Polynucleotide
阅读说明：本技术 多核苷酸 (Polynucleotide ) 是由 安德里亚·克里斯蒂安 托尼·诺兰 安德鲁·哈蒙德 于 2019-06-21 设计创作，主要内容包括：本发明涉及多核苷酸,特别是涉及代表启动子序列的新型多核苷酸。本发明尤其涉及在生殖细胞表达中使用的新型启动子,因为它们仅在生殖细胞中基本上有效。特别地,启动子在节肢动物的生殖细胞中启动基因的转录,并且可以用于基因驱动中。本发明还涉及包含本发明的多核苷酸的载体和基因驱动构建体。本发明还涉及生产节肢动物的方法,该节肢动物包含含有此类启动子的载体。(The present invention relates to polynucleotides, in particular to novel polynucleotides representing promoter sequences. The invention relates in particular to novel promoters for use in germ cell expression, as they are substantially effective only in germ cells. In particular, promoters initiate transcription of genes in arthropod germ cells and can be used in gene drives. The invention also relates to vectors and gene driver constructs comprising the polynucleotides of the invention. The present invention also relates to a method for producing arthropods comprising vectors containing such promoters.)
1. An isolated polynucleotide comprising a sequence substantially as set forth in SEQ ID No: 1.2 or 3, or a variant thereof which is identical to the nucleic acid sequence of any one of SEQ ID nos: 1.2 or 3, or a variant or fragment thereof having at least 50% sequence identity.
2. The isolated polynucleotide of claim 1, wherein the polynucleotide comprises a nucleotide sequence identical to SEQ ID No: 1, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 80% or 90% sequence identity.
3. The isolated polynucleotide of claim 1, wherein the polynucleotide comprises a nucleotide sequence identical to SEQ ID No: 1, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 95% or 99% sequence identity.
4. The isolated polynucleotide of claim 1, wherein the polynucleotide sequence comprises a nucleotide sequence identical to SEQ ID No: 2, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 80% or 90% sequence identity.
5. The isolated polynucleotide of claim 1, wherein the polynucleotide sequence comprises a nucleotide sequence identical to SEQ ID No: 2, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 95% or 99% sequence identity.
6. The isolated polynucleotide of claim 1, wherein the polynucleotide sequence comprises a nucleotide sequence identical to SEQ ID No: 3, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 80% or 90% sequence identity.
7. The isolated polynucleotide of claim 1, wherein the polynucleotide sequence comprises a nucleotide sequence identical to SEQ ID No: 3, or a variant or fragment thereof, or consisting of said nucleic acid sequence, said nucleic acid sequence variant or fragment, having at least 95% or 99% sequence identity.
8. The isolated polynucleotide of any of the preceding claims, wherein the polynucleotide promotes gene expression of a coding sequence operably linked thereto only in germ cells.
9. The isolated polynucleotide of any one of the preceding claims, wherein the polynucleotide sequence is a promoter sequence that is substantially effective only in arthropod germ cells, optionally wherein the polynucleotide is a promoter sequence that is substantially effective in male and female mosquito gonad cells at meiosis.
10. An expression cassette comprising a polynucleotide according to any one of the preceding claims operably linked to a transgene.
11. The expression cassette of claim 10, wherein the transgene is selected from the group consisting of: CRISPR nuclease, zinc finger nuclease, TALEN-derived nuclease, Cre recombinase and back-spanning transposase; andan integrase.
12. The expression cassette of claim 10 or 11, wherein the transgene is a CRISPR nuclease, optionally wherein the transgene is Cpf1 or Cas 9.
13. A recombinant vector comprising a polynucleotide according to any one of claims 1 to 9 or an expression cassette according to any one of claims 10 to 12.
14. A host cell comprising the expression cassette of any one of claims 10 to 12 or the recombinant vector of claim 13.
15. The host cell of claim 14, wherein the cell is an arthropod cell, optionally wherein the arthropod cell is an insect cell.
16. The host cell of claim 15, wherein the insect cell is a mosquito cell, optionally wherein the mosquito is of anopheles.
17. The host cell of claim 16, wherein the mosquito is selected from the group consisting of: anopheles gambiae; anopheles cruzi; anopheles thumbsis; anopheles arabica; four rings of anopheles sp; anopheles stephensi; anopheles funestus; and Melaleuca melleus.
18. A method of producing a transgenic host cell, the method comprising introducing into a host cell the expression cassette of any one of claims 10 to 12 or the vector of claim 13.
19. A method according to claim 18, wherein the host cell is as defined in any one of claims 14 to 17.
20. A transgenic host cell obtained or obtainable by the method of claim 18 or claim 19.
21. A gene-driven genetic construct comprising a polynucleotide according to any one of claims 1 to 9, an expression cassette according to any one of claims 10 to 12 or a recombinant vector according to claim 13.
22. The gene driven genetic construct of claim 21, wherein the polynucleotide sequence substantially limits the activity of the gene driven genetic construct on germ cell expression of the construct in an arthropod.
23. The gene driver gene construct according to claim 22, wherein the arthropod is an insect, optionally wherein the insect is a mosquito.
24. A gene driver gene construct according to claim 23, wherein the mosquito is of the anopheles subfamily, optionally wherein the mosquito is selected from the group consisting of: anopheles gambiae; anopheles cruzi; anopheles thumbsis; anopheles arabica; four rings of anopheles sp; anopheles stephensi; anopheles funestus; and Melaleuca melleus.
25. A method of producing a transgenic arthropod comprising introducing the gene driven genetic construct of any one of claims 21 to 24 into an arthropod gene.
26. A transgenic arthropod obtained or obtainable by the method of claim 25.
27. A transgenic arthropod comprising a gene driven genetic construct according to any one of claims 21 to 24.
28. A method of suppressing a wild type arthropod population comprising breeding a transgenic arthropod comprising a gene driver construct capable of disrupting a gene associated with female reproductive ability with the wild type population of arthropod, wherein the gene driver construct comprises an isolated polynucleotide according to any one of claims 1 to 9, an expression cassette according to any one of claims 10 to 12, or a recombinant vector according to claim 13.
29. The method according to claim 28, wherein the arthropod is an insect, optionally wherein the insect is a mosquito.
30. The method of claim 29, wherein the mosquito is of anopheles subfamily, optionally wherein the mosquito is selected from the group consisting of: anopheles gambiae; anopheles cruzi; anopheles thumbsis; anopheles arabica; four rings of anopheles sp; anopheles stephensi; anopheles funestus; and Melaleuca melleus.
31. Use of a gene-driven genetic construct comprising a polynucleotide sequence according to any one of claims 1 to 9, an expression cassette according to any one of claims 10 to 12 or a recombinant vector according to claim 13 for suppression of a wild-type arthropod population.
32. The use of claim 31, wherein the arthropod is an insect, optionally wherein the insect is a mosquito.
33. The use of claim 32, wherein the mosquito is of anopheles subfamily, optionally wherein the mosquito is selected from the group consisting of: anopheles gambiae; anopheles cruzi; anopheles thumbsis; anopheles arabica; four rings of anopheles sp; anopheles stephensi; anopheles funestus; and Melaleuca melleus.
Examples
The invention described herein relies on the insertion of a site-specific nuclease gene into a selected locus, the information of which both confers a trait of interest to an individual and results in a genetic bias for that trait. This approach relies on "homing" to cause inhibition. The present invention focuses on population suppression where gene drive constructs are designed to be inserted into a target gene in a manner that disrupts the gene product or a specific isoform thereof. To construct the nuclease-based gene driver of the present invention, a nuclease gene is inserted into its own recognition sequence in the genome so that a chromosome containing the nuclease gene cannot be cleaved, but a chromosome lacking the nuclease gene is cleaved. When an individual contains both a nuclease-carrying chromosome and an unmodified chromosome (i.e., a gene-driven hybrid), the unmodified chromosome will be cleaved by the nuclease. The disrupted chromosome is usually repaired using a chromosome containing the nuclease as a template, and the nuclease is replicated into the targeted chromosome by a process of homologous recombination. If this process (termed "homing") is allowed to occur in the germ cell, it will result in a genetic bias in the nuclease gene and its associated disruption, as the sperm or egg produced in the germ cell can inherit the gene from the original nuclease-carrying chromosome or a newly modified chromosome.
