阅读说明：本技术 菠菜中的霜霉病抗性 (Downy mildew resistance in spinach ) 是由 R·J·J·M·弗里特斯 V·L·A·考克 于 2019-12-20 设计创作，主要内容包括：本发明涉及命名为α-WOLF 25的等位基因,其赋予对至少一种粉霜霉菠菜专化型小种(Peronospora farinosa f.sp.Spinacea race)的抗性,其中由所述等位基因编码的蛋白质是CC-NBS-LRR蛋白质,在其氨基酸序列中包含：a)在其N末端的基序“MAEIGYSVC”；b)基序“KWMCLR”；并且其中蛋白质的LRR结构域以增加的优先性顺序与SEQ ID No:5具有至少95％、96％、97％、98％、99％、100％的序列相似性。当存在于菠菜植物中时,所述等位基因赋予至少对粉霜霉菠菜专化型小种Pfs:8、Pfs15和Pfs:16的完全抗性,不赋予对Pfs:3的抗性。(The invention relates to an allele designated α -WOLF25, conferring resistance to at least one Peronospora farinosa f.sp.Spinaceae, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 5. When present in spinach plants, the allele confers complete resistance to at least the frost mildew spinach specialized races Pfs:8, Pfs15 and Pfs:16, but not to Pfs: 3.)

1. An allele designated α -WOLF25 conferring resistance to at least one Frost mildew spinach specialized race, wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; and b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 5.

2. The allele of claim 1, wherein the genomic DNA sequence of the LRR domain has at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity, in increasing order of preference, to SEQ ID No. 4.

3. The allele of claim 1, wherein the allele, when present in a spinach plant, confers complete resistance to at least the bloom spinach specialized races Pfs:8, Pfs15 and Pfs:16, and does not confer resistance to Pfs: 3.

4. Spinach plant comprising the allele of any one of claims 1 to 3, which is capable of growing into a representative sample of seed of a plant comprising the allele as deposited with the NCIMB under NCIMB accession No. 43495.

5. Spinach plant as claimed in claim 4, wherein the plant is an agronomically elite plant.

6. Spinach plant as claimed in claim 5, wherein the agronomically elite plant is a hybrid variety or an inbred line.

7. The spinach plant of claim 6, further comprising a genetic determinant resulting in resistance against the Peronospora farinosa spinach specialized races Pfs:1 to Pfs: 16.

8. Propagation material capable of developing into and/or derived from a spinach plant as defined in any of the claims 4 to 7, wherein the propagation material comprises an allele as defined in any of the claims 1 to 3 and wherein the propagation material is selected from the group consisting of microspores, pollen, ovaries, ovules, embryos, embryo sacs, egg cells, cuttings, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, cells or tissue cultures thereof.

9. A cell of a spinach plant, the cell comprising an allele according to any one of claims 1 to 3.

10. A method for producing a hybrid spinach seed, comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first parent spinach plant comprises the allele of any one of claims 1 to 3.

11. The method of claim 10, wherein the first and/or second parent is a plant of the inbred line.

12. A hybrid spinach plant grown from a seed produced by the method of claim 10 or claim 11.

13. Method for identifying a spinach plant carrying an allele according to any one of claims 1 to 3, comprising determining the presence of an LRR domain as defined in claim 1 by determining in the genome of the plant its genomic nucleotide sequence or a part thereof, wherein said sequence has in increasing order of preference at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity to SEQ ID No. 4.

14. The method of claim 13, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID No: 1.

15. The method of claim 13, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID No. 2.

16. A primer pair comprising a forward primer and a reverse primer, wherein the forward primer is a nucleic acid molecule with a sequence of SEQ ID No. 1, and the reverse primer is a nucleic acid molecule with a sequence of SEQ ID No. 2.

17. A method of producing a spinach plant that exhibits resistance to a peronospora farinosa spinach specialized form, comprising: (a) crossing a plant comprising the allele of claim 1 or 2 with another plant; (b) optionally performing one or more rounds of selfing and/or crossing; (c) selecting a plant comprising the allele of any one of claims 1 to 3 after one or more rounds of selfing and/or crossing.

18. The method of claim 16, wherein selecting a plant comprising an allele comprises determining the presence of the allele according to the method of any one of claims 13 to 15.

Technical Field

The present invention relates to genes capable of conferring resistance to a spinach plant against one or more of the specialized cultivars of the plant Peronospora farinosa f.sp.spinosae race. The invention also relates to a spinach plant, propagation material of said spinach plant, cells of said spinach plant and seeds of said spinach plant carrying the gene. The invention further relates to a method for producing spinach plants carrying this gene and to the use of this gene for conferring specialization resistance against Peronospora farinosa spinach in breeding.

