阅读说明：本技术 水稻多组织表达启动子及其应用 (Rice multi-tissue expression promoter and application thereof ) 是由 龙湍 吴春瑜 唐杰 曾翔 吴永忠 黄培劲 于 2020-06-02 设计创作，主要内容包括：本发明涉及基因工程和分子生物学技术领域,具体涉及水稻多组织表达启动子及其应用。本发明提供水稻多组织表达启动子GMS2P和GMS2P1、含有该启动子的表达盒和表达载体以及扩增该启动子的引物对。本发明的水稻多组织表达启动子GMS2P和GMS2P1为水稻内源序列,对水稻基因工程十分有利,可驱动目的基因在根、茎、叶、花药、花粉、雌蕊、颖壳及桨片中表达,为驱动基因在水稻多种组织中广泛表达提供了新方法。(The invention relates to the technical field of genetic engineering and molecular biology, in particular to a multi-tissue expression promoter of rice and application thereof. The invention provides rice multi-tissue expression promoters GMS2P and GMS2P1, an expression cassette and an expression vector containing the promoters, and a primer pair for amplifying the promoters. The rice multi-tissue expression promoters GMS2P and GMS2P1 are rice endogenous sequences, are very beneficial to rice genetic engineering, can drive target genes to be expressed in roots, stems, leaves, anthers, pollen, pistils, glumes and blades, and provide a new method for wide expression of the driver genes in various tissues of rice.)

1. The rice multi-tissue expression promoter is characterized in that the promoter is GMS2P or GMS2P1, and the GMS2P has any one of the following nucleotide sequences:

1) a nucleotide sequence shown as SEQ ID NO. 1;

2) a nucleotide sequence derived from 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and having the same promoter function of driving the DNA to be widely expressed in plant tissues including roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes and blades;

3) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO. 1;

GMS2P1 has the nucleotide sequence of any one of:

1) a nucleotide sequence shown as SEQ ID NO. 2;

2) a nucleotide sequence derived from 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 and having the same promoter function of driving the expression of DNA in plant tissues including roots, stems, pollen, ovaries, paddles and glumes;

3) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO. 2.

2. An expression cassette comprising the rice multi-tissue expression promoter of claim 1.

3. A vector comprising the rice multi-tissue expression promoter according to claim 1 or the expression cassette according to claim 2.

4. A host cell comprising the expression cassette of claim 2 or the vector of claim 3.

5. A primer pair for amplifying the rice multi-tissue expression promoter of claim 1.

6. A kit comprising one or more of the rice multi-tissue expression promoter of claim 1, the expression cassette of claim 2, the vector of claim 3, the host cell of claim 4, and the primer pair of claim 5.

7. Use of the rice multi-tissue expression promoter of claim 1, the expression cassette of claim 2, the vector of claim 3, the host cell of claim 4, the primer set of claim 5, or the kit of claim 6 for driving expression of DNA in multiple tissues of a plant.

8. Use of the rice multi-tissue expression promoter of claim 1, the expression cassette of claim 2, the vector of claim 3, the host cell of claim 4, the primer pair of claim 5, or the kit of claim 6 for preparing transgenic plants.

9. Use of the rice multi-tissue expression promoter of claim 1, the expression cassette of claim 2, the vector of claim 3, the host cell of claim 4, the primer pair of claim 5, or the kit of claim 6 for improving plant germplasm resources.

10. A method for expressing a DNA of interest in a plurality of tissues of a plant, comprising: introducing into a plant a DNA of interest operably linked to the rice multi-tissue expression promoter of claim 1.

Technical Field

The invention relates to the technical field of genetic engineering and molecular biology, in particular to multiple tissue expression promoters GMS2P and GMS2P1 of rice and application thereof.

Background

Transcriptional regulation is one of the major forms of plant gene expression regulation and is coordinated by cis-acting elements and trans-acting factors. The promoter is one of the most important cis-acting elements in plant gene transcription regulation, is generally located in the upstream region of the 5' end of a gene, and is a recognition and binding site for RNA polymerase and some trans-acting factors. The promoter mainly comprises two functional regions, namely a core promoter region and a transcription regulation region. The core promoter region is the shortest promoter fragment to initiate transcription, typically 40nt, and is a DNA sequence recognized and bound by RNA polymerase families I, II and III. This region contains several important functional elements that can accurately locate the transcription start point and direction, which is the basis of gene expression regulation. The transcription regulation region is located at the upstream (or downstream) of the core promoter, and can be combined with a specific transcription factor to play a role in regulating the space-time and strength of transcription, such as an enhancer, a silencer and the like. The deep research on the expression mode of the promoter is not only beneficial to understanding the expression regulation mechanism and biological function of the gene, but also beneficial to controlling the expression of the exogenous gene.