Selection for resistance alleles is expected due to the negative reproductive load imposed by gene drive. The most likely source of such resistance is sequence variation at the target site which prevents nuclease cleavage but at the same time allows the target gene to produce a functional product. Such variations may be pre-existing in the population, or may result from the activity of the nuclease itself-a small portion of the cleaved chromosome (rather than using homologous chromosomes as templates) may be repaired by End Joining (EJ), which may introduce small insertions or deletions ("indels") or base substitutions in repairing the target site. It is expected that in the presence of gene drive, in-frame insertion of deletions or conservative substitutions will indicate a choice. The inventors have previously observed target resistance in cage-culture experiments (data not shown) and found that end-joining in early embryo chromosomes is likely to be the major source of resistance alleles at the target due to the parent deposited nucleases.
In mitigating and preventing the emergence of resistant alleles, strategies that the inventors are working on involve reducing the embryonic origin of end-linked mutations by expressing nucleases from promoters that exhibit more stringent, germ cell-restricted expression and less maternal and paternal deposition, such as the nos (nos), null population (zpg) and exuperentia (exu).
Materials and methods
Pooled amplicon sequencing for cage experiments
Such as Hammond and Kyrou (2017)6Performing pooled amplicon sequencing. Up to 600 adult mosquitoes were homogenized from caged trials at generations 0, 2, 5 and 8 and extracted in the pooled groups using Wizard Genomic DNA purification kit (Promega). The 332bp locus spanning the target site was amplified from 90ng of each genomic sample in a 50 μ l reaction using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems). The primers were designed to include the Illumina Nextera transposase linker (underlined), 7280-Illumina-F (TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGGGAGAAGGTAAATGCGCCAC-SEQ ID No:63) and 7280-Illumina-R (R: (R)GTCTCGTGG GCTC GGAGATGTGTATAAGAGACAGGCGCTTCTACACTCGCTTCT-SEQ ID No:64) for downstream library preparation and sequencing. The primers were annealed at 68 ℃ for 20 seconds to minimize target amplification. To maintain an accurate representation of the allele frequency at the target site, 25 μ L of the PCR reaction was removed at 20 cycles while the reaction was left unsaturated and stored at-20 ℃. The remaining 25 μ L was subjected to an additional 20 cycles to verify the reaction on an agarose gel. The unsaturated samples were purified using AMPure XP beads (Beckman Coulter) and used in a second PCR reaction in which,according to the Illumina 16S Metagenomic Sequencing Library Preparation protocol (Illumina 16S Metagenomic Sequencing Library preference protocol #15044223), the double marker of Nextera XT Index Kit and the Illumina Sequencing linker were added. PCR was again purified using AMPure XP beads and validated with an Agilent Bioanalyzer 2100. Standardized library sequencing was performed in pooled reactions at a concentration of 10pM on an Illumina Nano flow cell v2 using Illumina MiSeq instrument, run at 2x250 bp paired ends.
Driving Cas9 expression in gene-driven constructs using zpg promoter
The dsxF-targeting gene-driven constructs were identical in design to those described by Hammond et al. In addition to the promoter and 3' UTR surrounding the Cas9 gene (previously from the vasa ortholog gene (AGAP008578)), in the current constructs these were replaced by the germ cell specific gene AGAP006241 by 1074bp upstream and 1034bp downstream, a hypothetical ortholog of zero population growth (zpg). The inventors' CRISPR of vasa and zpg driven genes hybridized at the exact same target locus in AGAP007280hThe fecundity and homing rate of individuals in the constructs were compared and were previously described in Hammond et al (fig. 9). Hatched larva counts of individual crosses showed improved fertility in heterozygous females containing the zpg-based CRISPRhAlleles in which larval yields were 50-53% of wild-type control, compared to only 8.4% for vasa. No reproductive effect was observed in males. To assess the level of homing, the drive heterozygotes were crossed to wild type, allowed to lay eggs individually, and their progeny scored for the presence of DsRed linked to the construct. The zpg construct transmission rate was over 91.9% for males and over 98.7% for females-99.6% for males and 97.7% for females for the previously observed transmission rate of the vasa construct.
Probability of drive random loss as a function of initial number of male drive heterozygotes
To calculate the probability of drive random loss in the experimental cage setting, for each initial number of male drive heterozygous individuals (h0), the inventors recorded the number of times drive did not occur in 40 generations (and thus did not eliminate the population) in 1000 simulations of the random cage model. Each data point represents 1000 individual simulations of the random cage model (fig. 11).
In vitro cleavage assay for wild-type and SNP variant target sites
The inventors performed an in vitro cleavage assay to test the ability of the grnas used in this study to cleave a target site that incorporates a SNP found in an african wild population (fig. 14). Using a gold Gate (Golden Gate) clone and modified primers to carry appropriate overhangs, the inventors introduced the two target sequences separately into a 2kb plasmid. As a control, the inventors also prepared plasmids that carry a modified version of the dsx target site, without the SNP that lacks the PAM sequence necessary for Cas9 cleavage. All three vectors were linearized and validated on a gel prior to cleavage experiments. For cleavage experiments, the inventors used the sgRNA available from Synthego (usa) and the enzyme form of streptococcus pyogenes (s. pyogenes) Cas9 Nuclease (NEB). To form ribonucleoprotein particles (RNPs), the inventors mixed sgRNA and Cas9 protein in the same molar ratio into 40 μ Ι of reaction to a final concentration of 400nM and incubated for 10 min at room temperature. The linearized substrate was added to the reaction at a final concentration of 40mM, in a final volume of 50. mu.l, and incubated at 37 ℃ for 30 minutes. Proteinase K was added to stop the reaction and 20. mu.l was verified on the gel.
Amplification of promoter and terminator sequences
Published anopheles gambiae genomic sequences provided in Vectorbase (Giraldo-Calderon et al, 2015) were used as references for designing primers to amplify the promoters and terminators of the three anopheles gambiae genes: AGAP006098(nanos), AGAP006241 (zero population growth) and AGAP007365 (exaprantia).
Using the primers provided in table 3, the inventors performed PCR on 40ng of Genomic material extracted from wild type mosquito of strain G3 using Wizard Genomic DNA purification kit (Promega). Primers were modified to contain appropriate Gipson (Gibson) assembly overhangs (underlined) for subsequent vector assembly. The promoter and terminator fragments for nos were 2092bp and 601bp, respectively, the promoter and terminator fragments for zpg were 1074bp and 1034bp, respectively, and the promoter and terminator fragments for exu were 849 and 1173bp, respectively. The sequences of all regulatory fragments are shown in Table 4.
CRISPRhGeneration of driver constructs
The inventors modified the previous Hammond et al (2016)2The available template plasmids were used to replace and test alternative promoters and terminators for expression of Cas9 protein in mosquito germ cells. The p16501 used in this study carried a human optimized Cas9(hCas9) under the control of vas22 promoter and terminator, an RFP cassette under the control of the neuronal 3xP3 promoter, and a U6: sgRNA cassette targeting the AGAP007280 gene in anopheles gambiae.
The hCas9 fragment and backbone (containing the sequences of 3xP3:: RFP and U6:: gRNA cassette) were excised from plasmid p16501 using restriction enzymes XhoI + PacI and AscI + AgeI, respectively. The gel-electrophoresis fragments were then recombined with PCR-amplified promoter and terminator sequences of zpg, nos or exu by Gibson assembly to create new CRISPRs named p17301(nos), p17401(zpg) and p17501(exu)hAnd (3) a carrier.
Transformation of driver constructs into the genome at AGAP007280
CRISPR comprising Cas9 under control of zpg, nos and exu promotershThe construct was inserted at the hdrGFP docking site previously generated at the target site of AGAP007280 (Hammond et al, 2016).
