Gametogenesis
阅读说明：本技术 配子发生 (Gametogenesis ) 是由 P·哈吉科瓦 P·希尔 H·利奇 于 2018-12-21 设计创作，主要内容包括：本发明涉及通过生成减数分裂胜任细胞来诱导配子发生的活体外方法。还提供用于本发明的所述方法中的试剂和试剂盒。本发明适用于医学领域,特定来说适用于不孕症的研究和治疗。(The present invention relates to in vitro methods for inducing gametogenesis by generating meiosis competent cells. Reagents and kits for use in the methods of the invention are also provided. The invention is applicable in the field of medicine, in particular to the study and treatment of infertility.)
1. An in vitro method of generating a meiosis competent cell, the method comprising:
(i) providing a precursor cell, wherein the precursor cell is a cell,
(ii) inhibiting methylation of genomic DNA of the precursor cell,
(iii) treating said precursor cells with an inhibitor of polycombin inhibitory complex, and subsequently
(iv) Propagating the precursor cells over a period of time and under culture conditions suitable for the precursor cells to become meiosis competent cells;
wherein step (ii) and step (iii) may be carried out simultaneously or sequentially in either order.
2. The method of claim 1, wherein the precursor cells are derived from a sample that has been obtained from an individual.
3. The method of claim 1 or claim 2, wherein the precursor cells are stem cells or primordial germ cell-like cells (PGCLC).
4. The method of claim 3, wherein the stem cell is an iPS cell.
5. The method according to any of the preceding claims, wherein the precursor cells express, or begin expressing, Tetl after steps (i) and/or (ii).
6. The method of any preceding claim, wherein the inhibiting step (ii) and the treating step (iii) are sufficient to induce the precursor cells to express a Germline Reprogramming Response (GRR) gene during the propagating step (iv).
7. The method of claim 6, wherein the expression of the GRR gene is associated with or induced by recruitment of a transcriptional activator.
8. The method of claim 7, wherein the transcriptional activator is Tetl.
9. The method of claim 5 or claim 8, wherein the Tetl expression is provided or enhanced exogenously.
10. The method according to any of the preceding claims, wherein prior to or during step (iv), a Tetl protein is exogenously introduced into the precursor cells.
11. The method of claim 9 or claim 10, wherein the exogenously provided or exogenously introduced Tetl is a Tetl fusion construct that targets one or more specific genomic regions.
12. The method of any one of the preceding claims, further comprising:
(v) detecting the expression level of one or more GRR genes in the cell.
13. The method of claim 12, wherein step (v) is performed on the meiosis competent cells after step (iv).
14. The method of any one of the preceding claims, wherein the inhibitor of polycombin inhibitory complex is a PRC1 inhibitor and/or a PRC2 inhibitor.
15. The method of claim 14, wherein said inhibitor of polycombin inhibitory complex is a PRC1 inhibitor.
16. The method of claim 15, wherein the PRC1 inhibitor is PRT 4165.
17. The method of any one of claims 1-14, wherein the inhibitor of polycombin inhibitory complex is an RNAi molecule.
18. The method of any one of the preceding claims, wherein step (ii) is performed by treating the precursor cells with an agent that reduces genomic DNA methylation.
19. The method of claim 18, wherein the agent that reduces genomic DNA methylation is a DNA methyltransferase inhibitor, an agent that prevents DNA methylation deposition, or an agent that inhibits maintenance of DNA methylation.
20. The method of claim 19, wherein the agent that reduces genomic DNA methylation is a DNA methyltransferase inhibitor.
21. The method of claim 20, wherein the DNA methyltransferase inhibitor is a DNMT1 inhibitor.
22. The method of claim 20 or claim 21, wherein the DNA methyltransferase inhibitor is SGI1027 or 5-azacytidine.
23. The method of claim 20 or claim 21, wherein the DNA methyltransferase inhibitor is an RNAi molecule.
24. The method according to any one of claims 1 to 17, wherein step (ii) is performed by using gene editing to inactivate a DNA methyltransferase gene or a component of a DNA methylation mechanism.
25. A meiosis competent cell generated by the method of any of the preceding claims.
26. A method of inducing gametogenesis, said method comprising treating a meiosis competent cell according to claim 25 with retinoic acid.
27. The method of claim 26, wherein the gametogenesis is spermatogenesis.
28. The method of claim 27, wherein the gametogenesis is oogenesis.
29. A gametocyte produced by the method of any one of claims 21-23.
30. A gamete derived from the gametocyte of claim 29.
31. A kit for generating in vitro a meiosis competent cell according to claim 25, said kit comprising a methylation inhibitor and an inhibitor of polycombin inhibitory complex.
32. The kit of claim 31, further comprising retinoic acid.
33. A method of assessing fertility in a mammal, the method comprising determining the nucleic acid sequence and/or epigenetic status of one or more Germline Reprogramming Response (GRR) genes in cells that have been obtained from the mammal.
34. A method of determining the meiotic capacity of a cell, the method comprising determining the nucleic acid sequence and/or epigenetic status and/or gene expression level of one or more Germline Reprogramming Response (GRR) genes in the genomic DNA of the cell.
Technical Field
The present invention relates to a method for inducing gametogenesis in vitro. Reagents and kits for use in the methods of the invention are also provided. The invention is applicable in the field of medicine, in particular to the study and treatment of infertility.
Background
Gametogenesis is the process by which gametes are produced. In animals, gametogenesis proceeds by division and differentiation of meiotic competent germ cells in the gonads (males are testis; females are ovaries). In males, spermatogenesis occurs in testes to produce sperm from Spermatogonial Stem Cells (SSCs) in a multistep process involving meiosis and mitosis. SSCs are derived from germ cells in postpartum testes, and these germ cells are in turn derived from primordial germ cells (PGC; Phillips et al, 2010), which migrate to the genital ridge during embryogenesis.
In mice, the specification of PGCs (embryonic precursors of germ cells) began on day 6.25 (E6.25) of the embryo1. Following specialization, the nascent PGCs undergo significant global epigenetic changes2-9Including global reduction of genomic 5-methylcytosine (5mC)3,6,7,10. After migration of PGCs across various stages of developing embryos, epigenetic reprogramming including global DNA demethylation continues once the gonads of developing embryos are reached. The molecular mechanisms involved in this DNA demethylation of gonadal PGCs have been the focus of intense research3,4,6,12-19,21And recently published observations indicate that 5mC oxygenase Tet1 is a key factor involved in the correct progression of DNA demethylation in gonadal PGCs12,14,16,17. However, the precise nature of this epigenetic reprogramming remains elusive. Recent studies have shown (Hill et al, 2018) that gonad epigenetic reprogramming is critically involved in the transformation of PGC-germ cells to produce meiotic competent germ cells (and thus allow initiation of gametogenesis)As needed. Importantly, the gonadal reprogramming process represents a barrier that has not been overcome until recently only in the context of gonadal somatic cells5,24,25,27。
Recent studies have reported the transformation of somatic precursor cells into meiosis competent cells by inducible expression of several germline associated genes (Mederano et al, 2016). Other studies have identified Tet1 as a key factor in the regulation of certain germline-associated genes during activation of female gametogenesis16. However, manipulation of Tet1 expression has not been shown to be sufficient to convert somatic precursor cells into meiosis competent cells.
Infertility is a major health problem in humans. For example, male infertility affects 7% of the population, with about 10% of infertile men being azoospermia (Galdon et al, 2016). The provision of meiosis competent cells represents an important step in the in vitro reproduction of gametogenesis, which will find application in research and medicine, in particular in the case of infertility.
Disclosure of Invention
The present inventors have found that two different biochemical conditions are required for efficient activation of a set of genes required for progression from PGC to the germ cell stage of germline development, which genes are referred to herein and in Hill et al 2018 as "germline reprogramming-responsive (grr) genes". These genes (also required for transformation of somatic precursor cells, pluripotent cells or early germ cells into meiosis competent cells) can be activated by first reducing DNA methylation and second removing polycombin-driven inhibition. Once these biochemical conditions are in place, transcription and activation factors including the epigenetic activator Tet1 are able to drive GRR gene expression. Recruitment of transcriptional activators (e.g., Tet1) and/or expression of GRR genes indicates conversion of precursor (somatic) cells to meiosis competent cells.
Accordingly, in a first aspect, the present invention provides an in vitro method of generating a meiosis competent cell, the method comprising:
(i) providing a precursor cell, wherein the precursor cell is a cell,
(ii) inhibiting methylation of genomic DNA of the precursor cell,
(iii) treating said precursor cells with an inhibitor of polycombin inhibitory complex, and subsequently
(iv) Propagating the precursor cells for a period of time and under culture conditions suitable for the precursor cells to become meiosis competent cells;
wherein step (ii) and step (iii) may be carried out simultaneously or sequentially in either order.
In some embodiments, the precursor cells are derived from a sample that has been obtained from an individual. The precursor cell may be a stem cell, a primordial germ cell-like cell (PGCLC) or an early germ cell. In some embodiments, the stem cell is an Induced Pluripotent Stem (iPS) cell or an spermatogonial stem cell
In some embodiments, the inhibiting step (ii) and the treating step (iii) induce the precursor cells to express a Germline Reprogramming Response (GRR) gene during the propagating step (iv). Expression of the GRR gene may be associated with or induced by recruitment of transcriptional activators (e.g., Tet 1). Tet1 may be expressed by a precursor cell, and/or Tet1 may be provided exogenously (e.g., by delivering a nucleic acid that exogenously expresses Tet1, by enhancing or stimulating endogenous expression of Tet1, and/or by providing Tet1 in the form of an exogenous protein). Exogenously supplied Tet1 can be in the form of a fusion construct targeting one or more specific genomic regions. For example, the Tet1 fusion construct may target promoter or enhancer sequences involved in the expression of one or more GRR genes disclosed herein. Providing an effective level of Tet1 as a transcriptional activator enhances expression of the GRR gene. The methods of the invention enable enhanced GRR gene expression, and these methods may comprise increasing or inducing expression of Tet1 and/or targeting Tet1 to one or more GRR genes.
The methods of the invention may also comprise detecting and/or quantifying the expression level of one or more GRR genes in the cell. The GRR genes are listed in table 1. Methods for detecting and/or quantifying expression levels are well known in the art. For example, the mRNA level of a gene can be measured, e.g., by RT-PCR. Protein expression levels can be measured, for example, by assays such as ELISA. Expression of one or more GRR genes can be measured before, during, or after transformation of the precursor cells into meiosis competent cells. Preferably, the expression of one or more GRR genes in the meiosis competent cells after step (iv) is measured. The GRR gene to be measured may be one or more of: dazl, hormd 1, Sycp2, Sycp3, Mae1, Fkbp6 (see table 1). In some embodiments of the invention, the inhibitor of polycombin inhibitory complex is a PRC1 inhibitor (meaning that the PRC1 complex is selectively inhibited). In other embodiments of the invention, the inhibitor of polycombin inhibitory complex is a PRC2 inhibitor (meaning that the PRC2 complex is selectively inhibited). In still other embodiments, the inhibitor of polycombin inhibitory complex inhibits both PRC1 and
In some embodiments, the inhibitor of polycombin inhibitory complex is PRT 4165. In other embodiments, the inhibitor of a polycombin inhibitory complex is an RNAi molecule that selectively reduces expression of a component of the polycombin inhibitory complex (e.g., a component of PRC1 or PRC 2).