Background

Downy mildew (downy mildew spinach specialization) is a major threat to spinach growers, as it directly affects the harvested leaves. In spinach, downy mildew is caused by the oomycete peronospora farinosa spinach specialized form, previously known as peronospora dispersa (p. Infection makes leaves unsuitable for sale and consumption, as they phenotypically manifest as yellow lesions on old leaves, and gray fungal growth can be observed on the leaf back surface. Infection can spread very rapidly and it can occur in greenhouse and soil cultivation. The optimal temperature for the formation and germination of the bloom mildew spinach specialized spores is 9 to 12 ℃ and is promoted by high relative humidity. When spores are deposited on moist leaf surfaces, they can easily germinate and infect the leaves. The optimal growth temperature of the fungi is 8-20 ℃, the relative humidity is more than or equal to 80%, and hypha growth can be observed within 6-13 days after infection. The oospores of peronospora farinosa can survive in soil for up to 3 years, or exist as mycelia in seeds or live plants.

To date, 17 pathogenic races of spinach downy mildew (Pfs) have been formally identified and characterized, and many new candidates have been observed in the field. 17 officially recognized species of the Peronospora farinosa spinach specialization type were named Pfs:1 to Pfs:17 (Irish et al, Phtypathol. Vol.98pg.894-900,2008; plant NL (Dutch seed and young plant breeding, tissue culture, production and trade Association, production and trade, tissue culture, production and trade, of the genus and youth)) news publications, "beneeming van Pfs: 14, Green nieuwe fysio van value market in sports", 19. 2012, 9. month 19; Report Jim core (Arkansas) and Steven Koike (UC Cooperation, Montery couth), "RaPfs: 14-other new road of the kind of fertilizer market, 10. month 18. mile, 18. Pfav. Pfop.18. sub.16. news, of the family of the genus, 23. mu. 10. Pfop.n.g.J., a new race of descending mill in sport ", April 16,2018). The microspecies 4 to 16 were identified during the period 1990 to 2014, while two new Peronospora (Peronospora) isolates (named UA201519B and US1602) were only recently identified, and since then formally named Pfs by the international Peronospora working group (IWGP): 16 and Pfs:17 (the Association for the breeding, tissue culture, production and trade of Dutch seeds and young plants) News publication, "denotation of Pfs:16, a new race of descending milew in sport", 15.3.2016; Plantum NL News publication, denotation of Pfs:17, a new race of descending milew in sport ", 16.4.2018 all 17 officially recognized Pfs races are publicly available from Department of Plant Pathology, University of Arkansas, Fayettville, AR 72701, USA, NAK Tuinbow, Sotaweg 22,2371 Roelof arendesven, the Netherlands.

In particular, the newly identified species of peronospora can break the resistance of many spinach varieties currently used commercially worldwide, and thus they pose a serious threat to the productivity of the spinach industry. Therefore, it is vital to keep the front of development in this area, as peronospora continues to develop the ability to break the resistance present in commercial spinach varieties. Therefore, new resistance genes against downy mildew are very valuable assets and they form an important research focus for breeding, in particular spinach and lettuce breeding. One of the main goals of spinach breeders is to rapidly develop spinach varieties that are resistant to as many of the peronospora species as possible, including the most recently identified species, before these species become widespread and can threaten the industry.

In commercial spinach varieties, resistance against downy mildew is usually caused by the so-called R gene. R gene-mediated resistance is based on the ability of plants to recognize invading pathogens. In many cases, this recognition occurs after the pathogen establishes a first stage of interaction and transfers a so-called pathogenic (or avirulent) factor into the plant cell. These pathogenic agents interact with host components to establish conditions that favor pathogen invasion into the host and thereby cause disease. Resistance responses can be initiated when plants are able to recognize events triggered by disease causing agents. In many different plant pathogen interaction systems, such as spinach interaction with different strains of downy mildew, plants initiate these events only after specific recognition of the invading pathogen.

Co-evolution of plants and pathogens has led to a race of arms race in which R gene-mediated resistance is sometimes overcome, with the result that pathogens can interact with and modify alternative host targets or the same targets in different ways, such that recognition is lost, and infections can be successfully established, leading to disease. In order to reestablish resistance in plants, it is necessary to introduce a new R gene which is capable of recognizing the mode of action of the alternative disease-causing agent.

Despite the fact that the persistence of the R gene is relatively low, the R gene remains the predominant form of protection against downy mildew in spinach. This is primarily because it is the only form of defense that provides absolute resistance. To date, plant breeders have been very successful in producing downy mildew resistant spinach varieties using resistance genes present in the wild germplasm of the crop species. Although R genes are widely used in spinach breeding, to date, little is known about these R genes.

