阅读说明：本技术 Prpf31基因表达敲低提高体外分化的人细胞的存活 (Knockdown of PRPF31 gene expression enhances survival of human cells differentiated in vitro ) 是由 查尔斯·E·默里 莎拉·杜普拉斯 约翰·拉玛基亚 詹姆斯·富盖特 威廉·罗伯·麦克莱伦 莉 于 2020-03-13 设计创作，主要内容包括：本文描述了与提高体外分化的人细胞的存活和植入的方法相关的方法和组合物及其用途。(Described herein are methods and compositions related to methods of improving survival and engraftment of human cells differentiated in vitro and uses thereof.)

1. A composition comprising a human cell differentiated in vitro from a stem cell and an agent that reduces the level or activity of pre-mRNA processing factor 31(PRPF 31).

2. The composition of claim 1, wherein the cells differentiated in vitro from stem cells are cardiomyocytes.

3. The composition of claim 1, wherein the cells differentiated in vitro from stem cells are cells of mesodermal lineage.

4. The composition of claim 3, wherein the in vitro differentiated cells are cell types selected from the group consisting of: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

5. The composition of claim 1, wherein the in vitro differentiated human cells are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

6. The composition of claim 1, wherein the stem cells are derived from a healthy subject.

7. The composition of claim 1, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

8. The composition of claim 7, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

9. The composition of claim 7, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

10. The composition of claim 8, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

11. A transplant composition for transplantation into a recipient, the composition comprising in vitro differentiated human myocardial cells that have been contacted with an agent that reduces the level or activity of PRPF31 and a pharmaceutically acceptable carrier.

12. The graft composition of claim 11, wherein the agent is selected from a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

13. The graft composition of claim 11, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

14. The graft composition of claim 12, wherein said vector is selected from the group consisting of a plasmid and a viral vector.

15. The graft composition of claim 13, wherein the RNAi molecules comprise the nucleic acid sequence of SEQ ID No. 1.

16. The graft composition of claim 11, wherein the in vitro differentiated human cardiomyocytes are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

17. The transplant composition of claim 11 wherein the cardiomyocytes are differentiated from ipscs derived from the transplant recipient.

18. A method of transplanting in vitro differentiated human cardiomyocytes, the method comprising transplanting in vitro differentiated human cardiomyocytes, which have been contacted with an agent that reduces the level or activity of PRPF31, into cardiac tissue of a subject.

19. The method of claim 18, wherein the contacted cardiomyocytes survive to a greater extent following transplantation than cardiomyocytes not contacted with the agent.

20. The method of claim 18, wherein the subject has a myocardial infarction.

21. The method of claim 18, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

22. The method of claim 18, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

23. The method of claim 21, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

24. The method of claim 22, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

25. The method of claim 18, wherein the human cardiomyocytes are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

26. The method of claim 25, wherein the iPSC is derived from the subject.

27. The method of claim 25, wherein the ipscs are derived from healthy donors.

28. A method of promoting survival and/or engraftment of transplanted in vitro differentiated cardiomyocytes, the method comprising contacting in vitro differentiated cardiomyocytes with an agent that reduces the level or activity of PRPF31, and transplanting the cells into cardiac tissue of a human subject in need thereof.

29. The method of claim 28, wherein the subject has had a myocardial infarction.

30. The method of claim 28, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

31. The method of claim 28, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

32. The method of claim 30, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

33. The method of claim 31, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

34. A method of promoting survival and/or engraftment of transplanted cells of mesodermal lineage, the method comprising: administering to a subject in need thereof a cell of mesodermal lineage contacted with or treated with an agent that reduces the level or activity of PRPF31 in the subject.

35. The method of claim 34, wherein the mesoderm-derived cells are cells of mesoderm lineage differentiated in vitro.

36. The method of claim 35, wherein the cells of the mesodermal lineage are differentiated in vitro from iPS cells or embryonic stem cells.

37. The method of claim 34, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

38. The method of claim 37, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

39. The method of claim 37, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

40. The method of claim 38, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

41. The method of claim 36, wherein the iPSC is derived from the subject.

42. The method of claim 36, wherein the ipscs are derived from healthy donors.

43. The method of claim 34, wherein the transplanted cells of mesodermal lineage are of a cell type selected from: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

44. A transplantation composition for transplantation into a recipient, the composition comprising in vitro differentiated mesodermal lineage cells that have been contacted with or treated with an agent that reduces the level or activity of PRPF31, and a pharmaceutically acceptable carrier.

45. The graft composition of claim 44, wherein the agent is selected from a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

46. The graft composition of claim 44, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

47. The graft composition of claim 45, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

48. The graft composition of claim 46, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

49. The graft composition of claim 44, wherein the in vitro differentiated cells of mesodermal lineage are differentiated from Induced Pluripotent Stem Cells (iPSCs) or from embryonic stem cells.

50. The transplant composition of claim 44 wherein the cells of the mesodermal lineage are differentiated from iPSCs derived from a transplant recipient.

51. A method of transplanting cells of in vitro differentiated mesodermal lineage, the method comprising transplanting cells of in vitro differentiated mesodermal lineage that have been contacted with or treated with an agent that reduces the level or activity of PRPF31 into a tissue of a subject.

52. The method of claim 51, wherein the contacted in vitro differentiated mesodermal lineage cells survive a greater extent following transplantation than in vitro differentiated mesodermal lineage cells not contacted with the agent.

53. The method of claim 51, wherein the subject has a myocardial infarction.

54. The method of claim 51, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

55. The method of claim 51, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

56. The method of claim 54, wherein the vector is selected from the group consisting of a plasmid and a viral vector.

57. The method of claim 55, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

58. The method of claim 51, wherein the cells of the mesodermal lineage are differentiated from Induced Pluripotent Stem Cells (iPSCs) or from embryonic stem cells.

59. The method of claim 58, wherein the iPSC is derived from the subject.

60. The method of claim 58, wherein the iPSC is derived from a healthy donor.

61. The method of claim 51, wherein the transplanted cells of mesodermal lineage are of a cell type selected from: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

Technical Field

The technology described herein relates to methods of improving survival and engraftment of human cells differentiated in vitro and uses thereof.

Background

In millennium traffic, cardiovascular disease has been widely identified as a new epidemic. Despite major advances in the treatment of heart failure and myocardial infarction, human cell therapy has failed to achieve the expected results of repairing heart tissue. This is due to the lack of survival of stem cell derived cardiomyocytes after transplantation and their lack of stability in vivo. Therefore, new methods are needed to enhance the survival of human cells differentiated in vitro to improve the therapeutic outcome of patients with cardiovascular disease, cardiac injury, or other diseases that rely on stem cell or cell transplantation therapies.

SUMMARY

The methods and compositions described herein are directed, in part, to the following findings: decreasing the level of precursor mRNA processing factor 31 enhances survival and/or engraftment of differentiated cells in vitro.

In one aspect, described herein are compositions comprising human cells differentiated in vitro from stem cells and an agent that reduces the level or activity of pre-mRNA processing factor 31(PRPF 31).

In one embodiment of any aspect, the composition is a graft composition.

In another embodiment, the cells differentiated in vitro from stem cells are cardiomyocytes.

In another embodiment, the cells differentiated in vitro from stem cells are cells of mesodermal lineage.

In another embodiment, the in vitro differentiated cell is a cell type selected from the group consisting of: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

In another embodiment, the in vitro differentiated human cells are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

In another embodiment, the stem cells are derived from a healthy subject.

In another embodiment, the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

In another embodiment, the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

In another embodiment, the vector is selected from the group consisting of a plasmid and a viral vector.

In another embodiment, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

In another aspect, described herein are transplantation compositions for transplantation into a recipient, the compositions comprising in vitro differentiated human mesodermal lineage cells that have been contacted with an agent that reduces the level or activity of PRPF 31. In one embodiment of any aspect, the human mesodermal lineage cells are cardiomyocytes.

In another embodiment, the agent is selected from a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

In another embodiment, the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

In another embodiment, the vector is selected from the group consisting of a plasmid and a viral vector.

In another embodiment, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

In another embodiment, the in vitro differentiated human mesodermal lineage cells are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

In another embodiment, the mesodermal lineage cells are differentiated from ipscs derived from the transplant recipient.

In another aspect, described herein is a method of transplanting cells of an in vitro differentiated human mesodermal lineage, comprising transplanting cells of the in vitro differentiated human mesodermal lineage that have been contacted with an agent that reduces the level or activity of PRPF31 into or onto a tissue or organ of a subject. In one embodiment of any aspect, the cell is a cardiac myocyte.

In another embodiment, the contacted cells survive to a greater extent after transplantation than cells not contacted with the agent.

In another embodiment, the cell is a cardiomyocyte and the subject has had a myocardial infarction.

