阅读说明：本技术 用于治疗眼咽肌营养不良(opmd)的组合物和方法 (Compositions and methods for treating oculopharyngeal muscular dystrophy (OPMD) ) 是由 V·斯特林斯-尤弗姆巴 D·苏伊 S-C·卡奥 P·W·罗伊温克 于 2020-02-28 设计创作，主要内容包括：本发明涉及包括‘沉默和替代’DNA构建体的经修饰的腺相关病毒(AAV)递送载体(vector)、包括其的组合物,以及经修饰的AAV和组合物用于治疗患有眼咽肌营养不良(OPMD)或对其易感的个体的OPMD的用途。具体地,本发明涉及具有衣壳蛋白的AAV,衣壳蛋白具有经修饰的亚单位1(VP1)并且包括‘沉默和替代’DNA构建体,其中该‘沉默和替代’DNA构建体包括(i)编码靶向导致OPMD的PABPN1的短发夹微小RNA(shmiR)的DNA指导的RNAi(ddRNAi)构建体,和(ii)编码具有在(i)未被shmiR靶向的mRNA转录物的功能性PABPN1蛋白的PABPN1构建体。本发明还涉及治疗OPMD的方法,包括向受试对象的咽肌直接注射本发明的AAV。(The present invention relates to modified adeno-associated virus (AAV) delivery vectors (vectors) comprising 'silencing and replacement' DNA constructs, compositions comprising the same, and the use of modified AAV and compositions for treating oculopharyngeal muscular dystrophy (OPMD) in an individual suffering from or susceptible to OPMD. In particular, the invention relates to AAV having a capsid protein with a modified subunit 1(VP1) and comprising a 'silencing and replacement' DNA construct, wherein the 'silencing and replacement' DNA construct comprises (i) a DNA-directed rnai (ddrnai) construct encoding a short hairpin microrna (shrir) targeting a PABPN1 that results in OPMD, and (ii) a PABPN1 construct encoding a functional PABPN1 protein having an mRNA transcript that is not targeted by the shrir at (i). The invention also relates to methods of treating OPMD comprising directly injecting an AAV of the invention into the pharyngeal muscle of a subject.)

1. An adeno-associated virus (AAV) comprising:

(a) a viral capsid protein from AAV9, comprising a modified subunit 1(VP1) sequence, wherein the amino acid sequence is modified relative to SEQ ID NO: 87, the amino acids at positions 1, 26, 40, 43 and 44 are modified; and

(b) a polynucleotide sequence comprising (i) a DNA-directed rnai (ddrnai) construct comprising a nucleic acid comprising a sequence encoding a short hairpin microrna (shrir); and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein having an mRNA transcript not targeted by the shmiR encoded by the ddRNAi construct.

2. The AAV of claim 1, wherein the modified VP1 sequence is modified relative to SEQ ID NO: 87 comprising a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43 and a serine at position 44.

3. The AAV of claims 1 or 2, wherein the modified AAV9 VP1 sequence comprises SEQ ID NO: 88.

4. The AAV of any one of claims 1 to 3, wherein the polynucleotide sequence comprises the ddRNAi construct and the PABPN1 construct in a 5 'to 3' direction.

5. The AAV of any one of claims 1 to 3, wherein the polynucleotide sequence comprises the PABPN1 construct and the ddRNAi construct in a 5 'to 3' direction.

6. The AAV of any one of claims 1 to 5, wherein the polynucleotide sequence at (b) comprises an Inverted Terminal Repeat (ITR) from an AAV serotype, and wherein the ITR is flanked by the sequences comprising the ddRNAi construct and the PABPN1 construct.

7. The AAV of claim 6, wherein the ITRs are from an AAV2 serotype.

8. The AAV of any one of claims 1 to 7, wherein the sequence encoding the functional PABPN1 protein is codon optimized such that its mRNA transcript is not targeted by the shmiR of the ddRNAi construct.

9. The AAV of any one of claims 1 to 8, wherein the sequence encoding the functional PABPN1 protein is as set forth in SEQ ID NO: 73, respectively.

10. The AAV of any one of claims 1 to 9, wherein the ddRNAi construct and the sequence encoding the functional PABPN1 protein are operably linked to a promoter upstream of the ddRNAi construct and the sequence encoding the functional PABPN1 protein.

11. The AAV of claim 10, wherein the promoter is a muscle-specific promoter.

12. The AAV of any one of claims 1 to 11, wherein the shrir comprises:

an effector sequence of at least 17 nucleotides in length;

an effector complement sequence;

a stem-loop sequence; and

a primary microrna (pri-miRNA) backbone;

wherein the effector sequence is identical to SEQ ID NO: 1-13 is substantially complementary to a region of corresponding length in an RNA transcript.

13. The AAV of any one of claims 1 to 12, wherein the shrir is selected from the group consisting of:

comprises the amino acid sequence of SEQ ID NO: 15 and the effector sequence shown in SEQ ID NO: 14, the shrmir of an effector complement sequence shown in fig. 14;

comprises the amino acid sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16, and the shrmir of the effector complement sequence shown in fig. 16;

comprises the amino acid sequence of SEQ ID NO: 19 and the effector sequence shown in SEQ ID NO: 18, the shrmir of an effector complement sequence shown in fig. 18;

comprises the amino acid sequence of SEQ ID NO: 21 and the effector sequence shown in SEQ ID NO: 20, the shrmir of an effector complement sequence shown in fig. 20;

comprises the amino acid sequence of SEQ ID NO: 23 and the effector sequence shown in SEQ ID NO: 22, and the shrmir of the effector complement sequence shown in fig. 22;

comprises the amino acid sequence of SEQ ID NO: 25 and the effector sequence shown in SEQ ID NO: 24, the shrmir of an effector complement sequence shown in fig. 24;

comprises the amino acid sequence of SEQ ID NO: 27 and the effector sequence shown in SEQ ID NO: 26, the shrmir of an effector complement sequence shown in fig. 26;

comprises the amino acid sequence of SEQ ID NO: 29 and the effector sequence shown in SEQ ID NO: 28, and the shrmir of the effector complement sequence shown in fig. 28;

comprises the amino acid sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, and the shrmir of the effector complement sequence shown in fig. 30;

comprises the amino acid sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32, and the shrmir of the effector complement sequence;

comprises the amino acid sequence of SEQ ID NO: 35 and the effector sequence shown in SEQ ID NO: 34, and the shmiR of the effector complement sequence shown in the figure;

comprises the amino acid sequence of SEQ ID NO: 37 and the effector sequence shown in SEQ ID NO: 36, and the shrmir of the effector complement sequence shown in figure 36; and

comprises the amino acid sequence of SEQ ID NO: 39 and the effector sequence shown in SEQ ID NO: 38, and the shrmir of the effector complement sequence shown in fig. 38.

14. The AAV of any one of claims 1 to 13, wherein the shrir comprises in the 5 'to 3' direction:

5' flanking sequences of the pri-miRNA backbone;

the effector complement sequence;

the stem-loop sequence;

the effector sequence; and

3' flanking sequences of the pri-miRNA backbone.

15. The AAV of claim 14, wherein the stem-loop sequence is SEQ ID NO: 40, or a sequence as set forth in seq id no.

16. The AAV of claim 14 or 15, wherein the pri-miRNA scaffold is a pri-miR-30a scaffold.

17. The AAV of any one of claims 14 to 16, wherein the 5' flanking sequence of the pri-miRNA backbone is as set forth in SEQ ID NO: 41, and the 3' flanking sequence of the pri-miRNA backbone is as set forth in SEQ ID NO: shown at 42.

18. The AAV of any one of claims 1 to 17, wherein the ddRNAi construct comprises at least two nucleic acids, each nucleic acid encoding a shmiR, wherein each shmiR comprises an effector sequence substantially complementary to an RNA transcript corresponding to PABPN1 protein that causes OPMD, and wherein each shmiR comprises a different effector sequence.

19. The AAV of claims 1-18, wherein each of the at least two nucleic acids encodes a polypeptide comprising an amino acid sequence identical to SEQ ID NO: 1. 2, 4,7, 9, 10 and 13, a region of corresponding length in an RNA transcript substantially complementary to the shrir of the effector sequence.

20. The AAV of claim 19, wherein the at least two nucleic acids are selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 15 and the effector sequence shown in SEQ ID NO: 14(shmiR 2);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16(shmiR 3);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 21 and the effector sequence shown in SEQ ID NO: 20(shmiR 5);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 27 and the effector sequence shown in SEQ ID NO: 26(shmiR 9);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32(shmiR 14); and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17).

21. The AAV of claim 19, wherein the at least two nucleic acids are selected from the group consisting of:

comprises the amino acid sequence of SEQ ID NO: 56(shmiR2) or a DNA sequence represented by SEQ ID NO: 56(shmiR 2);

comprises the amino acid sequence of SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR 3);

comprises the amino acid sequence of SEQ ID NO: 59(shmiR5) or a DNA sequence represented by SEQ ID NO: 59(shmiR 5);

comprises the amino acid sequence of SEQ ID NO: 62(shmiR9) or a DNA sequence represented by SEQ ID NO: 62(shmiR 9);

comprises the amino acid sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13);

comprises the amino acid sequence of SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR 14); and

comprises the amino acid sequence of SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

22. The AAV of claim 19, wherein each of the at least two nucleic acids encodes a polypeptide comprising an amino acid sequence identical to SEQ ID NO: 2. 9, 10 and 13, or a region of substantially complementary length in the RNA transcript.

23. The AAV of claim 19, wherein the at least two nucleic acids are selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16(shmiR 3);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32(shmiR 14); and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17).

24. The AAV of claim 19, wherein the at least two nucleic acids are selected from the group consisting of:

comprises the amino acid sequence of SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR 3);

comprises the amino acid sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13);

comprises the amino acid sequence of SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR 14); and

comprises the amino acid sequence of SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

25. The AAV of any one of claims 1 to 24, wherein the ddRNAi construct comprises:

(a) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13); and

(b) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17).

26. The AAV of claim 25, wherein the ddRNAi construct comprises:

(a) comprises the amino acid sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13); and

(b) comprises the amino acid sequence of SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

27. A pharmaceutical composition comprising an AAV according to any one of claims 1 to 26 and one or more pharmaceutically acceptable carriers (carriers).

28. A method of treating a subject having oculopharyngeal muscular dystrophy (OPMD) comprising administering to the subject the AAV of any one of claims 1 to 26 or the pharmaceutical composition of claim 27.

29. The method of claim 28, wherein the composition is administered by direct injection into the pharyngeal muscle of the subject.

30. The method of claim 29, wherein the pharyngeal muscle comprises one or more of a lower constrictor, a middle constrictor, an upper constrictor, a palatopharyngeal muscle, a eustachian tube pharyngeal muscle, a stylopharyngeal muscle, or any combination thereof.

Technical Field

The present invention relates to modified adeno-associated virus (AAV) delivery vectors (vectors) comprising 'silencing and replacement' DNA constructs, compositions comprising the same, and the use of modified AAV and compositions for treating oculopharyngeal muscular dystrophy (OPMD) in an individual suffering from or susceptible to OPMD.

Background

OPMD is an autosomal dominant hereditary, slowly progressing, late-onset degenerative muscle disease. The disease is mainly characterized by progressive eyelid ptosis (ptosis) and dysphagia (dysphagia). Pharyngeal and circumpharyngeal muscles are specific targets for OPMD. Proximal limb weakness tends to accompany later stages of disease progression. The mutation causing the disease is an abnormal amplification of the (GCN) n trinucleotide repeat in the coding region of the poly (a) binding protein core 1(PABPN 1). This amplification resulted in the amplification of the poly-alanine tract at the N-terminus of PABPN1 protein: there are 10 alanines present in the normal protein, amplified to 11 to 18 mutant forms of alanine (expPABPN 1). The main pathological hallmark of the disease is nuclear aggregates of expPABPN 1. Misfolding of the amplified PABPN1 resulted in the accumulation of insoluble polymer fibrillar aggregates within the nuclei of the affected cells. PABPN1 is an aggregation-prone protein, and the alanine-amplified PABPN1 mutated in OPMD has a higher aggregation rate than the wild-type normal protein. However, it is still unclear whether nuclear aggregates in OPMD have a pathological function or protective effect due to cellular defense mechanisms.

There is currently no approved therapy, pharmacology or other treatment available for OPMD. Symptomatic surgical intervention can partially correct ptosis and improve swallowing function in moderately to severely affected individuals. For example, circumpharyngeal myotomy is currently the only possible treatment available to improve swallowing function in these patients. However, this does not correct the progressive degeneration of the pharyngeal musculature, which often leads to dysphagia and post-asphyxia death.

Thus, there remains a need for therapeutic agents to treat patients suffering from OPMD and/or susceptible to OPMD.

Disclosure of Invention

The present invention is based, in part, on the inventors' recognition that there are currently no approved therapeutics for the treatment of OPMD. Accordingly, the present invention provides a therapeutic agent for the treatment of OPMD based on a modified adeno-associated virus (AAV) delivery vector (vector) comprising a 'silencing and replacement' construct comprising (i) one or more RNAi agents targeting a region of the PABPN1mRNA transcript responsible for OPMD and (ii) a PABPN1 replacement construct for the expression of a wild-type (functional) human PABPN1 protein, the human PABPN1 protein having an mRNA transcript not targeted by the RNAi agent of the invention. The invention also provides methods of treating OPMD using AAV delivery vectors (vectors) and compositions comprising the same.

According to one example, the present invention provides an adeno-associated virus (AAV) comprising:

(a) a viral capsid protein from AAV9, comprising a modified subunit 1(VP1) sequence, wherein the amino acid sequence is modified relative to SEQ ID NO: 87, the amino acids at positions 1, 26, 40, 43 and 44 are modified; and

(b) a polynucleotide sequence comprising (i) a DNA-directed rnai (ddrnai) construct comprising a nucleic acid comprising a sequence encoding a short hairpin microrna (shrir); and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein having an mRNA transcript not targeted by the shmiR encoded by the ddRNAi construct.

In one example, the sequence relative to SEQ ID NO: 87, the modified AAV9 VP1 sequence comprising a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44. For example, relative to SEQ ID NO: 87, the modified AAV9 VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, and a 44S. In one example, the modified AAV9 VP1 sequence comprises SEQ ID NO: 88, respectively.

In one example, the sequence relative to SEQ ID NO: 89, and the viral capsid proteins include mutations a42S, a67E, Q81R, K84D, and a 85S. In one example, the viral capsid protein comprises SEQ ID NO: 90, or a pharmaceutically acceptable salt thereof.

The invention also provides an AAV comprising:

(a) a viral capsid protein from AAV8, comprising a modified subunit 1(VP1) sequence, wherein the amino acid sequence is modified relative to SEQ ID NO: 91, amino acids at positions 1, 26, 40, 43, 44 and 64 are modified; and

(b) a polynucleotide sequence comprising (i) a (ddRNAi) construct comprising a nucleic acid comprising a sequence encoding shmiR; and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein having an mRNA transcript not targeted by the shmiR encoded by the ddRNAi construct.

In one example, the sequence relative to SEQ ID NO: 91, modified AAV8VP1 sequence comprising a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, a serine at position 44, and a lysine at position 64. For example, relative to SEQ ID NO: 91, the modified AAV8VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, a44S, and Q64K. In one example, the modified AAV8VP1 sequence comprises SEQ ID NO: 92, respectively.

In one example, the sequence relative to SEQ ID NO: 93 and the viral capsid proteins include mutations a42S, a67E, Q81R, K84D, a85S, and Q105K. In one example, the viral capsid protein comprises SEQ ID NO: 94, or a pharmaceutically acceptable salt thereof.

In each of the foregoing examples, the modified viral capsid protein is a delivery vector (vector) for a polynucleotide comprising a ddRNAi construct and a PABPN1 construct. In one example, the polynucleotide sequence includes the ddRNAi construct and the PABPN1 construct in the 5 'to 3' direction. In another example, the polynucleotide sequence comprises in the 5 'to 3' direction a PABPN1 construct and a ddRNAi construct.

The polynucleotide may also include Inverted Terminal Repeats (ITRs) from an AAV serotype. For example, the ITRs may be flanked by sequences including the ddRNAi construct and the PABPN1 construct. In some examples, the ITRs are from AAV2 serotype (e.g., SEQ ID NO: 95 and/or SEQ ID NO: 96).

In one example, the DNA sequence encoding a functional PABPN1 protein is codon optimized such that its mRNA transcript is not targeted by the shmiR of the ddRNAi construct. For example, the sequence encoding a functional PABPN1 protein may be SEQ ID NO: 73, respectively.

In one example, the ddRNAi construct and the sequence encoding a functional PABPN1 protein are operably linked to a promoter upstream of the ddRNAi construct and the sequence encoding a functional PABPN1 protein. In some examples, the promoter is a muscle-specific promoter.

In one example, the or each shmiR encoded by the ddRNAi construct comprises:

an effector sequence of at least 17 nucleotides in length;

an effector complement sequence;

a stem-loop sequence; and

a primary microrna (pri-miRNA) backbone;

wherein the effector sequence is identical to SEQ ID NO: 1-13 is substantially complementary to a region of corresponding length in an RNA transcript.

In one example, the at least one shrir encoded by the ddRNAi construct is selected from the group consisting of:

comprises the amino acid sequence of SEQ ID NO: 15 and the effector sequence shown in SEQ ID NO: 14, the shrmir of an effector complement sequence shown in fig. 14;

comprises the amino acid sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16, and the shrmir of the effector complement sequence shown in fig. 16;

comprises the amino acid sequence of SEQ ID NO: 19 and the effector sequence shown in SEQ ID NO: 18, the shrmir of an effector complement sequence shown in fig. 18;

comprises the amino acid sequence of SEQ ID NO: 21 and the effector sequence shown in SEQ ID NO: 20, the shrmir of an effector complement sequence shown in fig. 20;

comprises the amino acid sequence of SEQ ID NO: 23 and the effector sequence shown in SEQ ID NO: 22, and the shrmir of the effector complement sequence shown in fig. 22;

comprises the amino acid sequence of SEQ ID NO: 25 and the effector sequence shown in SEQ ID NO: 24, the shrmir of an effector complement sequence shown in fig. 24;

comprises the amino acid sequence of SEQ ID NO: 27 and the effector sequence shown in SEQ ID NO: 26, the shrmir of an effector complement sequence shown in fig. 26;

comprises the amino acid sequence of SEQ ID NO: 29 and the effector sequence shown in SEQ ID NO: 28, and the shrmir of the effector complement sequence shown in fig. 28;

comprises the amino acid sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, and the shrmir of the effector complement sequence shown in fig. 30;

comprises the amino acid sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32, and the shrmir of the effector complement sequence;

comprises the amino acid sequence of SEQ ID NO: 35 and the effector sequence shown in SEQ ID NO: 34, and the shmiR of the effector complement sequence shown in the figure;

comprises the amino acid sequence of SEQ ID NO: 37 and the effector sequence shown in SEQ ID NO: 36, and the shrmir of the effector complement sequence shown in figure 36; and

comprises the amino acid sequence of SEQ ID NO: 39 and the effector sequence shown in SEQ ID NO: 38, and the shrmir of the effector complement sequence shown in fig. 38.

In a specific example, the ddRNAi construct encodes a polypeptide comprising SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, and the shrmir of the effector complement sequence shown in fig. 30; and comprising SEQ ID NO: 39 and the effector sequence shown in SEQ ID NO: 38, and the shrmir of the effector complement sequence shown in fig. 38. For example, the ddRNAi construct can encode a shrmir designated shrmir 13 as described herein and a shrmir designated shrmir 17 as described herein.

In one example, the or each shmiR comprises, in the 5 'to 3' direction:

the 5' flanking sequence of the pri-miRNA backbone;

an effector complement sequence;

a stem-loop sequence;

an effector sequence; and

the 3' flanking sequence of the pri-miRNA backbone.

In another example, the or each shmiR comprises, in the 5 'to 3' direction:

the 5' flanking sequence of the pri-miRNA backbone;

an effector sequence;

a stem-loop sequence;

an effector complement sequence; and

the 3' flanking sequence of the pri-miRNA backbone.

In one example, the stem-loop sequence is SEQ ID NO: 40, or a sequence shown in figure 40.

In one example, the pri-miRNA scaffold is a pri-miR-30a scaffold. For example, the 5' flanking sequence of the pri-miRNA backbone may be SEQ ID NO: 41, the 3' flanking sequence of the pri-miRNA backbone may be SEQ ID NO: 42, or a sequence shown in figure 42.

In one example, the ddRNAi construct comprises at least two nucleic acids, each nucleic acid encoding a shmiR, wherein each shmiR comprises an effector sequence substantially complementary to an RNA transcript corresponding to the PABPN1 protein that causes OPMD, and wherein each shmiR comprises a different effector sequence.

In one example, each of the at least two nucleic acids in the ddRNAi construct can encode a polypeptide comprising an amino acid sequence identical to SEQ ID NO: 1. 2, 4,7, 9, 10 and 13, a region of corresponding length in an RNA transcript substantially complementary to the shrir of the effector sequence. For example, the at least two nucleic acids in the ddRNAi construct are selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 15 and the effector sequence shown in SEQ ID NO: 14(shmiR 2);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16(shmiR 3);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 21 and the effector sequence shown in SEQ ID NO: 20(shmiR 5);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 27 and the effector sequence shown in SEQ ID NO: 26(shmiR 9);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32(shmiR 14); and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17).

For example, the at least two nucleic acids in the ddRNAi construct may be selected from the group consisting of: comprises the amino acid sequence of SEQ ID NO: 56(shmiR2) or a DNA sequence represented by SEQ ID NO: 56(shmiR 2); comprises the amino acid sequence of SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR 3); comprises the amino acid sequence of SEQ ID NO: 59(shmiR5) or a DNA sequence represented by SEQ ID NO: 59(shmiR 5); comprises the amino acid sequence of SEQ ID NO: 62(shmiR9) or a DNA sequence represented by SEQ ID NO: 62(shmiR 9); comprises the amino acid sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13); comprises the amino acid sequence of SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR 14); and a nucleic acid comprising SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In one example, each of the at least two nucleic acids in the ddRNAi construct encodes a polypeptide comprising an amino acid sequence identical to SEQ ID NO: 2. 9, 10 and 13, or a region of substantially complementary length in the RNA transcript. For example, the at least two nucleic acids in the ddRNAi construct may be selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16(shmiR 3);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13);

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32(shmiR 14); and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17).

For example, the at least two nucleic acids in the ddRNAi construct may be selected from the group consisting of: comprises the amino acid sequence of SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR 3); comprises the amino acid sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13); comprises the amino acid sequence of SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR 14); and a nucleic acid comprising SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In a particular example, the at least two nucleic acids are selected from nucleic acids comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30(shmiR 13); and a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 38(shmiR 17). For example, the at least two nucleic acids can be a nucleic acid comprising SEQ ID NOs: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR 13); and a nucleic acid comprising SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In any of the foregoing examples, the ddRNAi construct and PABPN1 construct are operably linked to a promoter. In one example, the ddRNAi construct and PABPN1 construct are operably linked to the same promoter, e.g., a muscle-specific promoter. Also provided are compositions comprising an AAV of the invention and one or more pharmaceutically acceptable carriers (carriers).

The invention also provides various baculovirus vectors (vectors) for use in the production of the AAVs of the invention in insect cells. In one example, the plurality of baculovirus vectors (vectors) includes:

(a) a first baculovirus vector (vector) comprising a nucleic acid molecule encoding an AAV viral capsid protein having a modified VP1 sequence as described herein; and

(b) a second baculovirus vector (vector) comprising a polynucleotide encoding the ddRNAi construct and PABPN1 construct as described herein, flanked by AAV Inverted Terminal Repeat (ITR) sequences.

In one example, a first baculovirus vector (vector) comprises a nucleic acid molecule encoding a viral capsid protein from AAV9, the viral capsid protein comprising a modified VP1 sequence, wherein the nucleic acid molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence set forth in SEQ ID NO: 87, the amino acids at positions 1, 26, 40, 43 and 44 are modified by the sequence, and a second baculovirus vector (vector) comprises a polynucleotide sequence comprising (i) a ddRNAi construct encoding a shrir and (ii) a PABPN1 construct encoding a functional PABPN1 protein, the functional PABPN1 protein having an mRNA transcript not targeted by the shrir encoded by the ddRNAi construct.

In one example, the sequence relative to SEQ ID NO: 87, the modified AAV9 VP1 sequence comprising a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44. For example, relative to SEQ ID NO: 87, the modified AAV9 VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, and a 44S. In one example, the modified AAV9 VP1 sequence comprises SEQ ID NO: 88, respectively.

In one example, the sequence relative to SEQ ID NO: 89, and the viral capsid proteins include mutations a42S, a67E, Q81R, K84D, and a 85S. In one example, the viral capsid protein comprises SEQ ID NO: 90, or a pharmaceutically acceptable salt thereof.

In another example, the first baculovirus vector (vector) comprises a nucleic acid molecule encoding a viral capsid protein from AAV8, the viral capsid protein comprising a modified VP1 sequence, wherein the nucleic acid molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence set forth in SEQ ID NO: 91, amino acids at positions 1, 26, 40, 43, 44 and 64 are sequence modified, and a second baculovirus vector (vector) comprises a polynucleotide sequence comprising (i) a ddRNAi construct encoding a shrir and (ii) a PABPN1 construct encoding a functional PABPN1 protein having an mRNA transcript not targeted by the shrir encoded by the ddRNAi construct.

In one example, the sequence relative to SEQ ID NO: 91, modified AAV8VP1 sequence comprising a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, a serine at position 44, and a lysine at position 64. For example, relative to SEQ ID NO: 91, the modified AAV8VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, a44S, and Q64K. In one example, the modified AAV8VP1 sequence comprises SEQ ID NO: 92, respectively.

In one example, the sequence relative to SEQ ID NO: 93 and the viral capsid proteins include mutations a42S, a67E, Q81R, K84D, a85S, and Q105K. In one example, the viral capsid protein comprises SEQ ID NO: 94, or a pharmaceutically acceptable salt thereof.

In each of the foregoing embodiments, the AAV ITR sequences can be from the same serotype as the viral capsid protein encoded by the nucleic acid molecule within the first baculovirus vector (vector). In another example, the AAV ITR sequences are from another AAV serotype, such as AAV 2. In some examples, the ITR sequence is from AAV serotype 2 and includes SEQ ID NO: 95 and/or SEQ ID NO: 96, respectively.

