Gene for resisting plant diseases

文档序号：1835800 发布日期：2021-11-12 浏览：10次中文

阅读说明：本技术 用于抗植物病害的基因 (Gene for resisting plant diseases ) 是由 O·特尔耶克 D·博尔夏特 M·雷科斯克 W·梅歇尔克 J·C·莱恩 B·舒尔茨于 2019-02-18 设计创作，主要内容包括：通过提供根据本发明的抗性介导基因,能够实现抗植物病害的更有效育种或开发新的抗性品系；特别地,目标植物的抗性效果是由所鉴定基因的特性引起的。前面所述的本发明的实施方式和抗性介导基因提供了旨在开发新的抗性品种的额外应用,例如抗性基因等位基因在反式遗传途径中的用途。(By providing the resistance-mediating gene according to the present invention, more effective breeding against plant diseases or development of new resistant lines can be achieved; in particular, the resistance effect of the target plant is caused by the characteristics of the identified gene. The previously described embodiments of the invention and resistance mediating genes provide additional applications aimed at developing new resistant varieties, such as the use of resistance gene alleles in the trans-genetic pathway.)

1. A nucleic acid molecule encoding a polypeptide capable of conferring resistance to cercospora on a plant expressing said polypeptide, characterized in that said nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of:

(a) encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 3;

(b) comprising a sequence according to SEQ ID NO: 2;

(c) comprising a sequence according to SEQ ID NO: 1 or SEQ ID NO: 53, nucleotide sequence of the DNA sequence of seq id no;

(d) a nucleotide sequence that hybridizes under stringent conditions to the complement of the nucleotide sequence according to (a), (b) or (c);

(e) a nucleotide sequence encoding a polypeptide which differs from the polypeptide encoded by the nucleotide sequence according to (a), (b) or (c) by substitution, deletion and/or addition of one or more amino acids of said amino acid sequence;

(f) encoding a polypeptide having a sequence corresponding to that according to SEQ ID NO: 3, a nucleotide sequence of a polypeptide having an amino acid sequence at least 70% identical to the amino acid sequence of seq id no;

(g) and a polypeptide according to SEQ ID NO: 1 or SEQ ID NO: 2, a nucleotide sequence at least 70% identical to the DNA sequence of 2;

wherein the resistance to Cercospora is preferably resistance to Cercospora betana (Cercospora betacola), or the plant belongs to the subsp of beet (Beta vulgaris subsp.

2. A polypeptide encoded by a nucleic acid molecule according to claim 1.

3. A vector or expression cassette comprising a nucleic acid molecule according to claim 1.

4. A cell comprising a nucleic acid molecule according to claim 1 or a polypeptide according to claim 2.

5. Cercospora resistant plant or part thereof, characterized in that said plant or part thereof endogenously or transgenically comprises a nucleic acid molecule according to claim 1, wherein the plant endogenously comprising said nucleic acid molecule belongs to the beet subspecies.

6. Seed or progeny of a plant according to claim 5, wherein the seed or the progeny comprises the nucleic acid molecule according to claim 1 transgenically or endogenously.

7. Seed according to claim 6, which has been subjected to a technical treatment, wherein the technical treatment is selected from the group consisting of:

(a) the polishing is carried out on the mixture of the raw materials,

(b) the seed is dressed, preferably granulated,

(d) and (4) coloring.

8. A method for increasing the resistance of a plant of the sugar beet species to the genus cercospora, comprising the steps of:

(i) integrating a nucleic acid molecule according to claim 1 into the genome of at least one cell of a plant of the beet species by homologous directed repair or homologous recombination, preferably facilitated by a site-directed nuclease, and optionally regenerating a plant from said plant cell; or

(ii) Increasing the expression of a nucleic acid molecule according to claim 1 in said plant, preferably by modifying the nucleotide sequence according to SEQ ID NO: 7 or by fusing said nucleic acid molecule to a heterologous promoter which exhibits higher activity than the native promoter, in particular after infection with cercospora; or

(iii) Increasing the activity and/or stability of a polypeptide according to claim 3 by modifying the nucleotide sequence of the nucleic acid molecule according to; or

(iv) Transforming a plant cell with a nucleic acid molecule according to claim or a vector or expression cassette according to claim 3 and regenerating a transgenic plant from the transformed plant cell.

9. A method for producing a cercospora resistant plant according to claim 5, comprising the steps of:

(Ia) transforming a plant cell with a nucleic acid molecule according to claim 1 or a vector or expression cassette according to claim 3; and

(Ib) regenerating a transgenic plant from the transformed plant cell; or

(IIa) introducing a site-directed nuclease and a repair matrix into a cell of a beta plant, wherein the site-directed nuclease is capable of generating at least one DNA double strand break in the genome of the cell and the repair matrix comprises a nucleic acid molecule according to claim 1;

(IIb) culturing the cell from (IIa) under conditions that allow homology-directed repair or homologous recombination, wherein the nucleic acid molecule is integrated from the repair matrix into the genome of the plant; and

(IIc) regenerating a plant from the cell modified in (b).

10. Method according to claim 9, characterized in that the at least one double strand break occurs in a sensitive allelic variant of the nucleic acid molecule according to claim 1, or the at least one double strand break occurs at a position of at most 10000 base pairs upstream or downstream of the sensitive allelic variant, wherein the allelic variant encodes a polypeptide that does not confer resistance to cercospora.

11. Method according to claim 10, characterized in that said sensitive allelic variant comprises a nucleotide sequence selected from the group consisting of:

(a) encoding a polypeptide comprising a sequence according to SEQ ID NO: 6, or a nucleotide sequence of a polypeptide of the amino acid sequence of,

(b) comprising a sequence according to SEQ ID NO: 5, or a nucleotide sequence of a sequence of SEQ ID NO,

(d) a nucleotide sequence which hybridizes under stringent conditions to a sequence complementary to one of the nucleotide sequences according to (a), (b) or (c),

(f) encoding a polypeptide comprising a sequence identical to that according to SEQ ID NO: 6 an amino acid sequence which is at least 70% identical to the amino acid sequence of the polypeptide, or

(g) And a polypeptide according to SEQ ID NO: 4 or SEQ ID NO: 5 is at least 70% identical to the sequence of seq id no.

12. Method for identifying and optionally providing plants of sugar beet species resistant to the genus cercospora, characterized in that said method comprises at least steps (i) or (ii):

(i) detecting the presence and/or expression of a nucleic acid molecule according to claim 1, or the presence of a polypeptide according to claim 2, in said plant or part of said plant; and/or

(ii) Detecting at least one marker locus in the nucleotide sequence of the nucleic acid molecule according to claim 1 or in a co-segregating region, and

(iii) optionally selecting said Cercospora resistant plant,

preferably wherein the co-segregating region is a genomic region in sugar beet co-segregating with cercospora resistance conferred by a polypeptide according to claim 2 or with a nucleic acid molecule according to claim 1, more preferably the co-segregating region

a) Comprising markers sxh0678s01 and s4p0264s01 and flanked by markers sxh0678s01 and s4p0264s01, or

b) Comprising a sequence according to SEQ ID NO 74 and/or SEQ ID NO 75.

13. A method for growing plants of the sugar beet species, comprising:

(i) providing a plant according to claim 5, a plant of the beet species produced by a method according to one of claims 8 to 12, or a plant of the genus beta identified and selected by a method according to claim 12, and

(ii) (ii) cultivating the plant from (i) or its progeny,

wherein the method hinders infection of the cultivated plant with Cercospora.

14. An oligonucleotide of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and particularly preferably at least 100, 200, 300 or 500 nucleotides in length, which oligonucleotide specifically hybridizes with a nucleotide sequence as defined in claim 1.

15. Method for producing an organism comprising a mutated form of a nucleic acid molecule according to claim 1 and/or a mutated form of a promoter comprising a nucleic acid sequence selected from the group consisting of:

(a)SEQ ID NO：7，

(b) a nucleotide sequence which hybridizes under stringent conditions to a sequence complementary to the sequence according to (a),

wherein the method comprises the steps of:

(I) providing an organism or cell comprising said nucleic acid molecule and/or said promoter,

(II) increasing the mutation rate of or mutagenizing the organism or the cell,

(III) phenotypic selection of organisms which, as a result of mutation, exhibit an altered resistance or altered level of resistance to Cercospora betaine, or

Genotyping an organism or cell comprising a mutation in said nucleic acid molecule and/or said promoter, wherein said mutation is caused by step (II)

And optionally

(IV) regenerating the organism from the cells obtained by step (III).

Technical Field

The present invention relates to nucleic acid molecules encoding polypeptides capable of conferring resistance to Cercospora, in particular the fungus Cercospora betanae (Cercospora betaca betacola), on plants expressing the polypeptides, in particular plants of the species beet (Beta vulgaris), and to polypeptides encoded by nucleic acid molecules according to the invention. In particular, the nucleic acid molecule according to the invention is characterized in that the resistance effect conferred by the polypeptide on Cercospora is dominant. Furthermore, the invention relates to a cercospora resistant plant, plant cell, plant organ, plant tissue, plant part or seed or progeny of a plant comprising the nucleic acid molecule or part thereof as an endogenous gene, as an editing gene, or as a transgene. Furthermore, the present invention also encompasses methods for increasing the resistance of plants of the sugar beet species to Cercospora, as well as methods for producing or identifying and possibly selecting anti-Cercospora plants. The invention also includes methods for monitoring infection by the pathogen cercospora betanae, as well as oligonucleotide probes and primers for hybridization to nucleic acid molecules according to the invention.

Background

Cercospora leaf spot is one of the most important, global epidemic leaf diseases in plants of the sugar beet species. It is caused by the fungus cercospora betanae. Plants infected with this disease typically form small, relatively round leaf spots (2-3mm), which are pale gray in the middle and reddish brown at the edges. When severely infested, the leaf spots overlap, thereby leaving the entire leaf dry. Small black spots (pseudostroma) were visible in the fully formed spots and a grey felt-like covering (conidia carrier with conidia) was formed mainly under moist conditions in the lower part of the leaf. Severely infected leaves first turn yellow, then brown and die. However, the growth of new leaves occurs in parallel, wherein the leaves are diseased again and die. First, the symptoms of injury are only visible on individual plants; however, as the disease spreads, persistent infection nests often form. Further spread throughout the land by rain and wind.

The pathogen cercospora betanae was first described in italy in the latter half of the 19 th century. Crop losses of up to 40% may be due to severe infestation, which may be caused by wet weather, early row closure (early row closure), high infection potential in the last few years, or strong irrigation. These losses are due to reduced yield and reduced sugar content of the sugar beet crops; see Holtschult ((2000) "Cerco beta-workbench distribution and emphasis" pp.5-16, in "Cerco beta Sacc.biology, agricultural influx and Control Measures in Sugar Beet" vol.2(M.J.C.Asher, B.Holtschult, M.R.Molard, F.Rosso, G.Steinru cken, R.Beckers, eds.) International Institute for Beet Research, Brussels, Belgium, 215 pp.). To combat this disease, intercropping or bactericidal agents are often used. Chemical control of the cercospora farinosa by the bactericide brings cost to farmers and pollutes the environment. Repeated application of the bactericide additionally increases the selective pressure of the bactericide-resistant cercospora betanae strain. This runs counter to sustainable agricultural practice.

Indirect countermeasures were performed by selecting varieties with healthy leaves and growing beets in at least 3 annual rings. Significantly better control of infestation can be achieved by combinations of resistant or resistant varieties. A variety of Neurospora sugar beet resistant to infection has been provided on The market since 2000 (Steinr ü cken 1997, "Die Z ü tung von Cercospora-resistance Zuckerr ü ben." [ "The weaving of Cercospora-resistance sugar beets"]，für Pflanzenzüchtung[Lectures on Plant Breeding]Volume 37, feature symposium, March 4-5, 1997, Kiel). These varieties are quantitatively resistant to cercospora betanae. The resistance of these varieties is based on several genes and is quantitativeInherited, where the exact number of genes responsible for resistance is not known; see Weiland and Koch (2004) (Surgarbeet leaf spot disease (Cercosporia beta Sacc.), The Plant Journal, 5(3), 157-. Complex quantitative inheritance was confirmed by multiple Quantitative Trait Locus (QTL) analysis. This method allows for the localization of resistance to polygenic inheritance and is a reliable technique for identifying the number and location of genetic resistance factors on a genetic linkage map of a host plant. In this way, multiple pathogenic QTLs can be determined on each chromosome of sugar beet.

Mapping was performed using different cercospora resistance donors, where most of the QTL effects observed were minor. The maximum declared phenotype value is 5%.

A list of differentially expressed genes is described in the continuing study. In the Weltmeier et al study ((2011) Transcript profiles in sugar beets genes undercover timing and stripe of death reactions to Central microbial inoculum, Molecular plant-microbial interactions, 24(7), 758-772), whole genome expression profiles for various genotypes of sugar beet (i.e., Cercospora resistance, Cercospora tolerance, Cercospora sensitivity, etc.) were created during pathogen infection with microarray-based techniques to analyze leaf spot-related transcriptional changes in the expression profiles. Through these analyses, the authors created pathogen-induced transcription profiles and identified potential candidate genes in multiple tested genotypes of sugar beet. However, these genes have not been characterized in detail. The genetic and functional background of Cercospora resistance and the identity of the resistance gene (identity) are not known at all to date.

However, by quantitative inheritance of QTLs, not only the desired resistance to cercospora betaine is introduced into a plant, but also unwanted characteristics, such as reduced yield, are often introduced due to the inheritance of additional genes associated with the positive characteristics of cercospora resistance. This phenomenon is also referred to as "linkage drag". Furthermore, the enormous breeding costs required to select multiple resistance loci without reducing yield can negatively impact the vigor of the plant; see Weiland and Koch, 2004.

For more than a decade, breeding companies have offered varieties of cercospora species on the market. The resistance of these varieties is inherited through multiple resistance genes with little effect. However, these varieties have the disadvantage that, due to the complexity of the inheritance, the development of the varieties is very difficult and complex and, without infestation, these varieties have yield properties which are significantly lower than those of normal varieties. This may be associated, inter alia, with the epigenetic interaction of some resistance genes with genes responsible for sugar production, which leads to a reduced adaptability of the plant in the absence of pathogens.

Due to the complexity of genetics and the large number of genes involved in resistance development, many of which have not been identified and characterized, the use of new breeding techniques based on gene editing (e.g., by TALE nucleases or CRISPR systems, as well as transgenic approaches) is not possible in practice.

In order to achieve sustainable breeding against cercospora leaf spot (i.e. to eliminate the risk of cercospora variants overcoming resistance), it is necessary to continually identify new resistance genes and integrate them into the gene bank of cultivated plants (e.g. sugar beet). In particular, it is an object to provide suitable resistance genes which, when expressed in plants, themselves exert a very large dominant resistance effect against Cercospora betaine. According to the invention, this object is achieved by the embodiments described in the claims and the description.

Brief description of the invention

The present invention relates to nucleic acid molecules capable of conferring resistance to a plant, in particular a subsp. Thereby producing the polypeptide encoded by the nucleic acid molecule in the plant. The nucleic acid molecules which, when expressed, produce the polypeptide themselves exert a very large dominant resistance effect in plants against Cercospora betaine.

Furthermore, the present invention relates to a cercospora plant, plant cell, plant organ, plant tissue, plant part or seed, seed stock (seed stock) or progeny of a plant, comprising a nucleic acid molecule or part thereof. The nucleic acid can be constructed, for example, endogenously or transgenically. Furthermore, the nucleic acid may be constituted as an introgression (introgresson). Optionally, plants and their components obtained by basic biological processes are excluded.

The invention also encompasses methods for increasing the resistance of plants of the sugar beet species to Cercospora, as well as methods for generating or identifying and possibly selecting anti-Cercospora plants. The invention also encompasses methods for monitoring the infection by the pathogen cercospora betanae, as well as oligonucleotide probes and primers for hybridization with nucleic acid molecules according to the invention.

The invention thus relates to embodiments which are listed in the following points and illustrated in the examples and figures.

[1] A nucleic acid molecule encoding a polypeptide capable of conferring cercospora resistance to a plant in which it is expressed, comprising a nucleotide sequence selected from the group consisting of:

(a) encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 3;

(b) comprising a sequence according to SEQ ID NO: 2;

(c) comprises a sequence selected from the group consisting of SEQ ID NO: 1 or SEQ ID NO: 53, nucleotide sequence of a DNA sequence of the group consisting of;

(d) a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence according to (a), (b) or (c);

(g) and a polypeptide according to SEQ ID NO: 1 or SEQ ID NO: 2, a nucleotide sequence at least 70% identical to the DNA sequence of 2;

wherein the Cercospora resistance is preferably Cercospora farinosa resistance, or wherein the plant is preferably a beet subspecies plant, particularly preferably beet.

[2] The nucleic acid molecule according to [1], characterized in that the resistance effect conferred by the polypeptide to Cercospora is dominant in plants, preferably wherein the polypeptide confers a resistance effect on at least one scale score, and preferably confers a resistance effect on a plurality of scale scores, particularly preferably confers a resistance effect on at least two scale scores, particularly preferably confers a resistance effect on at least three scale scores, particularly preferably confers a resistance effect on at least four scale scores.

[3] The nucleic acid molecule according to [1] or [2], which is derived from sea beet (Beta vulgaris subsp.

[4] A polypeptide encoded by the nucleic acid molecule according to any one of [1] to [3 ].

[5] A vector or an expression cassette comprising a nucleic acid molecule according to any one of [1] to [3], wherein the nucleic acid molecule is preferably heterologous to the vector or the expression cassette.