In some embodiments of the invention, inhibition of DNA methylation is performed by treating the precursor cells with an agent that reduces genomic DNA methylation (step (ii) of the method). In the context of the present disclosure, 'treating' a cell is understood to mean 'contacting' a cell, even if the cell is exposed to an agent. Furthermore, 'inhibition' includes both 'reduction' and 'total prevention'. For example, the precursor cells may be treated (contacted) with a DNA methyltransferase inhibitor, with an agent that prevents the deposition of DNA methylation, or with an agent that inhibits the maintenance of DNA methylation. 5-Aza-2-deoxycytidine (5-Aza-dc) is an agent that inhibits DNA methylation and also inhibits DNA methylation maintenance.
In embodiments where the agent that reduces methylation of genomic DNA is a DNA methyltransferase inhibitor, the DNA methyltransferase inhibitor can be a DNMT1 inhibitor. For example, the DNA methyltransferase inhibitor may be SGI1027 or 5-azacytidine. Alternatively, the DNA methyltransferase inhibitor may be an RNAi molecule that reduces expression of a component of the DNA methylation machinery. The RNAi molecule can be an siRNA molecule or an miRNA molecule (or a precursor of either).
In other embodiments, inhibition of DNA methylation (step (ii) of the method) can be performed by using techniques that inactivate DNA methyltransferase genes, such as gene editing. Thus, a variety of means of inhibiting DNA methylation can be used to generate meiosis competent cells. For example, a gene knock-out methylation mechanism or a chemical block methylation mechanism can be used.
In a second aspect, the invention provides a meiosis competent cell generated by the methods described herein. Meiosis competent cells may be treated with retinoic acid. Retinoic acid is known to induce gametogenesis in meiotic competent cells.
Thus, in a third aspect, the invention provides a method of inducing gametogenesis in meiosis-competent cells of the invention by treating them with retinoic acid. In some embodiments, the gametogenesis is spermatogenesis. In other embodiments, the gametogenesis is oogenesis.
In another aspect, the invention provides a kit for generating meiosis competent cells in vitro. The kit of the invention comprises a methylation inhibitor and an inhibitor of polycombin inhibitory complex. In some embodiments, the kit also includes retinoic acid. Kits may also include suitable hardware for use in the methods of the invention, e.g., tubes, plates, and the like.
In yet another aspect, the present invention provides a method of assessing fertility in a mammal. In this aspect of the invention, the nucleic acid sequence and/or epigenetic status and/or gene expression level of one or more Germline Reprogramming Response (GRR) genes in cells that have been obtained from the mammal is determined.
In a related aspect, the invention provides a method of determining the meiotic competence of a cell, the method comprising determining the nucleic acid sequence, epigenetic status and/or expression of one or more Germline Reprogramming Response (GRR) genes in the genomic DNA of the cell. The invention also provides kits and/or assay plates having a panel of probes consisting of or consisting essentially of probes that detect expression or epigenetic status or expression of one or more GRR genes as set forth in table 1.
TABLE 1 GRR genes
n.d.: no data; l.c.c.: low confidence classification
As described herein, some embodiments of the invention relate to detecting GRR genes (e.g., sequence, epigenetic state or expression level) or inducing GRR expression. These embodiments may involve detecting or inducing a gene group comprising, consisting of, or consisting essentially of: one or more GRR genes selected from table 1; for example, any 2, any 3, any 4, any 5, any 6, any 7, any 8, any 9, any 10, any 11, any 12, any 13, any 14, any 15, any 16, any 17, any 18, any 19, or any 20 genes selected from table 1. In some embodiments, the genes selected from table 1 may comprise one or more of: dazl, Hormd 1, Sycp2, Sycp3, Mae1,
Therapeutic applications
The methods and products of the invention have therapeutic applications, particularly in infertility treatment. For example, as described herein, meiosis competent cells produced by the methods of the invention can be induced to undergo gametogenesis, e.g., by treatment with Retinoic Acid (RA). Gametocytes (i.e., spermatocytes; oocytes) produced in this manner constitute other aspects of the invention. The gametocytes of the invention have therapeutic applications, for example, in adoptive transfer to sterile individuals: it is envisaged that spermatocytes of the present invention may be adoptively transferred to testes of male infertility patients. It is envisaged that the oocytes of the invention may be adoptively transferred to the ovaries of female infertility patients. These gametocytes can be derived from the patient's own cells, for example by performing the methods of the invention on iPS cells, Spermatogonial Stem Cells (SSCs) or PGCLC derived from the patient's cells. This method allows for the adoptive transfer of gametocytes to a patient.
In other aspects of the invention, the gamete is derived from the gametocyte of the invention in vitro as described above. In this way, the invention provides male gametes, sperm (spermatozoa/sperm) and female gametes, egg cells (ova) that can be used therapeutically. For example, the gametes of the invention can be used In Vitro Fertilization (IVF) applications.
Precursor cell
As explained herein, the methods of the invention are capable of converting somatic precursor cells into meiosis competent cells. This section discusses a variety of cell types that can be used as precursor cells.
In nature, the precursor to meiotic competent germ cells are primordial germ cells. Current in vitro systems aimed at generating PGC-like cells (PGCLC)5,24-26Can successfully reproduce only the early stage of PGC development, in which gonadal reprogramming still appears to be overcome and performed only in the context of the gonadal somatic environment5,24,25,27The barrier of (2). In some embodiments of the invention, the precursor cells are PCGLC obtained by the aforementioned prior art methods.
In other embodiments of the invention, the precursor cells are stem cells, such as embryonic stem cells. Human embryonic stem cells represent a type of precursor cell. It is known in the art that human embryonic stem cells can be obtained without destruction of human embryos (Chung et al, 2008). Mouse embryonic stem cells also represent one type of precursor cell that is effective in demonstrating the efficacy of the present invention. The inventors have found that the epigenetic regulation of the GRR gene in PGCs is very similar to that in serum-grown mouse embryonic stem cells.
Pluripotent stem cells that are not of embryonic origin may also be used as precursor cells in the methods of the invention. Pluripotent stem cells can be obtained by a method comprising:
this technique involves transferring the nucleus from a somatic cell to an oocyte or fertilized egg. In some cases, this can result in the production of animal-human hybrid cells. For example, the cell may be produced by fusion of a human somatic cell with an animal oocyte or fertilized egg or fusion of a human oocyte or fertilized egg with an animal somatic cell.
This technique involves the fusion of somatic cells with embryonic stem cells. This technique can also result in the generation of animal-human hybrid cells as in 1 above.
This technique involves the generation of pluripotent cells from non-pluripotent cells after long-term culture. For example, pluripotent Embryonic Germ (EG) cells have been generated by long-term culture of Primordial Germ Cells (PGCs) (Matsui et al, 1992). The development of pluripotent stem cells after prolonged culture of bone marrow-derived cells has also been reported (Jiang et al, 2002). They called these cells Multipotent Adult Progenitor Cells (MAPCs). Shinohara et al also demonstrated that pluripotent stem cells, known as pluripotent germline stem (mGS) cells, can be generated during the process of culturing Germline Stem (GS) cells from neonatal mouse testes (kantsu-Shinohara et al, 2004).
For example, iPS cells are generated by retrovirus-mediated introduction of transcription factors (e.g., Oct-3/4, Sox2, c-Myc, and KLF4) into mouse embryonic or adult fibroblasts, e.g., as described by Kaji et al, 2002, and non-viral transfection of a single multi-protein expression vector comprising the coding sequences for c-Myc, Klf4, Oct4, and Sox2 linked to a 2A peptide, which can reprogram mouse and human fibroblasts. iPS cells generated with this non-viral vector showed robust expression of pluripotency markers indicating a reprogrammed state that was functionally confirmed by in vitro analysis and development of adult chimeric mice. They successfully established reprogrammed human cell lines from embryonic fibroblasts that stably expressed pluripotency markers. Induced pluripotent stem cells have the advantage that they can be obtained by a method that does not result in the destruction of an embryo, more specifically, a human or mammalian embryo.
Pluripotent stem cells can also be obtained from arrested embryos that terminate divisions and fail to develop morula and blastocysts in vitro, obtained by parthenogenesis or derived from hESC lines from single or biopsy blastomeres.
Thus, aspects of the invention may be carried out or practiced by using cells that are not prepared solely by methods that necessarily involve the destruction of human or animal embryos from which those cells are derived. This optional limitation is especially intended to consider decision G0002/06 of the European patent office extended prosecution Board of application of the European PatentOffice, 25.2008.
In other embodiments, gametocytes (gamete stem cells) can be used as precursor cells. For example, Spermatogonial Stem Cells (SSC) are one preferred precursor cell type for use in the methods of the invention. SSC can be extracted from testis, e.g. from testis biopsies. Testosterone aspirates are a source of SSC-containing cell preparations (extracts). It is envisaged that the method of the invention may be carried out directly on such testis extracts, or it may be carried out on SSCs that have been enriched, selected and/or purified.
The precursor cells can be obtained from an individual. The subject may be a mammalian subject, e.g., a human subject. In some embodiments of the invention, the individual is an infertility patient.
RNA interference (RNAi)
The present invention also encompasses the use of techniques known in the art for the therapeutic down-regulation of a component of a polycombin inhibitory complex or a component of a DNA methylation mechanism. These include the use of RNA interference (RNAi).
Small RNA molecules can be used to regulate gene expression. These include targeted degradation of mRNA by small interfering rna (sirna), post-transcriptional gene silencing (PTG), sequence-specific translational suppression of developmentally regulated mRNA by microrna (mirna), and targeted transcriptional gene silencing.
RNAi mechanisms and the role of small RNAs in targeting heterochromatin complexes and epigenetic gene silencing at specific chromosomal loci have also been demonstrated. Double-stranded RNA (dsRNA) -dependent post-transcriptional silencing, also known as RNA interference (RNAi), is a phenomenon in which dsRNA complexes can target homologous specific genes for silencing within a short period of time. It serves as a signal to promote the degradation of mRNA with sequence identity. 20-nucleotide siRNAs are generally long enough to induce gene-specific silencing, but short enough to evade the host response. The reduction in expression of the targeted gene product can be extensive, with 90% silencing being induced by several siRNA molecules.
Depending on their origin, these RNA sequences are referred to in the art as "short or small interfering RNAs" (sirnas) or "micrornas" (mirnas). Both types of sequences can be used to down-regulate gene expression by binding to complementary RNA and triggering mRNA elimination (RNAi) or suppressing mRNA translation to protein. siRNA is obtained by treating long double-stranded RNA. Micro-interfering RNA (mirna) is an endogenously encoded small non-coding RNA obtained by treatment of short hairpins. Both siRNA and miRNA can inhibit translation of mRNA carrying a partially complementary target sequence without RNA cleavage and degrade mRNA carrying a fully complementary sequence.
Accordingly, the present invention provides the use of these sequences for down-regulating the expression of a component of a polycombin inhibitory complex (e.g. PRC1 and/or PRC 2).
The siRNA is generally double stranded and in order to optimize the effect of RNA mediated down regulation of the function of a target gene, it is preferred that the length of the siRNA molecule is selected to ensure that the RISC complex mediating recognition by the siRNA targeted by the mRNA correctly recognizes the siRNA and that the siRNA is therefore short enough to reduce the host response.
mirnas are typically single stranded and have regions that are partially complementary such that the miRNA is capable of forming a hairpin. mirnas are RNA genes that are transcribed from DNA but not translated into proteins. The DNA sequence encoding the miRNA gene is longer than the miRNA. This DNA sequence comprises the miRNA sequence and a substantially reverse complement. When this DNA sequence is transcribed into a single-stranded RNA molecule, the miRNA sequence and its reverse complement base-pair form a partially double-stranded RNA segment. The design of microRNA sequences is known in the art.
