Severe immunodeficiency swine-derived recombinant cell and preparation method and kit thereof

文档序号：872088 发布日期：2021-03-19 浏览：8次中文

阅读说明：本技术 重症免疫缺陷猪源重组细胞及其制备方法和试剂盒 (Severe immunodeficiency swine-derived recombinant cell and preparation method and kit thereof ) 是由牛冬汪滔马翔曾为俊王磊程锐赵泽英于 2020-09-04 设计创作，主要内容包括：本发明公开了重症免疫缺陷猪源重组细胞及其制备方法。具体来说,本发明涉及IL2RG基因、RAG1基因和RAG2基因这三个基因联合敲除的重症免疫缺陷猪源重组细胞,以及用于制备该重组细胞的方法,以及用于制备该重组细胞的试剂盒。本发明提供了sgRNA组合,由sgRNA-(IL2RG-g7)、sgRNA-(RAG1-g4)和sgRNA-(RAG2-g2)组成。sgRNA-(IL2RG-g7)的靶序列结合区如SEQ ID NO：24中第1-20位核苷酸所示。sgRNA-(RAG1-g4)的靶序列结合区如SEQ ID NO：9中第1-20位核苷酸所示。sgRNA-(RAG2-g2)的靶序列结合区如SEQ ID NO：13中第1-20位核苷酸所示。本发明为重症免疫缺陷猪模型的制备奠定了坚实的基础,对于重症免疫缺陷药物的研发具有重大应用价值。(The invention discloses a severe immunodeficiency swine-derived recombinant cell and a preparation method thereof. Specifically, the invention relates to a severe immunodeficiency swine recombinant cell with combined knock-out of three genes, namely an IL2RG gene, a RAG1 gene and a RAG2 gene, a method for preparing the recombinant cell and a kit for preparing the recombinant cell. The invention provides sgRNA combinations comprising sgRNAs IL2RG‑g7 、sgRNA RAG1‑g4 And sgRNA RAG2‑g2 And (4) forming. sgRNA IL2RG‑g7 The target sequence binding region of (a) is as shown in SEQ ID NO: nucleotides 1 to 20 of 24. sgRNA RAG1‑g4 The target sequence binding region of (a) is as shown in SEQ ID NO: 9 at nucleotides 1-20. sgRNA RAG2‑g2 The target sequence binding region of (a) is as shown in SEQ ID NO: 13, nucleotides 1-20. The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model and has great application value for the research and development of severe immunodeficiency medicaments.)

1. A kit comprising a sgRNA combination or a plasmid combination; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.

The sgRNA combination consists of sgRNAs_IL2RG-g7、sgRNA_RAG1-g4And sgRNA_RAG2-g2Composition is carried out;

the plasmid combination consists of plasmid pKG-U6gRNA (IL2RG-g7), plasmid pKG-U6gRNA (RAG1-g4) and plasmid pKG-U6gRNA (RAG2-g 2);

the sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (IL2RG-g7)_IL2RG-g7；

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG1-g4)_RAG1-g4；

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG2-g2)_RAG2-g2；

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: nucleotides 1 to 20 of 24;

the sgRNA_RAG1-g4The target sequence binding region of (a) is as shown in SEQ ID NO: 9, nucleotides 1-20;

the sgRNA_RAG2-g2The target sequence binding region of (a) is as shown in SEQ ID NO: 13, nucleotides 1-20.

2. The kit of claim 1, wherein: the kit further comprises plasmid pKG-GE 3;

the plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two nuclear localization signals, Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A and resistance screening marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

sgRNA combinations consisting of sgRNAs_IL2RG-g7、sgRNA_RAG1-g4And sgRNA_RAG2-g2Composition is carried out;

the sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO:nucleotides 1 to 20 of 24;

the sgRNA_RAG1-g4The target sequence binding region of (a) is as shown in SEQ ID NO: 9, nucleotides 1-20;

the sgRNA_RAG2-g2The target sequence binding region of (a) is as shown in SEQ ID NO: 13, nucleotides 1-20.

4. A plasmid combination consisting of plasmid pKG-U6gRNA (IL2RG-g7), plasmid pKG-U6gRNA (RAG1-g4) and plasmid pKG-U6gRNA (RAG2-g 2);

the sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (IL2RG-g7)_IL2RG-g7；

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG1-g4)_RAG1-g4；

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG2-g2)_RAG2-g2；

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: nucleotides 1 to 20 of 24;

the sgRNA_RAG1-g4The target sequence binding region of (a) is as shown in SEQ ID NO: 9, nucleotides 1-20;

the sgRNA_RAG2-g2The target sequence binding region of (a) is as shown in SEQ ID NO: 13, nucleotides 1-20.

5. The sgRNA combination of claim 3 or the plasmid combination of claim 4 or the kit of claim 1 or the kit of claim 2 for use as (a) or (b) below: (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.

6. A method of making a recombinant cell comprising the steps of: co-transfecting the plasmid pKG-U6gRNA (IL2RG-g7), the plasmid pKG-U6gRNA (RAG1-g4), the plasmid pKG-U6gRNA (RAG2-g2) and the plasmid pKG-GE3 of claim 2 into a porcine cell to obtain a recombinant cell in which the IL2RG gene, the RAG1 gene and the RAG2 gene are mutated.

7. The recombinant cell produced by the method of claim 6.

8. Use of the recombinant cell of claim 7 for the preparation of an immunodeficient animal model.

9. Use of the sgRNA combination of claim 3 or the plasmid combination of claim 4 in the preparation of a kit; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.

10. Use of the plasmid combination according to claim 4 and the plasmid pKG-GE3 according to claim 2 for the preparation of a kit; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.

Technical Field

The invention relates to a severe immunodeficiency swine-derived recombinant cell and a preparation method thereof. Specifically, the invention relates to a severe immunodeficiency swine recombinant cell with combined knock-out of three genes, namely an IL2RG gene, a RAG1 gene and a RAG2 gene, a method for preparing the recombinant cell and a kit for preparing the recombinant cell.

Background

Severe Combined Immunodeficiency (SCID) is the most severe phenotype in primary immunodeficiency diseases, and refers to the development, differentiation, proliferation, metabolism or dysfunction of T cells, B cells and NK cells simultaneously caused by genetic, developmental or infection. SCID disease in human infants was first reported by Glanzmann and Riniker in 1950. Worldwide, the neonatal incidence of SCID is about 1/50000, the disease is early in age, clinically significant, and high in mortality. Most SCIDs are due to abnormalities in immune-related genes, and the major genetic patterns of SCIDs include both X-linked recessive inheritance and autosomal recessive inheritance. The disease has certain regionality and consanguinity, and is mostly seen in male patients due to the characteristic of X-linked recessive inheritance.

Currently, the therapeutic approaches aimed at SCID mainly include bone marrow or hematopoietic stem cell transplantation and gene therapy. Bone marrow or stem cell transplantation is the best strategy for treating SCID, but finding donors that fit the patient appropriately is rather difficult. As a large animal, the pig is a meat-source animal which is mainly used by human for a long time, is easy to breed and feed in a large scale, has lower requirements on ethics, animal protection and the like, has the body size and the organ function similar to those of the human, and is an ideal human disease model animal.

In addition, when studying the efficacy of bioactive macromolecules or cellular therapies, testing with xenobiotics can produce immune rejection, and thus, effective animal testing is not possible. While the problem of immunological rejection between species can be avoided by using severe combined immunodeficiency model animals.

Therefore, the research of developing human SCID pig model for drug (especially bioactive molecule) screening, drug effect detection, disease pathology, gene and cell therapy and the like can provide effective experimental data for further clinical application and provide powerful experimental means for successfully treating human SCID diseases.

SCID caused by X-linked recessive inheritance is the most common type, and the pathogenic mutation is that IL2RG gene which codes IL-2R gamma chain is mutated, thereby leading to IL-2R gamma chain dysfunction. The IL-2R gamma chain is also called a common gamma chain (common gamma chain), and is a signal transduction molecule commonly used when a plurality of cytokine receptors involved in the regulation of the differentiation, development and maturation of immune cells, such as IL-2, IL-4 and IL-7, are bound to their corresponding ligands and then transduce signals into the immune cells. Thus, dysfunction of the common gamma chain results in dysfunction or dysplasia of immune cells, which triggers SCID. SCID caused by mutation of IL2RG gene accounts for 50% -60%, and the other 10% of SCID onset is due to mutation of RAG gene. Mutations in the RAG gene can affect VDJ domain rearrangement, affect T and B cell differentiation, interfere with antigen receptor formation and immunoglobulin expression. RAG1 acts as a catalyst component for RAG complexes, whereas RAG2, although not a catalyst, is involved in the currently known RAG1 catalytic process. Both RAG1 and RAG2 are therefore closely related to SCID.

Disclosure of Invention

The invention aims to provide a severe immunodeficiency swine-derived recombinant cell and a preparation method thereof. Specifically, the invention relates to a severe immunodeficiency swine recombinant cell with combined knock-out of three genes, namely an IL2RG gene, a RAG1 gene and a RAG2 gene, a method for preparing the recombinant cell and a kit for preparing the recombinant cell.

The invention provides a kit which comprises a specific sgRNA combination.

The invention also provides a kit comprising the specific plasmid combination. The kit also includes plasmid pKG-GE 3.

The invention also protects specific sgRNA combinations.

The invention also protects specific plasmid combinations.

Any one of the specific sgRNA combinations described above, consisting of sgRNAs_IL2RG-g7、sgRNA_RAG1-g4And sgRNA_RAG2-g2And (4) forming.

Any one of the plasmid combinations above, consisting of plasmid pKG-U6gRNA (IL2RG-g7), plasmid pKG-U6gRNA (RAG1-g4) and plasmid pKG-U6gRNA (RAG2-g 2).

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparation of recombinant cells. The recombinant cell is a porcine recombinant cell. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparation of an immunodeficient animal model. When the method is applied, the recombinant cell is prepared firstly, and then the recombinant cell is used as a donor cell to obtain a cloned animal by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The animal may specifically be a pig. The recombinant cell is a porcine recombinant cell. The immunodeficiency animal model is an immunodeficiency pig model. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The invention also provides a method for preparing recombinant cells, which comprises the following steps: the plasmid pKG-U6gRNA (IL2RG-g7), the plasmid pKG-U6gRNA (RAG1-g4), the plasmid pKG-U6gRNA (RAG2-g2) and the plasmid pKG-GE3 were co-transfected into porcine cells, resulting in recombinant cells in which the IL2RG gene, the RAG1 gene and the RAG2 gene were mutated. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The recombinant cell prepared by the method also belongs to the protection scope of the invention.

