阅读说明：本技术 Crispr系统及其在构建lrp5基因突变的骨质疏松症克隆猪核供体细胞中的应用 (CRISPR system and application thereof in construction of LRP5 gene mutant osteoporosis clone porcine nuclear donor cell ) 是由 牛冬 汪滔 陶裴裴 曾为俊 王磊 程锐 马翔 赵泽英 刘璐 黄彩云 于 2020-10-28 设计创作，主要内容包括：本发明公开了一种CRISPR/Cas9系统及其在构建LRP5基因突变的骨质疏松症克隆猪核供体细胞中的应用。一种用于猪LRP5基因编辑的CRISPR/Cas9系统,包含Cas9表达载体和针对猪LRP5基因的gRNA表达载体；所述的Cas9表达载体为质粒全序列如SEQ ID NO.1所示的pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO。采用本发明筛选的gRNA联合改造的Cas9高效表达载体进行基因编辑,编辑效率比原载体提高100％以上。本发明为骨质疏松症猪模型的制备奠定了坚实的基础,将有助于该病的治疗及发病机制研究。(The invention discloses a CRISPR/Cas9 system and application thereof in construction of LRP5 gene mutated osteoporosis clone pig nuclear donor cells. A CRISPR/Cas9 system for porcine LRP5 gene editing comprising a Cas9 expression vector and a gRNA expression vector for porcine LRP5 gene; the Cas9 expression vector is pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO with the complete sequence of the plasmid shown as SEQ ID NO. 1. The gene editing is carried out by adopting the Cas9 high-efficiency expression vector jointly modified by the gRNA screened by the invention, and the editing efficiency is improved by more than 100 percent compared with that of the original vector. The invention lays a solid foundation for the preparation of the osteoporosis pig model, and is beneficial to the treatment of the osteoporosis pig model and the research of pathogenesis.)

1. A CRISPR/Cas9 system for porcine LRP5 gene editing, characterized by comprising a Cas9 expression vector and a gRNA expression vector for porcine LRP5 gene; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector with the complete sequence of the plasmid shown as SEQ ID NO. 1.

2. The CRISPR/Cas9 system according to claim 1, characterized in that the vector backbone of gRNA expression vector for pig LRP5 gene is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

3. The CRISPR/Cas9 system according to claim 2, characterized in that the expression vector expresses the gRNA shown in SEQ ID No.28, whose target is shown in SEQ ID No. 16.

4. The CRISPR/Cas9 system according to claim 3, characterized in that the gRNA expression vector for pig LRP5 gene contains gRNA sequence for target site, the gRNA sequence is formed by annealing single-stranded DNA shown in SEQ ID No.20 and single-stranded DNA shown in SEQ ID No. 21.

5. The CRISPR/Cas9 system according to claim 4, characterized in that the molar ratio of the gRNA expression vector to the Cas9 expression vector is 1-3: 1, further preferably 3: 1.

6. Use of the CRISPR/Cas9 system of claim 5 in the construction of LRP5 gene mutated porcine recombinant cells.

7. A recombinant cell characterized by being obtained by co-transfecting porcine primary fibroblasts with the CRISPR/Cas9 system of claim 6 after validation.

8. Use of the recombinant cell of claim 7 in the construction of a cloned pig with an LRP5 gene knockout.

9. The gRNA sequence aiming at the pig LRP5 gene target site is characterized by being formed by annealing a single-stranded DNA shown in SEQ ID NO.20 and a single-stranded DNA shown in SEQ ID NO. 21.

10. A gRNA expression vector for a pig LRP5 gene, which is characterized in that the expression vector expresses a gRNA shown in SEQ ID No. 23; and the vector framework of the expression vector is pKG-U6gRNA, and the complete sequence of the plasmid is shown in SEQ ID NO. 3.

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a CRISPR/cas9 system and application thereof in construction of LRP5 gene mutant osteoporosis clone porcine nuclear donor cells.

Background

Osteoporosis (OP) is caused by an imbalance between bone resorption and bone formation, a systemic metabolic disease of bone characterized by low bone mass and microstructural destruction of bone tissue, increased bone fragility and susceptibility to fracture. Modern medicine classifies osteoporosis into three major categories, primary, secondary and idiopathic osteoporosis. Primary osteoporosis is a sudden decrease in sex hormones in the body and a physiological degenerative change due to age, and is classified into type i postmenopausal osteoporosis and type ii senile osteoporosis. Secondary osteoporosis is induced by diseases or drug factors, such as endocrine metabolic diseases (diabetes, hyperthyroidism), kidney diseases, liver diseases and the like, and drug induction such as application of heparin, immunosuppressant, antiepileptic drug and glucocorticoid with long-term large dose. Idiopathic osteoporosis is generally accompanied by a history of genetic diseases, is common in women, and is often classified as osteoporosis in lactation and pregnancy of women.

Bone is a dynamic, constantly changing tissue, with approximately 10% of the bone being renewed each year, i.e. the dynamic balance between bone resorption and bone remodeling is cyclically repeated. The large-scale epidemiological investigation research in China shows that the total disease rate of osteoporosis in China is 12.4 percent, and the total number of people exceeds 1.6 hundred million. The medical experts found through the study of the genetic information of the osteoporosis-pseudoglioma syndrome family that the bone density of individuals carrying the mutated LRP5 gene but not affected in this syndrome family was significantly lower than that of normal persons. LRP5 (low-density lipoprotein receptor-related protein 5) belongs to the family of low-density lipoprotein receptors, plays an important role in the Wnt/beta-catenin signaling pathway, and is closely related to bone remodeling. Further studies have shown that LRP5 influences bone density by participating in regulating osteoblast growth and differentiation, regulating bone metabolism. The results of research show that LRP5 gene mutation is closely related to osteoporosis. Therefore, constructing an osteoporosis animal model based on LRP5 gene mutation provides a powerful experimental tool for researching and treating human osteoporosis. The pig is a large animal, is a main meat food supply animal for human for a long time, is easy to breed and feed in a large scale, has lower requirements on ethics, animal protection and the like, has the body size and the physiological function similar to those of human, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been under significant development in recent years, including injection from embryonic stem cells based on homologous recombination into nuclease-based ZFNs, TALENs, CRISPR/Cas9, etc., with CRISPR/Cas9 being the currently most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models. For example, in the method of embryo transplantation after injecting gene editing material into fertilized ovum in mouse model making, because the probability of directly obtaining homozygous mutant offspring is very low (less than 5%), it needs to cross and breed offspring, which is not suitable for making model of large animal (such as pig) with long gestation period.

Disclosure of Invention

The present invention aims to provide a gRNA of the porcine LRP5 gene and a gRNA expression vector, which address the above-mentioned deficiencies of the prior art.

Another object of the invention is to provide a CRISPR/Cas9 system for porcine LRP5 gene editing.

The invention also aims to provide application of the CRISPR/Cas9 system in construction of the LRP5 gene mutant porcine recombinant cell.

The purpose of the invention can be realized by the following technical scheme:

a CRISPR/Cas9 system for porcine LRP5 gene editing comprising a Cas9 expression vector and a gRNA expression vector for porcine LRP5 gene; the Cas9 expression vector is a plasmid complete sequence shown as SEQ ID NO: 1, and pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE3 for short).