[6] A cell comprising a nucleic acid molecule according to any one of [1] to [3] or a vector or expression cassette according to [5], wherein the nucleic acid molecule or the expression cassette is preferably present as an endogenous gene or transgene.

[7] anti-Cercospora plant or part thereof, characterized in that the plant or part thereof endogenously or transgenically comprises a nucleic acid molecule according to any one of [1] to [3] or a vector or expression cassette according to [5], wherein the plant endogenously comprising the nucleic acid molecule is a beet species (non-sea beet)) plant or a beet subspecies.

[8] The plant according to [7], characterized in that the plant is a hybrid plant.

[9] The plant according to [7] or [8], wherein the nucleic acid molecule is present in heterozygous or homozygous form in the genome of the plant.

[10] Seed or progeny of a plant according to any of [7] to [9], wherein the seed or progeny comprises the nucleic acid molecule according to any of [1] to [3] or the vector or expression cassette according to [5] transgenically or endogenously.

[11] A method for increasing resistance of a plant to cercospora, the method comprising the steps of:

(i) integrating the nucleic acid molecule according to any one of [1] to [3] or the vector or expression cassette according to [5] into the genome of at least one cell of a plant by homology directed repair or homologous recombination (preferably supported by site-directed nucleases) and optionally regenerating a plant from the at least one plant cell; or

(ii) In particular after infection with cercospora, preferably by modification, for example, comprising a sequence according to SEQ ID NO: 7, or by contacting a nucleic acid molecule according to any one of [1] to [3] with a nucleic acid molecule having a sequence as defined by a sequence comprising the DNA sequence according to SEQ ID NO: 7 to enhance expression of the nucleic acid molecule according to any one of [1] to [3] in at least one cell of the plant and optionally regenerating a plant from the at least one plant cell; or

(iii) Increasing the activity and/or stability of the polypeptide according to [4] in at least one cell of the plant by modifying the nucleotide sequence of the nucleic acid molecule according to any one of [1] to [3], and optionally regenerating a plant from the at least one plant cell; or

(iv) Transforming a plant cell with a nucleic acid molecule according to any one of [1] to [3] or a vector or expression cassette according to [5], and optionally regenerating a (transgenic) plant from the transformed plant cell;

wherein the Cercospora resistance is preferably Cercospora farinosa resistance, or the plant is preferably a plant of the species beet, preferably subspecies beet, especially beet.

[12] A method for producing a cercospora resistant plant according to any one of [7] to [9], the method comprising the steps of:

(a) transforming a plant cell with the nucleic acid molecule according to any one of [1] to [3] or the vector or expression cassette according to [5 ]; and

(b) regenerating a transgenic plant from the transformed plant cell; or

(i) Introducing a site-directed nuclease and a repair matrix into a cell of a plant of the sugar beet species, wherein the site-directed nuclease is capable of generating at least one DNA double strand break in the genome of the cell (preferably upstream and/or downstream of the target region) and the repair matrix comprises a nucleic acid molecule according to any one of [1] to [3 ];

(ii) (ii) culturing the cell of (i) under conditions that allow for homology-directed repair or homologous recombination, wherein the nucleic acid molecule is integrated into the genome of the plant from the repair matrix; and

(iii) (iii) regenerating a plant from the cell modified in (ii).

[13] The method according to [12], wherein the target region comprises an allelic variant of the nucleic acid molecule according to any one of [1] to [3], wherein the allelic variant encodes a polypeptide that does not confer Cercospora resistance or that has slight Cercospora resistance.

[14] The method according to [12] or [13], wherein the at least one double-strand break occurs at a position of at most 10000 base pairs upstream and/or downstream of the target region, or at a position of at most 10000 base pairs away from the allelic variant defined in [13 ].

[15] The method according to [12] or [13], wherein the allelic variant of the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of:

(a) encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 6;

(b) comprising a sequence according to SEQ ID NO: 5, a nucleotide sequence of the DNA sequence of seq id no;

(d) a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence that is complementary to a nucleotide sequence according to (a), (b) or (c);

(f) Encoding a polypeptide having a sequence corresponding to that according to SEQ ID NO: 6, and a polypeptide having an amino acid sequence at least 80% identical to the amino acid sequence of seq id No. 6.

[16] A plant or part thereof obtained or obtainable by a method according to any one of [12] to [15 ].

[17] Method for identifying and optionally providing a plant of a Saccharum sinensis species resistant to Cercospora, characterized in that the method comprises at least steps (i) or (ii):

(i) detecting the presence and/or expression of a nucleic acid molecule according to any one of [1] to [3] or detecting the presence of a polypeptide according to [4] in the plant or the plant part; and/or

(ii) Detecting at least one marker locus in the nucleotide sequence of the nucleic acid molecule according to any one of [1] to [3], or in the co-segregating region; and

(iii) it is possible to select plants resistant to Cercospora betaine.

[18] A method for identifying a nucleic acid molecule encoding a polypeptide capable of conferring cercospora resistance on a beet species plant expressing the polypeptide, the method comprising the steps of:

(i) aligning the amino acid sequence of the polypeptide according to [4] with amino acid sequences in sequence databases or identifying allelic variants encoding the polypeptide according to [4] in the genotype of a sugar beet species;

(ii) identifying an amino acid sequence or an allelic variant encoding the amino acid sequence, wherein the amino acid sequence is at least 80% identical to the amino acid sequence of the polypeptide according to [4 ];

(iii) introducing a nucleic acid molecule or allelic variant encoding the identified amino acid sequence into a plant of the beet species and expressing the nucleic acid molecule in the plant; and

(iv) resistance to Cercospora was tested.

[19] A method for growing a plant of the sugar beet species, the method comprising:

(i) providing a plant according to any of [7] to [9], producing a plant of the beet species by a method according to any of [12] to [15], or identifying and selecting a plant of the genus beta by a method according to [17 ]; and

(ii) (ii) growing the plant obtained in (i) or its progeny,

wherein the method prevents Cercospora infestation of the cultivated plant.

[20] An oligonucleotide of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, particularly preferably at least 100, 200, 300 or 500 nucleotides in length which hybridizes to a nucleotide sequence as defined in any one of [1] to [3 ].

[21] A pair of oligonucleotides, preferably oligonucleotides according to [20] or a kit comprising these oligonucleotides, wherein the oligonucleotides are suitable for hybridization as forward and reverse primers into regions of the sugar beet genome which are co-isolated with the cercospora resistance conferred by the polypeptide according to [4] or which are co-isolated with the nucleic acid molecule according to any one of [1] to [3 ].

[22] Use of a nucleic acid molecule according to any one of [1] to [3] for the production of a plant of the subspecies betanae genus, resistant to cercospora.

[23] A method for producing an organism comprising a mutant form according to [1] and/or a mutant form of a promoter comprising a nucleic acid sequence selected from the group consisting of:

(a)SEQ ID NO：7

(b) nucleotide sequence hybridizing under stringent conditions with a sequence complementary to a sequence according to (a)

Wherein, the method comprises the following steps:

(I) providing an organism or cell comprising the nucleic acid molecule and/or the promoter

(II) increasing the mutation rate of the organism or the cell, or

Mutagenizing the organism or the cell

(III) selection of a phenotype of an organism which, as a result of a mutation, exhibits an altered resistance or an altered level of resistance to Cercospora betaine or

Selecting the genotype of the organism or cell comprising the mutation in the nucleic acid molecule and/or the promoter, wherein the mutation is generated by step (II)

And optionally

(IV) regenerating the organism from the cells obtained in step (III).

[24] The method according to [23], wherein the organism is a plant.

[25] The method according to [24], wherein the plant is a beet, preferably a beet subspecies, more preferably a beet.

First, some terms used in the present application will be explained in detail below:

a "grade score" in the sense of the present invention is understood as a qualitative assessment of the resistance to infection by cercospora, expressed using a scale from 1 to 9 (where 1 is strong resistance and 9 is no resistance).

Table 1A: grade 9 resistance rating of Cercospora

The genus Cercospora encompasses various species such as Cercospora arachidicola (Cercospora arachidicola), Cercospora arimeriensis, Asparagus officinalis (Cercospora asparagus), Cercospora bertoreae, Cercospora saccharina, Cercospora bizzozeriana, Cercospora variabilis (Cercospora encensis), Cercospora carota (Cercospora carota), Umbiospora odorifera (Cercospora cheopodii), Cercospora cinerea, Cercospora citrina, Sporospora sporotrichioides (Cercospora clathrata), Cercospora diazu, Cercospora durcanae, Cercospora erygiensis, Cercospora harea (Cercospora echinospora), Cercospora japonica (Cercospora aurora), Cercospora nigra (Cercospora), Cercospora cornucospora officinalis (Cercospora cornucopora), Cercospora officinalis (Cercospora cornucopora officinalis (Cercospora cornucopora), Cercospora cornucopora (Cercospora cornucopora), Cercospora (Cercospora coera), Cercospora (Cercospora cornucopora (Cercospora), or Cercospora (Cercospora), Cercospora (Cercospora), or Cercospora (Cercospora), or), Cercospora (Cercospora), or Cercospora (Cercospora), Cercospora (Cercospora), or Cercospora (Cercospora), or Cercospora), or (Cercospora), or), Cercospora (Cercospora), or (Cercospora), or (Cercospora), Cercospora (Cercospora), or Cercospora (Cercospora), or (Cercospora), or), Cercospora (Cercospora), or (Cercospora), or Cercospora (Cercospora), or (Cercospora), or Cercospora), Cercospora (Cercospora), or Cercospora (Cercospora), Cercospora (Cercospora), or (Cercospora.

The term "about" as used in connection with the length of a nucleotide sequence refers to a +/-200 base pair deviation, preferably a +/-100 base pair deviation, and particularly preferably a +/-50 base pair deviation.

"plants of the genus beta" belong to the family Amaranthaceae (amaranth family/Amaranthaceae). These plants include plants of the species Beta macrocarpa, beet (Beta vulgaris), Beta logonona, Beta macrorrhiza, Beta cororoliflora, Beta trigyna and Beta nana. In particular, the plants of the beet species are plants of the beet subspecies. Examples include Beta vulgaris subsp. vulgaris var. album (beet in the narrower sense), Beta vulgaris ssp. vulgaris var. vulgaris (beet leaf), Beta vulgaris ssp. vulgaris var. album (beet root/red beet), Beta vulgaris ssp. vregas var. album (beet leaf), crara/alba (beet for feeding). It should be noted that the nucleic acids according to the invention do not occur naturally in sugar beet, leaf beet, sugar beet root or fodder beet, but can be introduced into them by human action.

"functional fragment" of a nucleotide sequence refers to a segment of a nucleotide sequence whose functionality is identical or equivalent to the functionality of the complete nucleotide sequence from which it is derived. Thus, a functional fragment may be a nucleotide sequence that is identical or homologous to the total nucleotide sequence over at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 96%, 97%, 98%, or 99% of its length. This also explicitly covers the range of 90-100%. Furthermore, a "functional fragment" of a nucleotide sequence may also refer to a fragment of a nucleotide sequence that modifies the functionality of the entire nucleotide sequence, e.g., post-transcriptionally or during transcriptional gene silencing. Thus, a functional fragment of a nucleotide sequence may comprise at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, preferably at least 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120 or 140, particularly preferably at least 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900 or 1,000 consecutive nucleotides in the total nucleotide sequence. This also explicitly covers the range of 21 to 50 nucleotides.

"functional part" of a protein refers to a segment of the protein or a portion of the amino acid sequence encoding the protein, wherein the segment can perform the same or equivalent function as the intact protein in a plant cell. A functional portion of a protein is an amino acid sequence that is the same or similar (allowing for conservative and semi-conservative amino acid exchanges) as the protein from which it is derived over at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 96%, 97%, 98% or 99% of its length.

The term "heterologous" means that the introduced polynucleotide originates from a cell or organism with a different genetic background, belonging to the same species or a different species, or that it is homologous to a prokaryotic or eukaryotic host cell, but is then located in a different genetic environment and thus different from the corresponding polynucleotide which may be naturally present. In addition to the corresponding endogenous gene, a heterologous polynucleotide may be present.

"homologues" in the sense of the present invention are to be understood as proteins having the same phylogenetic origin; "analogs" are understood as proteins which exert the same function but have a different phylogenetic origin; "orthologues" are to be understood as proteins from different species which exert the same function; "paralogs" are to be understood as proteins which occur within a species as a result of replication, wherein such copies retain the same protein function, alter their expression template without altering function, alter their protein function, or melon divide (divide up) the original gene function between two copies.

"hybridization" is understood to mean a process in which a single-stranded nucleic acid molecule binds to a nucleic acid strand which is complementary to it to the greatest possible extent, i.e.forms base pairs with it. Standard methods of hybridization are described, for example, in Sambrook et al, Molecular Cloning: a Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. It is thus preferably to be understood that at least 60%, more preferably at least 65%, 70%, 75%, 80% or 85%, and particularly preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the bases of the nucleic acid molecules form base pairs with the most complementary nucleic acid strand. The feasibility of such annealing depends on the stringency of the hybridization conditions. The term "stringency" relates to hybridization conditions. High stringency exists when base pairing is more difficult. When base pairing is easier, then low stringency exists. For example, the stringency of hybridization conditions depends on salt concentration or ionic strength and temperature. Generally, stringency can be increased by increasing the temperature and/or decreasing the salt content. "stringent hybridization conditions" are to be understood as meaning conditions under which hybridization predominantly occurs only between homologous nucleic acid molecules. The term "hybridization conditions" thus relates not only to the conditions prevailing in the actual addition of nucleic acids, but also to the conditions prevailing in the subsequent washing steps. For example, stringent hybridization conditions refer primarily to hybridization, under such conditions, only those nucleic acid molecules having at least 70%, preferably, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. Stringent hybridization conditions were: for example, hybridization in 4 XSSC at 65 ℃ followed by repeated washes in 0.1 XSSC at 65 ℃ for about 1 hour. Hybridization preferably occurs under stringent conditions.

For nucleic acids in the form of double-stranded DNA, a "complementary" nucleotide sequence refers to a second DNA strand that is complementary to the first DNA strand, having nucleotides corresponding to the bases of the first strand, according to the base pairing rules. The complementary sequence is preferably completely complementary to the anti-sequence and therefore preferably of the same length.

An "isolated nucleic acid molecule" is understood to be a nucleic acid molecule that has been extracted from its natural or original environment. The term also includes synthetically produced nucleic acid molecules. An "isolated polypeptide" is understood to be a polypeptide that is extracted from its natural or original environment. The term also includes synthetically produced polypeptides.

A "molecular marker" is a nucleic acid that has a polymorphism in a population of plants and serves as a reference or targeting point. The marker used to detect the recombination event should be suitable for monitoring differences or polymorphisms within the plant population. Thus, such markers are capable of detecting and distinguishing the status of various alleles (alleles). The term "molecular marker" also relates to a nucleotide sequence that is complementary, or at least largely complementary or homologous to a genomic sequence, for example a nucleic acid used as a probe or primer. These differences at the DNA level can be found as markers and are, for example, polynucleotide sequence differences such as SSR (simple sequence repeat), RFLP (restriction fragment length polymorphism), FLP (fragment length polymorphism) or SNP (single nucleotide polymorphism). The tag may be derived from genomic or expressed nucleic acid, such as spliced RNA, cDNA or EST, and may also be associated with nucleic acid used as a probe or primer pair, and is therefore suitable for amplification of sequence fragments using PCR-based methods. Markers that describe Genetic polymorphisms (between various parts of the population) can be detected using methods well established in the art (An Introduction to Genetic Analysis, 7 th edition, Griffiths, Miller, Suzuki et al, 2000). For example, DNA sequencing, PCR-based sequence specific amplification, RFLP validation, polynucleotide polymorphism validation by Allele Specific Hybridization (ASH), detection of amplified variable sequences of plant genomes, detection of 3SR (autonomous sequence replication), detection of SSR, SNP, RFLP or AFLP (amplified fragment length polymorphism) are included among others. In addition, methods for detecting ESTs (expressed sequence tags) and SSR markers derived from EST sequences and RAPDs (randomly amplified polymorphic DNA) are also known. Depending on the context, the term "marker" in the specification may also refer to a specific chromosomal location in the genome of a species in which a specific marker (e.g., a SNP) may be found.

Labels also include synthetic oligonucleotides that can be linked to one or more detection molecules that can be used to detect a reaction or signal generation within the context of a validation method. The synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds that do not exist in nature and cannot be isolated from nature. The production of such compounds is further illustrated below.

A "promoter" is a non-translated regulatory DNA sequence, usually upstream of a coding region, which contains a binding site for RNA polymerase and initiates transcription of DNA. Promoters also contain other elements (e.g., cis-regulatory elements) that act as regulatory genes for gene expression. A "core or minimal promoter" is a promoter (e.g., a TATA box and/or initiator) that has essential elements required to initiate transcription.

"pathogen" refers to an organism that interacts with a plant to cause disease symptoms in one or more organs of the plant. For example, animal, fungal, bacterial or viral organisms or oomycetes are included among these pathogens.

