CLD protein mutant and application thereof
阅读说明：本技术 一种cld蛋白突变体及应用 (CLD protein mutant and application thereof ) 是由 胡勤学 付明 杜涛 于 2021-07-12 设计创作，主要内容包括：本发明涉及基因工程领域,更具体涉及一种CLD蛋白突变体及应用。所述的蛋白为SEQ ID NO.1-SEQ ID NO.5所示的任一一个蛋白,申请人将原代CLD重组蛋白中的CD4 60位处的半胱氨酸突变为丝氨酸,获得的CLD蛋白突变体对测试的HIV-1毒株抑制能力提高2-3个数量级,显著提高了对病毒的中和能力,这种差异在测试的HIV-1 T/F(transmitter/founder)virus中更加显著,CLD蛋白能够大幅提高与HIV-1病毒的结合效率；CLD蛋白突变体或重组CLD蛋白与包膜蛋白形成的复合物可以作为一种免疫原,更好诱导出针对包膜蛋白V1V2区的抗体,表现出良好的应用前景。(The invention relates to the field of genetic engineering, and in particular relates to a CLD protein mutant and application thereof. The protein is any one of proteins shown in SEQ ID No.1-SEQ ID No.5, the applicant mutates cysteine at a CD460 position in a primary CLD recombinant protein into serine, the inhibition capability of the obtained CLD protein mutant on a tested HIV-1 strain is improved by 2-3 orders of magnitude, the neutralization capability on viruses is obviously improved, the difference is more obvious in tested HIV-1T/F (transmitter/launcher) viruses, and the CLD protein can greatly improve the binding efficiency with the HIV-1 viruses; the CLD protein mutant or the compound formed by the recombinant CLD protein and the envelope protein can be used as an immunogen to better induce an antibody aiming at the V1V2 region of the envelope protein, and has good application prospect.)
1. A CLD protein mutant is any one of proteins in SEQ ID No.1-SEQ ID No. 5.
2. A CLD protein mutant composition is a combination of any two, three, four or all proteins in SEQ ID No.1-SEQ ID No. 5.
3. A composite immunogen comprising the CLD protein mutant of claim 1 and an HIV-1 envelope protein.
4. Use of a mutant CLD protein according to claim 1 or a composition according to claim 2 or a complex immunogen according to claim 3 for the preparation of an anti-HIV-1 medicament.
5. A composite immunogen consisting of a recombinant CLD protein and an HIV-1 envelope protein, wherein the recombinant CLD protein is any one of the proteins in claims 1-8 in CN 102617738A.
6. Use of the complex immunogen of claim 5 in the preparation of an anti-HIV-1 medicament.
Technical Field
The invention relates to the field of genetic engineering, and in particular relates to a CLD protein mutant and application thereof.
Background
Human immunodeficiency virus (HIV-1) is the etiological agent of AIDS (acquired immune deficiency syndrome). Due to the high degree of variation of HIV-1 and the lack of understanding of the mechanisms of human immunity, no successful HIV-1 vaccine has been developed. The treatment and prevention of HIV-1 infected patients mainly depends on anti-HIV drugs. However, due to the high variability of HIV-1, long-term use of clinical drugs inevitably leads to viral resistance and drug resistance. The development of new antiviral drugs is pressing for the sustainability of HIV-1 treatment.
Target cell types for HIV-1 infection include T cells, macrophages, and partial types of DC cells, which are commonly characterized by cell surface expression of CD4 molecules and co-receptor molecules. HIV-1 is classified into R5 and X4 viruses according to whether HIV-1 uses CCR5 or CXCR4 co-receptor in infecting cells, and some subtypes of AIDS viruses also exist as intermediate type R5X4 viruses using CCR5 and CXCR 4. The process of HIV-1 infection of target cells is actually the process of recognition of the viral envelope proteins, binding to CD4 and co-receptors. However, the virus, whether R5, X4 or R5X4, uses CD4 to complete the infection process. Binding of the HIV-1 envelope protein to CD4 and the co-receptor is sufficient for the virus to infect cells. Therefore, targeting the binding site of the HIV-1 envelope protein CD4 can block HIV-1 infection of cells.
DC-SIGN is a lectin recognition protein expressed on the surface of DC cells, and can enrich viruses by binding to polysaccharide on the surface of envelope protein, and soluble DC-SIGN can inhibit the binding of HIV-1 envelope protein to DC cells.
Early applicants tried to express CD4 in prokaryotic cells after fusing with DC-SIGN (CN 102617738A), and the results showed that the designed recombinant protein CLD has better antiviral activity and the tested virus neutralization capacity reaches microgram level, but in later experiments, applicants found that the recombinant protein has poor effect on most T/F strains.
Aiming at the problems, the fusion recombinant protein is improved, the cysteine at the position 60 of the CD4 structural domain of the recombinant fusion protein is mutated into the serine, the HIS histidine sequence used in prokaryotic expression is removed, and the expression is carried out in a eukaryotic system, so that the obtained recombinant protein CLD mutant is greatly improved relative to the first generation CLD activity of prokaryotic expression, has strong broad-spectrum property, and is hopefully to become a new generation of anti-HIV-1 drugs.
Disclosure of Invention
The invention aims to provide a CLD protein mutant, which is any one protein of SEQ ID NO.1-SEQ ID NO. 5.
Another object of the present invention is to provide a CLD protein mutant composition, which is a combination of any two, three, four or all of the proteins of SEQ ID NO.1 to SEQ ID NO. 5.
Another object of the present invention is to provide the use of a mutant CLD protein or a composition thereof for the preparation of an anti-HIV-1 agent.
Still another object of the present invention is to provide a composite immunogen consisting of a recombinant CLD protein and an HIV-1 envelope protein, wherein the recombinant CLD protein is any one of the proteins of SEQ ID No.1 to SEQ ID No.5 or any one of the proteins of claims 1 to 8 of CN 102617738A.
The last purpose of the invention is to provide the application of the compound immunogen in the preparation of anti-HIV-1 medicines.
In order to achieve the purpose, the invention adopts the following technical measures:
a mutant of CLD protein, said mutant being any one of the proteins of SEQ ID No.1 to SEQ ID No.5, the applicant mutated cysteine at position CD460 to serine compared to the primary CLD mentioned in CN 102617738A. The coded product can greatly improve the binding efficiency with HIV-1 virus and maintain the stability of protein.
A composition of a CLD protein mutant, which is a combination of any two, three, four or all of the proteins in SEQ ID No.1-SEQ ID No. 5.