Anopheles gambiae of hdrGFP-7280 strain was bred under standard conditions of 80% relative humidity and 28 ℃ and freshly produced embryos were used for microinjection as described previously (Fuchs et al, 2013). Microinjection was performed on freshly born embryos as described previously (Fuchs et al, 2013). The recombinase mediated cassette exchange (RCME) reaction is carried out by adding each new CRISPRhThe construct was injected into hdrGFP docking line embryos previously generated at the target site of AGAP007280 (Hammond et al, 2016). For each construct, embryos were injected with CRISPR containingh(400 ng/. mu.l) and vas2: (Volohonsky et al, 2015) solutions of integrase helper plasmid (400 ng/. mu.l). StoreLive G0 larvae were crossed with the wild-type transformants by linkage from GFP (present at the hdrGFP docking site) to CRISPRhDsRed changes of the construct identified wild-type transformants, indicating RCME success.
Molecular confirmation of gene targeting and cassette integration
Successful CRISPR verification by PCR using Genomic DNA extracted using Wizard Genomic DNA purification kit (Promega)hConstruct RMCE integrated into the genome at AGAP 007280. Primers binding to the integration cassette (hCas9-F7 and RFP2qF) were used together with primers binding to the adjacent genomic integration site in AGAP007280 (Seq-7280-F and Seq-7280-R) to verify CRISPRhThe presence and orientation of the cassette. Primer sequences can be found in (supplementary Table S2).
Cage culture experiment
The cage test was performed according to the same principles as described previously by Hammond et al (2016). Briefly, a driven hybrid zpg-CRISPR has been inherited from the female parenthAge matched wild type was mixed at L1 with heterozygote frequency of 10% or 50%. In the pupa stage, 600 selection started only replication cages for each initial release frequency. Adult mosquitoes were mated for 5 days and then fed blood to anesthetized mice. Two days later, the mosquitoes were placed in a 300ml egg laying bowl (egg bowl) filled with water and lined with filter paper. For each generation, all eggs were incubated for two days, and randomly selected 600 larvae were screened to determine transgene rates by the presence of DsRed and then used to lay the next generation. Starting from passage 4, adult mosquitoes were fed a second time and whole eggs were photographed and counted using jmicrosvision V1.27. The larvae were housed in 2L trays and reared in 500ml water, each tray having a density of 200 larvae. After the progeny are recovered, the entire adult population is collected and all samples from generations 0, 2, 5 and 8 are used for pooled amplicon sequence analysis.
Phenotypic assay to measure fertility and homing rate
Will be from three new lines zpg-CRISPRh、nos-CRISPRh、zpg-CRISPRhHybrid CRISPR ofh/+ mosquitoes crossed with equal numbers of wild-type mosquitoes in both males and femalesAnd (5) carrying out middle mating. On the sixth day, the females were fed with blood from anesthetized mice, and after three days, at least 40 were allowed to lay eggs alone in 25-ml cups filled with water and lined with filter paper. All larval offspring of each individual were counted and at least 50 larvae were screened to determine identity to CRISPR using nikon inverted fluorescence microscope (Eclipse TE200)hFrequency of allele-linked DsRed. Females that did not produce offspring and whose fertilized sac showed no signs of sperm were excluded from the analysis. Statistical differences between genotypes were assessed using the Kruskal-Wallis test (Kruskal-Wallis).
Population genetic model
To model the results of the cage experiments, the inventors treated males and females separately using a discrete generation recursive equation for genotype frequencies. F _ ij (t) and M _ ij (t) represent the frequency of females (or males) with genotype i/j in the total female (or male) population. The inventors considered three alleles, W (wild type), D (driver) and R (non-functional resistance), and thus six genotypes.
Homing device
The proportion of gamete produced by adult mosquitoes of W/D genotype at meiosis is W: d: r, as follows:
(1-df)(1-uf)：df：(1-df)ufin female
(1-dm)(1-um)：dm：(1-dm)umIn the male
Here, d _ f and d _ m are the transmission rates of the driver alleles in both sexes, and u _ f and u _ m are the fraction of non-driver gametes of non-functional resistance (R allele) in meiotic end junctions. In all other genotypes, inheritance is mendelian inheritance.
And (4) fitness. Let w _ ij ≦ 1 denote the fitness of genotype i/j relative to the wild-type homozygote w _ WW ═ 1. The inventors hypothesized that there was no fitness effect on males. The fitness effect of females appears as a difference in the relative ability of genotypes to participate in mating and reproduction. The inventors hypothesized that the target genes are required for female fertility, and thus D/D, D/R and R/R females are sterile; female fitness of only one copy of the target gene (W/D, W/R) is not reduced.
Parental Effect
The inventors believe that further cleavage and repair of the W allele can occur in the embryo if a nuclease is present, due to one or both contributing gametes derived from the parent with one or both driving alleles. The presence of the parent nuclease is thought to affect somatic cells and therefore female fitness, but not germ cells that alter gene transmission. Previously, the embryonic EJ effect (maternal only) was modeled as an immediate effect in the zygote [1, 2)]. Here, the inventors believe that experimental measurements on female individuals of different genotypes and origins show a certain fitness indicating that the individual may be a chimera with an intermediate phenotype. Thus, the inventors modeled genotype W/X (X ═ W, D, R) with the parent nuclease as having moderate fitness to decreaseOrDepending on whether the nuclease is derived from the transgenic female parent, male parent or both. The inventors hypothesize that the parental effect is the same whether the parent has one or two driver alleles. For simplicity, the baseline reduced fitness W10、W01、W11The fitness of all genotypes W/X (X ═ W, D, R) corresponding to maternal, paternal and maternal/paternal effects, respectively, was estimated as the product of average egg production value and hatchability for wild type in deterministic model table 1. In a random version of the model, oviposition of female individuals of different descent was instead sampled from experimental values.
TABLE 1 parameters of random cage culture model
Recursive equation
The inventors first considered the gametic contribution of each genotype, including the influence of the parent on fitness. In addition to the W and R gametes originating from the parent without driver alleles and therefore without deposited nucleases, gametes from W/D females and W/D, D/R and D/D males also carry nucleases that are transmitted to the zygotes, these are denoted as W ^ D ^ R, R ^. The ratio of type i alleles in eggs produced by females involved in reproduction is given in terms of male and female genotype frequencies as follows. Superscript 10, 01 or 11 indicates the frequency of chimeric individuals that produce a parental effect (i.e., reduced fitness) due to nucleases of the female parent, male parent or both.
Ratio of type i alleles in sperm siThe method comprises the following steps:
in the above-mentioned manner,andis the mean female and male fitness:
to model the cage experiment, the inventors started with equal numbers of males and females, with the initial frequency F _ WW of wild-type females being 1 in the female population and the initial frequency M of wild-type males in the male populationWW1/2 heterozygote driven males inheriting the drive from the male parentAssume a ratio of female to female in offspring of 50: 50, then after the initial generation, the genotype frequency of i/j type in the next generation (t +1) is the same in males and females, Fij(t+1)＝Mij(t + 1). Assuming random mating, according to the gamete proportion of the previous generation, in the following set of equations, both Gij(t +1) gives:
GWW(t+1)＝eWsW
GWR(t+1)＝eWsR+eRsW
the frequency of transgenic individuals can be compared to the experiment (fraction of RFP + individuals):
wallferm was used for all calculations23(Wolfram Mathematic).
PCR
The PCR reaction was performed using Phusion High Fidelity Master Mix. Initial denaturation was carried out at 98 ℃ for 30 seconds. Primer annealing was performed at a temperature range of 60-72 ℃ for 30 seconds, and extension was performed at a temperature of 72 ℃ for 30 seconds/kb.
TABLE 2 primers used in this study
TABLE 3 primers for amplification of promoters
TABLE 4 primers used for assembling vectors and validating insert sequences
Results
To investigate whether dsx represents a suitable target for gene-driven approaches aimed at inhibiting population fertility, the inventors disrupted the intron 4-exon 5 boundary of dsx in order to prevent the formation of functional AgdsxF while leaving the AgdsxM transcript unaffected. The inventors injected anopheles gambiae embryos with Cas9 and a gRNA source and Homology Directed Repair (HDR) template designed to selectively cleave the intron 4-exon 5 boundary (fig. 1c) to insert eGFP transcription units. Transformed individuals are crossed to produce homozygous and heterozygous mutants in progeny. HDR-mediated integration was confirmed by diagnostic PCR using primers spanning the insertion site, resulting in larger amplicons of the expected size for the HDR event and smaller amplicons for the wild-type allele, so the genotype could be easily confirmed (fig. 1 d).
