阅读说明：本技术 芝麻SiOASA基因在植物雄性不育中的应用 (Application of sesame SiOASA gene in plant male sterility ) 是由 周婷 杨远霄 赵应忠 李田雨 刘红艳 周芳 于 2020-11-24 设计创作，主要内容包括：本发明属于植物基因工程技术领域,具体涉及芝麻SiOASA基因在调控植物雄性不育中的应用。本发明包括芝麻SiOASA基因的分离克隆、载体构建、功能验证及在调控植物雄性不育中的应用。所述的芝麻SiOASA基因的核苷酸序列如序列表SEQ ID NO:1所示；该基因编码的蛋白质序列如SEQ ID NO:2所示。本发明还公开了该基因在影响拟南芥绒毡层和小孢子的发育进而导致植株雄性不育中的应用。(The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a sesame SiOASA gene in regulation and control of plant male sterility. The invention comprises the separation and cloning of sesame SiOASA gene, the construction of vector, the functional verification and the application in the regulation and control of plant male sterility. The nucleotide sequence of the sesame SiOASA gene is shown in a sequence table SEQ ID NO 1; the protein sequence coded by the gene is shown in SEQ ID NO. 2. The invention also discloses application of the gene in influencing the development of arabidopsis thaliana tapetum and microspore to further cause plant male sterility.)

1. An application of the separated SiOASA gene of sesame in regulating and controlling plant male sterility, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. An application of the SiOASA gene of the separated sesame in regulating and controlling the male sterility of plants, wherein the protein sequence coded by the gene is shown in SEQ ID NO. 2.

3. A overexpression vector PRI101-AN-SiOASA, wherein the vector contains the SiOASA gene as claimed in claim 1.

4. The use as claimed in claim 1, which includes use in regulating plant pollen development and creating plant male sterile material.

5. The use as claimed in claim 1, wherein the plant is Arabidopsis thaliana.

6. The application of the SiOASA gene separated from sesame in influencing the development of arabidopsis thaliana tapetum and microspore to further cause plant male sterility, wherein the nucleotide sequence of the SiOASA gene is shown as SEQ ID NO. 1.

Technical Field

The present invention belongs to the field of plant gene engineering technology. In particular to functional verification and application of an acetylserine (thiol) lyase SiOASA gene separated and identified from sesame. Functional verification shows that the SiOASA gene can regulate the development of arabidopsis pollen, so that the arabidopsis pollen is aborted. The cloned SiOASA gene can be used for creating a male sterile material through genetic transformation, is applied to cross breeding, and improves the crop yield.

Background

With the continuous growth of the global population, how to maintain an adequate supply of food with limited resources becomes a major concern worldwide. Therefore, it is important to improve the yield of grains on the premise of environmental protection and sustainable development. The heterosis can obviously improve the crop yield, improve the crop quality and enhance the stress resistance and disease resistance of plants, and is an effective way for increasing the grain yield under the condition of sustainable development. Currently, cross breeding systems have been established in a number of crops. By using heterosis, rice is increased by 55% (Chen et al, 2007, Progress in research and maintenance on Hybrid: A super-biomedical in China, annual Botany,100: 959-. The crossbreeding makes great contribution to agricultural production increase.

The male sterility system is an important way for utilizing the heterosis of crops. Meanwhile, male sterility is also an important factor affecting crop seed production. Male Reproductive dysplasia leads to Male sterility (Guo and Liu,2012, Molecular Control of Large regenerative development and Pollen Fertility in Rice. journal of Integrated Plant Biology,54: 967-. Male reproductive organ development is a complex biological process involving a series of developmental events including stamen primordial differentiation, sporogenesis, pollen mother cell differentiation, mitosis to microspore production and maturation, pollen release, etc., involving a series of genes and gene-environment interactions (Ma,2005, Molecular genetic analysis of microsporogenesis and microorganisational genetics in fluidic plants, annual Review of Plant biology, 56: 393-434). Therefore, the deep understanding of plant fertility and the mechanism and gene network leading to normal pollen formation and release has important significance for creating male sterile materials, matching dominant hybrid combinations and improving crop yield through genetic engineering.

Amino acids are essential components of life activities and are essential for the normal development of male and female gametophytes. In the tapetum of anthers, the expression of amino acid transporters was detected, and the transport of amino acids from sporozoites to male gametocytes was observed (Tegeter and Rentsch,2010, Uptake and partitioning of amino acids and polypeptides. molecular Plant,3: 997-. Studies have shown that histidine, lysine or tryptophan transport from sporophytes to male gametophytes can satisfy the requirements for these three amino acids during pollen development (Hudson et al, 2006, An L-diaminopimelate aminotransferase derivatives a novel variant of the pollen development in plants. plant Physiology,140: 292. 19; Muralla et al, 2007, Genetic differentiation of the histidine biosynthesis in plants Physiology,144: 890. 903; Song et al, 2004, transgenic in Arabidopsis thaliana derivatives a novel variant of the pollen development, ABERT 6324 AND 8652. important for pollen development in pollen development, pollen synthesis in pollen AND cysteine synthesis in plants, pollen development in pollen et al, pollen development in pollen et al, No. 2-transgenic in pollen development in pollen et al, No. 2-2, No. 4. D, No. 2. 3. D, No. 2. D, No. 3. D. As shown in FIGS. 2013, curative Fertilization recovery of the Presence of at Least One of the Major O-acetyl server (thio) lyse for Cysteine Synthesis in polen of Arabidopsis plant physiology 163: 959-. Cysteine is not only an important constituent of proteins, but also a precursor of many important biomolecules, such as vitamins, cofactors and glutathione, an important regulator of cellular redox balance (Wirtz and Droux,2005, Synthesis of the sulfur amino acids: cysteine and methionine. Photosyn. Research,86:345- & 362). Cysteine has an important role in plant metabolism due to its biochemical function. Cysteine is synthesized by first producing acetylserine (OAS) as an intermediate product catalyzed by serine-acyltransferase (SAT), and then combining the sulfide with OAS to produce cysteine by acetylserine (thiol) lyase (OASTL). Cysteine, synthesized by OASTL, is a direct link between carbon and nitrogen metabolism (OAS) and sulfur (sulfide) metabolism, and is central in plant primary metabolism (Heeg et al, 2008, Analysis of the Arabidopsis O-acetyl server (thio) Gene Family microorganisms complex-Specific differentiation in the Regulation of Cysteine Synthesis. plant Cell,20: 168-. Plant cells harbor a variety of acetylserine (thiol) lyase isoforms. There are 9 genes encoding acetylserine (thiol) lyase in Arabidopsis, encoding five isoforms OASA, OASB, OASC, CS-LIKE and CAS. Wherein OASA, OASB and OASC are main subtypes, are respectively positioned in cytoplasm, plastid and mitochondria, and catalyze the biosynthesis of Cysteine, thereby forming a plurality of subcellular Cysteine pools (Birke et al, 2013, culture fermentation recovery of at Least One Major O-acetyl server (thio) lysine for Cysteine Synthesis in Pollen of Arabidopsis. plant physiology,163: 959-. Research shows that the single mutants of Arabidopsis oasa and oasb have no obvious difference compared with wild Arabidopsis thaliana, while the oasc mutant shows slow growth compared with wild Arabidopsis thaliana. The oastlAB, oastlAC, oastlBC double mutants, respectively, show a partially Pollen sterile phenotype and the oastlABC triple mutant shows a gametophytic phenotype (Birke et al, 2013, Successful Fertilization Requiries the Presence of at Least One Major O-acetyl server (thio) lysine for Cysteine Synthesis in polen of Arabidopsis plant physiology,163: 959-. DES1 encodes L-cysteine desulfhydrase, belonging to the CS-LIKE isoform. The Des1 insertion mutant exhibited leaf senescence advancing and was involved in Cysteine Homeostasis maintenance in vivo (A' lverez et al, 2010, An O-acetyl server (thio) lyse hollog with L-Cysteine Desulfhydrase Activity regulation Cysteine in Arabidopsis plant Physiology,152,656 669). At present, little is known about the molecular mechanism of acetylserine (thiol) lyase participating in growth and development, and only few reports exist. In sesame, acetylserine (thiol) lyase has not been reported.