As described herein, the second baculovirus vector (vector) includes a ddRNAi construct encoding one or more shmiR targeting PABPN 1. Described herein are exemplary ddRNAi constructs encoding shrimrs (including combinations of shrimrs) targeted to PABPN 1. In one example, the second baculovirus vector (vector) can include a ddRNAi construct encoding shrir 13 and shrir 17, and a polynucleotide construct including a sequence encoding a functional PABPN1 protein, the functional PABPN1 protein being codon optimized such that its mRNA transcript is not targeted by the shrir of the ddRNAi construct (e.g., the sequence shown in SEQ ID NO: 73). For example, the second baculovirus vector (vector) may comprise a ddRNAi construct comprising a nucleotide sequence encoding a polypeptide comprising SEQ ID NO: 31 and a DNA sequence of shrmir having an effector sequence shown in SEQ ID NO: 31, e.g., SEQ ID NO: 30(shmiR13) or a ddRNAi construct consisting thereof, and a nucleic acid comprising a DNA sequence encoding a shmiR comprising the sequence set forth in SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39, such as SEQ ID NO: 38(shmiR17) or a nucleic acid consisting of the same. For example, the second baculovirus vector (vector) may comprise a ddRNAi construct comprising the nucleotide sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

According to an example in which the first baculovirus vector (vector) does not encode AAV Rep proteins, the plurality of baculovirus vectors (vectors) may further comprise:

(c) a third baculovirus vector (vector) comprising polynucleotide sequences encoding at least one large AAV Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40.

At least one of the plurality of baculovirus vectors (vectors) may comprise a polynucleotide encoding an assembly-activation protein (AAP). In one example, a baculovirus vector (vector) encoding a capsid protein comprises a polynucleotide encoding an AAP. In an alternative example, a baculovirus encoding a Rep protein and/or a baculovirus encoding a ddRNAi construct and a PABPN1 construct includes a polynucleotide encoding an AAP.

The invention also provides a method for producing an AAV as described herein in an insect cell, the method comprising:

(i) culturing an insect cell comprising a plurality of baculovirus vectors (vectors) described herein in a culture medium under conditions sufficient for the cell to produce AAV; and optionally

(ii) Recovering the AAV from the culture medium and/or the cells.

In one example, a method includes co-infecting insect cells with a baculovirus vector (vector).

In one example, a method of producing AAV comprises recovering AAV from the culture medium and/or cells. In another embodiment, the method of producing AAV comprises recovering AAV from the culture medium and/or cells, and then purifying the AAV. In one example, AAV is recovered from the cell. In one example, AAV is recovered from the culture medium. In one example, AAV is recovered from the cells and culture medium.

The invention also provides AAV produced by the methods described herein.

The invention also provides a method for treating a subject suffering from oculopharyngeal muscular dystrophy (OPMD), the method comprising administering to the subject an AAV of the invention or a composition comprising the same; wherein the AAV or composition is administered by direct injection into the pharyngeal muscle of the subject. In one example, an AAV of the invention or a composition comprising the same is administered by direct injection into the pharyngeal muscle of a subject. For example, the pharyngeal muscles include one or more of the inferior constrictor, the middle constrictor, the superior constrictor, the palatopharyngeal muscle, the eustachian tube pharyngeal muscle, the stylopharyngeal muscle, or any combination thereof. In one example, an AAV of the invention or a composition comprising the same is administered by direct injection into the tongue muscle of a subject.

Drawings

Fig. 1A is a schematic illustrating a construct for simultaneous silencing and replacement of an endogenous PABPN1 gene with codon-optimized PABPN1, codon-optimized PABPN1 was generated by subcloning two shrimrs targeting wtpapn 1 into the 3' untranslated region of a codon-optimized PABPN1 transcript between two pAAV2 ITRs (ITRs not shown in the schematic).

Fig. 1B is a schematic illustrating a "silencing and replacement" construct (SR-construct) designed to simultaneously silence and replace the endogenous PABPN1 gene with codon-optimized PABPN1, the codon-optimized PABPN1 was generated by subcloning two shrims (shrimt 17 and shrimt 13) targeting wtpapn 1 into the 3' untranslated region of the codon-optimized PABPN1 transcript in pAAV2 vector (vector) backbone.

FIG. 1C shows a sense strand of siRNA including the 5' flanking region; predicted secondary structure of representative shrir constructs of stem/loop junction sequence, siRNA antisense strand and 3' flanking region.

Figure 2 is a schematic diagram showing the SR construct. In the SR-construct, the "replacement" and "silencing" cassettes are all inserted into a single vector (vector) with Spc512 muscle specific promoter. Two shrir sequences were inserted into the 3' UTR of codon optimized PABPN1 cassette.

FIG. 3A shows the expression of shRNA in TA muscle (tibialis anterior) of A17 mice injected with the SR-construct. RNA was extracted from TA samples 14 weeks after administration of the SR construct.

Figure 3B shows silencing of PABPN1 expression (including expPABPN1) in TA muscle of a17 mice treated with SR-constructs. RNA was extracted from TA samples 14 weeks after administration of the SR construct.

Figure 3C illustrates the restoration of normal PABPN1 levels in a17 mouse model after treatment with SR-constructs. RNA was extracted from TA muscle samples 14 weeks after administration of the SR-construct.

Figure 4A shows a significant reduction in the formation of insoluble aggregates (nuclear inclusions (INI)) including PABPN1 with SR construct dose effect. SR constructs were injected into TA muscle of a17 mice. Muscles were harvested and fixed for histological studies 14 weeks after SR construct administration. The immunofluorescence for PABPN1 appears green, while the immunofluorescence for laminin appears red.

Figure 4B shows quantification of the percentage of nuclei containing INI in muscle sections, indicating that treatment with SR-constructs significantly reduced the amount of INI compared to untreated a17 TA muscle (One-way Anova test with Bonferroni post hoc test, p <0.001, ns: not significant).

Figure 5A shows that the maximum force produced by TA muscle in a17 mice was significantly increased in a SR construct dose-dependent manner. The maximum force value was measured using in situ muscle physiology methods.

Figure 5B shows muscle weight normalized to Body Weight (BW) of TA muscle treated with SR construct in a17 mice. The normalized muscle weights were comparable to those of the control FvB mice at doses above 1e10 vg per TA injection (mean ± SEM, n-10, single factor variance test using Bonferroni post hoc test,. p <0.05,. p <0.001,. p <0.01, ns: not significant).

Figure 6A shows the maximum force exerted by the TA muscle of a17 mice at 14 weeks after SR-construct administration. The maximum force value was measured using in situ muscle physiology methods.

Figure 6B shows the maximum force exerted by the TA muscle of a17 mice at 20 weeks after SR-construct administration. The maximum force value was measured using in situ muscle physiology methods.

Figure 7A shows direct injection of SR-constructs into sheep pharyngeal muscle.

Figure 7B shows an image of a patient using a radioactivatable cream showing severe dysphagia in a human OPMD patient at risk of "misinterpretation".

FIG. 8 is a vector (vector) diagram of a DNA construct designed as BacAAV 9-Rep-VPmod. The DNA constructs are designed to express AAV Rep proteins and modified AAV9 capsids in insect cells. The vector backbone was a baculovirus vector (vector) pOET1 backbone (Oxford Expression Technologies) used to prepare AAV containing the modified AAV9 capsid protein.

FIG. 9 is a vector diagram of a DNA construct designed as AAV 9-VPmod. The DNA construct contains a modified version of the AAV9 capsid gene, which was used to prepare BacAAV9-Rep-VPmod (FIG. 8).

FIG. 10 is a vector (vector) diagram of a DNA construct designed as AAV 9-Rep-VPmod. The DNA constructs are designed to express AAV Rep proteins and modified AAV9 capsids in insect cells.

FIG. 11 is a vector (vector) diagram of a DNA construct designed as BacAAV 8-Rep-VPmod. The DNA constructs are designed to express AAV Rep proteins and modified AAV8 capsids in insect cells. The vector backbone was a baculovirus vector (vector) pOET1 backbone (Oxford Expression Technologies) used to prepare AAV containing the modified AAV8 capsid protein in insect cells.

FIG. 12 is a vector (vector) diagram of a DNA construct designed as AAV 8-VPmod. The DNA constructs contained modified versions of the AAV8 capsid gene, which were used to make AAV8-Rep-VPmod (FIG. 13) and BacAAV8-Rep-VPmod (FIG. 11).

FIG. 13 is a vector (vector) map of a DNA construct designed as wtAAV 8-Rep/Cap. The DNA constructs are designed to express AAV Rep proteins and wt AAV8 capsid in insect cells and are used to prepare AAV containing the wt AAV8 capsid protein.

FIG. 14 is a vector (vector) diagram of a DNA construct designed as an AAV 2-GOI. The DNA construct was designed to express two shmirs flanking AAV ITRs and used to make BacAAV2-GOI (fig. 15).

FIG. 15 is a vector (vector) diagram of a DNA construct designed as BacAAV 2-GOI. The DNA construct was designed to express two shrimrs (oxford Expression technologies) flanking an AAV ITR (AAV2-GOI) in the baculovirus vector (vector) pOET1 backbone. The constructs were used to prepare AAV comprising modified AAV9 capsid proteins expressing GOIs encoding two shrimrs.

Fig. 16A-16C show the total number of shmiR copies expressed per cell of JHU67 cells infected with (i) AAV8 with an unmodified VP1 (VecBio) produced in mammalian cells, (ii) AAV8 with a modified VP1 produced by baculovirus in insect cells (BacVPmod), and (iii) AAV8 with an unmodified VP1 produced by baculovirus in insect cells (Ben10), 4x10e9, 8x10e9, and 1.6x10e10 AAV vector (vector) genomes. AAV having a wild-type capsid produced in a mammalian cell expresses high levels of shrir compared to AAV having a wild-type capsid produced in an insect cell, wherein expression is barely detectable. AAV having a capsid with modified VP1 produced in insect cells showed a significant increase in expression, and thus a significant increase in function, compared to AAV produced in insects using an unmodified wild-type capsid.

Figure 17 shows the total number of shmiR copies expressed from C2C12 cells expressing AAV internalizing receptor (AAV-R) and infected with (i) AAV9 with unmodified VP1 produced in mammalian cells and (ii) AAV9 with modified VP1 produced by baculovirus in insect cells, 4x10e9, 8x10e9, and 1.6x10e10 AAV vector (vector) genomes. Both recombinant viruses produced the same level of shmiR, showing the same function.

Keywords of sequence Listing

SEQ ID NO: 1: the RNA sequence corresponding to the region of the mRNA transcript of the PABPN1 protein, designated PABPN1mRNA region 2.

SEQ ID NO: 2: the RNA sequence corresponding to the region of the mRNA transcript of the PABPN1 protein, designated PABPN1mRNA region 3.

SEQ ID NO: 3: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 4.

SEQ ID NO: 4: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 5.

SEQ ID NO: 5: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 6.

SEQ ID NO: 6: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 7.

SEQ ID NO: 7: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 9.

SEQ ID NO: 8: the RNA sequence of the mRNA transcript region corresponding to the PABPN1 protein, designated PABPN1mRNA region 11.

SEQ ID NO: 9: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 13.

SEQ ID NO: 10: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, termed PABPN1mRNA region 14.

SEQ ID NO: 11: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, termed PABPN1mRNA region 15.

SEQ ID NO: 12: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 16.

SEQ ID NO: 13: the RNA sequence of the region of the mRNA transcript corresponding to the PABPN1 protein, designated PABPN1mRNA region 17.

SEQ ID NO: 14: the RNA effector complement of shrmir, designated shrmir 2.

SEQ ID NO: 15: the RNA effector sequence of shrmir designated shrmir 2.

SEQ ID NO: 16: the RNA effector complement of shrmir, designated shrmir 3.

SEQ ID NO: 17: the RNA effector sequence of shrmir designated shrmir 3.

SEQ ID NO: 18: the RNA effector complement of shrmir, designated shrmir 4.

SEQ ID NO: 19: the RNA effector sequence of shrmir designated shrmir 4.

SEQ ID NO: 20: the RNA effector complement of shrmir, designated shrmir 5.

SEQ ID NO: 21: the RNA effector sequence of shrmir designated shrmir 5.

SEQ ID NO: 22: the RNA effector complement of shrmir, designated shrmir 6.

SEQ ID NO: 23: the RNA effector sequence of shrmir designated shrmir 6.

SEQ ID NO: 24: the RNA effector complement of shrmir, designated shrmir 7.

SEQ ID NO: 25: the RNA effector sequence of shrmir designated shrmir 7.

SEQ ID NO: 26: the RNA effector complement of shrmir, designated shrmir 9.

SEQ ID NO: 27: the RNA effector sequence of shrmir designated shrmir 9.

SEQ ID NO: 28: the RNA effector complement of shrmir, designated shrmir 11.

SEQ ID NO: 29: the RNA effector sequence of shrmir designated shrmir 11.

SEQ ID NO: 30: the RNA effector complement of shrmir, designated shrmir 13.

SEQ ID NO: 31: the RNA effector sequence of shrmir designated shrmir 13.

SEQ ID NO: 32: the RNA effector complement of shrmir, designated shrmir 14.

SEQ ID NO: 33: the RNA effector sequence of shrmir designated shrmir 14.

SEQ ID NO: 34: the RNA effector complement of shrmir, designated shrmir 15.

SEQ ID NO: 35: the RNA effector sequence of shrmir designated shrmir 15.

SEQ ID NO: 36: the RNA effector complement of shrmir, designated shrmir 16.

SEQ ID NO: 37: the RNA effector sequence of shrmir designated shrmir 16.

SEQ ID NO: 38: the RNA effector complement of shrmir, designated shrmir 17.

SEQ ID NO: 39: the RNA effector sequence of shrmir designated shrmir 17.

SEQ ID NO: 40: RNA stem-loop sequence of shmiR

SEQ ID NO: 41: the 5' flanking sequence of the pri-miRNA backbone.

SEQ ID NO: 42: 3' flanking sequence of pri-miRNA backbone

SEQ ID NO: 43: the RNA sequence of the shrmir designated shrmir 2.

SEQ ID NO: 44: the RNA sequence of the shrmir designated shrmir 3.

SEQ ID NO: 45: the RNA sequence of the shrmir designated shrmir 4.

SEQ ID NO: 46: the RNA sequence of the shrmir designated shrmir 5.

SEQ ID NO: 47: the RNA sequence of the shrmir designated shrmir 6.

SEQ ID NO: 48: the RNA sequence of the shrmir designated shrmir 7.

SEQ ID NO: 49: the RNA sequence of the shrmir designated shrmir 9.

SEQ ID NO: 50: the RNA sequence of the shrmir designated shrmir 11.

SEQ ID NO: 51: the RNA sequence of the shrmir designated shrmir 13.

SEQ ID NO: 52: the RNA sequence of the shrmir designated shrmir 14.

SEQ ID NO: 53: the RNA sequence of the shrmir designated shrmir 15.

SEQ ID NO: 54: the RNA sequence of the shrmir designated shrmir 16.

SEQ ID NO: 55: the RNA sequence of the shrmir designated shrmir 17.

SEQ ID NO: 56: a DNA sequence encoding shrmir designated shrmir 2.

SEQ ID NO: 57: a DNA sequence encoding shrmir designated shrmir 3.

SEQ ID NO: 58: a DNA sequence encoding shrmir designated shrmir 4.

SEQ ID NO: 59: a DNA sequence encoding shrmir designated shrmir 5.

SEQ ID NO: 60: a DNA sequence encoding shrmir designated shrmir 6.

SEQ ID NO: 61: a DNA sequence encoding shrmir designated shrmir 7.

SEQ ID NO: 62: a DNA sequence encoding shrmir designated shrmir 9.

SEQ ID NO: 63: a DNA sequence encoding shrmir designated shrmir 11.

SEQ ID NO: 64: a DNA sequence encoding shrmir designated shrmir 13.

SEQ ID NO: 65: a DNA sequence encoding shrmir designated shrmir 14.

SEQ ID NO: 66: a DNA sequence encoding shrmir designated shrmir 15.

SEQ ID NO: 67: a DNA sequence encoding shrmir designated shrmir 16.

SEQ ID NO: 68: a DNA sequence encoding shrmir designated shrmir 17.

SEQ ID NO: 69: DNA sequences encoding shmiR3 and shmiR14 under the control of muscle-specific CK8 promoter and codon-optimized version 1 of PABPN1 under the control of shmiR14 and Spc512

SEQ ID NO: 70: DNA sequences encoding shmiR17 and shmiR13 under the control of muscle-specific CK8 promoter and codon-optimized version 1 of PABPN1 under the control of shmiR13 and Spc512

SEQ ID NO: 71: DNA sequences encoding coPABPN1 and the double construct version 2 of shmiR designated shrir 3 and shrir 14 under control of Spc 512.

SEQ ID NO: 72: DNA sequences encoding coPABPN1 and the double construct version 2 of shmiR designated shmiR17 and shmiR13 under control of Spc 512.

SEQ ID NO: 73: DNA sequence of the human codon-optimized PABPN1 cDNA sequence.

SEQ ID NO: 74: amino acid sequence of codon-optimized human PABPN1 protein.

SEQ ID NO: 75: amino acid sequence of wild-type human PABPN1 protein with FLAG tag.

SEQ ID NO: 76: amino acid sequence of codon optimized human PABPN1 protein with FLAG tag.

SEQ ID NO: 77: the DNA sequence of the primer designated wtPABPN 1-Fwd.

SEQ ID NO: 78: DNA sequence of the primer named wtPABPN1-Rev

SEQ ID NO: 79: DNA sequence of the Probe named wtPABPN 1-Probe

SEQ ID NO: 80: DNA sequence of the primer designated oppTABPN 1-Fwd

SEQ ID NO: 81: DNA sequence of the primer designated oppTABPN 1-Rev

SEQ ID NO: 82: DNA sequence of the Probe named OptPABPN 1-Probe

SEQ ID NO: 83 DNA sequence of primer named shmiR3-FWD

SEQ ID NO: DNA sequence of primer named shmiR13-FWD 84

SEQ ID NO: 85 DNA sequence of primer named shmiR14-FWD

SEQ ID NO: DNA sequence of primer named shmiR17-FWD 86

SEQ ID NO: 87 is the wild-type VP1 subsequence of AAV serotype 9, including the PLA2 domain and flanking sequences.

SEQ ID NO: 88 is a modified VP1 subsequence of AAV serotype 9, including the PLA2 domain and flanking sequences.

SEQ ID NO: 89 full length wild type AAV serotype 9 capsid.

SEQ ID NO: 90 full length modified AAV serotype 9 capsid.

SEQ ID NO: 91 is the wild type VP1 subsequence of AAV serotype 8, including the PLA2 domain and flanking sequences.

SEQ ID NO: 92 is a modified VP1 subsequence of AAV serotype 8, including the PLA2 domain and flanking sequences.

SEQ ID NO: 93 full length wild type AAV serotype 8 capsid.

SEQ ID NO: 94 full length modified AAV serotype 8 capsid.

SEQ ID NO: 95AAV 25' ITR sequences.

SEQ ID NO: 96AAV 23' ITR sequence.

SEQ ID NO: 97 full length wild type AAV serotype 2 capsid.

SEQ ID NO: 98: an RNA sequence encoding wild-type human PABPN1 protein.

Detailed Description

Summary of the invention

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, feature, composition of matter, group of steps, feature group, or group of matter shall be taken to include one or more (i.e., one or more) of those steps, features, compositions of matter, groups of steps, feature groups, or groups of matter.

Those skilled in the art will appreciate that the present invention is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended as exemplary only. Functionally equivalent products, compositions and methods are clearly within the scope of the present invention.

Unless specifically stated otherwise, it should be applied mutatis mutandis to any other example of the invention.

Unless clearly defined otherwise, all technical and scientific terms used herein are to be considered as having the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

Unless otherwise indicated, recombinant DNA, recombinant proteins, cell culture and immunological techniques used in the present invention are standard procedures well known to those skilled in the art. These techniques are described and explained in the following source literature, for example, J.Perbal, "Practical guidelines for Molecular Cloning (A Practical Guide to Molecular Cloning), John Wiley and Sons (1984), Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T.A.Brown (eds.)," basic Molecular biology: a Practical method (Essential Molecular Biology: A Practical Approach), volumes 1 and 2, IRL Press (1991), D.M.Glover and B.D.Hames (eds.), "DNA cloning: a Practical method (DNA Cloning: A Practical Approach), volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al, (eds.), (Current Protocols in Molecular Biology), Greene pub. associates and Wiley-Interscience (1988, including all updates so far), Ed Harlow and David Lane (eds.), [ antibody: a Laboratory Manual (Antibodies: A Laboratory Manual), Cold Spring Harbor Laboratory, (1988), and J.E.Coligan et al, (eds.), (Current Protocols in Immunology), John Wiley & Sons (including all updates to date).

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of integers.

The term "and/or", such as "X and/or Y", is understood to mean "X and Y" or "X or Y", and is understood to provide explicit support for both meanings or for either meaning.

Selected definition

"RNA" refers to a molecule comprising at least one ribonucleotide residue. "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of the β -D-ribofuranose moiety. The term includes double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, substantially pure RNA, synthetic RNA, recombinantly produced RNA, and altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides. Such alterations may include the addition of non-nucleotide species, for example, to the end or interior of the siRNA, for example, at one or more nucleotides of the RNA. The nucleotides in the RNA molecules of the invention may also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogs or analogs of naturally occurring RNAs.

The term "RNA interference" or "RNAi" generally refers to RNA-dependent silencing of gene expression by double-stranded RNA (dsrna) molecules in the cytoplasm of a cell. The dsRNA molecule reduces or inhibits the transcription product of a target nucleic acid sequence, thereby silencing or reducing the expression of the gene.

As used herein, the term "double-stranded RNA" or "dsRNA" refers to an RNA molecule having a duplex structure and comprising an effector sequence and an effector-complementary sequence that are similar in length to each other. The effector sequence and effector complement sequence may be a single RNA strand or separate RNA strands. The "effector sequence" (often referred to as the "guide strand") is substantially complementary to the target sequence, which in the present invention is a region of the PABPN1mRNA transcript. An "effector sequence" may also be referred to as an "antisense sequence". An "effector-complementary sequence" will be sufficiently complementary to an effector sequence that it can anneal to the effector sequence to form a duplex. In this regard, the effector complement sequence will be substantially homologous to a region of the target sequence. It will be apparent to those skilled in the art that the term "effector-complementary sequence" may also be referred to as the complement or sense sequence of an "effector sequence.

As used herein, the term "duplex" refers to a region in two complementary or substantially complementary nucleic acids (e.g., RNAs) of a single-stranded nucleic acid (e.g., RNA), or in two complementary or substantially complementary regions of a single-stranded nucleic acid (e.g., RNA) that form base pairs with each other, by Watson-Crick (Watson-Crick) base pairing or any other means that allows for a stable duplex between complementary or substantially complementary nucleotide sequences. Those skilled in the art will appreciate that within the duplex region, 100% complementarity is not required; substantial complementarity is permitted. Substantial complementarity may include 79% or greater complementarity. For example, a single mismatch in a duplex region consisting of 19 base pairs (i.e., a common pairing, 18 base pairs and one mismatch) results in 94.7% complementarity such that the duplex regions are substantially complementary. In another example, two mismatches in a duplex region consisting of 19 base pairs (i.e., 17 base pairs and two mismatches) result in 89.5% complementarity such that the duplex regions are substantially complementary. In another example, 3 mismatches in a duplex region consisting of 19 base pairs (i.e., 16 base pairs and 3 mismatches) result in 84.2% complementarity, such that the duplex regions are substantially complementary, and so on.

The dsRNA may be provided as a hairpin or stem-loop structure having a duplex region consisting of an effector sequence and an effector-complementary sequence, the effector sequence and the effector-complementary sequence being linked by at least 2 nucleotide sequences called stem-loops. When the dsRNA is provided in a hairpin or stem-loop structure, it may be referred to as a "hairpin RNA" or a "short hairpin RNAi agent" or "shRNA". Other dsRNA molecules provided in or producing the hairpin structure or stem-loop structure include primary miRNA transcripts (pri-mirnas) and precursor micrornas (pre-mirnas). pre-miRNA shrnas can be naturally produced from pri-mirnas by the action of Drosha and Pasha enzymes that recognize and release regions of the primary miRNA transcript that form stem-loop structures. Alternatively, pri-miRNA transcripts may be engineered to replace the native stem-loop structure with artificial/recombinant stem-loop structures. That is, an artificial/recombinant stem-loop structure may be inserted or cloned into a pri-miRNA backbone sequence that lacks its native stem-loop structure. In the case of stem-loop sequences designed to express pri-miRNA molecules, Drosha and Pasha recognize and release artificial shRNA. The dsRNA molecules produced by the method are called shmiRNA, shmiR or shRNA (short hairpin ribonucleic acid) of a micro RNA framework.

As used herein, the term "complementary" with respect to a sequence refers to complementarity to the sequence by watson-crick base pairing, whereby guanine (G) is paired with cytosine (C) and adenine (a) is paired with uracil (U) or thymine (T). One sequence may be complementary to the full length of the other sequence, or it may be complementary to a particular portion or length of the other sequence. One skilled in the art will recognize that U may be present in RNA and T may be present in DNA. Thus, an a within either of an RNA or DNA sequence can pair with a U in the RNA sequence or a T in the DNA sequence. One skilled in the art will also recognize that the G present in the RNA may pair with the C or U in the RNA.

As used herein, the term "substantially complementary" is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between nucleic acid sequences, e.g., between an effector sequence and an effector-complementary sequence, or between an effector sequence and a target sequence. It is understood that a nucleic acid sequence need not be 100% complementary to its target or complementary sequence. The term encompasses sequences that are complementary to another sequence except for overhangs. In some cases, the sequence is complementary to another sequence except for 1-2 mismatches. In some cases, the sequences are complementary except for 1 mismatch. In some cases, the sequences are complementary except for 2 mismatches. In other cases, the sequences are complementary except for 3 mismatches. In still other cases, the sequences are complementary except for 4 mismatches.

The term "encoded" as used in the context of shrnas or shmiR of the invention is understood to mean shrnas or shmiR capable of being transcribed from a DNA template. Thus, a nucleic acid encoding or encoding an shRNA or shmiR of the invention will include a DNA sequence that serves as a template for transcription of the corresponding shRNA or shmiR.

The term "DNA-directed RNAi construct" or "ddRNAi construct" refers to a nucleic acid that includes a DNA sequence that, when transcribed, produces an shRNA or shrmir molecule (preferably shrmir) that causes RNAi. The ddRNAi construct can include a nucleic acid that is transcribed into a single RNA capable of self-annealing to a hairpin structure having duplex regions, i.e., shRNA or shmiR, connected by a stem loop of at least 2 nucleotides, or into a single RNA having multiple shRNA or shmiR, or into multiple RNA transcripts each capable of folding into a single shRNA or shmiR, respectively. The ddRNAi constructs may be provided within a larger "DNA construct" that includes one or more additional DNA sequences. For example, the ddRNAi construct may be provided in a DNA construct comprising an additional DNA sequence encoding a functional PABPN1 protein, which has been codon optimized such that its mRNA transcript is not targeted by the shmiR of the ddRNAi construct. The ddRNAi construct and/or DNA construct comprising the construct may be in an expression vector (vector), such as a plasmid, operably linked to a promoter.