Until recently it was discovered that the formally recognized R gene in spinach was actually all the different alleles of two closely linked genes, the α -WOLF and β -WOLF genes. This is also the first characterization of the R gene or better the R allele at the molecular level, i.e. the determination of its nucleotide and amino acid sequence. Although this provides a tool for breeders to increase the efficiency of detecting and selecting the R allele, adequate response to emerging downy mildew races is still crucial for the development of commercially successful spinach varieties. It is therefore an object of the present invention to provide new resistance alleles conferring resistance to emerging isolates of downy mildew, and to provide molecular biological tools for identifying the new resistance alleles.

Summary of The Invention

In the studies leading to the present invention, new allelic variants of the α -WOLF gene described in WO2018059651 were found. The alpha-WOLF gene encodes a protein belonging to the CC-NBS-LRR family (coiled coil-nucleotide binding site-leucine rich repeat). Depending on the allelic variant (or variants) present in spinach plants, the plants will produce WOLF protein variants conferring a certain resistance profile to the pathogenic races of the frost mildew spinach specialization type.

In the context of the present invention, the term "allele" or "allelic variant" is used to designate the version of a gene associated with a particular phenotype, i.e. the spectrum of resistance. Spinach was found to carry one or two WOLF genes. Each of these two WOLF genes comprises multiple alleles, each of which confers a specific resistance profile. In the context of the present invention, an allele or allelic variant is a nucleic acid.

The β WOLF gene is located on scaffold12735 (scaffold12735) (sequence: GenBank: KQ143339.1) at position 213573-221884. If the spinach plant also carries or carries only the alpha-WOLF gene, the alpha-WOLF gene is located at approximately the same position as the beta-WOLF gene is located on the scaffold12735 in the Viroflay genome assembly.

The newly discovered alpha-WOLF allele provides at least resistance to downy mildew subspecies Pfs: 16. alpha-WOLF 25 also provides resistance to Pfs:8 and Pfs 15.

Detailed Description

The genomic assembly of the spinach variety Viroflay, which is sensitive to all known pathogenic races of the Bluella farinosa spinach specialization type, is publicly available (spinach (Spinacia oleracea) cultivar SynViroflay, Whole genome shotgun sequencing project; Bioproject: PRJNA 41497; GenBank: AYZV 00000000.2; BioSample: SAMN02182572, see additionally Dohm et al 2014, Nature 505: 546-549). In the genomic assembly of Viroflay, the β -WOLF gene was located on the scaffold12735 (sequence: GenBank: KQ143339.1) at position 213573-221884. The sequence covered by the gap includes the entire genomic sequence of the Viroflay's β -WOLF gene, plus the 2000 base pair sequence upstream of that gene, plus the sequence downstream of that gene, up to the locus of the adjacent gene located downstream of the WOLF gene. Spinach variety Viroflay has only a single WOLF gene, i.e. the β -WOLF gene, but most other spinach lines carry a single α -type WOLF gene at the same position in the genome. Other spinach lines contain two WOLF genes at approximately the same location in the genome. In this case, the two WOLF genes are adjacent to each other. In most spinach lines containing two WOLF genes, one of the WOLF genes belongs to the alpha type, while the other WOLF gene belongs to the beta type. It was observed that this allelic variation in the WOLF locus was responsible for the differences in resistance to the pathogenic microspecies of the frost mildew spinach specialization type.

The difference between the alleles of the alpha-WOLF gene and the beta-WOLF gene is the presence of specific conserved amino acid motifs in the encoded protein sequence. As mentioned above, all WOLF proteins have (from N-terminal to C-terminal) the following domains known in the art: coiled-coil domains (RX-CC-like, cd14798), NBS domains (also known as "NB-ARC domains", pfam 00931; van der Biezen & Jones,1998, curr. biol.8: R226-R228), and leucine-rich repeats comprising LRR domains (IPR 032675). Furthermore, all WOLF proteins contain the motif "MAEIGYSVC" at the N-terminus of their amino acid sequence. In addition to this, all α -WOLF proteins contain the motif "KWMCLR" in their amino acid sequence, whereas all β -WOLF proteins contain the motif "HVGCVVDR" in their amino acid sequence.

The invention relates to an allele of the alpha-WOLF gene, named alpha-WOLF 25, which confers Peronospora farinosa spinach specialized resistance.

In particular, the invention relates to an allele, designated α -WOLF25, conferring resistance to the specialization type of Frisella gougerontis spinach, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 5. Optionally, the alpha-WOLF 25 allele also comprises an additional motif in its amino acid sequence, namely "DQEDEGEDN".