The sesame SiOASA gene is obtained by cloning, and codes acetylserine (thiol) lyase, and the applicant finds that overexpression of SiOASA in Arabidopsis results in delay of programmed death (PCD) of Arabidopsis tapetum, vacuolation of microspores and pollen wall abnormality, and further pollen abortion. The cloned gene of the present invention may be used in creating male sterile material for plant and providing new germplasm resource and breeding material for cross breeding.

Disclosure of Invention

The invention aims to separate and clone a gene related to sesame male sterility from sesame, verify the function of the gene in pollen development by transforming arabidopsis thaliana, and further transform the gene into sesame so as to create a male sterile material through genetic engineering, use the material in sesame hybridization breeding and improve the yield of the sesame.

The technical scheme of the invention is as follows:

(1) the invention separates an acetylserine (thiol) lyase gene related to sesame male sterility from sesame, and the applicant names the gene as SiOASA, the nucleotide sequence of the gene is shown in a sequence table SEQ NO:1, and the sequence shown in the 1 st-1191 th position of the sequence is the coding region (CDS) of the gene. The encoded protein has 73% homology with Arabidopsis OASA. Clustering analysis indicated that the protein encoded by the SiOASA gene was clustered with OASA (FIG. 1), so this gene was named SiOASA. Constructing a super expression vector of the gene according to the sequence information of the full-length cDNA of the gene after sequencing verification, wherein the super expression vector contains an amino acid sequence shown in a sequence table SEQ NO. 2.

The acetylserine (thiol) lyase gene SiOASA shown in SEQ ID NO:1 is derived from sesame, consists of 1191 bases, and the predicted protein coding sequence is 396 amino acids, and consists of the 1 st base to the 1191 st base from the 5' end of the sequence SEQ ID NO: 1. The gene has not been reported in sesame. Tissue expression pattern analysis showed that the SiOASA gene was expressed in both vegetative and reproductive organs with higher expression levels in reproductive organs than in vegetative organs (panel a in fig. 2). By comparing the expression of the gene in the development process of fertile and sterile sesame anthers, the expression of the gene in the anther tetrad period of sterile plants is higher than that of fertile anthers, and the expression of the SiOASA gene in the fertile and sterile anthers has no obvious difference in the microspore and mature pollen periods (B picture in figure 2). A transformation vector PRI101-AN-SiOASA (B picture in figure 3) is obtained by constructing AN over-expression vector of the gene, and the obtained transformation vector PRI101-AN-SiOASA is transformed into Columbia ecological arabidopsis thaliana to obtain AN SiOASA over-expression transgenic positive arabidopsis thaliana plant. The expression level was detected and four families with appropriate expression level were selected for subsequent experiments (panel A in FIG. 4). It was found by comparing the growth and development processes of the wild type (non-transgenic plant, the same below) and the transgenic plant that there was no significant difference between them at the vegetative growth stage, but the reproductive development of the transgenic plant was affected, the transgenic plant had significantly shortened silique and shriveled silique (panels B to E in fig. 4). The pollen viability is detected by using the acetic acid carmine staining, and the result shows that the pollen of the wild plant is deeply stained, the pollen is oval and full in shape (figure 4F), while the pollen of the transgenic plant is basically not stained, the pollen is small, the pollen is shrunken, and the pollen viability of the transgenic plant is reduced (figure 4G). The observation of a scanning electron microscope shows that the fertile pollen is full, elliptical or circular, has consistent size, the surface of the pollen has a regular three-dimensional ornamentation structure (a picture H in a picture 4), and the transgenic plants have sunken pollen, shriveled pollen and different pollen forms. The surface of the pollen also lacks a regular three-dimensional ornamentation (panel I in FIG. 4), indicating pollen abortion of the transgenic plant. Observation through paraffin sections showed that there was no significant difference in microspore morphology between wild-type and SiOASA overexpressing plants in the uninucleate limbic stage (panels a to B in fig. 5), microspores of wild-type plants formed mature trinuclear pollen grains through mitosis during the subsequent pollen maturation stage (panels C, E in fig. 5), whereas SiOASA overexpressing plants were pollen vacuolated and finally aborted (panels D, F in fig. 5). Further observation of tapetum and microspore development by transmission electron microscopy revealed that at stage9-10, wild-type tapetum was rich in plastids and vesicles (panel a in fig. 6) and microspore was rich in inclusions in the cytoplasm (panel B in fig. 6). The tapetum cells of the overexpressed plants were not significantly different from the wild-type tapetum (panel C in FIG. 6), whereas the microspores of the SiOASA overexpressed plants contained fewer organelles within the cytoplasm (panel D in FIG. 6). During stage10-11, tapetum cells gradually degraded, tapetum cells were incomplete in morphology (panel E in FIG. 6), microspores underwent mitosis, pollen wall material was deposited in order on the surface of microspores (panel F in FIG. 6), whereas SiOASA overexpressing plant tapetum cells were intact, microspore cytosol contents gradually disintegrated (panel G and panel H in FIG. 6), wild-type tapetum cells had been substantially degraded during stage11-12, only a few debris were seen, microspores developed into mature pollen grains (panel I in FIG. 6), whereas SiOASA overexpressing plant tapetum cells still had a more intact organelle structure, microspores vacuolated (panel J in FIG. 6), and during stage12-13, substantially no wild-type tapetum was observed, oil-containing layers resulting from tapetum degradation were embedded between the outer walls of pollen and covering the pollen surface, mature pollen was formed (K-plot in FIG. 6), whereas in SiOASA overexpressing plants there was still degraded tapetum cellular material transported to the surface of the small gown, and there was an outer wall of pollen on the surface of the shrunken microspores, but an abnormal coverage of the inner wall of pollen and the oil-containing layer (L-plot in FIG. 6). These results indicate that the SiOASA gene causes PCD delay of tapetum and mitosis abnormality of microspore, and finally causes vacuolation of microspore, coverage abnormality of pollen inner wall and oil-containing layer, and pollen abortion.

