6Carbocyclic and heterocyclic rings;

R¹⁰selected from H, OH, C_1-3Alkyl and C_2-3Alkenyl groups;

each R is independently selected from C_1-6Alkyl radical, C_1-3Alkyl-aryl, C_2-3Alkenyl, (CH)₂)_qOR and H,

and each q is independently selected from 1,2 and 3;

each R' is independently selected from C_1-18Alkyl radical, C_2-18Alkenyl, -R-YR ", and H;

each R' is independently selected from the group consisting of C_3-15Alkyl and C_3-15Alkenyl groups;

each R is independently selected from C_1-12Alkyl and C_2-12Alkenyl groups;

each Y is independently C_3-6A carbocyclic ring;

each X is independently selected from the group consisting of F, Cl, Br, and I; and is

m is selected from 5,6, 7, 8, 9, 10, 11, 12 and 13; and wherein when R⁴Is- (CH)₂)_nQ、-(CH₂)_nCHQR, -CHQR, or-CQ (R)₂When n is 1,2, 3,4 or 5, then (i) Q is not-N (R)₂Or (ii) when n is 1 or 2, Q is not 5,6 or 7 membered heterocycloalkyl.

In some embodiments, the subgroup of compounds of formula (IL-I) includes compounds of formula (IL-IA):

or an N-oxide thereof or a salt or isomer thereof, wherein:

l is selected from 1,2, 3,4 and 5; m is selected from 5,6, 7, 8 and 9; m₁Is a bond or M'; r⁴Is hydrogen, unsubstituted C_1-3Alkyl, - (CH)₂)_oC(R¹⁰)₂(CH₂)_n-oQ, -C (O) NQR or- (CH)₂)_nQ, wherein Q is OH, -NHC (S) N (R)₂、-NHC(O)N(R)₂、-N(R)C(O)R、-N(R)S(O)₂R、-N(R)R⁸、-NHC(＝NR⁹)N(R)₂、-NHC(＝CHR⁹)N(R)₂、-OC(O)N(R)₂、-N(R)C(O)OR、-(CH₂)_nN(R)₂Heteroaryl or heterocycloalkyl; m and M 'are independently selected from the group consisting of-C (O) O-, -OC (O) -M' -C (O) O-, -C (O) N (R ') -, -P (O) (OR') O-, -S-S-, aryl and heteroaryl; and R is²And R³Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups. For example, m is 5, 7 or 9. For example, Q is OH, -NHC (S) N (R)₂or-NHC (O) N (R)₂。

In some embodiments, Q is-N (R) C (O) R or-N (R) S (O)₂R。

In some embodiments, the subgroup of compounds of formula (I) includes compounds of formula (IL-IB):

or an N-oxide thereof, or a salt or isomer thereof, wherein all of the variables are as defined herein.

In some embodiments, m is selected from 5,6, 7, 8, and 9; r₄Is hydrogen, unsubstituted C_1-3Alkyl or- (CH)₂)_nQ, wherein Q is-OH, -NHC (S) N (R)₂、-NHC(O)N(R)₂、-N(R)C(O)R、-N(R)S(O)₂R、-N(R)R₈、-NHC(＝NR₉)N(R)₂、-NHC(＝CHR₉)N(R)₂、-OC(O)N(R)₂-N (R) C (O) OR, heteroaryl OR heterocycloalkyl; m and M 'are independently selected from the group consisting of-C (O) O-, -OC (O) -M' -C (O) O-, -C (O) N (R ') -, -P (O) (OR') O-, -S-S-, aryl and heteroaryl; and R is₂And R₃Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups. In some embodiments, m is 5, 7, or 9. In some embodiments, Q is OH, -NHC (S) N (R)₂or-NHC (O) N (R)₂. In some embodiments, Q is-N (R) C (O) R or-N (R) S (O)₂R。

In some embodiments, the subgroup of compounds of formula (IL-I) includes compounds of formula (IL-II):

or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1,2, 3,4 and 5; m₁Is a bond or M'; r⁴Is hydrogen, unsubstituted C_1-3Alkyl, - (CH)₂)_oC(R¹⁰)₂(CH₂)_n-oQ, -C (O) NQR or- (CH)₂)_nQ, wherein n is 2,3 or 4 and Q is OH, -NHC (S) N (R)₂、-NHC(O)N(R)₂、-N(R)C(O)R、-N(R)S(O)₂R、-N(R)R⁸、-NHC(＝NR⁹)N(R)₂、-NHC(＝CHR⁹)N(R)₂、-OC(O)N(R)₂、-N(R)C(O)OR、-(CH₂)_nN(R)₂Heteroaryl or heterocycloalkyl; m and M 'are independently selected from the group consisting of-C (O) O-, -OC (O) -M' -C (O) O-, -C (O) N (R ') -, -P (O) (OR') O-, -S-S-, aryl and heteroaryl; and R is²And R³Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups.