Drawings
Embodiments of the invention will now be described, by way of example, with reference to the accompanying drawings:
figure 1-5 mC and 5hmC kinetics during epigenetic reprogramming a) key events during mouse PGC development. b-c) mESC and individual 5mC (b, left) and 5hmC (b, right) and combined 5mC/5hmC (c) levels (LC/MS) in E9.5 to E13.5 PGCs. (b) The asterisks in (a) refer to the mean. The adjusted p-value is based on analysis of variance and Tukey post hoc testing. (c) The bar graph in (a) depicts the median of the biological replicates depicted in (b). d) Redistribution of 5hmC from uniquely located parts of the genome to the repeat element between E10.5 and E12.5. The p-value is based on a combinatorial analysis of variance and Tukey post hoc test. e) Representative 5hmC immunostaining in E10.5 and E12.5 PGCs. The scale bar represents 10 μm. Details on sample size and how the samples were collected can be found in the statistics and reproducibility section.
FIG. 2-Tet1 protects but does not drive DNA demethylation a-b) representative immunostaining in E13.5 wild type and Tet1-KO PGC against 5hmC (a) or 5mC (b). The scale bar represents 10 μm. c-d) global 5hmC (c) and 5mC (d) levels (LC/MS) in wild type and Tet1-KO PGC. The number of samples is indicated on the curve. Asterisks refer to mean values. The p-value is based on a two-sided Steady t-test (Student's t-test). e) The upper diagram: proportion of differentially methylated regions in E14.5Tet1-KO PGC (p <0.05, > 10% methylation difference; p values are derived from RnBeads software). The following figures: combined 5mC/5hmC levels (RRBS) in E12.5 (middle) and E14.5 (lower) Tet1-KO (red) and wild-type (blue) PGCs for all E14.5 highly methylated 2kB windows. The level of DNA modification from E10.5 wild-type PGCs is also shown (upper panel). The median combination 5mC/5hmC level is indicated by the vertical line. Details on sample size and how the samples were collected can be found in the statistics and reproducibility section.
Figure 3-Germline Reprogramming Response (GRR) gene a) combined promoter 5mC/5hmC level (right), promoter 5hmC level (center) or gene expression level (right) in successive stages of PGC development of the HCP gene cluster (see methods). The upper and lower hinges correspond to the first and third quartiles, and the middle line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within a range of 1.5 x quartiles. b) TSS-centered genomic sequence of methylated and unmethylated HCPs based on up-regulated significance ranking between E10.5 and E14.5 in wild type PGCs (
FIG. 4-epigenetic principle of GRR gene activation a) GRR gene expression kinetics in Tet1-KO PGCs; the p-value is based on a two-sided paired Wilcoxon test (two-sided paired Wilcoxon test). b) Combined 5mC/5hmC levels (RRBS) at the GRR gene in E12.5 or E14.5tet1-KO (red) and wild type (blue) PGCs. For comparison, combined 5mC/5hmC levels in mESC are shown30(%; WGBS) p-values are Log2 (fold change) based on paired double sided wilcoxon test.c-d) GRR gene and other related gene sets between Dnmt-TKO (green) or Tet1-KO Dnmt-TKO and wildtype mESC (c), or wildtype +6h PRT4165 treatment (purple), Dnmt-TKO +6h DMSO treatment (green), or Dnmt-TKO +6h PRT4165 treatment (yellow) and wildtype +6h DMSO treatment mESC (d) FWER adjusted p-values are based on GSEA software (see methods for details.) specific details on sample size and how to collect samples are found in the statistical and reproducibility sections.
Figure 5-characterization of WGBS dataset and validation of AbaSeq method a) distribution of WGBS coverage for each symmetric CpG. For box drawing, upper and lowerHinge corresponds to the first and third quartile, and the middle line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within a range of 1.5 × quartiles15. c-E) density heat map showing the correlation between 5hmC levels at all 2kB windows (minimum 4 symmetrical CpG) in E14mESC as calculated by: (c) TAB-Seq35(x-axis) and AbaSeq15(y-axis); (d) TAB-Seq35(x-axis) and hMeDIP36(y-axis); or (e) AbaSeq15(x-axis) and hMeDIP36(y-axis). For (c-e), a Pearson correlation coefficient (ρ) is shown. Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
FIG. 6-further analysis of 5hmC levels in E10.5 PGC. a) shows E10.5PGC (y-axis) and E14mESCs15Density heatmap of 5hmC levels per 2kB window (minimum 4 cpgs) (y-axis). The pearson correlation coefficient (ρ) is displayed. b) 5hmC levels (AbaSeq) at various regulatory elements in E10.5PGC (left) or E14mESC15For the boxed plot, the upper and lower hinges correspond to the first and third quartiles, and the median line corresponds to the median, and the maximum and minimum correspond to the highest or lowest values, respectively, within the range of 1.5 × quartiles.c) the 5hmC levels in E10.5PGC (upper panel, AbaSeq) and the Metagene curve combining 5mC/5hmC levels (lower panel, WGBS) for genes with different expression levels in E10.5PGC are shown d-E) the 5hmC levels (upper panel, AbaSeq) and the 5mC/5hmC levels (lower panel, WGBS) in E10.5PGC are shown throughout CpG island (d) or throughout the putative activity enhancer (E)35(%; light green) or AbaSeq15Bar graph of 5hmC levels at ICR in E14mESC as determined (read count; dark green), or E10.5PGC as determined by AbaSeq (read count; orange). Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
Figure 7-further analysis of 5mC and 5hmC kinetics in PGC a) combination of 5mC/5hmC (WGBS; left) or 5hmC (AbaSeq; right side) horizontal. The upper and lower hinges correspond to the first and third quartiles, and the middle line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within a range of 1.5 x quartiles. b) The combination at various common repeat elements in PGCs between E10.5 and E12.5, 5mC/5hmC (WGBS; left) or 5hmC (AbaSeq; right side) horizontal. Asterisks refer to mean values. For specific details on sample size and how the sample is collected, see statistics and reproducibility section.
Figure 8-density heatmap showing pearson correlation (ρ) between 5hmC levels of E10.5 biological repeats (left), E10.5 and E11.5PGC (middle), and E10.5 and E12.5 PGC (right) after DNA demethylation in mouse gonad PGC, targeting the new hypomethylated region (see also figure 9 a). b) The average Z scores for 5hmC (orange, AbaSeq) and 5mC/5hmC (grey, WGBS) levels normalized to the average level of 5hmC (orange, AbaSeq) or combination 5mC/5hmC (grey, WGBS) across the stages are depicted. The standard error of the displayed mean is too small to be seen. c-f) shows the total (c, d; and a y axis: AbaSeq read count) or relative (e, f; and a y axis: (AbaSeq read count)/(%; WGBS)) 5mC level change from the combined 5mC/5hmC level in PGC between these two stages with a minimum 20% combined 5mC/5hmC in E10.5PGC for all 2kB windows (x-axis: percent; WGBS). g) Relative 5hmC levels in E11.5PGC are shown (y-axis: (AbaSeq read count)/(%; WGBS) ratio) and the combined 5mC/5hmC level in E11.5PGC with all 2kB windows of the minimum 20% combined 5mC/5hmC in E10.5PGC (x-axis: percent; WGBS). h) Density curve showing a reduced combined 5mC/5hmC level in PGCs between E10.5 and E11.5 with a 2kB window of minimum 20% total DNA modification in E10.5 PGCs, 1) enrichment of total 5hmC level at E10.5 or E11.5 (green, tailed-up poisson p value adjusted)<0.05) or 2) total 5hmC (Red, tailed Poisson p value) at consumption of both E10.5 and E11.5<0.05). i) 2kB window with minimum 20% combination of 5mC/5hmC in E10.5PGCCombined 5mC/5hmC levels in oral E10.5 and E11.5 PGCs, 1) enrichment of total 5hmC levels at E10.5 or E11.5 (green, tailed poisson p values adjusted<0.05) or 2) total 5hmC (Red, tailed Poisson p value) at consumption of both E10.5 and E11.5<0.05). for all box plots, the upper and lower hinges correspond to the first and third quartiles, and the middle line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within a range of 1.5 × quartilesS) (ii) a And 2) the red line represents the smoothed average as determined by the generalized additive model. Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
Figure 9-recommended model of 5mC oxidation in DNA demethylation involving gonadal PGC a) oxidation followed by passive dilution model predicting the degree of combined 5mC/5hmC level reduction between the two stages (i.e%; WGBS) and the total 5hmC level at the two stages immediately preceding and following this reduction. b) A model involving triggering of 5mC oxidation in DNA demethylation by an activation mechanism that predicts the extent of reduction of the combined 5mC/5hmC level between the two stages (i.e.; WGBS) and the relative 5hmC level in the phase immediately preceding this decrease, since further oxidation of 5hmC to 5fC is a rate limiting step in the complete oxidation of 5mC to 5caC39. c) Models involving protection of 5mC oxidation in DNA hypomethylation after the dominant wave (major wave) of DNA demethylation predict that regions that have lost most of DNA demethylation between the two stages (i.e. those regions of new hypomethylation) will have high relative 5hmC levels in the stage immediately following the dominant wave of DNA demethylation to remove residual methylation and/or aberrant nascent methylation. Thus, a finite correlation between the degree of combined 5mC/5hmC level reduction between the two phases (i.e. -% -, WGBS) and the relative 5hmC level in the phase immediately following this reduction can also be seen.
FIG. 10-Tet 1-3 expression and locus specific DNA methylation in Tet1-KO PGCs during epigenetic reprogramming a) E12.5 Tet1-KO and expression of Tet1 total transcripts (left) or deleted exon 4 (right) in wild type PGCs. Adjusted p-values calculated by DESeq2 (left) and p-values calculated by schodn's t test (right). Asterisks refer to mean values. b) Representative immunostaining against the N-terminus of Tet1 protein in E12.5 wild-type and Tet1-KO PGC. The scale bar represents 10 μm. c) E12.5 expression of Tet1-KO and Tet2 and Tet3 in wild-type PGCs. Adjusted p-value calculated by
Figure 11-promoter DNA methylation cluster analysis during germline reprogramming a) combined promoter 5mC/5hmC levels (WGBS, right), promoter 5hmC levels (AbaSeq, center) or gene expression levels (RNA-Seq, right) in successive stages of PGC development for all genes grouped by K-means clustering of combined 5mC/5hmC kinetics at their promoter regions. b-c) depicts the expression of a gene with low CpG promoter (LCP; b) or a medium CpG promoter (ICP; c) the box plots of the combined promoter 5mC/5hmC level (WGBS, right), promoter 5hmC level (AbaSeq, center), or gene expression level (RNA-Seq, right) of the three gene clusters of (a). For all box plots, the upper and lower hinges correspond to the first and third quartiles, and the median line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within the range of 1.5 x quartiles. Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
Figure 12-DNA modification and expression kinetics in wild-type and Tet1-KO PGCs at retrotransposons that are normally activated in parallel with epigenetic reprogramming a-b) are significantly upregulated between E10.5 and E14.5 in wild-type PGCs in a gender independent manner (a), in a male specific manner (b, blue box) or in a female specific manner (b, pink box) (adjusting p-value < 0.05; sleuth) combined 5mC/5hmC kinetics in wild-type PGCs of representative repeat elements (%; a WGBS; left most), relative 5hmC kinetics in wild type PGCs (abeseq read count normalized to E10.5; left of center), wild type or expression kinetics in Tet1-KO PGCs (transcripts per million (TPM); RNA-Seq; right center) and combined 5mC/5hmC kinetics in wild-type and Tet1-KO PGCs (%; an RRBS; the rightmost side). The average value is shown in all cases. The adjusted p-values for the differential repeat expression analysis between E14.5 wild-type and Tet1-KO PGC were based on Sleuth software. Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
Figure 13-characterization of GRR gene regulation by Tet1 and 5mC in PGC and mESC a) CpG density at GRR gene promoter and other related promoters; the p-value is based on a two-sided wilcoxon test. b) Average 5hmC kinetics at GRR gene promoter and unactivated methylation and demethylation HCPs in PGCs; the p-value is based on a two-sided paired wilcoxon test. c) Log2 (fold change) between Tet1-KO of the GRR gene and other related gene sets and wild-type E14.5 male (blue) or female (pink) PGC. The FWER adjusted p-value is based on GSEA software (see methods for details). d) Dnmt1-CKO of GRR gene and other related gene sets24Log2 (fold change) between wild type mESC (green) or E14.5 female (pink) or male (blue) wild type PGC and E10.5 wild type PGC. The FWER adjusted p-value is based on GSEA software (see methods for details). e) Combined 5mC/5hmC level difference at GRR promoter (x-axis; changes in GRR gene expression in Tet1-KO (RRBS;%) -WT (RRBS;%)) versus E12.5 (right) and E14.5 (left) Tet1-KO PGCs (y-axis; log2(Tet 1-KO/WT)). Spearman correlation is shown. f) Representative immunoblots showing expression of the Tet1 and Lamin B proteins in wild-type, Dnmt-TKO and Tet1-KODnmt-TKO mESCFor all box-shaped figures, the upper and lower hinges correspond to the first and third quartiles, and the middle line corresponds to the median, and the maximum and minimum values correspond to the highest or lowest values, respectively, within the range of 1.5 × quartiles.