Any one of the above recombinant cells is a cell deficient in all of the IL2RG gene, the RAG1 gene, and the RAG2 gene.

Any one of the recombinant cells is a recombinant cell in which an IL2RG gene, a RAG1 gene and a RAG2 gene are mutated. The mutation may be a heterozygous mutation (heterozygous mutant type corresponding to the genotype) or a homozygous mutation (biallelic same mutant type or biallelic different mutant type corresponding to the genotype).

In particular, the recombinant cell may be any one of: the monoclonal cell strains numbered 2, 16, 19, 26, 37, 48, 55, 58, 64, 66, 75, 79, 80, 83, 85 in tables 1 to 3.

The invention also protects the application of the recombinant cell in the preparation of an immunodeficiency animal model. When preparing the immunodeficiency animal model, the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The immunodeficiency animal model is an immunodeficiency pig model.

The invention also protects the application of the sgRNA combination in the preparation of a kit.

The invention also protects the application of the plasmid combination in the preparation of a kit.

The invention also protects the application of the plasmid combination and the plasmid pKG-GE3 in the preparation of a kit.

The use of any one of the above kits is (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cell is prepared firstly, and then the recombinant cell is used as a donor cell to obtain a cloned animal by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The animal may specifically be a pig. The recombinant cell is a porcine recombinant cell. The immunodeficiency animal model is an immunodeficiency pig model. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

sgRNA_IL2RG-g7And (3) target point: 5'-TCCCTTCAGAGAATAGATAG-3' are provided.

sgRNA_RAG1-g4And (3) target point: 5'-AGTTATGGCAGAACTCAGTG-3' are provided.

sgRNA_RAG2-g2And (3) target point: 5'-GATAACAGTTGGTAATAACA-3' are provided.

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: nucleotides 1 to 20 of 24.

The sgRNA_RAG1-g4The target sequence binding region of (a) is as shown in SEQ ID NO: 9 at nucleotides 1-20.

The sgRNA_RAG2-g2The target sequence binding region of (a) is as shown in SEQ ID NO: 13, nucleotides 1-20.

The sgRNA_IL2RG-g7As shown in SEQ ID NO: as shown at 24.

The sgRNA_RAG1-g4As shown in SEQ ID NO: shown at 9.

The sgRNA_RAG2-g2As shown in SEQ ID NO: shown at 13.

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (IL2RG-g7)_IL2RG-g7。

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG1-g4)_RAG1-g4。

The sgRNA is obtained by transcribing the plasmid pKG-U6gRNA (RAG2-g2)_RAG2-g2。

Specifically, the plasmid pKG-U6gRNA (IL2RG-g7) binds sgRNA with the aid of the restriction enzyme BbsI_IL2RG-g7The coding sequence of the target sequence binding region is inserted into a pKG-U6gRNA vector.

Specifically, theThe plasmid pKG-U6gRNA (RAG1-g4) uses the sgRNA with the aid of the restriction enzyme BbsI_RAG1-g4The coding sequence of the target sequence binding region is inserted into a pKG-U6gRNA vector.

In particular. The plasmid pKG-U6gRNA (RAG2-g2) is a sgRNA prepared by means of the restriction enzyme BbsI_RAG2-g2The coding sequence of the target sequence binding region is inserted into a pKG-U6gRNA vector.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two Nuclear Localization Signals (NLS), Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A, resistance selection marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in the following order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be Puromycin protein.

The amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The amino acid sequence of self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The specific fusion gene is specifically shown as SEQ ID NO: 2, nucleotide 911-6706.

The CMV enhancer is as set forth in SEQ ID NO: 2 at nucleotide 395-680.

The EF1a promoter is shown as SEQ ID NO: 2, nucleotide 682-890.

The WPRE sequence element is shown as SEQ ID NO: 2 at nucleotide 6722 and 7310.

The 3' LTR sequence element is shown in SEQ ID NO: nucleotide 7382-7615 in 2.

The bGH poly (a) signal sequence element is as set forth in SEQ ID NO: 2 as shown by nucleotide 7647-7871.

The plasmid pKG-GE3 is specifically shown in SEQ ID NO: 2, respectively.

In plasmid pKG-U6gRNA, the plasmid has the sequence of SEQ ID NO: 3, the 2280-position 2637 nucleotide.

The plasmid pKG-U6gRNA is specifically shown in SEQ ID NO: 3, respectively.

Porcine IL2RG gene information: encoding the interleaver 2 receiver subBunit gamma; is located on the X chromosome; GeneID 397156, Sus scrofa. The protein coded by the porcine IL2RG gene is shown as SEQ ID NO: shown at 16. In the genome DNA, the porcine IL2RG gene has 9 exons, wherein the 4 th exon and the upstream and downstream 500bp sequences thereof are shown as SEQ ID NO: shown at 17.

Pig RAG1 gene information: encoding a reconstruction-activating protein 1; is located on chromosome 2; GeneID 397506, Sus scrofa. The protein coded by the pig RAG1 gene is shown as SEQ ID NO: 4, respectively. In the genomic DNA, the pig RAG1 gene has 2 exons, wherein the 2 nd exon sequence is shown as SEQ ID NO: 5, respectively.

Pig RAG2 gene information: encoding a reconstruction-activating protein 2; is located on chromosome 2; GeneID 100151744, Sus scrofa. The protein coded by the pig RAG2 gene is shown as SEQ ID NO: shown at 10. In the genomic DNA, the pig RAG2 gene has 2 exons, wherein the 2 nd exon and the sequences of 500bp respectively upstream and downstream of the exon are shown as SEQ ID NO: shown at 11.

Any of the above-described immunodeficiency may specifically be severe immunodeficiency.

The invention can be used for obtaining the severe immunodeficiency pig model by a gene editing means, is used for researching drug screening, drug effect detection, disease pathology, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and lays a solid foundation for curing the severe immunodeficiency of human in the future.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) the subject of the invention (pig) has better applicability than other animals (rats, mice, primates). At present, no large animal Duchenne muscular dystrophy disease model is successfully developed. Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. The large animals, primates, which are the animals most closely related to humans, are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation rate is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high. However, pigs, which are animals that have a close relationship with humans except primates, do not have the above-mentioned disadvantages as model animals, and have body types, body weights, organ sizes, and the like close to those of humans, and are very similar to those of humans in terms of anatomy, physiology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple births, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate; and the resistance of the pig as a carnivorous animal for a long time in the aspects of animal protection, ethics and the like is relatively small when the pig is used as a disease model animal.

(2) The gene editing is carried out by adopting the cas9 high-efficiency expression vector modified by the invention, and the editing efficiency is obviously improved compared with that of the original vector.

The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model and has great application value for the research and development of severe immunodeficiency medicaments.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

FIG. 2 is a schematic structural diagram of plasmid pKG-GE 3.

FIG. 3 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 4 is a schematic diagram of insertion of a DNA molecule of about 20bp (target sequence binding region for transcription to form a gRNA) into a plasmid pKG-U6 gRNA.

FIG. 5 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of IL2RG-GT-F4543/IL2RG-GT-R5180 using genomic DNA of 8 pigs as a template in step one of example 2.

FIG. 6 shows double-stranded DNA molecules having sticky ends in the third step of example 2.

FIG. 7 is a graph of the sequencing peaks in step four of example 2.

FIG. 8 is an electrophoretogram of a primer pair consisting of RAG1-GT-F4699/RAG1-GT-R5306 used in PCR amplification using genomic DNA of 8 pigs as a template in step one of example 3.

FIG. 9 shows double-stranded DNA molecules having sticky ends in each of the three steps of example 3.

FIG. 10 is a graph of the sequencing peaks in step four of example 3.

FIG. 11 is an electropherogram of the primer pair consisting of RAG2-GT-F4181/RAG2-GT-R4927 using genomic DNA from 8 pigs as a template in step one of example 4 after PCR amplification.

FIG. 12 shows double-stranded DNA molecules having sticky ends in the third step of example 4.

FIG. 13 is a graph of the sequencing peaks in step four of example 4.

FIG. 14 is a graph of the target gene sequencing peaks of a portion of the monoclonal cells in Table 1.

FIG. 15 is a target gene sequencing peak of a portion of the monoclonal cells in Table 2.

FIG. 16 is a peak diagram of the sequencing of the target gene in a portion of the monoclonal cells in Table 3.

FIG. 17 is an electrophoretogram of three sets of MSTN in step three of example 6.

FIG. 18 is an electrophoretogram of three sets of FNDC5 in step three of example 6.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicilin-Streptomyces (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37 ℃ and 5% CO₂、5％O₂The constant temperature incubator.

The 8 pigs in examples 2 to 4 were all the swine from Jiangxiang at birth, 4 female pigs (named 1, 2, 3 and 4 respectively) and 4 male pigs (named A, B, C, D respectively).

The method for preparing the primary pig fibroblast comprises the following steps: taking 0.5g of pig ear tissue, removing hairs, soaking for 30-40s by using 75% alcohol, washing for 5 times by using PBS (phosphate buffer solution) containing 5% (volume ratio) Penicillin-streptomycin (Gibco), and washing for one time by using the PBS; ② the tissue is cut into pieces by scissors, 5mL of 1% collagenase solution (Sigma) is adopted to digest for 1h at 37 ℃, then 500g is centrifuged for 5min, and the supernatant is discarded; thirdly, resuspending the precipitate with 1mL of complete culture solution, then paving the precipitate into a cell culture dish which contains 10mL of complete culture medium and is sealed by 0.2 percent gelatin (VWR) and has the diameter of 9cm, and culturing until the cell grows to be about 60 percent of the bottom of the dish; and fourthly, after the third step is finished, digesting and collecting the cells by adopting trypsin, and freezing and storing the cells by using a cell freezing medium (90% complete culture medium + 10% DMSO in volume ratio).

The porcine primary fibroblasts used in examples 2 to 6 were all obtained from the above-mentioned pig named 2 (female, blood group AO).

Example 1 preparation of plasmid

Plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 was prepared as shown in SEQ ID NO: 1 is shown. Plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9, abbreviated as plasmid pX 330.

Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO was prepared as shown in SEQ ID NO: 2, respectively. The plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO is called plasmid pKG-GE3 for short.