In some embodiments, the compound of formula (IL-I) has formula (IL-IIa):

or their N-oxides or their salts or isomers, wherein R₄As described herein.

In some embodiments, the compound of formula (IL-I) has formula (IL-IIb),

or their N-oxides or their salts or isomers, wherein R₄As described herein.

Or their N-oxides or their salts or isomers, wherein R₄As described herein.

In some embodiments, the compound of formula (IL-I) has formula (IL-IIf):

or their N-oxides or their salts or isomers, wherein M is-C (O) O-or-OC (O) -, and M "is C_1-6Alkyl or C_2-6Alkenyl radical, R₂And R₃Independently selected from C_5-14Alkyl and C_5-14Alkenyl, and n is selected from the group consisting of 2,3, and 4.

In a further embodiment, the compound of formula (IL-I) has the formula (IL-IId),

or an N-oxide thereof or a salt or isomer thereof, wherein N is 2,3 or 4; and m, R' and R₂To R₆As described herein. In some embodiments, R₂And R₃Each of which may be independently selected from C_5-14Alkyl and C_5-14Alkenyl groups.

In a further embodiment, the compound of formula (IL-I) has the formula (IL-IIg),

or their N-oxides or salts or isomers thereof, wherein l is selected from 1,2, 3,4 and 5; m is selected from 5,6, 7, 8 and 9; m₁Is a bond or M'; m and M 'are independently selected from the group consisting of-C (O) O-, -OC (O) -M' -C (O) O-, -C (O) N (R ') -, -P (O) (OR') O-, -S-S-, aryl and heteroaryl; and R is₂And R₃Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups. In some embodiments, M "is C_1-6Alkyl (e.g. C)_1-4Alkyl) or C_2-6Alkenyl (e.g. C)_2-4Alkenyl). In some embodiments, R₂And R₃Independently selected from C_5-14Alkyl and C_5-14Alkenyl groups.

In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. application nos. 62/220,091, 62/252,316, 62/253,433, 62/266,460, 62/333,557, 62/382,740, 62/393,940, 62/471,937, 62/471,949, 62/475,140, and 62/475,166, and PCT application No. PCT/US 2016/052352.

In some embodiments, the ionizable lipid is selected from compounds 1-280 described in U.S. application No. 62/475,166.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. application nos. 62/733,315 and 62/798,874.

In some embodiments, the ionizable lipid has the formula (IL-IIh):

or an N-oxide thereof or a salt or isomer thereof, wherein

R¹Is selected from the group consisting ofC_5-30Alkyl radical, C_5-20Alkenyl, -R + YR ", -YR", and-R "M' R";

each R⁵Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

each R⁶Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

R⁷selected from the group consisting of C_1-3Alkyl radical, C_2-3Alkenyl and H;

each R is independently selected from the group consisting of H, C_1-3Alkyl and C_2-3Alkenyl groups;

R^Nis H or C_1-3An alkyl group;

each R' is independently selected from C_1-18Alkyl radical, C_2-18Alkenyl, -R-YR ", and H;

each R' is independently selected from the group consisting of C_3-15Alkyl and C_3-15Alkenyl groups;

each R is independently selected from C_1-12Alkyl and C_2-12Alkenyl groups;

each Y is independently C_3-6A carbocyclic ring;

each X is independently selected from the group consisting of F, Cl, Br, and I;

X^aand X^bEach independently is O or S;