The specific operation steps are as follows:

(1) through sesame genome information, cDNA amplification primers SiOASA-F and SiOASA-R are designed, and a cDNA sequence of SiOASA (shown as SEQ ID NO: 1) is amplified by taking sesame bud cDNA as a template. The target sequence was ligated to PGEM-T (purchased from Promega, USA) vector by TA cloning, and the positive clone T-SiOASA without mutation was obtained by sequencing. Designing excessive expression vector construction primers SiOASA-MF and SiOASA-MR, amplifying by using the obtained positive clone T-SiOASA without mutation as a template to obtain a target fragment with an enzyme cutting site, connecting the target fragment to a PGEM-T vector (purchased from Promega corporation, USA) through TA cloning, and sequencing to obtain the positive clone T-ovSiOASA without mutation. The DNA sequences of the primers used are as follows:

SiOASA-F：5'-ATGGCGTCCGTGGTGAACAAGC-3'(SEQ ID NO:3)

SiOASA-R：5'-TCACACTTCAGGTTGCATCTTCTCAC-3'(SEQ ID NO:4)

SiOASA-MF：5'-GGAATTCCATATG(NDE1)ATGGCGTCCGTGGTGAACAAGC-3'(SEQ ID NO:5)

SiOASA-MR：5'-CGCGGATCC(BAMH1)TCACACTTCAGGTTGCATCTTCTCAC-3'(SEQ ID NO:6)

(2) the obtained T-ovSiOASA plasmid and PRI101-AN vector plasmid (purchased from Takara Bio-engineering Co., Ltd., Japan) (the vector plasmid is shown in A in FIG. 3) are subjected to enzyme digestion ligation reaction, a target gene fragment is ligated to the vector PRI101-AN, and then Escherichia coli competent cell TOP10 is transformed by heat to obtain a recombinant vector containing the target gene, and the applicant named the recombinant vector as plant recombinant vector PRI101-AN-SiOASA (the vector construction diagram is shown in A in FIG. 3). The vector is introduced into arabidopsis thaliana by utilizing an agrobacterium-mediated transgenic method to obtain a transformed plant.

(3) Obtaining transgenic positive plants by means of kanamycin resistance screening and segregation ratio statistics, detecting the expression quantity of the transgenic plants by means of RT-PCR, and identifying the phenotype of the transgenic plants.

(4) And identifying the pollen fertility of the wild plant pollen and the transgenic plant by a carmine acetate dyeing method.

(5) Fresh pollen of the SiOASA overexpression transgenic positive plant and the wild plant which grow for 8 weeks is taken, and the morphology of the pollen is observed through a scanning electron microscope.

(6) And observing the cytological characteristics of the anthers of the SiOASA overexpression transgenic positive plant and the wild plant in different development periods through paraffin section and a transmission electron microscope.

The invention has the advantages that:

the cloned SiOASA gene can influence the fertility of pollen, so that a plant male sterile plant can be purposefully created by using a genetic engineering technology, can be used for plant cross breeding, and can be used for researching a molecular mechanism of anther development.

Drawings

FIG. 1: results of the clustering analysis of the SiOASA coding sequence with acetylserine (thiol) lyase in arabidopsis thaliana using ClustalW software and MEGA4.0 software (publicly available software). The similarity relation between the cloned SiOASA gene and the Arabidopsis OASA gene is relatively close as shown by cluster analysis.

FIG. 2: and detecting the tissue expression pattern of the SiOASA gene by using an RT-PCR method. Description of reference numerals: a diagram in figure 2 is the expression of SiOASA in sesame root, stem, leaf and flower detected by RT-PCR. FIG. 2B shows the expression difference of SiOASA in the tetrad period, microspore period and pollen maturation period of sesame fertile anther and sterile anther by RT-PCR detection.

FIG. 3: the starting vector used for constructing the overexpression vector. Description of reference numerals: FIG. 3A is a schematic diagram of the construction of the overexpression vector PRI101-AN-SiOASA used in the present invention; FIG. 3B is a diagram schematically showing DNA of the overexpression vector pRI-101-AN used in the present invention; .

FIG. 4: schematic representation of expression level and phenotype of SiOASA overexpression transgenic Arabidopsis thaliana. Description of reference numerals: FIG. 4A is the expression level of transgenic Arabidopsis plants detected by RT-PCR. Wherein the first lane from the left is the expression of SiOASA in wild-type plants, the second lane is the expression of SiOASA in empty transformed plants, and the third to sixth lanes are the expression of SiOASA in four different overexpression families. Arabidopsis Atactin2 was used as an internal control. FIG. 4B is a phenotypic plot of wild type Arabidopsis and transgenic Arabidopsis grown for 8 weeks, with the overexpression transgenic Arabidopsis plant on the left, the wild type Arabidopsis plant in the middle, and the empty-transformed plant on the right. Panel C in FIG. 4 is an enlarged view of the silique phenotype of a plant overexpressing transgenic Arabidopsis thaliana, and panel D in FIG. 4 is an enlarged view of the silique phenotype of a plant of wild-type Arabidopsis thaliana. Panel E in FIG. 4 is an enlarged view of the silique phenotype of the unloaded transformed plants. FIG. 4 is a graph F showing the acetic acid magenta staining of wild-type pollen, and a graph G showing the acetic acid magenta staining of over-expressed transgenic Arabidopsis pollen. FIG. 4 is a scanning electron micrograph of mature pollen of wild type Arabidopsis thaliana as shown in FIG. H-I. And J-K in figure 4 is a scanning electron microscope image of mature pollen of transgenic arabidopsis thaliana.