The invention further relates to an allele, designated α -WOLF25, conferring resistance to the specialization type of Frisella gourme spinach, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity in increasing order of preference with SEQ ID No. 5. Optionally, the alpha-WOLF 25 allele also comprises an additional motif in its amino acid sequence, namely "DQEDEGEDN".

The invention also relates to the alpha-WOLF 25 allele with an LRR domain having a genomic sequence with at least 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 4.

The invention also relates to the alpha-WOLF 25 allele with an LRR domain having a genomic sequence with at least 96%, 97%, 98%, 99%, 100% sequence identity in increasing order of preference to SEQ ID No. 4.

For the purposes of the present invention, the LRR domain of the protein of the alpha-WOLF 25 allele is defined as an amino acid sequence having in increasing order of preference at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity to SEQ ID No. 5.

For the purposes of the present invention, the LRR domain of the protein of the alpha-WOLF 25 allele is defined as an amino acid sequence which has in increasing order of preference at least 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity with SEQ ID No. 5.

The skilled person is familiar with methods for calculating sequence similarity and sequence identity. Using EMBOSS stretcher 6.6.0(www.ebi.ac.uk/Tools/psa/emboss_stretcher) The sequence similarity of the amino acid sequences was calculated using the EBLOSUM62 matrix with settings Gap open:12 and Gap extended: 2. For DNA, sequence similarity was calculated using DNA full matrix with settings Gap open:16 and Gap extended: 4.

The general knowledge of selecting the correct reading frame can be applied by determining the LRR domain of the alpha-WOLF 25 allele as defined herein by amplifying and sequencing genomic DNA encoding the amino acid sequence of the LRR domain using specific primers and then translating this DNA sequence into the amino acid sequence. The technician can use online bioinformatics tools that are provided free of charge (such as can be found here:http://web.expasy.org/translate/) To do so.

The genomic sequence of the LRR domain of an α -WOLF gene, such as α -WOLF25, can be amplified using a primer pair having a forward primer and a reverse primer, the forward primer being a primer having the sequence set forth in SEQ ID No:1, the reverse primer is a nucleic acid molecule having the sequence of SEQ ID No: 2.

The invention also relates to a nucleic acid molecule conferring resistance to at least one frost mildew spinach specialized microspecies, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 5. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.

The invention also relates to a nucleic acid molecule conferring resistance to at least one frost mildew spinach specialized microspecies, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein comprising in its amino acid sequence: a) motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has at least 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity in increasing order of preference with SEQ ID No. 5. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.

This allele shows a segregation pattern consistent with its dominant inheritance conferring resistance to the downy mildew subspecies Pfs8, Pfs15 and Pfs16 (segregation pattern).

PCR conditions for amplifying the LRR domain coding region of the alpha-WOLF gene using primers with SEQ ID No:1 and SEQ ID No:2 were the use of Platinum Taq enzyme (Thermo Fisher Scientific): 3 min at 95 ℃ (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds; at 72 ℃ for 2 minutes (final extension step).

The LRR domain of the β -WOLF gene, such as the empty allele present in variety Viroflay, can be amplified using a forward primer, which is a nucleic acid molecule having the sequence of SEQ ID No:3, and a reverse primer, which is a nucleic acid molecule having the sequence of SEQ ID No: 2.

PCR conditions for amplifying the LRR domain coding region of the β -WOLF gene using primers with SEQ ID No:2 and SEQ ID No:3 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific): 3 min at 95 ℃ (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95 ℃ for 30 seconds, annealing at 58 ℃ for 50 seconds, and extension at 72 ℃ for 50 seconds; at 72 ℃ for 2 minutes (final extension step).

The invention therefore also relates to a primer pair for amplifying the LRR domain of the alpha-WOLF gene, more particularly for amplifying the LRR domain of the alpha-WOLF 25 allele, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID No. 1 and the reverse primer is a nucleic acid molecule having the sequence of SEQ ID No. 2. The primers disclosed herein are specifically designed to selectively amplify portions of the WOLF gene, but not any other CC-NBS-LRR protein-encoding gene.

The invention relates to the alpha-WOLF 25 allele having a coding sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 8.

The invention also relates to the alpha-WOLF 25 allele having a coding sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity in increasing order of preference to SEQ ID No. 8.

In another aspect of the invention, the alpha-WOLF 25 allele encodes a protein having an amino acid sequence with at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence similarity in increasing order of preference to SEQ ID No. 9.

In another aspect of the invention, the alpha-WOLF 25 allele encodes a protein having an amino acid sequence with at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity in increasing order of preference to SEQ ID No. 9.