In another embodiment, the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

In another embodiment, the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

In another embodiment, the vector is selected from the group consisting of a plasmid and a viral vector.

In another embodiment, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

In another embodiment, the human cardiomyocytes are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

In another embodiment, the iPSC is derived from the subject.

In another embodiment, the ipscs are derived from healthy donors.

In another aspect, described herein is a method of promoting survival and/or engraftment of transplanted in vitro differentiated cardiomyocytes, the method comprising contacting in vitro differentiated cardiomyocytes in a human with an agent that reduces the level or activity of PRPF31, and transplanting the cells into cardiac tissue of a human subject in need thereof.

In one embodiment, the subject has a myocardial infarction.

In another embodiment, the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

In another embodiment, the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

In another embodiment, the vector is selected from the group consisting of a plasmid and a viral vector.

In another embodiment, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

In another aspect, described herein is a method of promoting survival and/or engraftment of transplanted cells of mesodermal lineage, the method comprising: administering to a subject in need thereof a cell of mesodermal lineage contacted with or treated with an agent that reduces the level or activity of PRPF31 in the subject.

In one embodiment, the mesoderm-derived cells are cells of mesoderm lineage differentiated in vitro.

In another embodiment, the cells of the mesodermal lineage are differentiated in vitro from iPS cells or embryonic stem cells.

In another embodiment, the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

In another embodiment, the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

In another embodiment, the vector is selected from the group consisting of a plasmid and a viral vector.

In another embodiment, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

In another embodiment, the iPSC is derived from the subject.

In another embodiment, the ipscs are derived from healthy donors.

In another embodiment, the transplanted cells of the mesodermal lineage are of a cell type selected from the group consisting of: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

Definition of

For convenience, the meanings of some of the terms and phrases used in the specification, examples, and appended claims are provided below. Unless otherwise indicated or implied from the context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in the description of particular embodiments and are not intended to limit the claimed technology, as the scope of the technology is defined only by the claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. To the extent that there is a clear difference between the usage of a term in the art and its definition provided herein, the definition provided within the specification controls.

Definitions of common terms in cell and molecular biology and biochemistry can be found in The Merck Manual of Diagnosis and Therapy, 20 th edition, published by Merck Sharp & Dohme corp, 2018(ISBN 9780911910421,0911910425); robert S.Porter et al (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd.,2008(ISBN 3527305424,9783527305421); and Robert A.Meyers (eds.), Molecular Biology and Biotechnology a Comprehensive Desk Reference, published by VCH Publishers, Inc.,1995(ISBN 1-56081-; immunology by Werner Luttmann, published by Elsevier, 2006; janeway's immunology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited,2016(ISBN 9780815345510,0815345518); lewis's Genes XI, published by Jones & Bartlett Publishers,2014 (ISBN-1449659055); michael Richard Green and Joseph Sambrook, Molecular Cloning A Laboratory Manual, 4 th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); davis et al, Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); laboratory Methods in Enzymology DNA, Jon Lorsch (eds.) Elsevier,2013(ISBN 0124199542); laboratory Methods in Enzymology: RNA, Jon Lorsch (eds.) Elsevier,2013(ISBN:9780124200371,0124200370); current Protocols in Molecular Biology (CPMB), Frederick m.ausubel (ed), John Wiley and Sons,2014(ISBN 047150338X,9780471503385), Current Protocols in Protein Science (CPPS), John e.colour (ed), John Wiley and Sons, inc., 2005; and Current Protocols in Immunology (CPI) (John E.Coligan, ADA M Kruisbeam, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc.,2003(ISBN 0471142735,9780471142737), Immunology Methods, Ivan Lefkovits, Benvenuto Pernis, (eds.) Elsevier Science,2014(ISBN:9781483269993,148326999X), the contents of which are all incorporated herein by reference in their entirety.

As used herein, "transplant composition" refers to a composition comprising cells or populations thereof differentiated in vitro. The composition may be formulated for administration to a subject as a graft. The implant composition will comprise a pharmaceutically acceptable carrier and may optionally comprise a matrix or scaffold for the cells. The graft composition may be formulated for administration by injection or, for example, by surgical implantation.

The terms "patient," "subject," and "individual" are used interchangeably herein and refer to an animal, particularly a human, to which treatment (including prophylactic treatment) is provided. The term "subject" as used herein refers to both human and non-human animals. The terms "non-human animal" and "non-human mammal" are used interchangeably herein and include all vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (e.g., mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, as well as non-mammals, such as chickens, amphibians, reptiles, and the like. In one embodiment of any aspect, the subject is a mammal. In another embodiment of any aspect, the subject is a human. In another embodiment of any aspect, the subject is an experimental animal or animal replacement that is a model of a disease. In another embodiment of any aspect, the subject is a domestic animal, including a companion animal (e.g., dog, cat, rat, pig, guinea pig, hamster, etc.). The subject may have previously received treatment for the disease, or never received treatment for the disease. The subject may have been previously diagnosed with the disease, or never been diagnosed with the disease.

The term "healthy subject" as used herein refers to a subject that lacks at least the markers or symptoms of the disease or disorder to be treated.

As used herein, the term "human stem cell" refers to a human cell that can self-renew and differentiate into at least one different cell type. The term "human stem cell" encompasses a human stem cell line, a human-derived Induced Pluripotent Stem (iPS) cell, a human embryonic stem cell, a human pluripotent stem cell, a human multipotent stem cell, an amniotic stem cell, a placental stem cell, or a human adult stem cell. In one embodiment of any aspect, the human stem cells are not derived from a human embryo.

The term "derived from" as used in reference to a stem cell means that the stem cell is generated by reprogramming a differentiated cell to a stem cell phenotype. The term "derived from" as used in reference to a differentiated cell means that the cell is the result of differentiation (e.g., in vitro differentiation) of a stem cell. As one example, "iPSC-CM" or "induced pluripotent stem cell-derived cardiomyocytes" are used interchangeably to refer to cardiomyocytes derived from induced pluripotent stem cells by in vitro differentiation of stem cells.

As used herein, "in vitro differentiated cells" refers to cells produced in culture, typically via stepwise differentiation from precursor cells, such as human embryonic stem cells, induced pluripotent stem cells, early mesodermal, ectodermal or endodermal cells, or progenitor cells. Thus, for example, an "in vitro differentiated cardiomyocyte" is a cardiomyocyte produced in culture, typically via stepwise differentiation from precursor cells such as human embryonic stem cells, induced pluripotent stem cells, early mesodermal cells, lateral plate mesodermal cells, or cardiac progenitor cells.

The term "agent" refers to any entity administered to or in contact with a cell, tissue, organ or subject, which is not normally present or present at the level of administration to the cell, tissue, organ or subject. The agent may be selected from: a chemical substance; a small molecule; a nucleic acid; a nucleic acid analog; a protein; a peptide; a peptide mimetic; a peptide derivative; a peptide analog; an aptamer; an antibody; internal antibodies (intrabodies); a biological macromolecule; or a functional fragment thereof. The nucleic acid may be RNA or DNA, may be single-or double-stranded, and may include, for example, nucleic acids encoding a protein of interest and nucleic acids that inhibit gene expression or protein function, such as RNA interference or small interfering RNA molecules, antisense RNA molecules, or aptamers. Nucleic acids may include oligonucleotides as well as nucleic acid analogues, such as Peptide Nucleic Acids (PNA), pseudo-complementary PNA (pc-PNA), Locked Nucleic Acids (LNA), and the like.

Nucleic acids may include sequences encoding, for example, proteins that are transcription repressors, as well as sequences encoding antisense molecules, ribozymes, small inhibitory nucleic acids, such as, but not limited to, RNAi, shRNAi, siRNA, micro RNAi (mnrnai), antisense oligonucleotides, and the like. The protein and/or peptide or fragment thereof may be any protein of interest, such as, but not limited to: muteins, therapeutic proteins, or truncated proteins, including, for example, dominant negative muteins, wherein the protein is normally absent or expressed at a lower level in a cell. Proteins may also include muteins, genetically engineered proteins, recombinant proteins, chimeric proteins, antibodies, midibodies, triple-chain antibodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins, and fragments thereof. The agent may be applied or introduced into the cell culture medium where it contacts the cells and induces their action. Alternatively, the agent may be intracellular in that the nucleic acid encoding the agent is introduced into the cell and transcription thereof results in the production of the nucleic acid and/or protein agent within the cell. In some embodiments, an agent is any chemical entity or moiety, including but not limited to synthetic and naturally occurring non-protein entities. In certain embodiments, the agent is a small molecule. Small molecules may include chemical moieties including unsubstituted or substituted alkyl, aromatic or heterocyclyl moieties including macrolides, leptomycin, and related natural products or analogs thereof. In some embodiments, the agent may be an extract made from biological materials such as bacteria, plants, fungi, or animal cells or tissues. In some embodiments, the agent may be a naturally occurring or synthetic composition or a functional fragment thereof. The agent may be known to have the desired activity and/or properties, or may be selected from a library of compounds.