Promoters can be classified into constitutive promoters, inducible promoters, and space-time specific promoters according to their expression modes. Constitutive promoters are capable of promoting gene transcription in all or most tissues, resulting in spatiotemporal persistence and constancy of expression. The 35S promoter of tobacco mosaic virus, the Actin promoter of rice and the Ubiquitin promoter of corn belong to constitutive promoters. Constitutive promoters are widely used in genetic engineering research of plants for overexpression of target genes (e.g., insect-and herbicide-resistant genes). Inducible promoters can initiate or greatly increase gene expression upon stimulation by certain physical or chemical signals. They have sequence structures of enhancers, silencers, or similar functions, and have significant specificity. The inducible promoters can be classified into light-inducible promoters, heat-inducible promoters, low-temperature inducible promoters, drought-inducible promoters, wound-inducible promoters, hormone-inducible promoters and the like according to different inducing signals. Spatio-temporal specific promoters only initiate gene expression in specific growth stages or sites. A tissue-specific promoter is one of the spatio-temporal specific promoters that only promotes expression in a specific cell, tissue or organ. The expression of a target gene is controlled by using a promoter with tissue specific expression in the genetic transformation of plants, so that potential side effects caused by using a constitutive promoter can be effectively avoided, such as reduction of metabolic burden increased by constitutive expression, reduction of safety risk of transgenic food and adverse effect on environment, gene silencing caused by repeated use of the same promoter, and the like. There are various types of rice tissue-specific promoters developed so far, and promoters expressed specifically in tissues such as roots, stems, leaves, seeds, and fruits have been found in almost all kinds of tissues.

The rice spike is the reproductive organ of rice, and the growth of the rice spike determines the agronomic characters of the rice, such as seed setting rate, thousand grain weight, spike grain number, grain type, chalkiness grain rate, chalkiness degree, gel consistency, gelatinization temperature, amylose content, protein content and the like, such as yield, quality and the like. The stem is the supporting structure of the upper part of the rice field and controls the transportation of air, moisture and nutrients between the rice ears and the roots. The stem node is the position of the internode meristem, is the internode connecting point and is the regulation node of stem development. The top of the rice root is a growing point, the root tip and root hair are the main places for absorbing water and nutrients by the root system, and the promoter which is specifically expressed at the ear and the young root nodes simultaneously is searched, which is beneficial to the breeding of high-yield, high-quality, lodging-resistant, nutritional and high-efficiency rice varieties.

Disclosure of Invention

The invention aims to provide rice multi-tissue expression promoters GMS2P and GMS2P1 which belong to constitutive promoters, application thereof and a method for expressing target genes in plants by using the promoters.

The invention firstly provides a promoter GMS2P capable of widely driving DNA expression in tissues such as rice roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes, blades and the like, and the promoter GMS2P has any one of the following nucleotide sequences:

1) a nucleotide sequence shown as SEQ ID NO. 1;

2) a nucleotide sequence derived from 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and having the same promoter function of driving the expression of DNA in plant tissues including roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes and blades;

3) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO. 1.

Wherein, the nucleotide sequence derived from 1) in 2) is a nucleotide sequence which has 70% or more homology, 80% or more homology, 85% or more homology, 90% or more homology, 95% or more homology, 98% or more homology, or 99% or more homology with 1) and has the same promoter function for driving DNA to express in plant tissues such as roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes, and blades.

For the nucleotide sequence described in 3) which is complementary to the nucleotide sequence shown in SEQ ID NO.1, a DNA molecule complementary to the nucleotide sequence of GMS2P can be easily identified and utilized by those skilled in the art for the same purpose, and therefore, a DNA sequence having promoter activity and capable of hybridizing to the promoter sequence of the present invention or a fragment thereof under stringent conditions is included in the present invention. Wherein, the nucleotide sequence is complementary, which means that it can hybridize with GMS2P under stringent conditions.

Stringent conditions refer to conditions under which a probe will hybridize to a detectable degree to its target sequence over other sequences (e.g., at least 2 times background). Stringent conditions are sequence dependent and will vary with the other conditions of the experiment. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified that are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches so that a lower degree of similarity is detected (heterologous detection). Generally, probes are no longer than 1000 nucleotides in length, preferably shorter than 500 nucleotides.

Typically, stringent conditions are those in which the salt concentration is less than about 1.5M Na at a pH of 7.0-8.3⁺Typically about 0.01-1.0M Na⁺Concentration (or other salts) and temperature of at least about 30 ℃ for short probes (e.g., 10-50 nucleotides) and at least about 60 ℃ for long probes (e.g., more than 50 nucleotides). Severe can also be obtained by adding destabilizing agents such as formamideAnd (4) grid conditions. Low stringency conditions, for example, include hybridization in 30-35% formamide, 1M NaCl, l% SDS (sodium dodecyl sulfate) buffer at 37 ℃ and washing in 1 × to 2 × SSC (20 × SSC ═ 3.0M NaCl/0.3M trisodium citrate) at 50-55 ℃. Moderately stringent conditions, for example, comprise hybridization at 37 ℃ in a buffer solution of 40-45% formamide, 1.0M NaCl, l% SDS, washing at 55-60 ℃ in 0.5X to 1 XSSC. Highly stringent conditions, for example, include hybridization at 37 ℃ in a buffer solution of 50% formamide, 1M NaCl, l% SDS, and washing at 60-65 ℃ in 0.1 XSSC. Optionally, the wash buffer may contain about 0.1% to 1% SDS. Hybridization times are generally less than about 24 hours, usually about 4-12 hours.