As used herein, the term "operably linked" or "operably linked" (or the like) means that the coding nucleic acid sequence is linked to or associated with a regulatory sequence (e.g., a promoter) in a manner that facilitates expression of the coding sequence. Regulatory sequences include promoters, enhancers and other expression control elements, which are well known in the art and are selected to direct the expression of a coding sequence.

As used herein, the term "inverted terminal repeat" or "ITR" refers in plural or singular form to a sequence located at one end of a vector (vector), which when used in combination with a complementary sequence located at the opposite end of the vector (vector) can form a hairpin structure. The pair of inverted terminal repeats participate in the rescue of AAV DNA, replication and packaging in the host genome. ITRs are also used for efficient encapsidation of AAV DNA and production of fully assembled AAV particles.

"vector" is understood to mean a vector (vector) for introducing a nucleic acid into a cell. Vectors (vectors) include, but are not limited to, plasmids, phagemids, viruses, bacteria and vectors (vectors) derived from viral or bacterial sources. A "plasmid" is a circular double-stranded DNA molecule. A useful type of vector (vector) for use according to the invention is a viral vector (vector) in which a heterologous DNA sequence is inserted into the viral genome which may be modified to delete one or more viral genes or parts thereof. Certain vectors (vectors) are capable of autonomous replication in a host cell (e.g., vectors having an origin of replication that functions in a host cell). Other vectors (vectors) may be stably integrated into the genome of the host cell so as to be replicated together with the host genome. As used herein, the term "expression vector" is understood to mean a vector (vector) capable of expressing an RNA molecule of the invention.

A "functional PABPN1 protein" is understood to mean a PABPN1 protein having the functional properties of the wild-type PABPN1 protein, e.g. the ability to control mRNA polyadenylation and/or intron splice sites in mammalian cells. Thus, a "functional PABPN1 protein" is understood to be a PABPN1 protein that does not cause OPMD when expressed or present in a subject. In one example, reference herein to a "functional PABPN1 protein" refers to a human wild-type PABPN1 protein. The sequence of the human wild-type PABPN1 protein is given in NCBI RefSeq NP _ 004634. Thus, a functional human PABPN1 protein may have the in vivo functional properties of the human PABPN1 protein listed in NCBI RefSeq NP _ 004634.

As used herein, the terms "treatment", "treating" or "treatment" and variations thereof refer to clinical interventions designed to alter the natural course of the treated individual or cell during the course of clinical pathology. Desirable effects of treatment include reducing the rate of disease progression, ameliorating or alleviating the disease state, and ameliorating or improving prognosis. Thus, treatment of OPMD includes reducing or inhibiting the expression of PABPN1 protein that causes OPMD in a subject and/or expressing PABPN1 protein having a normal length of a poly-alanine residue in a subject. Preferably, the treatment of OPMD comprises reducing or inhibiting the expression of PABPN1 protein that causes OPMD and/or expressing PABPN1 protein with a normal length of a poly-alanine residue in a subject. For example, an individual is successfully "treated" if one or more of the above-described treatment outcomes are achieved.

A "therapeutically effective dose" is at least the minimum concentration or amount required to provide a significant improvement in a condition of OPMD, such as a significant improvement in one or more symptoms of OPMD, including but not limited to ptosis, dysphagia, and muscle weakness of the subject. The therapeutic effector amounts herein can vary according to factors such as the disease state, age, sex, and weight of the patient, as well as the ability of the shrir, the nucleic acid encoding the shrir, the ddRNAi construct, the DNA construct, the expression vector (vector), or a composition comprising the same, to elicit a desired response in an individual and/or the ability of the expression vector (vector) to express a functional PABPN1 protein in a subject. A therapeutically effective amount is also an amount wherein any toxic or detrimental effects of the shrir, the shrir-encoding nucleic acid, the ddRNAi construct, the DNA construct, the expression vector (vector), or the composition comprising the same, exceed the therapeutically beneficial effects of the shrir, the shrir-encoding nucleic acid, the ddRNAi construct, the DNA construct, the expression vector (vector), or the composition comprising the same, to inhibit, suppress, or reduce expression of the PABPN1 protein that causes OPMD in a subject (considered alone or in combination with expression of the functional PABPN1 protein).

As used herein, a "subject" or "patient" may be a human or non-human animal having or genetically predisposed to OPMD, i.e., a human or non-human animal having a variant of the PABPN1 gene that causes OPMD. The "non-human animal" may be a primate, a domestic animal (e.g. sheep, horse, cow, pig, donkey), a companion animal (e.g. pets such as dogs and cats), a laboratory animal (e.g. mouse, rabbit, rat, guinea pig, drosophila, caenorhabditis elegans, zebrafish), a performance animal (e.g. racehorse, camel, greyhound) or a captive wild animal. In one example, the subject or patient is a mammal. In one example, the subject or patient is a human.

The terms "reduced expression", "reduced expression" or similar terms refer to the absence or observable reduction in the level of protein and/or mRNA products of a target gene (e.g., PABPN1 gene). The reduction need not be absolute, but can be a partial reduction sufficient to result in a detectable or observable change in RNAi caused by the shrmir, a nucleic acid encoding the shrmir, a ddRNAi construct, a DNA construct, an expression vector (vector), or a composition comprising these of the invention. The reduction can be measured by determining a reduction in the level of mRNA and/or protein product from the target nucleic acid relative to a cell lacking a shrir, a nucleic acid encoding a shrir, a ddRNAi construct, a DNA construct, an expression vector (vector), or a composition comprising the same, and can be as low as 1%, 5%, or 10%, or can be absolute, i.e., 100% inhibition. The effect of the reduction can be determined by examining an outward property of the cell or organism (i.e., a quantitative and/or qualitative phenotype of the cell or organism), and can further comprise detecting the presence of nuclear aggregates or changes in the amount of nuclear aggregates of expPABPN1 in the cell or organism following administration of the shrir, the shrir-encoding nucleic acid, the ddRNAi construct, the DNA construct, the expression vector (vector), or a composition comprising the same of the invention.

As used herein, "delivery system" refers to a vector (vector) for packaging foreign genetic material, such as DNA or RNA, and which can be introduced into a cell. Delivery systems may include viral vectors (vectors), e.g., adeno-associated virus (AAV) vectors (vectors), retroviral vectors (vectors), adenoviral vectors (vectors) (AdV), and Lentiviral (LV) vectors (vectors). As described herein, viral vectors (vectors) can be used to deliver and express exogenous genetic material in cells. Thus, the viral expression vectors (vectors) described herein can be used as delivery systems.

As used herein, the term "adeno-associated virus" or "AAV" relates to a group of viruses within the Parvoviridae (Parvoviridae) that contain a short (about 4.7kb) single-stranded DNA genome and are dependent on the presence of a helper virus (e.g., an adenovirus for its replication). The invention also relates to vectors (vectors) derived from AAV, for example for use as gene transfer vectors (vectors).

As used herein, the term "serotype" as used in the context of AAV is intended to refer to the distinction of AAV having a serologically distinct capsid from other AAV serotypes. Serological specificity was determined on the basis of the lack of cross-reactivity between antibodies against one AAV compared to another. This cross-reactivity difference is typically due to differences in capsid protein sequences/epitopes (e.g., due to differences in VP1, VP2, and/or VP3 sequences of AAV serotypes).

As used herein, in the context of AAV, the terms "viral capsid protein", "capsid polypeptide" or analog relate to a polypeptide of AAV that has self-assembly activity to produce a protein shell of AAV particles, also referred to as coat protein or VP protein. It consists of three subunits, VP1, VP2, and VP3, is typically expressed from a single nucleic acid molecule, and interacts to form an icosahedral symmetric capsid. The capsid structure of AAV is described in Bernard N.FIELDS et al, VIROLOGY (VIROLOGY) Vol.2, Chapter 69&70 (4 th edition, Lippincott-Raven Press).

As used herein, the term "promoter" generally refers to a DNA sequence that is involved in the recognition and binding of DNA-dependent RNA polymerase and other proteins (trans-acting transcription factors) to initiate and control the transcription of one or more coding sequences, and is generally located upstream of the coding sequence relative to the direction of transcription.

The term "improved function" or similar terms as used in the context of an AAV of the invention comprising a modified capsid protein or VP1 sequence should be understood to mean that the AAV comprising the modified capsid protein or VP1 sequence has improved endosomal escape activity relative to a wild-type AAV of the same serotype, which has not been modified and produced in an insect cell. As used herein, the term "endosomal escape activity", "endosomal escape activity" or similar terms shall be understood to refer to the ability of AAV to escape from the endosomal compartment following cellular internalization. In terms of AAV function, it is understood that AAV which cannot escape from endosomes following cellular internalization is not functional, particularly in gene therapy.

As used herein, "pharyngeal muscle" refers to one or more groups of muscles that form the pharynx. The pharyngeal muscles may include one or more of the lower, middle, upper, palatopharyngeus, pharyngeal laryngeal, and/or stylopharyngeal muscles.

Modified AAV delivery vectors (vectors) for the treatment of OPMD

Adeno-associated virus (AAV) is a dependent parvovirus that typically requires co-infection with another virus (usually adenovirus or herpes virus) to initiate and maintain a productive infection cycle. In the absence of such helper viruses, AAV is still able to infect or transduce target cells through receptor-mediated binding and internalization, penetrating the nucleus in non-dividing and dividing cells. Because progeny viruses are not produced by AAV infection in the absence of helper virus, the extent of transduction is limited to only the initial cells infected with the virus. This is a characteristic feature of AAV which is becoming an ideal vector for gene therapy (vector). Furthermore, unlike retroviruses, adenoviruses and herpes simplex viruses, AAV appears to lack human pathogenicity and virulence (Kay et al, Nature.424:251 (2003)). Since the genome typically encodes only two genes, it is not surprising that AAV as a delivery vector (vehicle) is limited by a packaging capacity of 4.5 kilobases (kb/s). However, while this size limitation may limit the genes that can be delivered for alternative gene therapy, it does not adversely affect the packaging and expression of shorter sequences such as shmiR and shRNA. For these reasons, the present invention contemplates the use of AAV as a vector (vector) or system for delivering PABPN1 'silencing and replacement' constructs for the treatment of OPMD. Typically, the AAV for gene therapy applications is preferably selected from those serotypes which are capable of infecting humans, for example an AAV selected from the group consisting of AAV serotypes 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12 and 13 (or variants thereof).

In one example, the invention provides an AAV comprising:

(a) a viral capsid protein comprising a modified VP1 sequence, wherein flanking sequences for specific amino acids and subunit 1(VP1) within the phospholipase a2(PLA2) domain are modified to be more "AAV 2-like" relative to the corresponding wild-type sequence; and

(b) a polynucleotide sequence comprising (i) a DNA-directed rnai (ddrnai) construct comprising a nucleic acid comprising a sequence encoding a short hairpin microrna (shrir); and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein, the functional PABPN1 protein having an mRNA transcript that is not targeted by the shmiR encoded by the ddRNAi construct;

in this regard, the inventors have shown that the endosomal escape activity of representative AAV from serotypes other than serotype 2, produced by baculovirus expression systems in insect cells, can be restored or improved by amino acid substitutions at specific sites within the PLA2 domain and its flanking sequences. For example, the inventors have shown that endosomal escape activity of AAV from a representative serotype other than serotype 2 can be restored or improved by substituting amino acids at up to 6 different positions within the PLA2 domain and flanking sequences with amino acids at corresponding positions within the AAV serotype 2PLA2 domain and flanking sequences. In this regard, since the currently employed strategy is to improve the function of AAV produced in insect cells, the inventors have shown that it is not necessary to exchange the entire PLA2 domain and flanking sequences with those of AAV2 to produce chimeric AAV, nor to produce AAV that expresses a chimeric capsid comprising wild-type VP1/PLA2 sequences and AAV2, e.g., AAV2/WT VP 1.

The AAV sequences useful for producing AAV having the modified VP1 sequences described herein may be derived from the genome of any AAV serotype. In general, AAV serotypes have genomic sequences with significant homology at the amino acid and nucleic acid levels, provide the same set of genetic functions, produce virions that are physically and functionally similar, and replicate and assemble by virtually the same mechanisms (a specific exemption with the activity of the PLA2 domain described herein). Suitable AAV nucleic acid and protein sequences for designing and producing the modified AAV of the invention are publicly available. The VP1 sequence of wild-type AAV known to infect humans (and which is encompassed herein) is described in Chen et al, (2013) J.Vir.87(11): 6391-6405. Human or simian adeno-associated virus (AAV) serotypes are a preferred source of AAV nucleotide sequences for use in the present disclosure, with AAV serotypes that normally infect humans (e.g., serotypes 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, and 13) being more preferred. The capsid polypeptide sequences of AAV serotypes 1-13 are known in the art, for example, AAV1 (GenBank accession No.: AAD27757.1, GI:4689097), AAV2 (GenBank accession No.: AAC03780.1, GP.2906023), AAV3 (GenBank accession No.: AAC55049.1, GI:1408469), AAV4 (GenBank accession No.: AAC58045.1, GL2337940), AAV5 (GenBank accession No.: AAD13756.1, GI-4249658), AAV10 (GenBank accession No.: AAT46337.1, GL48728343), AAV11 (GenBank accession No.: AAT46339.1, GI:48728346), AAV12 (GenBank accession No.: A I16639.1, GI:112379656) or AAV13 (GenBank accession No.: ABZ10812.1, GI: 167047087). Polypeptide sequences of AAV capsid proteins of serotypes 1-13 are also set forth herein in SEQ ID NOs: 27-39. Furthermore, the complete genome of AAV from serotypes 1-13 is known in the art, for example, AAV1(NCBI reference: NC-002077.1), AAV2 (GenBank accession: J01901.1), AAV3 (GenBank accession: AF028705.1), AAV4(NCBI reference: NC-001829.1), AAV5(NCBI reference: NC-006152.1), AAV6 (GenBank: AF028704.1), AAV7(NCBI reference: NC-006260.1), AAV8(NCBI reference: NC-006261.1), AAV9 (GenBank accession: AY530579.1), AAV10 (GenBank accession: AY631965.1), AAV11 (GenBank accession: AY631966.1), or AAV12 (GenBank accession: DQ 813647.1). In particular examples, the invention provides AAV delivery vectors (vectors) from serotypes 8 and 9.

In one example, the AAV of the invention comprises a viral capsid protein from AAV9, comprising a modified VP1 sequence, wherein the viral capsid protein comprises a sequence that is modified relative to SEQ ID NO: 87, and one or more of the amino acids at positions 1, 26, 40, 43 and 44 are modified. For example, an AAV of the invention may include a viral capsid protein from AAV9, the viral capsid protein including a modified VP1 sequence, the VP1 sequence including the sequence of serine at position 1, glutamic acid at position 26, arginine at position 40, aspartic acid at position 43, serine at position 44, and lysine at position 64, wherein the amino acid positions are relative to the amino acid sequence set forth in SEQ ID NO: 87, wherein the amino acids at any one or more of positions 1, 26, 40, 43 and 44 are modified relative to the corresponding wild type AAV9 VP1 sequence. In some examples, no other amino acids other than those at any one or more of positions 1, 26, 40, 43, and 44 are modified relative to the corresponding wild type AAV9 VP1 sequence.

In one example, the AAV described herein may include a viral capsid protein from AAV9 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 87, the amino acids at any two, three, four or five of positions 1, 26, 40, 43 and 44 are modified.

In one example, the AAV described herein may include a viral capsid protein from AAV9 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 87, the amino acid at any two or more of positions 1, 26, 40, 43 and 44 is modified. For example, relative to SEQ ID NO: 87, the modified VP1 sequence may include two or more modifications selected from A1S, a26E, Q40R, K43D, and a 44S.

In one example, the AAV described herein may include a viral capsid protein from AAV9 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 87 of the corresponding wild-type AAV9 VP1, the amino acids at any three or more of positions 1, 26, 40, 43 and 44 are modified. For example, relative to SEQ ID NO: 87, the modified VP1 sequence may include three or more modifications selected from A1S, a26E, Q40R, K43D, and a 44S.

In one example, the AAV described herein may include a viral capsid protein from AAV9 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 87, the amino acid at any four or more of positions 1, 26, 40, 43 and 44 is modified. For example, relative to SEQ ID NO: 87, the modified VP1 sequence may include four or more modifications selected from A1S, a26E, Q40R, K43D, and a 44S.

In one example, the AAV described herein may include a viral capsid protein from AAV9 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 87 of the corresponding wild-type AAV9 VP1, the amino acids at positions 1, 26, 40, 43 and 44 are modified. For example, relative to SEQ ID NO: 87, the modified VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, and a 44S. For example, the modified AAV9 VP1 sequence may include SEQ ID NO: 88. For example, relative to SEQ ID NO: 89, residues at positions 42, 67, 81, 84 and 85 are modified (e.g., a42S, a67E, Q81R, K84D and a85S are modified relative to the sequence shown in SEQ ID NO: 89). According to this example, an AAV of the invention may include a viral capsid protein from AAV9, the viral capsid protein comprising the amino acid sequence set forth in SEQ ID NO: 90, modified VP1 sequence.

In one example, the AAV of the invention comprises a viral capsid protein from AAV8, comprising a modified VP1 sequence, wherein the viral capsid protein comprises a sequence that is modified relative to SEQ ID NO: 91, one or more of the amino acids at positions 1, 26, 40, 43, 44 and 64 are modified. For example, an AAV of the invention may include a viral capsid protein from AAV8, the viral capsid protein including a modified VP1 sequence, the VP1 sequence including the sequence of serine at position 1, glutamic acid at position 26, arginine at position 40, aspartic acid at position 43, serine at position 44, and lysine at position 64, wherein the amino acid positions are relative to the amino acid sequence set forth in SEQ ID NO: 91, wherein the amino acids at any one or more of positions 1, 26, 40, 43, 44 and 64 are modified relative to the corresponding wild type AAV8VP1 sequence. In some examples, no other amino acids other than those at any one or more of positions 1, 26, 40, 43, 44, and 64 are modified relative to the corresponding wild type AAV8VP1 sequence.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91, amino acids at any two, three, four or five of positions 1, 26, 40, 43, 44 and 64 are modified.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91, amino acids at any two or more of positions 1, 26, 40, 43, 44 and 64 are modified. For example, relative to SEQ ID NO: 91, the modified VP1 sequence may include two or more modifications selected from A1S, a26E, Q40R, K43D, a44S, and Q64K.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91 at any three or more of positions 1, 26, 40, 43, 44 and 64 of the corresponding wild type AAV8VP 1. For example, relative to SEQ ID NO: 91, the modified VP1 sequence may include three or more modifications selected from A1S, a26E, Q40R, K43D, a44S, and Q64K.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91, amino acids at any four or more of positions 1, 26, 40, 43, 44 and 64 are modified. For example, relative to SEQ ID NO: 91, the modified VP1 sequence may include four or more modifications selected from A1S, a26E, Q40R, K43D, a44S, and Q64K.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91 at any five or more of positions 1, 26, 40, 43, 44 and 64 of the corresponding wild type AAV8VP 1. For example, relative to SEQ ID NO: 91, the modified VP1 sequence may include five or more modifications selected from A1S, a26E, Q40R, K43D, a44S, and Q64K.

In one example, the AAV described herein may include a viral capsid protein from AAV8 having a modified VP1 sequence, wherein the viral capsid protein has a sequence that is complementary to SEQ ID NO: 91 at positions 1, 26, 40, 43, 44 and 64 of the corresponding wild type AAV8VP 1. For example, relative to SEQ ID NO: 91, the modified VP1 sequence may include the following modifications: A1S, a26E, Q40R, K43D, a44S, and Q64K. For example, the modified AAV8VP1 sequence may include SEQ ID NO: 92, or a pharmaceutically acceptable salt thereof. For example, relative to SEQ ID NO: 93, residues at positions 42, 67, 81, 84, 85 and 105 are modified (e.g., a42S, a67E, Q81R, K84D, a85S and Q105K are modified relative to the sequence shown in SEQ ID NO: 93). According to this example, an AAV of the invention may include a viral capsid protein from AAV8, the viral capsid protein comprising the amino acid sequence set forth in SEQ ID NO: 94, modified VP1 sequence shown in seq id no.

In each of the above examples, the viral capsid protein may include subunit 2(VP2) and subunit 3(VP3) sequences from the same AAV serotype as modified VP 1. Preferably VP1, VP1 and VP3 are expressed from the same ORF.

The AAV genome includes a replication (Rep) gene, which is a protein encoded by a virus that plays a role in replication of the viral genome. Thus, in one example, an AAV described herein includes at least one large AAV Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40. In one example, the AAV described herein includes Rep78 and Rep 52. In one example, the AAV described herein includes Rep78 and Rep 40. In one example, the AAV described herein includes Rep68 and Rep 52. In one example, the AAV described herein includes Rep68 and Rep 40. In one example, the AAV described herein includes Rep78, Rep68, Rep52, and Rep 40. In each of the above examples, the corresponding small and large Rep proteins may be from the same AAV serotype as the viral capsid proteins. Alternatively, each of the small and large Rep proteins can be from an AAV serotype different from the viral capsid proteins, e.g., the Rep proteins can be from AAV 2.

As described herein, AAV can be used as a delivery system in gene therapy. For example, an AAV may include a polynucleotide that encodes a protein or RNA of interest. As described herein, the AAV of the present invention includes a polynucleotide sequence comprising a ddRNAi construct and a PABPN1 construct. The polynucleotides encoding the ddRNAi construct and the PABPN1 construct may be flanked by AAV Inverted Terminal Repeat (ITR) sequences. In one example, the AAV ITR sequences are from the same serotype as the viral capsid protein. In another example, the AAV ITR sequences are from a serotype different from the viral capsid protein. In a particular example, the ITR sequence is from AAV serotype 2. In another specific example, the ITR sequence is from AAV serotype 2 and comprises SEQ ID NO: 91 and/or SEQ ID NO: 92.

As noted above, polynucleotides encoding a protein or RNA of interest, including flanking ITRs, are typically 5,000 nucleotides (nt) or less in length. However, polynucleotides encoding oversized DNA, i.e., greater than 5,000nt in length, are also contemplated. Oversized DNA is herein understood to be DNA exceeding the maximum AAV packaging limit of 5 kbp. Thus, it is also possible that the AAV of the invention is capable of expressing proteins or RNAs that are typically encoded by a genome of greater than 5.0 kb.

As described herein, the AAV of the present invention also includes a polynucleotide sequence incorporated into its genome, the polynucleotide sequence comprising a ddRNAi construct and a PABPN1 construct for expression in a mammalian cell. Exemplary ddRNAi constructs and PABPN1 constructs are described herein (e.g., under the subheading "ddRNAi construct") and should be considered as applicable mutatis mutandis to the examples describing the AAV of the invention, unless specifically noted otherwise. In this regard, an AAV of the invention can comprise a polynucleotide comprising a ddRNAi construct encoding any one or more of the herein-described shrimrs designated shrimr 2-shrimr 7, shrimr 9, shrimr 11, or shrimr 13-shrimr 17. However, in particular examples, an AAV of the invention can include a polynucleotide comprising a ddRNAi construct encoding shrir 13 and/or shrir 17, and a polynucleotide construct comprising a sequence encoding a functional PABPN1 protein, the functional PABPN1 protein being codon optimized such that its mRNA transcript is not targeted by the shrir of the ddRNAi construct (e.g., the sequence shown in SEQ ID NO: 73). Exemplary ddRNAi constructs encoding shmiR13 and shmiR17 are described and contemplated herein.

In one particular example, the AAV comprises: (a) a viral capsid protein from AAV9, comprising the amino acid sequence set forth relative to SEQ ID NO: 87 has a modified VP1 sequence that modifies A1S, A26E, Q40R, K43D, and A44S (e.g., a modified VP1 sequence that includes the sequence shown in SEQ ID NO: 88); and (b) a polynucleotide sequence comprising (i) a ddRNAi construct comprising a nucleic acid comprising a sequence encoding shmiR13 as described herein and shmiR17 as described herein; and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein having an mRNA transcript that is not targeted by the shmiR encoded by the ddRNAi construct (e.g., the codon optimized sequence shown in SEQ ID NO: 73). (b) The polynucleotide of (a) may be flanked by AAV Inverted Terminal Repeat (ITR) sequences from AAV2, such as SEQ ID NO: 95 and SEQ ID NO: as shown at 96. In some embodiments, the ddRNAi construct comprises a nucleic acid sequence encoding a polypeptide comprising SEQ ID NO: 31 and a DNA sequence of shrmir having an effector sequence shown in SEQ ID NO: 31, e.g., SEQ ID NO: 30(shmiR13) or a nucleic acid consisting of the same, and a nucleic acid comprising a DNA sequence encoding a shmiR comprising the sequence set forth in SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39, such as SEQ ID NO: 38(shmiR17) or a nucleic acid consisting of the same. For example, a ddRNAi construct according to this example may include a nucleotide sequence comprising SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In another specific example, the AAV comprises: (a) a viral capsid protein from AAV8, comprising the amino acid sequence set forth relative to SEQ ID NO: 91 has a modified VP1 sequence that modifies A1S, A26E, Q40R, K43D, A44S, and Q64K (e.g., a modified VP1 sequence that includes the sequence set forth in SEQ ID NO: 92); and (b) a polynucleotide sequence comprising (i) a ddRNAi construct comprising a nucleic acid comprising a sequence encoding shmiR13 as described herein and shmiR17 as described herein; and (ii) a PABPN1 construct comprising a nucleic acid comprising a sequence encoding a functional PABPN1 protein having an mRNA transcript that is not targeted by the shmiR encoded by the ddRNAi construct (e.g., the codon optimized sequence shown in SEQ ID NO: 73). (b) The polynucleotide of (a) may be flanked by AAV Inverted Terminal Repeat (ITR) sequences from AAV2, such as SEQ ID NO: 95 and SEQ ID NO: as shown at 96. (b) The polynucleotide of (a) may be flanked by AAV Inverted Terminal Repeat (ITR) sequences from AAV2, such as SEQ ID NO: 95 and SEQ ID NO: as shown at 96. In some embodiments, the ddRNAi construct comprises a nucleic acid sequence encoding a polypeptide comprising SEQ ID NO: 31 and a DNA sequence of shrmir having an effector sequence shown in SEQ ID NO: 31, e.g., SEQ ID NO: 30(shmiR13) or a nucleic acid consisting of the same, and a nucleic acid comprising a DNA sequence encoding a shmiR comprising the sequence set forth in SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39, such as SEQ ID NO: 38(shmiR17) or a nucleic acid consisting of the same. For example, a ddRNAi construct according to this example may include a nucleotide sequence comprising SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In each of the foregoing examples, the polynucleotides encoding the ddRNAi construct and the PABPN1 construct were operably linked to one or more promoters suitable for expression of the shrir and PABPN1 proteins in mammalian cells. In one example, the promoter can be a muscle-specific promoter. Suitable muscle-specific promoters are described herein.