The phrase "pharmaceutically acceptable" is employed herein to refer to those agents, compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

As used herein, "substrate" refers to a structure comprising a biocompatible material that provides a surface suitable for cell adhesion and proliferation. The nanopatterned substrate may further provide mechanical stability and support, and may, for example, promote maturation of in vitro differentiated cells such as in vitro differentiated myocytes or in vitro differentiated cardiomyocytes. Substrates, including but not necessarily limited to nanopatterned substrates, can be of a particular shape or form so as to influence or define the three-dimensional shape or form assumed by the proliferating cell population. Such shapes or forms include, but are not limited to, films (e.g., having a two-dimensional form substantially larger than a third dimension), tapes, wires, sheets, flat discs, cylinders, spheres, three-dimensional amorphous shapes, and the like.

As used herein, "administering" is used to place an agent (e.g., a small molecule) described herein in the context of a cell, tissue, organ, or subject by a method or pathway that results in at least partial localization of the agent at a desired site (e.g., an in vitro differentiated cell, heart, kidney, blood, skin, or region thereof) to produce a desired effect (e.g., reduced level or activity of PRPF 31). The agents described herein may be administered by any suitable route that results in delivery to the desired location in the subject. The half-life of the agent after administration to a subject may be as short as minutes, hours or days, for example 24 hours to days, up to years, i.e. long-term. "administering" may also refer to placing in vitro differentiated cells treated with an agent as described herein into a tissue, organ, or subject. In this context, "administration" is equivalent to "transplantation".

As used herein, the term "transplantation" is used to place cells (e.g., the in vitro differentiated cells described herein) in the context of a subject by a method or pathway that results in at least partial localization of the introduced cells at a desired site (e.g., a site of injury or repair), thereby producing a desired effect. In some embodiments, cells, such as cardiomyocytes, can be implanted or injected directly into or onto an organ, or alternatively can be administered by any suitable route that results in delivery to a desired location in a subject where at least a portion of the implanted cells or components of the cells remain viable. The time of cell viability after administration to a subject may be as short as several hours, e.g. 24 hours to several days, up to several years or more, i.e. long term implantation. As will be understood by those skilled in the art, long-term implantation of in vitro differentiated cells is desirable because many mature adult somatic cells (e.g., cardiomyocytes) do not proliferate to the point where an organ (e.g., the heart) can be cured from acute injury involving cell death.

As referred to herein, "treatment" of a condition or disease (e.g., cardiovascular disease) refers to a therapeutic intervention that enhances the function of a cell, tissue, or organ, and/or enhances implantation, and/or enhances transplantation or implantation vascularization in the treatment area, thereby improving the function of a tissue or organ (as a non-limiting example, the heart). That is, "treatment" is directed to the function of the tissue or organ being treated (e.g., enhanced function in the infarcted area of the heart), and/or other sites being treated with the compositions described herein. Effective treatment does not require a cure or directly affect the underlying cause of the disease or condition that is considered to be effectively treated. For example, a treatment that improves cardiac function, e.g., in terms of intensity of contraction or rhythm, may be an effective treatment without necessarily treating the cause of the infarction or arrhythmia.

As used herein, the term "disease" or "disorder" refers to a disease, syndrome, or condition caused, in part or in whole, directly or indirectly, by one or more abnormalities in the genome, physiology, behavior, or health of a subject.

The disease or disorder may be a cardiac disease or disorder. Non-limiting examples of heart diseases include cardiomyopathy, cardiac arrhythmias, heart failure, Arrhythmogenic Right Ventricular Dysplasia (ARVD), long QT syndrome, catecholamine-sensitive polymorphic ventricular tachycardia (CPVT), Barth syndrome, and cardiac involvement in duchenne muscular dystrophy.

As used herein, "prevention" or "preventing" when used in reference to a disease, disorder, or symptom thereof, refers to a decreased likelihood that an individual will develop the disease or disorder (e.g., heart failure following myocardial infarction, as just one example). For example, when an individual having one or more risk factors for a disease or disorder fails to develop the disorder, or develops such a disease or disorder at a later time, or statistically develops such a disease or disorder with less severity, a reduced likelihood of developing the disease or disorder as compared to a population having the same risk factors and not receiving treatment as described herein. Non-developing symptoms of a disease or developing reduced symptoms (e.g., at least 10% reduction on a clinically accepted scale for the disease or disorder) or delayed symptoms (e.g., days, weeks, months, or years) are considered effective prophylaxis.

The terms "decrease", "reduction", "to a lesser extent" or "inhibition" are used herein to mean that a characteristic, level or other parameter is reduced or decreased in a statistically significant amount. In some embodiments, "reduced", "reduction", or "inhibition" generally means a reduction of at least 10% as compared to a reference level (e.g., in the absence of a given treatment), and may include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%. At least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, "reduce" or "inhibit" does not encompass complete inhibition or reduction as compared to a reference level. "complete inhibition" is 100% inhibition compared to a reference level. For individuals without a given condition, the reduction may preferably be reduced to a level that is acceptable within the normal range.

The terms "increased", "increase" or "enhancing" or "activating" or "to a greater extent" are used herein to generally mean an increase in a characteristic, level or other parameter by a statistically significant amount; for the avoidance of any doubt, the terms "increased", "increase", "to a greater extent", "enhanced" or "activation" may refer to an increase of at least 10%, for example at least about 20%, or at least about 30%, or at least about 40%, or at least about 50% as compared to a reference level. Or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase of 10-100% compared to a reference level, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold or at least about 10-fold increase, at least about 20-fold increase, at least about 50-fold increase, at least about 100-fold increase, at least about 1000-fold increase or more compared to a reference level.

As used herein, "reference level" refers to a normal otherwise unaffected cell population or tissue (e.g., a cell, tissue, or biological sample obtained from a healthy subject, or a biological sample obtained from a subject at a previous point in time, e.g., a cell, tissue, or biological sample obtained from a patient prior to diagnosis of a disease, or a biological sample that has not been contacted with an agent or composition disclosed herein). Alternatively, a reference level may also refer to the level of a given marker or parameter in a subject, organ, tissue or cell prior to administration of a treatment, e.g., with an agent or via administration of a transplant composition.

As used herein, "suitable control" refers to an otherwise identical cell, object, organism, or population that is untreated (e.g., a cell, tissue, or biological sample that is not contacted with an agent or composition described herein) relative to a cell, tissue, biological sample, or population that is contacted with or treated with a given treatment. For example, a suitable control may be a cell, tissue, organ, or subject that has not been contacted with an agent or administered with a cell as described herein.

The term "statistically significant" or "significantly" refers to statistical significance, and generally means a difference of two standard deviations (2SD) or greater.

As used herein, the term "comprising" means that additional elements may be present in addition to the limiting elements presented. The use of "including" is meant to be inclusive and not limiting.

The term "consisting of … …" refers to the compositions, methods, and respective components thereof as described herein, excluding any elements not stated in the description of the embodiments.

As used herein, the term "consisting essentially of … …" refers to those elements required for a given embodiment. The term allows for the presence of additional elements that do not materially affect the basic and novel or functional characteristics of this embodiment of the invention.

The singular terms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "e.g. (e.g.)" derived from latin "e.g. (exempli gratia)" and is used herein to denote non-limiting examples. Thus, the abbreviation "e.g. (e.g.)" is synonymous with the term "e.g. (for example)".

Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular.

Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein are to be understood as being modified in all instances by the term "about". The term "about" when used in conjunction with a percentage may mean ± 1%.

Brief Description of Drawings

FIG. 1 shows gene knockdown in hPSC-CM derived from the RUES2 embryonic stem cell line. Liposomal RNAiMax (thermo Fisher) was used for 48 h incubation and hPSC-CM was transfected with 5nM siRNA. Controls were untreated or transfected with negative control scrambled sirna (scrambled sirna). Knockdown efficiency was confirmed by quantitative rtPCR. The resulting cells were cryopreserved for transplantation.

Figure 2 shows the increased survival of hPSC-CM with PRPF31 knockdown compared to untreated and control siRNA treated hPSC-CM (p 0.008 and p 0.007, respectively; unpaired t-test).

Detailed description of the invention

The compositions and methods described herein are directed, in part, to the discovery that: when transplanted into a tissue, organ or subject, the derived cells of human pluripotent stem cells of mesodermal lineage treated to reduce the level or activity of precursor mRNA processing factor (PRPF31) survive better than untreated cells. In particular, human pluripotent stem cell-derived cardiomyocytes (hPSC-CM) were found to survive and/or engraft in cardiac tissue with increased efficiency in such tissue after transplantation into such tissue.