Particularly typically as a function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, Tm can be estimated from the equation of Meinkoth and Wahl (Anal Biochem, 1984, 138: 267-284) that Tm is 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% form) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanine and cytosine nucleotides in DNA,% form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in a base pair. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm needs to be lowered by about l ℃ per 1% mismatch; thus, Tm hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if the sought sequence has > 90% identity, the Tm can be lowered by 10 ℃. Generally, stringent conditions are selected to be about 5 ℃ below the thermal melting point (Tm) for the particular sequence, and which are complementary at a defined ionic strength and pH. However, highly stringent conditions can employ hybridization and/or washing at 1, 2, 3, or 4 ℃ below the thermal melting point (Tm); moderately stringent conditions can employ a hybridization and/or wash at 6, 7, 8, 9, or 10 ℃ below the thermal melting point (Tm); low stringency conditions can employ hybridization and/or washing at 11, 12, 13, 14, 15, or 20 ℃ below the thermal melting point (Tm). One of ordinary skill in the art will appreciate that the conditions of the hybridization and/or wash solutions will vary with varying stringency, and that this equation can be used to calculate the hybridization and wash compositions and desired Tm. If the desired degree of mismatch is such that the Tm is below 45 deg.C (aqueous solution) or 32 deg.C (formamide solution), it is preferred to increase the SSC concentration to enable the use of higher temperatures. Guidelines for nucleic acid hybridization are found in Tijssen (1993) biochemical and molecular biology laboratory techniques using nucleic acid probe hybridization, part I, chapter 2 (Elsevier, New York); and Ausubel et al, edited (1995) Chapter 2, a modern method of molecular biology (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al (1989) molecular cloning, A Laboratory Manual (second edition, Cold Spring Harbor Laboratory Press, Plainview, New York).

The stringent conditions are preferably hybridization at 65 ℃ in a solution of 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate), followed by washing the membrane 1 times with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The invention also provides a promoter GMS2P1 capable of widely driving DNA expression in tissues such as rice roots, stems, pollen, ovaries, blades and glumes, and the promoter GMS2P1 has any one of the following nucleotide sequences:

1) a nucleotide sequence shown as SEQ ID NO. 2;

2) a nucleotide sequence which is derived from 1) and has the nucleotide sequence shown in SEQ ID NO.2 by replacing, deleting or adding one or more nucleotides and has the same promoter function of driving the expression of DNA in plant tissues including roots, stems, pollen, ovaries, paddles and glumes;

3) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO. 2.

The nucleotide sequence shown in SEQ ID NO.2 is obtained by deleting 490bp from the 5 'to 3' direction of the nucleotide sequence shown in SEQ ID NO. 1.

Wherein, the nucleotide sequence derived from 1) in 2) is a nucleotide sequence which has 70% or more homology, 80% or more homology, 85% or more homology, 90% or more homology, 95% or more homology, 98% or more homology or 99% or more homology with 1) and has the same promoter function for driving the specific expression of DNA in the ear and the rootlet nodes.

For the nucleotide sequence described in 3) which is complementary to the nucleotide sequence shown in SEQ ID NO.2, a DNA molecule which is complementary to the nucleotide sequence of GMS2P1 can be easily identified and utilized by those skilled in the art for the same purpose, and therefore, a DNA sequence having promoter activity and capable of hybridizing to the promoter sequence of the present invention or a fragment thereof under stringent conditions is included in the present invention. Wherein, the nucleotide sequence is complementary, which means that it can hybridize with GMS2P1 under stringent conditions.

Stringent conditions refer to conditions under which a probe will hybridize to a detectable degree to its target sequence over other sequences (e.g., at least 2 times background). Stringent conditions are sequence dependent and will vary with the other conditions of the experiment. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified that are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches so that a lower degree of similarity is detected (heterologous detection). Generally, probes are no longer than 1000 nucleotides in length, preferably shorter than 500 nucleotides.