When present in spinach plants, the alpha-WOLF 25 allele confers complete resistance to at least one of the 17 formally recognized cottrella chalcopyrite spinach specialized races. In another embodiment, the alpha-WOLF 25 allele when present in spinach plants confers complete resistance to at least two of the 17 formally recognized cottrella chalcopyrite spinach specialized races. In another embodiment, the alpha-WOLF 25 allele confers complete resistance in increasing order of preference to at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the 17 formally recognized flour cream mould spinach specialization races when present in spinach plants.

When present heterozygously or homozygously in spinach plants, the alpha-WOLF 25 allele confers at least complete resistance to the formally recognized downy mildew spinach speciality species Pfs:8, Pfs15 and Pfs:16 and does not confer resistance to the downy mildew species Pfs:3 (see Table 1).

Can be administered by using young childrenThe shoot test was used to determine the resistance of spinach plants to one or more races of the Peronospora farinosa spinach specialization type. In this context, a seedling test is defined as a test in which spinach plants are planted in trays containing growth medium, optionally fertilized twice a week after emergence of the seedlings. The concentration used in the first true leaf stage is about 2.5X 10⁵Peronosporangia suspension of one pathogenic microspecium of the Peronospora farinosa spinach specialization or isolate to be tested/ml was inoculated to the plant. The inoculated plants were placed in an open room at 18 ℃ and 100% relative humidity for 24 hours and then transferred to a 12 hour photoperiod growth chamber at 18 ℃ for 6 days. After 6 days, the plants were returned to the exposure room for 24 hours to induce sporulation and then scored for disease response. Preferably, 30 plants per race are tested.

As used herein, a plant is completely resistant to the peronospora farinosa spinach specialized race when the plant does not exhibit symptoms in the seedling test described herein.

As used herein, a plant is moderately resistant to the specialized microspecies of downy mildew spinach when the plant exhibits only chlorosis symptoms or sporulation occurs only at the tip of the cotyledons in the seedling test described herein.

As used herein, a plant is susceptible to an isolate of a bloom spinach specialized race when the plant exhibits not only chlorosis symptoms in the seedling test described herein, or when sporulation occurs in an area larger than just the tip of the cotyledons.

Another aspect of the invention relates to a spinach plant comprising the alpha-WOLF 25 allele of the invention, a representative sample of the seed of which was deposited with the NCIMB under NCIMB accession No. 43495.

In another embodiment, the plant of the invention comprising the alpha-WOLF 25 allele is an agronomically elite spinach plant. In the context of the present invention, an agronomically superior spinach plant is a plant having a genotype resulting in the accumulation of a distinguishable and desired agronomic trait, which allows the producer to harvest a product of commercial interest, preferably the agronomically superior spinach plant comprising the alpha WOLF25 allele is a plant of an inbred or hybrid.

As used herein, a plant of an inbred line is a plant of a plant population resulting from three or more rounds of selfing or backcrossing; or the plant is a doubled haploid. The inbred line may for example be a mother line for the production of commercial hybrids.

As used herein, a hybrid plant is a plant produced by crossing between two different plants having different genotypes. More particularly, the hybrid plant is the result of a cross between two different inbred plants, which hybrid plant may be, for example, F₁A plant of the hybrid variety.

Plants carrying the α -WOLF25 allele in heterozygous form may further comprise the β -WOLF 0 allele, e.g. as present in variety Viroflay, wherein the β -WOLF 0 allele does not confer any resistance to downy mildew. However, plants heterozygous for the alpha-WOLF 25 allele may also comprise alleles of the alpha/beta-WOLF gene that do provide resistance to downy mildew. Preferably, such an allele will complement the alpha-WOLF 25 allele, such that the spinach plant will be at least moderately resistant to one or more other small species that do not provide resistance to the alpha-WOLF 25 allele. Most preferably, the other allele of the α/β -WOLF gene complements the α -WOLF25 allele, rendering the plant resistant to the Fructusgourmet spinach specialized races Pfs:1 to Pfs: 17. In one embodiment, such a plant is an agronomically elite plant.

Alternatively, the resistance profile of plants carrying the alpha-WOLF 25 allele is complemented by a resistance conferring allele of a completely different gene. Examples of such genes are e.g. DMR1 as described in US8,354,570, DMR6 as described in US9,121,029 and p10 as described in US 20170327839. Thus, the present invention relates to spinach plants carrying the alpha-WOLF 25 allele and further comprising a genetic determinant resulting in resistance against the Peronospora farinosa spinach specialized races Pfs:1 to Pfs: 17. The genetic determinant may be another resistance conferring alpha/beta-WOLF allele, or a resistance conferring allele of a completely different gene.