FIG. 5: the cytological characteristics of the anthers of the wild type and SiOASA overexpression plants in different development stages. Description of reference numerals: FIG. 5A is a cross section of the wild type anther stage9-10 and FIG. 5B is a cross section of the SiOASA overexpressing plant anther stage 9-10. FIG. 5, panel C, is a cross-section of the wild-type anther stage11-12 and FIG. 5, panel D, is a cross-section of the SiOASA overexpressing plant anther stage 11-12. FIG. 5E is a cross-sectional view of the wild type anther stage13-14 period, and F in FIG. 5 is a cross-sectional view of the SiOASA overexpressing plant anther stage13-14 period.

FIG. 6: and (3) observing the development of tapetum and microspore of the wild type and SiOASA overexpression plants by a transmission electron microscope. Description of reference numerals: panel A of FIG. 6 shows the ultrastructure of tapetum cells at the time of wild type anther stage 9-10. Panel B of FIG. 6 is microspores at stage9-10 of wild type anther stage. FIG. 6C is the microstructure of tapetum cells during the period of SiOASA overexpression plant anther stage 9-10. Panel D of FIG. 6 shows microspore morphological structure at the anther stage9-10 stage of the overexpressed plants. FIG. 6, Panel E, shows the ultrastructure of tapetum and microspores at the time of wild type anther stage 10-11. Panel F of FIG. 6 shows microspores at stage10-11 of the wild type anther stage. FIG. 6, panel G, shows the tapetum at the time of SiOASA overexpression plant anther stage 10-11. FIG. 6, panel H, shows the microspore morphology at the time of anther stage10-11 in SiOASA overexpressing plants. Panel I of FIG. 6 shows the ultrastructure of anther tapetum and pollen grains at the time of wild type stage 11-12. FIG. 6, panel J, shows the morphology of anther tapetum and pollen grains during the time period of SiOASA overexpression plant stage 11-12. FIG. 6 shows K-map of anther tapetum and mature pollen grain structure at time stage wild type stage 12-13. FIG. 6 shows L-diagram of the structure of anther tapetum and pollen grains at the time of SiOASA overexpression of stage12-13 of the plant.

Detailed Description

Description of the sequence listing

The sequence table SEQ ID NO 1 is the nucleotide sequence of the SiOASA gene separated and cloned by the invention. Wherein, 1-1191bp is ORF (coding reading frame), and the corresponding amino acid sequence of the gene is the sequence shown by 1-1191 bp. The gene encodes 396 amino acid residues.

The sequence table SEQ ID NO 2 is the protein sequence coded by SiOASA gene.

The following examples define the invention and describe the method of the invention in isolating and cloning nucleotide fragments containing the complete coding segment of the SiOASA gene, and verifying the function of the SiOASA gene. From the following description and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Example 1 isolation cloning and expression Pattern analysis of the SiOASA Gene

The specific steps of the invention are as follows:

A. extraction of total RNA of different tissues of sesame and obtaining of cDNA

Respectively extracting the root, stem, leaf and flower bud tissue samples of sesame and the RNA of fertile and sterile anthers of sesame at the tetrad stage of 95ms-5, the microspore stage and the mature pollen stage. RNA was extracted using Trizol kit (purchased from Invitrogen, usa). This was reverse-transcribed to synthesize cDNA using reverse transcriptase Superscript III (purchased from Invitrogen, USA) under the following conditions: 5min at 65 ℃, 60min at 50 ℃ and 10min at 70 ℃.

Isolation cloning of the SiOASA Gene

Taking sesame genome as a reference sequence (http:// ocri-genetics. org/Sinbase _ v2.0/), designing a cDNA amplification primer of SiOASA, wherein the primer sequence is SiOASA-F: 5'-ATGGCGTCCGTGGTGAACAAGC-3' and SiOASA-R: 5'-TCACACTTCAGGTTGCATCTTCTCAC-3' are provided. And amplifying the cDNA sequence of the SiOASA by PCR by using the bud cDNA as a template. The target sequence was ligated to PGEM-T vector (purchased from Promega, USA) by TA cloning, and the mutation-free positive clone T-SiOASA with the nucleotide sequence shown in SEQ ID NO:1 was obtained by sequencing.

Analysis of expression Pattern of SiOASA

Respectively taking the cDNA of the roots, stems, leaves and buds synthesized by reverse transcription as templates, and detecting the expression mode of the SiOASA by adopting RT-PCR, wherein the used primers are as follows: SiOASA-RT-F: (5'-CCAACAAGTCCGACCTCCGCT-3') and SiOASA-RT-R: (5'-TTCCCGTATTTCCACTTGTAGGTT-3'). Simultaneously, using a primer SiUbiquitin 6-F: (5'-CACCAAGCCGAAGAAGATCAAG-3') and Siubiquitin 6-R: (5'-CCTCAGCCTCTGCACCTTTC-3') sesame Siubiquitin6 gene (the gene sequence is shown in GenBank accession number: JP631638) is specifically amplified and used as an internal reference for relative quantitative analysis. The results show that: the SiOASA gene is expressed in all roots, stems, leaves, and flower buds, and the expression level is highest in the flower buds (see a-diagram in fig. 2). Using cDNA of fertile and sterile anthers in the tetrad period, the microspore period and the mature pollen period as a template, adopting RT-PCR to detect the expression mode of SiOASA in the sterile and fertile anthers, and using primers as follows: SiOASA-RT-F: (5'-CCAACAAGTCCGACCTCCGCT-3') and SiOASA-RT-R: (5'-TTCCCGTATTTCCACTTGTAGGTT-3'). SiActin7 (NM-001304413) as an internal reference control, and the primers are SiActin 7-F: (TTTGAGCAGGAACTGGACACT) and SiActin 7-R: (ACAACACTTCTGGACAACGGA). The results show that in the tetrad stage, the expression of SiOASA is higher in sterile anthers than in fertile anthers, and the expression of SiOASA is not significantly different in other stages. Expression patterns suggest that SiOASA may be involved in reproductive development.