Thus, described herein is a method of promoting survival and/or engraftment of cells of a transplanted mesodermal lineage, the method comprising: administering to a subject in need thereof a cell of mesodermal lineage that has been treated with an agent that reduces the level or activity of PRPF 31.

In certain embodiments, the cell is an in vitro differentiated cell, including but not limited to an in vitro differentiated cardiomyocyte and the like. In addition to methods for transplanting cells and for promoting survival of such cells, the techniques described herein also include compositions comprising cells treated with an agent that reduces the level or activity of PRPF31 and cells admixed with such an agent.

Considerations related to the practice of the techniques are described below.

Cell preparation:

in certain embodiments, the compositions and methods described herein use cells differentiated in vitro. Such cells may be differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

Various sources and stem cells that can be used to prepare cells for transplantation or implantation into a subject are described below.

Stem cells are cells that retain the ability to self-renew through cell mitosis and can differentiate into more specialized cell types. Three broad types of mammalian stem cells include: embryonic Stem (ES) cells found in blastocysts, induced pluripotent stem cells (ipscs) reprogrammed from somatic cells, and adult stem cells found in adult tissues. Other sources of stem cells may include, for example, amnion-derived stem cells or placenta-derived stem cells. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.

Cells useful in the compositions and methods described herein can be differentiated from embryonic stem cells, induced pluripotent stem cells, and the like.

In one embodiment, the compositions and methods provided herein use mesodermal lineage cells, including but not limited to human cardiomyocytes differentiated from embryonic stem cells. Alternatively, in some embodiments, the compositions and methods provided herein do not encompass the generation or use of differentiated human cells derived from cells taken from a living human embryo.

Embryonic stem cells: embryonic stem cells and Methods for obtaining them are described, for example, in Trousnon A.O.reprod.Fertil.Dev. (2001)13:523, Roach M L Methods mol.biol. (2002)185:1 and Smith A.G.Annu Rev Cell Dev Biol (2001)17: 435. The term "embryonic stem cell" is used to refer to a pluripotent stem cell of the inner cell mass of an embryonic blastocyst (see, e.g., U.S. Pat. nos. 5,843,780, 6,200,806). Such cells can similarly be obtained from the inner cell mass of blastocysts derived from somatic cell nuclear transfer (see, e.g., U.S. Pat. nos. 5,945,577, 5,994,619, 6,235,970). Markers for embryonic stem cells include, for example, any one or any combination of Oct3, Nanog, SOX2, SSEA1, SSEA4, and TRA-1-60.

Cells derived from embryonic sources may include embryonic stem cells or stem cell lines obtained from stem cell banks or other recognized depositories. Other means of generating stem cell lines include methods involving the use of blastomere cells from early embryos prior to blastocyst formation (at about the 8-cell stage). Such techniques use, for example, single cells removed in pre-implantation genetic diagnostic techniques routinely practiced in assisted reproductive clinics. Individual blastomere cells were co-cultured with the established ES cell line and then separated from them to form a fully competent ES cell line.

Undifferentiated Embryonic Stem (ES) cells are readily recognized by those skilled in the art and typically appear in two dimensions of the microscopic view as cell colonies with a high nuclear/cytoplasmic ratio and prominent nucleoli. Markers for embryonic stem cells include, for example, any one or any combination of Oct3, Nanog, SOX2, SSEA1, SSEA4, and TRA-1-60. In some embodiments, the differentiated human cells used in the methods and compositions described herein are not derived from embryonic stem cells or any other cells of embryonic origin.

Induced pluripotent stem cells (ipscs): in some embodiments, the compositions and methods described herein utilize human cardiomyocytes or other human mesodermal lineage cells differentiated in vitro from induced pluripotent stem cells. An advantage of using ipscs to generate cells for use in the compositions and methods described herein is that the cells can be derived from the same subject to which the differentiated cells are to be administered, if desired. That is, somatic cells can be obtained from a subject, reprogrammed to induced pluripotent stem cells, and then re-differentiated to human cardiomyocytes or other mesodermal lineage cells for administration to the subject (i.e., autologous cells). Since the cells and their differentiated progeny are essentially derived from autologous sources, the risk of transplant rejection or allergy is reduced compared to using cells from another subject or group of subjects. While this is an advantage of iPS cells, in alternative embodiments, cardiomyocytes and other human mesodermal lineage cells useful in the methods and compositions described herein are derived from non-autologous sources (i.e., allogeneic cells). Furthermore, the use of ipscs does not require cells obtained from embryonic sources.

Although differentiation is generally irreversible in physiological environments, several methods have been developed in recent years to reprogram somatic cells to induce pluripotent stem cells. Exemplary methods are known to those skilled in the art and are briefly described below.

Reprogramming is the process of altering or reversing the differentiation state of a differentiated cell (e.g., a somatic cell). In other words, reprogramming is the process of driving differentiation of a cell back to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can result in some loss of fully differentiated characteristics. However, simply culturing such cells, which are included in the term differentiated cells, does not render these cells undifferentiated or pluripotent. The transition of differentiated cells to pluripotency requires reprogramming stimuli in excess of the following: this stimulation results in a partial loss of differentiation characteristics when differentiated cells are placed in culture. Reprogrammed cells are also characterized by the ability to be extended for passage without loss of growth potential relative to the primary cell parent, which typically has only a limited number of culture division abilities.

The cells to be reprogrammed may be partially or terminally differentiated prior to reprogramming. Thus, the cells to be reprogrammed may be terminally differentiated somatic cells, as well as adult or somatic stem cells.

In some embodiments, reprogramming encompasses a complete reversal of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent or multipotent state. In some embodiments, reprogramming encompasses the complete or partial reversal of the differentiation state of a differentiated cell to an undifferentiated cell (e.g., an embryonic-like cell). Reprogramming can result in cells expressing specific genes, the expression of which further contributes to reprogramming. In certain embodiments described herein, reprogramming of the differentiated cells results in the differentiated cells assuming an undifferentiated state with the ability to self-renew and differentiate into cells of all three germ layer lineages. These are induced pluripotent stem cells (iPSC or iPS cells).

Methods of reprogramming somatic cells to iPS cells are described, for example, in U.S. patent nos. 8,129,187B 2; 8,058,065B 2; U.S. patent application 2012/0021519a 1; singh et al, front.cell dev.biol. (February, 2015); and Park et al, Nature 451: 141-; which is incorporated by reference in its entirety. Specifically, ipscs are generated from somatic cells by introducing a combination of reprogramming transcription factors. The reprogramming factors can be introduced, for example, as proteins, nucleic acids (mRNA molecules, DNA constructs, or vectors encoding them), or any combination thereof. Small molecules may also enhance or complement the introduced transcription factor. While additional factors have been determined to affect, for example, the efficiency of reprogramming, a standard set of four reprogramming factors that combine to adequately reprogram somatic cells to an induced pluripotent state includes Oct4 (octamer-binding transcription factor-4), SOX2 (sex-determining region Y) -cassette 2, Klf4 (Kruppel-like factor-4), and c-Myc. It has been found that additional proteins or nucleic acid factors (or constructs encoding them), including but not limited to LIN28+ Nanog, Esrrb, Pax5 shRNA, C/EBP, p53 siRNA, UTF1, DNMT shRNA, Wnt3a, SV40 LT (T), hTERT, or small molecule chemical agents, including but not limited to BIX-01294, BayK8644, RG108, AZA, dexamethasone, VPA, TSA, SAHA, PD0325901+ CHIR99021(2i), and A-83-01, replace one of the four reprogramming factors from the basic or standard set or other reprogramming factors, or improve the efficiency of reprogramming.

The particular pathway or method used to generate pluripotent stem cells from somatic cells (e.g., any cells of the body that do not include germline cells; fibroblasts, etc.) is not critical to the claimed invention. Thus, any method of reprogramming a somatic cell to a pluripotent phenotype is suitable for use in the methods described herein.

The efficiency of reprogramming (i.e., the number of reprogrammed cells) obtained from the starting Cell population can be increased by adding various small molecules, as shown by Shi, Y., et al, (2008) Cell-Stem Cell 2: 525-. Some non-limiting examples of agents that increase reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294(G9a histone methyltransferase), PD0325901(MEK inhibitor), DNA methyltransferase inhibitor, Histone Deacetylase (HDAC) inhibitor, valproic acid, 5' -azacytidine, dexamethasone, suberoylanilide (suberoylanilide), hydroxamic acid (SAHA), vitamin C, and Trichostatin (TSA), among others.