The application of the CLD protein mutant in preparing anti-HIV-1 medicaments utilizes any one protein of SEQ ID NO.1-SEQ ID NO.5, or any combination thereof as a unique main effective component, or one of the main effective components, to prepare the anti-HIV-1 medicaments.
A composite immunogen consisting of recombinant CLD protein and HIV-1 envelope protein, wherein the recombinant CLD protein is any one of the proteins of SEQ ID No.1-SEQ ID No.5 or any one of the proteins of claim 1-8 in CN 102617738A.
The HIV-1 envelope proteins include but are not limited to: HIV-1gp 160, HIV-1gp 140 or HIV-1gp 120.
The protective scope of the invention also includes the application of the composite immunogen in the preparation of anti-HIV-1 medicines.
Compared with the prior art, the invention has the following advantages and effects:
compared with prokaryotic recombinant CLD, the eukaryotic expressed recombinant protein CLD mutant has 2-3 orders of magnitude higher inhibition capability on tested HIV-1 strains, obviously improves the virus neutralization capability, has more obvious difference in tested HIV-1T/F (transmitter/foundation) viruses, and shows good application prospect. Compared with the CLD expressed by pronucleus and the CLD non-mutant recombinant fusion protein expressed by eukaryon, the CLD mutant expressed by eukaryon is more stable in solution, and the change of the ability of inhibiting HIV-1 is small. In an anti-HIV-1 infection experiment, the inhibitory activity of the eukaryotic expression CLD mutant recombinant fusion protein on partial strains is improved by 3-5 times compared with that of a non-mutant.
The series of CLD mutant proteins obtained by the invention have good inhibition effect on HIV. The CLD mutant protein forms a tetrameric form of the dual-function structural domain in a solution state, and after the DC-SIGN functional structural domain in the multimerized CLD mutant is combined with the envelope protein, the local concentration of a tetrameric CD4 molecule and a CD4 combination site on the envelope protein is increased, so that the HIV-1 neutralizing capacity is improved.
Compared with HIV-1 envelope protein mixed with CD4 or DC-SIGN or single envelope protein, the compound formed by the CLD mutant protein and the HIV-1 envelope protein can be used as immunogen to induce organism to generate stronger immune response targeting gp 120V 1V2 epitope, and the generated immune response targeting gp 120V 3C3 epitope is weaker.
Detailed Description
The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
construction of eukaryotic expression vectors pCDNA-C25NDC60S, pCDNA-C30NDC60S, pCDNA-C35NDC60S, pCDNA-C40NDC60S and pCDNA-C45NDC60S
The primers used in this example were as follows:
P1-F：GAATTCCCTGCTGCTGCTCCTGCCTCAGGCCCAGGCTGTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTA；
P1-R：TTAAACGGGCCCTCTAGACTCGAGCTACGCAGGAGGGGGGTTTGGGGTG。
P2-F:ATGGACCGGGCCAAGCTGCTGCTCCTGCTCCTGCTGCTGCTCCTGCCTCTGCAGATATCCAGCACAGTGG；
P2-R:GAGGCAGGAGCAGCAGCAGGAGCAGGAGCAGCAGCTTGGCCCGGTCCATGAATTCCACCACACTGGACTAGTGG。
P3-F:GATCGCGCTGACTCAAGAAGAAGCCTTTGGGAC；
P3-R:GTCCCAAAGGCTTCTTCTTGAGTCAGCGCGATC。
(1) construction of pCDNA-C25NDC 60S:
PCR was carried out using pET28a-C25D (CN 102617738A) as a template and primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. PCR was performed using pCDNA3.1 as a template and primers P2-F and P2-R, and the gel was recovered after nucleic acid electrophoresis. Homologous recombination was performed using the Novowed homologous recombination kit. Adding 15 mul of recombinant system into 100 mul of escherichia coli DH5 alpha competence, mixing uniformly, carrying out heat shock transformation at 42 ℃, adding 800 mul of LB culture solution, carrying out shake culture at 37 ℃ for 1h, coating the bacterial solution on a kanamycin-resistant LB culture medium, carrying out overnight culture at 37 ℃, picking 6 colonies from a transformed plate, inoculating the colonies to 5ml of LB containing kanamycin, carrying out shake culture at 37 ℃ for overnight, extracting plasmids by using a plasmid extraction kit, carrying out sequencing verification, and successfully constructing and naming the recombinant system as pCDNA-C25 ND.
PCR amplification was carried out using Takara circular PCR kit with the constructed pCDNA-C25ND as a template and P3-F, P3-R as a primer set. Adding 2 mul dpnI into each 50 mul PCR system, digesting for 2 hours at 37 ℃, taking 15 mul adding to 100 mul Escherichia coli DH5 alpha, mixing evenly, transforming at 42 ℃, adding 800 mul LB culture solution, culturing for 1 hour at 37 ℃ in a shaking way, coating the bacterial solution on a kanamycin-resistant LB culture medium, culturing overnight at 37 ℃, picking 6 colonies from the transformed plate, inoculating to 5ml LB containing kanamycin, culturing overnight at 37 ℃ in a shaking way, extracting plasmids by using a plasmid extraction kit, verifying sequencing, and naming the successful construction as pCDNA-C25NDC 60S. pCDNA-C25NDC60S encodes a DNA comprising a CD4D1D 2N-terminal 178 aa portion and DC-SIGN NECK and CRD portions; 25 amino acid linker; mutation of CD460 amino acid from cysteine to serine
(2) Construction of pCDNA-C30NDC 60S:
PCR was carried out using pET28a-C30D (CN 102617738A) as a template and primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. PCR was performed using pCDNA3.1 as a template and primers P2-F and P2-R, and the gel was recovered after nucleic acid electrophoresis. Homologous recombination was performed using the Novowed homologous recombination kit. Adding 15 mul of recombinant system into 100 mul of escherichia coli DH5 alpha competence, mixing uniformly, carrying out heat shock transformation at 42 ℃, adding 800 mul of LB culture solution, carrying out shake culture at 37 ℃ for 1h, coating the bacterial solution on a kanamycin-resistant LB culture medium, carrying out overnight culture at 37 ℃, picking 6 colonies from a transformed plate, inoculating the colonies to 5ml of LB containing kanamycin, carrying out shake culture at 37 ℃ for overnight, extracting plasmids by using a plasmid extraction kit, carrying out sequencing verification, and successfully constructing and naming the recombinant system as pCDNA-C30 ND.