Example 2: construction of SiOASA gene plant overexpression vector

Designing a primer for constructing an expression vector according to the obtained nucleotide sequence of SEQ ID NO. 1, wherein the specific steps are respectively adding enzyme cutting sites at two ends of the primer, and the primer sequences are respectively SiOASA-MF: 5'-GGAATTCCATATG (NDE1) ATGGCGTCCGTGGTGAACAAGC-3' and SiOASA-MR: 5'-CGCGGATCC (BAMH1) TCACACTTCAGGTTGCATCTTCTCAC-3', and carrying out PCR amplification by using a T-SiOASA plasmid as a template, wherein the PCR reaction system is as follows: 10 × buffer 2 μ l; dNTP 0.4 u l; forward and reverse primers (upstream and downstream) each 0.2. mu.M; pfu polymerase 0.2. mu.l, add ddH₂Make up to 20. mu.l. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; 28 cycles of 94 ℃ for 30sec, 58 ℃ for 30sec, and 72 ℃ for 1 min; the temperature of the mixture is extended to 7min at 72 ℃,the PCR product is connected to a PGEM-T carrier through TA cloning, the connecting product is transformed into escherichia coli competent cells TOP10 through heat shock, and the PCR product is expressed by using a primer SiOASA-MF which is specific to SiOASA: 5'-GGAATTCCATATG (NDE1) ATGGCGTCCGTGGTGAACAAGC-3' and SiOASA-MR: 5'-CGCGGATCC (BAMH1) TCACACTTCAGGTTGCATCTTCTCAC-3' were PCR tested to pick positive clones and activate the extracted plasmids. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; 30sec at 94 ℃, 30sec at 55 ℃, 1min at 72 ℃ and 25 cycles; extension at 72 ℃ for 7 min. Positive clone T-ovSiOASA without mutation was obtained by sequencing. T-ovSiOASA and AN expression vector pRI101-AN (Takara Bio Inc., Japan) were subjected to double digestion with NDE1 and BAMH1 restriction enzymes (available from Takara Bio Inc.), respectively, in the following reaction scheme: 10 XFastduest Buffer 2. mu.l, DNA 1. mu.g, NDE1 and BAMH1 each 1. mu.l, plus ddH₂And (2) fully and uniformly mixing O to 20 mu l, placing in a constant temperature oven at 37 ℃ for 1h, detecting enzyme digestion products by gel electrophoresis, respectively recovering a target gene fragment (the target fragment is a small fragment) and a target carrier fragment (the target fragment is a large fragment) by using a DNA gel recovery kit (purchased from Axygen company, USA), and then performing a ligation reaction on the recovered target gene fragment and the target carrier fragment, wherein the ligation reaction system is as follows: according to 100ng of the target vector fragment and 50ng of the target gene fragment, 2. mu.l of 10 XT 4 ligase Buffer and 1. mu.l of T4 ligase (purchased from Thermo, USA) were added, sterile water was added to 20. mu.l and mixed, and after 10min at 22 ℃, ligation reaction was performed overnight at 4 ℃. Coli competent cells TOP10 were then transformed by conventional heat shock methods with SiOASA-MF primers specific for SiOASA: 5'-GGAATTCCATATG (NDE1) ATGGCGTCCGTGGTGAACAAGC-3' and SiOASA-MR: 5'-CGCGGATCC (BAMH1) TCACACTTCAGGTTGCATCTTCTCAC-3' were PCR tested to pick positive clones, which were sequenced. The PCR reaction system is as follows: 10 × buffer 2 μ l; dNTP 0.4 u l; upstream and downstream primers are 0.2. mu.M each; taq polymerase 0.2. mu.l, ddH₂Make up to 20. mu.l. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; 30sec at 94 ℃, 30sec at 55 ℃, 1min at 72 ℃ and 25 cycles; extension at 72 ℃ for 7 min. The clones determined to be positive were the recombinant vector PRI101-AN-SiOASA (see Panel A in FIG. 3) obtained for transformation.

The constructed PRI101-AN-SiOASA vector is transformed into Agrobacterium strain GV3101(Roger et al, 2000, A guide to Agrobacterium binding Ti vectors. trends in Plant Sci,5, 1360) -1385), and a single colony is selected and inoculated into LB liquid medium containing 50mg/L rifampicin and 100mg/L kanamycin, and shaken at 150rpm and 28 ℃ for 48h, and the volume ratio of the bacterial liquid to the glycerol is 1: 1, adding into a 1.5mL centrifuge tube, mixing uniformly, and preserving at-70 ℃. Then, the arabidopsis thaliana is transformed by an agrobacterium-mediated transformation method.

The LB medium formula described above and in the following is: 10g/L of peptone, 5g/L of yeast extract and 10g/L of NaCl; adjusting pH to 7.2 with 5mM NaOH; adding distilled water to constant volume of 1L; sterilizing at 121-125 deg.C for 15-20 min. The LB solid medium was added with 8g of agar per liter.

Example 3 genetic transformation and screening identification of the SiOASA Gene

The method comprises the following specific steps:

A. preparation of Arabidopsis thaliana

The test material was wild type Arabidopsis thaliana (i.e., non-transgenic, abbreviated WT, see below) (Arabidopsis thaliana L. Columbia ecotype). The wild type arabidopsis seeds are dibbled into nutrient soil special for arabidopsis planting (trade name: culture bud, purchased from Zhenju province, Zhenjiang city) and put into an artificial culture room (16 hours of illumination, 8 hours of darkness, culture temperature 22 +/-2 ℃) for growth. And (4) performing final singling when the arabidopsis grows to about 4 leaves so as to control the growth density of the arabidopsis. The transformation can be carried out when the flower begins to bloom after the arabidopsis grows for about 6 weeks, and enough water is poured into the arabidopsis one day before the transformation.