R¹⁰selected from the group consisting of H, halo, -OH, R, -N (R)₂、-CN、-N₃、-C(O)OH、-C(O)OR、-OC(O)R、-OR、-SR、-S(O)R、-S(O)OR、-S(O)₂OR、-NO₂、-S(O)₂N(R)₂、-N(R)S(O)₂R、-NH(CH₂)_tlN(R)₂、-NH(CH₂)_plO(CH₂)_qlN(R)₂、-NH(CH₂)_slOR、-N((CH₂)_slOR)₂-N (R) -carbocycle, -N (R) -heterocycle, -N (R) -aryl, -N (R) -heteroaryl, -N (R) (CH)₂)_tl-carbocyclic ring, -N (R) (CH)₂)_tl-heterocycle, -N (R) (CH)₂)_tlAryl, -N (R) (CH)₂)_tl-heteroaryl, carbocycle, heterocycle, aryl and heteroaryl;

m is selected from 5,6, 7, 8, 9, 10, 11, 12 and 13;

n is selected from 1,2, 3,4, 5,6, 7, 8, 9 and 10;

r is 0 or 1;

t¹selected from 1,2, 3,4 and 5;

p¹selected from 1,2, 3,4 and 5;

q¹selected from 1,2, 3,4 and 5; and is

s¹Selected from 1,2, 3,4 and 5.

In some embodiments, the ionizable lipid has the formula (IL-IIj):

or an N-oxide thereof or a salt or isomer thereof, wherein

l is selected from 1,2, 3,4 and 5;

M₁is a bond or M'; and is

R²And R³Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups.

In some embodiments, the ionizable lipid has the formula (IL-IIk):

or an N-oxide thereof or a salt or isomer thereof, wherein

l is selected from 1,2, 3,4 and 5;

M₁is a bond or M'; and is

R^a’And R^b’Independently selected from C_1-14Alkyl and C_2-14Alkenyl groups; and is

R²And R³Independently selected from C_1-14Alkyl and C_2-14Alkenyl groups.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. application nos. 62/733,315 and 62/798,874.

In some embodiments, the ionizable lipid has the formula (IL-IIh):

or an N-oxide thereof or a salt or isomer thereof, wherein

R¹Selected from the group consisting of C_5-30Alkyl radical, C_5-20Alkenyl, -R + YR ", -YR", and-R "M' R";

each R⁵Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

each R⁶Independently selected from the group consisting of OH, C_1-3Alkyl radical, C_2-3Alkenyl and H;

R⁷selected from the group consisting of C_1-3Alkyl radical, C_2-3Alkenyl and H;

each R is independently selected from the group consisting of H, C_1-3Alkyl and C_2-3Alkenyl groups;

R^Nis H or C_1-3An alkyl group;

each R' is independently selected from C_1-18Alkyl radical, C_2-18Alkenyl, -R-YR ", and H;

each R' is independently selected from the group consisting of C_3-15Alkyl and C_3-15Alkenyl groups;

each R is independently selected from C_1-12Alkyl and C_2-12Alkenyl groups;

each Y is independently C_3-6A carbocyclic ring;

each X is independently selected from the group consisting of F, Cl, Br, and I;

X^aand X^bEach independently is O or S;

m is selected from 5,6, 7, 8, 9, 10, 11, 12 and 13;

n is selected from 1,2, 3,4, 5,6, 7, 8, 9 and 10;

r is 0 or 1;

t¹selected from 1,2, 3,4 and 5;

p¹selected from 1,2, 3,4 and 5;

q¹selected from 1,2, 3,4 and 5; and is

s¹Selected from 1,2, 3,4 and 5.

In some embodiments, the ionizable lipid has the formula (IL-IIi):

or an N-oxide thereof or a salt or isomer thereof, wherein

R^laAnd R^1bIndependently selected from C_1-14Alkyl and C_2-14Alkenyl groups; and is

R²And R³Independently selected from C_1-14Alkyl radical, C_2-14Alkenyl, -R-YR ", and-R-OR", OR R²And R³Together with the atoms to which they are attached form a heterocyclic or carbocyclic ring.

In some embodiments, the ionizable lipid has the formula (IL-IIj):

or an N-oxide thereof or a salt or isomer thereof, wherein

l is selected from 1,2, 3,4 and 5;

M₁is a bond or M'; and is

R²And R³Independently selected from H, C_1-14Alkyl and C_2-14Alkenyl groups.

In some embodiments, the ionizable lipid has the formula (IL-IIk):

or an N-oxide thereof or a salt or isomer thereof, wherein

l is selected from 1,2, 3,4 and 5;

M₁is a bond or M'; and is

R^a’And R^b’Independently selected from C_1-14Alkyl and C_2-14Alkenyl groups; and is

R²And R³Independently selected from C_1-14Alkyl and C_2-14Alkenyl groups.