Plasmid pKG-U6gRNA was prepared as shown in SEQ ID NO: 3, respectively.

The plasmid pX330, the plasmid pKG-GE3 and the plasmid pKG-U6gRNA are all circular plasmids.

The structure of plasmid pX330 is schematically shown in FIG. 1. SEQ ID NO: 1, the 440-st-725 nucleotide constitutes the CMV enhancer, the 727-1208 th-1208 nucleotide constitutes the chicken beta-actin promoter, the 1304-st-1324 nucleotide encodes SV40 Nuclear Localization Signal (NLS), the 1325-st-5449 nucleotide encodes the Cas9 protein, and the 5450-st-5497 nucleotide encodes the nucleosplastin Nuclear Localization Signal (NLS).

The structure of plasmid pKG-GE3 is shown in FIG. 2. SEQ ID NO: 2, the 395-680 nucleotide constitutes a CMV enhancer, the 682-890 nucleotide constitutes an EF1a promoter, the 986-1006 nucleotide encodes a Nuclear Localization Signal (NLS), the 1016-1036 nucleotide encodes a Nuclear Localization Signal (NLS), the 1037-5161 nucleotide encodes a Cas9 protein, the 5162-5209 nucleotide encodes a Nuclear Localization Signal (NLS), the 5219-5266 nucleotide encodes a Nuclear Localization Signal (NLS), the 5276-5332 nucleotide encodes a self-splicing polypeptide P2A (the amino acid sequence of the self-splicing polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage position occurring from the cleavage is between the first amino acid residue and the second amino acid residue from the C-terminal), the 5333-6046 nucleotide encodes an EGFP protein, the 526056-6109 nucleotide encodes a self-splicing polypeptide T2A (the amino acid sequence of the self-splicing polypeptide T2A is "EGRGSLLTCGDVEENPGP", between the first amino acid residue and the second amino acid residue from the C-terminal position of the cleavage site), nucleotides 6110-6703 encode Puromycin protein (Puro protein for short), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3' LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly (A) signal sequence element. SEQ ID NO: 2, 911-6706 form a fusion gene to express the fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein and a protein with Puro protein.

Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: removing residual gRNA framework sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; secondly, the original chicken beta-actin promoter is transformed into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is improved; ③ the nuclear localization signal coding gene (NLS) is added at the upstream and the downstream of the Cas9 gene, and the nuclear localization capability of the Cas9 protein is increased; the original plasmid does not have any eukaryotic cell screening marker, is not beneficial to screening and enriching of positive transformed cells, and is sequentially inserted with a P2A-EGFP-T2A-PURO coding gene at the downstream of the Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance screening capacity; inserting WPRE element and 3' LTR sequence element to strengthen the protein translating capacity of Cas9 gene.

The structure of plasmid pKG-U6gRNA is schematically shown in FIG. 3. SEQ ID NO: 3, the 2280-position 2539 nucleotide constitutes the hU6 promoter, and the 2558-position 2637 nucleotide is used for transcription to form a gRNA framework. When the recombinant gRNA is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) of about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA, wherein a schematic diagram is shown in figure 4.

Example 2 screening of target for IL2RG Gene knockout

First, IL2RG gene knockout preset target and adjacent genome sequence conservation analysis

The genomic DNA of 8 pigs were used as templates, PCR amplification was carried out using the primer pair IL2RG-GT-F4543/IL2RG-GT-R5180, and electrophoresis was carried out, as shown in FIG. 5. And recovering PCR amplification products, sequencing, and comparing the sequencing result with the IL2RG gene sequence in a public database for analysis. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: IL2RG-nF33/IL2RG-nR 460.

IL2RG-GT-F4543：5’-ATATAGCACAGGGGAGGGAGGAA-3’；

IL2RG-GT-R5180：5’-AGGGTGCGAAGGGTCAGATTC-3’；

IL2RG-nF33：5’-CCCAGGCTTCCCACTATATTCTC-3’；

IL2RG-nR460：5’-CCATTGGATCCCTCACTTCTTCT-3’。

Secondly, screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 9 targets from the NGG through a preliminary experiment.

The 9 targets were as follows:

sgRNA_IL2RG-g1and (3) target point: 5'-CCTGTAGTTTTAGCGTCTGT-3', respectively;

sgRNA_IL2RG-g2and (3) target point: 5'-CAACAAATGTTTGGTAGAGG-3', respectively;

sgRNA_IL2RG-g3and (3) target point: 5'-GATGATAAAGTCCAGGAGTG-3', respectively;

sgRNA_IL2RG-g4and (3) target point: 5'-CTGGACTTTATCATCATTAG-3', respectively;

sgRNA_IL2RG-g5and (3) target point: 5'-TTGTCCAGCTCCAGGACCCA-3', respectively;

sgRNA_IL2RG-g6and (3) target point: 5'-GGCCACTATCTATTCTCTGA-3', respectively;

sgRNA_IL2RG-g7and (3) target point: 5'-TCCCTTCAGAGAATAGATAG-3', respectively;

sgRNA_IL2RG-g8and (3) target point: 5'-AACATTTGTTGTCCAGCTCC-3', respectively;

sgRNA_IL2RG-g9and (3) target point: 5'-TGTCCAGCTCCAGGACCCAC-3' are provided.

Thirdly, preparing recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

IL2RG-g1S and IL2RG-g1A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6A). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 1). Plasmid pKG-U6gRNA (IL2RG-g1) expresses the nucleic acid sequence of SEQ ID NO: 18 of sgRNA_IL2RG-g1。

SEQ ID NO：18：

CCUGUAGUUUUAGCGUCUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g2S and IL2RG-g2A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6B). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 2). Plasmid pKG-U6gRNA (IL2RG-g2) expresses the nucleic acid sequence of SEQ ID NO: 19 sgRNA_IL2RG-g2。

SEQ ID NO：19：

CAACAAAUGUUUGGUAGAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g3S and IL2RG-g3A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6C). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 3). Plasmid pKG-U6gRNA (IL2RG-g3) expresses the nucleic acid sequence of SEQ ID NO: 20 sgRNA_IL2RG-g3。

SEQ ID NO：20：

GAUGAUAAAGUCCAGGAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g4S and IL2RG-g4A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6D). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 4). Plasmid pKG-U6gRNA (IL2RG-g4)) Expresses SEQ ID NO: 21 sgRNA_IL2RG-g4。

SEQ ID NO：21：

CUGGACUUUAUCAUCAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g5S and IL2RG-g5A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6E). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 5). Plasmid pKG-U6gRNA (IL2RG-g5) expresses the nucleic acid sequence of SEQ ID NO: 22 of sgRNA_IL2RG-g5。

SEQ ID NO：22：

UUGUCCAGCUCCAGGACCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g6S and IL2RG-g6A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6F). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 6). Plasmid pKG-U6gRNA (IL2RG-g6) expresses the nucleic acid sequence of SEQ ID NO: 23 sgRNA_IL2RG-g6。

SEQ ID NO：23：

GGCCACUAUCUAUUCUCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-G7S and IL2RG-G7A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6G). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 7). Plasmid pKG-U6gRNA (IL2RG-g7) expresses the nucleic acid sequence of SEQ ID NO: 24 sgRNA_IL2RG-g7。

SEQ ID NO：24：

UCCCUUCAGAGAAUAGAUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g8S and IL2RG-g8A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6H). Connecting the double-stranded DNA molecule with cohesive end with the carrier skeleton to obtain plasmid pKG-U6gRNA (IL2RG-g 8). Plasmid pKG-U6gRNA (IL2RG-g8) expresses the nucleic acid sequence of SEQ ID NO: 25 of sgRNA_IL2RG-g8。

SEQ ID NO：25：

AACAUUUGUUGUCCAGCUCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g9S and IL2RG-g9A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 6I). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 9). Plasmid pKG-U6gRNA (IL2RG-g9) expresses the nucleic acid sequence of SEQ ID NO: 26 sgRNA_IL2RG-g9。

SEQ ID NO：26：

UGUCCAGCUCCAGGACCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

sgRNA-IL2RG-1S：5’-caccgCCTGTAGTTTTAGCGTCTGT-3’；

sgRNA-IL2RG-1A：5’-aaacACAGACGCTAAAACTACAGGc-3’。

sgRNA-IL2RG-2S：5’-caccgCAACAAATGTTTGGTAGAGG-3’；

sgRNA-IL2RG-2A：5’-aaacCCTCTACCAAACATTTGTTGc-3’。

sgRNA-IL2RG-3S：5’-caccGATGATAAAGTCCAGGAGTG-3’；

sgRNA-IL2RG-3A：5’-aaacCACTCCTGGACTTTATCATC-3’。

sgRNA-IL2RG-4S：5’-caccgCTGGACTTTATCATCATTAG-3’；

sgRNA-IL2RG-4A：5’-aaacCTAATGATGATAAAGTCCAGc-3’。

sgRNA-IL2RG-5S：5’-caccgTTGTCCAGCTCCAGGACCCA-3’；

sgRNA-IL2RG-5A：5’-aaacTGGGTCCTGGAGCTGGACAAc-3’。

sgRNA-IL2RG-6S：5’-caccgGGCCACTATCTATTCTCTGA-3’；

sgRNA-IL2RG-6A：5’-aaacTCAGAGAATAGATAGTGGCCc-3’。

sgRNA-IL2RG-7S：5’-caccgTCCCTTCAGAGAATAGATAG-3’；

sgRNA-IL2RG-7A：5’-aaacCTATCTATTCTCTGAAGGGAc-3’。

sgRNA-IL2RG-8S：5’-caccgAACATTTGTTGTCCAGCTCC-3’；

sgRNA-IL2RG-8A：5’-aaacGGAGCTGGACAACAAATGTTc-3’。

sgRNA-IL2RG-9S：5’-caccgTGTCCAGCTCCAGGACCCAC-3’；

sgRNA-IL2RG-9A：5’-aaacGTGGGTCCTGGAGCTGGACAc-3’。

The sgRNA-IL2RG-1S, sgRNA-IL2RG-1A, sgRNA-IL2RG-2S, sgRNA-IL2RG-2A, sgRNA-IL2RG-3S, sgRNA-IL2RG-3A, sgRNA-IL2RG-4S, sgRNA-IL2RG-4A, sgRNA-IL2RG-5S, sgRNA-IL2RG-5A, sgRNA-IL2RG-6S, sgRNA-IL2RG-6A, sgRNA-IL2RG-7S, sgRNA-IL2RG-7A, sgRNA-IL2RG-8S, sgRNA-IL2RG-8A, sgRNA-IL2RG-9S, sgRNA-IL2RG-9A are single-chain DNA molecules.