Knock-in of the eGFP construct resulted in complete disruption of the exon 5(dsxF-) coding sequence and has been confirmed by PCR and genomic sequencing of chromosomal integrations (fig. 6). The expected mendelian ratio of the generated crosses for heterozygous, wild-type, heterozygous and homozygous individuals for the dsxF-allele was 1: 2: 1, indicating that there was no significant lethality associated with the mutation during development (table 4).
TABLE 4 ratio of larvae harvested by heterozygous dsx Φ C31 knock-in mosquito crosses
GFP Strong (dsxF-/-)
GFP Weak (dsxF-/+)
No GFP (+/+)
Total of
262(24.9％)
523(49.7％)
268(25.5％)
1053
Exon 5 disrupted heterozygote larvae develop into adult male and female mosquitoes with a sex ratio approaching 1: 1. in contrast, half of the dsxF-/-individuals develop normal males, while the other half exhibit morphological characteristics of both males and females and various dysplasias in internal and external reproductive organs (hermaphrodisiac).
To determine the sex genotype of these dsxF-/-interhermaphroditic mutants, the inventors introgressed the mutants into lines containing a Y-linked visual marker (RFP) and used the presence of this marker to unambiguously assign the sex genotype to heterozygotes and homozygotes for null mutations. This method indicates that the androgenic phenotype is only observed in females of the genotype homozygous for the null mutation. The inventors found that heterozygous mutants did not work, indicating that the female specificity of dsx was haploid dose sufficiency.
Examination of the external dyadic structure of dsxF-/-genotypic females revealed several phenotypic abnormalities, including: development of a male clasper (and female caudal hair loss) rotating to the back, associated with male pinnate tentaclesThe longer whip nub (fig. 2). Analysis of the internal reproductive organs of these individuals failed to show complete development of the ovaries and seminal vesicles. Instead, they are replaced by Male Accessory Glands (MAGs), in some casesReplaced by an underdeveloped, essentially pear-shaped organ resembling an unstructured testis (fig. 7).
Males with dsxF-null mutations in either heterozygosity or homozygosity exhibit levels of wild-type fertility as measured by litter size and larval hatching of each mating female, as do heterozygous dsxF-female mosquitoes. In contrast, the interspecies XX dsxF-/-female mosquito, although attracted by anesthetized mice, was unable to eat a blood meal and produce eggs (FIG. 3).
The unexpectedly strong phenotype of dsxF-/-in females demonstrates the critical functional role of dsx exon 5 in the poorly understood sex differentiation pathway of anopheles gambiae and indicates that its sequence may serve as a suitable target for gene-driven approaches aimed at suppressing population numbers.
The inventors used recombinase-mediated cassette exchange (RMCE) to replace 3xP3 with a dsxfvirisprh gene-driven construct comprising an RFP marker gene, a transcriptional unit expressing a gRNA targeting dsxF, and a Cas9 gene under the control of a zero population growth (zpg) germ cell promoter and its terminator sequence (fig. 8). The zpg promoter showed better germ cell expression and specific limitations than the vasa promoter used in previous gene driven constructs (Hammond and Crisanti not published). Successful RMCE events for integration of dsxFCRISPRh into its target locus have been confirmed in those individuals who switched GFP to RFP labeling. During meiosis, the Cas9/gRNA complex cleaves the wild-type allele at the target sequence, and the dsxFCRISPRh cassette replicates to the wt locus through HDR ("homing"), which disrupts exon 5 in this process.
The ability of dsxfprisprh constructs to home and bypass mendelian inheritance was analyzed by scoring RFP inheritance rates of heterozygous parents (hereinafter dsxfprisprh/+) offspring crossed with wild type mosquitoes. Unexpectedly, high dsxFCRISPRh transmission rates of up to 100% were observed for progeny of both heterozygous dsxFCRISPRh/+ male and female mosquitoes (fig. 4 a). The fertility of dsxFCRISPRh lines was also evaluated to reveal potential negative effects due to ectopic expression of nucleases in somatic cells and/or parental deposition of nucleases in newly fertilized embryos (fig. 4 b). These experiments show that while the fertility (evaluated as larval offspring per fertilized female) of heterozygous dsxFCRISPRh/+ males is indistinguishable from wild-type males, the fertility of heterozygous dsxFCRISPRh/+ females is overall reduced (mean fertility 49.8% +/-6.3% standard error, p < 0.001).
Surprisingly, the inventors noted that the fertility of heterozygous females was more severely reduced when the driver allele was inherited from the paternal (average fecundity 21.7% +/-8.6%) rather than from the maternal parent (64.9% +/-6.9%) (fig. 10). Without wishing to be bound by any particular theory, the inventors believe that this may be explained by the hypothesis that the active Cas9 nuclease is deposited in the paternal into a newly fertilized zygote that is randomly induced to convert from dsx to dsxF-in a large number of cells by end ligation or HDR, resulting in reduced female fertility. Consistent with this hypothesis, some heterozygous females received paternal dsxFCRISPRh alleles exhibiting a somatic mosaic phenotype, including different penetrance rates, absence of fertilized sac and/or formation of incomplete clasper pairs. Mathematical models established in view of genetic preference of constructs, fertility of heterozygote individuals, hermaphroditic phenotype, and paternal deposition of nucleases on female fertility indicate that dsxfvirisprh has the potential to reach 100% frequency in caged populations depending on the frequency of initiation and randomness between generations 9 and 13 (fig. 5 a).
To test this hypothesis, a population of caged wild-type mosquitoes was mixed with individuals carrying the dsxFCRISPRh allele and subsequently monitored at each generation to assess the spread of driving force and quantify its effect on reproductive yield. To simulate the hypothetical release profile, the inventors began the experiment in two identical cages, 300 wild-type female mosquitoes versus 150 wt-male mosquitoes and 150 dsxFCRISPRh/+ males were placed together and mated. Eggs from the entire cage were counted and 650 eggs were randomly selected to breed the next generation. Larvae that have hatched from eggs and present the RFP marker are screened to count the progeny that contain the dsxFCRISPRh allele in each generation. In the first three generations, the inventors observed an increase in the driver allele from 25% to two caged populations After which they diverge. In cage 2, the drive reached 100% frequency in generation 7. In the next generation, no eggs were produced and the population collapsed. In cage 1, the driver allele reached a frequency of 100% at passage 11 after drifting about 65% in both passages. This cage population also failed to lay eggs in the next generation. Although both cages showed some significant differences in propagation kinetics, both curves fell within the prediction range of the model (fig. 5 b). Table 6 shows a summary of the cage experiments.
The inventors also monitored the occurrence of mutations at the target site in different generations to identify the occurrence of nuclease resistance functional variants. Amplicon sequencing of the target sequence from pooled population samples collected at generations 2, 3, 4 and 5 revealed the presence of several low frequency indels at the cleavage site, none of which appeared to encode a functional AgdsxF transcript (fig. 10A to C). Thus, as the frequency of driving increases with generation, none of the identified variants show any sign of forward selection, indicating that the selected target sequence has strict functional and structural constraints. High conservation of exon 5 in anopheles gambiae16,17And highly regulated splice sites critical to mosquito reproductive biology provide support for this view.
Heterozygous and homozygous individuals for the dsxF-allele are separated based on the fluorescence intensity provided by the GFP transcription unit in the knockout allele. At the expected mendelian ratio of 1: 2: 1 recovery, homozygous mutants could be distinguished, indicating that disruption of the female-specific isomer of Agdsx is not fatal at the L1 larval stage.