B. Agrobacterium activation

Taking out a glycerol tube of the preserved GV3101 strain containing the target gene (namely the cloned SiOASA gene of the invention) from an ultra-low temperature refrigerator, melting the glycerol tube on ice, streaking the glycerol tube on an LB solid culture medium containing 50mg/L rifampicin and 100mg/L kanamycin, carrying out dark culture at 28 ℃ for 36-48h, picking out a single clear colony in a dish after the single colony grows out, carrying out overnight culture (26.5 ℃,100 rpm) in an LB liquid culture medium added with 50mg/L rifampicin and 100mg/L kanamycin, and using the single colony for transformation when the OD600 is 0.8-1.0;

transferring the bacterial liquid into a centrifuge tube, centrifuging at 5000rpm for 5min, and discarding the supernatant culture medium. Adding 100ml of sucrose solution with concentration of 5% (W/V), resuspending Agrobacterium GV3101, and recovering in a shaker at 28 deg.C for 1-2 h. Adding 0.05% (V/V) of surfactant Silwet L-77, shaking and mixing uniformly.

C. Agrobacterium-mediated inflorescence dip-dyeing method for transforming arabidopsis thaliana and screening of transgenic arabidopsis thaliana

Transformation methods and procedure reference for Agrobacterium-mediated floral-dip transformation of Arabidopsis thaliana (Zhang et al, 2006, Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nature Protocols,1, 641-646). The method comprises the following specific steps:

(1) immersing an arabidopsis flower device into the agrobacterium suspension, slightly stirring for about 30s, sucking off excessive bacteria liquid by using a paper towel, wrapping the arabidopsis flower plant by using a black plastic bag, and carrying out moisture preservation and light-proof treatment for 24 h.

(2) The plastic bag is gradually uncovered for ventilation and cultured normally.

(3) The operation of (1) above was repeated after one week.

(4) The watering can be stopped and the seeds harvested when the seeds are mature, i.e. T0 generation seeds.

(5) Disinfecting the harvested seeds: soaking in 70% (V/V) ethanol for 1min, and suspending the seeds in the above step; and then washed four times with sterile water.

(6) The treated seeds were uniformly spread on the surface of a kanamycin-containing Arabidopsis growth medium (1/2 MS medium containing 100mg/L kanamycin) with Top agar (0.1% (W/V) agar aqueous solution).

(7) Transferring into a culture room for 10 days, selecting a plant with kanamycin resistance, transplanting into soil for culture, and collecting seeds according to single plants after maturation, namely T1 generation seeds;

(8) the harvested T1 generation seeds were subjected to the operations of (5) - (6) for 1 time.

(10) After 10 days of normal culture, the separation ratio of kanamycin-resistant plants and non-resistant plants was calculated and subjected to statistical analysis.

(11) Selecting the plant line with the separation ratio of resistant and non-resistant plants being 3:1 as a single copy plant line, transplanting the single copy plant line into soil for culture, and harvesting seeds according to the single plant after the single copy plant line is mature, namely T2 generation seeds.

D. Inbred detection of transgenic Arabidopsis plants

The collected T2 generation seeds are transformed into arabidopsis thaliana and the operation steps (5) - (6) of screening transgenic arabidopsis thaliana by the agrobacterium-mediated inflorescence dip-dyeing method in the embodiment 3 are operated for 1 time; then, the transgenic plants were transferred to a culture room and cultured for 10 days to see whether or not resistance segregation occurred on a solid screening medium (MS medium containing 100mg/L kanamycin), and the lines not subjected to resistance segregation were regarded as transgenic pure lines and used for further phenotypic analysis and functional identification.

Example 4: expression analysis of transgenic Arabidopsis

(1) The above-ground parts of T3 generation Arabidopsis thaliana plants were collected to extract RNA using Trizol kit (purchased from Sigma, USA) (see the description of the kit for specific procedures).

(2) cDNA was synthesized using 3. mu.g of total RNA as a template, mixed with 1. mu.l of 500. mu.g/ml oligo-dT (15) primer (purchased from Promega, USA), 1. mu.l of 10mM dNTP, DEPC water, and made into a total volume of 12. mu.l; then, denaturation is carried out for 5min at 65 ℃, and then quenching is carried out on ice; a further 8. mu.l of a reagent containing 4. mu.l of RT buffer, 2. mu.l of 0.1M dithiothreitol, 40units ofA mixture of ribonuclear Inhibitor (available from Promega, usa) and 200units of Superscript iii reverse transcriptase (available from Invitrogen, usa); the first chain is synthesized after 1h of warm bath at 50 ℃; after the reaction was completed, Superscript III reverse transcriptase was inactivated by treatment at 75 ℃ for 15 min. Each cDNA was diluted to 200. mu.l and stored at-20 ℃ until use.

(3) The cDNA synthesized by reverse transcription is used as a template, and primers SiOASA-F and SiOASA-R are used for carrying out specific PCR amplification on the SiOASA gene (the length of an amplification product is 1191 bp). At the same time, the Arabidopsis Atactin2(GenBank accession number: NM-179953) gene is used as the reference gene for specific amplification (the length of the amplification product is 216 bp). The total volume of the PCR reaction system was 20. mu.l, 1. mu.l (about 50ng) of DNA template, 1 XTaq enzyme reaction buffer, and 25mM MgCL₂1.2. mu.l, 1.5. mu.l of 2mM dNTP, 0.2. mu.l of 10. mu.M primer, 0.3 unit Taq enzyme, add ddH₂O to 20. mu.l.The reaction procedure is as follows: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 30s, and denaturation at 72 ℃ for 30s for 30cycles, and elongation at 72 ℃ for 5 min. Mu.l of the obtained PCR product was detected by 0.8% agarose gel electrophoresis.

The primers used were:

SiOASA-F：5'-ATGGCGTCCGTGGTGAACAAGC-3'

SiOASA-R：5'-TCACACTTCAGGTTGCATCTTCTCAC-3'

Atactin2-F：5'-CACTGTGCCAATCTACGAGGGT-3'

Atactin2-R：5'-CACAAACGAGGGCTGGAACAAG-3'

example 5: functional verification of SiOASA gene by using transgenic arabidopsis thaliana

Phenotypic characterization of SiOASA overexpressing Arabidopsis

Wild arabidopsis thaliana (WT), empty vector transformed plant (EV) and T3 generation plant of over-expression family are planted in nutrient soil (trade name: Bao, producing area: Zhenjiang city, Jiangsu province) special for arabidopsis thaliana planting and placed in an artificial culture room (16h illumination, 22 +/-2 ℃). The change of the nutrition and reproductive development of the transgenic plants is observed by comparing with the wild type and the empty vector transformed plants. After the plants grow for 8 weeks, photographs were taken.