The AAV of the invention may include one large AAV Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40.

In this regard, the AAV genome includes Rep genes (i.e., Rep78 and Rep52), proteins that play a role in viral genome replication. Splicing events in the Rep ORF result in the expression of 4 Rep proteins (i.e., Rep78, Rep68, Rep52, and Rep 40). However, it has been shown that unspliced mRNA encoding Rep78 and Rep52 proteins are sufficient to produce AAV vectors (vectors) in insect cells. Thus, in one example, the AAV comprises one large AAV replicating Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40. In one example, the AAV includes Rep78 and Rep 52. In one example, the AAV includes Rep78 and Rep 40. In one example, the AAV includes Rep68 and Rep 52. In one example, the AAV includes Rep68 and Rep 40. In one example, the AAV includes Rep78, Rep68, Rep52, and Rep 40. In each of the above examples, the corresponding small and large Rep proteins may be from the same AAV serotype as the viral capsid proteins. Alternatively, each of the small and large Rep proteins can be from an AAV serotype different from the viral capsid proteins, e.g., the Rep proteins can be from AAV serotype 2. In this regard, Rep sequences are particularly conserved in most serotypes, and Rep sequences have been reported to effectively cross-complement in insect cells.

Any nucleotide sequence can be incorporated for subsequent expression in mammalian cells transfected with the AAV of the invention, so long as the construct remains within the packaging capacity of the AAV virion.

As described herein, the AAV described herein may have improved function when produced in an insect cell, as compared to an AAV comprising the corresponding wild-type VP1 sequence.

Methods and reagents for production of AAV using modified VP1

Methods for producing AAV are known in the art. As described, the AAV of the invention has improved function (e.g., improved endosomal escape activity) when produced in insect cells, as compared to an AAV comprising the corresponding wild-type VP1 sequence. Thus, methods and reagents for the production of AAV in insect cells are contemplated. In some examples, insect cell-compatible vectors (vectors), i.e., baculovirus vectors (vectors), or AAV vectors that produce the invention may be used.

In one example, the invention provides various baculovirus vectors (vectors) for producing the AAV of the invention in insect cells. Various baculovirus vectors (vectors) may include:

(i) a first baculovirus vector (vector) comprising a nucleic acid molecule encoding an AAV viral capsid protein having a modified VP1 sequence as described herein; and

(ii) a second baculovirus vector (vector) comprising a polynucleotide encoding the ddRNAi construct and PABPN1 construct as described herein, flanked by AAV Inverted Terminal Repeat (ITR) sequences.

In one example, the AAV ITR sequences are from the same serotype as the viral capsid protein encoded by the nucleic acid molecule within the first baculovirus vector (vector). In another example, the AAV ITR sequences are from another AAV serotype, such as AAV 2. In some examples, the ITR sequence is from AAV serotype 2 and includes SEQ ID NO: 95 and/or SEQ ID NO: 96, respectively.

In some examples, the AAV includes capsid proteins from AAV9, which AAV9 includes modified VP1 as described herein. In other examples, the AAV includes capsid proteins from AAV8, which AAV8 includes modified VP1 as described herein. Thus, the first baculovirus vector (vector) may comprise a nucleic acid molecule encoding an AAV8 or AAV9 viral capsid protein having a modified VP1 sequence. Modified VP1 sequences of AAV, including capsid proteins from AAV9 or AAV8, have been described herein and, unless otherwise specifically indicated, should be understood as examples of the invention that apply mutatis mutandis to the description of baculovirus vectors (vectors) used to produce the AAV of the invention.

As described herein, the second baculovirus vector (vector) includes a ddRNAi construct encoding one or more shmiR targeting PABPN 1. Exemplary ddRNAi constructs encoding shrimrs (including combinations of shrimrs) targeted to PABPN1 are described herein and, unless specifically stated otherwise, should be considered as applicable mutatis mutandis to the examples of the invention describing baculovirus vectors (vectors) used to produce AAV of the invention. In a particular example, the second baculovirus vector (vector) can include a ddRNAi construct encoding shrir 13 and shrir 17, and a polynucleotide construct including a sequence encoding a functional PABPN1 protein, the functional PABPN1 protein being codon optimized such that its mRNA transcript is not targeted by the shrir of the ddRNAi construct (e.g., the sequence shown in SEQ ID NO: 73). For example, the second baculovirus vector (vector) may comprise a ddRNAi construct comprising a nucleotide sequence encoding a polypeptide comprising SEQ ID NO: 31 and a DNA sequence of shrmir having an effector sequence shown in SEQ ID NO: 31, e.g., SEQ ID NO: 30(shmiR13) or a ddRNAi construct consisting thereof, and a nucleic acid comprising a DNA sequence encoding a shmiR comprising the sequence set forth in SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39, such as SEQ ID NO: 38(shmiR17) or a nucleic acid consisting of the same. For example, the second baculovirus vector (vector) may comprise a ddRNAi construct comprising the nucleotide sequence of SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In each of the foregoing examples, the polynucleotides encoding the ddRNAi construct and the PABPN1 construct may be operably linked to a promoter. In one example, the promoter can be a muscle-specific promoter.

Similarly, a nucleic acid molecule encoding an AAV viral capsid protein may be operably linked to a promoter suitable for expression of the capsid protein in insect cells. Suitable promoters for expression in insect cells are known in the art and are contemplated for use herein. In this regard, Methods of molecular engineering and polypeptide expression in Insect cells have been described previously, for example, in Summers and Smith, handbook of Baculovirus Vectors (Vectors) and Insect Culture Methods (A Manual of Methods for Baculoviral Vectors and Insect Culture Procedures), Texas Agricultural Experimental Station Bull. No.7555, College Station, Tex. (1986); luckow, In Prokop et al, "Cloning, Expression and use of Baculovirus vector Recombinant DNA Technology In Insect Cells" (Cloning and Expression of Heterologous Genes In Insect Cells with Baculoviruses Vectors' Recombinant DNA Technology and Applications), 97-152 (1991); king, L.A and r.d. possee, baculovirus expression system (The baculoviral expression system, Chapman and Hall), United Kingdom (1992); o' Reilly, D.R., L.K.Miller, V.A Luckow, Baculovirus Expression Vectors A Laboratory Manual, New York (1992); freeman and Richardson, C.D., "Baculovirus Expression Protocols in Molecular Biology, Methods in Molecular Biology, Vol.39 (1992); U.S. Pat. nos. 4,745,051; US 2003148506; WO 2003/074714; kotin RM (2011) human molecular genetics (hum. mol. Genet.), 20(R1) R2-R6; aucoin et al, (2006) Biotechnology and bioengineering (Biotechnol. Bioeng.)95(6) 1081-1092; and van Oers et al, (2015) J.Gen.Virol 96: 6-23. Promoters and other such regulatory elements known in the art are expressly contemplated for use in the nucleic acids of the present invention. In some embodiments, the promoter is a polyhedral promoter (polyhedron promoter) or a p10 promoter.

According to the example where the first baculovirus vector (vector) does not encode AAV Rep proteins, the plurality of baculovirus vectors (vectors) further comprises:

(iii) a third baculovirus vector (vector) comprising polynucleotide sequences encoding at least one large AAV Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40.

In this regard, the AAV genome includes Rep genes (i.e., Rep78 and Rep52), proteins that play a role in viral genome replication. Splicing events in the Rep ORF result in the expression of 4 Rep proteins (i.e., Rep78, Rep68, Rep52, and Rep 40). However, it has been shown that unspliced mRNA encoding Rep78 and Rep52 proteins are sufficient to produce AAV vectors (vectors) in insect cells. Thus, in one example, a third baculovirus vector (vector) comprises a polynucleotide sequence encoding at least one large AAV replicating Rep protein selected from Rep78 and Rep68 and at least one small AAV Rep protein selected from Rep52 and Rep 40. In one example, a third baculovirus vector (vector) comprises a polynucleotide sequence encoding Rep78 and Rep 52. In one example, a third baculovirus vector (vector) comprises a polynucleotide sequence encoding Rep78 and Rep 40. In one example, a third baculovirus vector (vector) comprises a polynucleotide sequence encoding Rep68 and Rep 52. In one example, a third baculovirus vector (vector) comprises a polynucleotide sequence encoding Rep68 and Rep 40. In one example, a third baculovirus vector (vector) comprises polynucleotide sequences encoding Rep78, Rep68, Rep52 and Rep 40. In each of the above examples, the corresponding small and large Rep proteins may be from the same AAV serotype as the viral capsid proteins. Alternatively, each of the small and large Rep proteins can be from an AAV serotype different from the viral capsid proteins, e.g., the Rep proteins can be from AAV serotype 2. In this regard, Rep sequences are particularly conserved in most serotypes, and Rep sequences have been reported to effectively cross-complement in insect cells.

In each of the foregoing embodiments describing a plurality of baculovirus vectors (vectors), the polynucleotide sequence encoding the Rep protein within the third baculovirus vector (vector) can be operably linked to a promoter for expression of the Rep protein in insect cells. Suitable promoters for expression in insect cells are known in the art and are contemplated for use herein. In a specific example, the promoter may be, for example, a polyhedral promoter or a p10 promoter. The nucleotide sequences encoding each Rep protein may be operably linked to the same promoter. Alternatively, each sequence encoding a Rep protein may be operably linked to its own promoter.

At least one of the plurality of baculovirus vectors (vectors) will comprise a polynucleotide encoding an assembly-activating protein (AAP) required for AAV capsid assembly. In one example, a baculovirus vector (vector) encoding a capsid protein comprises a polynucleotide encoding an AAP. In an alternative example, a baculovirus encoding a Rep protein and/or a baculovirus encoding a ddRNAi construct and a PABPN1 construct includes a polynucleotide encoding an AAP.

Methods of producing AAV suitable for gene therapy (e.g., incapable of replicating AAV) are well known in the art and are contemplated herein. For example, AAV can be produced in insect cells using a baculovirus system, e.g., such asUS20120028357 A1、WO2007046703、US20030148506 A1,WO2017184879、US20040197895A1 and WO2007148971, the contents of which are incorporated herein by reference. Recombinant AAV can also be produced in mammalian cells (adherent and suspension cells), methods of which are described in WO2015031686, WO2009097129, WO2007127264, WO1997009441 and WO2001049829, the contents of which are incorporated herein by reference. Methods for producing recombinant AAV for gene therapy are also described in Berns KI and Giraud C (1996) adeno-associated Virus Biology (Biology of adeno-associated virus.) Curr Top Microbiol Immunol 218:1-23, Snyder and Flote (2002) Curr. Opin. Biotechnol., 13: 418-423, and Synder RO and Moullier P, adeno-associated Virus: methods and Experimental guidelines the contents of which are incorporated herein by reference (Adeno-associated viruses; methods and protocols).

ddRNAi constructs

As described herein, the AAV of the present invention includes a DNA-directed rnai (ddrnai) construct comprising a DNA sequence encoding a short hairpin microrna (shrmir). The shmiR encoded by the ddRNAi construct includes:

an effector sequence of at least 17 nucleotides in length;

an effector complement sequence;

a stem-loop sequence; and

primary microrna (pri-miRNA) backbone.

In one example, the effector sequence is identical to SEQ ID NO: 1-13 is substantially complementary to a region of corresponding length in an RNA transcript. Preferably, the effector sequence is less than 30 nucleotides in length. For example, suitable effector sequences may range in length from 17-29 nucleotides. In a particularly preferred embodiment, the effector sequence is 21 nucleotides in length. More preferably, the effector sequence is 21 nucleotides in length and the effector complement sequence is 20 nucleotides in length.

In certain embodiments, the shrir encoded by the ddRNAi construct comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the amino acid sequence of SEQ ID NO: 1-13 (i.e. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13) or consist of a sequence as shown in any one thereof. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 1-13 or a sequence represented by any one of SEQ ID NOs: 1-13, and contains 4 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 1-13 or a sequence represented by any one of SEQ ID NOs: 1-13, and contains 3 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 1-13 or a sequence represented by any one of SEQ ID NOs: 1-13, and 2 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 1-13 or a sequence represented by any one of SEQ ID NOs: 1-13, and contains 1 mismatched base relative to the RNA transcript. For example, the effector sequence may be identical to a sequence comprising SEQ ID NO: 1-13 or a sequence represented by any one of SEQ ID NOs: 1-13 is 100% complementary to a region of corresponding length in an RNA transcript consisting of the sequence set forth in any one of claims 1-13.

In one example, the shrir encoded by the ddRNAi construct includes an effector sequence substantially complementary to a region of corresponding length in an RNA transcript including the amino acid sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and (c) the sequence shown in (b). The shmiR according to this example is also referred to herein as "shmiR 13". For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and contains 4 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and contains 3 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and 2 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and contains 1 mismatched base relative to the RNA transcript. For example, the effector sequence may be identical to a sequence comprising SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9 is 100% complementary to a region of corresponding length in an RNA transcript.

In one example, the shrir encoded by the ddRNAi construct includes an effector sequence substantially complementary to a region of corresponding length in an RNA transcript including the amino acid sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and (c) the sequence shown in figure 13. The shmiR according to this example is also referred to herein as "shmiR 17". For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and contains 4 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and contains 3 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and 2 mismatched bases relative to the RNA transcript. For example, the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript that includes the sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and contains 1 mismatched base relative to the RNA transcript. For example, the effector sequence may be identical to a sequence comprising SEQ ID NO: 13 or a sequence represented by SEQ ID NO: 13 is 100% complementary to a region of corresponding length in an RNA transcript.

According to one example, wherein the effector sequence of the shmiR is substantially complementary to a region of corresponding length in the PABPN1 miRNA transcript described herein and comprises 1, 2, 3, or 4 mismatched bases relative thereto, preferably the mismatch is not located within the region corresponding to the shmiR seed region, i.e., nucleotides 2-8 of the effector sequence.

In some examples, the ddRNAi construct can include a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 14, provided that the effector sequence is capable of hybridizing to the sequence set forth in SEQ ID NO: 14 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 15 and an effector sequence substantially identical to SEQ ID NO: 15 and is capable of forming a duplex therewith. And SEQ ID NO: 15 can be SEQ ID NO: 14, and (b) a sequence shown in (b). The shmiR according to the present example is hereinafter referred to as "shmiR 2".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 16, provided that the effector sequence is capable of hybridizing to the sequence set forth in SEQ ID NO: 16 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 17 and an effector sequence substantially identical to SEQ ID NO: 17 and an effector complement sequence substantially complementary to and capable of forming a duplex therewith. And SEQ ID NO: 17 can be the effector complement sequence substantially complementary to the sequence set forth in SEQ ID NO: 16, or a variant thereof. The shmiR according to the present example is hereinafter referred to as "shmiR 3".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 18, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 18 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 19 and an effector sequence substantially identical to SEQ ID NO: 19 and an effector complement sequence substantially complementary to and capable of forming a duplex therewith. And SEQ ID NO: 19 can be SEQ ID NO: 18, or a fragment thereof. The shmiR according to the present example is hereinafter referred to as "shmiR 4".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 20, provided that the effector sequence is capable of hybridizing to the sequence set forth in SEQ ID NO: 20 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 21 and an effector sequence substantially identical to SEQ ID NO: 21 and an effector complement sequence substantially complementary to and capable of forming a duplex therewith. And SEQ ID NO: the effector complement sequence substantially complementary to the sequence set forth in SEQ ID NO: 20, and (b) 20. The shmiR according to the present example is hereinafter referred to as "shmiR 5".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 22, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 22 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 23 and an effector sequence substantially identical to SEQ ID NO: 23 and is capable of forming a duplex therewith. And SEQ ID NO: the effector-complementary sequence substantially complementary to the sequence depicted in fig. 23 may be SEQ ID NO: 22, and (b) a sequence shown in figure 22. The shmiR according to the present example is hereinafter referred to as "shmiR 6".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 24, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 24 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 25 and an effector sequence substantially identical to SEQ ID NO: 25 and is capable of forming a duplex therewith. And SEQ ID NO: 25 can be SEQ ID NO: 24, or a fragment thereof. The shmiR according to the present example is hereinafter referred to as "shmiR 7".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 26, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 26 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 27 and an effector sequence substantially identical to SEQ ID NO: 27 and is capable of forming a duplex with an effector complement sequence. And SEQ ID NO: the effector-complementary sequence substantially complementary to the sequence shown in SEQ ID NO: 26, and (b) a sequence shown in 26. The shmiR according to the present example is hereinafter referred to as "shmiR 9".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 28, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 28 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 29 and an effector sequence substantially identical to SEQ ID NO: 29 and is capable of forming a duplex therewith. And SEQ ID NO: 29 can be the effector complement sequence substantially complementary to the sequence set forth in SEQ ID NO: 28, and (b) the sequence shown in 28. The shmiR according to the present example is hereinafter referred to as "shmiR 11".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 30, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 30 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 31 and an effector sequence substantially identical to SEQ ID NO: 31 and an effector complement sequence capable of forming a duplex therewith. And SEQ ID NO: 31 can be SEQ ID NO: 30, and (b) a sequence shown in (b). The shmiR according to the present example is hereinafter referred to as "shmiR 13".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 32, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 32 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 33 and an effector sequence substantially identical to SEQ ID NO: 33 and an effector complement sequence substantially complementary to and capable of forming a duplex therewith. And SEQ ID NO: 33 may be SEQ ID NO: 32, and (b) the sequence shown in (b). The shmiR according to the present example is hereinafter referred to as "shmiR 14".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 34, provided that the effector sequence is capable of hybridizing to the sequence set forth in SEQ ID NO: 34 form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 35 and an effector sequence substantially identical to SEQ ID NO: 35 and an effector complement sequence capable of forming a duplex therewith. And SEQ ID NO: 35 may be SEQ ID NO: 34, and (b) a sequence shown in the specification. The shmiR according to the present example is hereinafter referred to as "shmiR 15".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 36, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 36 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 37 and an effector sequence substantially identical to SEQ ID NO: 37 and an effector complement sequence capable of forming a duplex therewith. And SEQ ID NO: 37 can be SEQ ID NO: 36, and (b) the sequence shown in (b). The shmiR according to the present example is hereinafter referred to as "shmiR 16".

In one example, the ddRNAi construct can comprise a DNA sequence encoding a shrir comprising: (i) other than 1, 2, 3 or 4 base mismatches to SEQ ID NO: 38, provided that the effector sequence is capable of hybridizing to the effector sequence of SEQ ID NO: 38 to form a duplex; and (ii) an effector-complementary sequence comprising a sequence substantially complementary to the effector sequence. For example, the shrir encoded by the ddRNAi construct can include SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39 and is capable of forming a duplex therewith. And SEQ ID NO: 39 may be SEQ ID NO: 38, and (b) a sequence shown in figure 38. The shmiR according to the present example is hereinafter referred to as "shmiR 17".

In any of the examples described herein, the shrir encoded by a ddRNAi construct of the invention can comprise in the 5 'to 3' direction:

the 5' flanking sequence of the pri-miRNA backbone;

an effector complement sequence;

a stem-loop sequence;

an effector sequence; and

the 3' flanking sequence of the pri-miRNA backbone.

In any of the examples described herein, the shrir encoded by a ddRNAi construct of the invention can comprise in the 5 'to 3' direction:

the 5' flanking sequence of the pri-miRNA backbone;

an effector sequence;

a stem-loop sequence;

an effector complement sequence; and

the 3' flanking sequence of the pri-miRNA backbone.

Suitable loop sequences may be selected from those known in the art. However, exemplary stem-loop sequences are set forth in SEQ ID NO: shown at 40.

Suitable primary microRNA (pri-miRNA or pri-R) backbones for nucleic acids of the invention may be selected from those known in the art. For example, the pri-miRNA scaffold can be selected from the pri-miR-30a scaffold, the pri-miR-155 scaffold, the pri-miR-21 scaffold, and the pri-miR-136 scaffold. Preferably, however, the pri-miRNA backbone is a pri-miR-30a backbone. According to the example where the pri-miRNA backbone is a pri-miR-30a backbone, the 5' flanking sequence of the pri-miRNA backbone is set forth in SEQ ID NO: 41, the 3' flanking sequence of the pri-miRNA backbone is shown in SEQ ID NO: shown at 42. Thus, a ddRNAi construct encoding a shrir of the invention (e.g., one or more of shrir 2-shrir 7, shrir 9, shrir 11, and shrir 13-shrir 17 described herein) can comprise a nucleic acid sequence encoding SEQ ID NO: 41 and a DNA sequence encoding the sequence shown in SEQ ID NO: 42, or a DNA sequence of the sequence shown in 42.

In one example, the ddRNAi construct can include a nucleotide sequence selected from SEQ ID NOs: 56-68.

In one example, the ddRNAi construct comprises SEQ ID NO: 56 or the DNA sequence represented by SEQ ID NO: 56 and encodes a DNA sequence comprising SEQ ID NO: 43 or the sequence represented by SEQ ID NO: 43 (shmiR 2).

In one example, the ddRNAi construct comprises SEQ ID NO: 57 or a DNA sequence represented by SEQ ID NO: 57 and encodes a DNA sequence comprising SEQ ID NO: 44 or the sequence represented by SEQ ID NO: 44 (shmiR 3).

In one example, the ddRNAi construct comprises SEQ ID NO: 58 or the DNA sequence represented by SEQ ID NO: 58 and encodes a DNA sequence comprising SEQ ID NO: 45 or the sequence represented by SEQ ID NO: 45 (shmiR 4).

In one example, the ddRNAi construct comprises SEQ ID NO: 59 or the DNA sequence represented by SEQ ID NO: 59 and encoding a DNA sequence comprising the sequence set forth in SEQ ID NO: 46 or the sequence represented by SEQ ID NO: 46 (shmiR 5).

In one example, the ddRNAi construct comprises SEQ ID NO: 60 or the DNA sequence represented by SEQ ID NO: 60 and encodes a DNA sequence comprising SEQ ID NO: 47 or the sequence represented by SEQ ID NO: 47 (shmiR 6).

In one example, the ddRNAi construct comprises SEQ ID NO: 61 or the DNA sequence represented by SEQ ID NO: 61 and encodes a DNA sequence comprising SEQ ID NO: 48 or the sequence represented by SEQ ID NO: 48 (shmiR 7).

In one example, the ddRNAi construct comprises SEQ ID NO: 62 or the DNA sequence set forth by SEQ ID NO: 62 and encodes a DNA sequence comprising SEQ ID NO: 49 or the sequence represented by SEQ ID NO: 49 (shmiR 9).

In one example, the ddRNAi construct comprises SEQ ID NO: 63 or the DNA sequence represented by SEQ ID NO: 63 and encodes a DNA sequence comprising SEQ ID NO: 50 or the sequence represented by SEQ ID NO: 50 (shmiR 11).

In one example, the ddRNAi construct comprises SEQ ID NO: 64 or the DNA sequence represented by SEQ ID NO: 64 and encodes a DNA sequence comprising SEQ ID NO: 51 or the sequence represented by SEQ ID NO: 51 (shmiR 13).

In one example, the ddRNAi construct comprises SEQ ID NO: 65 or the DNA sequence represented by SEQ ID NO: 65 and encodes a DNA sequence comprising SEQ ID NO: 52 or the sequence represented by SEQ ID NO: 52 (shmiR 14).

In one example, the ddRNAi construct comprises SEQ ID NO: 66 or the DNA sequence represented by SEQ ID NO: 66 and encodes a DNA sequence comprising SEQ ID NO: 53 or the sequence represented by SEQ ID NO: 53 (shmiR 15).

In one example, the ddRNAi construct comprises SEQ ID NO: 67 or the DNA sequence represented by SEQ ID NO: 67 and encodes a DNA sequence comprising SEQ ID NO: 54 or the sequence represented by SEQ ID NO: 54 (shmiR 16).

In one example, the ddRNAi construct comprises SEQ ID NO: 68 or the DNA sequence represented by SEQ ID NO: 68 and encodes a DNA sequence comprising SEQ ID NO: 55 or the sequence represented by SEQ ID NO: 55 (shmiR 17).

Exemplary ddRNAi constructs of the invention encode one or more shmirs selected from the group consisting of shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14, and shmiR17 described herein. Particularly preferred are ddRNAi constructs encoding one or more of the herein described shmirs selected from the group consisting of shmiR3, shmiR13, shmiR14, and shmiR 17. For example, the ddRNAi construct can encode shrir 13 as described herein. For example, the ddRNAi construct can encode shrir 17 as described herein.

It will be appreciated by those skilled in the art that the ddRNAi constructs described herein can encode multiple shmis that target RNA transcripts corresponding to PABPN1 protein that result in OPMD.