By "pathogenic infection" is understood the earliest point in time at which a pathogen interacts with plant host tissue. In this sense, "infestation" refers to contact between a pathogen and a host. With the anchorage of pathogens on the host (e.g., fungal spores on the surface of plant leaves), the mechanisms of pathogen detection and signaling begin in the plant host cell. In the case of cercospora betanae, conidia are formed in humid and warm weather and transferred to neighboring plants by rain and wind. New infections usually first show a single leaf spot on the outer, physiologically older leaf. These are usually clearly separated from healthy leaf tissue by brown rings. The brown conidia carriers of the fungus were observed in the middle of the spots with the aid of a magnifying glass (rating score 3). The number of these brown spots increased rapidly, with the sporozoites initially overlapping with smaller necrotic areas (grade score 5). During further progression of the disease (now also extending to the inner lobe), the outer lobe first necroses (grade score 7) and then almost all the leaves die (grade score 9). The course of the disease and the severity of symptoms strongly depend on the location and the weather conditions that fluctuate year by year.

Plant "organ" means, for example, a leaf, shoot (shoot), stem, root, hypocotyl, vegetative bud, meristem, embryo, anther, ovule, seed, or fruit. "plant parts" include, but are not limited to, shoots or stems (stalk), leaves, flowers, inflorescences, roots, fruits and seeds, and pollen. The term "plant part" also refers to a combination of organs, such as flowers or seeds, or a portion of an organ, such as a cross-section through a young branch of a plant. Plant "tissue" is for example callus, storage tissue, meristem, leaf tissue, shoot tissue, root tissue, plant tumor tissue or reproductive tissue, as well as neogenetic tissue, parenchyma tissue, vascular tissue, sclerenchyma tissue and epidermis. However, the organization is not limited to those listed. For example, a plant "cell" is understood to be, for example, an isolated cell having a cell wall or an aggregate or protoplast thereof.

In connection with the present invention, the term "control sequence" relates to a nucleotide sequence which influences the specificity and/or the strength of expression, for example in that the control sequence confers a defined tissue specificity. For example, such regulatory sequences may be located upstream of the transcription start point of the minimal promoter, but may also be located downstream thereof, in the transcribed but untranslated leader sequence or in the intron.

The term "resistance" is to be understood in a broad sense and covers the range of protection from delaying until completely preventing the development of the disease. An example of an important pathogen is cercospora betanae. The resistant plant cells of the invention or the resistant plants of the invention preferably achieve resistance to cercospora betanae. Resistance to a pathogen is equivalent to resistance to a disease caused by such a pathogen; for example, resistance to cercospora betanae is also resistance to leaf spot. For example, an increase in resistance can be measured by a decrease in fungal biomass on the host plant; to this end, fungal DNA can be determined by means of quantitative PCR in comparison with plant DNA in infected plant tissues. Another method of resistance measurement is optical rating, where the awarded rating scores 1 (not susceptible) to 9 (very susceptible).

"transgenic plant" refers to a plant having at least one polynucleotide integrated into its genome. Thus, it may be a heterologous polynucleotide. Preferably, the polynucleotide is stably integrated, which means that the integrated polynucleotide is stably maintained in the plant and is expressed and may also be stably transmitted to progeny. Stably introducing the polynucleotide into the genome of the plant also includes integration into the genome of the last parent plant, wherein the polynucleotide may be further stably delivered. The term "heterologous" means that the introduced polynucleotide originates from a cell or organism of the same species or of a different species with a different genetic background, or is homologous to a prokaryotic or eukaryotic host cell, for example, but is located in a different genetic environment, and thus is different from the corresponding polynucleotide that may be naturally occurring. In addition to the corresponding endogenous gene, a heterologous polynucleotide may be present.

"feedstock for industrial sugar production" means plant material that can be fed to a sugar production plant dedicated to the extraction of sugar from sugar beets. This material is usually the beet body (main root) of the harvested beets. To ensure consistency with the extraction process, the sugar beet bodies need to have sufficient mass, volume and conical shape so that the raw material can be mechanically cut into strips (beet strips). These beet strips maximize the surface area of sugar extraction and have low levels of sodium, potassium and nitrogen for efficient extraction. After extraction, the remaining beet pulp is pressed, dried and used as animal feed.

"sucrose concentration" is expressed as a percentage of the fresh weight of the root.

By "single embryo" is meant that the seed grows completely into one plant, while multiple embryo (polygerm) seeds (also known as "seedballs") grow into several plants.

"bolting" is the creation of one or more flower stems from sugar beet in an attempt to naturally produce seeds and propagate. Bolting was triggered due to low temperature stress (e.g. overwintering). However, before bolting, commercially grown beets are harvested because this process reduces the sugar content in the beets.

By "introgression" is meant that a nucleotide sequence has been transferred into the genome of a plant, wherein the nucleotide sequence originates from a plant not belonging to the same species or subspecies. For example, this may mean that the nucleotide sequence from a plant of the sea beet subspecies has been transferred into a plant of the beet (Beta vulgaris vulgaris vulgaris) subspecies.

The design and embodiments of the present invention are described by way of example with reference to the accompanying (pending) sequences and figures.

FIG. 1: protein sequence alignment between a resistance protein (a protein conferring resistance to Cercospora species of plants) and a sensitivity protein (a protein not conferring resistance to Cercospora species of plants). Polymorphisms are highlighted in gray.

FIG. 2: protein sequence alignment between a resistance protein (a protein conferring resistance to Cercospora species of plants) and a sensitivity protein (a protein not conferring resistance to Cercospora species of plants). Polymorphisms are highlighted in gray.

FIG. 3: vector diagram of the vector pZFN-nptII comprising the LRR region.

FIG. 4: statistical boxplot evaluation of data generated 8 days after infection during transgene validation of resistance genes.

FIG. 5: statistical boxplot evaluation of data generated 11 days after infection during transgene validation of the resistance gene.

FIG. 6: statistical boxplot evaluation of data generated 8 days after infection during transgene validation of resistance genes.

FIG. 7: statistical boxed plot evaluation of data generated 15 days after infection during transgene validation of resistance genes.

Detailed Description

The present invention relates to a nucleic acid molecule capable of conferring resistance to Cercospora species of plants (in particular, subspecies betanae) expressing a polypeptide encoded by the nucleic acid molecule. According to a preferred embodiment of the invention, the pathogen is the fungus cercospora betanae, which is one of the most important and destructive leaf pathogens of sugar beets, beetroot and leaf beets, etc., and can cause crop losses of more than 40%. The fungus produces a secondary metabolite cercosporin which reacts with oxygen under light and forms Reactive Oxygen Species (ROS). ROS cause a great deal of cell damage in the leaf tissue of infected plants, appearing as necrosis.

The present invention is based on the genetic fine-mapping, identification, isolation and characterization of genes or loci derived from donor sea beet, whose presence in plants (especially in the sugar beet subspecies) is linked to or responsible for the resistance of plants to cercospora leaf spot. The starting material was a sea beet population, which was cultivated from 37 parts of sea beet material from different sources.

The nucleotide and amino acid coding sequences of the nucleic acid molecules according to the invention are characterized by a plurality of polymorphisms which distinguish the NPS-LRR gene identified according to the invention from "sensitive" variants of this gene, i.e.variants of the gene which do not confer resistance to Cercospora. Examples of polymorphisms are shown in FIG. 1.

The nucleic acid molecule according to the invention may be an isolated nucleic acid molecule. Preferably DNA, particularly preferably cDNA (coding DNA). The polypeptides encoded by the nucleic acid molecules according to the invention preferably confer resistance to the pathogen cercospora betanae which causes cercospora leaf spot. Furthermore, the polypeptides encoded by the nucleic acid molecules according to the invention confer resistance, in particular to the beta plants, to this pathogen. The plant is preferably a plant of the beet species, particularly preferably a plant of the beet subspecies; these include, for example, the varieties beet, beet root, fodder beet, leaf beet and swiss beet.

In one embodiment of the invention, the nucleic acid molecule according to the invention comprises a nucleic acid sequence encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 3 and/or an amino acid sequence according to SEQ ID NO: 2, and a nucleotide sequence encoding a polypeptide of the DNA sequence of (2). Furthermore, the present invention provides a nucleotide sequence comprising a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 53 in a DNA sequence of SEQ ID NO.

The genes identified according to the invention are NBS-LRR type resistance genes/proteins characterized by specific structural motifs. The general structure of such resistance proteins in plants has been well studied (Martin et al, Annual Plant Biology Annual Review (Martin et al, Annual Review Plant Biology 54(2003), 23-61), however, the principles of the structural embodiments-in particular the principles of the known LRR domains, this domain is a potential detection domain for most unknown pathogenic effectors-is unpredictable, and the functional background (i.e., genetic structure) of resistance genes is often largely unknown.therefore, it is not possible to identify genes or proteins that confer resistance to Cercospora based solely on known structural motifs. Which contain tandem repeats with very high sequence homology, make the development of diagnostic markers and the assembly of sequence data particularly difficult.

By means of the establishment of more than 4000 dividing progeny populations and the development of special recombination screens, the target region was reduced and further isolated by analysis of informative recombinants (genotype and phenotype) in a series of resistance tests. Genetic mapping and the creation of physical maps with WHG sequencing ("whole genome sequencing"), comparative BAC (BAC-by-BAC) sequencing and bioinformatics analysis led to the identification of three recombinant genotypes (1 in adjacent genes on the one hand and 2 in adjacent genes on the other hand) that identified the resistance gene. In view of the special requirements, the present inventors placed highly repetitive structures in the target region, including tandem repeats with very high sequence homology, which made marker development and informative recombinant identification more difficult. The following steps are particularly decisive for the localization of the genetic structure of the resistance gene:

development of markers s4p0264s01, s4p2271s01, sxh0678s01, s4p4293s01, s4p4295s01, s4p4301s01 (see table 1B).

Fine localization in combination with dense phenotypes. In greenhouse trials, phenotypes are identified by 90-180 progeny per plant and intensive statistical methods (e.g., t-test, power analysis, etc.).

-identifying and sequencing BAC clones from BAC pools of resistance genotypes.

Sequence assessment, and comparison of sequences and proteins between RR (i.e. resistance) and ss (i.e. sensitivity) genotypes; therefore, due to sequence complexity, unambiguous assembly of RR and ss sequence data is not always possible.

Table 1B: a marker in the target region; the information in square brackets [ X/Y ] indicates the diagnostic SNP, where X indicates the sensitivity genotype and Y indicates the resistance genotype.

The compounds provided in table 1B may be used as molecular markers according to the present invention.

Analysis showed that the LRR gene was homologous to a moderate protein from tomato (UNIPROT | Q41397_ SOLPI p. Cf-2.1) to the Cf-2 resistance protein (sequence identity 322/830 ═ 38%). In fact, the identified protein conferring Cercospora resistance is the best betaine protein homologue of the Cf-2 tomato resistance protein. The Cf-2 resistance protein from tomato confers resistance to the tomato mold phyllospora cassiicola (a black mold) by interacting with the avirulent protein Avr2 from tomato mold phyllosporium fulvum (US 6,287,865B 1). This leads to the activation of the plant's immune defenses against pathogens; see Dixon et al, 1996(Dixon, Mark S., et al., "The tomato Cf-2 discrete resistance locations comprising two functional genes encoding results-rich repeat proteins" Cell 84.3 (1996): 451-. Due to sequence homology between the Cf-2 gene and the identified LRR gene, it can be assumed, but without being bound by a theory, that a similar defense mechanism underlying cercospora resistance also exists in sugar beet. However, different mechanisms are not excluded because of the moderate sequence homology.

Furthermore, substitutions, deletions, insertions, additions and/or any other alterations, alone or in combination, which do in fact alter the nucleotide sequence, may be introduced into the nucleotide sequence according to the invention, wherein, however, the modified nucleotide sequence may perform the same function as the original sequence. The present application relates to the coding of amino acid sequences conferring resistance to cercospora leaf spot. Thus, in a further embodiment, the invention comprises a nucleotide sequence encoding a polypeptide representing a derivative of a polypeptide encoded by a nucleotide sequence according to the invention, or comprising an amino acid sequence according to the invention. The derivative amino acid sequence having at least one substitution, deletion, insertion or addition of one or more amino acids represents a derivative of the polypeptide in which the functionality of the encoded polypeptide/protein is retained. Thus, substitutions, deletions, insertions, additions and/or any other alterations, taken alone or in combination, may be introduced into a nucleotide sequence using conventional methods which do in fact alter the nucleotide sequence but perform the same function as the starting sequence, as are known in the art, e.g., by site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, genome editing, and the like.

The substitution of an amino acid by a different amino acid having the same or equivalent or similar chemical/physical properties is referred to as "conservative substitution" or "semi-conservative substitution". Examples of the physical/chemical properties of amino acids are hydrophobicity or charge. Which amino acid substitutions represent conservative or semi-conservative substitutions are known to those skilled in the art. Moreover, general expertise allows one skilled in the art to identify, identify and detect which amino acid deletions and additions are not detrimental to the function of the resistance protein, and at which positions are feasible. The person skilled in the art knows that in case the NBS-LRR protein of the invention is used to modify an amino acid (substitution, deletion, insertion or addition of one or more amino acids), the functionality of especially conserved domains must be preserved and therefore only limited modifications as described above are feasible in these domains.

Accordingly, the present invention includes functional fragments of the nucleotide sequences according to the present invention. Thus, the term "fragment" includes a gene having a nucleotide sequence sufficiently similar to the above-described nucleotide sequence. The term "sufficiently similar" means that a first nucleotide sequence or amino acid sequence has a sufficient or minimal number of identical or equivalent nucleotide or amino acid groups relative to a second nucleotide sequence or second amino acid sequence.

With regard to the amino acid sequences, they also have a common domain and/or have a common functional activity after modification by the above-described methods. Herein, a nucleotide sequence or amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identity to a nucleotide sequence or amino acid sequence according to the invention is defined as sufficiently similar. This also explicitly covers the range of 90% to 100%. For functional fragments, sufficient similarity is established if the nucleotide sequence or amino acid sequence generally has the same properties as the previously specified nucleotide sequence or amino acid sequence of the invention. Those nucleotide sequences which code for derivatives or for amino acid sequences derived therefrom are generated directly or indirectly (e.g. by amplification or replication steps) from an initial nucleotide sequence which corresponds over the entire length or at least in part to a nucleotide sequence according to the invention.

Thus, the present invention includes nucleotide sequences that are capable of hybridizing under stringent conditions to nucleotide sequences that are complementary to the nucleotide sequences according to the present invention or to nucleotide sequences encoding amino acid sequences according to the present invention.

In another embodiment, the nucleic acid molecule according to the invention is characterized in that, after expression in a plant, it itself has conferred a resistance effect against a pathogen (preferably against Cercospora species, or it encodes a polypeptide capable of exerting a dominant resistance effect against Cercospora species, in a preferred embodiment the nucleic acid molecule or the polypeptide confers a resistance effect on at least one scale score, preferably on at least two scales, particularly preferably on three to four scales. And are expensive and, in the absence of infection, the crop yields of these varieties are significantly lower than normal. This may be associated, inter alia, with the epigenetic interaction of some resistance genes with sugar-producing genes, which leads to a reduced adaptability of the plant in the absence of pathogens.

Therefore, the present inventors have for the first time provided a Cercospora resistance gene useful for simplified breeding. By adding this gene to elite lines, it is now possible to develop very high-yielding varieties with high Cercospora resistance very rapidly. Thus, within the framework of the present invention, for the first time, sugar beet plants, leaf beet plants (hard plants), red or sugar beet root plants, fodder beet plants having resistance to Cercospora sp according to the invention are provided and are therefore encompassed by the present invention. Since the listed plants are all cultivated plants, crops or plants which are suitable for agricultural cultivation and which have the resistance according to the invention are part of the invention. In particular, such crops are part of the present invention as follows: comprising a product, raw material or underground storage organ of industrial origin which can be used as sugar, and comprising a resistance according to the invention, constitute a further aspect of the invention. The storage organs can be, for example, sugar beet bodies of sugar beets, edible beet bodies of red beets or feedable beet bodies of feed beets. The sum of underground storage organs can be as high as 50% or more, and for sugar beet it is even more than 70% of the total mass of adult plants. Furthermore, seeds or sowing materials of these plants are also part of the present invention. The seeds or seeding material may be treated technically as follows.

In this context, the invention also comprises a polypeptide encoding a polypeptide according to SEQ ID NO: 3, wherein, in a specific embodiment, the nucleic acid sequence according to SEQ ID NO: 1.

Furthermore, the present invention relates to recombinant and/or heterologous DNA molecules comprising the sequence of a nucleic acid molecule according to the invention. Furthermore, the DNA molecule preferably has regulatory sequences. Thus, it may be operably linked to or affected by the regulatory sequence. The control sequence is preferably a promoter sequence and/or other sequences of transcriptional or translational control elements, such as cis-elements. Regulatory sequences which control the expression of the genes comprising the nucleic acid molecules of the invention are preferably sequences which are capable of conferring or regulating expression as a result of infection by a pathogen. The promoter is preferably capable of controlling expression of the DNA sequence, particularly in plant leaves. The control sequences may be heterologous to the expression sequences. The advantage of this method is that the person skilled in the art, because of the selection of the regulatory sequences which are most suitable for the respective use case, can better regulate the expression rate of the expression sequences, the tissue in which the expression takes place and the point in time at which the expression takes place. The heterologous DNA sequence preferably comprises a nucleotide sequence which codes for a component of the plant's pathogen defence (e.g.a resistance gene (R-gene) or a gene which codes for an enzyme involved in signal transmission, such as a kinase or a phosphatase, for a G-protein, or for a pathogenic effector (known as an avirulence gene (avr))). The heterologous DNA sequence may be one of the DNA sequences according to the invention. The heterologous DNA sequence may additionally encode other components of the plant pathogen defence. Thus, a heterologous DNA sequence can be designed such that, upon transcription thereof, a polycistronic mRNA is produced.