Typically, stringent conditions are those in which the salt concentration is less than about 1.5M Na at a pH of 7.0-8.3⁺Typically about 0.01-1.0M Na⁺Concentration (or other salts) and temperature of at least about 30 ℃ for short probes (e.g., 10-50 nucleotides) and at least about 60 ℃ for long probes (e.g., more than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Low stringency conditions, for example, include hybridization in 30-35% formamide, 1M NaCl, l% SDS (sodium dodecyl sulfate) buffer at 37 ℃ and washing in 1 × to 2 × SSC (20 × SSC ═ 3.0M NaCl/0.3M trisodium citrate) at 50-55 ℃. Moderately stringent conditions, for example, comprise hybridization at 37 ℃ in a buffer solution of 40-45% formamide, 1.0M NaCl, l% SDS, washing at 55-60 ℃ in 0.5X to 1 XSSC. Highly stringent conditions, for example, include hybridization at 37 ℃ in a buffer solution of 50% formamide, 1M NaCl, l% SDS, and washing at 60-65 ℃ in 0.1 XSSC. Optionally, the wash buffer may contain about 0.1% to 1% SDS. Hybridization times are generally less than about 24 hours, usually about 4-12 hours.

Particularly typically as a function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, Tm can be estimated from the equation of Meinkoth and Wahl (Anal Biochem, 1984, 138: 267-284) that Tm is 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% form) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanine and cytosine nucleotides in DNA,% form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in a base pair. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm needs to be lowered by about l ℃ per 1% mismatch; thus, Tm hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if the sought sequence has > 90% identity, the Tm can be lowered by 10 ℃. Generally, stringent conditions are selected to be about 5 ℃ below the thermal melting point (Tm) for the particular sequence, and which are complementary at a defined ionic strength and pH. However, highly stringent conditions can employ hybridization and/or washing at 1, 2, 3, or 4 ℃ below the thermal melting point (Tm); moderately stringent conditions can employ a hybridization and/or wash at 6, 7, 8, 9, or 10 ℃ below the thermal melting point (Tm); low stringency conditions can employ hybridization and/or washing at 11, 12, 13, 14, 15, or 20 ℃ below the thermal melting point (Tm). One of ordinary skill in the art will appreciate that the conditions of the hybridization and/or wash solutions will vary with varying stringency, and that this equation can be used to calculate the hybridization and wash compositions and desired Tm. If the desired degree of mismatch is such that the Tm is below 45 deg.C (aqueous solution) or 32 deg.C (formamide solution), it is preferred to increase the SSC concentration to enable the use of higher temperatures. Guidelines for nucleic acid hybridization are found in Tijssen (1993) biochemical and molecular biology laboratory techniques using nucleic acid probe hybridization, part I, chapter 2 (Elsevier, New York); and Ausubel et al, edited (1995) Chapter 2, a modern method of molecular biology (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al (1989) molecular cloning, A Laboratory Manual (second edition, Cold Spring Harbor Laboratory Press, Plainview, New York).

The stringent conditions are preferably hybridization at 65 ℃ in a solution of 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate), followed by washing the membrane 1 times with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The invention further provides an expression cassette containing the rice multi-tissue expression promoter GMS2P or GMS2P1, a vector containing the rice multi-tissue expression promoter GMS2P or GMS2P1 or the expression cassette, and a host cell containing the expression cassette or the vector.

The expression cassette is an expression cassette which is operably connected with a structural gene, a regulatory gene, an antisense gene of the structural gene, an antisense gene of the regulatory gene or a small RNA gene capable of interfering the expression of an endogenous gene at the downstream of a promoter GMS2P and/or GMS2P 1.

The vector is an expression vector or a gene editing vector.

The host cell is a microbial cell, a plant cell or a transgenic plant cell line.

The invention also provides plants or plant tissues containing the expression cassettes or the vectors.

The invention provides a primer pair for amplifying the rice multi-tissue expression promoter GMS2P or GMS2P 1.

As an embodiment of the present invention, the nucleotide sequences of the primer pair for amplifying GMS2P are SEQ ID NO.3 and SEQ ID NO.5, and the nucleotide sequences of the primer pair for amplifying GMS2P1 are SEQ ID NO.4 and SEQ ID NO. 5.

SEQ ID NO.3:CGACGGCCAGTGCCAGTAGTTGAGCTCAGGAC；

SEQ ID NO.4:CGACGGCCAGTGCCACAATTTCTATTGGATTTGGCAC；

SEQ ID NO.5:TACCCTCAGATCTACCATGGCGGCGGTGGTGGTGTTG。

The invention provides a kit, which comprises one or more of rice multiple tissue expression promoters GMS2P and GMS2P1, an expression cassette containing the promoters or a vector containing the promoters and the expression cassette, a host cell containing the expression cassette or the vector, and a primer pair for amplifying the promoters GMS2P and GMS2P 1.

The invention further provides application of the rice multi-tissue expression promoter GMS2P and/or GMS2P1, or the expression cassette or the vector or the host cell or the primer pair or the kit in driving expression of DNA in various tissues of plants.

Specifically, the application is that GMS2P is used for driving the expression of DNA in tissues such as roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes and blades of plants, or GMS2P1 is used for driving the expression of DNA in tissues such as roots, stems, pollen, ovaries, blades and glumes of plants.

The invention provides application of the rice multi-tissue expression promoter GMS2P and/or GMS2P1, or the expression cassette or the vector or the host cell or the primer pair or the kit in preparing transgenic plants.