The invention further relates to propagation material comprising the alpha-WOLF 25 allele. In one embodiment, the propagation material is suitable for sexual propagation. Such propagation material includes, for example, microspores, pollen, ovaries, ovules, embryo sacs and egg cells. In another embodiment, the propagation material is suitable for vegetative propagation. Such propagation material includes, for example, cuttings, roots, stems, cells, protoplasts, and tissue cultures of regenerable cells. Plant parts suitable for the preparation of tissue cultures are in particular leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, root tips, anthers, flowers, seeds and stems.

The invention also relates to a cell of a spinach plant comprising the alpha-WOLF 25 allele. Such a cell may be in isolated form or may be part of a whole plant or part thereof and then still constitute a cell of the invention, since such a cell contains the a-WOLF 25 allele which confers resistance to downy mildew. Each cell of the plants of the invention carries genetic information conferring resistance to the specialized form of Frutus trichosanthis spinach. Such cells of the invention may also be regenerable cells which can be used to regenerate new plants comprising the alleles of the invention.

Another aspect of the present invention relates to a method for preparing a hybrid spinach seed, comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and/or the second parent spinach plant comprises the alpha-WOLF 25 allele. In a particular embodiment, the first and/or second parent plant is a plant of an inbred as defined herein.

The invention further relates to a hybrid spinach plant grown from seed produced by crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and/or the second parent spinach plant comprises the alpha-WOLF 25 allele.

The genomic DNA or coding DNA sequence of at least part of the WOLF gene in the spinach plant genome can be determined using any suitable molecular biological method known in the art, including but not limited to (genomic) PCR amplification followed by Sanger sequencing, whole genome sequencing, transcriptome sequencing, sequence-specific target capture followed by next generation sequencing (e.g., using Integrated DNA Technologies)Target capture system), specific amplification of LRR domain-containing gene sequences (e.g., using RenSeq methods, such as U.S. patent application 14/627116 and Jupe et al, 2013, Plant j.76: 530-544) and then subjected to sequencing and the like.

In one embodiment, the invention relates to a method for identifying plants carrying the alpha-WOLF 25 allele, comprising determining a DNA sequence encoding an LRR domain as defined herein.

In another embodiment of the method, the LRR domain of the alpha-WOLF 25 allele is determined by amplifying a genomic DNA region of the LRR domain using a primer pair. The forward primer is preferably a nucleic acid molecule having the sequence of SEQ ID No. 1 and the reverse primer is preferably a nucleic acid molecule having the sequence of SEQ ID No. 2.

Another aspect of the invention relates to a method for producing a spinach plant comprising resistance to a Trypanosoma japonicum spinach specialized form, comprising: (a) crossing a plant comprising the alpha-WOLF 25 allele with another plant; (b) optionally performing one or more rounds of selfing and/or crossing; (c) plants comprising the alpha-WOLF 25 allele are optionally selected after each round of selfing or crossing.

Plants comprising the alpha-WOLF 25 allele can be selected genotypically by determining the presence of the genomic DNA sequence of the NBS-LRR domain of the allele, which has in increasing order of preference 95%, 96%, 97%, 98%, 99%, 100% sequence similarity to SEQ ID No. 4 or 95%, 96%, 97%, 98%, 99%, 100% sequence identity to SEQ ID No. 4.

In another embodiment, plants comprising the alpha-WOLF 25 allele can be selected genotypically by determining the presence of the coding sequence for the entire allele.

Alternatively, the presence of the alpha-WOLF 25 allele can be determined phenotypically by assaying the plant in a disease test, such as the test described herein.

The invention also relates to the use of spinach plants carrying the alpha-WOLF 25 allele in breeding to confer resistance to the propamonia spinach specialization type.

The invention also relates to a breeding method for breeding spinach plants carrying the alpha-WOLF 25 allele according to the invention, wherein germplasm comprising said allele is used. Seeds capable of growing plants comprising the alleles of the invention and representing the germplasm are deposited with the NCIMB under accession number NCIMB 43495.

In another aspect, the present invention relates to a method for producing a spinach plant comprising the alpha-WOLF 25 allele, which method comprises: (a) crossing a plant comprising an allele with another plant; (b) optionally selecting in F1 a plant comprising said allele; (c) optionally backcrossing the resulting F1 with a preferred parent and selecting plants having said allele in BC1F 1; (d) optionally performing one or more additional rounds of selfing, crossing and/or backcrossing, and then selecting for plants that comprise or exhibit a resistance profile corresponding to the allele. The invention also includes spinach plants produced by the method.

The invention also relates to harvested leaves of the spinach plant of the invention, to a food product comprising the harvested leaves of the spinach plant of the invention, in native or processed form.