The invention also relates to polypeptides which can be encoded by the nucleic acid molecules according to the invention and functional and/or immunologically active fragments thereof, as well as antibodies which specifically bind to the polypeptides or fragments thereof. The polypeptide particularly preferably has an amino acid sequence according to SEQ ID No: 3. Recombinant Production of Proteins, polypeptides and fragments is familiar to the person skilled in the art (Sambrook et al, Molecular Cloning: A Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001, or Wingfield, P.T., 2008, Production of Recombinant Proteins, Current Protocols in Protein Science, 52:5.0: 5.0.1-5.0.4). Polyclonal or monoclonal Antibodies to proteins according to the invention may be generated by a person skilled in the art according to known methods (e.g. edited by Harlow et al, Antibodies: A Laboratory Manual (1988)). Production of monoclonal antibodies and FabF (ab')₂Can be carried out by various conventional methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 98-118, New York: Academic Press (1983)). The antibodies can then be used to screen expression cDNA libraries to identify identical, homologous, or heterologous genes by immunological screening (Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, or Ausubel et al, 1994, "Current Protocols in Molecular biology," John Wiley&Sons) or can be used for western blot analysis. In particular, the present invention relates to antibodies which selectively detect the polypeptide encoded by the cercospora resistance-conferring allele according to the invention and which do not substantially detect the polypeptide encoded by the corresponding sensitive allele, i.e. they detect 2-fold less, preferably 5-fold less, more preferably 10-fold or more less of the polypeptide encoded by the corresponding sensitive allele than the polypeptide encoded by the cercospora resistance-conferring allele according to the invention.

In a preferred embodiment, the antibody according to the invention is characterized in that it is a synthetic polypeptide which does not occur in nature.

Furthermore, the antibodies according to the invention may be linked to a fluorescent dye so as to be useful, for example, in immunohistochemical methods and to cause staining of the antibodies. The fluorescent dye may be a fluorescent dye. The antibodies according to the invention can also be present in conjunction with other signal molecules. Including, for example, biotin, a radioisotope, a reporter enzyme (e.g., alkaline phosphatase), or an oligonucleotide.

Another subject of the invention is a vector or expression cassette comprising a nucleic acid molecule or a recombinant DNA molecule according to the invention, possibly under the control of regulatory elements, and in particular functional regulatory elements in plants, said vector or expression cassette further comprising a negative and/or positive selection marker. Thus, the vector backbone is heterologous to the nucleic acid molecule according to the invention, which means that such vectors do not exist in nature and cannot be isolated from nature. The vector is a plasmid, cosmid, phage or expression vector, transformation vector, shuttle vector or cloning vector; it may be double-stranded or single-stranded, linear or circular; or it may be transformed extrachromosomally into prokaryotic or eukaryotic organisms by integration into its genome. The nucleic acid molecule or DNA molecule according to the invention in an expression vector or cassette is preferably operably linked to one or more regulatory sequences which allow transcription and optionally expression in prokaryotic or eukaryotic cells; (Sambrook et al, Molecular Cloning: A Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001). These regulatory sequences are preferably promoters or terminators, in particular transcription initiation sites, ribosome binding sites, RNA processing signals, transcription termination sites and/or polyadenylation signals. For example, the nucleic acid molecule is here under the control of a suitable promoter and/or terminator. Suitable promoters may be constitutive promoters (for example the 35s promoter from Cauliflower mosaic virus (Odell et al, Nature 313(1985), 810-812)), those which are pathogen-inducible are particularly suitable (for example the PR1 promoter from parsley (Rushton et al, EMBO J.15(1996), 5,690-5, 700)). A particularly suitable pathogen-inducible promoter is a synthetic or chimeric promoter which does not occur in Nature and which consists of a multiplicity of elements and contains a minimal promoter and has at least one cis-regulatory element upstream of the minimal promoter, where at least one cis-regulatory element serves as a binding site for a particular transcription factor. Suitable terminators are nos terminators (Depicker et al, J.mol.J.mol.appl.Genet.1(1982), 561-. Suitable promoters and terminators may also be natural promoters and natural terminators whose DNA sequences are duplicated in SEQ ID NO: 7 and SEQ ID NO: 8 in (c). The vector or expression cassette additionally comprises a conventional indicator/reporter gene or resistance gene for detecting the transfer of the desired vector or DNA molecule/nucleic acid molecule and for selecting individuals comprising the vector or DNA molecule/nucleic acid molecule, since direct detection by gene expression is probably quite difficult.

Since the nucleic acid molecule according to the invention here itself encodes a polypeptide which confers resistance to Cercospora leaf spot, it is not necessary for expression in a plant cell to provide an additional resistance gene; however, to allow for quick selection, it is suggested to employ this approach.

Examples of indicator/reporter genes are, for example, the luciferase gene and the gene encoding Green Fluorescent Protein (GFP). Furthermore, these indicator/reporter genes also allow testing of the activity and/or regulation of the gene promoter. Examples of resistance genes, in particular for plant transformation, are the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene, or the gene encoding phosphinothricin acetyltransferase. Additional positive selection markers may be enzymes that provide advantages in the selection of transformed plants relative to untransformed plants-particularly a nutritional advantage, such as mannose-6-phosphate isomerase or xylose isomerase. However, this does not exclude other indicator/reporter genes or resistance genes known to the person skilled in the art. In a preferred embodiment, the vector is a plant vector. Furthermore, the expression cassette may be present in a form which is integrated into the genome of the plant.

In another aspect, the invention relates to a cell comprising a vector, a recombinant DNA molecule and/or a nucleic acid molecule according to the invention. A cell in the sense of the present invention may be a prokaryotic cell (e.g.a bacterium) or a eukaryotic cell (e.g.a plant cell or a yeast cell). The cell is preferably an Agrobacterium, such as an Agrobacterium tumefaciens (Agrobacterium tumefaciens) or Agrobacterium rhizogenes (Agrobacterium rhizogenes), Escherichia coli (Escherichia coli) cell or plant cell; the plant cells are particularly preferably cells of plants of the genus beta, of the species beet or of the subspecies beet. The cells may also be present as a culture. Accordingly, the invention also encompasses cell cultures comprising such cells. The cell culture is preferably a pure culture or an isolate free of other cell types.

Known to the person skilled in the art are various methods, for example conjugation or electroporation, with which he can introduce nucleic acid molecules according to the invention, recombinant DNA molecules and/or vectors or expression cassettes according to the invention into Agrobacterium, and methods such as various transformation methods (biotransformation, Agrobacterium-mediated transformation) with which he can introduce nucleic acid molecules, DNA molecules according to the invention and/or vectors according to the invention into plant cells (Sambrook et al, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001).

Furthermore, the present invention preferably relates to a cercospora plant, preferably a subspecies betaine plant or a part thereof, comprising a nucleic acid molecule conferring cercospora resistance according to the present invention. The Cercospora plant may comprise a nucleic acid molecule according to the invention as a transgene or as an endosome. Within the scope of the present invention, plants of the subspecies lycii containing the nucleic acid molecule according to the invention are produced for the first time. The invention also encompasses plants of the subspecies lycii, which comprise the nucleic acid molecules according to the invention as an endosome.

Thus, a portion may be a cell, a tissue, an organ, or a combination of multiple cells, tissues, or organs. The combination of multiple organs is, for example, a flower or a seed. The cercospora-resistant plants of the invention exhibit a higher resistance to cercospora, in particular cercospora betaine, than corresponding plants (control plants) which do not contain the nucleic acid molecule according to the invention. Ideally, the control plant has the same genotype as the transgenic plant and is cultured under the same conditions, but does not contain the resistance-conferring nucleic acid molecule. By determining the grade score, the level of resistance of the beta plant, for example to cercospora betaine, can be qualitatively determined. Higher resistance is manifested by improved resistance by at least one rating score, at least two rating scores, preferably at least three or more rating scores.

The plant cells or plants of the invention or parts thereof, in particular plants of the genus beta, which comprise a nucleic acid molecule according to the invention preferably exhibit a higher resistance to pathogens, in particular to cercospora betanae, than corresponding plant cells or plants or parts thereof which do not comprise a nucleic acid molecule according to the invention or comprise a sensitive allelic variant of a nucleic acid molecule. By determining the grade score, the level of resistance of the beta plant, for example to cercospora betaine, can be established qualitatively. Higher resistance is manifested by improved resistance by at least one rating score, at least two rating scores, preferably at least three or more rating scores.

In the case of transgenic plant cells or plants or parts thereof, they comprise the nucleic acid molecules or DNA molecules according to the invention as transgenes or as vectors or expression cassettes according to the invention. Such transgenic plant cells or plants or parts thereof are, for example, preferably stably transformed with a nucleic acid molecule, a DNA molecule according to the invention or with a vector or expression cassette according to the invention. In a preferred embodiment, the nucleic acid molecule is operably linked to one or more regulatory sequences which allow transcription and optionally expression in a plant cell. The overall structure consisting of the nucleic acid molecule according to the invention and the regulatory sequences then represents a transgene. Such regulatory sequences are, for example, promoters or terminators. Many functional promoters and terminators suitable for plants are known to those skilled in the art.

The invention also includes vacuoles of cells according to the invention, and contents stored therein.

Furthermore, the invention relates to cell extracts from cells, preferably plant cells, particularly preferably sugar beet cells, and particularly preferably cells from one of the following crops: sugar beet, leaf beet (chard) or beetroot. No plants can be regenerated from the cell extract.

The invention likewise comprises plant genomes comprising the nucleic acids according to the invention. Plants cannot be regenerated from the plant genome.

Thus, the sugar concentration of the cell extract may be increased relative to cells that are not cells according to the invention but belong to the same species or crop. This applies in particular to the case of infection with Cercospora.

The invention also encompasses the use of the cell extract for the production of sugar (sucrose) or for the production of juice, preferably beetroot juice.

The invention also encompasses sugars, in particular sucrose, contained in the cells according to the invention and in their vacuoles.

Another aspect of the invention is a stock comprising seeds containing a nucleic acid according to the invention. The nucleic acid molecules according to the invention can be transgenic or present endogenously. Stock and seeds may be subjected to technical treatment. Thus, the invention also encompasses technically treated stock and technically treated seed. Various embodiments of the technically processed stock are described in detail below, wherein the term stock also includes seeds. The technically processed stock exists in a form capable of being polished. The outermost layer of the seed is thus removed, so that the seed assumes a more rounded form. This is helpful in sowing where the optimal uniform shape results in a uniform distribution of the seed particles. Technically processed breeders also include pelleted breeders. Thereby embedding the stock seeds in the pelleted mass to protect the stock seeds contained therein and to result in greater mass, so that the pelleted stock seeds exhibit greater resistance to wind drift and are therefore less likely to be blown away by wind, while more accurate positioning during sowing is achieved. In a preferred embodiment of the invention, all of the granulated elite grains of a given sold batch or unit have substantially the same shape and the same quality. The deviation in diameter and mass may be 5%. However, the deviation is preferably not more than 1%. As one of the main components, the granulated mass may contain, for example, mineral compounds such as clay, bentonite, kaolin, humus and/or peat. Binder materials like polyacrylamide may be added. Other possible components are cited in US 4,067,141. Furthermore, the granulated mass may contain other chemical agents which in practice have a positive effect on cultivation. These may be materials that are counted as fertilizer applicators. Including compounds rich in one or more of the following elements: nitrogen, phosphorus and potassium (macronutrients). Thus, the fertilising ingredients may comprise, for example, nitrate nitrogen, ammonium nitrogen, magnesium nitrate, calcium ammonium nitrate, monoammonium phosphate, monopotassium phosphate and potassium nitrate. In addition, the granulated mass may contain fungicides, insecticides and/or antifeedants. The bactericide may be thiram and/or hymexazol and/or other bactericide. The pesticide may be a neonicotinoid. The neonicotinoid is preferably imidacloprid (ATC code: QP53AX17) and/or clothianidin (CAS number: 210880-92-5). In addition, the insecticide may be cyfluthrin (CAS number: 68359-37-5), lambda-cyhalothrin or tefluthrin. It is worth mentioning that the compounds contained in the seed dressing or granulated substance are taken up by the plant and show a systemic effect, thus providing a suitable protection of the whole plant. Thus, the plants produced from the granulated seeds comprising one or more pesticides are different from the natural plants and show better performance under biotic stress conditions. In this context, the invention also comprises mixtures of granulated material and seeds according to the invention. Furthermore, the present invention also comprises a method for producing a granulated seed according to the invention, comprising the steps of:

a) providing a sugar beet plant seed comprising a nucleic acid according to the invention,

b) embedding the sugar beet plant seeds in a granulating substance,

c) allowing the granulated substance to dry, wherein the seed may optionally be a prepared (prime) or pre-germinated seed, or the seed may be allowed to prepare during step b).

The pelleted stock is a specific example of a dressed stock. In this context, technically processed stocks also include dressed stocks. However, the present invention is not limited to pelleted stocks, but can be applied in any form of dressed stock. Thus, the present invention also relates to a dressed stock, including, but not limited to, a pelleted stock. Therefore, dry seed dressing, wet seed dressing and suspension seed dressing are also included. The seed dressing agent may therefore also comprise at least one dye (dye), so that the seed-dressed stock can be rapidly distinguished from the seed-unsorted stock and good visibility in the environment after sowing is ensured. Seed dressings may also comprise those agrochemicals described in the context of granulated materials. The invention therefore encompasses seed-dressed stock, whereby the seed dressing contains at least one antifeedant, such as a pesticide and/or at least one fungicide. Optionally, so-called electric seed dressing (dressing by applying electric energy) may be employed. However, electric seed dressing is not a strict seed dressing.

Another form of technically processed stock is the encapsidated stock. In this case, so-called coatings and stocks treated with coatings have also been proposed. The difference with the granulated seed is that the kernel retains its original shape, wherein the process is particularly economical. This process is described, for example, in EP 0334258 a 1. Another form of technically processed stock is germinated or prepared stock. Germinating stocks are pre-treated by pregermination, whereas prepared stocks have been pre-treated by preparation ("germination"). Pregermination and prepared stock have the advantage of short emergence times. Meanwhile, the time points of seedling emergence after sowing are more synchronous. This enables better agronomic processing during cultivation, in particular during harvesting, and, in addition, an increase in yield. In pregermination, the stock seeds germinate until the radicles leave the shell of the stock seeds, and the process is then stopped. At the time of initiation, the process was stopped before the radicle left the primordial shell. The primed stock is not sensitive to the pressure of redrying compared to the germinated stock, and after redrying, has a longer shelf life compared to the germinated stock, which is generally not recommended. In this case, the technically pretreated stock also includes the initiated and redried stock. The process of pregermination is described in US 4,905,411 a. Various examples of initiation are described in EP 0686340 a 1. In addition, the granulation and the preparation of the stock can be carried out simultaneously in one process. This process is described in EP 2002702B 1. The invention includes prepared stock that is additionally subjected to granulation.

The technically treated stock may additionally provide one or more of the above herbicide resistances. This allows further improvement of agricultural technical cultivation, since the technically treated stock can be deployed on fields that have previously been treated with herbicides and are therefore weed-free.

The invention also encompasses, inter alia, mixtures comprising the stock according to the invention or the seed according to the invention and the dressing as defined above. Therefore, the seed dressing briquette is preferably implemented as a granulated briquette as described above.

For storage of the stock according to the invention, it is preferred to select storage conditions which do not negatively affect the stability or shelf life of the stock. Fluctuations in humidity can be particularly adversely affected here. Part of the invention is a method of storing stock seeds in a bag or container that is both waterproof and breathable. Such bags or containers may be designed as cartons or packages. Such cartons or packages may optionally have an internal moisture barrier. If the carton or package is designed as a double-ply carton, its stability is increased. Containers, bags, cartons or packages containing the stock according to the present invention or treated stock according to the techniques of the present invention are also part of the present invention. Likewise, it is also part of the present invention to store the stock according to the present invention or the stock treated according to the techniques of the present invention in such bags, containers, packages or cartons.

In one embodiment, the plant according to the invention is a hybrid plant or a doubled haploid plant. Hybrid and doubled haploid plants do not occur in nature and cannot be isolated from nature. In another embodiment of the plant according to the invention, the nucleic acid molecule according to the invention is present in heterozygous or homozygous form. In the case of hybrid plants, the nucleic acid molecules may also be present in hemizygous form. The invention also encompasses hybrid seeds and doubled haploid seeds containing a nucleic acid molecule according to the invention or a polypeptide according to the invention.

Another embodiment of the invention comprises a plant, preferably a sugar beet species, characterized in that the plant has a further increased resistance to cercospora. This can be achieved, for example, by "gene stacking", i.e.using this dose effect to increase resistance. For this purpose, plants according to the invention which contain an allele which confers resistance to Cercospora are over-transformed with this resistant allele in order to increase the amount of transcription of the gene in the plant. Alternative approaches include gene editing/site-directed mutagenesis or TILLING-mediated modification of the native promoter of the resistance-conferring allele to increase its expression rate, or modification of the resistance-conferring LRR gene allele itself to increase its activity or stability. Such methods of increasing activity by modifying resistance genes are described, for example, in WO 2006/128444 a2 and can be achieved by techniques known to those skilled in the art. Additional approaches may include fusing the nucleic acid molecule according to the invention with a heterologous promoter exhibiting higher activity than the native promoter, especially after infection with Cercospora.