TABLE 5 insertion homozygous genetic females carrying Male-specific characteristics
The inventors hypothesized that the parental effects on fitness (egg production and hatchability) of non-drive (W/W, W/R) females with nucleases from one or both parents were the same as observed for drive heterozygote (W/D) females with parental effects. For combined maternal and paternal effects (nucleases from both parents), the minimum of the observed values for maternal and paternal effects was assumed.
TABLE 6 summary of values obtained from cage culture experiments
In the cage culture experiments, the transgene rate, hatchability, egg laying amount and reproductive load of each generation. The reproductive load showed that the egg laying amount was suppressed for each generation compared to the first generation.
Phenotypic analysis was performed to measure the fertility and the spread rate of each of the three drives simultaneously (fig. 15 c). To assess the level of homing, the drive heterozygotes were crossed with the wild type, allowed to lay eggs individually, and their progeny with DsRed linked to the construct were scored (fig. 15 c).
Maternally or paternally deposited Cas9 can cause resistance mutations in embryos that may reduce the next generationThe homing rate of (Hammond and Kyrou et al, 2017). To test this effect, the inventors isolated male and female drive heterozygotes by whether they inherited the drive from the female parent or male parent, and scored the inheritance of the drive in their offspring (fig. 15 c). All three promoters induced homing in males regardless of driver inheritance, whereas zpg-CRISPRhAnd nos-CRISPRhAlso in females, a biased spread was shown. zpg-CRISPRhThe transmission rate in males is over 90.6%, in females is over 97.8%, only slightly lower than the previously observed vas2-CRISPRh99.6% in males and 97.7% in females (Hammond et al, 2016). The nos promoter also showed high transmission, more than 83.6% in males and more than 85.1% in females. These ratios were significantly higher (99.1% in males and 99.6% in females) when the driver was inherited from the male parent, indicating that nos:: Cas9 was maternally deposited. exu promoter allows biased transmission rates in males (64%) and no bias in females (51%). These homing rates remained similar over more than 20 generations, indicating that the drive was very stable.
Fertility assays were performed to measure larval yield in each cross driving heterozygote and wild type (fig. 15 c). All new drives showed significant improvement in relative fertility compared to the wild type control. Wherein vas-CRISPRhThe relative female fertility of the female is about 8.4%, zpg-CRISPRh(50-58.3％)、nos-CRISPRh(40.2-55.9%) and exu-CRISPRh(75.5-77.4%) are greatly improved in relative fertility. Furthermore, nos-CRISPRhAnd exu-CRISPRhThe reduction in male larvae production may represent random variation due to different feeding and oviposition conditions rather than nuclease activity itself. The large difference between wild-type controls supports this hypothesis. Thus, the above values are only used as a rough estimate of fertility, which may prove to be a significant improvement over vas 2.
In order to test zpg-CRISPRhPotential for spread throughout the plasmodium population, two duplicate cages were initiated with 10% or 50% of the driver heterozygotesAnd 16 generations were monitored. Notably, this drive spread to over 97% of the population in all four replicate samples (fig. 16), and complete modification of the population was achieved in one of the two 50% release cages only after four passages. In all four releases, the drive remains more than 95% frequent for at least 3 passages, and then the anti-drive allele is gradually selected to reverse its spread. Notably, the inventors observed similar propagation kinetics, whether at 50% or 10% release, indicating that the initial release frequency had little effect on the probability of diffusion. Vas 2-driven CRISPR targeting exactly the same locus at AGAP007280hThese results are more surprising than others. Here, the drive is slower to propagate and resistance develops before 80% of the frequency is reached in the population. (Hammond et al, 2016).
Resistance mutations occur when the target site sequence is altered, which prevents further recognition or cleavage by nucleases, but also encodes a gene product that can rescue the sterile knockout phenotype. Although these may have been present in populations early, they are self-generated by gene-driven production of non-homologous end joining (NHEJ) or microhomology-mediated end joining (MMEJ) which is prone to error in a very small portion of the cleaved chromosomes which are not repaired by homing in germ cells, or in embryos cleaved by maternally or paternally deposited nucleases (Hammond et al, 2017).
To investigate the nature and frequency of resistance in zpg-CRISPRh release cages, the inventors performed amplicon sequencing through the target locus in pooled individual samples collected before, during and after the emergence of resistance at generations 0, 2, 5 and 8 (figure 17). In sharp contrast to the vas 2-based drive, the use of the zpg promoter can reduce the generation and selection of resistant mutations. Throughout the caging experiments, the inventors identified only 2 mutant alleles present at a frequency of more than 1% among the non-driving alleles, and both were present in each zpg-CRISPRh cage. Both mutations were either 3bp (203-GAG-SEQ ID No: 65) or 6bp (203-GAGGAGGAG-SEQ ID No: 66) in-frame deletions at the target site and previously demonstrated resistance to vas 2-based gene drives (Hammond and Kyrou et al, 2017). By passage 8, the frequency of one of the two mutations in the non-driven allele had reached more than 90%, but each cage selected a different allele-indicating that the selection of one or the other resistance mutation was random, rather than because of a more efficient regaining of fertility. In contrast, vas2-CRISPRh produced 6 to 12 mutant alleles with a frequency of more than 1% in each repeat of the early and later generations, and despite strong stratification for those conferred resistance, high changes in this variant allele remained over time (Hammond and Kyrou et al, 2017).
Conclusion
The zpg, nos and exu regulatory sequences described herein have significant advantages over the best system for germ cell nuclease expression currently used in gene drive for malaria mosquitoes (i.e., the vasa2 promoter), showing:
1) unexpectedly high rates of biased transmission of male and female mosquitoes to offspring;
2) greatly reduced adaptability cost;
3) reduced end joining mutations, which are the main cause of gene-driven resistance; and
4) in cage experiments, the spread was greatly improved in terms of speed, persistence and maximum driving frequency.
Gene drives based on these promoter sequences are far superior to all gene drives previously tested and can be used for population replacement and population suppression strategies. The improvement in gene-driven efficacy can be attributed to the spatiotemporal regulation of Cas9 nuclease expression, which is brought about by the use of these novel regulatory sequences, especially the improvement in germ cell restriction.
To illustrate the degree of improvement, the inventors observed a relative fitness of females in excess of 80%, while the vasa2 promoter was used for only 7%, as shown in fig. 15D. The ultimate goal of gene-driven technology is to modify the entire population starting from a low initial release frequency. Using the same approach as previously published studies, the inventors have observed that the use of the zpg promoter has historically diffused for the first time to > 99% of individuals in a caged population, compared to 80% of the maximum frequency of gene drive previously best tested based on the vasa2 promoter. The inventors have demonstrated this spread when released from an initial frequency of 50% (in agreement with previous studies) and also from an initial frequency of 10% (more relevant to media control). The increase in activity can be attributed entirely to the use of improved germ cell promoters, since the gene drive is otherwise identical, and the observed improvement in transmission is predicted by mathematical models based on the observed characteristics of the transgenic lines (which are based on these promoters).
The inventors have demonstrated that gene drives constructed using these promoters can invade the entire mosquito population without further improvement and meet the requirements of gene drive systems for population replacement. The regulatory sequences described herein are useful in a range of technologies currently under development, including improvements in mosquito transformation, driving endonuclease genes, and other gene-driven technologies that rely on expression in mosquito germ cells.
Reference to the literature
Highly efficient Cas9-mediated gene drive for population change of the malaria-vector mosquito Anopheles stephensi (high effective Cas9-mediated gene drive for distribution modification of the malarial vector magnetic to Anopheles stephensi) proceedings of the national academy of sciences USA (Proc Natl Acad Sci U S A)112, E6736-6743 (2015).
Hammond, A. et al, CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae (A CRISPR-Cas9 gene drive system targeting the male reproduction in the large mos methyl vector Anopheles. national Biotechnology (Nat Biotechnol)34,78-83 (2016).
Burt, A. Site-specific selfish genes as tools for control of natural populations and genetic engineering (Site-specific bacterial genes as tools for the control and genetic engineering) Bioscientific progress (Proc Biol Sci)270,921-928 (2003).