Spinach leaves are sold in packaged form, including but not limited to prepackaged spinach leaves or salads processed to contain the leaves. Such packages are made, for example, by U.S. patent No. 5,523,136, which provides packaging films and packages made from such packaging films, including such packages containing leaf products, as well as methods of making and using such packaging films and packages, which are suitable for use with the spinach leaves of the invention. Thus, the invention includes uses and methods of making and using leaves of the spinach plants of the invention as well as leaves derived from the spinach plants of the invention.

The present invention further relates to a container comprising one or more plants of the invention, or one or more spinach plants derived from a plant of the invention, for use in harvesting leaves from the plant in a domestic environment in a growing medium. In this way, the consumer can pick very fresh leaves for salad while the plant is in a ready to harvest state.

The invention also relates to the use of a spinach plant, representative seed of which is deposited with the NCIMB under accession number NCIMB 43495, for the production of a spinach plant comprising the alpha-WOLF 25 allele.

In another embodiment, the spinach plant is a hybrid, a doubled haploid or an inbred spinach plant.

Another aspect of the invention is the use of a cell comprising the alpha-WOLF 25 allele for the production of a spinach plant showing resistance to the frost mildew spinach specialization type.

The invention also relates to the use of a tissue culture comprising the alpha-WOLF 25 allele for the production of spinach plants showing resistance to the frost mildew spinach specialization type.

Resistance information

TABLE 1

The spectrum of resistance conferred by the alpha-WOLF 25 allele. "-" indicates complete resistance to a particular species of downy mildew; "(-) -indicates moderate resistance to a particular species of downy mildew; "+" indicates that the allele does not confer resistance and would result in a plant carrying only the α -WOLF25 allele being fully susceptible to a particular species of downy mildew; "nt" indicates that no test has been performed on this isolate.

Preservation information

Seeds of plants comprising in their genome the α -WOLF25 allele of the invention were deposited at 2019 on 2.10 with deposit accession number NCIMB 43495 at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB 219 YA, UK. The deposit is made under the terms of the budapest treaty. All restrictions on the deposit will be removed upon patent granting, and the deposit is intended to satisfy the requirements of 37CFR 1.801-1.809. The deposit will be irrevocably and unconditionally released to the public upon patent authorization. The preservation will be maintained at the preservation institution for 30 years, or 5 years after the last request, or the expiration date of the patent, whichever is longer, and replaced as necessary during this period.

Sequence information

Table 2 sequence information.

The present invention will be further illustrated in the following examples, which are for illustrative purposes only and are not intended to limit the invention in any way.

Examples

Example 1

Testing resistance to bloom mildew spinach specialization in spinach plants

Resistance to downy mildew infection was determined as described by Irish et al (2008; phytopathohol.98: 894-900), using a differential set. Spinach plants of the invention were sown together with spinach plants from different other genotypes (see table 3) in trays containing scott Redi-Earth medium and fertilized twice a week with Osmocote Peter's (13-13-13) fertilizer (Scotts) after emergence of seedlings. The plants were inoculated with sporangium suspension (2.5X 10) of a peronospora farinosa spinach specialized pathogen race in the first true leaf stage⁵In ml). In this way, 4 officially approved disease-causing races were tested.

The inoculated plants were placed in an open room at 18 ℃ and 100% relative humidity for 24 hours and then transferred to a 12 hour photoperiod growth chamber at 18 ℃ for 6 days. After 6 days, the plants were returned to the exposure room for 24 hours to induce sporulation and disease response was scored.

Plants used for this particular test were scored as resistant, moderately resistant or susceptible based on the symptoms of chlorosis and signs of sporulation of the pathogen on cotyledons and true leaves as described by Irish et al (2007; Plant Dis.91: 1392-1396). Plants that showed no signs of chlorosis and sporulation were considered resistant in this particular test. Resistant plants were re-inoculated to assess whether the plants initially scored as resistant had escaped infection, or whether they were truly resistant. Plants that showed only symptoms of chlorosis or sporulation only at the tips of the cotyledons were scored as moderately resistant. Plants showing more than these symptoms of downy mildew infection were scored as susceptible.

Table 1 shows the resistance of plants carrying the alpha-WOLF 25 allele to each of these pathogenic races. Table 3 shows the diversity of spinach downy mildew races and the resistance of various spinach varieties (hybrids) to each of these pathogenic races. The susceptible response was scored as "+" (indicating successful infection by the fungus, sporulation occurring across the cotyledons), and the resistance was scored as "-" (no sporulation on the cotyledons). The weak resistance response is indicated by "(-) -" which in practice means a slight reduction in the level of infection (in the differential shoot test only chlorosis symptoms appear, or sporulation only at the tip of the cotyledon).