FIG. 14-epigenetic characteristics of the GRR gene promoter in mESC. a) genomic sequence centered on the TSS of the following genes: GRR genes, activated non-GRR genes and non-GRR methylated and demethylated HCP genes in male and female PGCs between E10.5 and E14.5 in wild type mescs grown in serum-containing media. Each horizontal line represents a gene; the intensity of the red color indicates the relative enrichment of the features displayed at the top of each column. TSS and sequences of 5kb upstream and downstream of TSS are shown. b-f) box plots at the following levels: combination of 5mC/5hmC levels (WGBS) at the promoter of the GRR gene or other related gene sets in wild-type mESC grown in serum-containing media30；(c)5hmC(AbaSeq)15；(d)Tet1(ChIP-Seq)21；(e)Ring1b(ChIP-Seq)38And (f) H2Aub level (ChIP-Seq)37For all box plots, the upper and lower hinges correspond to the first and third quartiles, and the median line corresponds to the median, and the maximum and minimum correspond to the highest or lowest values, respectively, within a range of 1.5 × quartiles.p-values are based on the two-sided Wilcoxon test.g) depicts the median H3K4me3 level (ChIP-Seq) near the TSS for the GRR gene (left) and the non-GRR HCP gene (right) in wild-type and Tet1-KO mESC grown in serum-containing media30The non-GRR HCP genes were also initially methylated and subsequently demethylated during PGC reprogramming. The p-value is based on a paired two-sided Wilcoxon test performed on a region of TSS-1kB/+500 bp. Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
FIG. 15-characterization of GRR gene regulation by PRC1 and 5mC in PGC and mESC. a) GRR gene vs. wild type at E115 and/or E12.5 PRC1 conditional Gene knockout overlap between genes that are significantly upregulated in PGCs26. The p-value is based on the hyper-geometry test. b) Representative immunoblots showing levels of H2Aub and H2A in wild type or Dnmt-TKO mESC +6H DMSO and wild type or Dnmt-TKO mESC +6hPRT4165(PRC1 inhibitor). c) Their dependent GRR gene classification by 5mC and/or PRC1 reprogramming in mESC (see methods for details). Specific details regarding sample size and how the sample is collected are found in the statistics and reproducibility section.
FIG. 16-model of endogenous PGC conversion to germ cells
Timely and efficient activation of Germline Reprogramming Response (GRR) genes involved in PGC conversion to germ cells and successful gametogenesis requires initiation of interactions between global DNA demethylation, Tet1 recruitment, and removal of PRC 1-mediated inhibition. Both DNA demethylation-dependent (protection from aberrant residual/nascent promoter DNA methylation) and independent (e.g. potential recruitment of OGT to
FIG. 17-Gene expression changes in response to retinoic acid
Mouse embryonic stem cells (mESC) were treated with Retinoic Acid (RA). The J1 cell line was used in comparison with J1 "TKO" cells lacking the DNA methylation mechanism (triple knockout by means of Dnmt1/Dnmt3a/Dnmt3 b). The black bars show fold-changes in Dazl-hormd 1 expression and Mae1 expression, respectively, in TKO cells compared to J1 control (neither treated with RA). Grey bars show fold changes in Dazl, hormd 1, and Mae1 expression in J1 cells treated with RA compared to J1 cells not treated with RA, respectively. White bars show fold-changes in Dazl, hormd 1, and Mae1 expression in TKO cells treated with RA compared to J1 cells not treated with RA, respectively.
Detailed Description
While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not restrictive. Various changes may be made to the described embodiments without departing from the spirit and scope of the invention.
Epigenetic reprogramming enables primordial germ cells to be converted into germ cells
Gametes are highly specialized cells that can produce the next generation by their ability to produce totipotent zygotes. In mice, at embryo (E)6.251At the beginning of the day, germ cells first characterized as Primordial Germ Cells (PGCs) in the developing embryo (fig. 1 a). After subsequent migration into the developing gonads, PGCs were subjected to one-wave extensive epigenetic reprogramming at E10.5/E11.52-11Genome-wide deletions comprising 5-methylcytosine (5mC)2-5,7-11(FIG. 1 a). The underlying molecular mechanisms of this process remain mysterious, leading us to an inability to reproduce this step of germline development in vitro12-14. The inventors showed, using the integration approach, that this complex reprogramming process involves a synergistic interaction between promoter sequence characteristics, DNA (de) methylation, polycombin (PRC1) complex and DNA demethylation-dependent and independent functions of Tet1 to enable activation of a key set of Germline Reprogramming Response (GRR) genes involved in gametogenesis and meiosis. Our results also unexpectedly revealed a role for Tet1 in protecting but not driving DNA demethylation in gonadal PGCs. In general, our studies reveal the basic biological role of gonadal germline reprogramming and identify the epigenetic principle of PGC conversion to germ cells, which would be suggestive for the in vitro reproduction of complete gametogenesis.
To address the potential role and potential molecular mechanisms of gonadal reprogramming, the inventors first began to study the kinetics of 5mC and 5-hydroxymethylcytosine (5hmC) and the relationship between 5mC and 5-hydroxymethylcytosine (5hmC), which was previously involved in DNA demethylation in PGCs3,6,9-11. In this regard, the inventors used whole genome bisulfite sequencing (WGBS, FIG. 5a) and AbaSeq (FIGS. 5b-e)15Coupled liquid chromatography/mass spectrometry (LC/MS) was done quantitatively with single base resolution. WGBS provides for 5mC and 5hmCCombining horizontal information16And AbaSeq15Robust site-specific quantification and accurate comparison of genome-wide 5hmC levels within a given sample and between samples when combined with LC/MS can be performed (see methods, fig. 5 b-e).
By LC/MS, the inventors observed that the global level of genomic 5mC remained stable between migrating (E9.5) and early gonadal (E10.5) PGCs, followed by a significant decrease between E10.5 and E11.5, and much more limited DNA demethylation between E11.5 and E13.5 (fig. 1 b). With respect to 5hmC, LC/MS analysis unexpectedly showed that the global levels in PGCs were lower than those in mouse embryonic stem cells (mESC) grown in serum-containing culture conditions (fig. 1 b). Furthermore, the global 5hmC level in PGCs was relatively constant between E9.5 and E13.5, with a slight decrease starting at E12.5 in females (fig. 1 b). Importantly, the 5hmC level was always an order of magnitude lower than the total 5mC level at E10.5 or the 5mC deletion between E10.5 and E11.5 (fig. 1b-c), recording DNA demethylation was not accompanied globally by an inverse increase in 5hmC level, as has been suggested previously3,17(FIG. 9 a).
Consistent with our LC/MS measurements, WGBS analysis showed an almost complete deletion of the combined 5mC/5hmC at a feature within the uniquely localized region of the genome between E10.5 and E11.5, with limited further DNA demethylation observed between E11.5 and E12.5 (fig. 7 a). Deletions in DNA methylation were also observed at the consensus repeat sequences, although some of the repeat elements (e.g., LINE-1A and ERV-IAP retrotransposons) retained relatively high levels of the combination 5mC/5hmC in E12.5 PGC, as previously suggested8(FIG. 7 b). Detailed analysis of the 5hmC localization in E10.5PGC by AbaSeq showed that, despite the lower global level (fig. 1b), the 5hmC localization in PGC was significantly similar to that of serum-grown mESC, even at the imprint control region (ICR; fig. 6a, b, f). In summary, 5hmC was enriched at the putative active enhancer, was present in intergenic regions and genomes, was consumed at the promoter, and was absent on most CpG islands (fig. 6 b-f). Regarding transcription, 5mC and 5hmC at the promoter region showed an inverse relationship to gene expression level (fig. 6 c). In vivo gene, 5mC and 5hmC were significantly enriched at expressed genes compared to genes with no detectable expression, but a non-linear relationship of 5hmC to gene expression was observed, while the combined 5mC/5hmC levels showed a significant positive correlation (fig. 6 c).
Detailed analysis of the 5hmC pattern throughout the developmental stages examined revealed that most of the 5hmC was deleted from the uniquely located region of the genome and relocated to the repeat element (fig. 1d, fig. 7 a-b). This relocation was also evident by immunofluorescence staining (FIG. 1 e). Thus, our data show that 5mC and 5hmC are deleted in the entire unique localized region of the PGC genome, although the different kinetics of 5hmC show more gradual decrease (fig. 8 b). However, this is in contrast to passive dilution of 5hmC by cell division3Inconsistency, as demonstrated by poor pearson and spearman correlation between the phases (fig. 8a, 9 a). In contrast, the inventors concluded that 5hmC is a dynamic marker in PGCs.
We next investigated the relationship between 5hmC deposition and DNA demethylation in gonadal PGCs between E10.5 and E12.5 for all initial methylated 2kb windows (i.e. minimal 20% methylation at E10.5). DNA demethylation involving the 5hmC intermediate predicted a direct correlation between the appearance of 5hmC and the 5mC deletion (fig. 9 a-b). Surprisingly, the inventors observed that there was no correlation between the total or relative 5hmC levels of E10.5 or E11.5 and that the degree of combined 5mC/5hmC levels between these stages was reduced (fig. 8 c-f). However, a negative correlation between the relative 5hmC level of E11.5 and the combined 5mC/5hmC level was observed for all the initial methylated 2kb windows (fig. 8 g). Thus, 5hmC represents a combined 5mC/5hmC level at a much higher proportion at the new hypomethylated region at E11.5, regardless of its initial DNA methylation level. Although the 5hmC depleted region contained slightly more 5mC than the 5hmC rich region in E11.5, the 5hmC depleted sequence in E10.5 and E11.5 PGCs still underwent extensive DNA demethylation between these two stages (fig. 8h-i), indicating that the presence of detectable 5hmC is not a prerequisite for the deletion of 5mC in gonadal PGCs. Thus, our observations suggest that 5hmC is involved in regulation of locus-specific 5mC levels following DNA demethylation in germ cells rather than in the initial wave of global DNA demethylation (fig. 9 c).