Thus, in one example, a ddRNAi construct comprises two or more nucleic acids encoding a shrmir described herein, e.g., two, or three, or four, or five, or six, or seven, or eight, or nine, or ten nucleic acids encoding a shrmir described herein.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR2 and a DNA sequence encoding shmiR2 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR2 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 56 or the DNA sequence represented by SEQ ID NO: 56, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 43 or the sequence represented by SEQ ID NO: 43 and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 56(shmiR2) or a DNA sequence represented by SEQ ID NO: 56(shmiR2), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR3-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR17 or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR3-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR3 and a DNA sequence encoding shmiR3 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR3 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 57 or a DNA sequence represented by SEQ ID NO: 57, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 44 or the sequence represented by SEQ ID NO: 44, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR3), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR4-shmiR7, shmiR9, shmiR11, or shmiR13-shmiR17, or any shRNA corresponding thereto.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR4 and a DNA sequence encoding shmiR4 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR4 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 58 or the DNA sequence represented by SEQ ID NO: 58, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 45 or the sequence represented by SEQ ID NO: 45, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 58(shmiR4) or a DNA sequence represented by SEQ ID NO: 58(shmiR4), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR3, shmiR5-shmiR7, shmiR9, shmiR11, or shmiR13-shmiR17, or any of its corresponding shrnas.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR5 and a DNA sequence encoding shmiR5 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR5 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 59 or the DNA sequence represented by SEQ ID NO: 59, and encoding a DNA sequence comprising SEQ ID NO: 46 or the sequence represented by SEQ ID NO: 46, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 59(shmiR5) or a DNA sequence represented by SEQ ID NO: 59(shmiR5), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR4, shmiR6-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR17 or any corresponding shRNA thereof.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR6 and a DNA sequence encoding shmiR6 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR6 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 60 or the DNA sequence represented by SEQ ID NO: 60, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 47 or the sequence represented by SEQ ID NO: 47, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 60(shmiR6) or a DNA sequence represented by SEQ ID NO: 60(shmiR6), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2, shmiR5-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR17 or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR2, shmiR5-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR7 and a DNA sequence encoding shmiR7 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR7 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 61 or the DNA sequence represented by SEQ ID NO: 61, and encoding a DNA sequence comprising SEQ ID NO: 48 or the sequence represented by SEQ ID NO: 48, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 61(shmiR7) or a DNA sequence represented by SEQ ID NO: 61(shmiR7), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR6, shmiR9, shmiR11 or shmiR13-shmiR17 or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR6, shmiR9, shmiR11 or shmiR13-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR9 and a DNA sequence encoding shmiR9 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR9 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 62 or the DNA sequence set forth by SEQ ID NO: 62, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 49 or the sequence represented by SEQ ID NO: 49 and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 62(shmiR9) or a DNA sequence represented by SEQ ID NO: 62(shmiR9), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR11 or shmiR13-shmiR17, or any corresponding shRNA thereof, or a DNA sequence encoding one of shmiR2-shmiR7, shmiR11 or shmiR13-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR11 and a DNA sequence encoding shmiR11 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR11 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 63 or the DNA sequence represented by SEQ ID NO: 63, and a DNA sequence encoding a polypeptide comprising the sequence set forth in SEQ ID NO: 50 or the sequence represented by SEQ ID NO: 50, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 63(shmiR11) or a DNA sequence represented by SEQ ID NO: 63(shmiR11), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9 or shmiR13-shmiR17, or any corresponding shRNA thereof, or a DNA sequence encoding one of shmiR2-shmiR7, shmiR9 or shmiR13-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR13 and a DNA sequence encoding shmiR13 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR13 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 64 or the DNA sequence represented by SEQ ID NO: 64, and a nucleic acid sequence encoding a polypeptide comprising the sequence set forth in SEQ ID NO: 51 or the sequence represented by SEQ ID NO: 51, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR14-shmiR17, or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR14-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR14 and a DNA sequence encoding shmiR14 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR14 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 65 or the DNA sequence represented by SEQ ID NO: 65, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 52 or the sequence represented by SEQ ID NO: 52, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR14), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13, shmiR15-shmiR17 or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13, shmiR15-shmiR 17.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR15 and a DNA sequence encoding shmiR15 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR15 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 66 or the DNA sequence represented by SEQ ID NO: 66, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 53 or the sequence represented by SEQ ID NO: 53 and at least one other nucleic acid of the invention encodes a shrir that targets a region of the PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 66(shmiR15) or a DNA sequence represented by SEQ ID NO: 66(shmiR15), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR14 or shmiR16-shmiR17, or any corresponding shRNA thereof.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR16 and a DNA sequence encoding shmiR16 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR16 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 67 or the DNA sequence represented by SEQ ID NO: 67, and encoding a DNA sequence comprising SEQ ID NO: 54 or the sequence represented by SEQ ID NO: 54, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 67(shmiR16) or a DNA sequence represented by SEQ ID NO: 67(shmiR16), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR15, or shmiR17 or any of its corresponding shrnas.

In one example, the ddRNAi construct comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR17 and a DNA sequence encoding shmiR17 and at least one other nucleic acid of the invention encoding a shmiR that targets a region of a PABPN1mRNA transcript. Exemplary nucleic acids encoding shmiR17 are described herein and should be adapted mutatis mutandis to the present examples of the invention. In one example, a ddRNAi construct comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 68 or the DNA sequence represented by SEQ ID NO: 68, and a DNA sequence encoding a polypeptide comprising SEQ ID NO: 55 or the sequence represented by SEQ ID NO: 55, and at least one other nucleic acid of the invention encodes a shrir that targets a region of a PABPN1mRNA transcript. For example, a ddRNAi construct can include (i) a nucleic acid sequence comprising SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR17), and (ii) a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR16 or any corresponding shRNA thereof, or a nucleic acid comprising a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiR11 or shmiR13-shmiR 16.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 1 or a sequence represented by SEQ ID NO: 1. Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 1 or a sequence represented by SEQ ID NO: 1, are substantially complementary to regions of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 2 or a sequence represented by SEQ ID NO: 2, or a sequence shown in the sequence table 2. Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 2 or a sequence represented by SEQ ID NO: 2, are substantially complementary to regions of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 4 or the sequence represented by SEQ ID NO: 4, and (b) the sequence shown in (4). Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 4 or a sequence represented by SEQ ID NO: 4 is substantially complementary to a region of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 7 or a sequence represented by SEQ ID NO: 7. Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 7 or a sequence represented by SEQ ID NO: 7 is substantially complementary to a region of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 9 or a sequence represented by SEQ ID NO: 9, and (c) the sequence shown in (b). Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 9 or a sequence represented by SEQ ID NO: 9 is substantially complementary to a region of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 10 or a sequence represented by SEQ ID NO: 10, or a sequence represented by seq id no. Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 10 or a sequence represented by SEQ ID NO: 10 is substantially complementary to a region of corresponding length in an RNA transcript.

According to one example wherein the ddRNAi construct encodes a plurality of shrimrs, at least one of the shrimrs comprises an effector sequence substantially complementary to a region of corresponding length in an RNA transcript comprising the nucleic acid sequence of SEQ ID NO: 13 or the sequence represented by SEQ ID NO: 13, and (c) the sequence shown in figure 13. Suitable nucleic acids encoding shrimrs with effector sequences that are complementary to the nucleic acid sequences comprising SEQ ID NOs: 13 or a sequence represented by SEQ ID NO: 13 is substantially complementary to a region of corresponding length in an RNA transcript.

Exemplary ddRNAi constructs of multiple shrimrs of the invention comprise at least two nucleic acids, each nucleic acid comprising a DNA sequence encoding a shrmir of the invention, wherein each shrimr comprises a different effector sequence.

In one example, the nucleic acid sequence encoded in at least two nucleic acids comprises a nucleotide sequence identical to SEQ ID NO: 1. 2, 4,7, 9, 10 and 13, a region of corresponding length in an RNA transcript substantially complementary to the shrir of the effector sequence. Described herein are exemplary nucleic acids of the invention encoding shrimrs comprising an effector sequence that is complementary to SEQ ID NO: 1. 2, 4,7, 9, 10 and 13, and should be adapted mutatis mutandis to the present example of the invention.

In one example, the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 15 and the effector sequence shown in SEQ ID NO: 14, for example comprising SEQ ID NO: 56(shmiR2) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16, for example, comprising SEQ ID NO: 57(shmiR3) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 21 and the effector sequence shown in SEQ ID NO: 20, for example comprising SEQ ID NO: 59(shmiR5) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 27 and the effector sequence shown in SEQ ID NO: 26, for example, comprising SEQ ID NO: 62(shmiR9) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, for example comprising SEQ ID NO: 64(shmiR13) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32, for example comprising SEQ ID NO: 65(shmiR14) or a nucleic acid consisting of the same; and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 39 and SEQ ID NO: 38, e.g., comprising SEQ ID NO: 68(shmiR17) or a nucleic acid consisting of the same.

In one example, each of the at least two nucleic acids in the ddRNAi construct encodes a polypeptide comprising an amino acid sequence identical to SEQ ID NO: 2. 9, 10 and 13, or a region of substantially complementary length in the RNA transcript. Described herein are exemplary nucleic acids encoding shrimrs that include effector sequences that are complementary to SEQ ID NOs: 2. regions of corresponding length in the RNA transcripts shown at 9, 10 and 13 are substantially complementary and should be adapted to the present example of the invention mutatis mutandis.

In one example, the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of:

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16, for example, comprising SEQ ID NO: 57(shmiR3) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, for example comprising SEQ ID NO: 64(shmiR13) or a nucleic acid consisting of the same;

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32, for example comprising SEQ ID NO: 65(shmiR14) or a nucleic acid consisting of the same; and

a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 39 and SEQ ID NO: 38, e.g., comprising SEQ ID NO: 68(shmiR17) or a nucleic acid consisting of the same.

In one example, the ddRNAi construct comprises a nucleic acid encoding a shrir comprising a sequence identical to SEQ ID NO: 9, and a nucleic acid encoding a shrir comprising an effector sequence substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 13 in the RNA transcript, wherein the regions of corresponding length are substantially complementary effector sequences. For example, ddRNAi constructs may include:

(a) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 31 and the effector sequence shown in SEQ ID NO: 30, for example comprising SEQ ID NO: 64(shmiR13) or a nucleic acid consisting of the same; and

(b) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 39 and SEQ ID NO: 38, e.g., comprising SEQ ID NO: 68(shmiR17) or a nucleic acid consisting of the same.

Exemplary ddRNAi constructs of the invention include a nucleic acid sequence comprising SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13) and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

In one example, the ddRNAi construct comprises a nucleic acid encoding a shrir comprising a sequence identical to SEQ ID NO: 2, and a nucleic acid encoding a shrir comprising an effector sequence substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 10, wherein the regions of corresponding length in the RNA transcript are substantially complementary effector sequences. For example, ddRNAi constructs may include:

(a) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 17 and the effector sequence shown in SEQ ID NO: 16, for example, comprising SEQ ID NO: 57(shmiR3) or a nucleic acid consisting of the same; and

(b) a nucleic acid comprising or consisting of a DNA sequence encoding a shrmir comprising SEQ ID NO: 33 and the effector sequence shown in SEQ ID NO: 32, e.g., comprising SEQ ID NO: 65(shmiR14) or a nucleic acid consisting of the same.

Exemplary ddRNAi constructs of the invention include a nucleic acid sequence comprising SEQ ID NO: 57(shmiR3) or a DNA sequence represented by SEQ ID NO: 57(shmiR3) and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 65(shmiR14) or a DNA sequence represented by SEQ ID NO: 65(shmiR 14).

According to examples of the ddRNAi constructs of the invention encoding two or more shrimds, two or more of the nucleic acids encoding the shrimds can form separate portions of the same polynucleotide in the ddRNAi construct.

In some examples, the or each nucleic acid encoding a shrir can include, or be operably linked to, additional elements, e.g., to promote transcription of the shrir. For example, a ddRNAi construct can include one or more promoters operably linked to a sequence encoding a shrir described herein. Other elements, such as transcription terminators and initiators, are known in the art and/or described herein.

In each of the foregoing examples describing ddRNAi constructs of the present disclosure, the or each nucleic acid encoding shrir is operably linked to a promoter. For example, a ddRNAi construct as described herein can include a single promoter operably linked to the or each nucleic acid encoding a shrir included therein, e.g., to drive expression of one or more shrirs from the ddRNAi construct. In another example, each nucleic acid encoding a shmiR included in a ddRNAi construct is operably linked to a separate promoter.

Depending on the example where multiple promoters are present, the promoters may be the same or different. For example, a construct may comprise multiple copies of the same promoter, each copy being operably linked to a different nucleic acid of the invention. In another example, each promoter operably linked to a nucleic acid encoding a shrmir of the invention is different. For example, in a ddRNAi construct encoding two shmirs, each of the two nucleic acids encoding the shmirs is operably linked to a different promoter.

In one example, the promoter is a constitutive promoter. The term "constitutive" when referring to a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a particular stimulus (e.g., heat shock, chemicals, light, etc.). In general, a constitutive promoter is capable of directing expression of a coding sequence in essentially any cell and any tissue. Promoters for transcription of the shmiR include ubiquitin, CMV, β -actin, histone H4, EF-1 α, or the promoter of the pgk gene under the control of RNA polymerase II, or a promoter element under the control of RNA polymerase I.

In one example, Pol II promoters such as CMV, SV40, U1, β -actin or hybrid Pol II promoters are used. Other suitable Pol II promoters are known in the art and may be used in accordance with this example of the invention. For example, in ddRNAi constructs of the invention expressing pri-mirnas, a Pol II promoter system may be preferred, the pri-miRNA being processed to one or more shmirs under the action of the enzymes Drosha and Pasha. In ddRNAi constructs of the invention comprising sequences encoding multiple shmirs under the control of a single promoter, Pol II promoter systems may also be preferred. Pol II promoter systems may also be desirable where tissue specificity is desired.

In another example, promoters controlled by RNA polymerase III are used, such as the U6 promoter (U6-1, U6-8, U6-9), the H1 promoter, the 7SL promoter, the human Y promoter (hY1, hY3, hY4 (see Maraia et al, Nucleic Acids Res 22 (15): 3045-52(1994)) and hY5 (see Maraia et al, Nucleic Acids Res 24 (18): 3552-59(1994)), the human MRP-7-2 promoter, the adenovirus VA1 promoter, the human tRNA promoter, or the 5s ribosomal RNA promoter.

Suitable promoters for use in the ddRNAi constructs of the present invention are described in U.S. Pat. No. 8,008,468 and U.S. Pat. No. 8,129,510.

In one example, the promoter is an RNA Pol III promoter. For example, the promoter is the U6 promoter (e.g., the U6-1, U6-8, or U6-9 promoters). In another example, the promoter is the H1 promoter.

In the case of ddRNAi constructs of the invention encoding multiple shmis, each nucleic acid in the ddRNAi construct is operably linked to a U6 promoter, e.g., a separate U6 promoter.

In one example, the promoter in the ddRNAi construct is the U6 promoter. For example, the promoter may be the U6-1 promoter. For example, the promoter may be the U6-8 promoter. For example, the promoter may be the U6-9 promoter.

In some examples, promoters with variable strength are used. For example, the use of two or more strong promoters (e.g., Pol type III promoters) can cause cell death by, for example, removing the pool of available nucleotides or other cellular components required for transcription. Additionally, or alternatively, the use of several strong promoters can cause toxic levels of expression of the shmiR in the cell. Thus, in some examples, one or more promoters in a multi-promoter ddRNAi construct are weaker than other promoters in the construct, or all promoters in the construct can express the shrir at a rate less than the maximum rate. Promoters may also be modified using various molecular techniques, or by modifying various regulatory elements, to obtain weaker or stronger levels of transcription. One way to achieve reduced transcription is to modify sequence elements within the promoter that are known to control promoter activity. For example, Proximal Sequence Elements (PSE) are known to affect the activity of the human U6 promoter (see Domitrovich et al, Nucleic Acids Res, 31: 2344-. Replacement of a PSE element present in a strong promoter such as the human U6-1, U6-8 or U6-9 promoter with an element from a weak promoter such as the human U6-7 promoter reduces the activity of the hybrid U6-1, U6-8 or U6-9 promoter. This approach is used in the examples described in this application, but other means of achieving this result are known in the art.

Promoters useful in ddRNAi constructs of the invention may also be tissue-specific or cell-specific. The term "tissue-specific" when applied to a promoter refers to a promoter that is capable of directing selective transcription of a nucleic acid of interest in a particular type of tissue (e.g., tissues of the eye or muscle) when expression of the same nucleotide sequence of interest is relatively absent in the different type of tissue (e.g., liver). The term "cell-specific" as applied to a promoter refers to a promoter that is capable of directing the selective transcription of a nucleic acid of interest in a particular type of cell when expressed in a relative absence of the same nucleotide sequence of interest in different types of cells within the same tissue. According to one example, a muscle specific promoter, such as Spc512 or CK8, is used. However, other muscle-specific promoters are known in the art and are contemplated for use in conjunction with the ddRNAi constructs of the present invention.

In one example, a ddRNAi construct of the invention can additionally include one or more enhancers to increase expression by the shrimrs described herein. Enhancers suitable for use in embodiments of the invention include the Apo E HCR enhancer, the CMV enhancer (Xia et al, Nucleic Acids Res, 31-17(2003)) and other enhancers known to those skilled in the art. Suitable enhancers for use in ddRNAi constructs of the invention are described in U.S. Pat. No. 8,008,468.

In another example, a ddRNAi construct of the invention can comprise a transcription terminator linked to a nucleic acid encoding a shrir of the invention. In the case of ddRNAi constructs comprising multiple nucleic acids described herein (i.e., encoding multiple shmirs), the terminator attached to each nucleic acid can be the same or different. For example, in a ddRNAi construct of the invention using an RNA pol III promoter, the terminator may be a contiguous fragment of 4 or more or 5 or more or 6 or more T residues. However, when different promoters are used, the terminator may be different and matched to the promoter from the gene that produced the terminator. These terminators include, but are not limited to, SV40 poly A, AdV VA1 gene, 5S ribosomal RNA gene, and human t-RNA terminator. Other promoter and terminator combinations are known in the art and are contemplated for use in the ddRNAi constructs of the present invention.

In addition, promoters and terminators may be mixed and matched as is commonly done with RNA pol II promoters and terminators.

In one example, the promoter and terminator combinations for each nucleic acid in a ddRNAi construct comprising multiple nucleic acids are different to reduce the likelihood of DNA recombination events between the components.

An exemplary ddRNAi construct of the invention comprises or consists of a nucleic acid comprising or consisting of a DNA sequence encoding shrmir 13 described herein operably linked to a promoter and a nucleic acid comprising or consisting of a DNA sequence encoding shrmir 17 described herein operably linked to a promoter. For example, an exemplary ddRNAi construct of the invention includes a nucleic acid sequence comprising SEQ ID NO: 64 and a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 68 or a nucleic acid consisting of the DNA sequence shown in. In one example, each nucleic acid in the shmiR-encoding ddRNAi construct is operably linked to a separate promoter. In another example, each nucleic acid in the ddRNAi construct encoding shrir is operably linked to the same promoter. For example, the or each promoter may be a U6 promoter, for example, the U6-1, U6-8 or U6-9 promoter. For example, the or each promoter may be a muscle-specific promoter, for example, the Spc512 or CK8 promoters.

According to one example in which the nucleic acids in the ddRNAi constructs encoding shmiR13 and shmiR17 were operably linked to the same Spc512 promoter, the ddRNAi constructs included the nucleic acid sequences of SEQ ID NOs: 72 or the DNA sequence represented by SEQ ID NO: 72, or a DNA sequence shown in the specification. According to an example in which the nucleic acids in the ddRNAi constructs encoding shmiR13 and shmiR17 were operably linked to the same CK8 promoter, the ddRNAi constructs included the nucleic acid sequences of SEQ ID NOs: 70 or the DNA sequence represented by SEQ ID NO: 70 in sequence.

Another exemplary ddRNAi construct of the invention comprises a nucleic acid comprising or consisting of a DNA sequence encoding shrmir 3 described herein operably linked to a promoter and a nucleic acid comprising or consisting of a DNA sequence encoding shrmir 14 described herein operably linked to a promoter. For example, an exemplary ddRNAi construct of the invention includes a nucleic acid sequence comprising SEQ ID NO: 57 or a nucleic acid consisting of the DNA sequence set forth in SEQ ID NO: 65 or a nucleic acid consisting of the DNA sequence set forth in seq id no. In one example, each nucleic acid in the shmiR-encoding ddRNAi construct is operably linked to a separate promoter. In another example, each nucleic acid in the ddRNAi construct encoding shrir is operably linked to the same promoter. For example, the or each promoter may be a U6 promoter, for example, the U6-1, U6-8 or U6-9 promoter. For example, the or each promoter may be a muscle-specific promoter, for example, the Spc512 or CK8 promoters.

According to an example in which the nucleic acids in the ddRNAi constructs encoding shmiR3 and shmiR14 were operably linked to the same Spc512 promoter, the ddRNAi constructs included the nucleic acid sequences of SEQ ID NOs: 71 or the DNA sequence represented by SEQ ID NO: 71 in sequence. According to an example in which the nucleic acids in the ddRNAi constructs encoding shmiR3 and shmiR14 were operably linked to the same CK8 promoter, the ddRNAi constructs included the nucleic acid sequences of SEQ ID NOs: 69 or a DNA sequence represented by SEQ ID NO: 69.

In addition, the ddRNAi construct can include one or more multiple cloning sites and/or strategically located unique restriction sites that allow for easy removal or replacement of promoters, nucleic acids encoding shrimrs, and/or other regulatory elements. The ddRNAi constructs can be assembled from smaller oligonucleotide components using strategically located restriction sites and/or complementary sticky ends. The basic vector (vector) used in one method according to the invention comprises a plasmid with a polylinker, where all sites are unique (although this is not an absolute requirement). In turn, each promoter is inserted between its designated unique sites, creating a base cassette with one or more promoters, all of which may have variable orientations. In turn, the annealed primer pairs were inserted again into unique sites downstream of each individual promoter, resulting in single, double or multiple expression cassette constructs. The insert can be moved into the AAV backbone using two unique restriction enzyme sites (the same or different) flanking the single, double or multiple expression cassette insert.

The generation of ddRNAi constructs can be accomplished using any suitable genetic engineering technique known in the art, including, but not limited to, standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease cleavage, ligation, transformation, plasmid purification, and DNA sequencing. The ddRNAi construct (or a polynucleotide comprising the same) may further comprise sequences necessary for packaging the ddRNAi construct into a viral particle and/or sequences that allow integration of the ddRNAi construct into the genome of the target cell. In some examples, the or each viral construct additionally contains genes that allow the virus to replicate and propagate, however such genes will be provided in trans. In addition, or each viral construct may contain genes or genetic sequences from the genome of any known organism incorporated or modified in its native form. For example, the viral construct may include sequences for replicating the construct in bacteria.

Testing of the shmiR or ddRNAi constructs of the invention

Cell culture model

An example of a cell line used as a cell culture model for OPMD is the HEK293T cell line (HEK293T, ATCC, Manassas, USA) which has been transfected with a vector (vector) expressing normal Ala 10-human PABPN1-FLAG (Ala10) or mutant Ala 17-human PABPN1-FLAG (Ala17), the latter being a marker for OPMD.

Other examples of cell lines that can be used as culture models for OPMD cells are C2C12 mouse muscle cells and ARPE-19 human retinal cells.

Another example of a cell line used as an OPMD cell culture model is a primary mouse myoblast (IM2) cell line stably transfected to express normal Ala 10-human PABPN1-FLAG (Ala10) or mutant Ala 17-human PABPN1-FLAG (Ala 17). An exemplary IM 2-derived cell line stably expressing mutant Ala 17-human PABPN1-FLAG (Ala17) is the H2kB-D7e cell line. The H2kB-D7e cell line is also described in Raz et al, (2011) Journal of American Pathology (American Journal of Pathology), 179 (4): 1988-2000.

Other cell lines suitable for use in cell culture models for OPMD are known in the art, for example, as described in Fan et al (2001) Human Molecular Genetics (Human Molecular Genetics), 10: 2341-2351, Bao et al (2002) Journal of biochemistry (The Journal of Biological Chemistry), 277: 12263-12269 and Abu-Baker et al (2003) Human Molecular Genetics (Human Molecular Genetics), 12: 2609-2623.

As exemplified herein, the activity of the shrmir of the present invention is determined by administering a nucleic acid encoding the shrmir, or a ddRNAi construct or expression vector (vector) comprising the same, to a cell and subsequently measuring the expression level of RNA or protein encoded by the PABPN1 gene. For example, intracellular PABPN1 gene expression may be determined by any one or more of RT-PCR, quantitative PCR, semi-quantitative PCR, or in situ hybridization under stringent conditions, using one or more probes or primers specific for PABPN 1. PABPN1mRNA or DNA may also be used to detect PABPN1 protein by PCR, Western blot (Western blot) or ELISA using one or more probes or primers specific for PABPN 1.

Polynucleotides useful for RT-PCR, quantitative PCR or semi-quantitative PCR techniques for detecting PABPN1 expression are known and commercially available (Thermo Fisher). However, the sequence information available based on PABPN1 can be used to design a PCR-based assay using methods and/or software known in the artA polynucleotide of the method. In one example, RT-PCR can be used to detect the presence or absence of PABPN1mRNA using standard methods known in the art. In one example, the presence or absence or relative amount of PABPN1 polypeptide or protein may be detected using western blotting, ELISA, or any one or more of the other standard quantitative or semi-quantitative techniques available in the art, or a combination of these techniques. Techniques that rely on antibody recognition by PABPN1 are contemplated and described. In one example, the presence or absence or relative abundance of the PABPN1 polypeptide may be detected using a technique including antibody capture of the PABPN1 polypeptide and electrophoretic resolution of the captured PABPN1 polypeptide, e.g., using isonosic^TMAssay (Target Discovery, Inc.). Antibodies to PABPN1 protein are commercially available.

Various methods for normalizing differences in transfection or transduction efficiency and sample recovery are known in the art.

The nucleic acids, ddRNAi constructs or expression vectors (vectors) of the invention that reduce expression of mRNA or protein encoded by PABPN1, or reduce the presence of nuclear aggregation of PABPN1 protein, relative to the level of mRNA expression or protein encoded by PABPN1 or the level of nuclear aggregation of PABPN1 protein in the absence of RNA of the invention, are considered useful for therapeutic applications, e.g., to treat OPMD by reducing expression of endogenous PABPN1 and replacing some or all of the endogenous PABPN1 with the PABPN1 protein that causes OPMD as described herein.

Animal model

There are several small animal models available for studying OPMD, examples of which are described in Uyama et al, (2005) Acta Myologica,24(2):84-88 and Chartier and Simonelig (2013) Drug Discovery Today: technologies,10: e 103-107. An exemplary animal model is the a17.1 transgenic mouse model, previously described in Davies et al (2005) natural Medicine (Nature Medicine), 11: 672-677 and Trollet et al (2010) Human Molecular Genetics (Human Molecular Genetics), 19 (11): 2191-2207.

Any of the foregoing animal models can be used to determine the efficacy of the shrir or ddRNAi constructs of the invention to knock down, reduce, or inhibit the expression of the RNA or protein encoded by the PABPN1 gene.

The methods for determining the expression of PABPN1 gene have been described herein in terms of cell models and should be adapted mutatis mutandis to the present examples of the invention.

PABPN1 construct

As described herein, the AAV of the present invention includes a polynucleotide sequence comprising the PABPN1 construct. In this regard, the AAV of the present invention provides reagents for replacing a functional PABPN1 protein, for example, with a cell or animal. The functional PABPN1 protein was not causative of OPMD and was not encoded by mRNA transcripts that were targeted by the shrmir encoded by the ddRNAi constructs as described herein, also included within AAV.

In one example, the PABPN1 construct includes a nucleic acid, such as DNA or cDNA, encoding a functional PABPN1 protein. For example, a nucleic acid encoding a functional PABPN1 protein may be codon optimized, e.g., containing one or more degenerate or wobble bases relative to a wild-type PABPN1 nucleic acid but encoding the same amino acids, such that the corresponding mRNA sequence encoding the functional PABPN1 protein is not recognized by the shrir encoded and expressed from the ddRNAi construct. For example, a codon-optimized nucleic acid encoding a functional PABPN1 protein may include one or more degenerate or wobble bases relative to a wild-type PABPN1 nucleic acid within the region targeted by one or more shmis encoded and expressed by the ddRNAi construct. In one example, one or more degenerate or wobble bases are located within a seed region of the effector sequence of the shmiR encoded and expressed by the ddRNAi construct.