Requirement for effective malaria control with homing endonuclease genes (Requirements for effective mammalian control with housing end release genes.) national academy of sciences (Proc Natl Acad Sci U S A)108, E874-880(2011).
Hamilton, w.d. very high sex ratio. The theory of sex ratios for six linkages and inbreeding has new implications for cytogenetics and entomology (expression section. A section-ratio for section new associations in cytogenetics and entomology). Science 156,477-488 (1967).
The synthetic sex ratio distortion system for controlling the control of human malarial mosquitoes natural communication (Nat Commun)5,3977 (2014).
Emasculation of the Anopheles gambiae X chromosome on chromosome 10 BMC evolution biology (BMC Evol Biol)12,69 (2012).
Novel CRISPR/Cas9 gene driver constructs reveal the mechanism of resistance alleles and driving efficiency in genetically diverse populations (Novel CRISPR/Cas9 gene drive constructs in genetic engineering of resistance allele formation and drive efficiency in genetic reverse genes.) american scientific public library genetics (PLoS gene) 13, e1006796 (2017).
Hammond, A.M. et al, underwent generation and selection of gene-driven resistance mutations in malaria mosquitoes over multiple generations (The creation and selection of multiple resistance to gene drive multiple genes in The malarial mosquito). U.S. science public library genetics (PLoS Genet)13, e1007039 (2017).
Marshall, J.M., Buchman, A., Sanchez, C.H., and Akbarri, O.S. overcome the targeted-based gene-driven evolutionary resistance to suppressor populations scientific report (Sci Rep)7,3776 (2017).
Unckless, R.L., Clark, A.G., and Messer, P.W. anti-CRISPR/Cas 9 Gene driven Evolution (Evolution of Resistance Agait CRISPR/Cas9 Gene Drive) Genetics (Genetics)205,827-841 (2017).
The Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoding related sex-specific polypeptides (Drosophila doublesex gene controlled sexual differentiation by producing alternative specific mRNA) cells (Cell)56,997-1010 (1989).
Graham, p, Penn, j.k. and schedule, p. master changes, slave leaves (Masters change), biological paper (Bioessays)25,1-4 (2003).
Male genes in the Anopheles gambiae, malarial mosquito (a major gene in the malacia mosquito Anopheles) Science 353,67-69 (2016).
Identification of sex-specific transcripts of the gene for the mosquito, Anopheles gamblese, A. recombination of the gene for the mosquito, Atogania gamblese, J.Exp Biol. 208, 3701-.
Mosquito genomics, Neafsey, d.e. Highly evolved malaria vectors: the genomes of 16Anopheles species (Mosquito genetics. high elevation mammalian vectors. Science 347,1258522 (2015)).
17. Anopheles gambiae genome, C.et al, African malaria vector the Genetic diversity of the African major vectors Anopheles gambiae, Nature 552,96-100 (2017).
Murray, s.m., Yang, s.y, and Van Doren, m. Collaboration between somatic and Germ cells (Germ Cell sexing: a chromatography between soma and germline), the latest view of Cell biology (Curr Opin Cell Biol)22,722-729 (2010).
Curtis, C.F. A desired gene in a pest population may be fixed using translocation (Possible use of translocations to fix detectable genes in insect pests posts.) Nature (Nature)218, 368-.
20. National academy of sciences, engineering and medicine, gene drive on the horizon: advancing Science, coping with Uncertainty and keeping the study consistent with Public value (Gene Drives on the Horizon: Advancing Science, visualizing Ucertainty, and identifying Research with Public Values) (national academy of sciences Press, Columbia Texton; 2016).
Papathanos, p.a., Windbichler, n., menicheli, m., Burt, a. and crisantipi, a.vasa regulatory regions mediate germ cell expression and maternal transmission of proteins in the malaria mosquito anopheles gambiae: general tools for genetic control strategies (The vasa regulatory regions protocols expression and signal transmission of proteins in The mammalian organisms gambiae: a versatic tool for genetic control strategies). BMC molecular biology (BMC Mol Biol)10,65, (2009).
22Hammond, a.m. et al, underwent generation and selection of gene-driven resistance mutations in malaria mosquitoes over multiple generations (The creation and selection of multiple resistance to gene drive multiple genes in The malarial mosquito), american scientific public library genetics (PLoS gene) 13, e 7010039 (2017).
23. Wolflem (Wolfram) research, 2017Mathematica 11.2, champagne, illinois.
Sequence listing
<110> Imperial science and technology and medical college
<120> Polynucleotide
<130> 87576PCT1
<150> GB 1810256.6
<151> 2018-06-22
<160> 90
<170> PatentIn version 3.5
<210> 1
<211> 1074
<212> DNA
<213> Anopheles gambiae
<400> 1
cagcgctggc ggtggggaca gctccggctg tggctgttct tgcgagtcct cttcctgcgg 60
cacatccctc tcgtcgacca gttcagtttg ctgagcgtaa gcctgctgct gttcgtcctg 120
catcatcggg accatttgta tgggccatcc gccaccacca ccatcaccac cgccgtccat 180
ttctaggggc atacccatca gcatctccgc gggcgccatt ggcggtggtg ccaaggtgcc 240
attcgtttgt tgctgaaagc aaaagaaagc aaattagtgt tgtttctgct gcacacgata 300
attttcgttt cttgccgcta gacacaaaca acactgcatc tggagggaga aatttgacgc 360
ctagctgtat aacttacctc aaagttattg tccatcgtgg tataatggac ctaccgagcc 420
cggttacact acacaaagca agattatgcg acaaaatcac agcgaaaact agtaattttc 480
atctatcgaa agcggccgag cagagagttg tttggtattg caacttgaca ttctgctgcg 540
ggataaaccg cgacgggcta ccatggcgca cctgtcagat ggctgtcaaa tttggcccgg 600
tttgcgatat ggagtgggtg aaattatatc ccactcgctg atcgtgaaaa tagacacctg 660
aaaacaataa ttgttgtgtt aattttacat tttgaagaac agcacaagtt ttgctgacaa 720
tatttaatta cgtttcgtta tcaacggcac ggaaagatta tctcgctgat tatccctctc 780
gctctctctg tctatcatgt cctggtcgtt ctcgcgtcac cccggataat cgagagacgc 840
catttttaat ttgaactact acaccgacaa gcatgccgtg agctctttca agttcttctg 900
tccgaccaaa gaaacagaga ataccgcccg gacagtgccc ggagtgatcg atccatagaa 960
aatcgcccat catgtgccac tgaggcgaac cggcgtagct tgttccgaat ttccaagtgc 1020
ttccccgtaa catccgcata taacaaacag cccaacaaca aatacagcat cgag 1074
<210> 2
<211> 2092
<212> DNA
<213> Anopheles gambiae
<400> 2
gtgaacttcc atggaattac gtgctttttc ggaatggagt tgggctggtg aaaaacacct 60
atcagcaccg cacttttccc ccggcatttc aggttatacg cagagacaga gactaaatat 120
tcacccattc atcacgcact aacttcgcaa tagattgata ttccaaaact ttcttcacct 180
ttgccgagtt ggattctgga ttctgagact gtaaaaagtc gtacgagcta tcatagggtg 240
taaaacggaa aacaaacaaa cgtttaatgg actgctccaa ctgtaatcgc ttcacgcaaa 300
caaacacaca cgcgctggga gcgttcctgg cgtcaccttt gcacgatgaa aactgtagca 360
aaactcgcac gaccgaaggc tctccgtccc tgctggtgtg tgtttttttc ttttctgcag 420
caaaattaga aaacatcatc atttgacgaa aacgtcaact gcgcgagcag agtgaccaga 480
aataccgatg tatctgtata gtagaacgtc ggttatccgg gggcggatta accgtgcgca 540
caaccagttt tttgtgcagc tttgtagtgt ctagtggtat tttcgaaatt catttttgtt 600
cattaacagt tgttaaacct atagttattg attaaaataa tattctacta acgattaacc 660
gatggattca aagtgaataa attatgaaac tagtgatttt tttaaatttt tatatgaatt 720
tgacatttct tggaccatta tcatcttggt ctcgagctgc ccgaataatc gacgttctac 780
tgtattccta ccgatttttt atatgcctac cgacacacag gtgggccccc taaaactacc 840
gatttttaat ttatcctacc gaaaatcaca gattgtttca taatacagac caaaaagtca 900
tgtaaccatt tcccaaatca cttaatgtat taaactccat atggaaatcg ctagcaacca 960