Another embodiment of the invention relates to sugar beet plants or pelleted seeds of such plants, which are harvestable prior to bolting because no bolting of the beet plants occurs during the first 10, 11, 12, 13, 14 or 15 months during which the development of the beet bodies is complete.

In one embodiment of the invention, the sugar beet plant or the granulated seed of such a plant has a genome which allows bodies of beet to develop into a sum of their masses which amounts to at least 50%, 60%, 70%, 80% or even 90% of the total mass of the mature plant.

In another embodiment of the invention, the sugar beet plant or the granulated seed of such a plant has a genome which allows the bodies of beet to develop by photosynthesis with a minimum mass of 200g, 250g, 300g, 350g, 400g, 450g or 500g and a maximum mass of 100g, 1100g, 1200g, 1300g, 1400g, 1500g, 1600g, 1700g, 1800g, 1900g or even 2000 g.

Another embodiment of the invention relates to a sugar beet plant or a pelleted seed of such a plant, wherein the genome of the sugar beet plant allows the bodies of beet to develop with a sucrose concentration of at least 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or even 20%.

In one embodiment of the invention, the sugar beet plant or the pelleted seed of such plant comprises a nucleotide sequence relative to SEQ ID NO: 4, at least one, at least two, at least three, at least four, at least five, at least ten, at least twenty, or even at least thirty mutations.

A method of producing an organism comprising a mutated form of a nucleic acid molecule according to the above-given embodiment [1] and/or a mutated form of a promoter comprising a nucleic acid sequence consisting of: (a) SEQ ID NO: 7. (b) a nucleotide sequence that hybridizes under stringent conditions to the sequence complementary to the sequence according to (a), and (c) a nucleotide sequence that hybridizes to the sequence according to SEQ ID NO: 7, wherein the method comprises the steps of:

(I) providing an organism or cell comprising a nucleic acid molecule and/or a promoter;

(II) increasing the mutation rate of the organism or cell or

Mutagenesis of an organism or cell;

(III) phenotypically selecting an organism that exhibits altered resistance or altered level of resistance to cercospora betanae due to a mutation, or genotypically selecting an organism or cell comprising a mutation in a nucleic acid molecule and/or a promoter, wherein the mutation is produced by step (II);

and, optionally

(IV) regenerating the organism from the cells obtained by step (III).

The organism may be a plant. Preferably, the plant is sugar beet. However, unicellular organisms such as bacteria may also be used. The bacterium may be Escherichia coli. If the organism is a plant, the method can be used in vivo and in vitro. If the organism is a plant and the method is applied in vitro, a cell culture of the plant can be established and the mutation rate or mutagenesis can be increased in the cell culture. Increasing the mutation rate includes, for example, the use of mutagens such as 5-bromouracil or Ethylmethylsulfonate (EMS), or the use of physical mutagens such as ionizing radiation or ultraviolet light. Mutagenesis also includes targeted mutagenesis. Targeted mutagenesis can be achieved by precise methods such as gene editing (as explained further below). Regeneration of organisms from cells is explained in various standard references in cell biology. For example, in the standard reference "Plant biotechnology: regeneration of plants is described in comprehensive biotechnology, second supplement "(Michael W.Fowler, Graham Warren, Murray Moo-Young-Pergamon Press-1992). In Lindsey & Gallois "Transformation of sugarbottom (Beta vulgaris) by Agrobacterium tumefaciens" Journal of experimental botanic 41.5 (1990): 529-536 describes the regeneration of sugar beet from cell cultures.

These references also describe how to establish plant cell cultures. As explained further above, the mutated form of each of the nucleic acid molecule and the promoter preferably manifests itself because the expression rate of the resistance-conferring nucleic acid molecule increases due to the mutation). This effect may also depend on the presence of several mutations. For example, two, three, four, five or more mutations can be introduced into a promoter or nucleic acid molecule.

By introducing mutations, proteins or proteins conferring more resistance can be constructed in cells with better results. Thus, resistance may be increased, for example, by at least 1%, 2%, 3%, 4%, 5% or more, compared to a control plant comprising an unaltered nucleic acid according to the present invention. This increase can be measured as described further below. In addition, resistance due to one or more mutations may increase at least one rating score. Determination of the rating score is described elsewhere herein. Furthermore, the resistance protein may-due to mutation-confer an altered effect and in some cases may exhibit an effect on such pathogens which have adapted themselves to the initial resistance mechanism. In this case, the invention also encompasses such mutants of the nucleic acids according to the invention and mutants of the proteins according to the invention. Preferably, the present invention includes such variants which do not exist in nature and cannot be isolated from nature to ensure that the pathogen has no opportunity to adapt itself to such variants. The above-described method for producing organisms comprising mutated forms of nucleic acid molecules may also comprise a further step in which those organisms or the respective plants are identified which have a further increased resistance as a result of one or more mutations. If resistance has increased, it can be determined by ranking the scores or measuring the level of resistance as described herein.

In addition to the above-described methods for producing organisms comprising mutated forms of nucleic acid molecules or promoters, the corresponding nucleic acids can also be chemically modified in the isolated state in order to achieve the desired effect (e.g.as described above). The advantage of this approach is that compounds can be edited more precisely. To this end, the following method is provided:

producing a chemically modified nucleic acid molecule according to the given embodiment [1] above and/or a chemically modified promoter comprising a nucleotide sequence selected from the group consisting of:

(a)SEQ ID NO：7；

(b) a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence according to (a);

wherein the method comprises the steps of:

(I) providing the above-described nucleic acid molecule in isolated form;

(II) chemically modifying the nucleic acid molecule or promoter by one of the following steps:

(IIa) subjecting the mixture to a mutagenesis,

(IIb) editing of the gene,

(IIc) restriction and ligation, insertion or deletion, respectively.

Furthermore, in the case of allelic variants, chemical modifications may be generated by methods as described elsewhere herein. The gene editing given in step (II) is equivalent to the term "genome editing". Optionally, the chemically modified nucleic acid molecule or the chemically modified promoter may be subsequently introduced into a cell or stably integrated. With the aid of such cells, chemically modified nucleic acid molecules and modified promoters can be propagated in the context of cell proliferation. They can then be isolated in large quantities and can be subjected to expression analysis. Expression analysis is particularly suitable when the chemical modification involves a promoter. Cells can be harvested and chemically modified resistance proteins isolated for chemical analysis. If the cell comprising the chemically modified nucleic acid molecule or modified promoter is a plant cell, an intact plant can be regenerated from the cell. The methods described in this paragraph can be carried out following the methods given above for producing modified forms of nucleic acid molecules and/or modified promoters, and the variants obtained are also part of the invention. Furthermore, plants comprising chemically modified nucleic acid molecules or modified promoters are also part of the present invention. The invention therefore also relates to plants obtained by this method. Furthermore, the invention relates to chemically modified nucleic acid molecules and encoded polypeptides obtained by this method. These compounds may be optimized versions of the original (unmodified) compounds, wherein the level of acquired resistance (as further explained above) may be increased by at least 1%, 2%, 3%, 4%, 5% or more percent, or at least one rating score may be increased. In this respect, the method for producing a chemically modified nucleic acid molecule is also a method for optimizing a nucleic acid molecule. The optimized method may further comprise an additional step wherein those modified variants of the nucleic acid molecule are identified which result in an increased resistance in the plant compared to the unmodified variants.

In another embodiment, the plant of the invention further comprises, transgenically or endogenously, a second nucleic acid molecule located at a different position in the genome which encodes a polypeptide capable of conferring cercospora resistance to a plant in which it is expressed. For example, one or more resistance genes or resistance loci described in the prior art can be introduced into the plant by means of crossing, transformation, homologous directed repair or homologous recombination, as long as they are not already present in the initial genotype. These include, for example, the Podospora betanae disease resistance RZ1(Lewellen, R.T., I.O.Skoyen, and A.W.Erichsen, "Breeding Sugar bed for resistance to rhizobia: Evaluation of host-plant reactions and selection for and resistance to resistance, 50th Winter consistency of the International organization for Sugar bed Research, Brussels bed), Feb.11-12, 1987 IIRB Secretariat General, 1987), or the Podospora betanae disease resistance RZ3(WO 2014/202044).

The invention also relates to a method for enhancing the resistance of a plant of the sugar beet species to Cercospora, wherein the increase in resistance occurs in the absence of the resistance-conferring genes according to the invention compared to isogenic plants.

Resistance can be increased by integrating a nucleic acid molecule according to the invention into the genome of at least one cell of a plant of the sugar beet species, and by regenerating plants from the plant cells. Integration can be carried out by sexual crossing (for example with one of the above-mentioned sea beets) and subsequent selection steps, as well as by homologous targeted repair or homologous recombination. The latter two methods cited are preferably supported by site-directed nucleases, which can be selected from, but are not limited to, the following: CRISPR nucleases including Cas9, CasX, CasY or Cpf1 nucleases, TALE nucleases, zinc finger nucleases, homing endonucleases, Argonaut nucleases, restriction endonucleases (including fokl or variants thereof), recombinases, or two site-specific nicking endonucleases.

The introduction of the resistance conferring gene into the beet subspecies by CRISPR mediated homologous recombination is shown in example 1.

Alternative approaches include increasing the expression of the nucleic acid molecule according to the invention in plants. This can be achieved by modifying the native promoter, which can be done by modifying the native promoter, preferably by gene editing or site-directed mutagenesis (which is mediated by site-directed nucleases) and optionally a repair model. Examples of such nucleases are listed above. The expression of the nucleic acid molecules according to the invention can likewise be increased by fusing the nucleic acid molecules with heterologous promoters which exhibit a higher activity than the native promoters, in particular after infection with Cercospora. Fusion can also be performed by site-directed nucleases and repair models, or by direct insertion after double strand breaks.

As mentioned above, the method for increasing Cercospora resistance may also lead to an increase in the activity and/or stability of the polypeptide according to the invention by modifying the nucleotide sequence of the nucleic acid molecule according to the invention. Such methods of increasing activity by modification of resistance genes are described, for example, in WO 2006/128444 a2 and can be carried out by techniques known to those skilled in the art. This method will be described in detail below.

Alternatively, Cercospora resistance can be increased by generating a Cercospora resistance genotype from a Cercospora sensitivity genotype by random or directed mutagenesis of the nucleic acid sequence of the sensitivity gene. An example of polymorphisms that distinguish between sensitive and resistant alleles is presented in fig. 1.

For example, sensitive alleles can be modified by genetic mutations, either by TALE nucleases (TALENs) or Zinc Finger Nucleases (ZFNs), and by CRISPR/Cas systems described by way of example in WO 2014/144155 a1 (Engineering plant genomes using CRISPR/Cas systems) and Osakabe & Osakabe, plant Cell physiology, 56(2015), 389-. This can also be achieved by using the method named TILLING (Targeted Induced Local mutations in genes), where it is described, for example, in german patent application DE 102013101617 how to cause point mutations in sensitive genes and then selecting plants exhibiting suitable (resistance-conferring) mutations, for example, barley resistant to yellow mosaic virus; see DE 102013101617 pages 4, 8 and 12, paragraphs [0014], [0026] and [0038 ]. The TILLING method is also described in detail in the publication by Henikoff et al (Henikoff et al, Plant Physiol.135, 2004, 630-.

These methods preferably result in an increase in resistance by at least one rating score, particularly preferably by at least two, three or more rating scores. After mutagenesis of the plant cell followed by regeneration of the plant from the mutagenized plant cell, or after mutagenesis of the plant, plants can be identified that exhibit one or more mutations in the endogenous nucleic acid molecule, as shown in FIG. 1. In this context, plants according to the invention which have been mentioned are characterized in that the resistance is increased by at least one rating score, preferably by at least two or more rating scores. Alternatively, the resistance of a plant according to the invention may be increased, for example by at least 1%, 2%, 3%, 4%, 5% or more, compared to a control plant which does not comprise a nucleic acid according to the invention. The increase can be measured by inoculating a healthy leaf with isolates of the pathogen separately and determining the infected surface after 15 days. A 5% reduction in infected surface corresponds to a 5% increase in resistance. Further parameters for carrying out the measurements can be derived from the example "resistance test" given below.

Another embodiment of the present invention is a method for producing a cercospora plant, which can be achieved by: transformation of plant cells with a nucleic acid molecule, a recombinant DNA molecule or with a vector or an expression cassette according to the invention and regeneration of transgenic plants from the transformed plant cells (see example 2) and generation of Cercospora resistance genotypes by random or targeted mutagenesis of the nucleic acid sequence of the sensitive gene, as described above, or by hybridization and selection, for example using one of the above-mentioned sea beets. The vectors or expression cassettes, and methods for transforming plants have been described above.

As described above, the method for producing a cercospora plant may further comprise: introducing a site-directed nuclease and a repair matrix into a cell of a plant of the sugar beet species, wherein the site-directed nuclease is capable of generating at least one DNA double strand break in the genome of the cell, preferably upstream and/or downstream of the region of interest, and the repair matrix comprises a nucleic acid molecule according to the invention. The method further comprises culturing the cell under conditions that allow for homology-directed repair or homologous recombination, wherein the nucleic acid molecule is incorporated into the genome of the plant from the repair matrix. Furthermore, the regeneration of plants from the modified plant cells is also encompassed (see example 1).

In a preferred embodiment, the target region is an allelic variant of the nucleic acid molecule according to the invention, wherein the allelic variant encodes a polypeptide which does not confer Cercospora resistance. In another preferred embodiment, the allelic variant comprises a nucleotide sequence encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 6, and/or comprises a sequence of nucleotides according to the amino acid sequence of SEQ ID NO: 5 or a DNA sequence according to SEQ ID NO: 4.

As described in connection with the nucleic acid molecules according to the invention, substitutions, deletions, insertions, additions and/or any other alterations may be introduced which, alone or in combination, alter the nucleotide sequence but perform the same function as the original sequence, here the nucleotide sequence of an allelic variant of a nucleic acid molecule according to the invention. Thus, in another embodiment, the invention comprises a nucleotide sequence encoding a polypeptide representing a derivative of a polypeptide encoded by or comprising the amino acid sequence of an allelic variant of a nucleic acid molecule according to the invention. A derivative amino acid sequence (which has at least one substitution, deletion, insertion or addition of one or more amino acids, wherein the function of the encoded polypeptide/protein is retained) represents a derivative of the polypeptide. The nucleotide sequence may thus be altered by introducing it by substitution, deletion, insertion, addition and/or any other change (either alone or in combination with a gene) using conventional methods known in the art, e.g., by site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, genome editing, etc., but performing the same function as the original sequence.

With regard to the amino acid sequences, they also have a common domain and/or have a common functional activity after modification by the above-described methods. A nucleotide sequence or amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the nucleotide sequence or amino acid sequence of a referenced allelic variant of a nucleic acid molecule according to the invention is defined herein as sufficiently similar. The invention therefore encompasses nucleotide sequences which are capable of hybridizing under stringent conditions to the nucleotide sequence of an allelic variant of a nucleic acid molecule according to the invention or to a nucleotide sequence which is complementary to a nucleotide sequence encoding the corresponding amino acid sequence.

In another preferred embodiment, the method according to the invention is characterized in that the double strand break occurs in an allelic variant of the nucleic acid molecule according to embodiment [1], or the at least one double strand break occurs at a position of at least 10000 base pairs upstream or downstream of the allelic variant, wherein the allelic variant encodes a polypeptide which does not confer cercospora resistance.

It will be clear to the person skilled in the art that many different sensitive sequences may be present, which are derived from the nucleic acid molecule according to the invention, but which do not confer resistance to Cercospora, and therefore the above-mentioned sequences (SEQ ID Nos.4, 5, 6) should be regarded only as examples of sequences and the invention is not limited to the above-mentioned allelic variants of the nucleic acid molecule according to the invention. Such allelic variants may comprise a nucleotide sequence selected from:

(a) encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 6;

(b) comprising a sequence according to SEQ ID NO: 5, a nucleotide sequence of the DNA sequence of seq id no;

(d) a nucleotide sequence that hybridizes under stringent conditions to the complement of a sequence according to (a), (b) or (c);

(f) encoding a polypeptide having a sequence corresponding to that according to SEQ ID NO: 6, at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the polypeptide;

(g) and a polypeptide according to SEQ ID NO: 4 or SEQ ID NO: 5, a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the DNA sequence of seq id no;

as described above, by quantitative inheritance of QTLs, not only is desirable resistance often introduced into plants, but undesirable characteristics (e.g., reduced yield) are often also introduced into plants because other genes unrelated to the positive characteristics of resistance are inherited. This situation occurs more and more if, like cercospora resistance, resistance is inherited in previously available varieties through many resistance genes and the effect is small. Thus, in a preferred embodiment, the introduction of a nucleic acid molecule according to the invention (which already shows a dominant resistance effect itself) or the introduction of a vector or expression cassette is independent of the introduction of undesired characteristics, wherein the yield is preferably not negatively affected. Furthermore, the invention comprises plants obtained by such a method.

Although actual QTL can be detected using QTL analysis known from the prior art, potential genomic regions showing QTL effects also mediate the above-mentioned disadvantages, which is why "linkage drag" is also discussed herein. Also, QTLs and their associated effects are not uniformly described in the respective prior art, but mediate weak effects, so the use of these results in breeding of cercospora plants may be only of limited scope and largely uncertain. Now, by identifying the resistance genes described herein, it is possible to target breeding and control integration of the resistance genes into the sugar beet gene bank. This ensures the development and production of entirely new Cercospora resistant varieties that exhibit high resistance to pathogens without negatively impacting sugar yield.