In some embodiments, the ionizable lipid is

Or a salt thereof.

In some aspects, the ionizable lipid of the present disclosure can be one or more of the compounds of formula (IL-III),

or a salt or isomer thereof, wherein

W is

Ring A is

t is 1 or 2;

A₁and A₂Each independently selected from CH or N;

z is CH₂Or is absent, wherein when Z is CH₂When the dotted lines (1) and (2) each represent a single bond; and when Z is absent, both dashed lines (1) and (2) are absent;

R₁、R₂、R₃、R₄and R₅Independently selected from C_5-20Alkyl radical, C_5-20Alkenyl, -R 'MR', -R 'YR', -YR 'and-R OR';

R_X1and R_X2Each independently is H or C_1-3An alkyl group;

each M is independently selected from the group consisting of-C (O) O-, -OC (O) -, -OC (O) O-, -C (O) N (R ') -, -N (R ') C (O) -, -C (S) S-, -SC (S) -, -CH (OH) -, -P (O) (OR ') O-, -S (O)₂-, -C (O) S-, -SC (O) -, aryl and heteroaryl;

m is C₁-C₆An alkyl group, a carboxyl group,

W¹and W²Each independently selected from the group consisting of-O-and-N (R)₆) -a group of compositions;

each R₆Independently selected from the group consisting of H and C_1-5Alkyl groups;

X¹、X²and X³Independently selected from the group consisting of a bond, -CH₂-、-(CH₂)₂-、-CHR-、-CHY-、-C(O)-、-C(O)O-、-OC(O)-、-(CH₂)_n-C(O)-、-C(O)-(CH₂)_n-、-(CH₂)_n-C(O)O-、-OC(O)-(CH₂)_n-、-(CH₂)_n-OC(O)-、-C(O)O-(CH₂)_n-, -CH (OH) -, -C (S) -, and-CH (SH) -;

each Y is independently C_3-6A carbocyclic ring;

each R is independently selected from C_1-12Alkyl and C_2-12Alkenyl groups;

each R is independently selected from C_1-3Alkyl and C_3-6A group consisting of carbocyclic rings;

each R' is independently selected from C_1-12Alkyl radical, C_2-12Alkenyl and group HGroup (b);

each R' is independently selected from the group consisting of C_3-12Alkyl radical, C_3-12Alkenyl and-R MR'; and is

n is an integer from 1 to 6;

wherein when ring A isWhen it is, then

i)X¹、X²And X³Is not-CH₂-; and/or

ii)R₁、R₂、R₃、R₄And R₅At least one of which is-R "MR".

In some embodiments, the compound has any one of formulas (IL-IIIal) - (IL-IIIa 8):

in some embodiments, the ionizable lipid is one or more of the compounds described in U.S. application nos. 62/271,146, 62/338,474, 62/413,345, and 62/519,826, and PCT application No. PCT/US 2016/068300.

In some embodiments, the ionizable lipid is selected from compounds 1-156 described in U.S. application No. 62/519,826.

In some embodiments, the ionizable lipid is selected from the group consisting of compounds 1-16, 42-66, 68-76, and 78-156 described in U.S. application No. 62/519,826.

In some embodiments, the ionizable lipid is

Or a salt thereof.

The central amine portion of the lipid according to formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIal), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8) may be protonated at physiological pH. Thus, lipids may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino) lipids. The lipids may also be zwitterionic, i.e. neutral molecules having both a positive and a negative charge.

Polyethylene glycol (PEG) lipids

As used herein, the term "PEG lipid" refers to a polyethylene glycol (PEG) modified lipid. Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamines and phosphatidic acids, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1, 2-diacyloxypropyl-3-amines. Such lipids are also known as pegylated lipids. In some embodiments, the PEG lipid can be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

In some embodiments, PEG lipids include, but are not limited to, 1, 2-dimyristoyl-sn-glyceromethoxypolyethylene glycol (PEG-DMG), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [ amino (polyethylene glycol) ] (PEG-DSPE), PEG-distearoyl glycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleoyl, PEG-distearoyl, PEG-diacylglycinamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1, 2-dimyristoyl propan-3-amine (PEG-c-DMA).

In some embodiments, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

In some embodiments, the lipid portion of the PEG lipid comprises a length of about C₁₄To about C₂₂Preferably about C₁₄To about C₁₆. In some embodiments, PEG moiety (e.g., mPEG-NH)₂) Is about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the PEG lipid is PEG_2k-DMG。

In some embodiments, the lipid nanoparticles described herein can comprise PEG lipids that are non-diffusive PEG. Non-limiting examples of non-diffusing PEGs include PEG-DSG and PEG-DSPE.