Four, comparison of editing efficiency of different target points

1. Cotransfection

A first group: plasmid pKG-U6gRNA (IL2RG-g1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 1): 1.238 μ g of plasmid pKG-GE 3.

Second group: plasmid pKG-U6gRNA (IL2RG-g2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 2): 1.238 μ g of plasmid pKG-GE 3.

Third group: plasmid pKG-U6gRNA (IL2RG-g3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 3): 1.238 μ g of plasmid pKG-GE 3.

And a fourth group: plasmid pKG-U6gRNA (IL2RG-g4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 4): 1.238 μ g of plasmid pKG-GE 3.

And a fifth group: plasmid pKG-U6gRNA (IL2RG-g5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 5): 1.238 μ g of plasmid pKG-GE 3.

A sixth group: plasmid pKG-U6gRNA (IL2RG-g6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 6): 1.238 μ g of plasmid pKG-GE 3.

A seventh group: plasmid pKG-U6gRNA (IL2RG-g7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 7): 1.238 μ g of plasmid pKG-GE 3.

And an eighth group: plasmid pKG-U6gRNA (IL2RG-g8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 8): 1.238 μ g of plasmid pKG-GE 3.

Ninth group: plasmid pKG-U6gRNA (IL2RG-g9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 9): 1.238 μ g of plasmid pKG-GE 3.

The tenth group: porcine primary fibroblasts, without any transfection procedure.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, the cells were trypsinized and harvested, genomic DNA was extracted, PCR amplified using a primer pair consisting of IL2RG-nF33 and IL2RG-nR460, and then electrophoresed and sequenced, the results are shown in FIG. 7.

The editing efficiency of different targets was obtained by analyzing the sequencing peak patterns using the syntheo ICE tool. The editing efficiency of the first group to the tenth group of different target points is 1%, 0%, 3%, 5%, 0%, 46%, 65%, 18%, 34% and 0% in sequence. The results show that the seventh group has the highest editing efficiency, sgRNA_IL2RG-g7Is the optimal target point.

Example 3 screening of target for RAG1 Gene knockout

First, conservation analysis of RAG1 gene knockout preset target and adjacent genome sequence

8 pig genomic DNA was used as a template, and PCR amplification was carried out using a primer pair consisting of RAG1-GT-F4699/RAG1-GT-R5306, followed by electrophoresis, as shown in FIG. 8. PCR amplification products were recovered and sequenced, and the sequencing results were analyzed by alignment with the RAG1 gene sequence in public databases. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: RAG1-nF126/RAG1-nR 525.

RAG1-GT-F4699：5’-CACCTGAAAAGGCTCAAACGGAA-3’；

RAG1-GT-R5306：5’-CGCTCGGTCAATCACAGTTTTGA-3’；

RAG1-nF126：5’-CCCCATCCAAAGTTTTTAAAGGA-3’；

RAG1-nR525：5’-TGTGGCAGATGTCACAGTTTAGG-3’。

Secondly, screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA_RAG1-g1and (3) target point: 5'-GGGAATTCTTTCAACACCAC-3', respectively;

sgRNA_RAG1-g2and (3) target point: 5'-AGAGAAGGTATCCAGTCCAC-3', respectively;

sgRNA_RAG1-g3and (3) target point: 5'-AATGAGGTCTGGCCAGGACG-3', respectively;

sgRNA_RAG1-g4and (3) target point: 5'-AGTTATGGCAGAACTCAGTG-3' are provided.

Thirdly, preparing recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

RAG1-g1S and RAG1-g1A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 9A). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-g 1). Plasmid pKG-U6gRNA (RAG1-g1) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in FIG. 6_RAG1-g1。

SEQ ID NO：6：

GGGAAUUCUUUCAACACCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG1-g2S and RAG1-g2A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 9B). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-g 2). Plasmid pKG-U6gRNA (RAG1-g2) expresses the nucleic acid sequence of SEQ ID NO: 7 sgRNA_RAG1-g2。

SEQ ID NO：7：

AGAGAAGGUAUCCAGUCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG1-g3S and RAG1-g3A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 9C). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-g 3). Plasmid pKG-U6gRNA (RAG1-g3) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in FIG. 8_RAG1-g3。

SEQ ID NO：8：

AAUGAGGUCUGGCCAGGACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG1-g4S and RAG1-g4A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 9D). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-g 4). Plasmid pKG-U6gRNA (RAG1-g4) expresses the nucleic acid sequence of SEQ ID NO: 9 sgRNA_RAG1-g4。

SEQ ID NO：9：

AGUUAUGGCAGAACUCAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

sgRNA-RAG1-1S：5’-caccGGGAATTCTTTCAACACCAC-3’；

sgRNA-RAG1-1A：5’-aaacGTGGTGTTGAAAGAATTCCc-3’。

sgRNA-RAG1-2S：5’-caccgAGAGAAGGTATCCAGTCCAC-3’；

sgRNA-RAG1-2A：5’-aaacGTGGACTGGATACCTTCTCTc-3’。

sgRNA-RAG1-3S：5’-caccgAATGAGGTCTGGCCAGGACG-3’；

sgRNA-RAG1-3A：5’-aaacCGTCCTGGCCAGACCTCATTc-3’。

sgRNA-RAG1-4S：5’-caccgAGTTATGGCAGAACTCAGTG-3’；

sgRNA-RAG1-4A：5’-aaacCACTGAGTTCTGCCATAACTc-3’。

The sgRNA-RAG1-1S, sgRNA-RAG1-1A, sgRNA-RAG1-2S, sgRNA-RAG1-2A, sgRNA-RAG1-3S, sgRNA-RAG1-3A, sgRNA-RAG1-4S, sgRNA-RAG1-4A are single-chain DNA molecules.

Four, comparison of editing efficiency of different target points

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (RAG1-g1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG1-g 1): 1.238 μ g of plasmid pKG-GE 3.

Second group: the plasmid pKG-U6gRNA (RAG1-g2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG1-g 2): 1.238 μ g of plasmid pKG-GE 3.

Third group: the plasmid pKG-U6gRNA (RAG1-g3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG1-g 3): 1.238 μ g of plasmid pKG-GE 3.

And a fourth group: the plasmid pKG-U6gRNA (RAG1-g4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG1-g 4): 1.238 μ g of plasmid pKG-GE 3.

And a fifth group: porcine primary fibroblasts, without any transfection procedure.

3. After completion of step 2, cells were trypsinized and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of RAG1-nF126 and RAG1-nR525, followed by electrophoresis and sequencing, and the results are shown in FIG. 10.

The editing efficiency of different targets was obtained by analyzing the sequencing peak patterns using the syntheo ICE tool. The editing efficiencies of the first to fifth groups were 51%, 56%, 52%, 77%, and 0% in this order. The result shows that the editing efficiency of the fourth group is highest, and the sgRNA_RAG1-g4Is the optimal target point.

Example 4 screening of target for RAG2 Gene knockout

First, conservation analysis of RAG2 gene knockout preset target and adjacent genome sequence

Pig RAG2 gene information: encoding a reconstruction-activating protein 2; is located on chromosome 2;

GeneID 100151744, Sus scrofa. The protein coded by the pig RAG2 gene is shown as SEQ ID NO: shown at 10. In the genomic DNA, the pig RAG2 gene has 2 exons, wherein the 2 nd exon and the sequences of 500bp respectively upstream and downstream of the exon are shown as SEQ ID NO: shown at 11.

8 pig genomic DNA was used as a template, and PCR amplification was carried out using a primer pair consisting of RAG2-GT-F4181/RAG2-GT-R4927, followed by electrophoresis, as shown in FIG. 11. PCR amplification products were recovered and sequenced, and the sequencing results were analyzed by alignment with the RAG2 gene sequence in public databases. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: RAG2-nF138/RAG2-nR 600.

RAG2-GT-F4181：5’-CCACGTCTTAAACTTGTCCCAGC-3’；

RAG2-GT-R4927：5’-TGAGCAGAAGGGATGTATGACCG-3’；

RAG2-nnF138：5’-GGCTTTTTATGTGTGAGGGATCT-3’；

RAG2-nnR600：5’-TTGTTCTTGCAAACCACAGACAT-3’。

Secondly, screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA_RAG2-g1and (3) target point: 5'-TCACTACAGATGATAACAGT-3', respectively;

sgRNA_RAG2-g2and (3) target point: 5'-GATAACAGTTGGTAATAACA-3', respectively;

sgRNA_RAG2-g3and (3) target point: 5'-GTGCAGGCTTCAGTTTGAGA-3', respectively;

sgRNA_RAG2-g4and (3) target point: 5'-CAAGTGGCTGGGTAGCGGAG-3' are provided.

Thirdly, preparing recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

RAG2-g1S and RAG2-g1A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 12A). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG2-g 1). Plasmid pKG-U6gRNA (RAG2-g1) expresses the nucleic acid sequence of SEQ ID NO: 12 sgRNA_RAG2-g1。

SEQ ID NO：12：

UCACUACAGAUGAUAACAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG2-g2S and RAG2-g2A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 12B). Double-stranded DNA molecule having cohesive ends and vector backboneLigation yielded the plasmid pKG-U6gRNA (RAG2-g 2). Plasmid pKG-U6gRNA (RAG2-g2) expresses the nucleic acid sequence of SEQ ID NO: 13 sgRNA_RAG2-g2。

SEQ ID NO：13：

GAUAACAGUUGGUAAUAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG2-g3S and RAG2-g3A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 12C). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG2-g 3). Plasmid pKG-U6gRNA (RAG2-g3) expresses the nucleic acid sequence of SEQ ID NO: 14 sgRNA_RAG2-g3。

SEQ ID NO：14：

GUGCAGGCUUCAGUUUGAGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

RAG2-g4S and RAG2-g4A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 12D). The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG2-g 4). Plasmid pKG-U6gRNA (RAG2-g4) expresses the nucleic acid sequence of SEQ ID NO: 15 sgRNA_RAG2-g4。

SEQ ID NO：15：

CAAGUGGCUGGGUAGCGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

sgRNA-RAG2-1S：5’-caccgTCACTACAGATGATAACAGT-3’；

sgRNA-RAG2-1A：5’-aaacACTGTTATCATCTGTAGTGAc-3’。

sgRNA-RAG2-2S：5’-caccGATAACAGTTGGTAATAACA-3’；

sgRNA-RAG2-2A：5’-aaacTGTTATTACCAACTGTTATC-3’。

sgRNA-RAG2-3S：5’-caccGTGCAGGCTTCAGTTTGAGA-3’；

sgRNA-RAG2-3A：5’-aaacTCTCAAACTGAAGCCTGCAC-3’。

sgRNA-RAG2-4S：5’-caccgCAAGTGGCTGGGTAGCGGAG-3’；

sgRNA-RAG2-4A：5’-aaacCTCCGCTACCCAGCCACTTGc-3’。

The sgRNA-RAG2-1S, sgRNA-RAG2-1A, sgRNA-RAG2-2S, sgRNA-RAG2-2A, sgRNA-RAG2-3S, sgRNA-RAG2-3A, sgRNA-RAG2-4S, sgRNA-RAG2-4A are single-chain DNA molecules.