The invention likewise relates to a method for identifying and possibly providing a plant of the sugar beet species that is resistant to the pathogen cercospora, characterized in that it comprises the step of detecting the presence and/or expression of a nucleic acid molecule according to the invention or a polypeptide according to the invention in the plant or a sample/part thereof. The presence and/or expression of a nucleic acid molecule according to the invention or a polypeptide according to the invention can be tested by standard methods known to the person skilled in the art, for example by PCR, RT-PCR, or Western blotting.

Further, the authentication method according to the present invention further comprises: the nucleic acid molecule according to the invention is detected by detecting at least one polymorphism between the resistant sequence and the sensitive sequence (i.e. between the sequence of the nucleic acid molecule according to the invention described above and the sequence of the allelic variant of the nucleic acid molecule according to the invention) using a molecular marker that detects one or more polymorphisms. As mentioned above, it is obvious to the person skilled in the art that there are many sensitive sequences, i.e.many sequences encoding allelic variants of the nucleic acid molecules according to the invention. One of which is presented by way of example in sequence alignment with the nucleotide sequence of the nucleic acid molecule according to the invention shown in FIG. 1. Thus, a preferred embodiment of the method according to the invention comprises the detection of at least one of the polymorphisms presented in figure 2 using molecular markers that detect polymorphisms, in particular diagnostic polymorphisms. The detection is preferably performed using at least one molecular marker per polymorphism, in particular per diagnostic polymorphism. The person skilled in the art knows which labelling techniques to apply for detecting the corresponding polymorphisms and how to construct molecular markers for this (see Advances in Seed Science and Technology, Vol.I, Vanangmadi et al, 2008). Furthermore, the present invention encompasses molecular markers describing or detecting the polymorphisms according to fig. 1, for example using molecular markers for detecting the polymorphisms according to fig. 1. Thus, markers which do not distinguish between the various polymorphisms may also be used, provided that they are capable of detecting such polymorphisms which occur in the nucleic acid molecule according to the invention but which do not occur in the sensitive allelic variant.

Alternatively or additionally, the identification method according to the invention comprises the step of detecting at least one marker locus in the nucleotide sequence of the nucleic acid molecule according to the invention or in a co-segregating region thereof. Preferably, the co-segregating region is a genomic region in sugar beet which is co-segregating for cercospora resistance conferred by a polypeptide according to the invention or a nucleic acid molecule according to the invention, more preferably, the co-segregating region comprises or is flanked by the markers sxh0678s01 and s4p0264s01, the markers s4p4301s01 and s4p2271s01, the markers s4p4301s01 and s4p4293s01, or the markers s4p4301s01 and s4p4295s 01. Thus, detection can be achieved by binding at least one label or at least one primer pair to a nucleic acid sequence according to SEQ ID NO: 74 or 75 (preferably at the locus according to SEQ ID NO: 76 or 77), and optionally a signal generated therefrom (e.g.a fluorescent signal or a sequence amplification). Thus, alternatively or additionally, the co-segregating region may comprise a nucleotide sequence according to SEQ ID NOs 74 and/or 75 or SEQ ID NOs: 76 and/or 77. Furthermore, the aforementioned identification method also means a method for selecting a plant showing cercospora resistance according to the present invention. The selection method comprises the final step of selecting resistant plants.

In this context, the invention also encompasses the development or generation of molecular markers suitable for detecting the above-mentioned polymorphisms between the nucleic acid molecules according to the invention (resistance alleles) and the sensitive allelic variants, wherein the markers are preferably suitable for detecting the polymorphisms presented in FIG. 1, or for constructing hybridization probes which specifically bind to the nucleotide sequences of the nucleic acid molecules according to the invention, or for generating a pair of nucleic acid molecules suitable for amplification in PCR (regions specific for the nucleic acid molecules according to the invention) and thus for detection in plants or plant cells.

The present invention preferably comprises a method for producing oligonucleotides of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, particularly preferably at least 100, 200, 300, 500 or 1000 nucleotides in length, which specifically hybridize to the nucleotide sequence of a nucleic acid molecule according to the invention or a nucleic acid molecule complementary thereto; or comprises a pair of nucleic acid molecules, preferably in the form of oligonucleotides, which are suitable as forward and reverse primers for attachment to regions specific for the nucleic acid molecules according to the invention and for amplification in the Polymerase Chain Reaction (PCR), or which are suitable as forward and reverse primers for hybridization into regions of the sugar beet genome which are coseparated with cercospora resistance conferred by the polypeptides according to the invention or with the nucleic acid agents according to the invention. SEQ ID NO 98 and SEQ ID NO 99 give examples of suitable primers for detecting resistance mediating nucleotide sequences according to the present invention. These two sequences constitute a primer pair that can be used for PCR.

The method for producing oligonucleotides initially comprises: aligning the nucleotide sequence of the nucleic acid molecule according to the invention with the nucleotide sequence of a corresponding nucleic acid molecule not conferring resistance or a sensitive allelic variant, which preferably has a nucleotide sequence according to SEQ ID NO 4 or 5; identifying sequence differences between the two nucleotide sequences; and generating nucleic acid molecules (referred to herein as oligonucleotides) that specifically bind to nucleic acid molecules according to the invention, but do not bind to nucleic acid molecules that do not mediate resistance.

Furthermore, the oligonucleotides according to the invention can be linked to a fluorescent dye in order to generate a fluorescent signal upon excitation, for example by light of the corresponding wavelength. The fluorescent dye may be a fluorescent dye. The oligonucleotides according to the invention can be coupled to other compounds suitable for generating a signal. Such oligonucleotides do not exist in nature and cannot be isolated from nature. The following operations were performed to produce such labeled oligonucleotides: the DNA may be bioorthogonally labeled. For this purpose, the DNA can be labeled in vivo or in vitro with nucleoside analogues, which can then be coupled to fluorophores, for example in each Staudinger reaction. In addition, DNA may also provide fluorophores by chemical means. Oligonucleotides can be labeled by phosphoramidite synthesis with fluorophores such as those used in QPCR, DNA sequencing and in situ hybridization. In addition, DNA can be generated enzymatically during the polymerase chain reaction with fluorescent nucleotides or labeled with a ligase or a terminal deoxynucleotidyl transferase. DNA can also be detected indirectly by biotinylation and fluorescent avidin. For coupling, fluorescein, fluorescent lanthanide, gold nanoparticles, carbon nanotubes or quantum dots, etc. are used as fluorophores. One of the most commonly used fluorescent substances is FAM (carboxyfluorescein). Thus, the invention includes oligonucleotides and in particular primers with FAM labels. FAM is preferably present in the form of 6-FAM, wherein other FAM variants, such as 5-FAM, may also be used, depending on the desired wavelength of emission and excitation. Examples of other fluorescent labels are AlexaFluor, ATTO, Dabcyl, HEX, Rox, TET, Texas Red and Yakima Yellow. Depending on the field of use, oligonucleotides modified with bases or sugar phosphate backbones can be provided. These include amino-dT, azido-dT, 2-aminopurine, 5-Br-dC, 2 '-deoxyinosine (INO), 3' -deoxy-A, C, G, 5-Met-dC, 5-OH-Met-dCN6-Met-dA and the like.

Furthermore, the invention relates to a labeling chip ("DNA chip" or microarray) comprising at least one oligonucleotide according to the invention which is suitable for detection. The marker chip is suitable for application in one or more detection methods according to the invention.

The invention likewise comprises a process for the production of the proteins according to the invention. The method comprises providing or culturing a nucleic acid comprising SEQ ID NO: 2, and subsequent expression of a polypeptide consisting of SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

Furthermore, the invention relates to an anti-Cercospora plant or part thereof identified by the method as described above and, if applicable, selected. In particular, the present invention relates to a population of plants comprising plants which are obtainable according to one of the methods according to the invention as described previously and which are preferably resistant to cercospora leaf spot or cercospora infection and which are characterized by the presence of a nucleic acid molecule according to the invention. The population preferably has at least 10, preferably at least 50, more preferably at least 100, particularly preferably at least 500, and especially in agricultural farming, preferably at least 1,000 plants. The proportion of plants in the population which do not carry a nucleic acid molecule according to the invention and/or which are susceptible to cercospora leaf spot is preferably below 25% -preferably below 20%, more preferably below 15%, even more preferably 10%, and in particular preferably below 5%, if present.

By the above fine localization, the position of the gene conferring Cercospora resistance in the sea beet genome can be determined, and the sequence region of the gene itself and the surrounding can be identified. This in turn represents the basis for the development of DNA hybridization probes or genetic markers in the target region, by means of which genes mediating resistance in Cercospora can be detected or distinguished from genes which do not develop resistance.

DNA hybridization probes are available from the sequences of genes that confer Cercospora resistance, and can be used to screen genomic and/or cDNA libraries of desired organisms. The probe can be used for amplifying the identified homologous genes by the known Polymerase Chain Reaction (PCR) and for checking whether the gene conferring Cercospora resistance is endogenously present in the organism or has been heterologously introduced into the plant.

The skilled artisan can here resort to conventional hybridization, Cloning and sequencing methods, as listed, for example, in Sambrook et al, Molecular Cloning: a Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. One skilled in the art can also synthesize and use oligonucleotide primers to amplify the sequence of genes that confer Cercospora resistance. To achieve specific hybridization, such probes should be specific and have a length of at least 15 nucleotides, preferably at least 20 nucleotides. Detailed guidelines for nucleic acid hybridization can be found in the following documents: tijssen, Laboratory technologies in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, first part, second chapter, "Overview of principles of Hybridization and the protocol of Nucleic Acid probe assays," Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter II, edited by Ausubel et al, Greene Publishing and Wiley lnterscience, New York (1995).

Thus, a nucleic acid molecule of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, particularly preferably at least 100, 200, 300, 500 or 1000 nucleotides in length is a subject of the present invention, wherein the nucleic acid molecule specifically hybridizes with the aforementioned nucleotide sequence according to the invention comprising a gene conferring cercospora resistance. This also explicitly includes the range of 15 to 35 nucleotides.

The invention therefore also relates to labels as oligonucleotides, in particular primer oligonucleotides. These labels comprise nucleic acid molecules of at least 15 nucleotides in length, which specifically hybridize to the aforementioned nucleotide sequences.

In particular, the invention comprises a pair of nucleic acid molecules-preferably in the form of oligonucleotides or a kit containing the pair of oligonucleotides-which are suitable as forward and reverse primers for hybridization into regions specific for the nucleic acid molecules according to the invention and for amplification in the Polymerase Chain Reaction (PCR) or which are suitable as forward and reverse primers for hybridization into regions of the sugar beet genome which are coseparated with the cercospora resistance conferred by the polypeptides according to the invention or with the nucleic acid molecules according to the invention.

The following advantages of breeding and breeding of new resistant plant lines of the genus beta are also achieved by the present invention. Sequence information and the identified polymorphisms that allow distinguishing between the resistant and susceptible alleles of the disclosed genes, i.e., between the allele that confers cercospora resistance and the allele that does not, make it possible to develop markers directly in the above genes and in regions located upstream and downstream, which represents an important advance for plant breeders-particularly for the development of optimized core lines without "linkage drag". Furthermore, knowledge about the sequence structure can be used to identify other resistance genes, e.g., homologous or orthologous, in particular anti-cercospora genes.

Thus, the invention also includes methods for identifying additional nucleic acid molecules encoding polypeptides or other proteins capable of conferring resistance to Cercospora in plants expressing the polypeptides. Thus, one skilled in the art can use databases, using appropriate search profiles and computer programs, to screen for homologous sequences or to perform sequence comparisons. Furthermore, other DNA sequences encoding Cercospora resistance proteins are available to the skilled person himself and are used within the scope of the present invention by means of conventional molecular biological techniques. For example, suitable hybridization probes may be derived from nucleic acid sequences according to the invention and may be used to screen genomic and/or cDNA libraries of a desired organism. The skilled artisan can here resort to conventional hybridization, Cloning and sequencing methods, as listed, for example, in Sambrook et al, Molecular Cloning: a Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. Using known sequences, one skilled in the art can also synthesize and use oligonucleotide primers to amplify the sequence of a nucleic acid molecule that confers Cercospora resistance.

In one embodiment, the invention therefore also includes a method for identifying a nucleic acid molecule encoding a polypeptide capable of conferring resistance to cercospora in a plant of the sugar beet species in which it is expressed. Thus, the method comprises comparing the amino acid sequence of a polypeptide according to the invention, which confers cercospora resistance in the sugar beet subspecies, with amino acid sequences from sequence databases, or with the sequence of allelic variants of a polypeptide according to the invention, in the genotype of the sugar beet species. Furthermore, the method according to the invention comprises identifying an amino acid sequence or allelic variant which is at least 80% identical to the amino acid sequence of the polypeptide according to the invention, and introducing a nucleic acid molecule encoding the identified amino acid sequence or allelic variant in a plant of the sugar beet species; expressing a nucleic acid molecule in a plant; and optionally, subsequently verifying resistance to Cercospora.

As already mentioned, further proteins conferring resistance to Cercospora or the genes encoding them, i.e.homologues, analogues and orthologues which are at least 70% identical, preferably at least 80%, particularly preferably at least 90%, particularly preferably at least 95%, or even 98% identical, to the amino acid sequence of the polypeptide encoded by the nucleic acid molecule according to the invention, can be identified by classical bioinformatic methods (database search and computer programs for screening for homologous sequences).

Thus, the term homologue means that the relevant genes (from two different plant species) have essentially the same function and common ancestry and thus usually show significant identity in their nucleic acid or encoded amino acid sequences. However, there are also many genes that are homologous to each other, but do not produce significant pairwise aligned (paired alignment) protein sequences. In contrast, the term analog describes a gene or protein (likewise) having the same or similar function, but not being produced by the same structure, i.e.without a common ancestor. In this case, no significant identity can be established, usually in their nucleic acid or encoded amino acid sequence, or, in the best case, in a particular functional domain.

In the context of genomic sequencing, homologs are more finely classified for annotation. The term is introduced for this purpose: orthologs and paralogs. Orthologs are genes linked by speciation events. Paralogs are genes that trace back replication events.

In the sense of the present invention, a gene is essentially a homologue or an analogue or an orthologue if it is capable of conferring cercospora resistance in a plant. To verify this, the identified homologues or analogues or orthologues are amplified by PCR, cloned in an expression vector, introduced into the target plant or plant cell and then checked for resistance, using methods known to those skilled in the art which have been described previously.

As mentioned above, the use of alleles of resistance genes in cis or transgenic approaches disclosed herein opens up the possibility of new resistant species of the genus beta, which exhibit higher resistance with dose effects, or, by stacking the disclosed genes with other resistance genes, resistance fragmentation can be avoided and resistance development optimized. Genes can also be modified by tilling techniques or targeted engineering to optimize codon usage, which in turn increases expression or develops new or modified resistance alleles. According to a preferred embodiment, the codon optimized sequence or modified resistance allele is not naturally occurring but is artificially synthesized. SEQ ID NO: 94 provides an example of a modified genomic sequence in which codons at positions 16-18 are modified, but the encoded amino acid sequence is unchanged and corresponds to SEQ ID NO: 3. SEQ ID NO: 95 provides an example of a modified cDNA sequence in which the codons at positions 55-57 are modified, but the encoded amino acid sequence is unchanged and corresponds to SEQ ID NO: 3. according to SEQ ID NO: 96 gives an example of a modified resistance-conferring allele in which the amino acid valine has been replaced by the amino acid leucine at position 209. According to SEQ ID NO: 96 consists of the amino acid sequence according to SEQ ID NO: 97. These sequences do not occur naturally, but are artificially synthesized. When the substitution is for example according to SEQ ID NO: 3, it is recommended to exchange amino acids within the following group:

a) glycine, alanine, valine, leucine, isoleucine

b) Serine, cysteine, selenocysteine, threonine, methionine

c) Phenylalanine, tyrosine, tryptophan

d) Histidine, lysine, arginine

e) Aspartic acid, glutamic acid, asparagine, glutamine.

The invention also relates to the use of the identified Cercospora resistance-conferring alleles in plants in genetic or molecular stack with other genetic elements that may confer agronomically advantageous properties. Thus, the economic value of a cultivated plant may be significantly increased, since for example the yield performance is increased compared to a plant having the same genetic gene but not provided with a nucleic acid molecule according to the invention. In addition, biological factors such as strong pathogen stress may open up new crop areas of plants that could not have been previously cultivated. In particular, the invention relates to the use of alleles conferring cercospora resistance in a method of controlling the infestation of the pathogen cercospora betanae in agricultural or horticultural cultivation of beet plants, comprising identifying and selecting the beet plants by means of one of the aforementioned methods and/or cultivating the plants so selected or progeny thereof. The present invention therefore comprises a method for cultivating a plant of the sugar beet species, comprising in a first step providing a plant of the sugar beet species having a resistance to Cercospora according to the invention, or producing a plant of the sugar beet species by means of the production method according to the invention, or identifying and selecting a plant of the sugar beet species by means of the previously described identification method according to the invention; and comprising, in a second step, growing the plant from the first step, or deploying an elite of the plant from the first step, or breeding the plant from the first step. The cultivation method thus prevents Cercospora from infecting the cultivated plants. The cultivation process may be part of a process for producing sugar. The method for producing sugar comprises the steps of the cultivation method, and further comprises, as a penultimate step, harvesting the cultivated plants and, as a final step, extracting sugar from said plants.

The cultivation method may be part of the method of producing the stock. The method for producing the stock comprises the steps of the cultivation method, and further comprises, as a penultimate step, vernalization of the cultivated plant, and as a final step, extraction of seeds from the plant.