PEG lipids are known in the art, such as those described in U.S. patent No. 8158601 and international publication No. WO2015/130584a2, which are incorporated herein by reference in their entirety.

In general, some other lipid components of the various formulae described herein (e.g., PEG lipids) can be synthesized as described in international patent application No. PCT/US2016/000129 entitled "Compositions and Methods for Delivery of Therapeutic Agents," filed on 10.12.2016, which is incorporated by reference in its entirety.

PEG lipids are lipids modified with polyethylene glycol. The PEG lipid may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG lipid can be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

In some embodiments, the PEG lipid useful in the present invention may be a pegylated lipid described in international publication No. WO2012099755, the contents of which are incorporated herein by reference in their entirety. Any of these exemplary PEG lipids described herein may be modified to include a hydroxyl group on the PEG chain. In some embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-pegylated lipid") is a pegylated lipid having one or more hydroxyl (-OH) groups on the lipid. In some embodiments, the PEG-OH lipid comprises one or more hydroxyl groups on the PEG chain. In some embodiments, the PEG-OH or hydroxyl-pegylated lipid comprises an-OH group at the end of the PEG chain. Each possibility represents a separate embodiment of the invention.

In some embodiments, the PEG lipids useful in the present invention are compounds of formula (PL-I). Provided herein are compounds of formula (PL-I):

or a salt thereof, wherein:

R³is-OR^O；

R^OIs hydrogen, optionally substituted alkyl or an oxygen protecting group;

r is an integer between 1 and 100, including 1 and 100;

L¹is optionally substituted C_1-10Alkylene, wherein C is optionally substituted_1-10At least one methylene group of the alkylene group is independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N (R)^N)、S、C(O)、C(O)N(R^N)、NR^NC(O)、C(O)O、OC(O)、OC(O)O、-OC(O)N(R^N)、NR^NC (O) O or NR^NC(O)N(R^N) Replacement;

d is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions;

m is 0,1, 2,3, 4,5, 6, 7, 8, 9 or 10;

a has the formula:

L²each instance of (A) is independently a bond or optionally substituted C_1-6Alkylene, wherein C is optionally substituted_1-6One methylene unit of the alkylene group is optionally substituted with O, N (R)^N)、S、C(O)、C(O)N(R^N)、NR^NC(O)、C(O)O、OC(O)、OC(O)O、OC(O)N(R^N)、NR^NC (O) O or NR^NC(O)N(R^N) Replacement;

R²each instance of (a) is independently optionally substitutedC of (A)_1-30Alkyl, optionally substituted C_1-30Alkenyl or optionally substituted C_1-30An alkynyl group; optionally wherein R is²Is independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N (R)^N)、O、S、C(O)、C(O)N(R^N)、NR^NC(O)、NR^NC(O)N(R^N)、C(O)O、OC(O)、OC(O)O、OC(O)N(R^N)、NR^NC(O)O、C(O)S、SC(O)、C(＝NR^N)、C(＝NR^N)N(R^N)、-NR^NC(＝NR^N)、NR^NC(＝NR^N)N(R^N)、C(S)、C(S)N(R^N)、NR^NC(S)、NR^NC(S)N(R^N)、S(O)、-OS(O)、S(O)O、OS(O)O、OS(O)₂、S(O)₂O、OS(O)₂O、N(R^N)S(O)、S(O)N(R^N)、-N(R^N)S(O)N(R^N)、OS(O)N(R^N)、N(R^N)S(O)O、S(O)₂、N(R^N)S(O)₂、S(O)₂N(R^N)、-N(R^N)S(O)₂N(R^N)、OS(O)₂N(R^N) Or N (R)^N)S(O)₂O is replaced;

R^Neach instance of (a) is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl or an optionally substituted heteroaryl; and is

p is 1 or 2.

In some embodiments, the compound of formula (PL-I) is a PEG-OH lipid (i.e., R)³is-OR^OAnd R is^OIs hydrogen). In some embodiments, the compound of formula (PL-I) has the formula (PL-I-OH):

or a salt thereof.