In one example, a nucleic acid with a PABPN1 construct encoding a functional PABPN1 protein was codon optimized such that its corresponding mRNA sequence was not recognized by the shrir encoded and expressed from the ddRNAi construct. Preferably, the functional PABPN1 protein encoded by the codon-optimized nucleic acid sequence comprises SEQ ID NO: 74, i.e., the amino acid sequence of wild-type human PABPN1 protein. The skilled artisan will appreciate that there are many combinations of nucleotide sequences that can be used to encode a functional PABPN1 protein, and that the choice of nucleotide sequence will ultimately depend on the effector sequence of the shrir encoded and expressed by the ddRNAi construct, i.e., such that the codon-optimized nucleic acid is not recognized by the shrir. In one example, the PABPN1 construct includes a PABPN comprising SEQ ID NO: 73, or a nucleic acid having the sequence set forth in seq id no. In one example, the nucleic acid encoding a functional PABPN1 protein may also include a Kozak sequence.

In one example, the codon-optimized nucleic acid encoding a functional PABPN1 protein is operably linked to a promoter suitable for expression of the functional PABPN1 protein. Promoters suitable for expressing functional PABPN1 protein in muscle may be particularly suitable. An exemplary promoter suitable for use in a nucleic acid encoding a functional PABPN1 protein is the Spc512 promoter. Another exemplary promoter suitable for nucleic acids encoding a functional PABPN1 protein is the CK8 promoter. However, any suitable promoter known in the art may be used. Other suitable promoters for use with nucleic acids encoding functional PABPN1 proteins are described, for example, in US 20110212529a 1.

In one example, the PABPN1 construct and the ddRNAi construct are operably linked to the same promoter within the same polynucleotide, e.g., they are both operably linked to the Spc512 promoter. According to this example, a single promoter drives the expression of functional PABPN1 protein and shmiR.

As described herein, promoters useful in some examples of the invention may be tissue-specific or cell-specific.

In one example, the codon-optimized nucleic acid encoding a functional PABPN1 protein of the invention may additionally include one or more enhancers to increase the expression of the functional PABPN1 protein and its corresponding mRNA transcript. Enhancers suitable for use in this embodiment of the invention will be known to those skilled in the art.

Testing functional PABPN1

Animal model

Exemplary animal models for studying OPMD have been described.

Any of the foregoing animal models can be used to determine the efficacy of a PABPN1 construct or AAV comprising the same in replacing a functional PABPN1 protein in vivo in the presence of one or more shmis expressed by a ddRNAi of the invention.

The methods for determining expression of PABPN1 have been described herein in terms of cell models and should be adapted mutatis mutandis to the present examples of the invention.

In one example, histological and morphological analyses can be used to determine the efficacy of an agent of the invention to replace a functional PABPN1 protein in vivo in the presence of one or more shmis expressed by a ddRNAi of the invention. Other assays that may be used to determine the efficacy of the agents of the invention to replace functional PABPN1 protein in vivo are described in Trollet et al, (2010) Human Molecular Genetics, 19 (11): 2191-2207.

PABPN1 'silencing and substitution' DNA constructs

As described herein, the AAV of the present invention comprises a single polynucleotide comprising the ddRNAi construct and the PABPN1 construct as described herein. That is, the ddRNAi construct and PABPN1 constructs may be provided as a combined DNA construct (also referred to herein as a 'silencing and replacement' construct or SR construct) packaged in a modified AAV as described herein for delivery to a patient. An exemplary DNA construct comprising a nucleic acid encoding a functional PABPN1 protein and a ddRNAi construct of the invention is described in example 2.

A single DNA construct comprising the ddRNAi construct and the PABPN1 construct may include, for example, one or more promoters to drive expression of the functional PABPN1 protein and/or shmiR encoded by the ddRNAi construct. Promoters useful in some examples of the invention may be tissue-specific or cell-specific. Exemplary promoters are muscle-specific promoters, such as Spc512 and CK 8. However, any suitable promoter known in the art is contemplated for use in the DNA constructs described herein, such as those described in US 20110212529a 1.

DNA constructs comprising ddRNAi constructs and PABPN1 constructs were packaged in modified AAV as described herein for delivery to patients.

In one example, the DNA construct comprises in the 5' to 3' direction a muscle-specific promoter, such as the Spc512 promoter, a PABPN1 construct described herein and a ddRNAi construct described herein, e.g., wherein the ddRNAi construct is located in the 3' untranslated region (UTR) of a nucleic acid encoding a functional PABPN1 protein. The DNA construct according to this example is shown in FIG. 1A.

An exemplary DNA construct according to this example comprises in the 5 'to 3' direction:

(a) muscle-specific promoters, e.g., Spc 512;

(b) a PABPN1 construct described herein comprising a DNA sequence encoding a functional PABPN1 protein, the functional PABPN1 protein having an mRNA transcript that is not targeted by the shmiR encoded by the ddRNAi construct; and

(c) the ddRNAi constructs of the invention comprising a nucleic acid comprising a DNA sequence encoding shrmir 17 described herein and a nucleic acid comprising a DNA sequence encoding shrmir 13 described herein.

According to this embodiment, the DNA construct may comprise SEQ ID NO: 72 or the DNA sequence represented by SEQ ID NO: 72, or a DNA sequence shown in the specification.

Exemplary ddRNAi constructs encoding shmiR13 and shmiR17 included in DNA constructs of the invention include DNA constructs comprising a DNA sequence encoding a polypeptide comprising SEQ ID NO: 31 and a DNA sequence of shrmir having an effector sequence shown in SEQ ID NO: 31, e.g., SEQ ID NO: 30(shmiR13) or a nucleic acid consisting of the same, and a nucleic acid comprising a DNA sequence encoding a shmiR comprising the sequence set forth in SEQ ID NO: 39 and an effector sequence substantially identical to SEQ ID NO: 39, such as SEQ ID NO: 38(shmiR17) or a nucleic acid consisting of the same. For example, a ddRNAi construct according to this example of a DNA construct may include a nucleotide sequence comprising SEQ ID NO: 64(shmiR13) or a DNA sequence represented by SEQ ID NO: 64(shmiR13), and a nucleic acid comprising the DNA sequence shown in SEQ ID NO: 68(shmiR17) or a DNA sequence represented by SEQ ID NO: 68(shmiR 17).

An exemplary PABPN1 construct included in the DNA constructs of the invention includes SEQ ID NO: 73 and encoding the sequence shown in SEQ ID NO: 74 or a functional PABPN1 protein.

While certain examples have been described, it is to be understood that a DNA construct according to the invention can include any ddRNAi construct described herein that encodes one or more shmirs targeting the RNA transcript of PABPN 1. However, ddRNAi constructs encoding the shrimrs described in examples 1-5 herein may be particularly suitable for inclusion in DNA constructs of the invention. Similarly, it is understood that DNA constructs according to the invention may include any PABPN1 construct encoding a functional PABPN1 protein, the transcript of which is not targeted by the shrmir expressed from the ddRNAi construct.

Composition and Carrier

In some examples, the AAV of the invention may be provided in a pharmaceutical composition formulated for delivery to a patient, e.g., a human patient.

The compositions of the present invention may also include one or more pharmaceutically acceptable carriers (carriers) or diluents. For example, the composition can include a vector (carrier) suitable for delivering the AAV of the invention to a muscle of a subject following administration. Suitable vectors (carriers) for formulation and delivery of AAV are known in the art and are encompassed herein.

The compositions will desirably include materials that increase the biostability of the AAV of the invention and/or materials that increase the ability of the AAV to selectively localize to and/or penetrate muscle cells. The therapeutic compositions of the present invention may be administered in a pharmaceutically acceptable carrier (e.g., saline), which is selected based on the mode and route of administration and standard pharmaceutical practice. One of ordinary skill in the art can readily formulate pharmaceutical compositions comprising one or more AAVs of the invention. In some cases, isotonic formulations are used. Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol, and lactose. In some cases, isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatin and albumin. In some examples, a vasoconstrictor is added to the formulation. Sterile and pyrogen-free compositions according to the invention are provided. In the standard reference book in the art, remington: pharmaceutical Sciences and practices (Remington: The Science and Practice of Pharmacy) (formerly Remington's Pharmaceutical Sciences, Mack publishing company, and in USP/NF suitable Pharmaceutical carriers (carriers) for Pharmaceutical formulations and Pharmaceutical requirements are described.

The volume, concentration and formulation of the pharmaceutical composition and the dosing regimen can be specifically tailored to maximize cellular delivery while minimizing toxicity, such as inflammatory response, e.g., relatively large volumes (5, 10, 20, 50ml or more) with correspondingly low concentrations of active ingredients can be used if desired, as well as including anti-inflammatory compounds such as corticosteroids.

The compositions of the invention may be formulated for administration by any suitable route (e.g., a route suitable for delivery to the pharyngeal muscle of a subject). For example, routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterial, intraocular, and oral, as well as transdermal or by inhalation or suppository. Exemplary routes of administration include Intravenous (IV) injection, Intramuscular (IM) injection, oral, intraperitoneal, intradermal, intraarterial, and subcutaneous injection. In one example, the compositions of the present invention are formulated for intramuscular administration (e.g., formulated for pharyngeal muscle administration). In a preferred embodiment, administration is directly to the pharyngeal muscle of the subject. For example, the pharyngeal muscles may include one or more of the inferior constrictor, the middle constrictor, the superior constrictor, the palatopharyngeal muscle, the eustachian tube pharyngeal muscle, the stylopharyngeal muscle, or any combination thereof. In another preferred embodiment, the administration is directly to the subject's tongue muscle. Such compositions are useful for pharmaceutical applications, and can be readily formulated in suitable sterile, pyrogen-free vehicles (vehicles), e.g., buffered saline for injection, for parenteral administration, e.g., intramuscular injection (e.g., directly to the pharyngeal muscle), intravenous injection (including intravenous infusion), subcutaneous injection, and intraperitoneal administration. In a preferred embodiment, an administration route such as intramuscular injection (e.g., direct administration to the pharyngeal muscle) achieves efficient delivery to muscle tissue and transfection of the ddRNAi construct encoding PABPN1 of the present invention and the codon-optimized nucleic acid, as well as expression of the shrir and the codon-optimized nucleic acid therein.

Method of treatment

Certain aspects of the invention relate to administering an AAV or a composition comprising the same as described herein to a human subject in need thereof for treating the subject and/or inhibiting the expression of endogenous PABPN1 protein (including the OPMD-causing PABPN1 protein), in a subject, wherein the composition is administered by direct injection into the pharyngeal muscle of the subject.

In some embodiments, an AAV or a composition comprising an AAV as described herein can be used to treat OPMD in a subject having OPMD. Similarly, an AAV or a composition comprising the same as described herein may be used to prevent development or progression of one or more symptoms of OPMD in a subject suffering from or susceptible to OPMD.

In some embodiments, after administering the AAV or the composition comprising the AAV by direct injection into the pharyngeal muscle of the subject, the subject has improved swallowing function.

As described herein, the AAV and/or composition of the invention includes a ddRNAi construct of the invention and a PABPN1 construct of the invention, the PABPN1 construct including a codon-optimized nucleic acid encoding a functional PABPN1 protein of the invention. Thus, administration of an AAV or composition may be effective to (i) inhibit, reduce, or knock-out the expression of endogenous PABPN1, including a PABPN1 protein that includes a poly-alanine tract that causes amplification of OPMD, and (ii) provide expression of a functional PABPN1 protein that is not targeted by a shmiR that inhibits, reduces, or knocks-out the expression of endogenous PABPN 1. Thus, AAV or a composition of the invention may restore PABPN1 protein function, e.g., post-transcriptional processing of RNA, in a cell or animal to which it is administered.

In certain embodiments, treatment of OPMD may comprise administering an AAV or a composition comprising an AAV as described herein by direct injection into the pharyngeal muscle of a subject

In some embodiments, the route of administration is IM (e.g., direct injection into the pharyngeal muscle of the subject) and results in efficient delivery to muscle tissue and transduction of the ddRNAi constructs and PABPN1 constructs of the invention comprising expression of a codon-optimized nucleic acid encoding PABPN1 and a shrir that targets the wild-type PABPN1mRNA transcript and expression of the codon-optimized nucleic acid therein.

The therapeutically effective dose level for any particular patient will depend upon a variety of factors including: the composition employed; the age, weight, general health, sex, and diet of the patient; the time of administration; the route of administration; the binding rate of an AAV or a composition comprising an AAV as described herein, the duration of treatment, and other relevant factors.

The efficacy of AAV or a composition comprising the same to reduce or inhibit expression of PABPN1 protein that causes OPMD and express functional PABPN1 protein that does not cause OPMD in an amount sufficient to restore PABPN1 function can be determined by assessing muscle contraction characteristics and/or dysphagia of a subject being treated. Methods for testing swallowing ability and muscle contraction characteristics are known in the art. For example, dysphagia may be assessed using television fluoroscopy, UGI endoscopy or esophageal manometry and impedance testing. Other methods for assessing clinical characteristics of OPMD are described in rueg et al, (2005) swedish Medical journal, 135: 574-586.

TABLE 1 targeting regions in PABPN1

Area ID	Region sequence (5'-3')	SEQ ID NO：
			Region 2	GAGAAGCAGAUGAAUAUGAGUCCACCUC	SEQ ID NO：1
Region 3	GAACGAGGUAGAGAAGCAGAUGAAUAUG	SEQ ID NO：2
			Region 4	GAAGCUGAGAAGCUAAAGGAGCUACAGA	SEQ ID NO：3
Region 5	GGGCUAGAGCGACAUCAUGGUAUUCCCC	SEQ ID NO：4
			Region 6	CUGUGUGACAAAUUUAGUGGCCAUCCCA	SEQ ID NO：5
Region 7	GACUAUGGUGCAACAGCAGAAGAGCUGG	SEQ ID NO：6
			Region 9	CGAGGUAGAGAAGCAGAUGAAUAUGAGU	SEQ ID NO：7
Region 11	CAGUGGUUUUAACAGCAGGCCCCGGGGU	SEQ ID NO：8
			Region 13	AGAGCGACAUCAUGGUAUUCCCCUUACU	SEQ ID NO：9
Region 14	GGUAGAGAAGCAGAUGAAUAUGAGUCCA	SEQ ID NO：10
			Region 15	AUUGAGGAGAAGAUGGAGGCUGAUGCCC	SEQ ID NO：11
Region 16	GGAGGAAGAAGCUGAGAAGCUAAAGGAG	SEQ ID NO：12
			Region 17	AACGAGGUAGAGAAGCAGAUGAAUAUGA	SEQ ID NO：13

TABLE 2-shmiR Effector and Effector complementary sequences

shmiR ID	Effector complement sequence (5'-3')	SEQ ID NO：	Effector sequences (5'-3')	SEQ ID NO：
					shmiR2	AGCAGAUGAAUAUGAGUCCA	SEQ ID NO：14	UGGACUCAUAUUCAUCUGCUU	SEQ ID NO：15
shmiR3	GAGGUAGAGAAGCAGAUGAA	SEQ ID NO：16	UUCAUCUGCUUCUCUACCUCG	SEQ ID NO：17
					shmiR4	CUGAGAAGCUAAAGGAGCUA	SEQ ID NO：18	UAGCUCCUUUAGCUUCUCAGC	SEQ ID NO：19
shmiR5	UAGAGCGACAUCAUGGUAUU	SEQ ID NO：20	AAUACCAUGAUGUCGCUCUAG	SEQ ID NO：21
					shmiR6	GUGACAAAUUUAGUGGCCAU	SEQ ID NO：22	AUGGCCACUAAAUUUGUCACA	SEQ ID NO：23
shmiR7	AUGGUGCAACAGCAGAAGAG	SEQ ID NO：24	CUCUUCUGCUGUUGCACCAUA	SEQ ID NO：25
					shmiR9	GUAGAGAAGCAGAUGAAUAU	SEQ ID NO：26	AUAUUCAUCUGCUUCUCUACC	SEQ ID NO：27
shmiR11	GGUUUUAACAGCAGGCCCCG	SEQ ID NO：28	CGGGGCCUGCUGUUAAAACCA	SEQ ID NO：29
					shmiR13	CGACAUCAUGGUAUUCCCCU	SEQ ID NO：30	AGGGGAAUACCAUGAUGUCGC	SEQ ID NO：31
shmiR14	GAGAAGCAGAUGAAUAUGAG	SEQ ID NO：32	CUCAUAUUCAUCUGCUUCUCU	SEQ ID NO：33
					shmiR15	AGGAGAAGAUGGAGGCUGAU	SEQ ID NO：34	AUCAGCCUCCAUCUUCUCCUC	SEQ ID NO：35
shmiR16	GAAGAAGCUGAGAAGCUAAA	SEQ ID NO：36	UUUAGCUUCUCAGCUUCUUCC	SEQ ID NO：37
					shmiR17	AGGUAGAGAAGCAGAUGAAU	SEQ ID NO：38	AUUCAUCUGCUUCUCUACCUC	SEQ ID NO：39

TABLE 3 shmiR sequences

TABLE 4-shmiR encoding box

Example 1 design of shmiR targeting PABPN1

Sequences representing potential targets for siRNA construct design were identified from PABPN1mRNA sequences using publicly available siRNA design algorithms (including Ambion, Promega, Invitrogen, Origene and MWG): the selected sequences are conserved in human, non-human primate, bovine and mouse species. Sequences encoding candidate sirnas were incorporated into a pre-miR30a scaffold to produce sequences encoding short hairpin micrornas (shrmir) that include a 5 'flanking region (SEQ ID NO: 41), an siRNA sense strand sequence (effector complement sequence), a stem/loop junction sequence (SEQ ID NO: 40), an siRNA antisense strand (effector sequence), and a 3' flanking region (SEQ ID NO: 42). Predicted secondary structures of representative shmiR are shown in fig. 1C. The target regions of the designed shmiR PABPN1mRNA transcripts are shown in table 1, and the corresponding shmiR effector sequences (antisense strands) are shown in table 2.

Example 2-generation of a single "silencing and replacement construct" for concurrent gene silencing and replacement with codon-optimized PABPN1 of endogenous PABPN 1.

Single-stranded adeno-associated virus type 2 (ssAAV2) plasmids expressing shmiR17 and shmiR13 (e.g., as described in tables 3 and 4) and opppabpn 1 sequences were created.

Silencing and replacement constructs (hereinafter "SR-constructs") were generated by subcloning DNA sequences encoding shrimr 17 and shrimr 13 (as in table 4) into the 3' untranslated region of the opppaabpn 1 transcript in the pAAV2 vector backbone (pAAV-shrimr viral plasmid). Expression of optpaabpn 1 and both shmis in a single transcript is driven by the muscle-specific promoter Spc 512. Schematic diagrams of SR constructs are provided in fig. 1(a), 1(B) and 2.

A recombinant pseudotyped AAV vector (vector) stock is then generated. Briefly, HEK293T cells were cultured in a cell factory in Dulbecco's modified Eagle's Medium supplemented with 10% FBS at 37 ℃ and 5% CO₂Under the conditions of (1). The pAAV-shmiR virus plasmid (SR-construct) and the pAAV helper virus and pAAV repcap8 plasmid or the pAAV repcap9 or the pAAV helper virus and pAAVRH74 plasmid were complexed with calcium phosphate according to the manufacturer's instructions. Triple transfection was then performed with pAAV-shmiR plasmid (SR-construct) in combination with pAAV helper virus and one of the following capsids; pAAVrepcap8, pAAVrepcap9 or pAAVRH74 in HEK293T cells. HEK293T cells were then incubated at 37 ℃ and 5% CO₂Incubate for 72 hours, after which the cells were lysed and the particles expressing the SR construct were purified by iodixanol (Sigma-Aldrich) fractionation-gradient ultracentrifugation followed by cesium chloride ultracentrifugation. Vector genomes were quantified using quantitative polymerase chain reaction (Q-PCR).

Example 3 in vivo study using a single vector (vector) "silencing and alternative" approach.

To test the in vivo efficacy of the SR-constructs described in example 2 in OPMD-related disease models, the SR-constructs were administered alone in a range of doses, by intramuscular injectionInjected into the Tibialis Anterior (TA) of 10-12 week old A17 mice. The dosage is 7.5x10 for each muscle respectively¹¹、2.5x10¹¹、5x10¹⁰、1x10¹⁰、2x10⁹And 4x10⁸Individual vector (vector) genomes (vg). Age-matched a17 mice were injected with saline as an untreated group. Mice were sacrificed 14 or 20 weeks after treatment.

Example 4-quantitative measurement of shrir production, PABPN1 silencing and codon optimized PABPN1 expression in SR-construct treated a17 mice.

TA muscles of a17 mice of example 3 were harvested and RNA extracted 14 weeks after SR-construct treatment. SR-construct-dependent expression of shrir in TA muscle was quantified (fig. 3A). Quantitative expression levels of shrir were dependent on SR-construct dose, as were silencing of PABPN1 (including expPABPN1) (fig. 3B) and restoration of normal PABPN1 levels (fig. 3C).

Example 5-reduction of nuclear inclusions (INI) in SR-construct treated A17 mice.

The effect of the SR-construct on the persistence of the nuclear inclusion (INI) was tested in week 14 a17 mice of example 3. FvB wild type mice were also included as healthy controls. At 14 weeks post AAV injection, muscles were harvested and placed for histological studies. Sections were pretreated with 1M KCl to preferentially elute all soluble PABPN1 from the tissues. Immunofluorescence of PABPN1 (green) and laminin, a protein abundant in muscle extracellular matrix (red), was detected in the treated muscle fraction and showed a significant reduction in the number of PABPN1 positive nuclear inclusions (INI) in SR-construct treated muscle with a dose effect (fig. 4A). Quantification of the percentage of nuclei containing INI in muscle sections showed that treatment with SR-constructs significantly reduced the amount of INI compared to untreated a17 muscle (One-way Anova test with Bonferroni post-hoc test); p <0.001, ns: not significant) (fig. 4B).

Example 6-treatment with the SR-construct improves the physiological properties and function of the treated muscle.

Physiological properties and function of the treated muscle were measured in week 14 a17 mice of example 3. FvB wild type mice were also included as healthy controls. The maximum force produced by TA muscle was measured by in situ muscle physiology (fig. 5A). The SR-construct significantly increased the maximum force produced by TA muscle in a dose-dependent manner. Muscle weight normalized to Body Weight (BW) was also measured 14 weeks after SR-construct administration (fig. 5B). Muscle weights of SR-treated groups normalized to body weight were comparable to those of control FvB mice when the dose per TA injection exceeded 1e10 vg (mean ± SEM, n ═ 10, single factor variance test using Bonferroni post hoc test,. p <0.05,. p <0.001,. p <0.01, ns: not significant).

Example 7 muscle function recovery over time

The maximum force produced by TA muscle in SR-construct treated a17 mice and FvB wild type mice was measured by in situ muscle physiology 14 weeks after SR-construct administration (fig. 6A) and 20 weeks after SR-construct administration (fig. 6B). For the intermediate doses (per TA 1e10 vg and 6e10vg), the beneficial effect on muscle strength was more pronounced at 20 weeks than at 14 weeks post-injection (mean ± SEM, n-10, single-factor variance test using Bonferroni post-hoc test,. p <0.001,. p < 0.01).

Example 8 direct administration to sheep pharyngeal muscle

The SR-construct was injected directly into the pharyngeal muscle of sheep, PABPN1 being highly conserved between sheep and humans, including all but one amino acid residue at position 95.

SR-constructs were injected directly into the pharyngeal muscle of sheep (fig. 7A). The circumpharyngeal muscle (CP) of two animals in the sheep study was injected with the 1.5e13 vg SR-construct, and the pharyngeal muscle (pharynx)) with the 1.0e13vg SR-construct, respectively. The remaining 10 animals treated with the SR-construct (1.0e10 vg to 1.0e13vg) received only CP injections. CP was injected in a total amount of 1.5ml (3 times each, 0.5ml each). The total amount of throat injection is 6ml (2 injections each time, 1.5ml each time).

Radiographic imaging using radiolabeled creams revealed that human OPMD patients had severe dysphagia with a risk of "misinterpretation" (fig. 7B).

Example 9 design, production and testing of modified AAV VP1 sequences

In this example, AAV having viral capsid protein subunit 1(VP1) was designed and prepared in which specific sequence modifications, i.e., amino acid substitutions, were introduced into the phospholipase a2(PLA2) domain and flanking sequences to restore the phospholipase activity of AAVs and viral functions of AAV when produced in insect cells. In addition, based on multiple sequence alignments of the VP1 subsequence including the PLA2 domain and flanking sequences of various representative AAV serotypes, a consensus VP1 subsequence was prepared including the PLA2 domain and flanking sequences, including sequence modifications designed to restore phospholipase activity. The wild type AAV9 VP1 subsequence is shown in SEQ ID NO: 87.

9.1 design of modified AAV9 VP1 sequences

The 180N-terminal amino acids of VP1 proteins of AAV9(SEQ ID NO: 89), AAV8(SEQ ID NO: 93) and AAV2(SEQ ID NO: 97) were aligned using the BLASTp alignment tool. Based on these alignments, the PLA2 domain and flanking sequences from AAV8 and AAV9 show a high degree of conservation with the corresponding sequences in AAV 2. Based on these sequence alignments, computer simulations designed modified AAV9 VP1 and AAV8VP1 sequences. By using the nucleotide sequence presented in SEQ ID NO: 97 of the AAV2 VP1 sequence with an amino acid substitution at the corresponding position of the SEQ ID NO: 89, i.e., the amino acids at positions 42, 67, 81, 84 and 85 of the sequence shown in SEQ ID NO: 89, a42S, a67E, Q81R, K84D, and a85S within the sequence to design a modified AAV9 VP1 sequence. One of the alternative positions in the modified AAV9 VP1 sequence is in the region flanking the PLA2 domain (but believed to be likely to be involved in the folding and/or activity of the PLA2 domain), and four of the modified residue positions are located within the PLA2 domain itself. Likewise, the nucleotide sequence presented in SEQ ID NO: 97 of the AAV2 VP1 sequence with an amino acid substitution at the corresponding position of the SEQ ID NO: 93 at positions 42, 67, 81, 84, 85 and 105 of the sequence shown in SEQ ID NO: 93 a42S, a67E, Q81R, K84D, a85S and Q105K, to design modified AAV8VP1 sequences.