Four, comparison of editing efficiency of different target points

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (RAG2-g1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG2-g 1): 1.238 μ g of plasmid pKG-GE 3.

Second group: the plasmid pKG-U6gRNA (RAG2-g2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG2-g 2): 1.238 μ g of plasmid pKG-GE 3.

Third group: the plasmid pKG-U6gRNA (RAG2-g3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG2-g 3): 1.238 μ g of plasmid pKG-GE 3.

And a fourth group: the plasmid pKG-U6gRNA (RAG2-g4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (RAG2-g 4): 1.238 μ g of plasmid pKG-GE 3.

And a fifth group: porcine primary fibroblasts, without any transfection procedure.

3. After completion of step 2, cells were trypsinized and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of RAG2-nF138 and RAG2-nR600, and then electrophoresed and sequenced, the results are shown in FIG. 13.

By making use ofThe syntheo ICE tool analyzed the sequencing peak maps to derive the editing efficiency of different targets. The editing efficiency of the first to fifth groups of different targets is 66%, 69%, 34%, 50% and 0% in sequence. The result shows that the editing efficiency of the second group is highest, and sgRNA_RAG2-g2Is the optimal target point.

Example 5 preparation of monoclonal cells for IL2RG, RAG1 and RAG2 Gene editing

1. Cotransfection

Plasmid pKG-U6gRNA (IL2RG-g7), plasmid pKG-U6gRNA (RAG1-g4), plasmid pKG-U6gRNA (RAG2-g2), and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.38 μ g plasmid pKG-U6gRNA (IL2RG-g 7): 0.38 μ g plasmid pKG-U6gRNA (RAG1-g 4): 0.38 μ g plasmid pKG-U6gRNA (RAG2-g 2): mu.g of plasmid pKG-GE 3.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 200. mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and harvested (cells from each well, approximately 2/3 were plated into 6-well plates containing complete medium and the remaining 1/3 collected in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 50% full, trypsinized and collected, and the cells were cryopreserved using a cell cryopreservation solution (90% complete medium + 10% DMSO by volume).

6. Taking the centrifuge tube in the step 4, taking the cell, extracting genomic DNA, performing PCR amplification (respectively adopting a primer pair consisting of IL2RG-nF33 and IL2RG-nR460, a primer pair consisting of RAG1-nF126 and RAG1-nR525, and a primer pair consisting of RAG2-nF138 and RAG2-nR 600), and then performing electrophoresis. Porcine primary fibroblasts were used as wild type controls.

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

The sequencing result of the primary pig fibroblast is only one, and the genotype of the primary pig fibroblast is homozygous wild type. If the sequencing result of a certain monoclonal cell has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is heterozygote; if the sequencing result of a certain monoclonal cell is two types, the two types of the sequencing results are both mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, and the genotype of the monoclonal cell is a biallelic different mutant type; if the sequencing result of a certain monoclonal cell is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is a biallelic gene identical mutant; if the sequencing result of a certain monoclonal cell is one and is consistent with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is a homozygous wild type.

The results of the IL2RG gene editing are shown in Table 1. The genotypes of the monoclonal cells numbered 26, 58, 64, 75, 83, 85 are biallelic and isomutant. The genotypes of the monoclonal cells numbered 16, 48 and 79 are biallelic different mutants. The genotype of the monoclonal cell numbered 66 was heterozygous. The monoclonal cells numbered 2, 6, 19, 27, 30, 37, 42, 55 and 80 all showed a complex set of peaks, and thus no effective sequence was obtained, and the genotype and specific form could not be determined, but it was judged that gene editing occurred. The obtained IL2RG gene edited monoclonal cells at a rate of 19/92. An exemplary sequencing peak profile for IL2RG is shown in figure 14.

Table 1 detection of IL2RG Gene Using primer set composed of IL2RG-nF33 and IL2RG-nR460

The compiled results of the RAG1 gene are shown in Table 2. The genotypes of the monoclonal cells numbered 6, 12, 19, 26, 27, 32, 37, 58, 64, 66, 81, 85 are biallelic and isogenic mutants. The genotypes of the monoclonal cells numbered 2, 16, 48, 75, 79, 80, 83 are biallelic different mutants. The genotype of the monoclonal cell numbered 47 was heterozygous. The monoclonal cells numbered 5, 22, 30, 31, 41, 55 and 73 all showed a complex set of peaks, and thus no valid sequence was obtained, and genotype and specific form could not be determined, but it was judged that gene editing occurred. The resulting RAG1 gene editing monoclonal cell ratio was 27/92. An exemplary sequencing peak plot for RAG1 is shown in figure 15.

TABLE 2 detection of the RAG1 gene using a primer pair consisting of RAG1-nF126 and RAG1-nR525

The compiled results of the RAG2 gene are shown in Table 3. The genotypes of the monoclonal cells numbered 16, 19, 26, 37, 48, 64, 66, 75, 79, 85 are biallelic and same mutant types. The genotypes of the monoclonal cells numbered 2, 80 and 83 are biallelic different mutants. The genotypes of the monoclonal cells numbered 5 and 73 were heterozygous. The monoclonal cells numbered 55, 58 and 61 all showed a complex set of peaks, and therefore no valid sequence was obtained, and genotype and specific form could not be determined, but it was judged that gene editing occurred. The resulting RAG2 gene editing monoclonal cell ratio was 18/92. An exemplary sequencing peak plot for RAG2 is shown in figure 16.

TABLE 3 detection of the RAG2 Gene Using a primer pair consisting of RAG2-nF138 and RAG2-nR600

Through analysis, the monoclonal cells with the numbers of 2, 16, 19, 26, 37, 48, 55, 58, 64, 66, 75, 79, 80, 83 and 85 are monoclonal cells with IL2RG, RAG1 and RAG2 genes knocked out simultaneously.

Example 6 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

Two gRNA targets located in the MSTN gene were selected:

target of MSTN-gRNA 1: 5'-GCTGATTGTTGCTGGTCCCG-3', respectively;

target of MSTN-gRNA 2: 5'-TTTCCAGGCGAAGTTTACTG-3' are provided.

Two gRNA targets located at FNDC5 gene were selected:

target of FNDC5-gRNA 1: 5'-TGTACTCAGTGTCCTCCTCC-3', respectively;

target of FNDC5-gRNA 2: 5'-GCTCTTCAAGACGCCTCGCG-3' are provided.

The primers used to amplify the fragment containing the target were:

MSTN-F896：5’-TCTCTCAGACAGTGCAGGCATTA-3’；

MSTN-R1351：5’-CGTTTCCGTCGTAGCGTGATAAT-3’。

FNDC5-F209：5’-CAGTTCTCACTTGATGGCCTTGG-3’；

FNDC5-R718：5’-AGGGGTCTGGGGAGGAATGG-3’。

firstly, preparing recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

MSTN-1S and MSTN-1A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule having the cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (MSTN-1).

MSTN-2S and MSTN-2A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (MSTN-2).

FNDC5-1S and FNDC5-1A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (FNDC 5-1).

FNDC5-2S and FNDC5-2A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (FNDC 5-2).

MSTN-1S：5’-caccGCTGATTGTTGCTGGTCCCG-3’；

MSTN-1A：5’-aaacCGGGACCAGCAACAATCAGC-3’。

MSTN-2S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’；

MSTN-2A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’。

FNDC5-1S：5’-caccgTGTACTCAGTGTCCTCCTCC-3’；

FNDC5-1A：5’-aaacGGAGGAGGACACTGAGTACAc-3’。

FNDC5-2S：5’-caccGCTCTTCAAGACGCCTCGCG-3’；

FNDC5-2A：5’-aaacCGCGAGGCGTCTTGAAGAGC-3’。

Secondly, the effect comparison of plasmid pX330 and plasmid pKG-GE3

1. Cotransfection

MSTN-B group: the plasmid pKG-U6gRNA (MSTN-1) and the plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-2).

MSTN-330 group: the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08. mu.g of plasmid pX 330.

MSTN-KG group: the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): plasmid 0.46. mu.g pKG-U6gRNA (MSTN-2): 1.08. mu.g of plasmid pKG-GE 3.

FNDC 5-group B: the plasmid pKG-U6gRNA (FNDC5-1) and the plasmid pKG-U6gRNA (FNDC5-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2).

FNDC5-330 group: the plasmid pKG-U6gRNA (FNDC5-1), the plasmid pKG-U6gRNA (FNDC5-2) and the plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08. mu.g of plasmid pX 330.

FNDC5-KG group: the plasmid pKG-U6gRNA (FNDC5-1), the plasmid pKG-U6gRNA (FNDC5-2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08. mu.g of plasmid pKG-GE 3.

3. After completion of step 2, the cells were digested with trypsin and collected, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of MSTN-F896 and MSTN-R1351 (three groups of MSTN), or a primer pair consisting of FNDC5-F209 and FNDC5-R718 (three groups of FNDC 5), followed by electrophoresis.

The results of three sets of MSTNs are shown in fig. 17.

The results of three sets of FNDC5 are shown in figure 18.