In some embodiments, PEG lipids useful in the present invention are pegylated fatty acids. In some embodiments, the PEG lipids useful in the present invention are compounds of formula (PL-II). Provided herein are compounds of formula (PL-II):

or a salt thereof, wherein:

R³is-OR^o；

R^OIs hydrogen, optionally substituted alkyl or an oxygen protecting group;

r is an integer between 1 and 100, including 1 and 100;

R⁵is optionally substituted C_10-40Alkyl, optionally substituted C_10-40Alkenyl or optionally substituted C_10-40An alkynyl group; and optionally R⁵Optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N (R) with one or more methylene groups of^N)、O、S、C(O)、C(O)N(R^N)、-NR^NC(O)、NR^NC(O)N(R^N)、C(O)O、OC(O)、OC(O)O、OC(O)N(R^N)、NR^NC(O)O、C(O)S、-SC(O)、C(＝NR^N)、C(＝NR^N)N(R^N)、NR^NC(＝NR^N)、NR^NC(＝NR^N)N(R^N)、C(S)、C(S)N(R^N)、-NR^NC(S)、NR^NC(S)N(R^N)、S(O)、OS(O)、S(O)O、OS(O)O、OS(O)₂、S(O)₂O、OS(O)₂O、-N(R^N)S(O)、S(O)N(R^N)、N(R^N)S(O)N(R^N)、OS(O)N(R^N)、N(R^N)S(O)O、S(O)₂、N(R^N)S(O)₂、-S(O)₂N(R^N)、N(R^N)S(O)₂N(R^N)、OS(O)₂N(R^N) Or N (R)^N)S(O)₂O is replaced; and is

R^NEach instance of (a) is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

In some embodiments, the compound of formula (PL-II) has the formula (PL-II-OH):

or a salt thereof. In some embodiments, r is 45.

In still other embodiments, the compound of formula (PL-II) is:

or a salt thereof.

In some embodiments, the compound of formula (PL-II) is

In some embodiments, the PEG lipid may be one or more of the PEG lipids described in U.S. application No. 62/520,530. In some embodiments, the PEG lipid is a compound of formula (PL-III):

or a salt or isomer thereof, wherein s is an integer between 1 and 100.

In some embodiments, the PEG lipid is a compound of the formula:

structured lipids

As used herein, the term "structural lipid" refers to sterols, and also to lipids containing sterol moieties.

Incorporation of a structural lipid in a lipid nanoparticle can help to mitigate aggregation of other lipids in the particle. The structural lipid may be selected from the group including, but not limited to, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, lycopene, ursolic acid, alpha-tocopherol, hopane, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, a "steroid" is a subgroup of steroids consisting of the alcohols of the steroid. In some embodiments, the structural lipid is a steroid. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid is an analog of cholesterol. In some embodiments, the structural lipid is alpha-tocopherol.

In some embodiments, the structural lipid may be one or more of the structural lipids described in U.S. application No. 62/520,530.

Phospholipids

Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.

The phospholipid moiety may be selected from, for example, the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

The fatty acid moiety can be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

Certain phospholipids promote fusion with membranes. In some embodiments, the cationic phospholipid may interact with one or more negatively charged phospholipids of a membrane (e.g., a cell membrane or an intracellular membrane). The fusion of the phospholipid to the membrane can allow one or more elements of the lipid-containing composition (e.g., therapeutic agent) to pass through the membrane, thereby allowing, for example, delivery of the one or more elements to a target tissue.

Non-natural phospholipid materials are also contemplated, including natural materials with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. In some embodiments, the phospholipid may be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne group can undergo copper-catalyzed cycloaddition upon exposure to the azide.

Phospholipids include, but are not limited to, glycerophospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol and phosphatidic acid. The phospholipid also includes sphingomyelin (sphingolipid), such as sphingomyelin (sphingomyelin).