In order to increase the gene editing capacity of the Cas9 Plasmid, pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE3 for short) is obtained by modifying pX330-U6-Chimeric _ BB-CBh-hSpCas9 (PX 330 for short) on the basis of an addge (Plasmid #42230, from Zhang Feng lab) vector. The map of PX330 is shown in FIG. 1, and the modification mode is as follows:

1) removing redundant invalid sequences in the original vector gRNA framework;

2) modifying a promoter: the original promoter (chicken beta-actin promoter) is transformed into an EF1a promoter with higher expression activity, and the protein expression capacity of the Cas9 gene is increased;

3) increase of nuclear localization signal: a nuclear localization signal coding sequence (NLS) is added at the N end and the C end of the Cas9, and the nuclear localization capability of the Cas9 is increased;

4) adding double screening marks: the original vector does not have any screening marker, is not beneficial to screening and enriching of positive transformed cells, and is inserted with P2A-EGFP-T2A-PURO at the C end of Cas9 to endow the vector with fluorescence and resistance screening capability;

5) inserting WPRE and 3' LTR and other sequences for regulating gene expression: the protein translation capability of the Cas9 gene can be enhanced by inserting WPRE, 3' LTR and other sequences in the reading frame of the gene.

The modified vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE3 for short) and the modified site are shown in figure 2, and the whole sequence of the plasmid is shown in SEQ ID NO: 1 is shown in the specification; the main elements of pKG-GE3 are:

1) gRNA expression elements: u6gRNA scaffold;

2) a promoter: the EF1a promoter and CMV enhancer;

3) cas9 gene containing multiple NLS: a Cas9 gene containing N-terminal and C-terminal multinuclear localization signals (NLS);

4) screening for marker genes: the fluorescent and resistant double-selection marker element P2A-EGFP-T2A-PURO;

5) elements that enhance translation: WPRE and 3' LTR enhance the translation efficiency of Cas9 and the screening marker gene;

6) transcription termination signal: a bGH polyA signal;

7) carrier skeleton: including Amp resistance elements and ori replicons, among others.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two Nuclear Localization Signals (NLS), Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A, resistance selection marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in the following order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be Puromycin protein.

The amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The amino acid sequence of self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The specific fusion gene is specifically shown as SEQ ID NO: nucleotide No. 911-6706 in 1.

The CMV enhancer is as set forth in SEQ ID NO: 1 at nucleotide 395-680.

The EF1a promoter is shown as SEQ ID NO: nucleotide 682-890 in 1.

The WPRE sequence element is shown as SEQ ID NO: 1 at nucleotide 6722 and 7310.

The 3' LTR sequence element is shown in SEQ ID NO: nucleotide 7382-7615 in 1.

The bGH poly (a) signal sequence element is as set forth in SEQ ID NO: 1 as shown by nucleotide 7647-7871.

Preferably, the vector framework of the gRNA expression vector for the pig LRP5 gene is pKG-U6gRNA, and the whole sequence of the plasmid is shown as SEQ ID NO: 3, respectively.

Preferably, the expression vector expresses SEQ ID NO: 28, and the target of the gRNA is shown as SEQ ID NO: shown at 16.

As a further preferred aspect of the present invention, the gRNA expression vector for porcine LRP5 gene contains an insertion sequence for a gRNA target site consisting of SEQ ID NO: 20 and a single-stranded DNA represented by SEQ ID NO: 21, and annealing the single-stranded DNA shown in fig. 21.

In a further preferred embodiment of the present invention, the molar ratio of the gRNA expression vector to the Cas9 expression vector is 1-3: 1, and a further preferred molar ratio is 3: 1.

The CRISPR/Cas9 system is applied to construction of LRP5 gene mutant porcine recombinant cells.

A recombinant cell is obtained by carrying out verification on a pig primary fibroblast cotransfected by the CRISPR/Cas9 system.

The recombinant cell is applied to construction of cloned pigs with LRP5 gene knockout; namely the application in constructing LRP5 gene knockout osteoporosis model pig recombinant cells.

A synthetic primer for a gRNA target site of the porcine LRP5 gene consisting of SEQ ID NO: 20 and a single-stranded DNA represented by SEQ ID NO: 21, and annealing the single-stranded DNA shown in fig. 21.

A gRNA expression vector for the porcine LRP5 gene, which expresses the nucleic acid sequence of SEQ ID NO: 28 or a gRNA; and the vector framework of the expression vector is pKG-U6gRNA, and the complete sequence of the plasmid is shown as SEQ ID NO: 3, respectively.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) the subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. The large animals, primates, which are the animals most closely related to humans, are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation rate is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals that have a close relationship with humans except primates, do not have the above-mentioned disadvantages as model animals, and have body types, body weights, organ sizes, and the like close to those of humans, and are very similar to those of humans in terms of anatomy, physiology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate; and the pig is taken as a carnivorous animal of human for a long time, and the pig is taken as a disease model animal, so that the problems of animal protection, ethics and the like do not exist.

(2) According to the invention, experiments prove that the modified pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector is replaced by a stronger promoter and an element for enhancing protein translation is added, so that the expression of Cas9 is improved, the number of nuclear localization signals is increased, the nuclear localization capability of Cas9 protein is improved, and the gene editing efficiency is higher compared with the pX330 vector before modification. The invention also adds fluorescent mark and resistance mark in the carrier, which is more convenient to be applied to the screening and enrichment of the positive transformation cell of the carrier. The Cas9 high-efficiency expression vector modified by the invention is used for gene editing, and the editing efficiency is improved by more than 100% compared with that of the original vector.

(3) The Cas9 high-efficiency expression vector modified by the invention is adopted to carry out gene editing, the genotype of the obtained cell (homozygous mutation comprises double allele same mutation and double allele different mutation, heterozygous mutation or wild type) can be analyzed through the sequencing result of the target gene PCR product, the probability of obtaining the homozygous mutation is 30-50%, and is superior to the probability (lower than 5%) of obtaining the homozygous mutation in a model preparation method (namely, fertilized egg injection gene editing material) by using an embryo injection technology.

(4) The homozygous mutant monoclonal cell strain obtained by the invention is used for somatic cell nuclear transplantation animal cloning to directly obtain a cloned pig containing target gene homozygous mutation, and the homozygous mutation can be stably inherited.

The invention adopts the method of primary cells with great technical difficulty and high challenge to edit and screen the positive editing monoclonal cells in vitro, and directly obtains the corresponding disease model pig by the somatic cell nuclear transfer animal cloning technology in the later stage, thereby greatly shortening the manufacturing period of the model pig and saving manpower, material resources and financial resources. Furthermore, the pig model for osteoporosis based on LRP5 gene mutation is developed, can be used for research on related drug screening, drug effect detection, disease pathology, gene therapy, cell therapy and the like, further can provide effective experimental data for clinical application, and also provides a powerful experimental means for successfully treating human osteoporosis.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

FIG. 2 is a schematic diagram of the structure of plasmid pU6gRNAcas 9.

FIG. 3 is a structural map of the pU6gRNA-eEF1a Cas9 vector.

FIG. 4 is a pU6gRNA-eEF1a Cas9+ nNLS vector map.

FIG. 5 is a schematic diagram of the structure of plasmid pKG-GE 3.

FIG. 6 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 7 is a schematic diagram showing the insertion of a DNA molecule of about 20bp (a target sequence binding region for transcription to form a gRNA) into a plasmid pKG-U6 gRNA.

FIG. 8 is a graph of the sequencing peaks of step 2.3.3 in example 2.

FIG. 9 is a graph of the sequencing peaks of step 2.4.3 in example 2.

FIG. 10 is an electrophoretogram after PCR amplification of the primer pairs consisting of LRP5-E6g-F1/LRP5-E6g-R826 (group 1), LRP5-E6g-F7/LRP5-E6g-R732 (group 2), respectively, using porcine genomic DNA as a template in step 3.2.3 of example 3.