PCR amplification was carried out using Takara circular PCR kit with the constructed pCDNA-C30ND as a template and P3-F, P3-R as a primer set. Adding 2 mul dpnI into each 50 mul PCR system, digesting for 2 hours at 37 ℃, taking 15 mul adding to 100 mul Escherichia coli DH5 alpha, mixing evenly, transforming at 42 ℃, adding 800 mul LB culture solution, culturing for 1 hour at 37 ℃ in a shaking way, coating the bacterial solution on a kanamycin-resistant LB culture medium, culturing overnight at 37 ℃, picking 6 colonies from the transformed plate, inoculating to 5ml LB containing kanamycin, culturing overnight at 37 ℃ in a shaking way, extracting plasmids by using a plasmid extraction kit, verifying sequencing, and naming the successful construction as pCDNA-C30NDC 60S. pCDNA-C30NDC60S encodes a DNA comprising a CD4D1D 2N-terminal 178 aa portion and DC-SIGN NECK and CRD portions; 30 amino acid linker; mutation of CD460 amino acid from cysteine to serine
(3) Construction of pCDNA-C35NDC 60S:
PCR was carried out using pET28a-C35D (CN 102617738A) as a template and primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. PCR was performed using pCDNA3.1 as a template and primers P2-F and P2-R, and the gel was recovered after nucleic acid electrophoresis. Homologous recombination was performed using the Novowed homologous recombination kit. Adding 15 mul of recombinant system into 100 mul of escherichia coli DH5 alpha competence, mixing uniformly, carrying out heat shock transformation at 42 ℃, adding 800 mul of LB culture solution, carrying out shake culture at 37 ℃ for 1h, coating the bacterial solution on a kanamycin-resistant LB culture medium, carrying out overnight culture at 37 ℃, picking 6 colonies from a transformed plate, inoculating the colonies to 5ml of LB containing kanamycin, carrying out shake culture at 37 ℃ for overnight, extracting plasmids by using a plasmid extraction kit, carrying out sequencing verification, and successfully constructing and naming the recombinant system as pCDNA-C35 ND.
PCR amplification was carried out using Takara circular PCR kit with the constructed pCDNA-C35ND as a template and P3-F, P3-R as a primer set. Adding 2 mul dpnI into each 50 mul PCR system, digesting for 2 hours at 37 ℃, taking 15 mul adding to 100 mul Escherichia coli DH5 alpha, mixing evenly, transforming at 42 ℃, adding 800 mul LB culture solution, culturing for 1 hour at 37 ℃ in a shaking way, coating the bacterial solution on a kanamycin-resistant LB culture medium, culturing overnight at 37 ℃, picking 6 colonies from the transformed plate, inoculating to 5ml LB containing kanamycin, culturing overnight at 37 ℃ in a shaking way, extracting plasmids by using a plasmid extraction kit, verifying sequencing, and naming the successful construction as pCDNA-C35NDC 60S. pCDNA-C35NDC60S encodes a DNA comprising a CD4D1D 2N-terminal 178 aa portion and DC-SIGN NECK and CRD portions; 35 amino acids; the amino acid at position 460 of CD is mutated from cysteine to serine.
(4) Construction of pCDNA-C40NDC 60S:
PCR was carried out using pET28a-C40D (CN 102617738A) as a template and primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. PCR was performed using pCDNA3.1 as a template and primers P2-F and P2-R, and the gel was recovered after nucleic acid electrophoresis. Homologous recombination was performed using the Novowed homologous recombination kit. Adding 15 mul of recombinant system into 100 mul of escherichia coli DH5 alpha competence, mixing uniformly, carrying out heat shock transformation at 42 ℃, adding 800 mul of LB culture solution, carrying out shake culture at 37 ℃ for 1h, coating the bacterial solution on a kanamycin-resistant LB culture medium, carrying out overnight culture at 37 ℃, picking 6 colonies from a transformed plate, inoculating the colonies to 5ml of LB containing kanamycin, carrying out shake culture at 37 ℃ for overnight culture, extracting plasmids by using a plasmid extraction kit, carrying out sequencing verification, and successfully constructing and naming the recombinant system as pCDNA-C40 ND.
PCR amplification was carried out using Takara circular PCR kit with the constructed pCDNA-C40ND as a template and P3-F, P3-R as a primer set. Adding 2 mul dpnI into each 50 mul PCR system, digesting for 2 hours at 37 ℃, taking 15 mul adding to 100 mul Escherichia coli DH5 alpha, mixing evenly, transforming at 42 ℃, adding 800 mul LB culture solution, culturing for 1 hour at 37 ℃ in a shaking way, coating the bacterial solution on a kanamycin-resistant LB culture medium, culturing overnight at 37 ℃, picking 6 colonies from the transformed plate, inoculating to 5ml LB containing kanamycin, culturing overnight at 37 ℃ in a shaking way, extracting plasmids by using a plasmid extraction kit, verifying sequencing, and naming the successful construction as pCDNA-C40NDC 60S. pCDNA-C40NDC60S encodes a DNA comprising a CD4D1D 2N-terminal 178 aa portion and DC-SIGN NECK and CRD portions; 40 amino acid linker; the amino acid at position 460 of CD is mutated from cysteine to serine.
(5) Construction of pCDNA-C45NDC 60S:
PCR was carried out using pET28a-C45D as a template and primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. PCR was performed using pCDNA3.1 as a template and primers P2-F and P2-R, and the gel was recovered after nucleic acid electrophoresis. Homologous recombination was performed using the Novowed homologous recombination kit. Adding 15 mul of recombinant system into 100 mul of escherichia coli DH5 alpha competence, mixing uniformly, carrying out heat shock transformation at 42 ℃, adding 800 mul of LB culture solution, carrying out shake culture at 37 ℃ for 1h, coating the bacterial solution on a kanamycin-resistant LB culture medium, carrying out overnight culture at 37 ℃, picking 6 colonies from a transformed plate, inoculating the colonies to 5ml of LB containing kanamycin, carrying out shake culture at 37 ℃ for overnight, extracting plasmids by using a plasmid extraction kit, carrying out sequencing verification, and successfully constructing and naming the recombinant system as pCDNA-C45 ND.