In some embodiments, the phospholipid useful or possible for use in the present invention is an analogue or variant of DSPC. In some embodiments, the phospholipids useful or possible for use in the present invention are compounds of formula (PL-I):

(PL-I)，

or a salt thereof, wherein:

each R¹Independently is optionally substituted alkyl; or optionally two R¹Taken together with the intervening atoms to form an optionally substituted monocyclic carbocyclic or optionally substituted monocyclic heterocyclic group; or optionally three R¹Taken together with the intervening atoms to form an optionally substituted bicyclic carbocyclic group or an optionally substituted bicyclic heterocyclic group;

n is 1,2, 3,4, 5,6, 7, 8, 9 or 10;

m is 0,1, 2,3, 4,5, 6, 7, 8, 9 or 10;

a has the formula:

L²each instance of (A) is independently a bond or optionally substituted C_1-6Alkylene, wherein C is optionally substituted_1-6One methylene unit of the alkylene group being optionally substituted by-O-, -N (R)^N)-、-S-、-C(O)-、-C(O)N(R^N)-、-NR^NC(O)-、-C(O)O-、-OC(O)-、-OC(O)O-、-OC(O)N(R^N)-、-NR^NC (O) O-or-NR^NC(O)N(R^N) -substitution;

R²each instance of (a) is independently optionally substituted C_1-30Alkyl, optionally substituted C_1-30Alkenyl or optionally substituted C_1-30An alkynyl group; optionally wherein R is²Is independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N (R)^N)-、-O-、-S-、-C(O)-、-C(O)N(R^N)-、-NR^NC(O)-、-NR^NC(O)N(R^N)-、-C(O)O-、-OC(O)-、-OC(O)O-、-OC(O)N(R^N)-、-NR^NC(O)O-、-C(O)S-、-SC(O)-、-C(＝NR^N)-、-C(＝NR^N)N(R^N)-、-NR^NC(＝NR^N)-、-NR^NC(＝NR^N)N(R^N)-、-C(S)-、-C(S)N(R^N)-、-NR^NC(S)-、-NR^NC(S)N(R^N)-、-S(O)-、-OS(O)-、-S(O)O-、-OS(O)O-、-OS(O)₂-、-S(O)₂O-、-OS(O)₂O-、-N(R^N)S(O)-、-S(O)N(R^N)-、-N(R^N)S(O)N(R^N)-、-OS(O)N(R^N)-、-N(R^N)S(O)O-、-S(O)₂-、-N(R^N)S(O)₂-、-S(O)₂N(R^N)-、-N(R^N)S(O)₂N(R^N)-、-OS(O)₂N(R^N) -or-N (R)^N)S(O)₂O-substitution;

R^Neach instance of (a) is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl or an optionally substituted heteroaryl; and is

p is 1 or 2;

provided that the compound does not have the formula:

wherein R is²Each instance of (a) is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.

In some embodiments, the phospholipid may be one or more of the phospholipids described in U.S. application No. 62/520,530.

i) Phospholipid head modification

In some embodiments, the phospholipids useful or possible for the present invention comprise a modified phospholipid head (e.g., a modified choline group). In some embodiments, the phospholipid having a modified head is DSPC or an analog thereof having a modified quaternary amine. In some embodiments, in embodiments of formula (PL-I), R¹At least one of which is not methyl. In some embodiments, R¹At least one of which is not hydrogen or methyl. In some embodiments, the compound of formula (PL-I) has one of the following formulas:

or a salt thereof, wherein:

each t is independently 1,2, 3,4, 5,6, 7, 8, 9, or 10;

each u is independently 0,1, 2,3, 4,5, 6, 7, 8, 9, or 10; and is

Each v is independently 1,2 or 3.

In some embodiments, the compound of formula (PL-I) has formula (PL-I-a):

(PL-I-a)，

or a salt thereof.

In some embodiments, the phospholipids useful or possible for the present invention comprise a cyclic moiety in place of a glyceride moiety. In some embodiments, the phospholipids useful in the present invention are DSPC or analogs thereof having a cyclic moiety in place of a glyceride moiety. In some embodiments, the compound of formula (PL-I) has formula (PL-I-b):

(PL-I-b)，

or a salt thereof.