FIG. 11 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of LRP5-E6g-F1/LRP5-E6g-R826, using 18 porcine genomic DNAs as a template, at step 3.2.4 of example 3.

FIG. 12 is an electrophoretogram obtained by PCR amplification of a primer pair consisting of LRP5-E6g-F1/LRP5-E6g-R826, using genomic DNA as a template in step 4.3.4 of example 4.

FIG. 13 is an electrophoretogram after PCR amplification of a primer pair consisting of LRP5-E6g-F1/LRP5-E6g-R826 using genomic DNA as a template at step 5.4.4 of example 5.

FIG. 14 is a graph of exemplary sequencing peaks for the determination of the target gene as wild-type at step 5.4.5 in example 5.

FIG. 15 is a graph of exemplary sequencing peaks for determining that the target gene is biallelic in the same mutation at step 5.4.5 in example 5.

FIG. 16 is a graph of exemplary sequencing peaks for the determination of heterozygous mutations in the target gene at step 5.4.5 in example 5.

FIG. 17 is an exemplary sequencing peak plot for determining biallelic differential mutation of the target gene at step 5.4.5 in example 5.

Detailed Description

Example 1 construction of Cas9 high-efficiency expression vector and construction of pKG-U6gRNA vector

1.1 construction of pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (Cas9 high-efficiency expression vector)

(1) Removal of redundant null sequences in the gRNA backbone

pX330-U6-Chimeric _ BB-CBh-hSpCas9 (pX 330 for short, FIG. 1) is digested with BbsI and XbaI, a vector fragment (about 8313 bp) is recovered, an insert fragment 175bp (SEQ ID NO: 31) is synthesized by a multi-fragment recombination method, and the insert fragment and the recovered vector fragment are recombined to obtain a pU6gRNAcas9 vector (FIG. 2).

(2) Engineering promoters and enhancers

For the constructed pU6gRNAcas9 vector, XbaI and AgeI endonuclease are used to remove promoter (chicken beta-actin promoter) and enhancer sequence (CMV enhancer), linear vector sequence is recovered about 7650bp, 554bp sequence containing CMV enhancer and EF1a promoter (SEQ ID NO: 32) is synthesized by multi-fragment recombination, and pU6gRNAcas9 is recombined with the vector pU6gRNAcas9 after enzyme digestion to obtain pU6 NA-eEF1a Cas9 vector (figure 3).

(3) Cas9 gene N-terminal increasing NLS sequence

The constructed vector pU6gRNA-eEF1a Cas9 is cut by AgeI and BglII, a 7786bp vector sequence is recovered, the sequence with increased NLS is supplemented to the enzyme cutting site, namely, a 447bp Cas9 coding sequence (SEQ ID NO: 33) comprising 2 nuclear localization signals and partial excision is synthesized by a multi-fragment recombination method, and the pU6gRNA-eEF1a Cas9+ nNLS vector (figure 4) is obtained by recombination.

(4) NLS, P2A-EGFP-T2A-PURO and WPRE-3' LTR-bGH polyA signals are added to the C end of Cas9 gene

The constructed vector is named as pU6gRNA-eEF1a Cas9+ nNLS, enzyme digestion is carried out by using FseI and SbfI, the 7781bp of vector sequence is recovered, 2727bp of sequence comprising NLS-P2A-EGFP-T2A-PURO-WPRE-3' LTR-bGH polyA signals (SEQ ID NO: 34) is synthesized by a multi-fragment recombination method, and the sequence and the vector fragment are recombined to obtain the pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, which is called pKG-GE3 for short, and the plasmid map is shown as figure 5 and the base sequence (SEQ ID NO: 1).

The main elements of the modified vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO are as follows:

1) gRNA expression elements: U6-gRNA scaffold.

2) A promoter: the EF1a promoter and the CMV enhancer.

3) Cas9 gene containing multiple NLS: cas9 gene containing N-and C-terminal multinuclear localization signals (NLS).

4) Screening for marker genes: the fluorescent and resistant double-selection marker element P2A-EGFP-T2A-PURO.

5) Elements that enhance translation: WPRE and 3' LTR, enhance translation of cas9 and the selectable marker gene.

6) Transcription termination signal: bGH polyA signal.

7) Carrier skeleton: including Amp resistance elements and ori replicons, among others.

1.2 construction of pKG-U6gRNA vector

A pUC57 vector is derived, a pKG-U6gRNA insertion sequence (a DNA fragment containing a U6 promoter, a BbsI enzyme cutting site and a sgRNA framework sequence, the sequence is shown in SEQ ID NO: 2) is connected through an EcoRV enzyme cutting site, the pKG-U6gRNA insertion sequence is reversely inserted into a pUC57 vector to obtain a pKG-U6gRNA vector complete sequence (SEQ ID NO: 3), and the constructed pKG-U6gRNA vector map is shown in figure 6.

Example 2 plasmid proportioning optimization and comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.1 gRNA target design and construction

2.1.1 gRNA target design of RAG1 Gene Using Benchling

RAG1-gRNA4：AGTTATGGCAGAACTCAGTG(SEQ ID NO：4)

The synthetic RAG1 gene insert complementary DNA oligo is as follows:

RAG1-gRNA4S：caccgAGTTATGGCAGAACTCAGTG(SEQ ID NO：5)

RAG1-gRNA4A：aaacCACTGAGTTCTGCCATAACTc(SEQ ID NO：6)

RAG1-gRNA4S, RAG1-gRNA4A are single-stranded DNA molecules.

2.1.2 primers designed to amplify a target fragment comprising RAG1 gRNA

RAG1-nF126：CCCCATCCAAAGTTTTTAAAGGA(SEQ ID NO：7)

RAG1-nR525：TGTGGCAGATGTCACAGTTTAGG(SEQ ID NO：8)

2.1.3 method for cloning gRNA sequence to pKG-U6gRNA backbone vector

1) Digesting 1ug pKG-U6gRNA plasmid with restriction enzyme BbsI;

2) separating the digested pKG-U6gRNA plasmid by agarose gel (agarose gel concentration is 1%, namely 1g of agarose gel is added into 100mL of electrophoresis buffer solution), and purifying and recovering the digested product by a gel recovery kit (Vazyme);

3) 2 complementary DNA oligos synthesized from the target of 2.1.1 are annealed to form a DNA double strand complementary to the cleaved sticky end of pKG-U6gRNA vector BbsI, as shown in FIG. 7:

95 deg.C, 5min and then reducing to 25 deg.C at a rate of 5 deg.C/min;

4) the ligation reaction was initiated as follows: reacting at room temperature for 10min

Reacting at 37 ℃ for 60 min;

5) transformation of

The procedure was followed in accordance with the instructions for competent cells (Vazyme).

2.1.4 gRNA vector construction

1) The synthesized RAG1-gRNA4S and RAG1-gRNA4A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-gRNA 4). Plasmid pKG-U6gRNA (RAG1-gRNA4) will express SEQ ID NO: 9, RAG1-gRNA 4.

2.1.5 gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaking table at 37 ℃ for 12-16h, sending the small upgraded grains to a general company for sequencing, and confirming that the RAG1-gRNA4 vector is successfully constructed through sequence comparison.

2.2 preparation of Primary pig fibroblasts

2.2.1 taking 0.5g of ear tissue of a newborn juniperus domestica, removing external tissue, and soaking in 75% alcohol for 30-40 s;

2.2.2 washing 5 times with PBS containing 5% P/S (Gibco Penicillin-Streptomyces) and once with PBS without P/S;

wherein the PBS formulation of 5% P/S is: 5% P/S (Gibco Penicillin-Streptomyces) + 95% PBS, 5%, 95% by volume.