gaaccagaag ttcaacagag acaaccaatt tccgtgtatg tacttcatga gatgagattg 1020
gacgcgctgg taaaatttta tatgggattt gacagataat gtaaggcgtg cgattttttt 1080
catacgatgg aatcaattca agagtcaatt gtgcaggatt tatagaaaca atctcttatt 1140
tatgttttgt tatcgttaca gttacagccc tgtcctaagc ggccgcgtga aggcccaaaa 1200
aaaagggagt ccccaacgct cagtagcaaa tgtgcttctc tatcattcgt tgggttagaa 1260
aagcctcatg tgacttctat gaacaaaatc taaactatct cctttaaata gagaatggat 1320
gtattttttc gtgccactga actttcgttg ggaagattag atacctctcc ctcccccccc 1380
ctccctttca acacttcaaa acctaccgaa aactaccgat acaatttgat gtacctaccg 1440
aagaccgcca aaataatctg gccacactgg ctagatctga tgttttgaaa catcgccaaa 1500
ttttactaaa taatgcactt gcgcgttggt gaagctgcac ttaaacagat tagttgaatt 1560
acgctttctg aaatgttttt attaaacact tgtttttttt aatacttcaa tttaaagcta 1620
cttcttggaa tgataattct acccaaaacc aaaaccactt tacaaagagt gtgtggttgg 1680
tgatcgcgcc ggctactgcg acctgtggtc atcgctcatc tcacgcacac atacgcacac 1740
atctgtcatt tgaaaagctg cacacaatcg tgtgttgtgc aaaaaaccgt tcgcgcacaa 1800
acagttcgca catgtttgca agccgtgcag caaagggctt ttgatggtga tccgcagtgt 1860
ttggtcagct ttttaatgtg ttttcgctta atcgcttttg tttgtgtaat gttttgtcgg 1920
aataattttt atgcgtcgtt acaaatgaaa tgtacaatcc tgcgatgcta gtgtaaaaca 1980
ttgctaattc ccggtaagaa cgttcattac gctcggatat catcttacga agcgtgtgta 2040
tgtgcgctag tacattgacc tttaaagtga tccttttgtt ctagaaagca ag 2092
<210> 3
<211> 849
<212> DNA
<213> Anopheles gambiae
<400> 3
ggaaggtgat tgcgattcca tgttgatgcc aatatatgat gattttgttg catattaata 60
gttgttgtta tgttttattc aaatttcaaa gataatttac tttacattac agttagtgag 120
catattatct actacataaa cacatagatc aaactggttt acataaattc aaaaagtttg 180
gattaaaatc gcagcaattg gttatgaaaa aatatgtgca taacgtaaat atcaagtaaa 240
tttttgcatt gcatatttat agactcctgt tacaatttcg gaaaaatgaa aaatgttaat 300
taatcaaaga agaaaaaaca aagaaattaa atcattaggt agcacaacca caagtacata 360
tttttatggc atgaatattc ctctacacta acatatttta tagcaattct attgatcgcc 420
ttagtatagc ggaattacca gaacggcact atagttgtct ctgtttggca cacgcaatca 480
tttttcatcc cagggttgcc atagcagttt ggcgacggtc acgtagcatg cgaaggattt 540
cgttcgcaca ggatcacttt tattctaacg tttgaagaag gcacatctca gtgcaagcgc 600
tctggaagct gcttttaccg aacgaactaa cttttcaagt aacctcaaaa acttgtctct 660
aacgacacca cgtgctatcc gcgagtttca tttcccgtgc aaagttcccc gatttagcta 720
tcattcgtga acatttcgta gtgcctctac cctcaggtaa gaccattcga ggtttaccaa 780
gttttgtgca aagaacgtgc acagtaattt tcgttctggt gaaaccttct cttgtgtagc 840
ttgtacaaa 849
<210> 4
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> dsxgRNA-F primers
<400> 4
tgctgtttaa cacaggtcaa gcgg 24
<210> 5
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> dsxgRNA-R primer
<400> 5
aaacccgctt gacctgtgtt aaac 24
<210> 6
<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223> dsx31L-F
<400> 6
gctcgaatta accattgtgg accggtcttg tgtttagcag gcagggga 48
<210> 7
<211> 49
<212> DNA
<213> Artificial sequence
<220>
<223> dsx31L-R primers
<400> 7
tccacctcac ccatgggacc cacgcgtggt gcgggtcacc gagatgttc 49
<210> 8
<211> 50
<212> DNA
<213> Artificial sequence
<220>
<223> dsx31R-F primers
<400> 8
caccaagaca gttaacgtat ccgttacctt gacctgtgtt aaacataaat 50
<210> 9
<211> 49
<212> DNA
<213> Artificial sequence
<220>
<223> dsx31R-R primers
<400> 9
ggtggtagtg ccacacagag agcttcgcgg tggtcaacga atactcacg 49
<210> 10
<211> 44
<212> DNA
<213> Artificial sequence
<220>
<223> zpgprCRISPR-F primer
<400> 10
gctcgaatta accattgtgg accggtcagc gctggcggtg ggga 44
<210> 11
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223> zpgprCRISPR-R primer
<400> 11
tcgtggtcct tatagtccat ctcgagctcg atgctgtatt tgttgt 46
<210> 12
<211> 50
<212> DNA
<213> Artificial sequence
<220>
<223> zpgtetCRISPR-F primer
<400> 12
aggcaaaaaa gaaaaagtaa ttaattaaga ggacggcgag aagtaatcat 50
<210> 13
<211> 51
<212> DNA
<213> Artificial sequence
<220>
<223> zpgtetCRISPR-R primer
<400> 13
ttcaagcgca cgcatacaaa ggcgcgcctc gcataatgaa cgaaccaaag g 51
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> dsxin3-F primer
<400> 14
ggcccttcaa cccgaagaat 20
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> dsxex6-R
<400> 15
ctttttgtac agcggtacac 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> GFP-F primer
<400> 16
gccctgagca aagaccccaa 20
<210> 17
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> dsxex4-F primers
<400> 17
gcacaccagc ggatcgacga ag 22
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> dsxex5-R primers
<400> 18
cccacataca aagatacgga cag 23
<210> 19
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> dsxex6-R primers
<400> 19
gaatttggtg tcaaggttca gg 22
<210> 20
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> 3xP3 primer
<400> 20
tatactccgg cggtcgaggg tt 22
<210> 21
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> hCas9-F
<400> 21
ccaagagagt gatcctggcc ga 22
<210> 22
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> dsxex5-R1 primer
<400> 22
cttatcggca tcagttgcgc ac 22
<210> 23
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> dsxin4-F primer
<400> 23
ggtgttatgc cacgttcact ga 22
<210> 24
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> RFP-R primer
<400> 24
caagtgggag cgcgtgatga ac 22
<210> 25
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 4 boundary 1
<400> 25
ttatgtttaa cacaggtcaa gcggtggtca 30
<210> 26
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary 2
<400> 26
aatacaaatt gtgtccagtt cgccaccagt 30
<210> 27
<211> 54
<212> DNA
<213> Artificial sequence
<220>
<223> dsx intron 4-exon 5 boundaries in 6 species
<400> 27
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctca 54
<210> 28
<211> 37
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 28
gtttaacaca ggtcaagcgg tggtcaacga atactca 37
<210> 29
<211> 26
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 29
gtttaacaca ggtcaacgaa tactca 26
<210> 30
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 30
gtttaacaca ggtcggtggt caacgaatac tca 33
<210> 31
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 31
gtttaacacg gtggtcaacg aatactca 28
<210> 32
<211> 26
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 32
gtttaacggt ggtcaacgaa tactca 26
<210> 33
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 33
gtttaacaca ggtcaacggt ggtcaacgaa tactca 36
<210> 34
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 34
gtttaacaca ggtccggtgg tcaacgaata ctca 34
<210> 35
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 35
gtttaacacc ggtggtcaac gaatactca 29
<210> 36
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 36
gtttaaccgg tggtcaacga atactca 27
<210> 37
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 37
gtttaacaca ggtcataagc ggtggtcaac gaatactca 39
<210> 38
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> intron 4 exon 5 boundary
<400> 38
gtttaacaca ggtcaaggac ggtggtcaac gaatactca 39
<210> 39
<211> 129
<212> DNA
<213> Anopheles gambiae
<400> 39
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 40
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 40
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 41
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 41
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 42
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 42
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 43
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 43
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 44