To confirm the induction of pluripotent stem cells for use in the methods described herein, isolated clones can be tested for expression of one or more stem cell markers. This expression in somatic cell-derived cells identifies the cells as induced pluripotent stem cells. Stem cell markers may include, but are not limited to, SSEA3, SSEA4, CD9, Nanog, Oct4, Fbx15, Ecat1, Esg1, Eras, Gdf3, Fgf4, Cripto, Dax1, Zpf296, Slc2a3, Rex1, Utf1, and Nat1, and the like. In one embodiment, cells expressing Nanog and SSEA4 are identified as pluripotent. Methods for detecting the expression of such markers may include, for example, RT-PCR and immunological methods for detecting the presence of the encoded polypeptide, such as western blot or flow cytometry analysis. Intracellular markers can be best identified via RT-PCR, while cell surface markers can be easily identified, for example, by immunocytochemistry.

The pluripotent stem cell characteristics of the isolated cells can be confirmed by tests that evaluate the ability of ipscs to differentiate into cells of each of the three germ layers. As an example, teratoma formation in nude mice can be used to evaluate the pluripotency profile of isolated clones. Cells are introduced into nude mice and tumors produced by the cells are histologically and/or immunohistochemically using antibodies specific for markers of different germline lineages. Growth of tumors containing cells from all three germ layers, endoderm, mesoderm, and ectoderm, further suggested or confirmed that the cells were pluripotent stem cells.

Adult stem cells: adult stem cells are stem cells derived from a postnatal or post-neonatal organism or from tissue of an adult organism. Adult stem cells differ structurally from embryonic stem cells not only in that they express or do not express markers relative to the embryonic stem cells, but also in that there are epigenetic differences, such as differences in DNA methylation patterns. It is contemplated that cardiomyocytes and/or neurons differentiated from adult stem cells can also be used in the methods described herein. Methods of isolating somatic stem cells are described, for example, in U.S. patent nos. 9,206,393B 2; and U.S. application No. 2010/0166714a 1; which is incorporated herein by reference in its entirety.

In vitro differentiation

Certain methods and compositions as described herein use cells of mesodermal lineage differentiated in vitro from stem cells. Typically, throughout differentiation, pluripotent cells will follow developmental pathways along specific developmental lineages, such as primordial-ectodermal, mesodermal or endodermal.

Embryonic germ layers are the source from which all tissues and organs are obtained. Mesoderm is the source of, for example, smooth and striated muscles, including cardiac muscle, connective tissue, blood vessels, the cardiovascular system, blood cells, bone marrow, bones, reproductive organs, and excretory organs.

Germ layer can be identified by the expression of specific biomarkers and gene expression. Assays to detect these biomarkers include, for example, RT-PCR, immunohistochemistry, and western blotting. Non-limiting examples of biomarkers expressed by early mesodermal cells include HAND1, ESM1, HAND2, HOPX, BMP10, FCN3, KDR, PDGFR-alpha, CD34, Tbx-6, Snail-1, Mesp-1, GSC, and the like. Biomarkers expressed by early ectodermal cells include, but are not limited to, TRPM8, POU4F1, OLFM3, WNT1, LMX1A, and CDH 9. Biomarkers expressed by early endoderm cells include, but are not limited to, LEFTY1, EOMES, NODAL, FOXA2, and the like. One skilled in the art can determine which lineage markers to monitor when performing a differentiation protocol based on the cell type and the germ layer of the cells obtained during development.

The induction of specific developmental lineages in vitro is accomplished by culturing stem cells in the presence of specific agents or combinations thereof that promote lineage targeting. Generally, the methods described herein involve stepwise addition of an agent (e.g., a small molecule, growth factor, cytokine, polypeptide, carrier, etc.) to the cell culture medium or contacting the cells with an agent that promotes differentiation. In particular, mesoderm formation is induced by transcription factors and growth factor signaling, including but not limited to VegT, Wnt signaling (e.g., via β -catenin), Bone Morphogenic Protein (BMP) pathway, Fibroblast Growth Factor (FGF) pathway, and TGF β signaling (e.g., activin a). See, e.g., Clemens et al, Cell Mol Life Sci, (2016), which is incorporated by reference herein in its entirety.

In the context of ontogeny of cells, the terms "differentiation" or "differentiation" are relative terms, meaning that a "differentiated cell" is a cell that develops further along a developmental pathway than its precursor cells. Thus, in some embodiments, the reprogrammed cell may be differentiated into lineage restricted precursor cells (such as mesodermal stem cells), which in turn may be further differentiated along the pathway into other types of precursor cells (such as tissue-specific precursors, e.g. cardiomyocyte precursors), and then into terminally differentiated cells, which play a characteristic role in certain tissue types, and may or may not retain the ability to further proliferate.

Typically, cells differentiated in vitro will exhibit down-regulation of pluripotency markers (e.g., HNF 4-a, AFP, GATA-4, and GATA-6) throughout the stepwise process, and increased expression of lineage specific biomarkers (e.g., mesodermal, ectodermal, or endodermal markers). See, e.g., Tsankov et al, Nature Biotech (2015), which describes the characterization and differentiation of human pluripotent stem cell lines along specific lineages. The efficiency of the differentiation process can be monitored by a variety of methods known in the art. This includes detecting the presence of germ layer biomarkers using standard techniques, such as immunocytochemistry, RT-PCR, flow cytometry, functional assays, optical tracking, and the like.

In some embodiments of any aspect, the cells differentiated in vitro are of a mesodermal lineage cell type selected from: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, liver cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

Cardiomyocyte differentiation

In some embodiments of the methods and compositions described herein, the cells differentiated in vitro from stem cells are cardiomyocytes. Methods of differentiating cardiomyocytes from ESC or iPSC are known in the art. In some embodiments of any aspect, the cardiomyocytes are differentiated from ipscs derived from, for example, a transplant recipient as described herein or as known in the art.

In certain embodiments, the stepwise differentiation of ESCs or ipscs into cardiomyocytes is performed in the following order: ESC or iPSC > cardiogenic mesoderm > cardiac progenitor > cardiomyocytes (see, e.g., Lian et al, Nat Prot (2013); U.S. application No. 2017/0058263 a 1; 2008/0089874 a 1; 2006/0040389 a 1; U.S. patent No. 10,155,927B 2; 9,994,812B 2; and 9,663,764B 2, the contents of each of which are incorporated herein by reference in their entirety). See also, e.g., LaFlamme et al, Nature Biotech 25:1015-1024(2007), which is incorporated herein by reference in its entirety. In these differentiation protocols, agents may be added to or removed from the cell culture medium to direct differentiation of cardiomyocytes in a stepwise manner. Non-limiting examples of factors and agents that can promote cardiomyocyte differentiation include small molecules (e.g., Wnt inhibitors, GSK3 inhibitors), polypeptides (e.g., growth factors), nucleic acids, vectors, and patterned substrates (e.g., nanopatterns). The addition of growth factors essential in cardiovascular development, including but not limited to fibroblast growth factor 2(FGF2), transforming growth factor beta (TGF β), superfamily growth factor activin a and BMP4, Vascular Endothelial Growth Factor (VEGF), and Wnt inhibitor DKK-1, may also be beneficial in directing differentiation along cardiac lineages. Additional examples of factors and conditions that help promote cardiomyocyte differentiation include, but are not limited to, insulin deficient B27 supplement, cell conditioned media, external electrical pacing, and nanopatterned substrates, among others.

By way of example only, embryonic stem cells or iPS cells can be cultured in embryonic fibroblast conditioned medium (e.g., mouse, MEF-CM) and seeded to an extracellular matrix (e.g.,a mixture of gelatins secreted by Engelbreth Holm-swarm (ehs) mouse sarcoma cells). To begin differentiating cardiomyocytes, new media containing basic fibroblast growth factor (bFGF) was administered to the cells for about 6-7 days. After 7 days, fibroblast conditioned media was replaced with los vin pascal souvenir Institute (Roswell Park mental Institute)1640 media containing B27 supplement (referred to herein as RPMI-B27) supplemented with the following cytokines: (a) treated with 100ng/ml human recombinant activin A for about 24 hours, and then (b) treated with 10ng/ml human recombinant BMP4 for about 4 days. The medium can then be changed to RPMI-B27 medium without the addition of cytokines, and the culture fed with new medium every 2-3 days for an additional 2-3 weeks.

Generally, cells that differentiate into cardiomyocytes begin to beat and contract in culture about 12 days after addition of activin a. This can be monitored using standard cell culture and microscopy techniques.