The transgenic plant is a transgenic plant in which the DNA of interest is expressed in various tissues.

Such plants include, but are not limited to, rice, corn, sorghum, barley, oats, wheat, millet, sugarcane, soybean, brassica species, cotton, safflower, tobacco, alfalfa, and sunflower.

The invention provides application of the rice multi-tissue expression promoter GMS2P and/or GMS2P1, or the expression cassette or the vector or the host cell or the primer pair or the kit in preparing transgenic rice.

The invention also provides application of the rice multi-tissue expression promoter GMS2P and/or GMS2P1, or the expression cassette or the vector or the host cell or the primer pair or the kit in plant germplasm resource improvement.

The improvement may be an improvement in one or more of the following agronomic traits: yield, nutritional quality, nitrogen use efficiency traits, water use efficiency traits, herbicide resistance traits, pesticide resistance traits, and the like.

The present invention also provides a method for expressing a DNA of interest in a plurality of tissues of a plant, comprising: introducing into a plant a DNA of interest operably linked to said rice multiple tissue expression promoter GMS2P or GMS2P 1.

Specifically, the method may be: cloning a rice multi-tissue expression promoter GMS2P or GMS2P1 and a target gene into a vector to obtain a recombinant expression vector containing GMS2P or GMS2P1 and an expression cassette of the target gene, and introducing the recombinant expression vector into a plant genome to obtain a transgenic plant with the target gene expressed in various tissues.

The invention also provides a method for separating the multiple tissue expression promoters GMS2P and GMS2P1, which is to PCR amplify the multiple tissue expression promoters GMS2P and GMS2P1 by using the primer pairs shown in SEQ ID NO.3 and SEQ ID NO.5, SEQ ID NO.4 and SEQ ID NO.5, respectively.

The invention has the beneficial effects that: the multiple tissue expression promoters GMS2P and GMS2P1 provided by the invention have the following advantages:

1) GMS2P and GMS2P1 are endogenous DNA sequences of rice, and the safety risk of transgenosis is extremely low;

2) the GMS2P can drive the expression of the target gene in tissues such as roots, stems, leaves, anthers, pollen, ovaries, stigma, glumes, blades and the like, and the GMS2P1 can drive the expression of the target gene in tissues such as roots, stems, pollen, ovaries, blades, glumes and the like, and the expression level is accurate.

3) The present invention provides a novel method for driving expression of a gene of interest in a variety of plant tissues.

Drawings

FIG. 1 is a diagram showing a distribution of cis-regulatory elements in example 1 of the present invention, wherein P and P1 ARE assigned to GMS2P and GMS2P1, 1 is TATA-Box, 2 is ARE, 3 is CAAT-Box, 4 is TAAGAGAGGAA, 5 is GATA-motif, 6 is Box 4, 7 is ABRE, 8 is P-Box, 9 is ATTAAT, 10 is CAT-Box, 11 is TGACG-motif, 12 is MRE, and 13 is GT 1-motif.

FIG. 2 is a map of a recombinant expression vector pC1300gus-GMS2P of the multiple tissue expression promoter GMS2P in example 2 of the present invention.

FIG. 3 is a map of a recombinant expression vector pC1300gus-GMS2P1 of the multiple tissue expression promoter GMS2P1 in example 2 of the present invention.

FIG. 4 is the agarose gel electrophoresis image of PCR detection of transgenic plants in example 3 of the present invention. The lanes are from left to right: middle flower 11 genomic DNA; pC1300gus-GMS2P plasmid DNA; 30T 0 transgenic plants; m is 2000DNA Marker.

FIG. 5 is the agarose gel electrophoresis image of PCR detection of transgenic plants in example 3 of the present invention. The lanes are from left to right: m is 2000DNA Marker; middle flower 11 genomic DNA; pC1300gus-GMS2P1 plasmid DNA; 22T 0 transgenic plants.

FIG. 6 shows GUS staining results of roots, stems, leaves, glumes, anthers, blades, stigma, ovaries and pollen of transgenic positive plants of T0 generation of transgenic flower 11 transformed with pC1300GUS-GMS2P and pC1300GUS-GMS2P1 vectors in example 4 of the present invention.

FIG. 7 shows the detection of the expression level of GMS2 gene in different tissues of rice by real-time fluorescent quantitative PCR in example 5 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 obtaining of multiple tissue expression promoters GMS2P and GMS2P1 from Rice

1. Extraction of genomic DNA of Rice

The genomic DNA of rice was extracted using a plant DNA isolation kit (Chengdu Fuji Biotechnology Co., Ltd.). The genome is derived from fresh leaves of rice variety 9311. The extracted genome DNA is subpackaged and stored at-20 ℃ for later use.

2. Functional element analysis of promoter region of GMS2 Gene

Cis-regulatory element analysis was performed using the PLACE database (https:// www.dna.affrc.go.jp/PLACE/. As shown in FIG. 1, a large number of TATA-boxes and CAAT-boxes are densely distributed in the region from-1984 bp to-1500 bp. The regions of-1984 bp to-1 bp, and-1494 bp to-1 bp were selected for promoter activity analysis, and the sequences of the two regions were named GMS2P and GMS2P1, respectively.