PCR amplification was carried out using Takara circular PCR kit with the constructed pCDNA-C45ND as a template and P3-F, P3-R as a primer set. Adding 2 mul dpnI into each 50 mul PCR system, digesting for 2 hours at 37 ℃, taking 15 mul adding to 100 mul Escherichia coli DH5 alpha, mixing evenly, transforming at 42 ℃, adding 800 mul LB culture solution, culturing for 1 hour at 37 ℃ in a shaking way, coating the bacterial solution on a kanamycin-resistant LB culture medium, culturing overnight at 37 ℃, picking 6 colonies from the transformed plate, inoculating to 5ml LB containing kanamycin, culturing overnight at 37 ℃ in a shaking way, extracting plasmids by using a plasmid extraction kit, verifying sequencing, and naming the successful construction as pCDNA-C45NDC 60S. pCDNA-C45NDC60S encodes a DNA comprising a CD4D1D 2N-terminal 178 aa portion and DC-SIGN NECK and CRD portions; 45 amino acid linker; the amino acid at position 460 of CD is mutated from cysteine to serine.
Example 2:
expression of recombinant protein CLD mutant of each eukaryotic expression vector prepared in example 1:
1. cell culture
Passaging is carried out at the cell density of 60-70 ten thousand/ml, the total volume is 30ml, when the cell density of 293F reaches 1.2-1.5 million cells/ml, the cells are collected (1200 turns and centrifugates for 5min), and the cells are resuspended by using 15ml of culture medium for transfection.
2. Transfection:
the plasmid used for transfection of each million cells is 1-1.5 mu g; 750. mu.l physiological saline + 37.5. mu.g plasmid; 750. mu.l physiological saline + 150. mu.l PEI (1 mg/ml). Standing for 5min after mixing, gently mixing, standing at room temperature for 10min (less than 20min), adding the plasmid-liposome mixture into shake flask, mixing, and placing into shaking table (8% carbon dioxide, 37 deg.C, 125 rpm). And supplementing 15ml of culture medium after 4-6 hours. Collecting cell supernatant after 4 days, ultrafiltering with 50KD ultrafiltering tube, concentrating to 80 times, adding 10% glycerol, and packaging at-80 deg.C.
In the invention, the protein expressed by the eukaryotic expression plasmid pCDNA-C25NDC60S is named as C25NDC60S (shown in SEQ ID NO. 1), the protein expressed by pCDNA-C30NDC60S is named as C30NDC60S (shown in SEQ ID NO. 2), the protein expressed by pCDNA-C35NDC60S is named as C35NDC60S (shown in SEQ ID NO. 3), the protein expressed by pCDNA-C40NDC60S is named as C40NDC60S (shown in SEQ ID NO. 4), and the protein expressed by pCDNA-C45NDC60S is named as C45NDC60S (shown in SEQ ID NO. 5).
ELISA for detecting concentration of recombinant protein CLD mutant
(1) The rabbit anti-DC-SIGN monoclonal antibody is coated on a 96-well plate at 5 mu g/ml, 50 mu l/well and stays overnight at room temperature;
eluting 5 times with plate washing machine, adding PBS blocking solution containing 1% BSA, sealing at 200 μ l/well, and blocking at 37 deg.C for one hour;
(2) eluting 5 times with plate washing machine, incubating standard (prokaryotic expression CLD)/recombinant protein sample, incubating at 50 μ l/well for one hour at 37 deg.C, and diluting the standard with blocking solution;
(3) the plate washing machine was eluted 5 times, and anti-CLD serum obtained from the subject group immunized mice was added and the mixture was washed with blocking solution 1: 1000 dilution, 50. mu.l/well, incubation for one hour at 37 ℃;
(4) the plate washing machine was eluted 5 times, HRP-labeled secondary goat anti-mouse IgG antibody was added, and the mixture was washed with blocking solution 1: 10000 dilution, 50 μ l/well, incubation for one hour at 37 ℃;
(5) eluting with a plate washing machine for 5 times, adding a TMB substrate placed at room temperature in advance, incubating at 50 μ l/hole, and incubating at room temperature in a dark place for 5 minutes; (6) and (3) terminating the reaction: 2M H was added2SO4Solution, 50 μ l/well, read using a microplate reader;
(7) and drawing a standard curve, and calculating the concentration of the recombinant protein CLD mutant.
The concentration of the recombinant protein CLD mutant prepared by the above method was 100. mu.g/ml.
Example 3:
the application of the CLD recombinant protein and the CLD mutant of the recombinant protein in the preparation of the medicine for treating or preventing HIV-1 virus:
1) preparation of HIV-1 pseudovirus:
pCDNA3.1(+) plasmid (Centralized Facility for AIDS Reagents) containing different HIV-1env genes and pSG3(Centralized Facility for AIDS Reagents) framework plasmid (Lipofectamine) lacking HIV-1env geneTM2000, Invitrogen Corporation) were co-transfected into 293T cells. After transfection for 48h, the virus-containing culture medium supernatant was filtered through a 0.45 μm filter membrane, 10% fetal bovine serum was added, and the mixture was dispensed into 1.5ml centrifuge tubes and stored at-80 ℃ for preparation; viral titers were determined using luciferase (commercially available, promega).
The different pCDNA3.1(+) plasmids described above contain different HIV-1env genes: MSW2, CH811, 700010040.C9.4520, PRB958_06.TB1.4305, weaud15.410.787, 62357_14.D3.4589, rejo.d12.1972, SC05.8C11.2344, 1059_09.a4.1460, 6240_08.TA5.4622, 700010058.a4.4375, 1058_11.B11.1550, SC45.4B5.2631, 62615_03. P4.3964.
2) Preparation of HIV-1 Euvirus:
different plasmids containing the HIV-1 genome in its entirety were isolated via liposomes (Lipofectamine)TM2000, Invitrogen corporation) transfected 293T cells. After transfection for 48h, filtering the virus-containing culture medium supernatant by using a 0.45 mu m filter membrane, adding 10% fetal bovine serum, subpackaging into 1.5ml centrifuge tubes, and storing at-80 ℃ for storage; viral titers were determined using luciferase (commercially available, promega).
The different plasmids described above are the laboratory adapted strains NL4-3 and BaL; T/F strains include THRO.c/2626, CH077.t/2627, CH040.c/2625, pCH058.c/2960, WITO.c/2474, SUMA.c/2821, CH164, CH185, CH 198.