9.2 production of baculovirus vectors (vector) expressing both structural and non-structural AAV9 proteins

Baculovirus vectors (vectors) encoding AAV9 capsid proteins including VP1, VP2, and VP3 subunits and AAV9 nonstructural proteins Rep78, Rep68, Rep52, and Rep40 were prepared (BacAAV9-Rep-VPmod, fig. 8). Briefly, a DNA construct encoding the AAV9 capsid protein was synthesized at GenScript (AAV9-VPmod, fig. 9), and the AAV9 capsid protein had a sequence consisting of SEQ ID NO: 90, and has flanking NotI and ApaI restriction sites. The wtAAV9-Rep plasmid (Virovek, Hayward, CA) encoding the nonstructural proteins Rep78, Rep68, Rep52, and Rep40, as well as the capsid proteins VP1, VP2, and VP3 and the Assembly Activating Protein (AAP) was used as a backbone to receive the AAV9-VPmod DNA construct. The AAV9-VPmod DNA construct and the wtAAV9-Rep plasmid were digested with NotI and ApaI, and then the AAV9-VPmod DNA construct was ligated into the wtAAV9-Rep plasmid backbone in place of the wt capsid protein coding sequence to generate AAV9-Rep-VPmod (FIG. 10). The AAV9-Rep-VPmod intermediate was then cloned into pOET1 baculovirus transfer vector (vector) (Oxford Expression Technologies). To facilitate this, an EcoRV site was inserted into the AAV9-Rep-VPmod intermediate using Quickchange technology to generate an AAV9-Rep-VPmod-EcoRV intermediate. The AAV9-Rep-VPmod-EcoRV intermediate and pOET1(Oxford Expression technology) were then cleaved with NotI and EcoRV, and the insert was ligated into pOET1 backbone, generating the final AAV9-Rep-VPmod clone (BacAAV9-Rep-CapPL, FIG. 8).

9.3 production of baculovirus vectors (vector) expressing both structural and non-structural AAV8 proteins

Baculovirus vectors (vectors) encoding AAV8 capsid proteins including VP1, VP2, and VP3 subunits and modified AAV8 nonstructural proteins Rep78 and Rep52 were prepared (BacAAV8-Rep-VPmod, fig. 11). Briefly, DNA constructs encoding AAV8 capsid proteins (VP1, VP2, and VP3) were synthesized at GenScript (AAV8-VPmod, fig. 12), AAV8 capsid protein having a sequence comprising SEQ ID NO: 94, and having flanking NotI and ApaI restriction sites. The wtAAV8-Rep/Cap plasmid (Virovek, Hayward, CA) encoding the nonstructural proteins Rep78, Rep68, Rep52, and Rep40, as well as the capsid proteins VP1, VP2, and VP3 and the Assembly Activating Protein (AAP) was used as a backbone to receive the AAV8-VPmod DNA construct. The AAV8-VPmod DNA construct and the wtAAV8-Rep/Cap plasmid were digested with NotI and ApaI, and then the AAV8-VPmod DNA construct was ligated into the wtAAV8-Rep/Cap plasmid backbone in place of the wt capsid protein coding sequence to generate AAV8-Rep-VPmod (FIG. 13). The AAV8-Rep-VPmod intermediate was then cloned into pOET1 baculovirus transfer vector (vector) (Oxford Expression Technologies). To facilitate this, an EcoRV site was inserted into the AAV8-Rep-VPmod intermediate using QuickChange technology to generate the AAV8-Rep-VPmod-EcoRV intermediate. The AAV8-Rep-VPmod-EcoRV intermediate and pOET1 were then cleaved with NotI and EcoRV, and the insert was ligated into the pOET1 backbone (Oxford Expression technology) to generate the final AAV8-Rep-VPmod clone (BacAAV8-Rep-VPmod, FIG. 11).

9.4 production of baculovirus vectors (vector) expressing the Gene of interest (GOI)

Baculovirus vectors (vectors) were prepared encoding the gene of interest (GOI) flanked by Inverted Terminal Repeats (ITRs) of AAV 2. Briefly, in one case, a DNA construct encoding two shrimrs targeting human PABPN1 transcripts flanked by AAV2 ITRs was cloned into a pOET1 baculovirus transfer vector (vector) (Oxford Expression Technologies) by digesting the AAV2-GOI construct (fig. 14) and pOET1(Oxford Expression Technologies) with NotI, and the AAV2-GOI construct was ligated into the pOET1 backbone to generate the final clone (BacAAV2-GOI, fig. 15). A second GOI was also prepared in the same manner as above, although it encodes three shmis that target different regions of the HBV polymerase gene transcript.

9.5 production of P0 baculovirus stocks

The Oxford Expression Technologies baculoCOMPLETE system (according to the manufacturer's instructions) was used to generate baculovirus P0 stock. Briefly, 1 million Sf9 cells were seeded in 6-well plates 1 hour prior to transfection and allowed to adhere to the plates. 500ng of BacAAV2-GOI plasmid, BacAAV8-Rep-CapPL or BacAAV9-Rep-CapPL was mixed with 500ng of flashed BAC DNA and baculoFECTIN transfection reagent (according to the manufacturer's protocol) in 1ml of TC100 medium. After incubation at room temperature for 30 min, the transfection mixture was added to seeded Sf9 cells. Incubate 6-well plates at 28 ℃. 24 hours after transfection, 1ml of Sf9 medium was added to the cells. 5 days after transfection, the medium containing P0 baculovirus stocks was collected and stored at4 ℃. Thus, P0 baculoviruses were generated for BacAAV8-Rep-CapPL, BacAAV9-Rep-CapPL and Bac-AAV 2-GOI.

9.6 production of AAV in mammalian cells

The function of AAV produced in mammalian cells is compared to the functionality of AAV produced in insect cells as described above. To compare the biological activity (function) of recombinant AAV prepared in mammalian and insect cells, mammalian cells were infected in vitro with various titers of virus, and the expression of the treated shrir was quantified using a qRT PCR assay.

For these experiments, recombinant AAV8 particles expressing the shmiR targeting HBV polymerase gene transcripts were prepared in mammalian cells by a commercial vendor (Vector Biolabs; https:// www.vectorbiolabs.com). In addition, recombinant AAV9 particles expressing 2 shrimrs targeting human PABPN1 were prepared from the second supplier of mammalian cells, national world's host vector core, (b), (d)https:// www.nationwidechildrens.org/research/resources-infrastructure/core- facilities/viralvector-core-clinical-manufacturing-facility)。

Biological activity evaluations were performed on (i) AAV8 (vector) Biolabs) with unmodified VP1 produced in mammalian cells, (ii) AAV8 with modified VP1 produced by baculovirus in insect cells (BacAAV8-Rep-VPmod was used as described herein), and (iii) AAV8(Ben10, Virovek, Hayward, CA) with unmodified wt VP1 produced by baculovirus in insect cells using wtAAV8-Rep/Cap, each encoding 3 shmirs targeting the HBV polymerase gene (HBV shmiR designated All-4_ m3, shRNA8v2_ p1 and All-9_ p 1). Briefly, JHU67 cells were infected with the modified or unmodified recombinant virus preparations described above at a MOI of 4x10e9, 8x10e9, and 1.6x10e10, and shrir expression was quantified for each of the three shrimrs at 72 hours post-infection. To quantify the expression of shmiR, RNA was extracted from infected cells using a Qiagen RNA mini kit (Qiagen). RNA was reverse transcribed using the Qiagen MiScript kit (Qiagen). The cDNA was then used in a qPCR reaction with specific primers designed to amplify the shmiR target to determine the total number of copies present in the sample.

As shown in fig. 16A-16C, cells infected with AAV8 with unmodified wt VP1 prepared in mammalian cells produced easily detectable levels of shrims, while AAV8 with unmodified wt VP1 produced by baculovirus in insect cells produced few, if any, shrims. In contrast, AAV8 with modified VP1 produced by baculovirus in insect cells produced relatively high levels of shrir, indicating increased function of these AAV compared to AAV8 with unmodified wt VP1 produced by baculovirus in insect cells.

The biological activity of (i) AAV9 with an unmodified capsid protein produced in mammalian cells (Nafionwide) and (ii) AAV9 with a modified capsid protein using BACAAV9-Rep-VPmod (as described herein) produced by baculovirus in insect cells, each encoding 2 shrim-targeted transcripts of human PABPN1 (designated sh13 and sh17) were also evaluated. Briefly, C2C12 cells expressing AAV internalizing receptors were infected with the 4x10e9, 8x10e9, and 1.6x10e10 vector (vector) genomes. After 72 hours of incubation, cells were harvested, RNA was extracted and the shrmir expression of the two shrmir was quantified according to the qPCR method described above.

As shown in fig. 17, both formulations showed very similar expression levels of shmiR, indicating very similar viral functions.

Although demonstrated in the context of AAV from serotypes 8 and 9, it is expected that modification of the VP1 subunit sequences of other AAV serotypes (other than serotype 2) according to the methods described herein will restore AAV function when produced from a baculovirus expression system in insect cells.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the above-described embodiments without departing from the broad scope of the disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Sequence listing

<110> Benitec biopharmaceutical Co., Ltd

<120> compositions and methods for treating oculopharyngeal muscular dystrophy (OPMD)

<130> 186752PCT

<150> US 62/812,187

<151> 2019-02-28

<160> 98

<170> PatentIn 3.5 edition

<210> 1

<211> 28

<212> RNA

<213> Intelligent people

<400> 1

gagaagcaga ugaauaugag uccaccuc 28

<210> 2

<211> 28

<212> RNA

<213> Intelligent people

<400> 2

gaacgaggua gagaagcaga ugaauaug 28

<210> 3

<211> 28

<212> RNA

<213> Intelligent people

<400> 3

gaagcugaga agcuaaagga gcuacaga 28

<210> 4

<211> 28

<212> RNA

<213> Intelligent people

<400> 4

gggcuagagc gacaucaugg uauucccc 28

<210> 5

<211> 28

<212> RNA

<213> Intelligent people

<400> 5

cugugugaca aauuuagugg ccauccca 28

<210> 6

<211> 28

<212> RNA

<213> Intelligent people

<400> 6

gacuauggug caacagcaga agagcugg 28

<210> 7

<211> 28

<212> RNA

<213> Intelligent people

<400> 7

cgagguagag aagcagauga auaugagu 28

<210> 8

<211> 28

<212> RNA

<213> Intelligent people

<400> 8

cagugguuuu aacagcaggc cccggggu 28

<210> 9

<211> 28

<212> RNA

<213> Intelligent people

<400> 9

agagcgacau caugguauuc cccuuacu 28

<210> 10

<211> 28

<212> RNA

<213> Intelligent people

<400> 10

gguagagaag cagaugaaua ugagucca 28

<210> 11

<211> 28

<212> RNA

<213> Intelligent people

<400> 11

auugaggaga agauggaggc ugaugccc 28

<210> 12

<211> 28

<212> RNA

<213> Intelligent people

<400> 12

ggaggaagaa gcugagaagc uaaaggag 28

<210> 13

<211> 28

<212> RNA

<213> Intelligent people

<400> 13

aacgagguag agaagcagau gaauauga 28

<210> 14

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR2

<400> 14

agcagaugaa uaugagucca 20

<210> 15

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR2

<400> 15

uggacucaua uucaucugcu u 21

<210> 16

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR3

<400> 16

gagguagaga agcagaugaa 20

<210> 17

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR3

<400> 17

uucaucugcu ucucuaccuc g 21

<210> 18

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR4

<400> 18

cugagaagcu aaaggagcua 20

<210> 19

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR4

<400> 19

uagcuccuuu agcuucucag c 21

<210> 20

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR5

<400> 20

uagagcgaca ucaugguauu 20

<210> 21

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR5

<400> 21

aauaccauga ugucgcucua g 21

<210> 22

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR6

<400> 22

gugacaaauu uaguggccau 20

<210> 23

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR6

<400> 23

auggccacua aauuugucac a 21

<210> 24

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR7

<400> 24

auggugcaac agcagaagag 20

<210> 25

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR7

<400> 25

cucuucugcu guugcaccau a 21

<210> 26

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR9

<400> 26

guagagaagc agaugaauau 20

<210> 27

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR9

<400> 27

auauucaucu gcuucucuac c 21

<210> 28

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR11

<400> 28

gguuuuaaca gcaggccccg 20

<210> 29

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR11

<400> 29

cggggccugc uguuaaaacc a 21

<210> 30

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR13

<400> 30

cgacaucaug guauuccccu 20

<210> 31

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR13

<400> 31

aggggaauac caugaugucg c 21

<210> 32

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR14

<400> 32

gagaagcaga ugaauaugag 20

<210> 33

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR14

<400> 33

cucauauuca ucugcuucuc u 21

<210> 34

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR15

<400> 34

aggagaagau ggaggcugau 20

<210> 35

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR15

<400> 35

aucagccucc aucuucuccu c 21

<210> 36

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR16

<400> 36

gaagaagcug agaagcuaaa 20

<210> 37

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR16

<400> 37

uuuagcuucu cagcuucuuc c 21

<210> 38

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> effector sequences of shmiR17

<400> 38

agguagagaa gcagaugaau 20

<210> 39

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> effector complement sequence of shmiR17

<400> 39

auucaucugc uucucuaccu c 21

<210> 40

<211> 18

<212> RNA

<213> Artificial sequence

<220>

<223> Stem-Ring

<400> 40

acugugaagc agaugggu 18

<210> 41

<211> 26

<212> RNA

<213> Artificial sequence

<220>

<223> 5' flanking sequence of pri-miRNA backbone

<220>

<221> misc_feature

<222> (26)..(26)

<223> n is u or a

<400> 41

gguauauugc uguugacagu gagcgn 26

<210> 42

<211> 22

<212> RNA

<213> Artificial sequence

<220>

<223> 3' flanking sequence of pri-miRNA backbone

<400> 42

cgccuacugc cucggacuuc aa 22

<210> 43

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR2

<400> 43

gguauauugc uguugacagu gagcguagca gaugaauaug aguccaacug ugaagcagau 60

ggguuggacu cauauucauc ugcuucgccu acugccucgg acuucaa 107

<210> 44

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR3

<400> 44

gguauauugc uguugacagu gagcgagagg uagagaagca gaugaaacug ugaagcagau 60

ggguuucauc ugcuucucua ccucgcgccu acugccucgg acuucaa 107

<210> 45

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR4

<400> 45

gguauauugc uguugacagu gagcgacuga gaagcuaaag gagcuaacug ugaagcagau 60

ggguuagcuc cuuuagcuuc ucagccgccu acugccucgg acuucaa 107

<210> 46

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR5

<400> 46

gguauauugc uguugacagu gagcgauaga gcgacaucau gguauuacug ugaagcagau 60

ggguaauacc augaugucgc ucuagcgccu acugccucgg acuucaa 107

<210> 47

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR6

<400> 47

gguauauugc uguugacagu gagcgaguga caaauuuagu ggccauacug ugaagcagau 60

ggguauggcc acuaaauuug ucacacgccu acugccucgg acuucaa 107

<210> 48

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR7

<400> 48

gguauauugc uguugacagu gagcgaaugg ugcaacagca gaagagacug ugaagcagau 60

gggucucuuc ugcuguugca ccauacgccu acugccucgg acuucaa 107

<210> 49

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR9

<400> 49

gguauauugc uguugacagu gagcgaguag agaagcagau gaauauacug ugaagcagau 60

ggguauauuc aucugcuucu cuacccgccu acugccucgg acuucaa 107

<210> 50

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR11

<400> 50

gguauauugc uguugacagu gagcgagguu uuaacagcag gccccgacug ugaagcagau 60

gggucggggc cugcuguuaa aaccacgccu acugccucgg acuucaa 107

<210> 51

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR13

<400> 51

gguauauugc uguugacagu gagcgacgac aucaugguau uccccuacug ugaagcagau 60

ggguagggga auaccaugau gucgccgccu acugccucgg acuucaa 107

<210> 52

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR14

<400> 52

gguauauugc uguugacagu gagcgugaga agcagaugaa uaugagacug ugaagcagau 60

gggucucaua uucaucugcu ucucucgccu acugccucgg acuucaa 107

<210> 53

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR15

<400> 53

gguauauugc uguugacagu gagcgaagga gaagauggag gcugauacug ugaagcagau 60

ggguaucagc cuccaucuuc uccuccgccu acugccucgg acuucaa 107

<210> 54

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR16

<400> 54

gguauauugc uguugacagu gagcgagaag aagcugagaa gcuaaaacug ugaagcagau 60

ggguuuuagc uucucagcuu cuucccgccu acugccucgg acuucaa 107

<210> 55

<211> 107

<212> RNA

<213> Artificial sequence

<220>

<223> RNA sequence encoding shmiR17

<400> 55

gguauauugc uguugacagu gagcgaaggu agagaagcag augaauacug ugaagcagau 60

ggguauucau cugcuucucu accuccgccu acugccucgg acuucaa 107

<210> 56

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR2

<400> 56

ggtatattgc tgttgacagt gagcgtagca gatgaatatg agtccaactg tgaagcagat 60

gggttggact catattcatc tgcttcgcct actgcctcgg acttcaa 107

<210> 57

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR3

<400> 57

ggtatattgc tgttgacagt gagcgagagg tagagaagca gatgaaactg tgaagcagat 60

gggtttcatc tgcttctcta cctcgcgcct actgcctcgg acttcaa 107

<210> 58

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR4

<400> 58

ggtatattgc tgttgacagt gagcgactga gaagctaaag gagctaactg tgaagcagat 60

gggttagctc ctttagcttc tcagccgcct actgcctcgg acttcaa 107

<210> 59

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR5

<400> 59

ggtatattgc tgttgacagt gagcgataga gcgacatcat ggtattactg tgaagcagat 60

gggtaatacc atgatgtcgc tctagcgcct actgcctcgg acttcaa 107

<210> 60

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR6

<400> 60

ggtatattgc tgttgacagt gagcgagtga caaatttagt ggccatactg tgaagcagat 60

gggtatggcc actaaatttg tcacacgcct actgcctcgg acttcaa 107

<210> 61

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR7

<400> 61

ggtatattgc tgttgacagt gagcgaatgg tgcaacagca gaagagactg tgaagcagat 60

gggtctcttc tgctgttgca ccatacgcct actgcctcgg acttcaa 107

<210> 62

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR9

<400> 62

ggtatattgc tgttgacagt gagcgagtag agaagcagat gaatatactg tgaagcagat 60

gggtatattc atctgcttct ctacccgcct actgcctcgg acttcaa 107

<210> 63

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR11

<400> 63

ggtatattgc tgttgacagt gagcgaggtt ttaacagcag gccccgactg tgaagcagat 60

gggtcggggc ctgctgttaa aaccacgcct actgcctcgg acttcaa 107

<210> 64

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR13

<400> 64

ggtatattgc tgttgacagt gagcgacgac atcatggtat tcccctactg tgaagcagat 60

gggtagggga ataccatgat gtcgccgcct actgcctcgg acttcaa 107

<210> 65

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR14

<400> 65

ggtatattgc tgttgacagt gagcgtgaga agcagatgaa tatgagactg tgaagcagat 60

gggtctcata ttcatctgct tctctcgcct actgcctcgg acttcaa 107

<210> 66

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR15

<400> 66

ggtatattgc tgttgacagt gagcgaagga gaagatggag gctgatactg tgaagcagat 60

gggtatcagc ctccatcttc tcctccgcct actgcctcgg acttcaa 107

<210> 67

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR16

<400> 67

ggtatattgc tgttgacagt gagcgagaag aagctgagaa gctaaaactg tgaagcagat 60

gggttttagc ttctcagctt cttcccgcct actgcctcgg acttcaa 107

<210> 68

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> DNA sequence encoding shmiR17

<400> 68

ggtatattgc tgttgacagt gagcgaaggt agagaagcag atgaatactg tgaagcagat 60

gggtattcat ctgcttctct acctccgcct actgcctcgg acttcaa 107

<210> 69

<211> 2532

<212> DNA

<213> Artificial sequence

<220>

<223> version 1 of the dual expression construct encoding shmiR3, shmiR14 and codon-optimized PABPN1

<400> 69

cgatcgcgcg cagatctgtc atgatgatcc tagcatgctg cccatgtaag gaggcaaggc 60

ctggggacac ccgagatgcc tggttataat taacccagac atgtggctgc cccccccccc 120

ccaacacctg ctgcctctaa aaataaccct gcatgccatg ttcccggcga agggccagct 180

gtcccccgcc agctagactc agcacttagt ttaggaacca gtgagcaagt cagcccttgg 240

ggcagcccat acaaggccat ggggctgggc aagctgcacg cctgggtccg gggtgggcac 300

ggtgcccggg caacgagctg aaagctcatc tgctctcagg ggcccctccc tggggacagc 360

ccctcctggc tagtcacacc ctgtaggctc ctctatataa cccaggggca caggggctgc 420

cctcattcta ccaccacctc cacagcacag acagacactc aggagccagc cagcgtcgat 480

cattgaagtt actattccga agttcctatt ctctagaatt cgccaccacg cgtggtatat 540

tgctgttgac agtgagcgag aggtagagaa gcagatgaaa ctgtgaagca gatgggtttc 600

atctgcttct ctacctcgcg cctactgcct cggacttcaa atcatctact ccatggccct 660

ctgcgtttgc tgaagacaga accgcaaagc aggacccgac aggattctcc ccgcctcttc 720

agagactatg tttacaagat atcggtatat tgctgttgac agtgagcgtg agaagcagat 780

gaatatgaga ctgtgaagca gatgggtctc atattcatct gcttctctcg cctactgcct 840

cggacttcaa gtcgacgcta gcaataaagg atcctttatt ttcattggat ccgtgtgttg 900

gttttttgtg tgcggttaat taaggtaccc gagctccacc gcggtggcgg ccgtccgccc 960

tcggcaccat cctcacgaca cccaaatatg gcgacgggtg aggaatggtg gggagttatt 1020

tttagagcgg tgaggaaggt gggcaggcag caggtgttgg cgctctaaaa ataactcccg 1080

ggagttattt ttagagcgga ggaatggtgg acacccaaat atggcgacgg ttcctcaccc 1140

gtcgccatat ttgggtgtcc gccctcggcc ggggccgcat tcctgggggc cgggcggtgc 1200

tcccgcccgc ctcgataaaa ggctccgggg ccggcggcgg cccacgagct acccggagga 1260

gcgggaggcg ccaagctcta gaactagtgg atcccccggg ctgcaggaat tcgatgccac 1320

catggccgct gccgccgctg ctgctgccgc agccggcgct gccggcggaa gaggcagcgg 1380

ccctggcaga cggcggcatc tggtccctgg cgccggaggg gaggccggcg aaggcgcccc 1440

tggcggagcc ggcgactacg gcaacggcct ggaaagcgag gaactggaac ccgaggaact 1500

gctgctggaa cctgagcccg agccagagcc cgaggaagag ccccctaggc caagagcccc 1560

ccctggcgcc ccaggaccag gaccaggctc tggggcacca ggctctcagg aagaggaaga 1620

agagcccggc ctcgtcgagg gagacccagg cgatggcgct atcgaagatc ccgagctgga 1680

agccatcaag gccagagtgc gggagatgga agaggaggcc gaaaaattga aagagctgca 1740

gaacgaagtc gaaaaacaaa tgaacatgtc cccccctcct ggaaatgctg gccctgtgat 1800

catgagcatc gaggaaaaga tggaagccga cgcccggtct atctacgtgg gcaacgtgga 1860

ctacggcgcc accgccgaag aactggaagc ccactttcac ggctgtggca gcgtgaaccg 1920

ggtgaccatc ctgtgcgaca agttcagcgg ccaccccaag ggcttcgcct acatcgagtt 1980

cagcgacaaa gaaagcgtgc ggacctctct ggctctcgac gagtctctgt tcaggggaag 2040

gcagatcaag gtcatcccca agcggaccaa caggcccggc atcagcacca ccgacagagg 2100

cttccctagg gctaggtaca gagcccggac caccaactac aacagcagca gaagccggtt 2160

ctacagcggc ttcaattctc ggcctagagg cagagtgtac cggggcaggg ccagggccac 2220

ctcctggtac agcccctacg aacagaagct gatcagcgag gaagatctgt gatgagatat 2280

ctgatgacat atgacgcgtt taattaactg tgccttctag ttgccagcca tctgttgttt 2340

gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 2400

aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 2460

tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 2520

tgggctctat gg 2532

<210> 70

<211> 2532

<212> DNA

<213> Artificial sequence

<220>

<223> version 1 of the dual expression construct encoding shmiR17, shmiR13 and codon-optimized PABPN1