The extracted seeds may optionally be granulated to obtain a granulated stock of the sugar beet species. In this case, this is a method of producing a granulated stock.

Furthermore, the method for producing the stock can be designed as a method for producing a Cercospora resistant stock. The method for producing a Cercospora resistant stock comprises the steps of the above-described method for producing a stock, and furthermore comprises verifying a nucleic acid according to the invention as a final step in at least one of the extracted seeds, preferably in at least 0.1% or at least 1% of the extracted seeds, according to the method described herein. It is particularly preferred to perform the validation so that the seeds remain germinable. This means that extraction of DNA from the seed required for validation does not neutralize the germinability of the seed. In this case, the verification of the nucleic acids according to the invention can be carried out in a particularly large proportion in all the extracted seeds. For example, validation may be performed in at least 2%, preferably at least 3%, particularly preferably at least 4% of all extracted seeds.

The plants according to the invention, their cells or the seeds or stocks according to the invention may have further agronomically advantageous properties or provide these properties. An example is tolerance or resistance to herbicides such as glyphosate, glufosinate or ALS inhibitors. Tolerance to glyphosate or ALS inhibitor herbicides is preferred. Specific examples of glyphosate resistance are disclosed in US 7,335,816B 2. Such glyphosate resistance may be obtained, for example, from stocks stored in NCIMB, Aberdeen (scotland, uk) under accession number NCIMB 41158 or NCIMB 41159. Such seeds can be used to obtain glyphosate tolerant sugar beet plants. Glyphosate resistance can also be introduced into other species of the beta genus by hybridization.

Thus, the present invention also encompasses plants, cells or seeds or seed starting materials thereof, characterized in that they comprise a nucleic acid according to the invention and in that:

a) a DNA fragment of genomic DNA of a plant, part thereof or seed can be obtained by comparison with a DNA fragment having a sequence according to SEQ ID NO: 81 and a first primer having a nucleotide sequence according to SEQ ID NO: 82, wherein the DNA fragment is amplified by polymerase chain reaction with a second primer of the nucleotide sequence according to SEQ ID NO: 83 are at least 95% (preferably 100%) identical in nucleotide sequence, and/or

b) A DNA fragment of genomic DNA of a plant, part thereof or seed can be obtained by comparison with a DNA fragment having a sequence according to SEQ ID NO: 84 and a first primer having a nucleotide sequence according to SEQ ID NO: 85, wherein the DNA fragment is amplified by polymerase chain reaction with a second primer of the nucleotide sequence according to SEQ ID NO: 86 are at least 95% (preferably 100%) identical in nucleotide sequence, and/or

c) A DNA fragment of genomic DNA of a plant, part thereof or seed can be obtained by comparison with a DNA fragment having a sequence according to SEQ ID NO: 87 and a first primer having a nucleotide sequence according to SEQ ID NO: 88, wherein the DNA fragment is amplified by polymerase chain reaction with a second primer according to the nucleotide sequence of SEQ ID NO: 89 are at least 95% (preferably 100%) identical in nucleotide sequence.

Specific examples of ALS inhibitor herbicide resistance are disclosed in WO2012/049268a1 documents. For example, such ALS inhibitor herbicide resistance is available from the deposit of NCIMB, Aberdeen, uk under accession number NCIMB 41705. Furthermore, such ALS inhibitor resistance may be produced by tilling or site-directed mutagenesis (e.g., by gene editing, e.g., by using CRISPR/Cas, CRISPR/Cpf1, TALENS, or zinc finger nucleases. The invention therefore also encompasses plants, their cells or seeds or seed starting materials, which are characterized in that they comprise a nucleic acid according to the invention and in that they exhibit a mutation in an endogenous acetolactate synthase gene, wherein the acetolactate synthase gene codes for an acetolactate synthase protein (whose amino acid differs from tryptophan as a result of the mutation at position 569). As a result of the mutation, the amino acid at position 569 is preferably alanine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, valine or arginine. Position 569 is preferably represented by SEQ ID NO: position 569 of 90. Furthermore, it is preferable to mutate the acetolactate synthase gene SEQ ID NO: 91. A mutated sequence of an acetolactate synthase gene, or a nucleotide sequence according to SEQ ID NO: 91, are not naturally occurring and cannot be isolated from nature. Furthermore, the mutation may be present in both heterozygous and homozygous form in the plant, its cells or seeds or seed material. We recommend that the mutation is present in homozygous form, as this may promote a more stable or more robust resistance phenotype.

Many other herbicides and their applicability are known to those skilled in the art from the prior art. He can resort to the prior art in order to understand which genetic elements are to be used in what way in order to achieve the corresponding tolerance in the plant.

Furthermore, herbicide tolerance has a synergistic effect, i.e. the occurrence of weeds can be reduced by the use of herbicides. This is advantageous against Cercospora species, since it is well known that conidia (asexual spores) or pseudo-substrates (mycelia) of Cercospora betanae can survive on plant material for up to 2 years.

Another example of an agronomically advantageous property is resistance to other pathogens, wherein the pathogen may be, for example, an insect, a virus, a nematode, a bacterium, or a fungus. For example, a wide range of pathogen defenses in plants can be achieved by different pathogen resistance/tolerance combinations, as genetic elements can exhibit additive effects with respect to each other. For example, the person skilled in the art knows many resistance genes for this as genetic elements. For example, US20160152999a1 discloses RZ resistance genes against beet clump root disease. The disease is caused by the virus of 'beet necrotic yellow vein'. Several disease resistances contained in one plant have a synergistic effect with each other. If a plant is infected with a pathogen for the first time, its immune system is usually weakened and the epidermis, which acts as an external barrier, is usually damaged, increasing the likelihood of further infection. Another example of an agronomically advantageous property is cold or freezing resistance. For example, plants exhibiting such characteristics may be sown early in the year, or may be grown in the field for longer periods of time, which may result in increased yield. The person skilled in the art can also resort here to the prior art for finding suitable genetic elements. Other examples of agronomically advantageous characteristics are water use efficiency, nitrogen use efficiency and yield. Genetic elements useful for conferring such properties can be found in the prior art.

In addition, many modifications of pathogen defense are known to those skilled in the art. In addition to the frequently described R gene families, the Avr/R method, Avr gene complementation (WO 2013/127379), R gene self-activation (WO 2006/128444) or HIGS (host-induced gene silencing) methods (e.g., WO2013/050024) can also be advantageously used. In particular, the self-activation of the R gene may be important for the present invention. To this end, a nucleic acid encoding a self-activating resistance gene that confers pathogen resistance to plants has been created. Then, the nucleic acid has only a limited portion of the NBS-LRR resistance gene (e.g., wb-R gene) extending downstream from the 5' end of the NBS-LRR resistance gene coding region to the start of the NBS domain coding for the NBS-LRR resistance gene.

In this context, a method is also included, which comprises the step of removing a region of a nucleic acid according to the invention, which nucleic acid encodes an N-terminal region and which starts from the p-loop in the NBS domain and extends to the end of the N-terminal region.

The resistance proteins encoded by such shortened nucleic acids are typically self-activating, as these resistance proteins trigger an immune response in the plant (even in the absence of the associated pathogen), thus increasing the basic immunity of the plant. Furthermore, such shortened nucleic acids according to the invention and polypeptides encoded thereby are also included.

Furthermore, the invention also comprises the use of alleles of genes conferring cercospora resistance identified by the above-described methods in combination with one of the aforementioned modifications or with the aforementioned genetic elements that can confer one or more agronomically advantageous properties to a plant.

In addition to the plants according to the invention, the invention also relates to seeds or progeny of plants, or organs or plant parts, tissues or cells thereof, in the production of products which are usually manufactured from sustainable raw materials, such as food and animal feed-preferably sugar or syrup (molasses), and in the production of materials or substances for the chemical industry, such as refining chemicals, pharmaceuticals or precursors thereof, diagnostics, cosmetics, bioethanol or biogas, or in the production of such materials or substances for the chemical industry, such as sugar or syrup (molasses), wherein molasses is also used in industrial applications, for example for alcohol production or as a growth substrate for the production of biotechnological products. An example of the use of sugar beets as biological raw material in biogas plants is described in application DE 102012022178 a 1; see, for example, paragraph 10.

The following examples illustrate the invention without limiting the subject matter of the invention. Standard molecular biology methods are used unless otherwise indicated. See, e.g., Sambrook et al, Molecular Cloning: a Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001; fritsch et al, Cold Spring Harbor Laboratory Press: 1989; mayer et al, biochemical Methods in Cell and Molecular Biology, eds., Academic Press, London, 1987; and Weir et al, Handbook of Experimental Immunology, Vol.I-IV, edited by Blackwel, 1986.

Some of the most important sequences according to the invention will be explained in detail below:

-SEQ ID NO: 1: genomic DNA sequence of a gene from sea beet conferring Cercospora resistance.

-SEQ ID NO: 2: a cDNA sequence of a non-naturally occurring gene conferring cercospora resistance.

-SEQ ID NO: 3: consisting of SEQ ID NO: 1 or SEQ ID NO: 2 encoding a protein conferring resistance to cercospora.

-SEQ ID NO: 4: genomic DNA sequence of a sensitive variant of a gene conferring Cercospora resistance.

-SEQ ID NO: 5: cDNA of a sensitive variant of a gene conferring resistance to Cercospora.

-SEQ ID NO: 6: amino acid sequence of a sensitive variant of a gene conferring Cercospora resistance.

-SEQ ID NO: 7: a native promoter of a gene from sea beet conferring cercospora resistance.

-SEQ ID NO: 8: a natural terminator from a gene of sea beet conferring cercospora resistance.

-SEQ ID NO: 53: from sea beet containing a polypeptide according to SEQ ID NO: 1 of the gene locus conferring cercospora resistance.

Examples

Example 1: introduction of resistance-conferring genes into sugar beet subspecies by CRISPR-mediated homologous recombination

Design and selection of crRNA:

suitable crRNAs for induction of Cpf 1-mediated double strand breaks were designed with the aid of the CRISPR RGEN tool (Park J., Bae S., and Kim J. -S.Cas-Designer: A web-based tool for choice of CRISPR-Cas9 target sites Bioinformatics 31, 4014-. For this purpose, suitable protospacer sequences were found within the genomic DNA sequence having a length of 500-1300bp flanking the 5 '-end and the 3' -end of the Cercospora resistance gene from sea beet. To ensure the functionality of endonuclease Cpf1 of Lachnospiraceae bacteria (Lachnospiraceae bacteria) ND2006(Lb), a 24nt long protospacer was chosen, the 5' -terminal genome-binding sequence of which is flanked by a basic protospacer-adjacent motif (PAM) with the sequence 5' -TTTV-3 ' (V ═ G or C or a). Appropriate protospacer sequences are selected according to predetermined quality criteria of the tool and matched to potential off-target sites of the reference genome of the beet subspecies. For the continuation of the test, only crRNA was selected, which has at most 15 identical bases to functional PAM, except for the actual target sequence. Since the first 18nt of the original spacer sequence is essential for detection and cleavage of the target sequence, unnecessary cleavage in other genomic sequences can be excluded in this way (Tang, X., L.G.Lowder, T.Zhang, A.A.Malzahn, X.ZHEN, D.F.Voytas, Z.ZHong, Y.Chen, Q.ren, Q.Li, E.R.Kirkland, Y.Zhang, and Y.Qi (2017), "A CRISPR-Cpf1 system for effective genome editing and translational expression in Plants" Nat Plants 3: 17018). In this way, four potential crrnas (5 'crRNA #1-4) can be identified in the 5' -flanking region of the resistance gene and three crrnas (3 'crRNA #1-3) can be identified in the 3' -flanking region of the resistance gene (see table a).

Table a: selected target sequences within the 5 '-and 3' -flanking DNA sequences of the resistance gene in sugar beet. PAM is underlined.

Cloning of the genetic elements: to clone the cpf1 expression cassette and the crRNA expression cassette, the test sequence of the BbsI restriction enzyme that prevented cloning was first removed from the target vector pzfnptii by introducing a point mutation (T to G). Mutagenesis was performed with the mutagenesis kit using two mutagenesis primers according to the manufacturer's instructions (see table B).

Table B: mutagenesis primers for introducing point mutations (T to G, underlined) to remove the BbsI detection sequence.

Name (R)	Sequence 5'→ 3'
		Mutagenesis primer 1	TCAGTGCAGCCGTCGTCTGAAAACGACA(SEQ ID NO：23)
Mutagenesis primer 2	TGTCGTTTTCAGACGACGGCTGCACTGA(SEQ ID NO：24)

For the expression of the Lbcpf1 gene in sugar beet, a codon-optimized DNA sequence for arabidopsis thaliana (a. thaliana) was synthesized with the 5 'flanking PcUbi promoter sequence (SEQ ID NO: 79) from parsley (Petroselinum crispum) and the 3' flanking 3A terminator sequence from Pea (Pea sp) as DNA fragments. Removal of the amino acid sequence of the coding sequence (CDS) in Lbcpf1 by introducing silent mutations (base exchange, without modifying the amino acid sequence) [ SEQ ID NO: 78] the relevant restriction medium (HindIII) was cloned to avoid accidental cleavage within the coding region. Codon optimization was performed with the aid of the GeneArt algorithm from Invitrogen/Thermoscientific. To enable Cpf1 to be transported within the nucleus, the coding sequence for the Nuclear Localization Signal (NLS) of SV40 was integrated into the Cpf1 CDS at the 5 'end and the NLS of the nucleoplasmin protein was integrated at the 3' end. For ligation in the binary target vector pZFNPTII (FIG. 2), the expression cassette was flanked by two HindIII restriction media and subsequently ligated to pZFNPTII _ LbCpf 1. Successful insertion of the PcUbi:: Cpf1:: TPea expression cassette was verified by sequencing, with the binding regions for the primers used for sequencing located within the flanking vector regions and expression cassettes (see Table C).

Table C: primers for sequencing of PcUbi:: Cpf1:: TPea expression cassette integrated into pZFNtII

Name (R)	Sequence 5 '3'
		pSeq_CRBM4_F1	SEQ ID NO：25
pSeq_CRBM4_R1	SEQ ID NO：26
		pSeq_CRBM4_F2	SEQ ID NO：27
pSeq_CRBM4_R2	SEQ ID NO：28
		pSeq_CRBM4_F3	SEQ ID NO：29
pSeq_CRBM4_R3	SEQ ID NO：30
		pSeq_CRBM4_F4	SEQ ID NO：31
pSeq_CRBM4_R4	(SEQ ID NO：32)

After transcription into a plant cell, the crRNA should be cleaved off by two flanking ribozymes. To this end, the precursor crRNA is flanked by coding sequences for hammerhead ribozymes and HDV ribozymes (Tang, X., L.G.Lowder, T.Zhang, A.A. Malzahn, X.ZHeng, D.F.Voytas, Z.ZHong, Y.Chen, Q.ren, Q.Li, E.R.Kirkland, Y.ZHang, and Y.Qi (2017), "A CRISPR-Cpf1 system for effective gene editing and transcriptional expression in Plants" Nat Plants 3: 17018).

To achieve perfect ligation of the respective protospacer sequences at the coding sequence of the crRNA repeat, two BbsI detection sequences were integrated between the crRNA repeat and the HDV ribozyme, with the single-stranded overhangs (overhangis) used for cloning adjusted accordingly. To ensure the same expression strength of cpf1 and crRNA, the crRNA nuclease cassette was conjugated at the 5 'end with the PcUbi promoter sequence and at the 3' end with the 3A terminator sequence. For subsequent ligation in the target vector pZFNPTII _ Cpf1, the crRNA expression cassette was flanked by two PstI junctions and arranged as a synthetic DNA fragment. The original spacer sequence was synthesized as a complementary oligonucleotide and annealed according to standard protocols. The 24bp long DNA fragment generated in this way was flanked by ligation-related 4-nt single-stranded overhangs (see Table D).

Table D: sequences used to generate oligonucleotides that are short 24bp protospacer sequences. The 4-nt single stranded overhangs used for ligation were the first four nucleotides of each of the sequences listed below, respectively.

The efficiency of four crrnas was tested by agrobacterium-mediated gene transfer in sugar beet leaves. The pZFNPTII plasmid was co-transformed to check the transformation efficiency. Transformation of leaf explants was performed by vacuum infiltration according to standard protocols. Six days later, the fluorescence of tDT was examined by fluorescence microscopy and leaf explants with heterogeneous fluorescence were discarded. Ten days after the infiltration had occurred, leaf explants were flash frozen in liquid nitrogen, triturated, and genomic DNA was isolated by the CTAB method (Clarke, Joseph D., "Cetylmethylmethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation" Cold Spring Harbor Protocols 2009.3 (2009): pdb-prot 5177). The efficiency of a single crRNA is determined by an external service provider by NGS using the frequency of inserted versions (e.g., insertions, deletions, or base exchanges) compared to the frequency of unedited sequences in genomic DNA.

As a synthetic DNA construct, the most efficient crRNAs (5 'crRNA #3 and 3' crRNA #1) were aligned as reverse expression cassettes along with the previously described ribozymes, promoter and terminator sequences. The entire DNA construct was flanked by two PstI restriction interfaces for cloning in the target vector pzfnptii _ LbCpf 1. After crRNA insertion has occurred, LbCpf1 and the crRNA expression cassette are ligated from the vector pzfnptii _ LbCpf1_ crRNA to the pUbitdtnptii vector by HindIII.