3) Each recombinant protein inhibited HIV-1 infection of TZM-bl cell lines:
A. diluting each recombinant protein solution to 1 mu M, taking the diluted solution as an initial concentration, downwards diluting 11 gradients by taking 3 as a dilution coefficient, and finally adding a culture medium without recombinant protein as a control;
B. diluting the virus to 200TCID 50;
c.60. mu.l of the diluted virus was mixed with 60. mu.l of each recombinant protein dilution and incubated at 37 ℃ for 1 hour;
D. 100. mu.l of the virus-recombinant protein mixture was added to TZM-bl cells previously plated on a 96-well plate, followed by addition of 100. mu.l of complete medium containing DEAE (40. mu.g/ml) and incubation in a carbon dioxide incubator for 48 hours;
E. fluorescence was measured using luciferase (commercially available, promega corporation);
F. the inhibition was calculated as 0% inhibition with no CLD well reading.
The results are shown in the following table:
c25ND and C35ND are prokaryotic expressed CLD recombinant proteins reported in CN 102617738 a:
the C35NDS60C protein is derived from Bifunctional CD 4-DC-SIGN Fusion Proteins Enhanced affinity to gp120 and inhibition HIV-1 Infection and differentiation.
The blank space in the above table indicates that the item of data was not made.
The results show that the CLD protein mutant has better inhibiting effect on various HIV-1 viruses than the prokaryotic expression CLD recombinant protein reported in CN 102617738A.
Example 4:
the application of any one of 8 recombinant proteins CLD in the CN 102617738A application and HIV-1 envelope protein in preparing mixed immunogen in preparing HIV-1 virus prevention medicine is as follows:
1) preparation of mixed immunogens of recombinant proteins CLD, CD4 and DC-SIGN with HIV-1 envelope protein:
experimental groups: the recombinant protein CLD and HIV-1 envelope protein (5 μ g) were expressed as 3: 1 (molar ratio) and incubating at 4 ℃ for 24 hours for a total of 100. mu.l;
the recombinant protein CLD is the protein of any one of claims 1 to 8 of the application CN 102617738A.
Control group 1: CD4 was conjugated to HIV-1 envelope protein (5. mu.g) according to 12: 1 (molar ratio) and incubated at 4 ℃ for 24 hours for a total of 100. mu.l;
control group 2: DC-SIGN and HIV-1 envelope protein (5. mu.g) were mixed according to 12: 1 (molar ratio) and incubated at 4 ℃ for 24 hours for a total of 100. mu.l;
the recombinant protein CLD is present as a tetramer, one CLD tetramer containing four CD4 and four DC-SIGN, so the control used 12: 1 in a molar ratio.
The HIV-1 envelope protein is gp140 protein of HIV-1 CN 54.
2) Immunizing a mouse: subcutaneously injecting 100. mu.l of each group of reagents of step 1) for 3 times with 3 weeks between each immunization, and killing the mice on day 7 after the last immunization, and collecting serum and spleen;
3) experimental methods
A. To investigate whether CD4 binding to gp140 could affect its conformational change and expose the CD4i epitope, 17b (CD4i), 19b (CD4i), 447-52D (V3), 39F (V3), 12b (CD4BS) and F1056 monoclonal antibodies recognizing different targets of gp120 were selected for ELISA experiments. 96-well plates (0.25. mu.g/well) were coated with gp140 or a mixture of gp140 and recombinant protein CLD overnight at room temperature, washed three times with TBST, and then blocked with TBST containing 1% BSA at 37 ℃ for 1 h. A serial gradient of the dilution of the above antibody was incubated at 37 ℃ for 1 h. Three washes of TBST were followed by incubation with HRP-labeled goat anti-mouse secondary antibody (1:5000 dilution) for 1h at 37 ℃. After 5 times of washing, TMB is added to incubate for 5min in the dark at room temperature, and then 2M concentrated sulfuric acid is added to terminate the reaction. And finally, detecting the OD value by using an enzyme-labeling instrument, wherein 450nm is used as the experimental wavelength, and 570nm is used as the reference wavelength.
B. Gp 140-specific antibody titers in serum were tested for exploration ELISA. 96-well plates (0.25. mu.g/well) were coated with gp140 or a mixture of gp140 and sCD4 overnight at room temperature, washed three times with TBST, and then blocked with TBST containing 1% BSA at 37 ℃ for 1 h. Serial gradient diluted samples were incubated at 37C for 1 h. After three washes of TBST, the cells were incubated with HRP-labeled goat anti-mouse secondary antibody (1:5000 dilution) for 1h at 37 ℃. After 5 times of washing, TMB is added to incubate for 5min in the dark at room temperature, and then 2M concentrated sulfuric acid is added to terminate the reaction. And finally, detecting the OD value by using an enzyme-labeling instrument, wherein 450nm is used as the experimental wavelength, and 570nm is used as the reference wavelength.
C. Cytokine detection
Spleen of experimental mice is taken, and lymphocytes are separated. Cells were plated at 3X 107 cells per well in 24-well plates, stimulated with gp140 (20. mu.g/well) or CLD-gp140 (35. mu.g/well), and after 5 days the supernatants were collected, filtered through 0.22um filters, and stored at-80 ℃ until needed. The amounts of IL-2, IL-4, IL-5, IFN-. gamma.and TNF-. alpha.in the supernatant were determined using the BD Biosciences cytokine kit.
4) Results of the experiment
The recombinant protein CLD of the CN 102617738A application influences the binding of mAbs (17b,19b,447-52D,39F, b12, F105) to HIV-1gp 140.
The compound of the recombinant protein CLD and HIV-1 envelope protein in the CN 102617738A application can be used as an immunogen to induce the organism to generate stronger antibody response targeting gp 120V 1V2 epitope and weaker antibody response targeting gp 120V 3C3 epitope compared with HIV-1 envelope protein mixed with CD4 or DC-SIGN or envelope protein alone.
The compound of the recombinant protein CLD and HIV-1 envelope protein in the CN 102617738A application can be used as an immunogen to induce the organism to generate different gp 140-specific Th1/Th2 cellular immune responses compared with HIV-1 envelope protein mixed with CD4 or DC-SIGN or envelope protein alone. In spleen cells of mice immunized by a compound consisting of the CLD mutant and HIV-1 envelope protein, gp 140-specific cells expressing IL-4, IL-5 and IFN-gamma are obviously reduced; TNF expressing cells were also reduced, but there was no significant difference.
Example 5:
the application of the mixed immunogen of the CLD protein mutant and the HIV-1 envelope protein in the prevention of HIV-1 virus:
1) preparation of mixed immunogens of CLD protein mutants, CD4 and DC-SIGN with HIV-1 envelope protein:
experimental groups: CLD protein mutant and HIV-1 envelope protein (5 μ g) were expressed as 3: 1 (molar ratio) and incubating at 4 ℃ for 24 hours for a total of 100. mu.l;
the CLD protein mutant is a protein shown by SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5.