In addition to the functional readout of the in vitro differentiated cardiomyocytes (e.g. beating cells), the in vitro differentiated cardiomyocytes will also express biomarkers specific for adult cardiomyocytes. Non-limiting examples of cardiomyocyte biomarkers include cardiac troponin t (ctnt), alpha-actinin, or myosin heavy chain. Although the presence of additional protein markers is preferred, and e.g.myocardial muscle cellsFunctional markers of cell maturation, but the least differentiated in vitro human cardiac muscle cells useful in the methods and compositions described herein will express cardiac troponin T. If necessary or desired, the cardiomyocytes can then be enriched using a Percoll gradient or cell sorting techniques directed against a cardiomyocyte biomarker (e.g., troponin T, alpha-actinin, myosin heavy chain, or ryanodine receptor 2). Examples of cardiomyocyte enrichment are found, for example, in Xu et al, Circ Res (2002); laflamme et al, am.J.Pathol.167, 663-671 (2005); and Miltenyi Biotec(2017) Characterization by flow cytometry PSC-derived cardiac cytometric subsets; which is incorporated herein by reference in its entirety.

In vitro differentiated cardiomyocyte maturation can be assessed by a number of parameters, such as electrical maturation of the cell, metabolic maturation of the cell, or contractile maturation of in vitro differentiated cells. Examples of cardiomyocyte maturation proteins, biochemical and electrical maturation markers are found, for example, in WO2019/035032a2, which is incorporated herein by reference in its entirety.

Non-limiting examples of such methods of determining electrical maturation of cells include whole-cell patch clamping (manual or automated), multi-electrode arrays, field potential stimulation, calcium imaging, and optical mapping, among others. Cells can be electrically stimulated during whole-cell current clamp or field potential recording to produce an electrical and/or contractile response. Measurements of the field potential and biopotential of cardiomyocytes can be used to determine the differentiation stage and cell maturation.

For cardiomyocytes, electrical maturation is determined by one or more of the following markers compared to a reference level: increased gene expression of one or more ion channel genes, increased sodium current density, increased inward rectifier potassium channel current density, increased action potential frequency, increased calcium wave frequency, and increased field potential frequency. Methods for measuring gene expression are known in the art, such as RT-PCR and transcriptome sequencing.

Metabolic assays can be used to determine the differentiation stage and cell maturation of differentiated cells in vitro as described herein. Non-limiting examples of metabolic assays include cellular bioenergy assays (e.g., Seahorse Bioscience XF extracellular flux analyzer) and oxygen consumption tests. In particular, cellular metabolism can be quantified by Oxygen Consumption Rate (OCR), OCR trace during fatty acid stress test, maximum change in OCR after FCCP addition, and maximum respiratory capacity among other parameters. In addition, metabolic challenge or lactate enrichment assays can provide a measure of cell maturation or of the effect of various treatments of such cells.

For example, metabolic maturation of differentiated cardiomyocytes in vitro is determined by one or more of the following markers, as compared to a reference level: increased mitochondrial functional activity, increased fatty acid metabolism, increased Oxygen Consumption Rate (OCR), increased level or activity of phosphorylated ACC, increased level or activity of Fatty Acid Binding Protein (FABP), increased level or activity of pyruvate dehydrogenase kinase-4 (PDK4), increased mitochondrial respiration capacity, increased mitochondrial volume, and increased mitochondrial DNA levels relative to immature in vitro differentiated cardiomyocytes. Mammalian cells typically use glucose as their primary energy source. However, cardiomyocytes are capable of producing energy from different sources such as lactic acid or fatty acids. In some embodiments, lactate supplemented and glucose depleted media or the ability of the cells to use lactate or fatty acids as an energy source may be used to identify mature cardiomyocytes and their functional changes.

In vitro differentiated cells (e.g. cardiomyocytes, skeletal muscle or smooth muscle) have contracted maturation as compared to a reference level determined by one or more of the following markers: increased beating frequency, increased contractility, increased alpha-myosin heavy chain (alpha-MHC) level or activity, increased sarcomere level or activity, decreased circulation index, increased troponin level or activity, increased titin N2b level or activity, increased cell area, and increased aspect ratio. The contractility can be measured by optical tracking methods such as video analysis. For video tracking methods, the displacement of tissue or single cells may be measured to determine contractility, frequency, etc.

Additional cell types

The methods and compositions described herein are also useful or applicable to cells of mesodermal lineage differentiated in vitro, including skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

Methods of differentiating stem cell-derived skeletal muscle cells, smooth muscle cells, and/or adipocytes are described, for example, in U.S. patent nos. 10,240,123B 2; and Cheng et al, Am J Physiol Cell Physiol (2014). Methods of differentiating renal cells are described, for example, in Tajiri et al, Scientific Reports 8:14919 (2018); taguchi et al, Cell Stem Cell 14:53-67 (2014); and us application 010/0021438a 1. Methods of differentiating endothelial cells (e.g., vascular endothelium) are described, for example, in U.S. Pat. No. 10,344,262B2 and Olgasi et al, Stem Cell Reports 11: 1391-. Methods for differentiating hormone-producing cells are described, for example, in 7,879,603B2 and in Abu-Bonsrah et al, Stem Cell Reports 10:134-150 (2018). Methods for differentiating osteocytes are described, for example, in Csponyeiova et al, J Adv Res 8:321-327 (2017); U.S. patent nos. 7,498,170B 2; 6,391,297B 1; and U.S. application No. 2010/0015164a 1. Methods of differentiating microglia are described, for example, in WO 2017/152081 a 1. Methods of differentiating epithelial and skin cells are described, for example, in Kim et al, Stem Cell Research and Therapy (2018); U.S. patent nos. 7,794,742B 2; 6,902,881B 2. Methods of differentiating blood cells and leukocytes are described, for example, in U.S. patent nos. 6,010,696a and 6,743,634B 2. Methods for differentiating stem cell-derived beta cells are described, for example, in WO2016/100930A 1. Each of the above references is incorporated by reference herein in its entirety.

Method for enriching specific cell types

The stem cells, progenitor cells, and/or in vitro differentiated cells described herein can be cultured on a Mouse Embryonic Fibroblast (MEF) feeder cell layer,Collagenase IV or substantially promotes the differentiation of desired cell types in vitro and/or maintains the maturation, survival of desired cellsAny other substrate or scaffold of live, phenotypic type. In some embodiments, antibodies or similar reagents specific for a given marker or set of markers may be used to separate and non-separate desired cells using Fluorescence Activated Cell Sorting (FACS), panning methods, magnetic particle selection, particle sorter selection and other methods known to those skilled in the art, including density separation (Xu et al, (2002) circ. Res.91: 501; U.S.S.N.20030022367) and separation based on other physical properties (Doeverdans et al, (2000) J.mol.cell.Cardiol.32: 839-. Negative selection may be performed, including selection and removal of cells with undesirable markers or characteristics (e.g., fibroblast markers, epithelial markers, etc.).

Undifferentiated ES cells express genes that can be used as markers for detecting the presence of undifferentiated cells. Exemplary ES cell markers include stage-specific embryonic antigen (SSEA) -3, SSEA-4, TRA-1-60, TRA-1-81, alkaline phosphatase, or e.g., u.s.s.n.2003/0224411; or Bhattacharya (2004) Blood 103(8) 2956-64 (each incorporated herein by reference in its entirety). Exemplary markers expressed on cardiac progenitors include, but are not limited to, TMEM88, GATA4, ISL1, MYL4, and NKX 2-5. Such markers may be evaluated or used to remove or determine the presence of undifferentiated cells or progenitor cells in, for example, an in vitro differentiated cardiomyocyte population. Similarly, the presence of markers of undifferentiated cells (whether embryonic markers or other markers) can be used to assess populations of other mesodermal lineage cell types that can be used in the methods and compositions described herein.

Agents that reduce the level and/or activity of PRPF31

Precursor mRNA processing factor 31, also known as U4/U6 micronucleus ribonucleoprotein Prp 31; hPRP31 or PRPF31 is part of a spliceosome (paraleosome) encoded by the gene PRPF 31. PRPF31 is a ubiquitously expressed 61-kDa splicing factor protein that activates the spliceosome complex. The spliceosome complex comprises a polypeptide and small nuclear RNA (snrna), which functions to remove introns, i.e., non-coding regions of transcribed pre-RNA, during RNA splicing. The addition of PRPF31 is necessary for the transition of the spliceosome complex to the activated state (see, e.g., Liu et al, 2007, and schafert et al, EMBO J. (2014), which is incorporated herein by reference in its entirety).

The gene, mRNA and amino acid sequences of PRPF31 are known in the art, e.g., the human PRPF31 gene (NCBI GeneID:26121)), human mRNA transcripts (NCBI reference sequence: NM-015629.4 (SEQ ID NO:4)) and the human amino acid sequence (NCBI reference sequence: NP-056444.3 (SEQ ID NO: 5)).