2.2.3 cutting the tissue with scissors, adding 5mL of 1% collagenase (Sigma) solution, and digesting with a shaker at 37 ℃ for 1 h;

2.2.4500 g were centrifuged for 5min, the supernatant removed, and the pellet resuspended in 1mL complete medium and plated into 10cm cell culture dishes containing 10mL complete medium and sealed with 0.2% gelatin (VWR).

Wherein, the formula of the complete cell culture medium is as follows: 15% fetal bovine serum (Gibco) + 83% DMEM medium

(Gibco) + 1% P/S (Gibco penillilin-Streptomyces) + 1% HEPES (Solambio), 15%, 83%, 1% in volume percentage.

2.2.5 culturing in a constant temperature incubator at 37 deg.C, 5% CO2 (vol.%), 5% O2 (vol.%);

2.2.6 cells were cultured to about 60% of their bottom in a petri dish and digested with 0.25% (Gibco) trypsin, complete medium was added to stop digestion, the cell suspension was transferred to a 15mL centrifuge tube, centrifuged at 400g for 4min, the supernatant was discarded, and the cells were resuspended in 1mL complete medium for further nuclear transfection experiments.

2.3 plasmid ratio optimization

2.3.1 Co-transfection grouping

A first group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.44 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.56. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 1: 1.

second group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.72 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.28. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 2: 1.

third group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.08. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 3: 1.

and a fourth group: plasmid pKG-U6gRNA (RAG1-gRNA4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: mu.g of plasmid pKG-U6gRNA (RAG1-gRNA 4).

2.3.2 Co-transfection procedure

Transfection experiments were performed using a mammalian fibroblast cell nuclear transfection kit (Neon) with a Neon TM transfection system electrotransfer.

1) Preparing electrotransformation reaction liquid according to the above groups, and intentionally preventing bubbles from being generated in the process of uniformly mixing;

2) washing the cell suspension prepared in the first step once by using PBS phosphate buffer (Solarbio), centrifuging for 6min at 600g, discarding supernatant, and resuspending the cells by using 11 mu L of electric rotating basic solution Opti-MEM, wherein bubbles are prevented from being generated in the process of resuspension;

3) sucking 10 mu L of cell suspension, adding the cell suspension into the electrotransformation reaction liquid obtained in the step 1), uniformly mixing, and intentionally preventing bubbles from being generated in the uniformly mixing process;

4) placing the electric rotating cup with the reagent cassette in a cup groove of a Neon (TM) transformation system electric rotating instrument, and adding 3mL of E Buffer;

5) sucking 10 mu L of the mixed solution obtained in the step 3) by using an electric rotating gun, inserting the mixed solution into a click cup, selecting an electric rotating program (1450V 10ms 3pulse), immediately transferring the mixed solution in the electric rotating gun into a 6-hole plate in a super clean bench after electric shock transfection, wherein each hole contains 3mL of complete culture solution of 15% fetal calf serum (Gibco) + 83% DMEM medium (Gibco) + 1% P/S (Gibco penillin-Streptomycin) + 1% HEPES (Solarbio);

6) mixing, and culturing in a constant temperature incubator at 37 deg.C and 5% CO2 and 5% O2;

7) after 6-12h of electrotransformation, the solution was changed, and 36-48h were digested with 0.25% (Gibco) trypsin and the cells were collected in a 1.5mL centrifuge tube.

2.3.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.3.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze the sequencing peak map to obtain that the editing efficiency of the first group, the second group and the third group is 9%, 53% and 66% in sequence, and an exemplary peak map of the sequencing result is shown in figure 8. Analysis proves that the gene editing efficiency of the third group is the highest, namely the optimal dosage of the gRNA plasmid and the Cas9 plasmid is determined as a molar ratio of 3:1, the actual amount of plasmid is 0.92. mu.g: 1.08. mu.g.

2.4 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.4.1 Co-transfection grouping

RAG1-330 group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.08. mu.g of plasmid pX 330.

Group RAG 1-KG: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.08. mu.g of plasmid pKG-GE 3.

Group RAG 1-B: plasmid pKG-U6gRNA (RAG1-gRNA4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g of plasmid pKG-U6gRNA (RAG1-gRNA 4).

2.4.2 Co-transfection procedure

As in this example 2.3.2.

2.4.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.4.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze a sequencing peak map to obtain that the editing efficiency of a RAG1-330 group and a RAG1-KG group is respectively 28% and 68%, an exemplary peak map of the sequencing result is shown in figure 9, and the result shows that compared with the result of adopting a plasmid pX330, the gene editing efficiency is obviously improved by adopting the plasmid pKG-GE 3.

Example 3 design and construction of LRP5 Gene target

3.1 extraction of genomic DNA

18 pigs (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) were each subjected to column extraction of genomic DNA using the Fastpure Cell/Tissue DNA Isolation Mini Kit (Vazyme Cat. DC102-01) of Vazyme, and quantified using NanoDrop and stored at-20 ℃ for future use.

3.2 conservative analysis of LRP5 gene knockout preset target and adjacent genome sequence

3.2.1 porcine LRP5 Gene information

Encodes LDL receptor-related protein 5; is located on chromosome 2; GeneID 100524299, Sus scrofa. The amino acid sequence encoded by the pig LRP5 gene is shown as SEQ ID NO: shown at 10. It has been shown that LRP5 plays a central role in bone mass regulation, and in porcine genomic DNA, LRP5 gene has 25 exons, of which exon 6 occupies an important position in all transcripts (exon 6 sequence of porcine LRP5 gene, with part of the 5 th and part of the 6 th intron sequences as shown in SEQ ID NO: 11).

3.2.2 LRP5 Gene knockout Preset target exon and adjacent genomic sequence PCR amplification primer design

According to the found genome sequence of the pig LRP5

(https://www.ncbi.nlm.nih.gov/nuccore/NC_010444.4report＝genbank& from＝4533721&to＝4653997&strand＝true) And designing primers to amplify the site of exon 6 of LRP5 gene of the 18 pig genome samples.

Primer design was performed using Oligo7, with the following design results:

LRP5-E6g-F1：AGCGCGAGGCGCTTCTTACAC(SEQ ID NO：12)

LRP5-E6g-R826：CCTTCAGGCCCACCCGGTCTC(SEQ ID NO：13)

LRP5-E6g-F7：GAGGGAGATCACAGCAAGCG(SEQ ID NO：14)

LRP5-E6g-R732：TGGAAATGCAAGATCGGAACG(SEQ ID NO：15)

3.2.3 LRP5 genomic PCR amplification primer screening

Using the genome extracted from ear tissue of swine (female 1) as a template, PCR was performed using the designed two upstream and two downstream combinations, Max enzyme (Vazyme: P505), and the product was subjected to 1% agarose gel electrophoresis to screen for good amplification primers, as shown in FIG. 10, with group 1: primer LRP5-E6g-F1/LRP5-E6 g-R826; group 2 is: the primer LRP5-E6g-F7/LRP5-E6g-R732, and both pairs of primers can amplify the target fragment.

PCR amplification of LRP5 gene fragment of 3.2.418 pigs

The products (767bp) were subjected to 1% agarose gel electrophoresis using 18 genomic templates (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), primers LRP5-E6g-F1/LRP5-E6g-R826, Max enzyme for amplification of LRP5 genomic fragment, respectively, and FIG. 11.