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 44
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgtaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 45
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 45
cctttccatt catttatgtt taacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 46
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 46
cctttccatt catttatgtt caacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 47
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 47
cctttccatt catttatgtt caacacaggt caaacggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttacgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 48
<211> 128
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 48
cctttccatt catttatgtt caacacaggt caaacggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttacgcaata ccacccgtca gagtggatga 120
taaacttt 128
<210> 49
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 49
cctttccatt catttatgtt caacacaggt caagcggtgg tcaacgaata ctcaagattg 60
cataatctga acatgttcga tggcgtggag ttacgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 50
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 50
cctttccatt catttatgtt caacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttacgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 51
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 51
ccttaccatg catttatgtt caacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgtggag ttacgcaaca ccacccgtca gagtggatga 120
taaactttc 129
<210> 52
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 52
cctttccatt catttatgtt caacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgcggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 53
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 53
cctttccatt catttatgtt caacacaggt caagcggtgg tcaacgaata ctcacgattg 60
cataatctga acatgttcga tggcgcggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 54
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 54
cctttccatt catttatgct caacacaggt caggccgtgg tcaacgaata ctcacgattg 60
cacaatctga acatgttcga tggcgtggag ttgcgcaaca ccacccgtca gagtggatga 120
taaactttc 129
<210> 55
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 55
cctttccatt catttatgct caacacaggt caggccgtgg tcaacgaata ctcacgattg 60
cacaatctga acatgttcga tggcgtggag ttgcgcaaca ccacccgtca gagtggatga 120
taaactttc 129
<210> 56
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx intron 4-exon 5 boundary
<400> 56
ctttgccatt tatttatgcc caacacaggt caggccgtgg tcaacgaata ctcacgattg 60
cacaatctga acatgttcga tggcgtagag ttgcgcaacg ccacccgcca gagcggatga 120
taaacttcc 129
<210> 57
<211> 37
<212> DNA
<213> unknown
<220>
<223> AGAP007280, and its target site in exon 6
<400> 57
cgaggtgagg aagaaagtga ggaggagggt ggtagtg 37
<210> 58
<211> 37
<212> DNA
<213> unknown
<220>
<223> AGAP007280, and its target site in exon 6
<400> 58
gctccactcc ttctttcact cctcctccca ccatcac 37
<210> 59
<211> 129
<212> DNA
<213> unknown
<220>
<223> dsx female specific exon 5 with SNP variants
<400> 59
cctttccatt catttatgtt taacacaggt caagcagtgg tcaacgaata ttcacgattg 60
cataatctga acatgtttga tggcgtggag ttgcgcaata ccacccgtca gagtggatga 120
taaactttc 129
<210> 60
<211> 23
<212> DNA
<213> unknown
<220>
<223> Wild Type (WT) target site in dsx exon 5
<400> 60
gtttaacaca ggtcaagcgg tgg 23
<210> 61
<211> 23
<212> DNA
<213> unknown
<220>
<223> target site in dsx exon 5 containing a single SNP found in the wild-capture population
<400> 61
gtttaacaca ggtcaagcag tgg 23
<210> 62
<211> 20
<212> DNA
<213> unknown
<220>
<223> PAM-free' control
<400> 62
gtttaacaca ggtcaagcgg 20
<210> 63
<211> 53
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 63
tcgtcggcag cgtcagatgt gtataagaga cagggagaag gtaaatgcgc cac 53
<210> 64
<211> 54
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 64
gtctcgtggg ctcggagatg tgtataagag acaggcgctt ctacactcgc ttct 54
<210> 65
<211> 3
<212> DNA
<213> Artificial sequence
<220>
<223> resistance mutation at target site
<400> 65
gag 3
<210> 66
<211> 6
<212> DNA
<213> Artificial sequence
<220>
<223> resistance mutation at target site
<400> 66
gaggag 6
<210> 67
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> nos-pr-F primer
<400> 67
gtgaacttcc atggaattac gt 22
<210> 68
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> nos-pr-R primer
<400> 68
cttgctttct agaacaaaag gatc 24
<210> 69
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> nos-ter-F primer
<400> 69
gacagagtcg ttcgttcatt 20
<210> 70
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> nos-ter-R primer
<400> 70
gtaattagtg ttcattttag 20
<210> 71
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> zpg-pr-F primer
<400> 71
cagcgctggc ggtgggga 18
<210> 72
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> zpg-pr-R primer
<400> 72
ctcgatgctg tatttgttgt 20
<210> 73
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> zpg-ter-F
<400> 73
gaggacggcg agaagtaatc at 22
<210> 74
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> zpg-ter-R primer
<400> 74
tcgcataatg aacgaaccaa agg 23
<210> 75
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> exu-pr-F primer
<400> 75
ggaaggtgat tgcgattcca tgt 23
<210> 76
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> exu-pr-R primer
<400> 76
tttgtacaag ctacacaaga gaagg 25
<210> 77
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> exu-ter-F
<400> 77
gcgtgagccg gagaaagc 18
<210> 78
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> exu-ter-R primer
<400> 78
actgctactg tgcaacacat c 21
<210> 79
<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223> nos-pr-CRISPR-F primer
<400> 79
gctcgaatta accattgtgg accggtgtga acttccatgg aattacgt 48
<210> 80
<211> 50
<212> DNA
<213> Artificial sequence
<220>
<223> nos-pr-CRISPR-R primer
<400> 80
tcgtggtcct tatagtccat ctcgagcttg ctttctagaa caaaaggatc 50
<210> 81
<211> 55
<212> DNA
<213> Artificial sequence
<220>
<223> nos-ter-CRISPR-F primer
<400> 81
gccggccagg caaaaaagaa aaagtaatta attaagacag agtcgttcgt tcatt 55
<210> 82
<211> 55
<212> DNA
<213> Artificial sequence
<220>
<223> nos-ter-CRISPR-r primer
<400> 82
tcaacccttc aagcgcacgc atacaaaggc gcgccgtaat tagtgttcat tttag 55
<210> 83
<211> 49
<212> DNA
<213> Artificial sequence
<220>
<223> exu-pr-CRISPR-F primer
<400> 83
gctcgaatta accattgtgg accggtggaa ggtgattgcg attccatgt 49
<210> 84
<211> 51
<212> DNA
<213> Artificial sequence
<220>
<223> exu-pr-CRISPR-R primer
<400> 84
tcgtggtcct tatagtccat ctcgagtttg tacaagctac acaagagaag g 51
<210> 85
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223> exu-ter-CRISPR-F primer
<400> 85
aggcaaaaaa gaaaaagtaa ttaattaagc gtgagccgga gaaagc 46
<210> 86
<211> 49
<212> DNA
<213> Artificial sequence
<220>
<223> exu-ter-CRISPR-r primer
<400> 86
ttcaagcgca cgcatacaaa ggcgcgccac tgctactgtg caacacatc 49
<210> 87
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> hCas9-F7
<400> 87
cggcgaactg cagaagggaa 20
<210> 88
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> RFP2qF
<400> 88
gtgctgaagg gcgagatcca ca 22
<210> 89
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Seq-7280-F
<400> 89
gcacaaatcc gatcgtgaca 20
<210> 90
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Seq-7280-R
<400> 90
cagtggcagt tccgtagaga 20
- 上一篇：一种医用注射器针头装配设备
- 下一篇：自动化蚯蚓生产线