3. PCR primer design and amplification for GMS2P and GMS2P1

Primer design Using the Gibson Assembly method, the amplification product was inserted between the Nco I and Pst I cleavage sites of the pC1300GUSPlus vector (obtained by inserting a GUSPlus element into the pCAMBIA1300 multiple cloning site). The primers shown in SEQ ID NO.3 and SEQ ID NO.5, and SEQ ID NO.4 and SEQ ID NO.5 were used to amplify two promoters of GMS2P and GMS2P1, respectively, using 9311 genomic DNA as a template. Wherein 15 nucleotide sequences at the 5' end of each forward and reverse primer overlap with the corresponding ligation sites of the vector for Gibson Assembly ligation. PCR reaction (100. mu.L): DNA template: 3 μ L (50ng), KOD polymerase (from Toyo Fang): 2 μ L, 10 × buffer: 10 μ L, 10 μ M forward primer: 3 μ L, 10 μ M reverse primer: 3 μ L, 10 μ M dNTP: 10 μ L, MgSO 4: 4 μ L, 1/10 DMSO: 20 μ L, ddH₂O：45μL。

PCR procedure: pre-denaturation at 95 ℃ for 4 min. Denaturation at 94 ℃ for 30 s; annealing at 50 ℃ for 30 s; extending at 68 ℃ for 2 min; 35 cycles. Extension was 68 ℃ for 10 min.

The amplification product comprises a multiple tissue expression promoter GMS2P (with the sequence shown as SEQ ID NO.1) of 1984bp and a deletion fragment GMS2P1 (with the sequence shown as SEQ ID NO.2) of 1494 bp.

Example 2 construction of recombinant expression vectors for the promoters GMS2P and GMS2P1 pC1300gus-GMS2P and pC1300gus-GMS2P1

The PCR products obtained in example 1 were electrophoresed on a 1% agarose gel, and bands of sizes 1984bp and 1494bp were recovered. The vector pC1300GUSPlus was digested with Nco I and Hind III to recover the linear digested vector.

The PCR-recovered product was ligated with the linearized pC1300GUSPlus empty vector using the lightning Cloning Kit (Bio-technology Co., Ltd., King, Beijing) in a 10. mu.L system as follows: mu.L of the recovered product (50 ng/. mu.L), 0.5. mu.L of the digestion vector (100 ng/. mu.L), and 2.5. mu.L of the Ligation Mix. And (3) connecting procedures: 50 ℃ for 60 min.

5 mu L of the ligation product is taken to transform the competent cells of the Escherichia coli by electric shock. Colony PCR was performed using primers SEQ ID NO.6 and SEQ ID NO.7, and positive clones were selected for sequencing validation. The correctly sequenced vectors were designated pC1300gus-GMS2P (FIG. 2) and pC1300gus-GMS2P1 (FIG. 3), respectively. The pC1300GUSPlus vector contains GUS gene, and the tissue expressing the GUS gene is blue after being dyed and can be used for indicating the expression position and the strength of the promoter.

Example 3 obtaining of transgenic Rice with pC1300gus-GMS2P and pC1300gus-GMS2P1

Agrobacterium EHA105 stored at-70 ℃ was streaked on a plate containing 50. mu.g/mL rifampicin and cultured at 28 ℃. Single colonies were picked and inoculated into 50mL YEP liquid medium and cultured with shaking at 220rpm and 28 ℃ for 12-16 hr. Transferring 2mL of the bacterial solution into 100mL of YEB liquid medium (containing antibiotics), and performing shaking culture at 28 ℃ and 220rpm until OD is reached₆₀₀0.5. Precooling on ice for 10 minutes, and centrifuging at 5000rpm for 10min (refrigerated centrifuge precooling to 4 ℃). The solution was washed 2 times with sterile deionized water (10 mL each) and 1 time with 10% glycerol in 3mL of 10% glycerol. mu.L of competent cells were transfected with 2.5KV by adding 1. mu.L of the plasmids pC1300gus-GMS2P and pC1300gus-GMS2P1 obtained in example 2. Positive clones were selected by culturing on YEP plates containing kanamycin and rifampicin at 28 ℃ and verified by PCR using pC1300GUSPlus vector-specific primers SEQ ID NO.6 and SEQ ID NO. 7.

The correct clones were verified and rice medium flower 11 was infected by Agrobacterium-mediated genetic transformation (Hiei Y Ohta S, Komari T, Kumashiro T (1994) efficiency transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the bases of the T-DNA. the Plant Journal 6: 271) 282). The T0 generation transgenic seedlings are obtained through links of co-culture, screening, differentiation, rooting and the like. Total DNA from leaves of the transformed plants was extracted and PCR-positive detection was performed using primers SEQ ID NO.8 and SEQ ID NO.9, and the electrophoretograms of PCR products from transgenic plants pC1300gus-GMS2P and pC1300gus-GMS2P1 are shown in FIGS. 4 and 5, respectively. And selecting positive plants verified by PCR (polymerase chain reaction), and selfing and fructifying to obtain T1 generations. Plants from the T0 or T1 generations were taken for subsequent analysis.