(ii) Phospholipid tail modification

In some embodiments, the phospholipids useful or possible for the present invention comprise a modified tail. In some embodiments, the phospholipid useful or possible for use in the present invention is DSPC or an analog thereof with a modified tail. As described herein, a "modified tail" can be a tail having a shorter or longer aliphatic chain, an aliphatic chain incorporating branching, an aliphatic chain incorporating substituents, an aliphatic chain in which one or more methylene groups are replaced with cyclic or heteroatom groups, or any combination thereof. In some embodiments, the compound of (PL-I) has formula (PL-I-a), or a salt thereof, wherein R is²At least one example of (A) is R²Each instance of (A) is optionally substituted C_1-30Alkyl radical, wherein R²Is independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N (R)^N)-、-O-、-S-、-C(O)-、-C(O)N(R^N)-、-NR^NC(O)-、-NR^NC(O)N(R^N)-、-C(O)O-、-OC(O)-、-OC(O)O-、-OC(O)N(R^N)-、-NR^NC(O)O-、-C(O)S-、-SC(O)-、-C(＝NR^N)-、-C(＝NR^N)N(R^N)-、-NR^NC(＝NR^N)-、-NR^NC(＝NR^N)N(R^N)-、-C(S)-、-C(S)N(R^N)-、-NR^NC(S)-、-NR^NC(S)N(R^N)-、-S(O)-、-OS(O)-、-S(O)O-、-OS(O)O-、-OS(O)₂-、-S(O)₂O-、-OS(O)₂O-、-N(R^N)S(O)-、-S(O)N(R^N)-、-N(R^N)S(O)N(R^N)-、-OS(O)N(R^N)-、-N(R^N)S(O)O-、-S(O)₂-、-N(R^N)S(O)₂-、-S(O)₂N(R^N)-、-N(R^N)S(O)₂N(R^N)-、-OS(O)₂N(R^N) -or-N (R)^N)S(O)₂O-substitution.

In some embodiments, the compound of formula (PL-I) has formula (PL-I-c):

or a salt thereof, wherein:

each x is independently an integer between 0-30, including 0 and 30; and is

Each instance of G is independently selected from the group consisting of: optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N (R)^N)-、-O-、-S-、-C(O)-、-C(O)N(R^N)-、-NR^NC(O)-、-NR^NC(O)N(R^N)-、-C(O)O-、-OC(O)-、-OC(O)O-、-OC(O)N(R^N)-、-NR^NC(O)O-、-C(O)S-、-SC(O)-、-C(＝NR^N)-、-C(＝NR^N)N(R^N)-、-NR^NC(＝NR^N)-、-NR^NC(＝NR^N)N(R^N)-、-C(S)-、-C(S)N(R^N)-、-NR^NC(S)-、-NR^NC(S)N(R^N)-、-S(O)-、-OS(O)-、-S(O)O-、-OS(O)O-、-OS(O)₂-、-S(O)₂O-、-OS(O)₂O-、-N(R^N)S(O)-、-S(O)N(R^N)-、-N(R^N)S(O)N(R^N)-、-OS(O)N(R^N)-、-N(R^N)S(O)O-、-S(O)₂-、-N(R^N)S(O)₂-、-S(O)₂N(R^N)-、-N(R^N)S(O)₂N(R^N)-、-OS(O)₂N(R^N) -or-N (R)^N)S(O)₂O-is formed. Each possibility represents a separate embodiment of the invention.

In some embodiments, the phospholipids useful or possible for the present invention comprise a modified phosphorylcholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in some embodiments, the phospholipids useful or possible for use in the present invention are compounds of formula (PL-I), wherein n is 1,3, 4,5, 6, 7, 8, 9 or 10. In some embodiments, the compound of formula (PL-I) has one of the following formulae:

or a salt thereof.

Alternative lipids

In some embodiments, an alternative lipid is used in place of the phospholipids of the present disclosure. Non-limiting examples of such alternative lipids include the following:

equivalent scheme

Example embodiments of devices, systems, and methods have been described herein. As noted elsewhere, these embodiments are described for illustrative purposes only and are not intended to be limiting. Other embodiments are possible and are encompassed by the present disclosure, as will be apparent from the teachings contained herein. Thus, the breadth and scope of the present disclosure should not be limited by any of the above-described embodiments, but should be defined only in accordance with the claims supported by the present disclosure and their equivalents. Further, embodiments of the present disclosure may include methods, systems, and devices that may further include any and all elements from any other disclosed methods, systems, and devices, including any and all elements corresponding to target particle separation, focusing/concentration. In other words, elements from one or another disclosed embodiment may be interchanged with elements from other disclosed embodiments. Furthermore, one or more features/elements of the disclosed embodiments may be deleted and still result in patentable subject matter (and thus yield yet further embodiments of the disclosure). Accordingly, some embodiments of the present disclosure may differ in patentability from one and/or another reference by the explicit absence of one or more elements/features. In other words, claims may include negative limitations to specifically exclude one or more elements/features, thereby creating embodiments that differ in patentability from the prior art that includes such features/elements.

103页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：搅拌机

Vortex mixer and related methods, systems, and apparatus

相关技术

网友询问留言