The gene deletion mutation efficiency of the MSTN-330 group is 27.6 percent, and the gene deletion mutation efficiency of the MSTN-KG group is 86.5 percent. The FNDC5-330 group gene deletion mutation efficiency is 18.6%, and the FNDC5-KG group gene deletion mutation efficiency is 81.7%. The results showed that the use of plasmid pKG-GE3 resulted in a significant improvement in gene editing efficiency compared to the use of plasmid pX 330.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Nanjing King Gene engineering Co., Ltd

<120> severe immunodeficiency swine-derived recombinant cell, and preparation method and kit thereof

<130> GNCYX202100

<160> 26

<170> PatentIn version 3.5

<210> 1

<211> 8484

<212> DNA

<213> Artificial sequence

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial sequence

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial sequence

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 1043

<212> PRT

<213> Sus scrofa

<400> 4

Met Ala Val Ser Leu Pro Pro Thr Leu Gly Leu Ser Ser Ala Pro Asp

1 5 10 15

Glu Ile Gln His Pro His Ile Lys Phe Ser Glu Trp Lys Phe Lys Leu

20 25 30

Phe Arg Val Arg Ser Phe Glu Lys Ala Pro Glu Lys Ala Gln Thr Glu

35 40 45

Lys Gln Asp Ser Ser Glu Gly Lys Pro Ser Leu Glu Gln Ser Pro Ala

50 55 60

Val Leu Asp Lys Pro Gly Gly Gln Lys Ser Ala Leu Pro Gln Pro Ala

65 70 75 80

Phe Lys Pro His Pro Lys Phe Leu Lys Glu Ser His Glu Asp Gly Lys

85 90 95

Ala Arg Asp Lys Ala Ile His Gln Ala Asn Leu Arg Arg Leu Cys Arg

100 105 110

Ile Cys Gly Asn Ser Phe Asn Thr Thr Gly His Lys Arg Arg Tyr Pro

115 120 125

Val His Gly Pro Val Asp Gly Lys Thr Gln Val Leu Leu Arg Lys Lys

130 135 140

Glu Lys Arg Ala Thr Ser Trp Pro Asp Leu Ile Ala Lys Val Phe Arg

145 150 155 160

Ile Asp Val Lys Ala Asp Val Asp Ser Ile His Pro Thr Glu Phe Cys

165 170 175

His Asn Cys Trp Ser Phe Met His Arg Lys Phe Ser Ser Thr Pro Cys

180 185 190

Glu Val Tyr Ser Pro Arg Asn Ala Thr Met Glu Trp His Pro His Thr

195 200 205

Leu Asn Cys Asp Ile Cys His Ile Ala Arg Arg Gly Leu Lys Arg Lys

210 215 220

Ser Gln Gln Pro Asn Met Gln Leu Ser Lys Lys Leu Lys Thr Val Ile

225 230 235 240

Asp Arg Ala Arg Gln Ala Arg Gln Arg Lys Arg Arg Ala Gln Ala Arg

245 250 255

Ile Ser Ser Lys Glu Leu Met Lys Lys Ile Ala Asn Cys Gly Gln Ile

260 265 270

His Leu Ser Pro Lys Leu Leu Ala Val Asp Phe Pro Ala His Phe Val

275 280 285

Lys Ser Ile Ser Cys Gln Ile Cys Glu His Ile Leu Ala Asp Pro Val

290 295 300

Glu Thr Ser Cys Lys His Val Phe Cys Arg Ile Cys Ile Leu Arg Cys

305 310 315 320

Leu Lys Val Met Gly Ser Ser Cys Pro Ser Cys His Tyr Pro Cys Phe

325 330 335

Pro Thr Asp Leu Glu Ser Pro Val Lys Ser Phe Leu Ser Ile Leu Asn

340 345 350

Thr Leu Met Val Lys Cys Pro Ala Lys Glu Cys Asn Glu Glu Ile Ser

355 360 365

Leu Glu Lys Tyr Asn His His Ile Ser Ser His Lys Glu Ser Lys Glu

370 375 380

Thr Phe Val His Ile Asn Lys Gly Gly Arg Pro Arg Gln His Leu Leu

385 390 395 400

Ser Leu Thr Arg Arg Ala Gln Lys His Arg Leu Arg Glu Leu Lys Leu

405 410 415

Gln Val Lys Ala Phe Ala Asp Lys Glu Glu Gly Gly Asp Val Lys Ser

420 425 430

Val Cys Leu Thr Leu Phe Leu Leu Val Leu Arg Ala Arg Asn Glu His

435 440 445

Arg Gln Ala Asp Glu Leu Glu Ala Ile Met Arg Gly Gln Gly Ser Gly

450 455 460

Leu Gln Pro Ala Val Cys Leu Ala Ile Arg Val Asn Thr Phe Leu Ser

465 470 475 480

Cys Ser Gln Tyr His Lys Met Tyr Arg Thr Val Lys Ala Ile Thr Gly

485 490 495

Arg Gln Ile Phe Gln Pro Leu His Ala Leu Arg Asn Ala Glu Lys Val

500 505 510

Leu Leu Pro Gly Tyr His Pro Phe Glu Trp Gln Pro Pro Leu Lys Asn

515 520 525

Val Ser Ser Ser Thr Asp Val Gly Ile Ile Asp Gly Leu Ser Gly Leu

530 535 540

Ser Ser Ser Val Asp Asp Tyr Pro Val Asp Thr Ile Ala Lys Arg Phe

545 550 555 560

Arg Tyr Asp Ser Ala Leu Val Ser Ala Leu Met Asp Met Glu Glu Asp

565 570 575

Ile Leu Glu Gly Met Arg Ala Gln Asp Leu Asp Asp Tyr Leu Asn Gly

580 585 590

Pro Phe Thr Val Val Val Lys Glu Ser Cys Asp Gly Met Gly Asp Val

595 600 605

Ser Glu Lys His Gly Ser Gly Pro Val Val Pro Glu Lys Ala Val Arg

610 615 620

Phe Ser Phe Thr Val Met Lys Ile Thr Ile Ala His Gly Ser Gln Asn

625 630 635 640

Val Lys Val Phe Glu Glu Ala Lys Pro Asn Ser Glu Leu Cys Cys Lys

645 650 655

Pro Leu Cys Leu Met Leu Ala Asp Glu Ser Asp His Glu Thr Leu Thr

660 665 670

Ala Ile Leu Ser Pro Leu Ile Ala Glu Arg Glu Ala Met Lys Ser Ser

675 680 685

Gln Leu Met Leu Glu Met Gly Gly Ile Leu Arg Thr Phe Lys Phe Ile

690 695 700

Phe Arg Gly Thr Gly Tyr Asp Glu Lys Leu Val Arg Glu Val Glu Gly

705 710 715 720

Leu Glu Ala Ser Gly Ser Val Tyr Ile Cys Thr Leu Cys Asp Ala Thr

725 730 735

Arg Leu Glu Ala Ser Gln Asn Leu Val Phe His Ser Ile Thr Arg Ser

740 745 750

His Ala Glu Asn Leu Glu Arg Tyr Glu Val Trp Arg Ser Asn Pro Tyr

755 760 765

His Glu Thr Val Asp Glu Leu Arg Asp Arg Val Lys Gly Val Ser Ala

770 775 780

Lys Pro Phe Ile Glu Thr Val Pro Ser Ile Asp Ala Leu His Cys Asp

785 790 795 800

Ile Gly Asn Ala Ala Glu Phe Tyr Lys Ile Phe Gln Leu Glu Ile Gly

805 810 815

Glu Ala Tyr Lys Asn Pro His Ala Ser Lys Glu Glu Arg Lys Arg Trp

820 825 830

Gln Ala Thr Leu Asp Lys His Leu Arg Lys Lys Met Asn Leu Lys Pro

835 840 845

Ile Met Arg Met Asn Gly Asn Phe Ala Arg Lys Leu Met Thr Lys Glu

850 855 860

Thr Val Glu Ala Val Cys Glu Leu Ile Pro Ser Glu Glu Arg His Glu

865 870 875 880

Ala Leu Arg Glu Leu Met Asp Leu Tyr Leu Lys Met Lys Pro Val Trp

885 890 895

Arg Ser Ser Cys Pro Ala Lys Glu Cys Pro Glu Ser Leu Cys Gln Tyr

900 905 910

Ser Phe Asn Ser Gln Arg Phe Ala Glu Leu Leu Ser Thr Lys Phe Lys

915 920 925

Tyr Arg Tyr Glu Gly Lys Ile Thr Asn Tyr Phe His Lys Thr Leu Ala

930 935 940

His Val Pro Glu Ile Ile Glu Arg Asp Gly Ser Ile Gly Ala Trp Ala

945 950 955 960

Ser Glu Gly Asn Glu Ser Gly Asn Lys Leu Phe Arg Arg Phe Arg Lys

965 970 975

Met Asn Ala Arg Gln Ser Lys Tyr Tyr Glu Met Glu Asp Val Leu Lys

980 985 990

His His Trp Leu Tyr Thr Ser Lys Tyr Leu Gln Lys Phe Met Asn Ala

995 1000 1005

His Lys Ala Phe Lys Asn Ser Gly Phe Thr Ile Asn Leu Gln Arg

1010 1015 1020

Ser Ser Gly Asp Thr Leu Asp Leu Glu Asn Ser Pro Glu Ser Gln

1025 1030 1035

Asp Leu Met Glu Phe

1040

<210> 5

<211> 3132

<212> DNA

<213> Sus scrofa

<400> 5

atggctgtct ctttgccacc cactctggga ctcagttccg ccccagatga aatccagcac 60

ccccacatta aattttcaga atggaagttt aagctattca gggtgagatc ctttgaaaag 120

gcacctgaaa aggctcaaac ggaaaagcag gattcctccg aggggaaacc ctcgctggag 180

caatctccag cagtcctgga caagcctggt ggtcagaagt cagccctgcc tcaaccagca 240

ttcaagcccc atccaaagtt tttaaaggaa tcccacgaag atgggaaagc aagagacaaa 300

gccatccacc aagccaacct gagacgtctc tgccgcatct gtgggaattc tttcaacacc 360

actgggcaca agagaaggta tccagtccac gggcctgtgg atggtaaaac ccaagtcctt 420

ttacggaaga aggaaaagag ggccacgtcc tggccagacc tcattgccaa agttttccgg 480

atcgatgtga aggcagatgt tgactcgatc caccccactg agttctgcca taactgctgg 540

agcttcatgc acaggaagtt tagcagcacc ccatgtgagg tttactcccc aaggaatgca 600

accatggagt ggcaccccca caccctaaac tgtgacatct gccacattgc acgtcgggga 660

ctcaagagga agagtcagca gccaaacatg cagctcagca aaaaactcaa aactgtgatt 720

gaccgagcga gacaagcccg tcagcgcaag aggagagctc aggccaggat cagcagcaag 780

gaactgatga agaagatcgc caactgcggt cagatacatc ttagccccaa gctcctggca 840