<400> 70

cgatcgcgcg cagatctgtc atgatgatcc tagcatgctg cccatgtaag gaggcaaggc 60

ctggggacac ccgagatgcc tggttataat taacccagac atgtggctgc cccccccccc 120

ccaacacctg ctgcctctaa aaataaccct gcatgccatg ttcccggcga agggccagct 180

gtcccccgcc agctagactc agcacttagt ttaggaacca gtgagcaagt cagcccttgg 240

ggcagcccat acaaggccat ggggctgggc aagctgcacg cctgggtccg gggtgggcac 300

ggtgcccggg caacgagctg aaagctcatc tgctctcagg ggcccctccc tggggacagc 360

ccctcctggc tagtcacacc ctgtaggctc ctctatataa cccaggggca caggggctgc 420

cctcattcta ccaccacctc cacagcacag acagacactc aggagccagc cagcgtcgat 480

cattgaagtt actattccga agttcctatt ctctagaatt cgccaccacg cgtggtatat 540

tgctgttgac agtgagcgaa ggtagagaag cagatgaata ctgtgaagca gatgggtatt 600

catctgcttc tctacctccg cctactgcct cggacttcaa atcatctact ccatggccct 660

ctgcgtttgc tgaagacaga accgcaaagc aggacccgac aggattctcc ccgcctcttc 720

agagactatg tttacaagat atcggtatat tgctgttgac agtgagcgac gacatcatgg 780

tattccccta ctgtgaagca gatgggtagg ggaataccat gatgtcgccg cctactgcct 840

cggacttcaa gtcgacgcta gcaataaagg atcctttatt ttcattggat ccgtgtgttg 900

gttttttgtg tgcggttaat taaggtaccc gagctccacc gcggtggcgg ccgtccgccc 960

tcggcaccat cctcacgaca cccaaatatg gcgacgggtg aggaatggtg gggagttatt 1020

tttagagcgg tgaggaaggt gggcaggcag caggtgttgg cgctctaaaa ataactcccg 1080

ggagttattt ttagagcgga ggaatggtgg acacccaaat atggcgacgg ttcctcaccc 1140

gtcgccatat ttgggtgtcc gccctcggcc ggggccgcat tcctgggggc cgggcggtgc 1200

tcccgcccgc ctcgataaaa ggctccgggg ccggcggcgg cccacgagct acccggagga 1260

gcgggaggcg ccaagctcta gaactagtgg atcccccggg ctgcaggaat tcgatgccac 1320

catggccgct gccgccgctg ctgctgccgc agccggcgct gccggcggaa gaggcagcgg 1380

ccctggcaga cggcggcatc tggtccctgg cgccggaggg gaggccggcg aaggcgcccc 1440

tggcggagcc ggcgactacg gcaacggcct ggaaagcgag gaactggaac ccgaggaact 1500

gctgctggaa cctgagcccg agccagagcc cgaggaagag ccccctaggc caagagcccc 1560

ccctggcgcc ccaggaccag gaccaggctc tggggcacca ggctctcagg aagaggaaga 1620

agagcccggc ctcgtcgagg gagacccagg cgatggcgct atcgaagatc ccgagctgga 1680

agccatcaag gccagagtgc gggagatgga agaggaggcc gaaaaattga aagagctgca 1740

gaacgaagtc gaaaaacaaa tgaacatgtc cccccctcct ggaaatgctg gccctgtgat 1800

catgagcatc gaggaaaaga tggaagccga cgcccggtct atctacgtgg gcaacgtgga 1860

ctacggcgcc accgccgaag aactggaagc ccactttcac ggctgtggca gcgtgaaccg 1920

ggtgaccatc ctgtgcgaca agttcagcgg ccaccccaag ggcttcgcct acatcgagtt 1980

cagcgacaaa gaaagcgtgc ggacctctct ggctctcgac gagtctctgt tcaggggaag 2040

gcagatcaag gtcatcccca agcggaccaa caggcccggc atcagcacca ccgacagagg 2100

cttccctagg gctaggtaca gagcccggac caccaactac aacagcagca gaagccggtt 2160

ctacagcggc ttcaattctc ggcctagagg cagagtgtac cggggcaggg ccagggccac 2220

ctcctggtac agcccctacg aacagaagct gatcagcgag gaagatctgt gatgagatat 2280

ctgatgacat atgacgcgtt taattaactg tgccttctag ttgccagcca tctgttgttt 2340

gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 2400

aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 2460

tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 2520

tgggctctat gg 2532

<210> 71

<211> 1943

<212> DNA

<213> Artificial sequence

<220>

<223> version 2 of the dual expression construct encoding shmiR3, shmiR14 and codon-optimized PABPN1

<400> 71

cgagctccac cgcggtggcg gccgtccgcc ctcggcacca tcctcacgac acccaaatat 60

ggcgacgggt gaggaatggt ggggagttat ttttagagcg gtgaggaagg tgggcaggca 120

gcaggtgttg gcgctctaaa aataactccc gggagttatt tttagagcgg aggaatggtg 180

gacacccaaa tatggcgacg gttcctcacc cgtcgccata tttgggtgtc cgccctcggc 240

cggggccgca ttcctggggg ccgggcggtg ctcccgcccg cctcgataaa aggctccggg 300

gccggcggcg gcccacgagc tacccggagg agcgggaggc gccaagctct agaactagtg 360

gatcccccgg gctgcaggaa ttcgatgcca ccatggccgc tgccgccgct gctgctgccg 420

cagccggcgc tgccggcgga agaggcagcg gccctggcag acggcggcat ctggtccctg 480

gcgccggagg ggaggccggc gaaggcgccc ctggcggagc cggcgactac ggcaacggcc 540

tggaaagcga ggaactggaa cccgaggaac tgctgctgga acctgagccc gagccagagc 600

ccgaggaaga gccccctagg ccaagagccc cccctggcgc cccaggacca ggaccaggct 660

ctggggcacc aggctctcag gaagaggaag aagagcccgg cctcgtcgag ggagacccag 720

gcgatggcgc tatcgaagat cccgagctgg aagccatcaa ggccagagtg cgggagatgg 780

aagaggaggc cgaaaaattg aaagagctgc agaacgaagt cgaaaaacaa atgaacatgt 840

ccccccctcc tggaaatgct ggccctgtga tcatgagcat cgaggaaaag atggaagccg 900

acgcccggtc tatctacgtg ggcaacgtgg actacggcgc caccgccgaa gaactggaag 960

cccactttca cggctgtggc agcgtgaacc gggtgaccat cctgtgcgac aagttcagcg 1020

gccaccccaa gggcttcgcc tacatcgagt tcagcgacaa agaaagcgtg cggacctctc 1080

tggctctcga cgagtctctg ttcaggggaa ggcagatcaa ggtcatcccc aagcggacca 1140

acaggcccgg catcagcacc accgacagag gcttccctag ggctaggtac agagcccgga 1200

ccaccaacta caacagcagc agaagccggt tctacagcgg cttcaattct cggcctagag 1260

gcagagtgta ccggggcagg gccagggcca cctcctggta cagcccctac tgatgacata 1320

tgacgcgtgg tatattgctg ttgacagtga gcgagaggta gagaagcaga tgaaactgtg 1380

aagcagatgg gtttcatctg cttctctacc tcgcgcctac tgcctcggac ttcaaatcat 1440

ctactccatg gccctctgcg tttgctgaag acagaaccgc aaagcaggac ccgacaggat 1500

tctccccgcc tcttcagaga ctatgtttac aagatatcgg tatattgctg ttgacagtga 1560

gcgtgagaag cagatgaata tgagactgtg aagcagatgg gtctcatatt catctgcttc 1620

tctcgcctac tgcctcggac ttcaagtcga cgctagcaat aaaggatcct ttattttcat 1680

tggatccgtg tgttggtttt ttgtgtgcgg ttaattaact gtgccttcta gttgccagcc 1740

atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 1800

cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 1860

ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 1920

tggggatgcg gtgggctcta tgg 1943

<210> 72

<211> 1943

<212> DNA

<213> Artificial sequence

<220>

<223> double construct version 2 encoding shmiR17, shmiR13 and codon-optimized PABPN1

<400> 72

cgagctccac cgcggtggcg gccgtccgcc ctcggcacca tcctcacgac acccaaatat 60

ggcgacgggt gaggaatggt ggggagttat ttttagagcg gtgaggaagg tgggcaggca 120

gcaggtgttg gcgctctaaa aataactccc gggagttatt tttagagcgg aggaatggtg 180

gacacccaaa tatggcgacg gttcctcacc cgtcgccata tttgggtgtc cgccctcggc 240

cggggccgca ttcctggggg ccgggcggtg ctcccgcccg cctcgataaa aggctccggg 300

gccggcggcg gcccacgagc tacccggagg agcgggaggc gccaagctct agaactagtg 360

gatcccccgg gctgcaggaa ttcgatgcca ccatggccgc tgccgccgct gctgctgccg 420

cagccggcgc tgccggcgga agaggcagcg gccctggcag acggcggcat ctggtccctg 480

gcgccggagg ggaggccggc gaaggcgccc ctggcggagc cggcgactac ggcaacggcc 540

tggaaagcga ggaactggaa cccgaggaac tgctgctgga acctgagccc gagccagagc 600

ccgaggaaga gccccctagg ccaagagccc cccctggcgc cccaggacca ggaccaggct 660

ctggggcacc aggctctcag gaagaggaag aagagcccgg cctcgtcgag ggagacccag 720

gcgatggcgc tatcgaagat cccgagctgg aagccatcaa ggccagagtg cgggagatgg 780

aagaggaggc cgaaaaattg aaagagctgc agaacgaagt cgaaaaacaa atgaacatgt 840

ccccccctcc tggaaatgct ggccctgtga tcatgagcat cgaggaaaag atggaagccg 900

acgcccggtc tatctacgtg ggcaacgtgg actacggcgc caccgccgaa gaactggaag 960

cccactttca cggctgtggc agcgtgaacc gggtgaccat cctgtgcgac aagttcagcg 1020

gccaccccaa gggcttcgcc tacatcgagt tcagcgacaa agaaagcgtg cggacctctc 1080

tggctctcga cgagtctctg ttcaggggaa ggcagatcaa ggtcatcccc aagcggacca 1140

acaggcccgg catcagcacc accgacagag gcttccctag ggctaggtac agagcccgga 1200

ccaccaacta caacagcagc agaagccggt tctacagcgg cttcaattct cggcctagag 1260

gcagagtgta ccggggcagg gccagggcca cctcctggta cagcccctac tgatgacata 1320

tgacgcgtgg tatattgctg ttgacagtga gcgaaggtag agaagcagat gaatactgtg 1380

aagcagatgg gtattcatct gcttctctac ctccgcctac tgcctcggac ttcaaatcat 1440

ctactccatg gccctctgcg tttgctgaag acagaaccgc aaagcaggac ccgacaggat 1500

tctccccgcc tcttcagaga ctatgtttac aagatatcgg tatattgctg ttgacagtga 1560

gcgacgacat catggtattc ccctactgtg aagcagatgg gtaggggaat accatgatgt 1620

cgccgcctac tgcctcggac ttcaagtcga cgctagcaat aaaggatcct ttattttcat 1680

tggatccgtg tgttggtttt ttgtgtgcgg ttaattaact gtgccttcta gttgccagcc 1740

atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 1800

cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 1860

ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 1920

tggggatgcg gtgggctcta tgg 1943

<210> 73

<211> 921

<212> DNA

<213> Artificial sequence

<220>

<223> human codon optimized PABPN1 cDNA sequence

<400> 73

atggccgctg ccgccgctgc tgctgccgca gccggcgctg ccggcggaag aggcagcggc 60

cctggcagac ggcggcatct ggtccctggc gccggagggg aggccggcga aggcgcccct 120

ggcggagccg gcgactacgg caacggcctg gaaagcgagg aactggaacc cgaggaactg 180

ctgctggaac ctgagcccga gccagagccc gaggaagagc cccctaggcc aagagccccc 240

cctggcgccc caggaccagg accaggctct ggggcaccag gctctcagga agaggaagaa 300

gagcccggcc tcgtcgaggg agacccaggc gatggcgcta tcgaagatcc cgagctggaa 360

gccatcaagg ccagagtgcg ggagatggaa gaggaggccg aaaaattgaa agagctgcag 420

aacgaagtcg aaaaacaaat gaacatgtcc ccccctcctg gaaatgctgg ccctgtgatc 480

atgagcatcg aggaaaagat ggaagccgac gcccggtcta tctacgtggg caacgtggac 540

tacggcgcca ccgccgaaga actggaagcc cactttcacg gctgtggcag cgtgaaccgg 600

gtgaccatcc tgtgcgacaa gttcagcggc caccccaagg gcttcgccta catcgagttc 660

agcgacaaag aaagcgtgcg gacctctctg gctctcgacg agtctctgtt caggggaagg 720

cagatcaagg tcatccccaa gcggaccaac aggcccggca tcagcaccac cgacagaggc 780

ttccctaggg ctaggtacag agcccggacc accaactaca acagcagcag aagccggttc 840

tacagcggct tcaattctcg gcctagaggc agagtgtacc ggggcagggc cagggccacc 900

tcctggtaca gcccctactg a 921

<210> 74

<211> 306

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of human wild type PABPN1

<400> 74

Met Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Ala Ala Gly Gly

1 5 10 15

Arg Gly Ser Gly Pro Gly Arg Arg Arg His Leu Val Pro Gly Ala Gly

20 25 30

Gly Glu Ala Gly Glu Gly Ala Pro Gly Gly Ala Gly Asp Tyr Gly Asn

35 40 45

Gly Leu Glu Ser Glu Glu Leu Glu Pro Glu Glu Leu Leu Leu Glu Pro

50 55 60

Glu Pro Glu Pro Glu Pro Glu Glu Glu Pro Pro Arg Pro Arg Ala Pro

65 70 75 80

Pro Gly Ala Pro Gly Pro Gly Pro Gly Ser Gly Ala Pro Gly Ser Gln

85 90 95

Glu Glu Glu Glu Glu Pro Gly Leu Val Glu Gly Asp Pro Gly Asp Gly

100 105 110

Ala Ile Glu Asp Pro Glu Leu Glu Ala Ile Lys Ala Arg Val Arg Glu

115 120 125

Met Glu Glu Glu Ala Glu Lys Leu Lys Glu Leu Gln Asn Glu Val Glu

130 135 140

Lys Gln Met Asn Met Ser Pro Pro Pro Gly Asn Ala Gly Pro Val Ile

145 150 155 160

Met Ser Ile Glu Glu Lys Met Glu Ala Asp Ala Arg Ser Ile Tyr Val

165 170 175

Gly Asn Val Asp Tyr Gly Ala Thr Ala Glu Glu Leu Glu Ala His Phe

180 185 190

His Gly Cys Gly Ser Val Asn Arg Val Thr Ile Leu Cys Asp Lys Phe

195 200 205

Ser Gly His Pro Lys Gly Phe Ala Tyr Ile Glu Phe Ser Asp Lys Glu

210 215 220

Ser Val Arg Thr Ser Leu Ala Leu Asp Glu Ser Leu Phe Arg Gly Arg

225 230 235 240

Gln Ile Lys Val Ile Pro Lys Arg Thr Asn Arg Pro Gly Ile Ser Thr

245 250 255

Thr Asp Arg Gly Phe Pro Arg Ala Arg Tyr Arg Ala Arg Thr Thr Asn

260 265 270

Tyr Asn Ser Ser Arg Ser Arg Phe Tyr Ser Gly Phe Asn Ser Arg Pro

275 280 285

Arg Gly Arg Val Tyr Arg Gly Arg Ala Arg Ala Thr Ser Trp Tyr Ser

290 295 300

Pro Tyr

305

<210> 75

<211> 314

<212> PRT

<213> Artificial sequence

<220>

<223> human wild type PABPN1 amino acid sequence (with FLAG tag)

<400> 75

Met Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Ala Ala Gly Gly

1 5 10 15

Arg Gly Ser Gly Pro Gly Arg Arg Arg His Leu Val Pro Gly Ala Gly

20 25 30

Gly Glu Ala Gly Glu Gly Ala Pro Gly Gly Ala Gly Asp Tyr Gly Asn

35 40 45

Gly Leu Glu Ser Glu Glu Leu Glu Pro Glu Glu Leu Leu Leu Glu Pro

50 55 60

Glu Pro Glu Pro Glu Pro Glu Glu Glu Pro Pro Arg Pro Arg Ala Pro

65 70 75 80

Pro Gly Ala Pro Gly Pro Gly Pro Gly Ser Gly Ala Pro Gly Ser Gln

85 90 95

Glu Glu Glu Glu Glu Pro Gly Leu Val Glu Gly Asp Pro Gly Asp Gly

100 105 110

Ala Ile Glu Asp Pro Glu Leu Glu Ala Ile Lys Ala Arg Val Arg Glu

115 120 125

Met Glu Glu Glu Ala Glu Lys Leu Lys Glu Leu Gln Asn Glu Val Glu

130 135 140

Lys Gln Met Asn Met Ser Pro Pro Pro Gly Asn Ala Gly Pro Val Ile

145 150 155 160

Met Ser Ile Glu Glu Lys Met Glu Ala Asp Ala Arg Ser Ile Tyr Val

165 170 175

Gly Asn Val Asp Tyr Gly Ala Thr Ala Glu Glu Leu Glu Ala His Phe

180 185 190

His Gly Cys Gly Ser Val Asn Arg Val Thr Ile Leu Cys Asp Lys Phe

195 200 205

Ser Gly His Pro Lys Gly Phe Ala Tyr Ile Glu Phe Ser Asp Lys Glu

210 215 220

Ser Val Arg Thr Ser Leu Ala Leu Asp Glu Ser Leu Phe Arg Gly Arg

225 230 235 240

Gln Ile Lys Val Ile Pro Lys Arg Thr Asn Arg Pro Gly Ile Ser Thr

245 250 255

Thr Asp Arg Gly Phe Pro Arg Ala Arg Tyr Arg Ala Arg Thr Thr Asn

260 265 270

Tyr Asn Ser Ser Arg Ser Arg Phe Tyr Ser Gly Phe Asn Ser Arg Pro

275 280 285

Arg Gly Arg Val Tyr Arg Gly Arg Ala Arg Ala Thr Ser Trp Tyr Ser

290 295 300

Pro Tyr Asp Tyr Lys Asp Asp Asp Asp Lys

305 310

<210> 76

<211> 314

<212> PRT

<213> Artificial sequence

<220>

<223> human codon optimized PABPN1 amino acid sequence (with FLAG-tag)

<400> 76

Met Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Ala Ala Gly Gly

1 5 10 15

Arg Gly Ser Gly Pro Gly Arg Arg Arg His Leu Val Pro Gly Ala Gly

20 25 30

Gly Glu Ala Gly Glu Gly Ala Pro Gly Gly Ala Gly Asp Tyr Gly Asn

35 40 45

Gly Leu Glu Ser Glu Glu Leu Glu Pro Glu Glu Leu Leu Leu Glu Pro

50 55 60

Glu Pro Glu Pro Glu Pro Glu Glu Glu Pro Pro Arg Pro Arg Ala Pro

65 70 75 80

Pro Gly Ala Pro Gly Pro Gly Pro Gly Ser Gly Ala Pro Gly Ser Gln

85 90 95

Glu Glu Glu Glu Glu Pro Gly Leu Val Glu Gly Asp Pro Gly Asp Gly

100 105 110

Ala Ile Glu Asp Pro Glu Leu Glu Ala Ile Lys Ala Arg Val Arg Glu

115 120 125

Met Glu Glu Glu Ala Glu Lys Leu Lys Glu Leu Gln Asn Glu Val Glu

130 135 140

Lys Gln Met Asn Met Ser Pro Pro Pro Gly Asn Ala Gly Pro Val Ile

145 150 155 160

Met Ser Ile Glu Glu Lys Met Glu Ala Asp Ala Arg Ser Ile Tyr Val

165 170 175

Gly Asn Val Asp Tyr Gly Ala Thr Ala Glu Glu Leu Glu Ala His Phe

180 185 190

His Gly Cys Gly Ser Val Asn Arg Val Thr Ile Leu Cys Asp Lys Phe

195 200 205

Ser Gly His Pro Lys Gly Phe Ala Tyr Ile Glu Phe Ser Asp Lys Glu

210 215 220

Ser Val Arg Thr Ser Leu Ala Leu Asp Glu Ser Leu Phe Arg Gly Arg

225 230 235 240

Gln Ile Lys Val Ile Pro Lys Arg Thr Asn Arg Pro Gly Ile Ser Thr

245 250 255

Thr Asp Arg Gly Phe Pro Arg Ala Arg Tyr Arg Ala Arg Thr Thr Asn

260 265 270

Tyr Asn Ser Ser Arg Ser Arg Phe Tyr Ser Gly Phe Asn Ser Arg Pro

275 280 285

Arg Gly Arg Val Tyr Arg Gly Arg Ala Arg Ala Thr Ser Trp Tyr Ser

290 295 300

Pro Tyr Asp Tyr Lys Asp Asp Asp Asp Lys

305 310

<210> 77

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> wtpABPPN 1-Fwd primer

<400> 77

atggtgcaac agcagaagag 20

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> wtpABPPN 1-Rev primer

<400> 78

ctttgggatg gccactaaat 20

<210> 79

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> wtpABPPN 1-Probe

<400> 79

cggttgactg aaccacagcc atg 23

<210> 80

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> optPABPN1-For primer

<400> 80

accgacagag gcttcccta 19

<210> 81

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> optPABPN1-Rev primer

<400> 81

ttctgctgct gttgtagttg g 21

<210> 82

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> optpABPABPN 1-Probe

<400> 82

tggtccgggc tctgtaccta gcc 23

<210> 83

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> shmiR3-Fwd primer

<400> 83

ttcatctgct tctctacctc g 21

<210> 84

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> shmiR13-Fwd primer

<400> 84

aggggaatac catgatgtcg c 21

<210> 85

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> shmiR14-Fwd primer

<400> 85

ctcatattca tctgcttctc t 21

<210> 86

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> shmiR17-Fwd primer

<400> 86

attcatctgc ttctctacct c 21

<210> 87

<211> 64

<212> PRT

<213> adeno-associated virus serotype 9

<400> 87

Ala Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly Pro Gly Asn

1 5 10 15

Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu

20 25 30

Glu His Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro

35 40 45

Tyr Leu Lys Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Lys

50 55 60

<210> 88

<211> 64

<212> PRT

<213> Artificial sequence

<220>

<223> modified VP1 PL subsequence of AAV9

<400> 88

Ser Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly Pro Gly Asn

1 5 10 15

Gly Leu Asp Lys Gly Glu Pro Val Asn Glu Ala Asp Ala Ala Ala Leu

20 25 30

Glu His Asp Lys Ala Tyr Asp Arg Gln Leu Asp Ser Gly Asp Asn Pro

35 40 45

Tyr Leu Lys Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Lys

50 55 60

<210> 89

<211> 736

<212> PRT

<213> adeno-associated virus serotype 9

<400> 89

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro

20 25 30

Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly

145 150 155 160

Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn

260 265 270

Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp

370 375 380

Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu

405 410 415

Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser

435 440 445

Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser

450 455 460

Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro

465 470 475 480

Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn

485 490 495

Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn

500 505 510

Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys

515 520 525

Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly

530 535 540

Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile

545 550 555 560

Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser

565 570 575

Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln

580 585 590

Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 90

<211> 736

<212> PRT

<213> Artificial sequence

<220>

<223> modified AAV9 capsid VP1 (full length)

<400> 90

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro

20 25 30

Lys Ala Asn Gln Gln His Gln Asp Asn Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly

145 150 155 160

Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn

260 265 270

Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp

370 375 380

Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu

405 410 415

Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser

435 440 445

Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser

450 455 460

Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro

465 470 475 480

Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn

485 490 495

Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn

500 505 510

Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys

515 520 525

Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly

530 535 540

Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile

545 550 555 560

Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser

565 570 575

Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln

580 585 590

Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 91

<211> 64

<212> PRT

<213> adeno-associated virus serotype 8

<400> 91

Gly Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly Pro Phe Asn

1 5 10 15

Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu

20 25 30

Glu His Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro

35 40 45

Tyr Leu Arg Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln

50 55 60

<210> 92

<211> 64

<212> PRT

<213> Artificial sequence

<220>

<223> modified VP1 PL subsequence of AAV8

<400> 92

Ser Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly Pro Phe Asn

1 5 10 15

Gly Leu Asp Lys Gly Glu Pro Val Asn Glu Ala Asp Ala Ala Ala Leu

20 25 30

Glu His Asp Lys Ala Tyr Asp Arg Gln Leu Asp Ser Gly Asp Asn Pro

35 40 45

Tyr Leu Arg Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Lys

50 55 60

<210> 93

<211> 738

<212> PRT

<213> adeno-associated virus serotype 8

<400> 93

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro

180 185 190

Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Thr Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Thr Thr Gly Gly Thr Ala Asn Thr Gln Thr Leu Gly

450 455 460

Phe Ser Gln Gly Gly Pro Asn Thr Met Ala Asn Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Gly

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Ala Gly Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asn Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile Leu Ile

530 535 540

Phe Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp Tyr Ser Asp Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Glu Tyr Gly Ile Val Ala Asp Asn Leu Gln Gln Gln Asn Thr Ala

580 585 590

Pro Gln Ile Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Asn Gln Ser Lys Leu Asn Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Ser Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 94

<211> 738

<212> PRT

<213> Artificial sequence

<220>

<223> modification of AAV8 capsid VP1 (full length)

<400> 94

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro

180 185 190

Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Thr Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Thr Thr Gly Gly Thr Ala Asn Thr Gln Thr Leu Gly

450 455 460

Phe Ser Gln Gly Gly Pro Asn Thr Met Ala Asn Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Gly

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Ala Gly Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asn Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile Leu Ile

530 535 540

Phe Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp Tyr Ser Asp Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Glu Tyr Gly Ile Val Ala Asp Asn Leu Gln Gln Gln Asn Thr Ala

580 585 590

Pro Gln Ile Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Asn Gln Ser Lys Leu Asn Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Ser Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 95

<211> 145

<212> DNA

<213> adeno-associated Virus 2

<400> 95

ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60

cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120

gccaactcca tcactagggg ttcct 145

<210> 96

<211> 145

<212> DNA

<213> adeno-associated Virus 2

<400> 96

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120

gagcgcgcag agagggagtg gccaa 145

<210> 97

<211> 735

<212> PRT

<213> adeno-associated Virus 2

<400> 97

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly

145 150 155 160

Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Thr Asn Thr Met Ala Thr Gly Ser Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr

435 440 445

Asn Thr Pro Ser Gly Thr Thr Thr Gln Ser Arg Leu Gln Phe Ser Gln

450 455 460

Ala Gly Ala Ser Asp Ile Arg Asp Gln Ser Arg Asn Trp Leu Pro Gly

465 470 475 480

Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Ser Ala Asp Asn Asn

485 490 495

Asn Ser Glu Tyr Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly

500 505 510

Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly Lys

530 535 540

Gln Gly Ser Glu Lys Thr Asn Val Asp Ile Glu Lys Val Met Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Ser Val Ser Thr Asn Leu Gln Arg Gly Asn Arg Gln Ala Ala Thr

580 585 590

Ala Asp Val Asn Thr Gln Gly Val Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 98

<211> 921

<212> RNA

<213> Intelligent people

<400> 98

auggcggcgg cggcggcggc ggcagcagca gcgggggcug cgggcggucg gggcuccggg 60

ccggggcggc ggcgccaucu ugugcccggg gccggugggg aggccgggga gggggccccg 120

gggggcgcag gggacuacgg gaacggccug gagucugagg aacuggagcc ugaggagcug 180

cugcuggagc ccgagccgga gcccgagccc gaagaggagc cgccccggcc ccgcgccccc 240

ccgggagcuc cgggcccugg gccugguucg ggagcccccg gcagccaaga ggaggaggag 300

gagccgggac uggucgaggg ugacccgggg gacggcgcca uugaggaccc ggagcuggaa 360

gcuaucaaag cucgagucag ggagauggag gaagaagcug agaagcuaaa ggagcuacag 420

aacgagguag agaagcagau gaauaugagu ccaccuccag gcaaugcugg cccggugauc 480

auguccauug aggagaagau ggaggcugau gcccguucca ucuauguugg caauguggac 540

uauggugcaa cagcagaaga gcuggaagcu cacuuucaug gcugugguuc agucaaccgu 600

guuaccauac ugugugacaa auuuaguggc caucccaaag gguuugcgua uauagaguuc 660

ucagacaaag agucagugag gacuuccuug gccuuagaug agucccuauu uagaggaagg 720

caaaucaagg ugaucccaaa acgaaccaac agaccaggca ucagcacaac agaccggggu 780

uuuccacgag cccgcuaccg cgcccggacc accaacuaca acagcucccg cucucgauuc 840

uacagugguu uuaacagcag gccccggggu cgcgucuaca ggggccgggc uagagcgaca 900

ucaugguauu ccccuuacua a 921