Example 4 GUS staining analysis of transgenic Rice

Preparing GUS staining solution X-Gluc reaction liquid (50mM sodium phosphate buffer solution, pH value of 7.0, 0.5mM potassium ferricyanide, 0.5mM potassium ferrocyanide, 0.5mg/ml X-Gluc, 20% methanol by volume percentage, 0.1% Triton X-100), randomly selecting more than 5 pC1300GUS-GMS2P and pC1300GUS-GMS2P1 transgenic positive strains obtained in example 3, collecting anther, pistil, glume, root, leaf, stem and other tissue samples, soaking in the X-Gluc reaction liquid for 2 hours at 37 ℃ or overnight, removing the color of the tissue chloroplast by using 75% ethanol by volume percentage, and observing and taking pictures. As a result, as shown in FIG. 6, the root, stem, leaf, glume, anther, blade, stigma, ovary, pollen, and other tissues or organs of GMS2P transgenic plants were stained blue. While the transgenic plant of GMS2P1, which is 490bp shorter than GMS2P, has the leaf, anther and stigma which cannot be dyed, only a tiny spotted blue region on the glume is respectively, the root and stem can be dyed blue but the dyed region is smaller than that of GMS2P transgenic plant, and the blade, ovary and pollen can be dyed blue and the dyed level is equivalent to that of GMS2P transgenic plant. The results show that the GMS2P promoter can drive the expression of GUS gene in rice root, stem, leaf, glume, anther, blade, stigma, ovary and pollen, and the GMS2P1 promoter can drive the expression of GUS gene in rice root, stem, pollen, ovary, blade, glume and other tissues or organs.

Example 5 expression analysis of GMS2 Gene

And (3) extracting total RNA from different tissues in 93-11 booting stages, and performing reverse transcription to obtain cDNA. Using primer InD48490 — F: GCTCCGGCTGTTGATCT (SEQ ID NO:10) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO:11), the expression level of GMS2 gene was measured using a primer GAPDH-RTF: GAATGGCTTTCCGTGTT (SEQ ID NO:12) and GAPDH-RTR: CAAGGTCCTCCTCAACG (SEQ ID NO:13) to detect the expression level of rice reference gene GAPDH. And (3) analyzing the expression quantity by adopting a real-time fluorescent quantitative PCR method. The results are shown in FIG. 7, and indicate that the GMS2 gene is expressed in roots, stems, nodes, leaves and ears, but the expression level in ears is significantly higher than that in other tissues. The above results indicate that the promoter of the GMS2 gene is a constitutive promoter.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> rice multi-tissue expression promoter and application thereof

<130> KHP201111611.4

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1984

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtagttgagc tcaggactgg agccagtatg ttactctgaa aagaaccagc atataggaca 60