To augment this observation, the inventors used the previously published Tet1-KO mouse model18(FIGS. 10 a-c). Initial LC/MS analysis showed that the Tet1 deletion caused a reduction in approximately 50% of the total 5hmC levels in E10.5 Tet1-KO germ cells (fig. 2 c). Consistent with high levels of Tet1 expression at E12.53,9,11(fig. 10a-c), LC/MS analysis confirmed that Tet1 represents a primary 5mC oxygenase in demethylated PGCs, with an approximately 85% reduction in global 5hmC levels observed in E14.5Tet1-KO germ cells (fig. 2a, c). Importantly, the genomes of both Tet1-KO and wild-type PGC reached almost complete 5mC depletion at E13.5 (fig. 2b, d), highlighting that Tet1 mediated 5mC oxidation did not directly cause bulk DNA demethylation in gonadal PGCs.
In support of our LC/MS measurements, only a limited number of differentially methylated regions were detected in E14.5Tet1-KO PGCs by reduced sequencing bisulphite sequencing (RRBS) as indicated. Interestingly, these regions were initially extensively DNA demethylated in Tet1-KO and wild-type PGCs, followed by a subsequent increase in 5mC levels specifically in Tet1-KO PGCs between E12.5 and E14.5 (fig. 2E). In contrast, between these stages in wild type germ cells, 5mC levels remained stable and/or slightly further reduced (fig. 2 e). Reported previously9,10The same DNA demethylation/demethylation kinetics were also observed at several instances of the germline gene promoter of (e) and ICR found to be highly methylated in the ee14.5tet1-KOPGC by RRBS (fig. 10 d-e). Although a significant enrichment of 5mC was indeed observed at the Dazl promoter by targeted bisulfite sequencing in demethylated PGCs, the extent of the high degree of methylation observed at Peg3 and IG-DMR ICR was in fact extremely limited (fig. 10 f-g). Furthermore, few clones remained fully methylated for all three regions, while many clones had a methylation pattern consistent with the random failure to remove aberrant residual/nascent DNA methylation in Tet1-KO PGCs (fig. 10 f-g).
We next analyzed the observed 5mC and 5hmC kinetics in conjunction with the RNA-Seq dataset derived from E10.5-E14.5 PGC (fig. 11). DNA A based on its promoterInitial cluster analysis of all genes based on kinetics revealed that although most promoters became fully demethylated, there were transcriptionally silent promoters of a small subset that retained high levels of 5mC/5hmC during global DNA demethylation (
Since it has been shown in mammals that the effect of 5mC on the transcriptional activity of a gene is highly dependent on the promoter CpG content19Therefore, the inventors performed specific clustering analysis at genes with High CpG (HCP), medium CpG (ICP) or Low CpG (LCP) promoters19(FIG. 3a and FIGS. 11 b-c). Interestingly, this resulted in a cohort of HCP genes that became DNA demethylated during the germline epigenetic reprogramming process and showed progressive transcriptional activation (
Considering that the GRR gene (n-45) accounts for less than 25% of the entire subset of HCP genes that undergo DNA demethylation (n-226; fig. 3a-c), DNA demethylation may be an important factor for transcriptional activation of methylated HCPs, as well as other factors that are otherwise required. Indeed, the GRR gene promoter showed exceptionally high CpG density and 5hmC levels compared to other methylated and unmethylated HCPs (fig. 13 a-b). It is also noted that it is rare for a promoter to be immediately adjacentFollowing the major wave of DNA demethylation, 5hmC levels at the GRR gene promoter in PGCs were transiently increased (fig. 7a, 13 b). In addition, and consistent with its high CpG density and 5hmC levels20,21The GRR gene promoter has been shown to be substituted by mESCs21And PGCs9Tet1 in (fig. 3 b).
The observed Tet1 binding was functionally related, as the degree of GRR gene upregulation was significantly lower in Tet1-KOPGC (fig. 4a, fig. 13 c). Although the GRR gene promoter was normally DNA demethylated by truncation E12.5 in the absence of Tet1, it was shown to be slightly hypermethylated at the late stage of Tet1-KO PGC E14.5 (FIG. 4 b). However, this limited DNA hypermethylation and reduced expression showed only a weak correlation (fig. 13 e). Furthermore, lower expression of the GRR gene in Tet1-KO germ cells has been evident at E12.5 in the absence of any methylation differences (fig. 4a-b, fig. 13E), suggesting that Tet1 potentially acts as a transcriptional regulator in addition to its 5mC removal effect21,22. In addition to the GRR gene, Transposable Elements (TEs) were shown to accumulate 5hmC during gonadal epigenetic reprogramming (fig. 7b, fig. 12). Together with the reduction in DNA methylation, some TEs showed transcriptional activation in parallel with epigenetic reprogramming, especially with evolved nascent retrotransposons (fig. 12). Interestingly, the absence of Tet1 also appears to reduce the extent of transcriptional activation of normally activated TEs (fig. 12).
To further mechanistically explore the causal relationship between epigenetic reprogramming and GRR gene activation, the inventors turned to an in vitro model. Serum-grown mescs represent an ideal system, since these cells are not germline restricted and the apparent genetic modifications observed at the GRR gene promoter are highly similar to those observed in vivo in pre-reprogrammed gonadal PGCs (fig. 14 a-d). Consistent with what the present inventors observed in vivo, promoter DNA demethylation also represents a dominant epigenetic reprogramming event of GRR gene activation in vitro. Dnmt-TKO23mESC showed increased expression of GRR gene (fig. 4 c). However, even in the complete absence of DNA methylation, this was critically dependent on the presence of Tet1, since Tet1-KO Dnmt-TKO mESC failed to activate GRR genes as a group (fig. 4c, fig. 13 f).
Although these in vitro observations clearly support our in vivo data on the role of 5mC and Tet1, Dnmt-TKO mESC (FIG. 4c) or have been subject to deletion by conditional Dnmt1(Dnmt1-CKO)24The degree of GRR gene upregulation in the early DNA demethylated E10.5PGC (FIG. 13d) was relatively mild. Thus, the inventors hypothesize that other factors, including potentially other epigenetic barriers, may regulate GRR gene expression. In this case, gonad epigenetic reprogramming has been previously associated with the erasure of epigenetic information at various levels4,25Where it was previously shown that removal of polycombin inhibitory complex 1(PRC1) coordinates the timing of meiotic initiation in E11.5/E12.5 PGCs for DNA demethylation26. Notably, the genes that were abnormally upregulated after deletion of PRC1 in PGCs showed significant enrichment for GRR genes (fig. 15a), and enrichment for the promoter of GRR genes in serum-grown mescs for Ring1b binding and H2AK119ub (fig. 14a, e, f). In view of this, the inventors tested the role of DNA methylation and PRC1 in GRR gene regulation using highly specific chemical inhibition of PRC1 in the context of Dnmt-TKO mESC to abrogate both DNA methylation and PRC1 activity, thereby mimicking gonad epigenetic reprogramming. And PRT416527Co-culture mESC caused significant inhibition of PRC 1-mediated H2A ubiquitination after only 6H of culture (fig. 15 b). The dual inhibition of 5mC/PRC1 inhibition surprisingly caused activation of 33 GRR genes out of 45 GRR genes, of which 25 and 10 genes were activated after single inhibition of 5mC or PRC1 inhibition, respectively (fig. 4d, fig. 15 c). In combination, these observations show that compound erasure of the gonadal epigenetic reprogrammed epigenetic system4,25To enhance expression of the GRR gene.
Our studies have identified a set of Germline Reprogramming Response (GRR) genes that are critical for the correct progression of gametogenesis. These genes have unique promoter sequence characteristics, have high levels of 5mC and 5hmC, and are targets of Tet1 and PRC 1. The present disclosure shows that a combined deletion of DNA methylation and PRC1 inhibition is required for the uniqueness of GRR gene activation, where this epigenetic readiness further requires Tet1 to enhance full and efficient activation. Tet (Tet)1 appears to be in female PGC9Of particular importance, it opens early meiosis shortly after completion of epigenetic reprogramming, thus requiring timely high expression of these genes. Importantly, although the inventors observed a slightly high degree of methylation at the GRR gene promoter in E14.5Tet1-KO PGC, our studies clearly recorded that Tet1 also stimulated transcription of the GRR gene by a DNA demethylation independent mechanism21,22. In this context, previous studies have shown that Tet1 recruits OGTs to gene promoters22Thus facilitating passage through SET1/COMPASS28H3K4me3, leading to transcriptional activation. In further support, the GRR gene promoter in mESC was labeled with low but detectable H3K4me3, the level of which was significantly reduced in the absence of Tet1 with no change in DNA methylation (fig. 4b, fig. 14 g). Tet1 may additionally enhance transcription by modulating the level of 5mC/5hmC at non-promoter cis-elements (such as enhancers). Last but not least, our studies showed that Tet1 is not directly involved in the initiation of global DNA demethylation during epigenetic reprogramming in gonadal PGCs, but instead the inventors identified a critical role for Tet1 in the subsequent removal of abnormal residues and/or nascent DNA methylation (fig. 16). This suggests that Tet 3-driven 5mC oxidation is protecting against demethylation of zygotic DNA29The role in the methylation of nascent DNA during this period suggests that the global reprogramming event needs to be effectively protected from the methylation of nascent DNA after removal of 5mC in order to stabilize the newly acquired epigenetic state. In general, our study of gonadal epigenetic reprogramming requires complex erasure of epigenetic information4And suggests that the central function of this process is to determine timely and efficient activation of the GRR gene, thus enabling progression towards gametogenesis (fig. 16).
Method of producing a composite material
Statistics and reproducibility
All statistical tests are clearly described in the figure legends and/or in the methods section, and the exact p-values or adjusted p-values are given where possible. For WGBS data (fig. 3a-b, 5a, 6c-E, 7a-b, 8, 11, 12), data was derived from cells from n-1 (E10.5 PGC samples) or n-2 (all other samples) biological replicates from pooled embryos (E10.5: n-39 embryos/4, (litter); E11.5: n-8 embryos/1; E12.5M/F: n-4 embryos/1). For AbaSeq data (fig. 1d, 3a-b, 5c-E, 6a-F, 7a-b, 8, 11, 12, 13b), the data was derived from cells from n-2 biological replicates, with each replicate from pooled embryos (E10.5: n-40 embryos/4, (E11.5: n-8 embryos/1; E12.5M/F: n-4 embryos/1). For RNA-Seq of mESC, samples were derived from n-2 biological replicates corresponding to n-2 independently cultured samples from n-1 cell line. For PGC LC/MS, RNA-Seq and RRBS data, please see full details regarding the number of embryos/litters that were the source of the samples. Three immunoblots were performed (fig. 13f, 15b), with similar results, and representative blots are shown. All immunostaining (FIGS. 1e, 2a-b, FIG. 10b) were performed twice with similar results and representative images are shown. Traditional bisulfite sequencing (FIGS. 10f-g) was performed twice and a representative methylation profile is shown. For the previously disclosed analysis of WGBS (fig. 14a-b), TAB-Seq (fig. 5c-e), AbaSeq (fig. 5c-e, 6b, 14a, 14c) and ChIP-Seq (fig. 3b, fig. 14a, 14c-g) datasets (accession number see methods) from mESC, the combined (shown) and individual (not shown) analysis was repeated on the organisms except for the H2 obbhip-Seq dataset (where n is 1) to ensure reproducibility of the analysis.