3.2.5 LRP5 gene sequence conservation analysis

The PCR amplification products were sequenced using amplification primers (sequencing by general Bio Inc.), and the sequencing results were compared with the LRP5 gene sequences in public databases. According to the comparison result, the sequence of the amplified fragment is relatively conservative, and the designed primer has no possible mutation site.

3.3 gRNA target design and construction

3.3.1 target gRNA design Using Benchling

Designing a target to avoid possible mutation sites, and designing the target gRNA by using Benchling:

https://benchling.com/

the LRP5 gene knockout target is designed as follows:

LRP5-E6-g1：GGAGGGCTACGTGTACTGGA(SEQ ID NO：16)

LRP5-E6-g2：CGTGTACTGGACGGACGACG(SEQ ID NO：17)

LRP5-E6-g3：CAACGACCCGGACGGCATCG(SEQ ID NO：18)

LRP5-E6-g4：ACCCGTCCAGGTACGCCCTG(SEQ ID NO：19)

the synthetic LRP5 gene has the following complementary DNA oligo for the insert sequence of 4 targets:

LRP5-E6-gRNA1-S：caccGGAGGGCTACGTGTACTGGA(SEQ ID NO：20)

LRP5-E6-gRNA1-A：aaacTCCAGTACACGTAGCCCTCC(SEQ ID NO：21)

LRP5-E6-gRNA2-S：caccgCGTGTACTGGACGGACGACG(SEQ ID NO：22)

LRP5-E6-gRNA2-A：aaacCGTCGTCCGTCCAGTACACGc(SEQ ID NO：23)

LRP5-E6-gRNA3-S：caccgCAACGACCCGGACGGCATCG(SEQ ID NO：24)

LRP5-E6-gRNA3-A：aaacCGATGCCGTCCGGGTCGTTGc(SEQ ID NO：25)

LRP5-E6-gRNA4-S：caccgACCCGTCCAGGTACGCCCTG(SEQ ID NO：26)

LRP5-E6-gRNA4-A：aaacCAGGGCGTACCTGGACGGGTc(SEQ ID NO：27)

LRP5-E6-gRNA1-S, LRP5-E6-gRNA1-A, LRP5-E6-gRNA2-S, LRP5-E6-gRNA2-A, LRP5-E6-gRNA3-S, LRP5-E6-gRNA3-A, LRP5-E6-gRNA4-S, LRP5-E6-gRNA4-A is a single-stranded DNA molecule.

3.3.2 method for cloning gRNA sequence onto pKG-U6gRNA backbone vector

The same as 2.1.4 in example 2.

3.3.3 gRNA vector construction

1) The synthesized LRP5-E6-gRNA1-S and LRP5-E6-gRNA1-A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to give the plasmid pKG-U6gRNA (LRP5-E6-gRNA 1). Plasmid pKG-U6gRNA (LRP5-E6-gRNA1) will express SEQ ID NO: LRP5-E6-gRNA1, shown at 28.

2) The synthesized LRP5-E6-gRNA2-S and LRP5-E6-gRNA2-A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to give the plasmid pKG-U6gRNA (LRP5-E6-gRNA 2). Plasmid pKG-U6gRNA (LRP5-E6-gRNA2) will express SEQ ID NO: LRP5-E6-gRNA2 shown at 29.

3) The synthesized LRP5-E6-gRNA3-S and LRP5-E6-gRNA3-A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to give the plasmid pKG-U6gRNA (LRP5-E6-gRNA 3). Plasmid pKG-U6gRNA (LRP5-E6-gRNA3) will express SEQ ID NO: LRP5-E6-gRNA3 shown at 30.

4) The synthesized LRP5-E6-gRNA4-S and LRP5-E6-gRNA4-A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to give the plasmid pKG-U6gRNA (LRP5-E6-gRNA 4). Plasmid pKG-U6gRNA (LRP5-E6-gRNA4) will express SEQ ID NO: LRP5-E6-gRNA4 shown at 31.

3.3.3 gRNA vector identification

Picking a single clone from an LB plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaker at 37 ℃ for 12-16h, sending the small upgraded particles to a general company for sequencing, and confirming that vectors of pKG-U6gRNA (LRP5-E6-gRNA1), pKG-U6gRNA (LRP5-E6-gRNA2), pKG-U6gRNA (LRP5-E6-gRNA3) and pKG-U6gRNA (LRP5-E6-gRNA4) are successfully constructed through sequence alignment.

Example 4 comparison of editing efficiency of different gRNA targets of LRP5 Gene

4.1 preparation of Primary pig fibroblasts

The same as 2.2 in example 2.

4.2 the porcine primary fibroblasts were co-transfected with the constructed gRNA plasmid, the CRISPR/Cas9 plasmid (pKG-GE 3).

4.2.1 Co-transfection grouping

A first group: plasmid pKG-U6gRNA (LRP5-E6-gRNA1), plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (LRP5-E6-gRNA 1): 1.08. mu.g of plasmid pKG-GE 3; wherein the molar ratio of the plasmid pKG-U6gRNA (LRP5-E6-gRNA1) to the plasmid pKG-GE3 is 3: 1.

Second group: plasmid pKG-U6gRNA (LRP5-E6-gRNA2), plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (LRP5-E6-gRNA 2): 1.08. mu.g of plasmid pKG-GE 3; wherein the molar ratio of the plasmid pKG-U6gRNA (LRP5-E6-gRNA2) to the plasmid pKG-GE3 is 3: 1.

Third group: plasmid pKG-U6gRNA (LRP5-E6-gRNA3), plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (LRP5-E6-gRNA 3): 1.08. mu.g of plasmid pKG-GE 3; wherein the molar ratio of the plasmid pKG-U6gRNA (LRP5-E6-gRNA3) to the plasmid pKG-GE3 is 3: 1.

And a fourth group: plasmid pKG-U6gRNA (LRP5-E6-gRNA4), plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (LRP5-E6-gRNA 4): 1.08. mu.g of plasmid pKG-GE 3; wherein the molar ratio of the plasmid pKG-U6gRNA (LRP5-E6-gRNA4) to the plasmid pKG-GE3 is 3: 1.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

4.2.2 Co-transfection procedure

The same as 2.3.2 in example 2.

4.3 analysis of editing efficiency of different gRNA targets of LRP5 Gene

4.3.1 to 5 groups of cells collected in 1.5mL centrifuge tubes in step 3.2, respectively, 10. mu.L of KAPA2G lysate was added to lyse the cells and extract the genomic DNA of the cells.

The system for preparing KAPA2G lysate is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

5 min-4 ℃ at 75 ℃ to 95 ℃, and storing the genome DNA at-20 ℃ after the reaction is finished;

4.3.2 detection of mutations with the aforementioned E6 primer for LRP5 gene LRP5-E6g-F7/LRP5-E6g-R732, the PCR target product being 725bp in length;

4.3.3 amplification of LRP5 target gene using conventional PCR reaction;

4.3.4 the PCR reaction products are subjected to 1% agarose gel electrophoresis, as shown in figure 12, the target products and the products nearby are cut and recovered, and then sent to a sequencing company for sequencing, and then the sequencing results are analyzed by a webpage version of Synthego ICE tool to obtain the editing efficiencies of different targets of LRP5-E6-gRNA1, LRP5-E6-gRNA2, LRP5-E6-gRNA3 and LRP5-E6-gRNA4, which are 24%, 1%, 10% and 12% in sequence. The result shows that LRP5-E6-gRNA1 has the highest editing efficiency and is the optimal target.