tagatggtga tttatcaaaa accatatcat ttctacacaa ccatatagcc caacatatag 120

cggatgctcc aacaagaata aatttggtag attttttatc aacccccaca agccaattct 180

caaaaatatg agatatacta taatgagtat ataaaccagt agtaaactgt agaactctcc 240

aaagaaattt tgtacagtaa cactccacga ataaatattg aatagtctta tttcgaaggc 300

catgagattt gagctcatgt tttagatcct ccaaaaaaaa agtgaaggaa aaaatggttc 360

ctatggaaaa ttttctgttc atagttttaa attctacaaa ttatctatta agatacctta 420

ctgtgaatga gcctgcacta ttcatgatgc cataagttag ctctactctt taagttatcc 480

tttgggaatt caatttctat tggatttggc actattattc atccatttga aatgatggat 540

tggaacatag taaaaggaga tctctagtat aataatagag gaaaattttc ctttgccatt 600

gattccattg cgataggaac atctactata ttttttcccc ttttctttgc taagattaat 660

gaaactgtac attaaccaaa gttgaggata ttttgaccaa cgaaattttt atcgtcgttt 720

tgtaataatc tcgtgataac tagattccta cggtccaaac tacgcacctt ctatttcatg 780

tgtttttcaa tcatctattt atttacatgt acattcttat gttggttact atgttttttt 840

ttttctattt gtgtgatttt tcattcccct tttgaaagga gccataaaca tttgtagctc 900

aaactgtgtt ctacgcataa cataatcata aattgtaaga ttcccttgga tgggtttagg 960

tcattctcta agtaacctta accattaatc ttatttaatc aaaggatttc ggatctattt 1020

gtactactgt agatctattt gtaataccgc tctataagtt aatggtagta gaaatgtgga 1080

tgagcatcat tattaaaaaa atggtgcggt ggtataatca tcatttagaa gtgactaaac 1140

ccattttctt cttttttttt tgggctttat ctacagaata taagcaatgc cactgcgatg 1200

acctagttcg attcagacgg aaaataaaac ataaatgata aagttacccc aataaattac 1260

taattaaccc ttaataataa atggtttgga ttattttttt attagtataa taatattagt 1320

agagagtacc aggtattttt gacgaacatc ataaaacaat actaccacga aaacaaacgt 1380

gtttaaactt tcaccatcct tattattggt atgactagtt caatcctcta attatagtgc 1440

aaaataaaac gctgtgcctc aatttaataa ttatagctta ccaacaaaaa cggggagtta 1500

atgtcgtacc aacataacct aaatatatgt ggccattctc atagatactc ttagaccata 1560

ctactggatt tttagcatat cgagtattcg attaaaactc tcaatcatgt gtggttaaca 1620

caaacgtgct aggcatgaaa acaccagcac tccatagtcc acagcactga gcacgcgatc 1680

caacaagagc accccaccgc cgcacagaaa atcatcacaa ccatcgaggc tgcagcacat 1740

gtccaggctt tagtgctgca cactccagta ctccatccag cacctaacca tggtcacggc 1800

acaaactcaa cttctctttt tctttgaaga ctcaacccaa cacctgaacc cctccaagac 1860

taaagtccaa caggccaaaa acccacgccc agaaaaagct aaaaccccaa cacggcgcac 1920

actactctcc ttcctctccc caacgtgtca caccacacca cacaacacca ccaccgccgc 1980

catg 1984

<210> 2

<211> 1494

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caatttctat tggatttggc actattattc atccatttga aatgatggat tggaacatag 60

taaaaggaga tctctagtat aataatagag gaaaattttc ctttgccatt gattccattg 120

cgataggaac atctactata ttttttcccc ttttctttgc taagattaat gaaactgtac 180

attaaccaaa gttgaggata ttttgaccaa cgaaattttt atcgtcgttt tgtaataatc 240

tcgtgataac tagattccta cggtccaaac tacgcacctt ctatttcatg tgtttttcaa 300

tcatctattt atttacatgt acattcttat gttggttact atgttttttt ttttctattt 360

gtgtgatttt tcattcccct tttgaaagga gccataaaca tttgtagctc aaactgtgtt 420

ctacgcataa cataatcata aattgtaaga ttcccttgga tgggtttagg tcattctcta 480

agtaacctta accattaatc ttatttaatc aaaggatttc ggatctattt gtactactgt 540

agatctattt gtaataccgc tctataagtt aatggtagta gaaatgtgga tgagcatcat 600

tattaaaaaa atggtgcggt ggtataatca tcatttagaa gtgactaaac ccattttctt 660

cttttttttt tgggctttat ctacagaata taagcaatgc cactgcgatg acctagttcg 720

attcagacgg aaaataaaac ataaatgata aagttacccc aataaattac taattaaccc 780

ttaataataa atggtttgga ttattttttt attagtataa taatattagt agagagtacc 840

aggtattttt gacgaacatc ataaaacaat actaccacga aaacaaacgt gtttaaactt 900

tcaccatcct tattattggt atgactagtt caatcctcta attatagtgc aaaataaaac 960

gctgtgcctc aatttaataa ttatagctta ccaacaaaaa cggggagtta atgtcgtacc 1020

aacataacct aaatatatgt ggccattctc atagatactc ttagaccata ctactggatt 1080

tttagcatat cgagtattcg attaaaactc tcaatcatgt gtggttaaca caaacgtgct 1140

aggcatgaaa acaccagcac tccatagtcc acagcactga gcacgcgatc caacaagagc 1200

accccaccgc cgcacagaaa atcatcacaa ccatcgaggc tgcagcacat gtccaggctt 1260

tagtgctgca cactccagta ctccatccag cacctaacca tggtcacggc acaaactcaa 1320

cttctctttt tctttgaaga ctcaacccaa cacctgaacc cctccaagac taaagtccaa 1380

caggccaaaa acccacgccc agaaaaagct aaaaccccaa cacggcgcac actactctcc 1440

ttcctctccc caacgtgtca caccacacca cacaacacca ccaccgccgc catg 1494

<210> 3

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgacggccag tgccagtagt tgagctcagg ac 32

<210> 4

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgacggccag tgccacaatt tctattggat ttggcac 37

<210> 5

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taccctcaga tctaccatgg cggcggtggt ggtgttg 37

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatcagttta aagaaagatc aaagctc 27

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctgcaaggcg attaagttgg gtaac 25

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cttagccaga cgagcgggtt c 21

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcttctgcgg gcgatttgt 19

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctccggctg ttgatct 17

<210> 11

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcctgctctt cctcctg 17

<210> 12

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaatggcttt ccgtgtt 17

<210> 13

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caaggtcctc ctcaacg 17