Mouse
All animal experiments were performed in the Home-Office assigned facility (Home-Office assigned facility) as per and according to UK Home Office Project License (UK Home Office Project License). In addition to direct comparison with Tet1-KOPGC, a hybrid background of GOF18 Δ PE-EGFP from MF1 females crossed by distantly5Transgenic male-produced embryos were isolated for wild-type PGCs. The sex of the embryo starting from E12.5 was determined by visual inspection of the gonads. For the study of Tet1-KOPGC, a Tet1 knock-out mouse strain (B6; 129S4-Tet 1)tm1.1Jae/J)18Purchased from Jackson Laboratory (Jackson Laboratory) and grown to GOF18 Δ PE-EGFP5Transgenic mouse lines. Wild isolation from embryos generated by crosses between Tet 1-heterozygous GOF18 Δ PE-EGFP-homozygous females and malesGreen and Tet1-KO PGC. For genotyping of embryos produced by crossing Tet 1-heterozygous GOF18 Δ PE-EGFP-homozygous male and female, two PCR runs were always performed using two different sets of primers (see below) to confirm
Molecular biology
The following genotyping primers were used in this study: TCAGGGAGCTCATGGAGACTA (Tet1 forward primer 1); AACTGATTCCCTTCGTGCAG (Tet1 forward primer 2); TTAAAGCATGGGTGGGAGTC (Tet1 reverse primer); TTGTCTAGAGAGCATGGAGGGCCATGTCAA (Sry forward primer); CCACTCCTCTGTGACACTTTAGCCCTCCGA (Sry reverse primer).
PGC isolation by flow cytometry
As described previously4Briefly, embryonic stems (E10.5) or genital ridges (E11.5-E14.5) were digested using 0.05% trypsin-EDTA (1 ×) (Gibco) or TrypLE Express (Thermo) at 37 ℃ for 3min after enzymatic digestion, neutralized with DMEM/F-12 (Gibco) containing 15% fetal bovine serum (Gibco), and dissociated by hand.
Generation of Tet1-KO Dnmt-TKO mESC
Tet1-KO Dnmt-TKO mESC line was generated by CRISPR/Cas9 mediated genome editing using lipofectamine 3000 at 5 × 106Dnmt-TKO mESCs23In the method, sgRNA targeting Tet1 is co-transfected by reporter GFP plasmid31(GGCTGCTGTCAGGGAGCTCA) pX330 (Addgene), # 42230). The following day, GFP positive cells were sorted by FACS (bd FACS Aria iii) in 96-well plates. Cells were cultured for one week before freezing and gDNA extraction. Colonies were screened for mutations using a measurer assay (measurer mutation detection kit from Edtig (IDT) and TaqDNA polymerase from Qiagen). Clones selected by Tet1-KO Dnmt-TKO mESC were further analyzed by genotyping, confirming the presence of the frameshift mutation. The deletion of Tet1 was verified by RNA-Seq and immunoblotting. The following primers were used for genotype sequencing and measurer analysis: 5'TTGTTCTCTCCTCTGACTGC3' and 5'TGATTGATCAAATAGGCCTGC 3'.
mESC cell culture
J1 (wild type), Dnmt-TKO were cultured in FCS/LIF medium without feed at 0.1% gelatin23And Tet1-KO Dnmt-TKO mESC. FCS/LIF media consisting of GMEM (Gembidae) supplemented with 10% FCS, 0.1mM MEM non-essential amino acids, 2mM l-glutamine, 1mM sodium pyruvate and 0.1mM 2-mercaptoethanol and mouse LIF (ESGRO. Millipore.) inhibitor experiments were performed at 1.5 × 104/cm2Density of (d) mESC was spread and left overnight. The following morning, media was exchanged with FCS/LIF media containing 50 μ M PRC1 inhibitor PRT4165(Ismail et al, 2013) or DMSO controls, and cells were pelleted at the indicated times for analysis.
AbaSeq library preparation
Total DNA was isolated from 10,000 sorted PGCs using QIAamp DNA mini kit (qiagen). As described previously15An AbaSeq library for 5hmC analysis was constructed. Briefly, genomic DNA is glucosylated, followed by digestion with the AbaSI enzyme (NEB). The biotin-labeled P1 adaptor was ligated to AbaSI digested DNA, followed by fragmentation using a kovaris S2 sonicator (Covaris)) according to the manufacturer' S instructions. Subsequently, fragmented P1-conjugated DNA was captured by mixing with Dynabeads MyOne streptavidin C1 beads (life technologies) according to the manufacturer's instructions. By using NEBNext end repair module (NEB) and NEBNext plus dA tail module (NEB) at 20 ℃ and 37 ℃ respectively for 30min,end repair and dA tail addition were performed on the beads. The P2 adaptor was ligated to randomly cleaved ends of dA-tailed DNA. Finally, 16 cycles of full DNA were amplified using Phusion DNA polymerase (NEB) with the addition of 300nM forward primer (PCR _ I) and 300nM reverse primer (PCR _ IIpe). The library was purified using AMPureXP beads (beckmann-coulter) and sequenced on an Illumina HiSeq 2000 instrument.
Whole Genome Bisulfite Sequencing (WGBS) library preparation
Total DNA was isolated from 10,000 sorted PGCs using QIAamp DNA mini kit (qiagen). In some cases, after DNA isolation, unmethylated lambda phage DNA (Promega) was incorporated to assess bisulfite conversion. DNA was fragmented using a kovaris S2 sonicator (Covaris) according to the manufacturer' S instructions. Following the NEBNext library prep protocol, the library was prepared with methylated adaptors and the following modifications: after adaptor ligation, bisulfite conversion was performed using the Imprint Modification kit (sigma); and PCR enrichment was performed for 16 cycles using NEXTflex bisulfite-Seq kit Illumina sequencing (bio Scientific) master mix and NEBNext library prep universal and index primers (NEB). The library was purified by AMPure XP beads (beckmann-coulter). The library was sequenced on an Illumina HiSeq 2000 or 2500 instrument.
Bisulfite Sequencing (RRBS) library preparation in simplified representation
Total DNA was isolated from FACS sorted PGCs isolated from individual Tet1-KO or wild type embryos using the ZR-Duet DNA-RNA MiniPrep kit (zmmo), and DNA from two to six embryos of the same genotype, stage and sex (equivalent to 1,000 to 8,000 cells) were pooled and concentrated to a 26 μ Ι final volume using a Savant SpeedVac concentrator (semer) and following the manufacturer's instructions. Genomic DNA was digested by
RNA-Seq library preparation
For the study of Tet1-KO PGCs, total RNA was isolated from sorted PGCs isolated from individual Tet1-KO or wild type embryos using the ZR-Duet DNA-RNA MiniPrep kit (Zimo), and RNAs from two to six embryos of the same genotype, stage, and sex (equivalent to 1,000 to 8,000 cells) were pooled and concentrated to a final volume of 6 μ L using the RNA cleaner and
Bioinformatics
Whole Genome Bisulfite Sequencing (WGBS) and Tet-assisted bisulfite sequencing (TAB-Seq) alignment and downstream analysis
The original reads were first trimmed using Trim Galore (version 0.3.1), Trim1 selection, paired with-Trim. The mouse genome (mm9, NCBI construct 37) was aligned with Bismark (version 0.13.0) and-n 1 parameters; the lambda phage genome is added as extra chromosome as appropriate. Aligned reads were de-duplicated with default _ bismark. Bisulfite conversion was calculated using reads aligned to the lambda phage genome and using the to-mr script (parameter: -mbismark) and the bsrate script (parameter: -N) of metapipe (version 3.3.1), as appropriate. CpG methylation responses were extracted from the de-duplicated localization outputs using a Bismark methylation extractor. The amount of methylated and unmethylated cytosines in CpG content was extracted using bismark2bedGraph and coverage2 cytosines. Symmetric CpG were merged with custom R script. For all downstream analyses, only symmetric CpG with minimum 8 × coverage was used. All WGBS analyses were performed on data from pooled biological replicates. For assessing the level of DNA modification at a particular repeat element, Bismark (version 0.14.4) was used to locate all reads from each data set against the consensus sequence constructed with Repbase for the-n 1 parameter set. CpG methylation responses were extracted from the localization output using a Bismark methylation extractor (version 0.14.4).
The mapped function of BEDtools (version 2.24.0) was used to calculate the combined 5mC/5hmC levels of the following genomic features: 1) all 2kb windows (containing a minimum of 4 symmetrical CpG); 2) gene promoter (as defined by Ensembl 67 gene start site-1 kB/+500 bp); 3) the genome (as defined by the regions contained within the initiation and termination sites of the Ensembl 67 gene); 4)
For k-means clustering combining mean 5mC/5hmC levels, High CpG (HCP), medium CpG (ICP), and Low CpG (LCP) promoters, e.g., using the same as previously disclosed19,34The same parameters of (2) are defined. Briefly, LCP contains no CpG ratio>A 500-bp window of 0.45; HCP contains CpG ratio>0.65 and GC content>55% of at least one 500-bp window; ICP does not meet the aforementioned criteria.
For determining locus-specific methylation levels in wild-type mescs grown in serum-containing media, from GSE4851930The original WGBS read is downloaded and processed as above. From GSE3617335TAB-Seq reads of E14mESC were downloaded and processed as above, except that only symmetric CpG with minimum 12 × coverage was used.
AbaSeq alignment and downstream analysis
For uniquely positionable parts of the genome, as described previously15The AbaSeq reads are processed. Briefly, the original sequencing reads were trimmed for adaptor sequences and low quality bases using Trim Galore. Trimmed reads were mapped to the mouse genome using Bowtie of-n 1-l 25-best-data-m 1 with parameters (version 0.12.8) (mm9, NCBI construct 37). The 5hmC response (Call) is based on the AbaSI enzyme (5' -CN) using custom Perl scripts11-13↓N9-10G-3′/3′-GN9-10↓N11-13C-5') recognition sequence and cleavage pattern. For assessing the relative enrichment of 5hmC at repeat and non-repeat elements, the AbaSeq alignment was divided into two groups: unique (single best alignment) and ambiguous (mapping to multiple locations with the same alignment score). Subsequently, the two groups were each positioned to the repetitive element defined by the RepeatMasker trajectory of mm9(UCSC genome browser). For comparison with 5hmC levels in mESC, from GSE4289815The AbaSeq reads were downloaded and compared in the same way.
For quantification of relative 5hmC levels at symmetric CpG in uniquely located portions of the genome, the number of counts per symmetric CpG of a given sample is normalized to the combined number of uniquely and unambiguously located reads for a given library, and then further multiplied by a stage-specific normalization factor based on the average 5hmC level for each stage as calculated by LC/MS (E14 ESC 1.64; E10.5 1.0; E11.5 1.13; E12.5F 0.76; E12.5M 1.0). All symmetric CpG belonging to the genomic interval on the black list of the mouse (mm9) ENCODE project were excluded from all further downstream analyses. Unless stated otherwise, all AbaSeq analyses were performed on data from pooled biological replicates.
The mapseed function of BEDtools (version 2.24.0) was used to calculate 5hmC levels for the same genomic features as was done for the WGBS dataset (see above). In all cases, 5hmC levels are expressed as the average of individual CpG sites.
To identify 5hmC enrichment or depletion regions in E10.5 and E11.5 PGCs, the mm9 genome was first divided into 2kb windows (minimum 4 symmetric CpG) and the average 5hmC level for each window was calculated using BEDtools (version 2.24.0). To determine the significance of 5hmC enrichment in each 2kB window, ppois (x, λ) was used to calculate the Poisson probability p value for the upper tail (to determine the 5hmC enrichment region) or lower tail (to determine the 5hmC depletion region), where x is the observed 5hmC mean for each 2kB window and λ is the mean of the 5hmC mean for all 2kB windows at E10.5. Subsequently, a Benjamini-Hochberg correction was applied to correct for multiple tests, resulting in final adjusted upper and lower tail p values for each 2kb window. A window of adjusted upper tail p value <0.05 is considered relatively enriched at 5hmC, while a window of adjusted lower tail p value <0.05 is considered relatively depleted at 5 hmC.