Example 5 creation of LRP5 Gene knockout Swine cells from Jiang by somatic cloning

5.1 preparation of Primary pig fibroblasts

The same as 3.1 in example 3.

5.2 Co-transfection of porcine primary fibroblasts with the constructed pKG-U6gRNA (LRP5-E6-gRNA1) plasmid, pKG-GE3 plasmid

The same as 3.2 in example 3.

5.3 screening of LRP5 Gene knockout monoclonal cell Strain

5.3.1 the 48h electro-transfected population cells from step 4.2 were digested with trypsin, neutralized with complete medium, centrifuged at 500g for 5min, the supernatant removed, the pellet resuspended in 200. mu.L complete medium and diluted appropriately, and the single clone picked up with a pipette and transferred to a 100. mu.L complete medium 96 well plate;

5.3.237 ℃, culturing in a constant-temperature incubator containing 5% CO2 and 5% O2, changing the cell culture medium every 2-3 days, observing the growth condition of cells in each hole by using a microscope during the culture, and removing the holes without cells and non-monoclonal cells;

5.3.3 cells in wells of a 96-well plate were grown to the well bottom, trypsinized and harvested, 2/3 cells were seeded into a 6-well plate containing complete medium, and the remaining 1/3 cells were harvested in a 1.5mL centrifuge tube;

5.3.4 cells were digested and harvested with 0.25% (Gibco) trypsin when the 6-well plates were 80% confluent, and frozen using cell-freezing medium (90% complete medium + 10% DMSO, vol.).

5.4 identification of recombinant cells with LRP5 Gene knockout

5.4.1 the cells obtained in step 4.3 were collected in a 1.5mL centrifuge tube, and then 10. mu.L of KAPA2G lysate was added to the cells to lyse the cells and extract the genomic DNA of the cells.

The system for preparing KAPA2G lysate is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

5 min-4 ℃ at 75 ℃ to 95 ℃, and storing the genome DNA at-20 ℃ after the reaction is finished;

5.4.2 detection of mutations with the aforementioned E6 primer for LRP5 gene LRP5-E6g-F7/LRP5-E6g-R732, the PCR target product being 725bp in length;

5.4.3 amplification of LRP5 target gene using PCR general reaction;

5.4.4 electrophoresis of the PCR reaction products, the electrophoresis results are shown in FIG. 13, lane numbers are consistent with the monoclonal cell numbers. The PCR amplification product was recovered and sequenced.

And 5.4.5, comparing the sequencing result with LRP5 target information to judge whether the recombinant cell is an LRP5 gene knockout.

The genotypes of the monoclonal cells numbered 1, 3, 10, 11, 12 and 13 are biallelic mutants. The genotypes of the monoclonal cells numbered 6 and 15 are biallelic different mutants. The genotypes of the monoclonal cells numbered 5, 9, 17 and 18 were heterozygous. The genotypes of the monoclonal cells numbered 2, 4, 7, 8, 14, 16, 19, 20 were homozygous wild-type. The rate of LRP5 gene-edited monoclonal cells obtained was 60%.

Exemplary sequencing alignments are shown in FIGS. 14-17, where FIG. 14 is the alignment of forward sequencing of clone number LRP5-2 to published sequences, judged as wild-type; FIG. 15 is an alignment of forward sequencing of clone No. LRP5-1 with published sequences, judged as biallelic mutations; FIG. 16 is an alignment of forward sequencing of clone No. LRP5-5 with published sequences, judged as a heterozygous mutation; FIG. 17 shows the alignment of forward and reverse sequencing of clone LRP5-6 with published sequences, which was judged as biallelic different mutations.

Through analysis of specific sequences, the genotypes of the LRP5 single cell clones are shown in table 1:

TABLE 1 identification of single cell clone gene from Jiangxiang pig fibroblast knocked out LRP5 Gene

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., Ltd

<120> CRISPR system and application thereof in construction of LRP5 gene mutant osteoporosis clone porcine nuclear donor cell

<160> 35

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10476

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaaccctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggcctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 2

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60

ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410

<210> 3

<211> 3120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agttatggca gaactcagtg 20

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caccgagtta tggcagaact cagtg 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaccactga gttctgccat aactc 25

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccccatccaa agtttttaaa gga 23

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgtggcagat gtcacagttt agg 23

<210> 9

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 10

<211> 1614

<212> PRT

<213> pig (Sus scrofa)