gtggacttcc cggcgcactt tgtgaaatct atctcctgcc agatttgtga acacatcctg 900

gccgacccgg tggagaccag ctgcaagcac gtgttttgca ggatctgcat tctcaggtgc 960

ctcaaagtca tgggcagcag ttgtccctct tgccactatc cctgtttccc tactgacctg 1020

gagagtccag tgaagtcttt tctgagcatc ttgaataccc tgatggtgaa atgcccagca 1080

aaggagtgca acgaggagat cagcttggaa aaatataatc accatatctc aagccacaag 1140

gagtcgaagg agacatttgt gcatattaat aaagggggcc ggccccgcca gcatctcctg 1200

tccctgacgc ggagggctca gaaacaccgt ctgagggagc tcaagctgca agtcaaggcc 1260

ttcgccgaca aagaagaagg tggcgacgtg aagtcagtgt gcctgacctt gttcctgcta 1320

gtgctgaggg cgaggaatga gcacagacaa gctgacgagc tggaggccat catgcgaggc 1380

cagggttccg gcctgcagcc tgctgtttgc ttggccatcc gcgtcaacac cttcctcagc 1440

tgcagccagt accacaagat gtacaggact gtgaaggcca tcacgggcag gcagattttc 1500

cagcctttgc atgcccttcg gaatgcggag aaggtccttc tgcccggcta ccaccccttc 1560

gagtggcagc cacctctgaa gaatgtgtct tccagcacgg acgtgggcat tattgatggg 1620

ctgtctggac tctcctcctc tgtggacgat tacccagtgg acaccattgc caagcgcttc 1680

cgctatgact cggctctggt gtccgctctc atggacatgg aagaagacat cctggagggt 1740

atgagagccc aagaccttga cgactacctg aatggcccct tcactgtggt ggtgaaggag 1800

tcttgtgatg ggatgggaga cgtgagtgag aagcacggca gtgggccggt cgtgccggaa 1860

aaggccgttc ggttttcctt cacagtcatg aaaatcacca tcgcacacgg gtcacagaac 1920

gtgaaggtgt ttgaggaagc caagcctaac tctgaactat gctgcaagcc cttgtgcctc 1980

atgctggccg acgaatccga ccatgagacc ctgacggcca tcctgagccc tctcattgcc 2040

gagagggagg ccatgaagag cagccagcta atgctggaga tgggaggcat cctccggact 2100

ttcaagttca tcttcagggg caccggatat gatgagaaac tggtccggga agtggaaggc 2160

cttgaggctt ctggctctgt ctacatctgt actctctgtg atgccacccg cctggaagcc 2220

tctcaaaatc tggtcttcca ctccataacc agaagccacg cggagaattt ggagcgctat 2280

gaggtctggc gttccaaccc ataccatgag acggtggatg aacttcggga ccgggtgaaa 2340

ggggtctcgg ccaaaccctt cattgagacg gtgccttcca tagatgccct ccactgtgac 2400

attggcaatg cagccgagtt ctacaagatt ttccagctcg agatagggga ggcgtataag 2460

aacccccatg cctccaagga ggaaaggaag agatggcagg cgaccttgga caagcacctc 2520

cgcaagaaga tgaatctgaa gcccatcatg aggatgaatg gcaactttgc caggaagctc 2580

atgaccaaag agactgtgga agcagtctgt gagttaattc cctccgagga gaggcatgaa 2640

gctctgaggg aactgatgga cctttacctg aagatgaaac ccgtctggcg atcgtcatgc 2700

cctgctaaag agtgcccgga atccctctgc cagtatagtt tcaattcgca gcgttttgct 2760

gagctcctct ccaccaagtt caagtacaga tatgagggca aaatcaccaa ttattttcac 2820

aagacactgg cccacgtccc ggaaattatc gagagggacg gctccattgg ggcatgggct 2880

agcgagggaa atgagtctgg gaacaagctg ttcaggcgct tccgaaaaat gaatgccagg 2940

cagtccaagt actatgaaat ggaagatgtt ttgaaacatc actggttgta cacctccaaa 3000

tacctgcaga agtttatgaa tgctcataaa gcatttaaaa actcagggtt taccataaac 3060

ttgcagagaa gttcagggga cacattagac ctagagaact ctccagaatc tcaagatttg 3120

atggaatttt aa 3132

<210> 6

<211> 100

<212> RNA

<213> Artificial sequence

<400> 6

gggaauucuu ucaacaccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 7

<211> 100

<212> RNA

<213> Artificial sequence

<400> 7

agagaaggua uccaguccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 8

<211> 100

<212> RNA

<213> Artificial sequence

<400> 8

aaugaggucu ggccaggacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 9

<211> 100

<212> RNA

<213> Artificial sequence

<400> 9

aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 10

<211> 527

<212> PRT

<213> Sus scrofa

<400> 10

Met Ser Leu Gln Met Ile Thr Val Gly Asn Asn Met Ala Leu Ile Gln

1 5 10 15

Pro Gly Phe Ser Leu Met Asn Phe Asp Gly Gln Ile Phe Phe Phe Gly

20 25 30

Gln Lys Gly Trp Pro Lys Arg Ser Cys Pro Thr Gly Val Phe His Phe

35 40 45

Asp Val Lys His Asn His Leu Lys Leu Lys Pro Ala Leu Phe Ser Lys

50 55 60

Asp Ser Cys Tyr Leu Pro Pro Leu Arg Tyr Pro Ala Thr Cys Thr Phe

65 70 75 80

Lys Ser Ser Leu Glu Ser Glu Lys His Gln Tyr Ile Ile His Gly Gly

85 90 95

Lys Thr Pro Asn Asn Glu Leu Ser Asp Lys Ile Tyr Val Met Ser Val

100 105 110

Val Cys Lys Asn Asn Lys Lys Val Thr Phe Arg Cys Arg Glu Lys Asp

115 120 125

Leu Val Gly Asp Val Pro Glu Gly Arg Tyr Gly His Ser Ile Asp Val

130 135 140

Val Tyr Ser Arg Gly Lys Ser Met Gly Val Leu Phe Gly Gly Arg Ser

145 150 155 160

Tyr Ile Pro Ser Ala Gln Arg Thr Thr Glu Lys Trp Asn Ser Val Ala

165 170 175

Asp Cys Leu Pro His Ile Phe Leu Val Asp Phe Glu Phe Gly Cys Ser

180 185 190

Thr Ser Tyr Ile Leu Pro Glu Leu Gln Asp Gly Leu Ser Phe His Val

195 200 205

Ser Ile Ala Arg Asn Asp Thr Ile Tyr Ile Leu Gly Gly His Ser Leu

210 215 220

Ala Asn Asn Ile Arg Pro Ala Asn Leu Tyr Lys Ile Arg Val Asp Leu

225 230 235 240

Pro Leu Gly Ser Pro Ala Val Thr Cys Thr Val Leu Pro Gly Gly Ile

245 250 255

Ser Val Ser Ser Ala Ile Leu Thr Gln Thr Ser Ser Asp Glu Phe Val

260 265 270

Ile Val Gly Gly Tyr Gln Leu Glu Asn Gln Lys Arg Met Val Cys Asn

275 280 285

Ile Ile Ser Phe Lys Asp Asn Lys Ile Gly Ile His Glu Met Glu Thr

290 295 300

Pro Asp Trp Thr Pro Asp Ile Lys His Ser Lys Ile Trp Phe Gly Ser

305 310 315 320

Asn Met Gly Asn Gly Thr Val Phe Leu Gly Ile Pro Gly Asp Asn Lys

325 330 335

Gln Ala Leu Ser Glu Ala Phe Tyr Phe Tyr Thr Leu Lys Cys Thr Glu

340 345 350

Asp Asp Val Asn Glu Asp Gln Lys Thr Phe Thr Asn Ser Gln Thr Ser

355 360 365

Thr Glu Asp Pro Gly Asp Ser Thr Pro Phe Glu Asp Ser Glu Glu Phe

370 375 380

Cys Phe Ser Ala Glu Ala Asn Ser Phe Asp Gly Asp Asp Glu Phe Asp

385 390 395 400

Thr Tyr Asn Glu Asp Asp Glu Glu Asp Glu Ser Glu Thr Gly Tyr Trp

405 410 415

Ile Thr Cys Cys Pro Thr Cys Asp Met Asp Ile Asn Thr Trp Val Pro

420 425 430

Phe Tyr Ser Thr Glu Leu Asn Lys Pro Ala Met Ile Tyr Cys Ser His

435 440 445

Gly Asp Gly His Trp Val His Ala Gln Cys Met Asp Leu Ala Glu His

450 455 460

Thr Leu Ile His Leu Ser Glu Gly Ser Ser Lys Tyr Tyr Cys Lys Glu

465 470 475 480

His Val Glu Ile Ala Arg Ala Leu Gln Thr Pro Lys Arg Val Leu Pro

485 490 495

Leu Lys Lys Pro Pro Leu Lys Ser Leu His Lys Lys Gly Ser Gly Lys

500 505 510

Ile Ile Thr Pro Ala Lys Lys Ser Phe Leu Arg Arg Leu Phe Asp

515 520 525

<210> 11

<211> 2584

<212> DNA

<213> Sus scrofa

<400> 11

tctacgtcag ccattctcac ctcccattcc ctagtttttc gccttggctt ccatctagtc 60

acttcgcact cttggcgtct ttattcagag agactcttaa agacttcttt cctggggcaa 120

taaagacaaa ctctgtagcc acacatccca tagagaatgg attcctggga aatgtagttc 180

tttctgggga caagtggtta gtctttaagg gaaaaggact acagttccca gaaatctaag 240

ggaggccagt ccacgtctta aacttgtccc agctgcatgg attgtattag gcaggaaggt 300

tctgtggcgt tttctttacc cagctgcctg gatttttgct aattcaatcc cactacaagc 360

ttgtggaaca actctctttt tttaacaggc tttttatgtg tgagggatct aaacacagtg 420

attttaatga agagatatag taagttaaaa aatgtttttt aattctttca gataaaaaaa 480

gagctaccca ctgtcagaaa atgtcactac agatgataac agttggtaat aacatggcct 540

taattcagcc aggcttctca ttgatgaatt ttgatgggca aatcttcttc tttggccaaa 600

aaggctggcc caagaggtcc tgccccactg gagtttttca ttttgatgta aagcataacc 660

atctcaaact gaagcctgca cttttctcta aggattcctg ctaccttcct cctctccgct 720

acccagccac ttgcacattc aaaagcagct tagagtctga aaaacatcag tacatcatcc 780

atggagggaa aacaccaaat aatgagcttt cggataagat ttatgtcatg tctgtggttt 840

gcaagaacaa caaaaaagtt acttttcgct gcagagagaa agacttggta ggagatgttc 900

ctgaaggcag atatggtcat tccattgatg tcgtgtatag tcgagggaaa agtatgggtg 960

ttctctttgg aggacggtca tacatccctt ctgctcaaag aaccacagaa aaatggaata 1020