For assessing the relative enrichment of 5hmC at a particular repeat element, Bowtie was used to locate all reads from each data set for consensus sequences constructed from Redbase with the parameter-n 1-M1-data-best. The number of reads mapped to each sequence within a given sample is first normalized to the library size for that particular sample and then normalized to a stage-specific normalization factor based on the average 5hmC level for each stage calculated by LC/MS (E10.5 ═ 1.0; E11.5 ═ 1.13; E12.5F ═ 0.76; E12.5M ═ 1.0) and the average proportion of reads mapped to the given sequence in E10.5PGC.
Bisulfite Sequencing (RRBS) alignment and downstream analysis in simplified representation
The original RRBS reads were first trimmed using Trim Galore (version 0.3.1) with a-RRBS parameter. An alignment was performed with respect to the mouse genome (mm9, NCBI construct 37) using Bismark (version 0.13.0) with-n 1 parameters. CpG methylation responses were extracted from the localization output using a Bismark methylation extractor (version 0.13.0). The number of methylated and unmethylated cytosines in CpG content was extracted using bismark2 bedGraph.
RnBeads (version 1.0.0) and rnbeads.mm9 (version 0.99.0) were used to identify differentially methylated regions between two test groups of the following genomic features, with the filtering.missing.value.quantile set at 0.95 and the filtering.missing.coverage.threshold set at 8: 1) all 2kb windows (containing a minimum of 4 symmetrical CpG); 2) gene promoter (as defined by Ensembl 67 gene start site-1 kB/+500 bp); and 3) imprinting the control region (mm9 genome). The following are extracted from the output of RnBeads: 1) average methylation levels for each cohort (i.e., stage, gender, and/or genotype) of test zones for each common coverage; 2) difference in methylation averages between two groups of each common coverage test zone; and 3) p-value representing the significance of the difference in methylation averages between two groups of each general coverage test area. Differential methylation regions were identified as regions with p-values <0.05 and differences in mean methylation between the two groups of greater than 10%.
For assessing the level of DNA modification at a particular repeat element, Bismark (version 0.14.4) was used to locate all reads from each data set against the consensus sequence constructed with Repbase of the-n 1 parameter set. CpG methylation responses were extracted from the localization output using a Bismark methylation extractor (version 0.14.4). The amount of methylated and unmethylated cytosines in CpG content was extracted using bismark2bedGraph and coverage2 cytosines. Consensus repeats of differential methylation were identified as regions with p-values <0.05 (as calculated by the two-sided stewarden t test) and differences in methylation averages between the two groups of greater than 10%.
hMeDIP alignment and downstream analysis
From GSE2850036The original hMeDIP-Seq and input reads of E14mESC were downloaded and aligned with the mouse genome (mm9, NCBI construct 37) using Bowtie (version 0.12.8) with parameter-n 2-l25-m 1. Bedtoolsmaltov was used to identify the number of input reads of hMeDIP and hMeDIP that overlap each 2kB window (containing a minimum of 4 symmetrical CpG). The final 5hmC level for each 2kB window was determined by first normalizing the number of overlapping hMeDIP reads (normalized to library size) to the number of overlapping input reads (normalized to library size), and then dividing this value by the number of symmetric CpG contained within the 2kB window.
ChIP-Seq alignment and downstream analysis
For putative activity enhancer response, from GSE6020433Raw ChIP-Seq reads of H3K4me3, H3K27me3, and H3K27Ac in
For analysis of epigenetic modifications and modifications near the transcription start site (Ensembl 67), the following original ChIP-Seq reads: from GSE2484321Downloading Tet1 binding in wildtype serum-grown mescs; from GSE3452037Downloading H2AK119Ub1 levels in wildtype serum-grown mescs; from ERP00557538Downloading wild type serum grown mescsRing1b binding; and from GSE4851930Download H3K4me3 from wildtype and Tet1-KO serum grown mESCs. Reads were aligned to the mouse genome (mm9, NCBI construct 37) with Bowtie (version 0.12.8 or version 1.0.0) with the parameter-n 2-l25-m 1. Subsequent ChIP-Seq analysis was performed on data from pooled biological replicates. For calculation of ChIP-Seq signals near the Transcription Start Site (TSS), the genomic intervals near the Ensembl 67 gene start site +/-5kB (or 2kB) were divided into 100 (or 40) equally sized groups using BEDtools makewindows. Subsequently, the number of test and control reads that overlapped the groups was calculated using BEDtools multicov. The total number of test and control reads per group of samples was normalized to the appropriate library size, and the fold enrichment for each group was determined by dividing the number of normalized ChIP-Seq test sample reads by the number of normalized ChIP-Seq control sample reads. For calculating ChIP-Seq signal at gene promoter, the interval between gene groups around the initiation site +500bp/-1kB of Ensembl 67 gene is
RNA-Seq alignment and downstream analysis
For the study of Tet1-KO and Tet1-WT PGC, Illumina and Smart-seq adaptors from sequencing reads were first trimmed using Trimmomatic. For other RNA-Seq libraries, the fastq files generated from the output of next generation sequencing were used directly for alignment. RNA-Seq reads were aligned to the mouse genome (mm9, NCBI construct 37) using Bowtie (version 0.12.8) and Tophat (version 2.0.2), with the selection-N2-b 2-most-sensitive-b 2-L25. Annotations from EnsemblGene version 67 were used as a gene model for Tophat. Read counts were calculated for each annotated gene using HTSeq (version 0.5.3p9), and expression levels of each gene were quantified by calculating the number of detected fragments per million reads per kilobase (FPKM) using custom R scripts. Genes were assigned to expression level groups based on the average FPKM values of the two biological replicates. Differential expression analysis was performed using DESeq2 (version 1.6.3) and p values adjusted<A gene of 0.05 was considered differentially expressed. For determination of Gene expression levels in wild-type and Dnmt 1-conditional Gene knockouts and matched wild-type E10.5 PGCs, from GSE7493824Download original RNA-Seq reads and work as aboveAnd (6) processing.
Based on the significance of activation between gene expression in E10.5 and E14.5 PGCs (α) (FIG. 4B), the HCPs methylated and unmethylated in PGCs during epigenetic reprogramming (
For the classification of GRR genes (fig. 14, table 1), pairwise differential expression analysis was first performed. The 5mC reprogramming dependent GRR gene is defined as a gene that performs the following: 1) Dnmt-TKO is up-regulated relative to WT, Dnmt-TKO + PRC1 inhibitor relative to WT and Dnmt-TKO + PRC1 inhibitor relative to WT + PRC1 inhibitor; and 2) WT + PRC1 inhibitor was not upregulated relative to WT. The PRC1 reprogramming-dependent GRR gene is defined as a gene that: 1) WT + PRC1 inhibitor was up-regulated relative to WT, Dnmt-TKO + PRC1 inhibitor relative to WT, and Dnmt-TKO + PRC1 inhibitor relative to Dnmt-TKO; and 2) Dnmt-TKO is not upregulated relative to WT. The 5mC/PRC1 reprogramming-dependent GRR gene is defined as a gene that performs either: 1) WT + PRC1 inhibitor was upregulated relative to WT, Dnmt-TKO + PRC1 inhibitor relative to WT, Dnmt-TKO + PRC1 inhibitor relative to Dnmt-TKO and Dnmt-TKO + PRC1 inhibitor relative to WT + PRC1 inhibitor; or 2) Dnmt-TKO + PRC1 inhibitor is up-regulated relative to WT, Dnmt-TKO + PRC1 inhibitor relative to Dnmt-TKO and Dnmt-TKO + PRC1 inhibitor relative to WT + PRC1 inhibitor, and WT + PRC1 inhibitor is not up-regulated relative to WT and Dnmt-TKO relative to WT. The 5mC/PRC1 reprogramming independent or deficient GRR gene was defined as the gene where Dnmt-TKO is not upregulated relative to WT, Dnmt-TKO + PRC1 inhibitor is relative to WT, and Dnmt-TKO + PRC1 inhibitor is relative to WT + PRC1 inhibitor and WT + PRC1 inhibitor is relative to WT. Genes that do fall into one of these five categories are described as low confidence classification (l.c.c.) genes.
Tet1 and 5mC/5hmC detection by immunofluorescence
Embryonic stems (E10.5) or genital ridges (E12.5/E13.5) were first fixed in 2% PFA (in PBS) at 4 ℃ for 30 min. After fixation, the tissues were washed three times in PBS for 10min and subsequently incubated overnight in PBS containing 15% sucrose. The next day after rinsing with PBS containing 1% BSA, tissues were embedded in OCT embedded matrix (Thermo Scientific Raymond Lamb) and frozen using liquid nitrogen. The samples were then stored at-80 ℃. A Leica CM 1950 cryostat was used to cut 10 μm sections from the frozen embedded tissue. Sections were placed on polylysine slides (seemer technology) and postfixed with PBS containing 2% PFA for 3 minutes.
For the detection of Tet1, sections were washed three times with PBS for 5 min. After incubation for 30min at room temperature in 1% BSA/PBS containing 0.1% Triton X-100, the sections were incubated with the listed primary antibodies in the same buffer overnight at 4 ℃. Subsequently, sections were washed three times for 5min in 1% BSA/PBS containing 0.1% Triton X-100 and incubated with secondary antibodies in the same buffer in the dark at room temperature for 1 hour. Subsequently, the secondary antibody incubations were washed three times for 5min with PBS. Subsequently, the DNA was stained with DAPI (100 ng/ml). After a final wash in PBS for 10min, sections were mounted with Vectashield (Vector Laboratories).
For the detection of 5hmC/5mC, the sections were washed three times with PBS for 5 min. After fixation the sections were first infiltrated with 0.5% Triton X-100 in 1% BSA/PBS for 30min and subsequently treated with RNase A (10 mg/ml; Roche) in 1% BSA/PBS for 1h at 37 ℃. After three 5min washes with PBS, sections were incubated with 4N HCl at 37 ℃ for 10-20min to denature genomic DNA, followed by three 10min washes with PBS. After incubation for 30min at room temperature in 1% BSA/PBS containing 0.1% Triton X-100, the sections were incubated with the listed primary antibodies in the same buffer overnight at 4 ℃. Subsequently, sections were washed three times for 5min in 1% BSA/PBS containing 0.1% Triton X-100 and incubated with secondary antibodies in the same buffer in the dark at room temperature for 1 hour. Subsequently, the secondary antibody incubations were washed three times for 5min with PBS. Subsequently, the DNA was stained with Propidium Iodide (PI) (0.25 mg/ml). After a final wash in PBS for 10min, sections were mounted with Vectashield (vector laboratories).
The following primary antibodies were used in this study: anti-SSEA 1 (bestowed by doctor p.beverly by doctor g.durova Hills); anti-MVH (ebola (Abcam)27591 or ebola 13840); anti-5 hmC (Activemotif 39791), anti-5 mC (Dagedode C15200081-100); anti-Tet 1 (gene tex (GeneTex) GTX 125888); anti-GFP (ebola 5450). The following secondary antibodies were used in this study: alexa Fluor647 goat anti-mouse IgM (Invitrogen) a 21238); alexa Fluor488 goat anti-rabbit IgG (invitrogen a 11008); alexa Fluor 405 goat anti-mouse IgG 1:300 (Invitrogen A31553); alexa Fluor488 goat anti-mouse IgG 1:300 (Invitrogen A11001); alexa Fluor 405 goat anti-rabbit IgG 1:300 (Invitrogen A31556); alexa Fluor 568 donkey anti-rabbit IgG (invitrogen a 10042); alexa Fluor488 donkey anti-goat IgG (Invitrogen A11055).