<400> 10

Met Glu Ala Ala Pro Pro Arg Pro Pro Pro Pro Pro Pro Pro Leu Leu

1 5 10 15

Leu Leu Leu Ala Leu Cys Cys Ser Leu Ala Pro Ala Ala Ala Ser Pro

20 25 30

Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp Ala Gly

35 40 45

Gly Val Lys Leu Glu Ser Thr Ile Val Val Ser Gly Leu Glu Asp Ala

50 55 60

Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp Thr Asp

65 70 75 80

Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr Gly Ala

85 90 95

Ala Val Gln Asn Val Val Ile Ser Gly Leu Val Ser Pro Asp Gly Leu

100 105 110

Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser Glu Thr

115 120 125

Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys Val Leu

130 135 140

Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp Pro Ala

145 150 155 160

His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Thr Pro Arg Ile Glu

165 170 175

Arg Ala Gly Met Asp Gly Ser Ser Arg Lys Val Ile Val Asp Ser Asp

180 185 190

Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys Leu

195 200 205

Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu Asp

210 215 220

Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro Phe

225 230 235 240

Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln Thr

245 250 255

Arg Ser Ile His Ala Cys Asn Lys Arg Thr Gly Glu Lys Arg Lys Glu

260 265 270

Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser Pro

275 280 285

Glu Arg Gln Pro Tyr Phe His Thr Arg Cys Glu Glu Asp Asn Gly Gly

290 295 300

Cys Ser His Leu Cys Leu Leu Ser Pro Arg Glu Pro Tyr Tyr Ala Cys

305 310 315 320

Ala Cys Pro Thr Gly Val Gln Leu Gln Gly Asn Gly Gln Thr Cys Lys

325 330 335

Ala Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu Arg

340 345 350

Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln Val

355 360 365

Asp Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu Gly

370 375 380

Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala Tyr

385 390 395 400

Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn Asp

405 410 415

Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp Thr

420 425 430

Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr Ser

435 440 445

Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile Val

450 455 460

Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu Ser

465 470 475 480

Pro Lys Ile Glu Cys Ala His Leu Asp Gly Gln Glu Arg His Val Leu

485 490 495

Val Asn Thr Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu Gln

500 505 510

Glu Gly Gln Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu Val

515 520 525

Ile Asn Ile Asp Gly Thr Glu Arg Arg Thr Leu Leu Glu Asp Lys Leu

530 535 540

Pro His Ile Phe Gly Phe Thr Leu Leu Gly Asp Phe Ile Tyr Trp Thr

545 550 555 560

Asp Trp Gln Arg Arg Ser Ile Glu Arg Val His Lys Val Lys Ala Ser

565 570 575

Arg Asp Ile Ile Ile Asp Gln Leu Pro Asp Leu Met Gly Leu Lys Ala

580 585 590

Val Asn Val Ala Lys Val Val Gly Thr Asn Pro Cys Ala Asp Arg Asn

595 600 605

Gly Gly Cys Ser His Leu Cys Phe Phe Thr Pro Arg Ala Thr Lys Cys

610 615 620

Gly Cys Pro Ile Gly Leu Glu Leu Leu Ser Asp Met Lys Thr Cys Ile

625 630 635 640

Val Pro Glu Ala Phe Leu Val Phe Thr Ser Arg Ala Ala Ile His Arg

645 650 655

Ile Ser Leu Asp Thr Asn Asn Asn Asp Val Ala Ile Pro Leu Ala Gly

660 665 670

Val Lys Glu Ala Ser Ala Leu Asp Phe Asp Val Ser Thr Asn His Ile

675 680 685

Tyr Trp Thr Asp Val Ser Leu Lys Thr Ile Ser Arg Ala Phe Met Asn

690 695 700

Gly Ser Ser Val Glu His Val Ile Glu Phe Gly Leu Asp Tyr Pro Glu

705 710 715 720

Gly Met Ala Val Asp Trp Met Gly Lys Asn Leu Tyr Trp Ala Asp Thr

725 730 735

Gly Thr Asn Arg Ile Glu Val Ala Arg Leu Asp Gly Gln Phe Arg Gln

740 745 750

Val Leu Val Trp Arg Asp Leu Asp Asn Pro Arg Ser Leu Ala Leu Asp

755 760 765

Pro Thr Lys Gly Tyr Ile Tyr Trp Thr Glu Trp Gly Gly Lys Pro Arg

770 775 780

Ile Val Arg Ala Phe Met Asp Gly Thr Asn Gly Met Thr Leu Val Asp

785 790 795 800

Lys Val Gly Arg Ala Asn Asp Leu Thr Ile Asp Tyr Ala Asp Gln Arg

805 810 815

Leu Tyr Trp Thr Asp Leu Asp Thr Asn Met Ile Glu Ser Ser Asn Met

820 825 830

Leu Gly Gln Glu Arg Val Val Ile Ala Asp Asp Leu Pro His Pro Phe

835 840 845

Gly Leu Thr Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr Asp Trp Asn Leu

850 855 860

His Ser Ile Glu Arg Ala Asp Lys Thr Ser Gly Arg Asn Arg Thr Leu

865 870 875 880

Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu Val Phe His Ser

885 890 895

Ser Arg Gln Asp Gly Leu Asn Asp Cys Met His Asn Asn Gly Gln Cys

900 905 910

Gly Gln Leu Cys Leu Ala Val Pro Ser Gly His Arg Cys Ser Cys Ala

915 920 925

Ser His Tyr Thr Leu Asp Pro Ser Ser Arg Asn Cys Ser Pro Pro Thr

930 935 940

Thr Phe Leu Leu Phe Ser Gln Lys Cys Ala Val Ser Arg Met Ile Pro

945 950 955 960

Asp Asp Gln His Ser Pro Asp Leu Ile Leu Pro Leu His Gly Leu Arg

965 970 975

Asn Val Arg Ala Ile Asp Tyr Asp Pro Leu Asp Lys Phe Ile Tyr Trp

980 985 990

Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly Thr Gln

995 1000 1005

Pro Phe Val Leu Thr Ser Pro Gly Gln Ser Gln Ser Pro Asp Arg Gln

1010 1015 1020

Pro His Asp Leu Ser Ile Asp Val Tyr Gly Arg Thr Leu Phe Trp Thr

1025 1030 1035 1040

Cys Glu Ala Thr Asn Thr Ile Asn Val His Arg Leu Asn Gly Asp Ala

1045 1050 1055

Met Gly Val Val Leu Arg Gly Asp Arg Asp Lys Pro Arg Ala Ile Val

1060 1065 1070

Val Asn Ala Glu Arg Gly Tyr Leu Tyr Phe Thr Asn Met Gln Asp Arg

1075 1080 1085

Ala Ala Lys Ile Glu Arg Ala Ala Leu Asp Gly Thr Glu Arg Glu Val

1090 1095 1100

Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val Asp Asn

1105 1110 1115 1120

Ala Leu Gly Lys Leu Phe Trp Val Asp Ala Asp Leu Lys Arg Ile Glu

1125 1130 1135

Ser Cys Asp Leu Ser Gly Ala Asn Arg Leu Thr Leu Glu Asp Ala Asn

1140 1145 1150

Ile Val Gln Pro Val Gly Leu Thr Val Leu Gly Lys His Leu Tyr Trp

1155 1160 1165

Ile Asp Arg Gln Gln Gln Met Ile Glu Arg Val Asp Lys Thr Thr Gly

1170 1175 1180

Asp Ser Arg Thr Arg Val Gln Gly Arg Val Ala His Leu Thr Gly Ile

1185 1190 1195 1200

His Ala Val Glu Asp Ile Ser Val Glu Glu Phe Ser Ala His Pro Cys

1205 1210 1215

Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile Ala Lys Gly Asp

1220 1225 1230

Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val Leu Leu Gln Asn

1235 1240 1245

Leu Leu Thr Cys Gly Glu Pro Pro Thr Cys Ser Pro Asp Gln Phe Ala

1250 1255 1260

Cys Ala Thr Gly Glu Ile Asp Cys Ile Pro Gly Ala Trp Arg Cys Asp

1265 1270 1275 1280

Gly Phe Pro Glu Cys Asp Asp Gln Ser Asp Glu Glu Gly Cys Pro Val

1285 1290 1295

Cys Ser Ala Ala Gln Phe Pro Cys Ala Arg Gly Gln Cys Val Asp Leu

1300 1305 1310

Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser Asp Glu

1315 1320 1325

Ala Asp Cys Asp Ala Val Cys Leu Pro Asn Gln Phe Arg Cys Ala Ser

1330 1335 1340

Gly Gln Cys Val Leu Ile Lys Gln Gln Cys Asp Ser Phe Pro Asp Cys

1345 1350 1355 1360

Ile Asp Gly Ser Asp Glu Leu Met Cys Glu Ile Thr Lys Leu Pro Ser

1365 1370 1375

Asp Asp Ser Pro Ala His Ser Ser Ala Ile Gly Pro Val Ile Gly Ile

1380 1385 1390

Ile Leu Ser Leu Phe Val Met Gly Gly Val Tyr Phe Val Cys Gln Arg

1395 1400 1405

Val Val Cys Gln Arg Tyr Ala Gly Ala Thr Gly Pro Phe Pro His Glu

1410 1415 1420

Tyr Val Ser Gly Thr Pro His Val Pro Leu Asn Phe Ile Ala Pro Gly

1425 1430 1435 1440

Gly Ser Gln His Gly Pro Phe Pro Gly Ile Ser Cys Ser Lys Ser Met

1445 1450 1455

Met Ser Ser Val Ser Leu Met Gly Gly Arg Ala Gly Val Pro Leu Tyr

1460 1465 1470

Asp Arg Asn His Val Thr Gly Ala Ser Ser Ser Ser Ser Ser Ser Thr

1475 1480 1485

Lys Ala Thr Leu Tyr Pro Pro Ile Leu Asn Pro Pro Pro Ser Pro Ala

1490 1495 1500

Thr Asp Pro Ser Leu Tyr Asn Leu Asp Val Phe Tyr Ser Ser Asn Ile

1505 1510 1515 1520

Pro Ala Ala Ala Arg Pro Tyr Arg Pro Tyr Ile Ile Arg Gly Met Ala

1525 1530 1535

Pro Pro Thr Thr Pro Cys Ser Thr Asp Val Cys Asp Ser Asp Tyr Ser

1540 1545 1550

Ala Ser Arg Trp Lys Ala Ser Lys Tyr Tyr Leu Asp Leu Asn Ser Asp

1555 1560 1565

Ser Asp Pro Tyr Pro Pro Pro Pro Thr Pro His Ser Gln Tyr Leu Ser

1570 1575 1580

Ala Glu Asp Ser Cys Pro Pro Ser Pro Ala Thr Glu Arg Ser Tyr Phe

1585 1590 1595 1600

His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser Ser

1605 1610

<210> 11

<211> 3000

<212> DNA

<213> pig (Sus scrofa)