As a repair template to be integrated into the genome of sugar beet by homologous recombination, the resistance gene expression cassette is flanked at the 5 '-end by a 5' crRNA #3 binding sequence and at the 3 '-end by a 3' crRNA #1 binding sequence. This allows excision of the resistance gene expression cassette from the plasmid by Cpfl. The entire DNA template was synthesized as a synthetic DNA fragment 87326bp long (SEQ ID NO: 80) and used directly in the vector backbone for transformation. The resistance gene plasmid and pUbitDTnptII _ LbCpf1_ crRNA plasmid were introduced into the sugar beet callus cultures by means of gene cannons.

One day after transformation, transformation efficiency was determined by fluorescence microscopy using transient tDT fluorescence. Callus cultures were grown on shoot induction medium without selective pressure (without kanamycin) and subsequently the regenerated shoots were examined for site-directed integration of the resistance-conferring resistance gene cassette. For this, genomic DNA was isolated by CTAB. Using the peptide according to SEQ ID NO: 47, pCRBM4_ F1 and the nucleotide sequence according to SEQ ID NO: primer pCRBM4_ R1 (see Table E) at 48, integrated resistance conferring genes were amplified by PCR and the PCR products were subsequently sequenced with both primers. In the following analysis of the integration sites of the resistance genes, shoots were identified which could verify successful insertion of the expression cassette in this way. To verify the insertion of the desired target sequence in the genome, the flanking regions of the resistance gene expression cassette were amplified by PCR. Primer binding here occurs within the resistance gene DNA sequence; binding of the second primer occurs outside the 5 '-or 3' -flanking homology region of the inserted expression cassette (see table E). The amplified DNA sequence was sequenced using the same primers and in this way the integration of the desired position was confirmed. To exclude the primers pCRBM4_ F1(SEQ ID NO: 47), pCRBM4_ R1(SEQ ID NO: 48), pCRBM4_ R2(SEQ ID NO: 50) and pCRBM4_ F3(SEQ ID NO: 51) from binding to similar regions of the genome sequences, all primer sequences were previously compared to the sugar beet genome. For primer pCRBM4_ F3(SEQ ID NO: 51), it was not possible to select the nucleotide sequence to exclude binding to the wild type sequence. Thus, the 3' flanking region was amplified in all shoots that tested positive for the resistance gene and site-specific insertions were specifically verified by subsequent sequencing. The PCR product thus produced differed from the wild type sequence by 18 bp. To enable complete sequencing of the amplified sequence, the PCR product was additionally sequenced by a third primer (pCRBM 4-S2, pCRBM 4-S3; see Table E) with a binding site in the amplified sequence. To exclude non-specific binding of primers pCRBM4_ F1(SEQ ID NO: 47), pCRBM4_ R1(SEQ ID NO: 48) and pCRBM4_ R2(SEQ ID NO: 50) within the non-wild type genome, the nucleotide sequences were compared to the internal reference genome of sugar beet. The binding of the primers in the genomic sequence of sugar beet wild type plants was additionally tested by PCR.

To exclude integration of the resistance gene in other regions of the genome, targeted amplification of the target site is performed (targeted site amplification, TLA).

Table E: primers used to verify insertion of the resistance gene expression cassette into the desired integration site.

In addition to the validation of the resistance gene expression cassette and the successful insertion into the sugar beet genome, unnecessary integration of the plasmid DNA was also examined. For this, the genomic DNA (in which the successful insertion of the resistance gene into the desired target site was verified) was checked by PCR for the presence of plasmid DNA. Thus, the sequence regions within cpf1, the crRNA nuclease cassette and tDT were amplified using the primers listed in table F, followed by sequencing.

Table F: primers for verifying stably integrated plasmid-specific sequences in the genome of regenerated sugar beet sprouts

Example 2: introduction of resistance-conferring genes as transgenes into sugar beet subspecies by gene transformation

The transgenic approach to produce cercospora resistant plants is not only used for alternative verification of LRR genes as resistance conferring genes, but also as a means to generate transgenic resistance events that confer new cercospora resistance or enhance existing cercospora resistance.

The binary vector pZFN-nptII-LRR was generated by the following standard cloning procedure: within the T-DNA of this vector, the cDNA of the resistance gene according to SEQ ID NO 2 is cloned together with its native promoter sequence. The T-DNA also includes the neomycin phosphotransferase II (nptII) gene, which confers resistance to aminoglycoside antibiotics such as kanamycin or paromomycin. These antibiotic resistances are used to select transgenic plant cells and tissues. The NOS promoter and pAG7 terminator flank the nptII gene. The backbone of the binary vector also contains sources of colE1 and pVS1 for plasmid replication in E.coli or Agrobacterium tumefaciens. The aadA gene confers streptomycin/spectinomycin resistance for bacterial selection. The pZFN-nptII-LRR plasmid was transformed into Agrobacterium strain AGL-1 by standard procedures.

The Transformation of sugar beets is carried out according to Lindsey & Gallois (1990) ("Transformation of sugarbeet (Beta vulgaris) by Agrobacterium tumefaciens" Journal of experimental botanic 41.5, 529-. For this purpose, "micropropagated shoots" of genotype 04E05B1DH5 which do not carry a resistance gene according to the invention are used as starting material. The shoots were propagated in the corresponding medium according to Lindsey & Gallois (1990). To induce as many meristems as possible, "shoots" were transferred to different media (see Lindsey & Gallois (1990)) and incubated at about 30 ℃ in the dark for several weeks. Agrobacterium strain AGL-1 (FIG. 3) carrying the vector pZFN-nptII-LRR was cultured in another medium additionally provided with the corresponding antibiotic for selection (see Lindsey & Gallois (1990)). Sections based on meristematic tissue of the shoot to be treated were incubated for several hours in another medium with Agrobacterium (see Lindsey & Gallois (1990)). Plant explants and Agrobacterium were co-cultured in medium in the dark for at least 2 days (see Lindsey & Gallois (1990)), and inoculated explants were subsequently cultured in additional medium in the dark for about 2 weeks (see Lindsey & Gallois (1990)). Subsequently, the explants were further propagated in additional medium (see Lindsey & Gallois (1990)) and subcultured to enable selection of transgenic tissues. To end the selection phase and reduce the extent of chimera formation, green "shoots" were transferred to medium H and propagated for 2 weeks in total. Leaf material was then extracted from this green growing "shoot" and examined for the presence of the transgene by PCT. The appropriate "shoots" were rooted in medium I and then transferred to the greenhouse for the production of T1 seed feedstock. In addition, leaf material from these "shoots" was used to analyze the expression of the transformed resistance genes.

Analysis of expression levels

RNA was isolated from leaves of in vitro "shoots" and used for qRT-PCR. qRT-PCR was performed according to Weltmeier et al (2011) (see background). The measurements were normalized to the reference gene PLT3_075_ F09 (see Weltmeier et al, 2011). Expression was determined by using the following primer sequences:

sequence of	Size [ No. nucleotide]	T_m[C°]	Size of amplification product [ No. nucleotide ]]
				SEQ ID NO：92	21	59,8	170
SEQ ID NO：93	21	58,9	170

Resistance testing after sugar beet inoculation with cercospora farinosa under greenhouse conditions:

pure cercospora cultures of known high virulence were propagated on vegetable juice agar in petri dishes (9 cm diameter) under Near Ultraviolet (NUV) light at 20 ℃. After 14 days, the mould-growing agar surface was submerged in 10ml sterile water in each petri dish and conidia and hyphal debris were carefully scraped off with the aid of subject slides. Plants were inoculated with an inoculum density of 20000 conidia/mycelium fragments per ml plus 0.1% tween 20. At the time of inoculation, the plants have been cultured under greenhouse conditions for 8 to 9 weeks. The top and bottom of the leaves were treated with inoculum. These plants were then cultured at 25 ℃ for 5 to 7 days at 18 hours/6 hours light/dark and about 100% humidity. The first Cercospora symptom appeared on the sugar beet leaves after 12 to 14 hours. With the help of the rating score assessment shown in table 1A, the symptoms of the individual plants were assessed regularly. The results are shown below.

Table G: transgenic validation of the function of the resistance gene according to the invention in transformed plants;

LSD ═ minimal significant difference; dpi ═ days after infection

Results of transgene validation of the resistance gene according to the invention (see table G).

Test group 1 represents a negative control. The genotype was the same as test groups 2 to 11, but no transformation occurred. Thus, no expression was detected. Test group 4 was transformed, but no expression was detected. Test groups 2, 3 and 5 to 11 represent transformants carrying the resistance gene according to the invention only as a result of transformation. Test group 12 represents breeding lines comprising non-transgenic forms of the resistance genes according to the invention. The grade scores of all lines were determined after inoculation of the plant material with cercospora betanae described above. Test group 12 showed the highest resistance with the final value indicated 5, 19.

Transgenic lines showed a rating scale according to the following table:

table H: grade scoring of transgenic lines of table G

Table H shows only the grade scores of the transgenic check groups. The mean of all transgenic test groups (excluding group 4) is shown first. Only transgenic lines showing an expression level of at least 10 are given a grade score (groups 3, 8, 9, 10; see table G). The final rating here was 5, 91. This is significantly higher than the higher resistance of the group 1 negative control (which has only a rating score of 6, 46) (the least significant difference is 0, 4; see table G). The best transgenic test group (group 8) showed better resistance because the rating score was 5,48 (see table G).

It is worth mentioning that the expression level of the transgene insert may be affected by the integration locus. When the expression level is measured in vitro, the actual expression level under infectious conditions may be higher, especially if the resistance gene is under the control of a pathogen-inducible promoter.

And (5) carrying out statistical evaluation on a transgenic verification result.

Table I: statistical cluster analysis

Test group	Clustering 8dpi	Clustering of 11dpi	Clustering of 13dpi	Clustering of 15dpi
					1	ab	a	a	ab
2	e	de	bc	cd
					3	e	ef	c	bcd
4	bc	bcd	bc	bcd
					5	cd	abc	a	abc
6	a	ab	a	ab
					7	ab	a	a	a
8	de	ef	c	e
					9	e	de	bc	d
10	cd	cd	b	d
					11	ab	a	a	a
12	de	f	d	e

Table I shows the statistical evaluation of the rating scores contained in table G. Each letter symbolizes the assignment to a statistical group. For example, it is clear that after final evaluation (15dpi) test group 8 (transgene validation) was in the same cluster as test group 12 (resistance source) but in a different cluster than test group 1 (negative control). Accordingly, test group 8 was significantly different from test group 1, but not from test group 12.

In addition, boxplot analysis was also performed. An illustration of box plots can be obtained from fig. 4 to 7.

Sequence listing

<110> Kovosa seed European shares of two

<120> Gene for controlling plant disease

<130> KWS0270PCT

<150> EP18157246.2

<151> 2018-02-16

<150> US16/051,113

<151> 2018-07-31

<160> 99

<170> PatentIn version 3.5

<210> 1

<211> 3720

<212> DNA

<213> Beta vulgaris

<400> 1

atgaacatga aaatcctcct tttgtttgtc ttccttcatc acctccacta cttcatccat 60

ggcagaacac ttacagaacg ccaagcttta ctaagtatca aatctgccat tacttatgat 120

tattataact ctctctcctc atggaaaaac acaacacacc actgcagttg gccatacatc 180

acttgctcct cctcttcttc ttcttcttct gttatttctc tcaacttcac catgttattt 240

ctcgaaggaa ttctctcccc tgatataggc ttcctcacca acctgcaaaa cctctctatt 300

cgatctaacc ttttttctgg cccactcccc cattctctct ctctcctcac ccaactccgc 360

tatctcgacg tttcccaaaa cagtttcaca ggtccaatcc catcttctct ctctctcctc 420

acccaactcc gctatctcca cgtttccggc aacagtttca caggtccaat cccatctttt 480

ctctctctcc tcacccaact ccgctatctc gacgtttccg acaacagttt cacaggtcca 540

atcccatctt ctctctctct cctcacccaa ctccgctatc tcgacgtttc ctacaacaat 600

ctaaatggca ctcttccctt atcggtcgtt gagaagatgt cggagctcag ctaccttaac 660

cttaggtata actctttcta cggtgagatt ccaccggagt ttgggaaact taagaagctt 720

gaaacattga atcttggtaa caacactctt tctgggagtc ttccatctga gttgggttca 780

ttaaagagtt tgaaacatat ggacttttct agtaatatgc tatttggtga gatcccacaa 840

tcttattctc ttcttcgaaa cttaatcgat attgatctta atagaaacaa gttatatggg 900

agtatacctg attatattgg agattttccg gagttggaat cacttttatt agactcgaat 960

aacttcacag ggagtatccc acaaaagtta ggtacaaacg ggaagttgca atatctagat 1020

ataagtaaca acaattttag tggtagtttg ccactaagtc tttgcaaagg agacaaactc 1080

caagatctgg acgcatccta taatttgttg gttgggtcaa ttcctgagag tttgggaagt 1140

tgcaagtcac ttgaaggagt gtacatggga aataatttct taaacgggtc gattcctaag 1200

ggcttgtttg ggagtgatgt ttcacttaat gacaaacttc ttagtggagg tctcgatgag 1260

aaattcggtg attgcgttaa tcttcgggac attgatctct ctaataataa gctatcaggg 1320

aagttacctg cgaccatcgg aaactgtatt catcttcggt ccttgacgct ttataataac 1380

acctgtaccg gacgtatccc tcaagagatt agcaagtgta agcagctaca gaccctcgat 1440

ctcagccaaa atcagttctc tggtgtgata cccaatgata ttacaggtaa gaaagtatat 1500

taaacttgtt acttttgaaa atattcgctc tagtttttgt ttcagttggt ccattctcac 1560

tttgtattat tgaaatatat cccaaaaaag taaatataat tatataaaag aatcttgcta 1620

aaaataatat gaattatttt tgtatgtgca aaataatgta caaatctaac taatttgttg 1680

tggataataa tattaattgt gtgaaatagt aaatgtgtgg agatatataa ctttatttat 1740

catattcact caggttttta ggtatttatt atgagttttg cattggagat atccaacttg 1800

acaatagtat ttttgtaata taccaatata taaagattac tgtacataac caaaatgtat 1860

acttttctta tttttataaa cttatatatt cctcttcttt gtatttatca caacattttt 1920

tatacccttt tgcctcatat taatagcaac acttataatt tatttattta ctttttattt 1980

cttggtctat aacctcatct acccacatat gacacaccct ataaaggacc cacatgatta 2040

accaaaatat acaaatatct tcaatgaaat taactttaac actaatatga taaaaatcat 2100

gtcccgcttt ttatcctcta actaagactc tgcataaagg tatattgcaa ttaatatgag 2160

atggaagagg tataataatt atatgatcaa attcctggat tgaaaaataa atatgagatt 2220

aaaagtggta tgtttttggt taaaagaaac tatccataaa gtatgttttt ggttaaaaga 2280

aactatgcaa cataccaatc aaatgtttat acgcttacaa tttatgtacc acttttttgt 2340

cattgttttt ctattgtttg ccatacgtac gttactaaat catgttgtct tttcacattt 2400

taactaacaa taaattacta ttgatacacc aaaaaaatct atgagcattg gagtacgttg 2460

tttgatagaa gcttcgtgct attatttctt gtcaaagaat ttcatatctc aatatcttct 2520

aatttaacaa tctaacgaaa tttttttgac ccaggaaaca aatccatttg caatctggaa 2580

aagatacaaa cacttaaatt atcaaacaat gctttgactg gtgaaatccc tcattgtgtt 2640

ggaaatatcg agctcatagc attatttctc caatcaaaca aactgaacgg taccataccc 2700

gcaaacttct caaagttatg tgattcattg atatatctag atcttagtga caatcaactc 2760

gaaggagttc tacctaagtc cttgtccaaa tgtcaaagtc tagaactcct aaatgtcggg 2820

aacaataggc taagagataa atttccttca tggttagaca acctcccacg tctccaagtt 2880

ttcagtgtgc gttttaacgc cttctacggt cctataacta gctcaccaaa agttagtcac 2940

ccatttccta tgctacaaat tatcgaccta tctaacaata agttttgtgg caagttgcca 3000

agaagatata tcaaaaactt tgcaaccatg cgcaatatga atgagtctgg tgttgggaat 3060

ccacagtacc tgggggactc atcaatatat agtattacgt actctatggt attgacattc 3120

aatgggttac aacaaaaata tgaaaagctt attgtgacga tgtcgacctt tgatatatcc 3180

agcaacaact ttactggaca gattccatat gttatagggg gattacgctc acttcgtaac 3240

cttaatctct ctcataatgt cttaaccggg aacattcctc catcaattgc aaaattgtct 3300

ttgcttcaag atttggacct ttcatcaaac agacttactg gtcgtatccc tcaagaatta 3360

gttagtttaa catttcttgg gagtttcaat gtttcgaaca atctattgga ggggtctata 3420

cctcatggtt tcaacttcga cacgtacaca gctaattcat accaggggaa tctcgaatta 3480

tgtggaaaac cattacctga gtgtggagaa agaagggcaa aaggcaccac taataatcaa 3540

gatgatccta aaaatgataa tgaacgaatg ttgtcgatgt ccgaaatcgt agttatgggg 3600

tttggcagtg gtgtactagt tgggttggct tggggatact atatgttttc agtgggaaag 3660

cccttttggt ttatcaagat ggctagcaaa atggaatcaa tattgattgg ttttttctga 3720

<210> 2

<211> 2652

<212> DNA

<213> Artificial Sequence

<220>

<223> cDNA sequence of the Cercospora resistance-conferring gene

<400> 2