Locus specific bisulfite sequencing
Bisulfite treatment of genomic DNA was performed using the Imprint DNA modification kit (sigma). Semi-nested amplification of the Dazl promoter was performed using the following primers: f1: GATTTTTGTTATTTTTTAGTTTTTTTAGGAT, respectively; f2: TTTATTTAAGTTATTATTTTAAAAATGGTATT, respectively; r: AGAAACAAGCTAGGCCAGCTGAGAGAATTCT are provided. The following primers were used for the semi-nested amplification of IG-DMR ICR: f1: GTGTTAAGGTATATTATGTTAGTGTTAGG, respectively; f2: ATATTATGTTAGTGTTAGGAAGGATTGTG, respectively; r: TACAACCCTTCCCTCACTCCAAAAATT are provided. Nested amplification of Peg3 ICR was performed using the following primers: f1: TTTTTAGATTTTGTTTGGGGGTTTTTAATA, respectively; f2: TTGATAATAGTAGTTTGATTGGTAGGGTGT, respectively; r1: AATCCCTATCACCTAAATAACATCCCTACA, respectively; r2: ATCTACAACCTTATCAATTACCCTTAAAAA are provided. Methylation levels were assessed by QUMA using default settings, with repeated bisulfite sequences excluded.
Mass spectrometry
Genomic DNA was extracted from 100 to 2,000 FACS-sorted PGCs using the ZR-Duet DNA/RNA Miniprep kit (the Zymo research) following the manufacturer's instructions, and eluted in LC/MS grade water DNA was digested to nucleosides using the mixture of digestive enzymes provided by NEB a dilution series prepared with known amounts of synthetic nucleosides and digested DNA was supplemented with similar amounts of isotopically labeled nucleosides (provided by t. carell doctor (LMU, germany)), and separated on an Agilent RRHD eclipsplus C182.1 x 100mm 1.8 μ column by using a UHPLC1290 system (Agilent) and Agilent 6490 triple quadrupole mass spectrometer, to calculate the number of individual nucleosides, a standard curve representing the ratio of unlabelled nucleosides to isotopically labelled nucleosides was generated, and used to convert peak-area values to corresponding quantities the threshold for quantification is a signal-to-noise ratio (calculated using the peak-to-peak method) of above 10.
Immunoblotting
mESC was lysed by sonication in RIPA buffer (150mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50mM Tris pH 8.0) and protease-inhibitor cocktail (roche, 11697498001). Cell debris was removed by centrifugation at 14000g for 5min at 4 ℃. Protein was quantified using BCA protein assay (sermer, 23227). Mu.g (H2A and H2Aub) or 20. mu.g (Tet1) of each protein extract were loaded onto 15% or 8% SDS polyacrylamide gels and transferred to PVDF membranes after electrophoresis. The membrane was blocked with 5% BSA for 1 hour, and then incubated overnight at 4 ℃ with the primary antibody at the following dilution: anti-H2A antibody (eboantibody, 18255)1: 2000; anti-ubiquitin H2A antibody (Cell signaling 8240)1: 2000; anti-Tet 1 antibody [ N1] (gene tex GTX125888)1: 1000; anti-Lamin B antibody (C20) (Santa Cruz Biotechnologies, sc-6216)1: 10000. Donkey anti-rabbit IgG-HRP (St. Cruz Biotechnology, sc-2077) or donkey anti-goat IgG-HRP (St. Cruz Biotechnology, sc-2056) secondary antibody was incubated at room temperature for 1 h. The blot was developed by using lumineta crescido Western HRP substrate (EMD Milipore).
Reference to the literature
Alphabetical references:
Chung et al.,2008 Human Embryonic Stem Cell Lines Generated withoutEmbryo Destruction.Cell Stem Cell.2(2)113-
Galdon et al.In Vitro Spermatogenesis:How Far from ClinicalApplication？Curr Urol Rep 17；49(2016)
Hill et al.Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition,Nature；555(7696):392–396；15Mar 2018.
Jiang et al.,Pluripotency of mesenchymal stem cells derived fromadult marrow.
Kaji et al Virus-free induction of pluripotency and subsequentexcision of reprogramming factors.Nature.Online publication 1 March 2009
Kanatsu-Shinohara et al.,Generation of pluripotent stem cells fromneonatal mouse testis.Cell 119,1001–1012,2004
Phillips et al.Spermatogonial stem cell regulation andspermatogenesis.Phil Trans R Soc B 365,1663-1678(2010)
Matsui et al.,Derivation of pluripotential embryonic stem cells frommurine primordial germ cells in culture.Cell 70,841–847,1992
Medrano et al.Human somatic cells subjected to genetic induction withsix germ line-related factors display meiotic germ cell-likefeatures.Scientific Reports 6:24956:10.1038(2016)
numbered references (main):
1 Lesch,B.&Page,D.Genetics of germ cell development.Nat Rev Genet 13,781-794(2012).
2 Guibert,S.,Forné,T.&Weber,M.Global profiling of DNA methylationerasure in mouse primordial germ cells.Genome Res 22,633-641(2012).
3 Hackett,J.et al.Germline DNA demethylation dynamics and imprinterasure through 5-hydroxymethylcytosine.Science 339,448-452(2013).
4 Hajkova,P.et al.Chromatin dynamics during epigenetic reprogrammingin the mouse germ line.Nature 452,877-881(2008).
5 Hajkova,P.et al.Epigenetic reprogramming in mouse primordial germcells.Mech Dev 117,15-23(2002).
6 Hill,P.,Amouroux,R.&Hajkova,P.DNA demethylation,Tet proteins and 5-hydroxymethylcytosine in epigenetic reprogramming:an emerging complexstory.Genomics 104,324-333(2014).
7 Lee,J.et al.Erasing genomic imprinting memory in mouse cloneembryos produced from day 11.5 primordial germ cells.Development 129,1807-1817(2002).
8 Seisenberger,S.et al.The dynamics of genome-wide DNA methylationreprogramming in mouse primordial germ cells.Mol Cell 48,849-862(2012).
9 Yamaguchi,S.et al.Tet1 controls meiosis by regulating meiotic geneexpression.Nature 492,443-447(2012).
10 Yamaguchi,S.,Shen,L.,Liu,Y.,Sendler,D.&Zhang,Y.Role of Tet1 inerasure of genomic imprinting.Nature 504,460-464(2013).
11 Hajkova,P.et al.Genome-wide reprogramming in the mouse germ lineentails the base excision repair pathway.Science 329,78-82(2010).
12 Hayashi,K.et al.Offspring from oocytes derived from in vitroprimordial germ cell-like cells in mice.Science 338,971-975(2012).
13 Hayashi,K.,Ohta,H.,Kurimoto,K.,Aramaki,S.&Saitou,M.Reconstitutionof the mouse germ cell specification pathway in culture by pluripotent stemcells.Cell 146,519-532(2011).
14 Hikabe,O.et al.Reconstitution in vitro of the entire cycle of themouse female germ line.Nature 539,299-303(2016).
15 Sun,Z.et al.High-resolution enzymatic mapping of genomic 5-hydroxymethylcytosine in mouse embryonic stem cells.Cell Rep 3,567-576(2013).
16 Huang,Y.et al.The behaviour of 5-hydroxymethylcytosine inbisulfite sequencing.PLoS One 5,e8888(2010).
17 Yamaguchi,S.et al.Dynamics of 5-methylcytosine and 5-hydroxymethylcytosine during germ cell reprogramming.Cell Res 23,329-339(2013).
18 Dawlaty,M.et al.Tet1 is dispensable for maintaining pluripotencyand its loss is compatible with embryonic and postnatal development.Cell StemCell 9,166-175(2011).
19 Weber,M.et al.Distribution,silencing potential and evolutionaryimpact of promoter DNA methylation in the human genome.Nat Genet 39,457-466(2007).
20 Tahiliani,M.et al.Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1.Science 324,930-935(2009).
21 Williams,K.et al.TET1 and hydroxymethylcytosine in transcriptionand DNA methylation fidelity.Nature 473,343-348(2011).
22 Vella,P.et al.Tet proteins connect the O-linked N-acetylglucosamine transferase Ogt to chromatin in embryonic stem cells.MolCell 49,645-656(2013).
23 Tsumura,A.et al.Maintenance of self-renewal ability of mouseembryonic stem cells in the absence of DNA methyltransferases Dnmt1,Dnmt3aand Dnmt3b.Genes Cells 11,805-814(2006).
24 Hargan-Calvopina,J.et al.Stage-Specific Demethylation inPrimordial Germ Cells Safeguards against Precocious Differentiation.Dev Cell39,75-86(2016).
25 Mansour,A.et al.The H3K27 demethylase Utx regulates somatic andgerm cell epigenetic reprogramming.Nature 488,409-413(2012).
26 Yokobayashi,S.et al.PRC1 coordinates timing of sexualdifferentiation of female primordial germ cells.Nature 495,236-240(2013).
27 Ismail,I.,McDonald,D.,Strickfaden,H.,Xu,Z.&Hendzel,M.A smallmolecule inhibitor of polycomb repressive complex 1 inhibits ubiquitinsignaling at DNA double-strand breaks.J Biol Chem 288,26944-26954(2013).
28 Deplus,R.et al.TET2 and TET3 regulate GlcNAcylation and H3K4methylation through OGT and SET1/COMPASS.EMBO J 32,645-655(2013).
29 Amouroux,R.et al.De novo DNA methylation drives 5hmC accumulationin mouse zygotes.Nat Cell Biol 18,225-233,doi:10.1038/ncb3296(2016).
30 Hon,G.et al.5mC Oxidation by Tet2 Modulates Enhancer Activity andTiming of Transcriptome Reprogramming during Differentiation.Mol Cell 56,286-297(2014).
31 Yang,H.et al.One-step generation of mice carrying reporter andconditional alleles by CRISPR/Cas-mediated genome engineering.Cell 154,1370-1379(2013).
32 Boyle,P.et al.Gel-free multiplexed reduced representationbisulfite sequencing for large-scale DNA methylation profiling.Genome Biol13,R92(2012).
33 Kurimoto,K.et al.Quantitative Dynamics of Chromatin Remodelingduring Germ Cell Specification from Mouse Embryonic Stem Cells.Cell Stem Cell16,517-532(2015).
34 Borgel,J.et al.Targets and dynamics of promoter DNA methylationduring early mouse
35 Yu,M.et al.Base-resolution analysis of 5-hydroxymethylcytosine inthe mammalian genome.Cell 149,1368-1380(2012).
36 Xu,Y.et al.Genome-wide regulation of 5hmC,5mC,and gene expressionby Tet1 hydroxylase in mouse embryonic stem cells.Mol Cell 42,451-464(2011).
37 Brookes,E.et al.Polycomb associates genome-wide with a specificRNA polymerase II variant,and regulates metabolic genes in ESCs.Cell StemCell 10,157-170(2012).
38 Cooper,S.et al.Targeting polycomb to pericentric heterochromatinin embryonic stem cells reveals a role for H2AK119u1 in
39 Hashimoto,H.et al.Structure of a Naegleria Tet-like dioxygenase incomplex with 5-methylcytosine DNA.Nature 506,391-395(2014).
all references mentioned above are incorporated herein by reference.