<400> 11

gaacctccat atgccgcagg tgcagccctg gaaaaaaaaa aaaaagtctc ttaataagtc 60

aagaaagaaa gaacatgttt caaaccagtc acatcattgt tccaggctat aaaggctgag 120

gtgtaccttt ctctgagttt gttctctgtg gagtcagttg aagctgggta tcagccgcca 180

gcttccaccc cttgctgccg gcgcacatgc tagtgggtga tggcaccaga gttggtgggg 240

gaggtgaatg tcctcactcc gggggccctt gtaccaccgc ctgcaaggag gagccttgcc 300

aaggcccctc tctcctgaga ctgttgccca ctttcatgcc actgccgacc aggagtggcc 360

tggccccggc aggagcagct ccagaccttt ggagagctgt ttagatcagc aaagagtcac 420

ctggcccagc ccgaacaccc tctgggtgag tcctcctcac agactgggtg tttcaagccc 480

cagcgtccag cgcgtcctgg ctgctattcc gtaatccgca tcgaccagcc cccagcggag 540

cccaggcccg tccccagctg ggcttctcag cgcttaccca cagcaacaga tggtccgtgg 600

tgtcaccctg gcatggcttc ccagtgtaaa cagatcaaaa cagcgtcact taagtcataa 660

acaagggggc tggtagtcac aacaaaccaa tacacagcaa aacgcaaggc caccagggtg 720

acaaagagga agatggggca acggcctcca aggtgctcac ctgtcagtga gatgcccacc 780

tgggcaggac aggacctggg atgatgtgtg tgctcttggg gcctgaagct gccttgctgg 840

gtaggtgtgg ggaggcaacg gtgggcctcg gggaagaagc agcgttcggg ctgagccagg 900

aagggtgagc acgtagaagg tgaggtccgg tgggggctct gaggagtacg gtgggcgagt 960

ggggcctgga gcccagtgcc gggtcgggac tgcagtcgcg gccggtttgt ggccaggaga 1020

ggggcttgca gggaagaagg agttctgagc gcgaggcgct tcttacacag cggttggagc 1080

tggtggctgt gtggctttca gagggctgct taacctctct gtgcttctgt ctgctcgtct 1140

ggacgttggg gacacacata gcgctggcct cagggatctc tttcaggatg aacgagtggc 1200

tgcggaggga gatcacagca agcgttccct gacacgacct gtcatcgcag gggcgtcccc 1260

ggggacccgg cagagccccg ccctgccccc cgcaggccca gctctgacgc ccccgctcct 1320

gtgtccgcag gggccgagga ggtgctgctg ctggcccgga ggacggacct gcggaggatc 1380

tcgctggaca cgccggactt cacggacatc gtgctgcagg tggacgacat ccggcacgcc 1440

atcgccatcg actacgaccc gctggagggc tacgtgtact ggacggacga cgaggtgcgg 1500

gccatccgca gggcgtacct ggacgggtcg ggggcgcaga cgctggtcaa caccgagatc 1560

aacgacccgg acggcatcgc ggtcgactgg gtggcccgca acctctactg gacggacacg 1620

ggcaccgacc gcatcgaggt gacgcgcctc aacggcacct cccgcaagat cctggtgtcc 1680

gaggacctgg acgagccccg cgccatcgtg ctgcaccccg tgatggggta aggctgtggc 1740

gggcgggcca ggagctgggc ggcgcggggc tgggggtccc ggagctctct cccgagaccg 1800

ggtgggcctg aaggctgggc cgggagctgg gcggcgcggg gctgggggtc ccggagctct 1860

ctcccgcgac tgggtgggcc tgaaggctgg gctgtgggct cagtgcccgt tccgatcttg 1920

catttccaac aagctcacag gagatgggcc gatctgggga ccaggctttg agaagctctc 1980

acacaacttg gttacattta tagcaagtcc tggagacctt gggtcagtca tttttctccc 2040

tgggcttcaa tattctcacc tataaaagca gagccaccca ccagggtgac ttctgagctg 2100

atgctggtaa caagagcggc ggccaccgca gcccttactg cacttgagcc gggcctcagc 2160

aggcacgtct gcctcctctc ctcccctgtg gggcgggcgc agggttcaga ggaggaagct 2220

gaagcccaga gaggagaagg gacttgccca agatcacgca gctgggaggt ggggactgga 2280

cctggcggtc tggttccaac ttcccatttt aggatttggt gacaaccgag agcttctccg 2340

tcattgcagg agcctttctg agatgccagc agctcagagg gtagcggctg ggtcccttcc 2400

tacgggctcg tgaccaagaa tgcgaagctg gtggacctga tgggggaggg gtgctgggcg 2460

ttctgggggc tgcagaggaa gccccctggc ctcaatgcag catgagggac caggtcctgg 2520

agaaggtctg gaggagctgg gaggacagag gagggccacc ccggctgctg cccctcaggt 2580

gtcaggagct cttcccatct ccccggggct gaggctcagg tgacgtgacc catcgcggtg 2640

cctggtggcg ggggctgtcc gcctgtggag cccgtgcacc ctgccctggc ccgggactgt 2700

cggacgtgct cttgctgtgg cgctgcttct gtggtagaag cacagccacg ggggcaggtc 2760

tggctgcagc tggaccgctg gactcggctc aggcagccgg ggacggtgcc tgtggagccc 2820

aggccccggt gggcatgtag acagacgctg cttggcgagg tggttgagga gcaggactgt 2880

cccccaagga gggtgggtgg agaagcgggt ccctggggtc tgagggtcaa ggagcatcgc 2940

cagcgtcagt gacgggactg gggctccgag gttggcagag aggccctccc cccacgctgc 3000

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agcgcgaggc gcttcttaca c 21

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccttcaggcc cacccggtct c 21

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gagggagatc acagcaagcg 20

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tggaaatgca agatcggaac g 21

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggagggctac gtgtactgga 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgtgtactgg acggacgacg 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

caacgacccg gacggcatcg 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

acccgtccag gtacgccctg 20

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caccggaggg ctacgtgtac tgga 24

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

aaactccagt acacgtagcc ctcc 24

<210> 22

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caccgcgtgt actggacgga cgacg 25

<210> 23

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aaaccgtcgt ccgtccagta cacgc 25

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

caccgcaacg acccggacgg catcg 25

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

aaaccgatgc cgtccgggtc gttgc 25

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

caccgacccg tccaggtacg ccctg 25

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

aaaccagggc gtacctggac gggtc 25

<210> 28

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

ggagggcuac guguacugga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 29

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cguguacugg acggacgacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 30

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

caacgacccg gacggcaucg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 31

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

acccguccag guacgcccug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 32

<211> 175

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175

<210> 33

<211> 554

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60

gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240

gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300

tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360

gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420

tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480

tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540

caccatggac tata 554

<210> 34

<211> 447

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60

ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120

ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180

caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240

cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300

catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360

ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420

gcaagagatc ttcagcaacg agatggc 447

<210> 35

<211> 2727

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840

ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900

gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960

tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020

ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080

agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140

acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200

tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260

agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320

tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380

tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440

tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500

cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560

ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620

cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680

tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740

ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800

gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860

cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920

ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980

ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040

cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100

gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160

gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220

gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280

agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340

ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400

ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460

cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700

tggcctgcag gggcgcctga tgcggta 2727