B. Acetic acid magenta dyeing

10 flowers of the transgenic plant and the wild plant which are open on the same day are taken, pollen is separated on a glass slide, and 0.5 percent of acetic acid carmine is adopted to stain the pollen. Each flower was observed for 3 fields. Wherein: full, dark red counts as normal (fertile) pollen; the pollen is marked as sterile if it is thin, light or not.

C. Observing pollen morphology by using scanning electron microscope

The anthers of 5 mature flowers on the transgenic plant and the wild plant are respectively taken, fixed by 2.5 percent glutaraldehyde, vacuumized, and dehydrated by alcohol gradient at each level for 30min each time. The alcohol gradient was 30%, 50%, 70%, 80%, 90%, 100% ethanol in sequence (co-treatment twice). Then using liquid CO₂Drying by critical point drying method (conventional method), adhering the dried sample on a metal stage with adhesive with good conductivity, and spraying metal with ion sputtering coater. Finally in JSM-6390 the anthers and pollen were observed under a scanning electron microscope and photographed.

D. Paraffin section observation wild type and SiOASA overexpression plant anther development

Anthers of wild plants and transgenic plants in different development periods are respectively taken and fixed in FAA fixing solution, the solution is vacuumized until the anthers sink to the bottom of a tube, and the fixation is carried out overnight. Sequentially dehydrating with 50%, 70%, 85%, 95% and 100% gradient alcohol, after 2h of each stage, passing through xylene transparent, and embedding in pure paraffin after gradient paraffin (50%, 75% and 100%). The wax blocks were cut to 4um thickness using a Leica RM2235 microtome, and the sections were spread for 5min at 42 ℃ and then overnight in a 37 ℃ incubator. Then, the slices are sequentially placed into xylene I for 20min, xylene II for 20min, absolute ethyl alcohol I for 10min, absolute ethyl alcohol II for 10min to 95% ethyl alcohol for 5min to 90% ethyl alcohol for 5min to 80% ethyl alcohol for 5min to 70% ethyl alcohol for 5min, and distilled water is washed for dewaxing. The slices are dyed in a solid green dyeing solution preheated at 60 ℃ for 6min, and are washed by distilled water for 1 time. Soaking the slices in saturated picric acid water solution for 10min, and rinsing with distilled water. Placing in 1% phosphomolybdic acid water solution for 1min, and rinsing with distilled water for 1 min. Coloring the slices with safranine dye solution for 3 min. Dehydrating with 70%, 95%, and 100% ethanol twice for 5min, respectively, and sealing with neutral gum for 5 min.

E. Transmission electron microscope observation of wild type and SiOASA overexpression plant tapetum and microspore development

Anthers of Wild Type (WT) and SiOASA overexpressing plants at different developmental stages were separately removed and fixed to the bottom of the material by aspiration in 2.5% glutaraldehyde fixing solution, then left overnight at room temperature, followed by post-fixation with osmic acid. The fixed material is subjected to alcohol gradient dehydration and then embedded in Spurt resin, a come ultrathin slicer (Leica EM UC7) is used for cutting the fixed material into slices with the thickness of 50nm, the slices are fished on a 200-mesh copper net, and then uranyl acetate and lead citrate solution are used for double dyeing. The section results were observed under a transmission electron microscope (Tecnai) and photographed.

Specifically, the following description is provided: the invention (patent application) obtains the subsidy of Chinese national science fund (number 31701468).

Sequence listing

<110> institute of oil crop of academy of agricultural sciences of China

Application of sesame SiOASA gene in plant male sterility

<141> 2020-11-24

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1191

<212> DNA

<213> sesame (Sesamum indicum)

<220>

<221> gene

<222> (1)..(1191)

<220>

<221> CDS

<222> (1)..(1191)