gtgtagctga ctgcctgccc cacattttct tggtagattt tgaatttggt tgctctacat 1080

catacattct tccagaactt caagatgggc tatcttttca tgtctccatt gccagaaatg 1140

ataccattta tattttagga ggacactcac ttgccaataa catccgtcct gccaatctat 1200

ataaaataag ggttgatctc cccctgggta gcccagctgt gacttgcaca gtcctgccag 1260

gaggaatctc tgtctccagt gcaatcctga ctcaaacgag cagtgatgaa tttgttattg 1320

ttggtggcta tcagcttgaa aatcaaaaaa gaatggtctg caacatcatc tctttcaagg 1380

acaacaagat aggaattcat gagatggaaa ctccagattg gaccccagat attaagcaca 1440

gcaagatatg gtttggaagc aacatgggaa atggaaccgt tttccttggc ataccaggag 1500

acaataaaca ggctctttca gaagcattct atttctatac attgaaatgt actgaagacg 1560

atgtgaacga agatcaaaaa acattcacaa atagtcagac atcaacagaa gatccagggg 1620

actccactcc ctttgaagac tcagaagaat tttgtttcag tgcagaagca aatagttttg 1680

atggtgatga tgaatttgac acctataacg aagatgatga ggaagatgag tctgagacgg 1740

gctactggat tacatgctgc cctacttgtg atatggatat caacacttgg gtaccatttt 1800

attcaactga gctcaacaaa cctgccatga tctactgctc tcatggagat gggcattggg 1860

tccatgccca gtgcatggat ctggcagaac acacactcat ccatctgtca gaaggaagca 1920

gcaagtatta ctgcaaggag catgtggaga tagcaagagc actgcaaacc cccaaaagag 1980

ttttaccctt aaaaaagcct ccactgaaat ccctccacaa aaaaggttct gggaaaatta 2040

ttacccctgc caagaaatcc tttcttagaa gattattcga ttagtttcac aaaagctttt 2100

ctgatccaag tgcatcaggt ttttaaacat attttcaaga atcctgacaa tgataaaaat 2160

tatattctta tttttgttat tgaaaatatc tgttttcttt tagttatatg aattaagttc 2220

cagagaaaag tcttataatg caatacaaaa tacagtcatt gtgtttagac ttatatagga 2280

cctataatat tttgaaaatt ctttactcaa aggatcttca gtgagtattt ttgatctgaa 2340

tttctttgtt caaggaatgt tcaacactga gacagtagta ataactaatg tatgcttatg 2400

tccattatat gactttcggt aacaaataat ctatagaata gttgagacaa gtttaaacag 2460

tagagaaact aagagctaaa ggaattaaag gaattctttt gcatgatgta gcaatttggt 2520

tgatgttgct tgatgctgta actccaacat ggccctttgg ttatgcccat gtacagaaaa 2580

agct 2584

<210> 12

<211> 100

<212> RNA

<213> Artificial sequence

<400> 12

ucacuacaga ugauaacagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial sequence

<400> 13

gauaacaguu gguaauaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 100

<212> RNA

<213> Artificial sequence

<400> 14

gugcaggcuu caguuugaga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 100

<212> RNA

<213> Artificial sequence

<400> 15

caaguggcug gguagcggag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 16

<211> 368

<212> PRT

<213> Sus scrofa

<400> 16

Met Leu Lys Pro Pro Leu Pro Val Lys Ser Leu Leu Phe Leu Gln Leu

1 5 10 15

Pro Leu Leu Gly Val Gly Leu Asn Pro Lys Val Leu Thr His Ser Gly

20 25 30

Asn Glu Asp Ile Thr Ala Asp Phe Leu Leu Leu Ser Thr Pro Pro Gly

35 40 45

Thr Leu Asn Val Ser Thr Leu Pro Leu Pro Lys Val Gln Cys Phe Val

50 55 60

Phe Asn Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Leu

65 70 75 80

Gln Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Thr Ser Asn Asp

85 90 95

Asp Lys Val Gln Glu Cys Gly His Tyr Leu Phe Ser Glu Gly Ile Thr

100 105 110

Ser Gly Cys Trp Phe Gly Lys Glu Glu Ile Arg Leu Tyr Gln Thr Phe

115 120 125

Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg Arg Gln Asp Pro Gln

130 135 140

Thr Leu Lys Leu Gln Asp Leu Val Ile Pro Trp Ala Pro Ala Asn Leu

145 150 155 160

Thr Leu Arg Thr Leu Ser Glu Ser Gln Leu Glu Leu Asn Trp Ser Asn

165 170 175

Arg Tyr Leu Asp His Cys Leu Glu His Leu Val Gln Tyr Arg Ser Asp

180 185 190

Arg Asp Arg Ser Trp Thr Glu Gln Ser Val Asp His Arg Gln Ser Phe

195 200 205

Ser Leu Pro Ser Val Asp Ala Gln Lys Leu Tyr Thr Phe Arg Val Arg

210 215 220

Ser Arg Tyr Asn Pro Leu Cys Gly Ser Ala Gln Arg Trp Ser Asp Trp

225 230 235 240

Ser His Pro Ile His Trp Gly Asn Thr Ser Lys Glu Asn Pro Leu Leu

245 250 255

Phe Ala Leu Glu Ala Val Leu Ile Pro Leu Gly Ser Met Gly Leu Ile

260 265 270

Val Gly Leu Met Cys Val Tyr Cys Trp Leu Glu Arg Thr Met Pro Arg

275 280 285

Ile Pro Thr Leu Lys Asn Leu Glu Asp Leu Val Thr Glu Tyr His Gly

290 295 300

Asn Phe Ser Ala Trp Ser Gly Val Ser Lys Gly Leu Ala Glu Ser Leu

305 310 315 320

Gln Pro Asp Tyr Ser Glu Arg Leu Cys His Val Ser Glu Ile Ser Pro

325 330 335

Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Gly Ser Pro Cys Ser Gln

340 345 350

His Ser Pro Tyr Trp Ala Pro Pro Cys Tyr Thr Leu Lys Pro Glu Thr

355 360 365

<210> 17

<211> 1185

<212> DNA

<213> Sus scrofa

<400> 17

aaattttaga gtactggggg gagggcaagg ggaagggttc cctgcctagt gctgcttctt 60

cttctgacca tcatgtcttc cctttgcctc ccccacttca ttttctcccc gtcctagatt 120

tcctcctgct ctctacaccc cctgggactc tcaacgtttc cactctaccc ctcccaaagg 180

ttcagtgttt tgtgttcaat gttgagtaca tgaattgcac ttggaacagc agctctgagc 240

tccagcctac caacctaact ctgcactact ggtatgagaa gggaagaggg gatatagcac 300

aggggaggga ggaagaggcg ctgggctaga tgtgagagat tgtgtgagga ccaagaaaga 360

ggttagccag catcccaggc ttcccactat attctcgtgg ggtaagtcat aagtcagttc 420

gtaggagctg aggctggact gtggaatctg tggtattcac atttacctca ctgttattct 480

tccttgaaat ccttctctag gtacaagacc tctaatgatg ataaagtcca ggagtgtggc 540

cactatctat tctctgaagg gatcacttct ggctgttggt ttggaaaaga ggagatccgc 600

ctctaccaaa catttgttgt ccagctccag gacccacggg aacccaggag gcaggaccca 660

cagacgctaa aactacagga tctgggtaat ttggaaatgg ggagggtcaa gggatattgt 720

gggggtattg gtgtatgtag agtggtattc ttgcaccata agggtacttg ggcagaaaag 780

aagaagtgag ggatccaatg gggtcgggag gagggatcag gagcactgcc ctcaggatcc 840

tgacttgtct aggccagggg aatgaccaca cacgcacaca tatctccagt gatcccctgg 900

gcgccggcga atctgaccct tcgcaccctg agtgaatccc agctagaact cagctggagc 960

aaccgatact tggaccactg tttggagcac ctcgtgcaat accggagtga ccgggaccgc 1020

agctggactg tgagtgagtg ggaacagcag ctggggctga gcaagtgggg ataaaggatt 1080

caatcagtcc agtaggaagg cttgattccc agctcctatt ctctgcatcc tggtgcctct 1140

gcccaccttc tcccctcctt ggactccttt ctctgtcgtc accat 1185

<210> 18

<211> 100

<212> RNA

<213> Artificial sequence

<400> 18

ccuguaguuu uagcgucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 19

<211> 100

<212> RNA

<213> Artificial sequence

<400> 19

caacaaaugu uugguagagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 20

<211> 100

<212> RNA

<213> Artificial sequence

<400> 20

gaugauaaag uccaggagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 21

<211> 100

<212> RNA

<213> Artificial sequence

<400> 21

cuggacuuua ucaucauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 22

<211> 100

<212> RNA

<213> Artificial sequence

<400> 22

uuguccagcu ccaggaccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 23

<211> 100

<212> RNA

<213> Artificial sequence

<400> 23

ggccacuauc uauucucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 24

<211> 100

<212> RNA

<213> Artificial sequence

<400> 24

ucccuucaga gaauagauag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 25

<211> 100

<212> RNA

<213> Artificial sequence

<400> 25

aacauuuguu guccagcucc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 26

<211> 100

<212> RNA

<213> Artificial sequence

<400> 26

uguccagcuc caggacccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

63页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：CRISPR系统及其在构建LRP5基因突变的骨质疏松症克隆猪核供体细胞中的应用

Severe immunodeficiency swine-derived recombinant cell and preparation method and kit thereof

相关技术

网友询问留言