Control group 1: CD4 was conjugated to HIV-1 envelope protein (5. mu.g) according to 12: 1 (molar ratio) and incubated at 4 ℃ for 24 hours for a total of 100. mu.l;
control group 2: DC-SIGN and HIV-1 envelope protein (5. mu.g) were mixed according to 12: 1 (molar ratio) and incubated at 4 ℃ for 24 hours for a total of 100. mu.l;
CLD is present as a tetramer, one CLD tetramer containing four CD4 and four DC-SIGN, so the control used 12: 1 in a molar ratio.
The HIV-1 envelope protein is gp140 protein of HIV-1 CN 54.
2) Immunizing a mouse: subcutaneously injecting 100. mu.l of each group of reagents of step 1) for 3 times with 3 weeks between each immunization, and killing the mice on day 7 after the last immunization, and collecting serum and spleen;
3) experimental methods
A. In order to investigate whether the binding of CD4 to gp140 can affect its conformational change and expose the CD4i epitope, in this experiment, 6 monoclonal antibodies recognizing different targets of gp120, such as 17b (CD4i), 19b (CD4i), 447-52D (V3), 39F (V3), 12b (CD4BS) and F105, were selected for ELISA experiments. 96-well plates (0.25. mu.g/well) were coated with gp140 or a mixture of gp140 and recombinant protein CLD overnight at room temperature, washed three times with TBST, and then blocked with TBST containing 1% BSA at 37 ℃ for 1 h. A serial gradient of the dilution of the above antibody was incubated at 37 ℃ for 1 h. Three washes of TBST were followed by incubation with HRP-labeled goat anti-mouse secondary antibody (1:5000 dilution) for 1h at 37 ℃. After 5 times of washing, TMB is added to incubate for 5min in the dark at room temperature, and then 2M concentrated sulfuric acid is added to terminate the reaction. And finally, detecting the OD value by using an enzyme-labeling instrument, wherein 450nm is used as the experimental wavelength, and 570nm is used as the reference wavelength.
B. Gp 140-specific antibody titers in serum were tested for exploration ELISA. 96-well plates (0.25. mu.g/well) were coated with gp140 or a mixture of gp140 and sCD4 overnight at room temperature, washed three times with TBST, and then blocked with TBST containing 1% BSA at 37 ℃ for 1 h. Serial gradient diluted samples were incubated at 37C for 1 h. After three washes of TBST, the cells were incubated with HRP-labeled goat anti-mouse secondary antibody (1:5000 dilution) for 1h at 37 ℃. After 5 times of washing, TMB is added to incubate for 5min in the dark at room temperature, and then 2M concentrated sulfuric acid is added to terminate the reaction. And finally, detecting the OD value by using an enzyme-labeling instrument, wherein 450nm is used as the experimental wavelength, and 570nm is used as the reference wavelength.
C. Cytokine detection
Spleen of experimental mice is taken, and lymphocytes are separated. Cells were plated at 3X 107 cells per well in 24-well plates, stimulated with gp140 (20. mu.g/well) or CLD-gp140 (35. mu.g/well), and after 5 days the supernatants were collected, filtered through 0.22um filters, and stored at-80 ℃ until needed. The amounts of IL-2, IL-4, IL-5, IFN-. gamma.and TNF-. alpha.in the supernatant were determined using the BD Biosciences cytokine kit.
4) Results of the experiment
Compared to the recombinant protein CLD of example 4, the CLD mutants of the present invention affected mAbs (17b,19b,447-52D,39F, b12, F105) more strongly to bind to HIV-1gp 140.
Compared with HIV-1 envelope protein mixed with CD4 or DC-SIGN or envelope protein alone, the compound formed by the CLD protein mutant and the HIV-1 envelope protein can be used as immunogen to induce organism to generate stronger antibody reaction targeting gp 120V 1V2 epitope, and the generated antibody reaction targeting gp 120V 3C3 epitope is weaker. And the difference was more significant compared to the recombinant protein CLD in example 4.
The compound formed by the CLD mutant and HIV-1 envelope protein of the invention can be used as immunogen to induce organism to generate different gp140 specific Th1/Th2 cell immune response compared with HIV-1 envelope protein mixed with CD4 or DC-SIGN or envelope protein alone. In spleen cells of mice immunized by a compound consisting of the CLD mutant and HIV-1 envelope protein, gp 140-specific cells expressing IL-4, IL-5, TNF and IFN-gamma are obviously reduced. And the difference was more significant compared to the recombinant protein CLD in example 4.