<400> 1

atg gcg tcc gtg gtg aac aag ccg ttt act tct ttc tgc gcc gcc aac 48

Met Ala Ser Val Val Asn Lys Pro Phe Thr Ser Phe Cys Ala Ala Asn

1 5 10 15

aag tcc gac ctc cgc tcg ccg gaa tta ttc gtt ggc aaa cgc tgc cgt 96

Lys Ser Asp Leu Arg Ser Pro Glu Leu Phe Val Gly Lys Arg Cys Arg

20 25 30

atc cga ggc agg agg tct ggc aat agt gtt aga att gcc acc aat gct 144

Ile Arg Gly Arg Arg Ser Gly Asn Ser Val Arg Ile Ala Thr Asn Ala

35 40 45

gtt gtt agt aga aag aat cac gat agt gac tgt ggg att gtg tgt aag 192

Val Val Ser Arg Lys Asn His Asp Ser Asp Cys Gly Ile Val Cys Lys

50 55 60

gct ctc tcc gtg gag cca cag acg gag att gaa ggc ctt aac atc gcc 240

Ala Leu Ser Val Glu Pro Gln Thr Glu Ile Glu Gly Leu Asn Ile Ala

65 70 75 80

gaa gat gtt act cag ctc att ggg aag aca ccg atg gtt tac ttg aat 288

Glu Asp Val Thr Gln Leu Ile Gly Lys Thr Pro Met Val Tyr Leu Asn

85 90 95

aat att gta aaa ggt tgt gtt gca aat ata gca gca aag ctt gag att 336

Asn Ile Val Lys Gly Cys Val Ala Asn Ile Ala Ala Lys Leu Glu Ile

100 105 110

atg gag ccg tgt tgc agt gtc aaa gat agg ata ggg tac agt atg atc 384

Met Glu Pro Cys Cys Ser Val Lys Asp Arg Ile Gly Tyr Ser Met Ile

115 120 125

act gat gct gag cag aaa ggg ctt ata act cca ggg aag agt gta ttg 432

Thr Asp Ala Glu Gln Lys Gly Leu Ile Thr Pro Gly Lys Ser Val Leu

130 135 140

gtt gaa cct aca agt gga aat acg gga att ggc ctt gca ttt att gct 480

Val Glu Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Phe Ile Ala

145 150 155 160

gct tca aaa ggc tac aag ctc atc tta aca atg cct gcg tcc atg agt 528

Ala Ser Lys Gly Tyr Lys Leu Ile Leu Thr Met Pro Ala Ser Met Ser

165 170 175

ctt gag aga agg gtt ctc ttg aaa gct ttt gga gct gaa cta gtt tta 576

Leu Glu Arg Arg Val Leu Leu Lys Ala Phe Gly Ala Glu Leu Val Leu

180 185 190

act gac gca gcc aaa ggc atg aaa gga gct gtc caa aag gca gaa gaa 624

Thr Asp Ala Ala Lys Gly Met Lys Gly Ala Val Gln Lys Ala Glu Glu

195 200 205

ata gtg aat agc acc cag aac gca tac atg ctt caa caa ttt gac aac 672

Ile Val Asn Ser Thr Gln Asn Ala Tyr Met Leu Gln Gln Phe Asp Asn

210 215 220

cct gca aat ccc aag att cac tat gaa acc acc ggc cct gag att tgg 720

Pro Ala Asn Pro Lys Ile His Tyr Glu Thr Thr Gly Pro Glu Ile Trp

225 230 235 240

gaa gat aca aaa ggc aag gtg gac atc ctt gtt gct ggg att ggc act 768

Glu Asp Thr Lys Gly Lys Val Asp Ile Leu Val Ala Gly Ile Gly Thr

245 250 255

ggt gga acc att tca ggg gtt ggt cgt tat ctc aaa aaa tat aat cct 816

Gly Gly Thr Ile Ser Gly Val Gly Arg Tyr Leu Lys Lys Tyr Asn Pro

260 265 270

aat ata aag gtt att ggc gtg gaa ccc act gaa agc aac ata cta tca 864

Asn Ile Lys Val Ile Gly Val Glu Pro Thr Glu Ser Asn Ile Leu Ser

275 280 285

ggt gga aaa cct ggc cct cac aaa att caa ggg att gga gca ggt ttt 912

Gly Gly Lys Pro Gly Pro His Lys Ile Gln Gly Ile Gly Ala Gly Phe

290 295 300

att ccg aag aat tta gat caa gat gtg atg gat gaa gtt ata gag ata 960

Ile Pro Lys Asn Leu Asp Gln Asp Val Met Asp Glu Val Ile Glu Ile

305 310 315 320

tca agt gat gaa gct gta gag act gcg aag caa tta gct ctt caa gag 1008

Ser Ser Asp Glu Ala Val Glu Thr Ala Lys Gln Leu Ala Leu Gln Glu

325 330 335

ggc ctg ctg gtg ggt att tct tca gga gca gca gca gct gct gct att 1056

Gly Leu Leu Val Gly Ile Ser Ser Gly Ala Ala Ala Ala Ala Ala Ile

340 345 350

aag gtt gga aag aga cct gaa aat gct gga aag ctt ata gcg gtt gtg 1104

Lys Val Gly Lys Arg Pro Glu Asn Ala Gly Lys Leu Ile Ala Val Val

355 360 365

ttc cct agc ttc ggg gaa cga tac tta tcc aca gtc ctc ttc cag tca 1152

Phe Pro Ser Phe Gly Glu Arg Tyr Leu Ser Thr Val Leu Phe Gln Ser

370 375 380

ata agg gaa gaa tgt gag aag atg caa cct gaa gtg tga 1191

Ile Arg Glu Glu Cys Glu Lys Met Gln Pro Glu Val

385 390 395

<210> 2

<211> 396

<212> PRT

<213> sesame (Sesamum indicum)

<400> 2

Met Ala Ser Val Val Asn Lys Pro Phe Thr Ser Phe Cys Ala Ala Asn

1 5 10 15

Lys Ser Asp Leu Arg Ser Pro Glu Leu Phe Val Gly Lys Arg Cys Arg

20 25 30

Ile Arg Gly Arg Arg Ser Gly Asn Ser Val Arg Ile Ala Thr Asn Ala

35 40 45

Val Val Ser Arg Lys Asn His Asp Ser Asp Cys Gly Ile Val Cys Lys

50 55 60

Ala Leu Ser Val Glu Pro Gln Thr Glu Ile Glu Gly Leu Asn Ile Ala

65 70 75 80

Glu Asp Val Thr Gln Leu Ile Gly Lys Thr Pro Met Val Tyr Leu Asn

85 90 95

Asn Ile Val Lys Gly Cys Val Ala Asn Ile Ala Ala Lys Leu Glu Ile

100 105 110

Met Glu Pro Cys Cys Ser Val Lys Asp Arg Ile Gly Tyr Ser Met Ile

115 120 125

Thr Asp Ala Glu Gln Lys Gly Leu Ile Thr Pro Gly Lys Ser Val Leu

130 135 140

Val Glu Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Phe Ile Ala

145 150 155 160

Ala Ser Lys Gly Tyr Lys Leu Ile Leu Thr Met Pro Ala Ser Met Ser

165 170 175

Leu Glu Arg Arg Val Leu Leu Lys Ala Phe Gly Ala Glu Leu Val Leu

180 185 190

Thr Asp Ala Ala Lys Gly Met Lys Gly Ala Val Gln Lys Ala Glu Glu

195 200 205

Ile Val Asn Ser Thr Gln Asn Ala Tyr Met Leu Gln Gln Phe Asp Asn

210 215 220

Pro Ala Asn Pro Lys Ile His Tyr Glu Thr Thr Gly Pro Glu Ile Trp

225 230 235 240

Glu Asp Thr Lys Gly Lys Val Asp Ile Leu Val Ala Gly Ile Gly Thr

245 250 255

Gly Gly Thr Ile Ser Gly Val Gly Arg Tyr Leu Lys Lys Tyr Asn Pro

260 265 270

Asn Ile Lys Val Ile Gly Val Glu Pro Thr Glu Ser Asn Ile Leu Ser

275 280 285

Gly Gly Lys Pro Gly Pro His Lys Ile Gln Gly Ile Gly Ala Gly Phe

290 295 300

Ile Pro Lys Asn Leu Asp Gln Asp Val Met Asp Glu Val Ile Glu Ile

305 310 315 320

Ser Ser Asp Glu Ala Val Glu Thr Ala Lys Gln Leu Ala Leu Gln Glu

325 330 335

Gly Leu Leu Val Gly Ile Ser Ser Gly Ala Ala Ala Ala Ala Ala Ile

340 345 350

Lys Val Gly Lys Arg Pro Glu Asn Ala Gly Lys Leu Ile Ala Val Val

355 360 365

Phe Pro Ser Phe Gly Glu Arg Tyr Leu Ser Thr Val Leu Phe Gln Ser

370 375 380

Ile Arg Glu Glu Cys Glu Lys Met Gln Pro Glu Val

385 390 395