Table 3:

example 2

Amplification of LRR Domain coding regions

An isolated genomic DNA of a spinach plant comprising the alpha-WOLF 25 allele, a representative sample of the seed of which was deposited with the NCIMB under NCIMB accession No. 43495, was used for Polymerase Chain Reaction (PCR) using a forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID No:1) and a reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID No: 2). The primer pair amplifies the LRR domain coding region of the alpha-WOLF gene and is designed to selectively amplify portions of the WOLF gene other than other CC-NBS-LRR protein coding genes.

PCR conditions for amplifying the LRR domain coding region of the α -WOLF gene using primers with SEQ ID No:1 and SEQ ID No:2 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

3 min at 95 ℃ (initial denaturation step)

-40 amplification cycles, each cycle consisting of: denaturation at 95 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds

2 min at 72 ℃ (Final extension step)

Isolated genomic DNA from a Viroflay spinach plant variety comprising the beta-WOLF 0 allele was used for Polymerase Chain Reaction (PCR) using forward primer TCACGTGGGTTGTGTTGT (SEQ ID No:3) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID No: 2). The primer pair amplifies the LRR domain coding region of the β -WOLF gene and is designed to selectively amplify portions of the WOLF gene other than other CC-NBS-LRR protein coding genes.

PCR conditions for amplifying the LRR domain coding region of the β -WOLF gene using primers with SEQ ID No:2 and SEQ ID No:3 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

3 min at 95 ℃ (initial denaturation step)

-40 amplification cycles, each cycle consisting of: denaturation at 95 ℃ for 30 seconds, annealing at 58 ℃ for 50 seconds and extension at 72 ℃ for 50 seconds

2 min at 72 ℃ (final extension step)

The PCR products were visualized on an agarose gel (not shown) and the DNA was purified from the PCR reaction. The sequence of the PCR product is then determined using methods well known in the art.

The sequence of the LRR domain of the alpha-WOLF 25 allele amplified by the primers with SEQ ID No. 1 and SEQ ID No. 2 is provided as SEQ ID No. 4 in Table 2.

The sequence of the LRR domain of the beta-WOLF 0 allele amplified by primers with SEQ ID No. 2 and SEQ ID No. 3 is provided as SEQ ID No. 6 in Table 2.

Finally, the sequence obtained was translated into the corresponding amino acid sequence of the LRR domain, SEQ ID No:5 and SEQ ID No:7 of the alpha-WOLF 25 allele and beta-WOLF 0, respectively (see also Table 2).

If the PCR product is sequenced using SMRT sequencing (Pacific Biosciences), the PCR primers and PCR conditions are different.

The following standard amplification sequences were added to the forward primers: GCAGTCGAACATGTAGCTGACTCAGGTCAC are provided.

The following standard amplification sequences were added to the reverse primer: TGGATCACTTGTGCAAGCATCACATCGTAG are provided.

Example 3

Introduction of the alpha-WOLF 25 allele in plants not carrying the allele

Spinach plants comprising the alpha-WOLF 25 allele, a representative seed sample of which was deposited at the NCIMB under NCIMB accession No. 43495, were crossed with plants of the variety Viroflay carrying the beta-WOLF 0 allele to obtain generation F1. Subsequently, the F1 plants were selfed to obtain a F2 population.

Plants of the F2 population were tested for downy mildew spinach specialized Pfs as described in example 1: 16 in the animal. In the assay, approximately 75% of plants are scored as completely resistant. This isolated pattern is consistent with the isolated pattern of dominant inheritance.

Genomic DNA of each plant of the same F2 population was isolated and used for two different Polymerase Chain Reactions (PCR). The first PCR reaction was performed using primers for amplifying the LRR domain of the alpha-WOLF allele and the second PCR reaction was performed using primers for amplifying the LRR domain of the beta-WOLF allele, both as described in example 2.

The PCR products were visualized on an agarose gel (not shown), which indicated that about 75% of the plants contained the α -WOLF fragment, while the remaining about 25% contained only the β -WOLF fragment. Plants containing the alpha-WOLF fragment were completely related to plants scored as resistant to Pfs: 16. Plants containing only the β -WOLF fragment were completely associated with plants scored as susceptible to Pfs: 16.

The DNA from the PCR reaction was purified and the sequence of the PCR product was subsequently determined. The alpha-WOLF PCR product yielded a sequence corresponding to that of SEQ ID No. 4, the genomic sequence of the LRR domain of the alpha-WOLF 25 allele. The beta-WOLF PCR product yielded a sequence corresponding to that of SEQ ID No. 6, the genomic sequence of the LRR domain of the beta-WOLF 0 allele.

PCT/RO/134 Table