Sequence listing
<110> Wuhan Virus institute of Chinese academy of sciences
<120> CLD protein mutant and application thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 541
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Asp Arg Ala Lys Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Gln Ala Gln Ala Val Lys Lys Val Val Leu Gly Lys Lys Gly Asp Thr
20 25 30
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser Ile Gln Phe His
35 40 45
Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Phe
50 55 60
Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala Asp Ser Arg Arg
65 70 75 80
Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile Lys Asn Leu Lys
85 90 95
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln Lys Glu
100 105 110
Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn Ser Asp Thr His
115 120 125
Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu Ser Pro Pro Gly
130 135 140
Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly Lys Asn Ile Gln
145 150 155 160
Gly Glu Lys Thr Leu Ser Val Ser Gln Leu Glu Leu Gln Asp Ser Gly
165 170 175
Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys Val Glu Phe Lys
180 185 190
Ile Asp Ile Val Val Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
195 200 205
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
210 215 220
Val Gly Glu Leu Ser Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu
225 230 235 240
Leu Thr Gln Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys
245 250 255
Leu Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly
260 265 270
Glu Leu Pro Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr
275 280 285
Trp Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Met Gln
290 295 300
Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu
305 310 315 320
Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu
325 330 335
Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile
340 345 350
Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu
355 360 365
Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala
370 375 380
Ala Val Glu Arg Leu Cys His Pro Cys Pro Trp Glu Trp Thr Phe Phe
385 390 395 400
Gln Gly Asn Cys Tyr Phe Met Ser Asn Ser Gln Arg Asn Trp His Asp
405 410 415
Ser Ile Thr Ala Cys Lys Glu Val Gly Ala Gln Leu Val Val Ile Lys
420 425 430
Ser Ala Glu Glu Gln Asn Phe Leu Gln Leu Gln Ser Ser Arg Ser Asn
435 440 445
Arg Phe Thr Trp Met Gly Leu Ser Asp Leu Asn Gln Glu Gly Thr Trp
450 455 460
Gln Trp Val Asp Gly Ser Pro Leu Leu Pro Ser Phe Lys Gln Tyr Trp
465 470 475 480
Asn Arg Gly Glu Pro Asn Asn Val Gly Glu Glu Asp Cys Ala Glu Phe
485 490 495
Ser Gly Asn Gly Trp Asn Asp Asp Lys Cys Asn Leu Ala Lys Phe Trp
500 505 510
Ile Cys Lys Lys Ser Ala Ala Ser Cys Ser Arg Asp Glu Glu Gln Phe
515 520 525
Leu Ser Pro Ala Pro Ala Thr Pro Asn Pro Pro Pro Ala
530 535 540
<210> 2
<211> 546
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Asp Arg Ala Lys Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Gln Ala Gln Ala Val Lys Lys Val Val Leu Gly Lys Lys Gly Asp Thr
20 25 30
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser Ile Gln Phe His
35 40 45
Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Phe
50 55 60
Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala Asp Ser Arg Arg
65 70 75 80
Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile Lys Asn Leu Lys
85 90 95
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln Lys Glu
100 105 110
Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn Ser Asp Thr His
115 120 125
Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu Ser Pro Pro Gly
130 135 140
Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly Lys Asn Ile Gln
145 150 155 160
Gly Glu Lys Thr Leu Ser Val Ser Gln Leu Glu Leu Gln Asp Ser Gly
165 170 175
Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys Val Glu Phe Lys
180 185 190
Ile Asp Ile Val Val Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
195 200 205
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
210 215 220
Gly Gly Gly Gly Ser Val Gly Glu Leu Ser Glu Lys Ser Lys Leu Gln
225 230 235 240
Glu Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala Ala Val Gly Glu Leu
245 250 255
Pro Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu
260 265 270
Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Leu Gln Glu Ile
275 280 285
Tyr Gln Glu Leu Thr Trp Leu Lys Ala Ala Val Gly Glu Leu Pro Glu
290 295 300
Lys Ser Lys Met Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala
305 310 315 320
Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln
325 330 335
Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser
340 345 350
Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val
355 360 365
Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu
370 375 380
Thr Gln Leu Lys Ala Ala Val Glu Arg Leu Cys His Pro Cys Pro Trp
385 390 395 400
Glu Trp Thr Phe Phe Gln Gly Asn Cys Tyr Phe Met Ser Asn Ser Gln
405 410 415
Arg Asn Trp His Asp Ser Ile Thr Ala Cys Lys Glu Val Gly Ala Gln
420 425 430
Leu Val Val Ile Lys Ser Ala Glu Glu Gln Asn Phe Leu Gln Leu Gln
435 440 445
Ser Ser Arg Ser Asn Arg Phe Thr Trp Met Gly Leu Ser Asp Leu Asn
450 455 460
Gln Glu Gly Thr Trp Gln Trp Val Asp Gly Ser Pro Leu Leu Pro Ser
465 470 475 480
Phe Lys Gln Tyr Trp Asn Arg Gly Glu Pro Asn Asn Val Gly Glu Glu
485 490 495
Asp Cys Ala Glu Phe Ser Gly Asn Gly Trp Asn Asp Asp Lys Cys Asn
500 505 510
Leu Ala Lys Phe Trp Ile Cys Lys Lys Ser Ala Ala Ser Cys Ser Arg
515 520 525
Asp Glu Glu Gln Phe Leu Ser Pro Ala Pro Ala Thr Pro Asn Pro Pro
530 535 540
Pro Ala
545
<210> 3
<211> 551
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Asp Arg Ala Lys Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Gln Ala Gln Ala Val Lys Lys Val Val Leu Gly Lys Lys Gly Asp Thr
20 25 30
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser Ile Gln Phe His
35 40 45
Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Phe
50 55 60
Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala Asp Ser Arg Arg
65 70 75 80
Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile Lys Asn Leu Lys
85 90 95
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln Lys Glu
100 105 110
Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn Ser Asp Thr His
115 120 125
Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu Ser Pro Pro Gly
130 135 140
Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly Lys Asn Ile Gln
145 150 155 160
Gly Glu Lys Thr Leu Ser Val Ser Gln Leu Glu Leu Gln Asp Ser Gly
165 170 175
Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys Val Glu Phe Lys
180 185 190
Ile Asp Ile Val Val Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
195 200 205
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
210 215 220
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Val Gly Glu Leu Ser Glu
225 230 235 240
Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala
245 250 255
Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln
260 265 270
Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser
275 280 285
Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr Trp Leu Lys Ala Ala Val
290 295 300
Gly Glu Leu Pro Glu Lys Ser Lys Met Gln Glu Ile Tyr Gln Glu Leu
305 310 315 320
Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Gln
325 330 335
Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu
340 345 350
Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Arg
355 360 365
Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu
370 375 380
Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala Ala Val Glu Arg Leu Cys
385 390 395 400
His Pro Cys Pro Trp Glu Trp Thr Phe Phe Gln Gly Asn Cys Tyr Phe
405 410 415
Met Ser Asn Ser Gln Arg Asn Trp His Asp Ser Ile Thr Ala Cys Lys
420 425 430
Glu Val Gly Ala Gln Leu Val Val Ile Lys Ser Ala Glu Glu Gln Asn
435 440 445
Phe Leu Gln Leu Gln Ser Ser Arg Ser Asn Arg Phe Thr Trp Met Gly
450 455 460
Leu Ser Asp Leu Asn Gln Glu Gly Thr Trp Gln Trp Val Asp Gly Ser
465 470 475 480
Pro Leu Leu Pro Ser Phe Lys Gln Tyr Trp Asn Arg Gly Glu Pro Asn
485 490 495
Asn Val Gly Glu Glu Asp Cys Ala Glu Phe Ser Gly Asn Gly Trp Asn
500 505 510
Asp Asp Lys Cys Asn Leu Ala Lys Phe Trp Ile Cys Lys Lys Ser Ala
515 520 525
Ala Ser Cys Ser Arg Asp Glu Glu Gln Phe Leu Ser Pro Ala Pro Ala
530 535 540
Thr Pro Asn Pro Pro Pro Ala
545 550
<210> 4
<211> 556
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Asp Arg Ala Lys Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Gln Ala Gln Ala Val Lys Lys Val Val Leu Gly Lys Lys Gly Asp Thr
20 25 30
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser Ile Gln Phe His
35 40 45
Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Phe
50 55 60
Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala Asp Ser Arg Arg
65 70 75 80
Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile Lys Asn Leu Lys
85 90 95
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln Lys Glu
100 105 110
Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn Ser Asp Thr His
115 120 125
Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu Ser Pro Pro Gly
130 135 140
Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly Lys Asn Ile Gln
145 150 155 160
Gly Glu Lys Thr Leu Ser Val Ser Gln Leu Glu Leu Gln Asp Ser Gly
165 170 175
Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys Val Glu Phe Lys
180 185 190
Ile Asp Ile Val Val Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
195 200 205
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
210 215 220
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Val
225 230 235 240
Gly Glu Leu Ser Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu
245 250 255
Thr Gln Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Leu
260 265 270
Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu
275 280 285
Leu Pro Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr Trp
290 295 300
Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Met Gln Glu
305 310 315 320
Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro
325 330 335
Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys
340 345 350
Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr
355 360 365
Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys
370 375 380
Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala Ala
385 390 395 400
Val Glu Arg Leu Cys His Pro Cys Pro Trp Glu Trp Thr Phe Phe Gln
405 410 415
Gly Asn Cys Tyr Phe Met Ser Asn Ser Gln Arg Asn Trp His Asp Ser
420 425 430
Ile Thr Ala Cys Lys Glu Val Gly Ala Gln Leu Val Val Ile Lys Ser
435 440 445
Ala Glu Glu Gln Asn Phe Leu Gln Leu Gln Ser Ser Arg Ser Asn Arg
450 455 460
Phe Thr Trp Met Gly Leu Ser Asp Leu Asn Gln Glu Gly Thr Trp Gln
465 470 475 480
Trp Val Asp Gly Ser Pro Leu Leu Pro Ser Phe Lys Gln Tyr Trp Asn
485 490 495
Arg Gly Glu Pro Asn Asn Val Gly Glu Glu Asp Cys Ala Glu Phe Ser
500 505 510
Gly Asn Gly Trp Asn Asp Asp Lys Cys Asn Leu Ala Lys Phe Trp Ile
515 520 525
Cys Lys Lys Ser Ala Ala Ser Cys Ser Arg Asp Glu Glu Gln Phe Leu
530 535 540
Ser Pro Ala Pro Ala Thr Pro Asn Pro Pro Pro Ala
545 550 555
<210> 5
<211> 561
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Asp Arg Ala Lys Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Gln Ala Gln Ala Val Lys Lys Val Val Leu Gly Lys Lys Gly Asp Thr
20 25 30
Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser Ile Gln Phe His
35 40 45
Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Phe
50 55 60
Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala Asp Ser Arg Arg
65 70 75 80
Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile Lys Asn Leu Lys
85 90 95
Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln Lys Glu
100 105 110
Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn Ser Asp Thr His
115 120 125
Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu Ser Pro Pro Gly
130 135 140
Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly Lys Asn Ile Gln
145 150 155 160
Gly Glu Lys Thr Leu Ser Val Ser Gln Leu Glu Leu Gln Asp Ser Gly
165 170 175
Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys Val Glu Phe Lys
180 185 190
Ile Asp Ile Val Val Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
195 200 205
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
210 215 220
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
225 230 235 240
Gly Gly Gly Ser Val Gly Glu Leu Ser Glu Lys Ser Lys Leu Gln Glu
245 250 255
Ile Tyr Gln Glu Leu Thr Gln Leu Lys Ala Ala Val Gly Glu Leu Pro
260 265 270
Glu Lys Ser Lys Leu Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys
275 280 285
Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys Leu Gln Glu Ile Tyr
290 295 300
Gln Glu Leu Thr Trp Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys
305 310 315 320
Ser Lys Met Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala
325 330 335
Val Gly Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu
340 345 350
Leu Thr Arg Leu Lys Ala Ala Val Gly Glu Leu Pro Glu Lys Ser Lys
355 360 365
Gln Gln Glu Ile Tyr Gln Glu Leu Thr Arg Leu Lys Ala Ala Val Gly
370 375 380
Glu Leu Pro Glu Lys Ser Lys Gln Gln Glu Ile Tyr Gln Glu Leu Thr
385 390 395 400
Gln Leu Lys Ala Ala Val Glu Arg Leu Cys His Pro Cys Pro Trp Glu
405 410 415
Trp Thr Phe Phe Gln Gly Asn Cys Tyr Phe Met Ser Asn Ser Gln Arg
420 425 430
Asn Trp His Asp Ser Ile Thr Ala Cys Lys Glu Val Gly Ala Gln Leu
435 440 445
Val Val Ile Lys Ser Ala Glu Glu Gln Asn Phe Leu Gln Leu Gln Ser
450 455 460
Ser Arg Ser Asn Arg Phe Thr Trp Met Gly Leu Ser Asp Leu Asn Gln
465 470 475 480
Glu Gly Thr Trp Gln Trp Val Asp Gly Ser Pro Leu Leu Pro Ser Phe
485 490 495
Lys Gln Tyr Trp Asn Arg Gly Glu Pro Asn Asn Val Gly Glu Glu Asp
500 505 510
Cys Ala Glu Phe Ser Gly Asn Gly Trp Asn Asp Asp Lys Cys Asn Leu
515 520 525
Ala Lys Phe Trp Ile Cys Lys Lys Ser Ala Ala Ser Cys Ser Arg Asp
530 535 540
Glu Glu Gln Phe Leu Ser Pro Ala Pro Ala Thr Pro Asn Pro Pro Pro
545 550 555 560
Ala
<210> 6
<211> 89
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gaattccctg ctgctgctcc tgcctcaggc ccaggctgtg aagaaagtgg tgctgggcaa 60
aaaaggggat acagtggaac tgacctgta 89
<210> 7
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttaaacgggc cctctagact cgagctacgc aggagggggg tttggggtg 49
<210> 8
<211> 70
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atggaccggg ccaagctgct gctcctgctc ctgctgctgc tcctgcctct gcagatatcc 60
agcacagtgg 70
<210> 9
<211> 74
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gaggcaggag cagcagcagg agcaggagca gcagcttggc ccggtccatg aattccacca 60
cactggacta gtgg 74
<210> 10
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gatcgcgctg actcaagaag aagcctttgg gac 33
<210> 11
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gtcccaaagg cttcttcttg agtcagcgcg atc 33