In certain embodiments, the methods and compositions described herein include the use of one or more agents that inhibit or reduce the level or activity of PRPF31 in cells or cell preparations for transplantation (e.g., in vitro differentiated cells for transplantation).

The level of PRPF31 can be determined by methods known in the art, such as immunoprecipitation or other pull-down assays, Western blots, qPCR, RT-PCR, and immunocytochemistry. Thus, these methods can be used to determine whether a given treatment or agent reduces the level of PRPF31 protein, mRNA, or both. Primers for RT-PCR can be prepared based on the mRNA sequence, e.g., based on SEQ ID NO: 5. Antibodies that specifically bind human PRPF31 can be obtained, for example, from Novus(Centennial,CO)、Santa Cruz(Dallas, TX) and(Cambridge, MA) and can be used, for example, to detect changes in PRPF31 in cells of mesodermal lineage, e.g., cardiomyocytes, etc., that differentiate in vitro after treatment with an agent that reduces the level of PRPF 31.

In some embodiments, the agent reduces the activity of PRPF 31. In some embodiments, the agent reduces the activity of PRPF31 by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more as compared to an appropriate control.

The activity of PRPF31 can be determined by any method known in the art. For example, the activity of PRPF31 in splicing can be determined using a minigene constructed based on transfection-based assays as described by Wilke et al, mol. Vis.14:683-690(2008), which is incorporated by reference in its entirety. While not wishing to be bound by theory, it is expected that the effect of PRPF31 inhibition on the promotion of survival or engraftment of transplanted cells is related to the activity of PRPF31 in mRNA splicing. PRPF31 binds to U4 snRNP in the U4/U6 snRNP complex and is thought to form a bridge between U4/U6 di-snRNP and U5 by binding to the U5 specific PRPF6 protein. See, e.g., Makarova et al, EMBO J.21: 1148-. Thus, in another method, PRPF31 activity may be assessed by assaying the interaction of PRPF31 with PRPF6 in cells or in vitro, e.g., via co-immunoprecipitation formed by the PRPF31/PRPF6 complex or other assays.

Alternatively, the activity of PRPF31 in promoting survival and/or engraftment is expected to be independent of the activity of this factor in splicing. Agents that bind to PRPF31 or promote modification of PRPF31, for example, can be evaluated for inhibition of PRPF31 activity.

In one embodiment, the effect of an agent that reduces the activity of PRPF31 can be demonstrated by contacting cells differentiated in vitro, e.g., cells of the mesodermal lineage, e.g., cardiomyocytes differentiated in vitro, with the agent and transplanting the cells into an appropriate animal model. It was then demonstrated that the agent that promotes survival of transplanted cells relative to untreated cells was an agent that reduced the activity of PRPF 31.

The Wilke et al publication also describes a pull-down assay to measure this complex formation, as well as a mutant PRPF31 polypeptide having an a216P missense mutation that acts in a dominant negative manner upon splicing. Transient expression of the a216P mutein is expected to be useful for reducing PRPF31 activity in differentiated cells in vitro for transplantation in methods and compositions as described herein.

In some embodiments of any aspect, the agent is a small molecule, polypeptide, antibody, nucleic acid molecule, RNAi, vector comprising a nucleic acid molecule, antisense oligonucleotide, or gene editing system.

In some embodiments, the agent reduces the level of PRPF 31. In some embodiments, the agent reduces the level of PRPF31 by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more, as compared to an appropriate control.

In some embodiments, the agent that reduces the level or activity of PRPF31 is a small molecule. Small molecules are organic or inorganic molecules that may include, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide analogs, organic or inorganic compounds having a molecular weight of less than about 10,000 grams/mole (e.g., including heteroorganic (heterorganic) and organometallic compounds), organic or inorganic compounds having a molecular weight of less than about 5,000 grams/mole, organic or inorganic compounds having a molecular weight of less than about 1,000 grams/mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. Examples of "small molecules" include, but are not limited to, The compounds described in Goodman and Gillman's "The pharmaceutical Basis of Therapeutics", 13 th edition, (2018); incorporated herein by reference. Methods for screening for small molecules are known in the art and can be used to identify small molecules that are effective, e.g., in modulating the level or activity of PRPF31, given a desired target (e.g., a PRPF31 polypeptide).

In some embodiments of any aspect, the agent that reduces the level or activity of PRPF31 comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) that targets PRPF31 or an RNA transcript thereof.

In some embodiments of any aspect, the inhibitory nucleic acid is an inhibitory RNA or RNA interference molecule (iRNA).

RNAi, also known as interfering RNA (irna), is any one of a class of agents that contain RNA (or modified nucleic acids such as those described below) and mediate the targeted cleavage of RNA transcripts via a highly conserved RNA-induced silencing complex (RISC) pathway. In some embodiments of any aspect, the iRNA as described herein affects inhibition of expression and/or activity of a target (e.g., PRPF 31). In some embodiments of any aspect, contacting the cell with the inhibitor (e.g., iRNA) results in a reduction in target mRNA levels in the cell by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, up to and including 100% of the target mRNA levels found in the cell in the absence of iRNA.

In some embodiments of any aspect, the iRNA can be dsRNA. dsRNA includes two strands of RNA that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA is used. One strand of the dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and usually completely complementary, to the target sequence. The target sequence may be derived from the sequence of an mRNA formed during target expression, for example, it may span one or more intron boundaries. The other strand (the sense strand) includes a region of complementarity to the antisense strand, such that the two strands hybridize and form a duplex structure upon binding under suitable conditions. In one embodiment, the iRNA may be or include a single-stranded RNA that folds upon itself through self-complementarity to form a base-paired duplex that targets the transcript of interest. These are referred to as short hairpin RNAs or shrnas and may be encoded by constructs introduced into cells, if desired. Typically, the duplex structure is 15-30 base pairs (inclusive), more typically 18-25 base pairs (inclusive), more typically 19-24 base pairs (inclusive), and most typically 19-21 base pairs (inclusive) in length. Similarly, the region complementary to the target sequence is 15-30 base pairs in length (inclusive), more typically 18-25 base pairs in length (inclusive), more typically 19-24 base pairs in length (inclusive), and most typically 19-21 base pairs in length (inclusive). In some embodiments of any aspect, the dsRNA is 15-20 nucleotides in length (inclusive), and in other embodiments, the dsRNA is 25-30 nucleotides in length (inclusive). As one of ordinary skill will recognize, the target region of the RNA targeted for cleavage is most often a portion of a larger RNA molecule, typically an mRNA molecule. In related cases, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to serve as a substrate for RNAi-directed cleavage (i.e., cleavage by the RISC pathway). In some cases, dsrnas with duplexes as short as 9 base pairs may mediate RNAi-directed RNA cleavage. The most common targets are at least 15 nucleotides in length, preferably 15-30 nucleotides in length, as described above.

Exemplary embodiments of inhibitory nucleic acid types can include, for example, sirnas, shrnas, mirnas, and/or amirnas as known in the art. One of ordinary skill in the art can design and test RNAi agents that target PRPF31 mRNA. Publicly available RNAi design software allows one of skill in the art to select one or more sequences within a given target transcript that is or may mediate efficient knockdown of target gene expression, and there are commercial sources of designing and making RNAi agents. In some embodiments of any aspect, the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1 or SEQ ID NO 2.

In some embodiments of any aspect, the RNA of the iRNA (e.g., dsRNA) is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids described herein can be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al, (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which are incorporated herein by reference. Modifications include, for example, (a) terminal modifications, e.g., 5 'terminal modifications (phosphorylation, conjugation, reverse ligation, etc.), 3' terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.), (b) base modifications, e.g., substitutions with a stabilizing base, a destabilizing base, or a base that base pairs with an extended pool of partners (reteire), a removing base (abasic nucleotide), or a conjugated base, (c) sugar modifications (e.g., at the 2 'or 4' position) or substitutions of sugars, and (d) backbone modifications, including modifications or substitutions of phosphodiester bonds. Specific examples of RNA compounds that can be used in the embodiments described herein include, but are not limited to, RNA that contains a modified backbone or that is free of natural internucleoside linkages. RNA having a modified backbone includes in particular those which do not have a phosphorus atom in the backbone. For the purposes of this specification and as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in the internucleoside backbone may also be considered oligonucleosides. In some embodiments of any aspect, the modified RNA will have a phosphorus atom in its internucleoside backbone.

Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkylphosphonates, including 3 '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3' -phosphoramidates and aminoalkyl phosphoramidates, thiocarbonylaminoates, thiocarbonylalkylphosphates, and boranophosphates having normal 3 '-5' linkages (boranophosphates), 2 '-5' linked analogs of these, and those having opposite polarities wherein adjacent pairs of nucleoside units are linked 3 '-5' to 5 '-3' or 2 '-5' to 5 '-2'. Various salts, mixed salts and free acid forms are also included. Wherein the modified RNA backbone, excluding the phosphorus atom, has a backbone formed of short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of the nucleoside); a siloxane backbone; sulfide, sulfoxide and sulfone backbones; formyl (formacetyl) and thioformyl (thioformacetyl) backbones; methylene formyl and thioformyl backbones; an olefin-containing backbone; a sulfamate backbone; methylene imino and methylene hydrazino backbones; sulfonated and sulfonamide backbones; an amide backbone; other oligonucleotides having mixed N, O, S and CH2 moieties, and having heteroatom backbones, particularly- -CH2- -NH- -CH2- -, - -CH2- -N (CH3) - - - -O- -CH2- - [ referred to as methylene (methylimino) or MMI backbones ], - -CH2- -O- -N (CH3) - - -CH2- -, - -CH2- -N (CH3) - - -N (CH3) - - -CH2- -, and- -N (CH3) - - -CH2- -CH2- - [ where the natural phosphodiester backbone is represented by- -O- -P- -O- -CH2- - ].

In other RNA mimetics suitable or contemplated for iRNA, the sugar and internucleoside linkages of the nucleotide units, i.e. the backbone, are all replaced by new groups. The base units are maintained for hybridization with the appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic, that has been shown to have excellent hybridization properties, is known as Peptide Nucleic Acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and bound directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone.

The RNA of the iRNA may also be modified to include one or more Locked Nucleic Acids (LNAs). Locked nucleic acids are nucleotides with a modified ribose moiety, wherein the ribose moiety comprises an additional bridge connecting the 2 'and 4' carbons. This structure effectively "locks" the ribose in the 3' -endo conformation. The addition of locked Nucleic Acids to siRNA has been shown to increase the stability of siRNA in serum and reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(1):439 447; Mook, OR. et al, (2007) Mol Canc Ther 6(3):833 843; Grunweller, A. et al, (2003) Nucleic Acids Research 31(12):3185 3193).

The modified RNA may also contain one or more substituted sugar moieties. The iRNA, e.g., dsRNA, described herein may include at the 2' position one of: OH; f; o-, S-or N-alkyl; o-, S-or N-alkenyl; o-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1-C10 alkyl or C2-C10 alkenyl and alkynyl. Exemplary suitable modifications include O [ (CH2) nO ] mCH3, O (CH2). nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nson h2, and O (CH2) nson [ (CH2) nCH3) ]2, where n and m are 1 to about 10. In some embodiments of any aspect, the dsRNA comprises at the 2' position one of: c1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of iRNA, or groups for improving the pharmacodynamic properties of iRNA, and other substituents having similar properties. In some embodiments of any aspect, the modification comprises 2 'methoxyethoxy (2' -O- -CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2' -MOE) (Martin et al, Helv. Chim. acta,1995,78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2 '-dimethylaminooxyethoxy, i.e., the O (CH2)2ON (CH3)2 group, also known as 2' -DMAOE (as described in the examples below), and2 '-dimethylaminoethoxyethoxy (also known in the art as 2' -O-dimethylaminoethoxyethyl or 2 '-DMAEOE), i.e., 2' -O-CH 2-O-CH 2-N (CH2)2 (also described in the examples below).

Other modifications include 2 '-methoxy (2' -OCH3), 2 '-aminopropoxy (2' -OCH2CH 2NH2), and2 '-fluoro (2' -F). Similar modifications can also be made at other positions on the RNA of the iRNA, particularly at the 3 'position of the sugar and 5' position of the 5 'terminal nucleotide in a 3' terminal nucleotide or 2 '-5' linked dsRNA. The iRNA may also have a glycomimetic, such as a cyclobutyl moiety, in place of the pentofuranosyl group.

Inhibitory nucleic acids may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiocytosine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, and guanine, 5-halogen is in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Some of these nucleobases are particularly useful for increasing the binding affinity of inhibitory nucleic acids of the features of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methyl cytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ℃ (Sanghvi, Y.S., crook, S.T. and Lebleu, B., eds., dsRNA Research and Applications, CRC Press, Boca Raton,1993, pp.276-278), and are exemplary base substitutions, even more particularly when combined with 2' -O-methoxyethyl sugar modifications.

The preparation of such modified nucleic acids, backbones and nucleobases is known in the art.

Another modification of an inhibitory nucleic acid characteristic of the invention includes chemically linking the inhibitory nucleic acid to one or more ligands, moieties or conjugates that enhance iRNA activity, cellular distribution, pharmacokinetic properties or cellular uptake. Such moieties include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al, Proc. Natl. acid. Sci. USA,1989,86: 6553-containing 6556), cholic acids (Manoharan et al, Bio rg. Med. chem. Let.,1994,4: 1053-containing 1060), thioethers such as beryllium-S-tritylthiol (beryl-S-trithiol) (Manoharan et al, Ann.N.Y.Acad. Sci.,1992,660: 306-containing 309; Manoharan et al, Bio.Med. chem. Let.,1993,3: 2765-containing 2770), mercaptocholesterol (Oberhauser et al, Nucl. acids Res, 1992,20: 533-containing 538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Bemoaras et al, EMB. J., EMB. 19884, 15: 14-K-S.K., 2000-S.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.R.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.R. No. 23, Skyphos.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K. 3, 15, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23, 3, 23 (Manohara et al, Tetrahedron Lett.,1995,36: 3651-3654; Shea et al, Nucl. acids Res.,1990,18:3777-3783), a polyamine or polyethylene glycol chain (Manohara et al, Nucleosides & Nucleosides, 1995,14:969-973), or adamantane acetic acid (Manohara et al, Tetrahedron Lett.,1995,36:3651-3654), a palmityl moiety (Mishra et al, Biochim. Biophys. acta,1995,1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al, J.Pharmacol. Exp. Ther.,1996,277: 937).

In one embodiment of any aspect, the agent that reduces PRPF31 is an antisense oligonucleotide, e.g., a nucleic acid having a sequence complementary to a target mRNA sequence. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by hybridizing to the target and halting expression at the level of transcription, translation, or splicing. The antisense oligonucleotides described herein are designed to hybridize to a target under typical intracellular conditions. Thus, oligonucleotides are selected that are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity in the context of the cellular environment, to produce the desired effect. For example, antisense oligonucleotides that reduce the level of PRPF31 can comprise at least 10, at least 15, at least 20, at least 25, at least 30, or more bases complementary to a portion of the coding sequence of the human PRPF31 gene (e.g., SEQ ID NOS: 4-5), respectively.

In some embodiments of any aspect, the agent is an aptamer. Aptamers typically consist of relatively short oligonucleotides, which typically range in length from 20 to 80 nucleotides, e.g., at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, or 80 nucleotides or more. Aptamers can be linked to longer sequences, for example at one or the other end of the aptamer, although additional sequences that affect the secondary structure of the aptamer can affect aptamer function. The functional activity of an aptamer, i.e. binding to a given target molecule, involves the interaction between a moiety or element in the aptamer and a moiety or element on the target molecule. Aptamers typically bind to a specific target through non-covalent interactions with the target (e.g., proteins), including but not limited to electrostatic interactions, hydrophobic interactions, and/or their complementary shapes. One skilled in the art may initially design aptamers targeting PRPF31 using computer models known in the art, such as UNPACK, APTANI, 3D-DART, ModeRNA, or Unified Nucleic Acid Folding and hybridization package (UNAFold), or any other oligonucleotide structure prediction model. After such design, molecules can be synthesized and tested for binding and inhibitory activity (as known in the art). If desired, the aptamer may be expressed in the cell from a construct encoding the aptamer sequence.

The nucleic acids described herein that reduce the level or activity of PRPF31 can be obtained commercially, chemically synthesized using, for example, nucleoside phosphoramidites or other methods, or isolated from biological samples by DNA or RNA extraction methods. These isolation methods include, but are not limited to, column purification, ethanol precipitation, phenol-chloroform extraction, or acid guanidinium thiocyanate-phenol chloroform extraction (AGPC).

In certain embodiments, the vectors may be used to express an agent described herein that reduces the level or activity of PRPF31 in an in vitro differentiated cell described herein, including, but not limited to, one or more polypeptides, peptides, ribozymes, peptide nucleic acids, sirnas, or RNAi molecules, including, for example, antisense oligonucleotides, antisense polynucleotides, sirnas, shrnas, micrornas and antisense counterparts thereof (e.g., antagomirs), antibodies, antigen-binding fragments, or any combination thereof.

A vector is a nucleic acid construct designed for delivery to a host cell or for transfer of genetic material between different host cells. As used herein, a vector may be viral or non-viral. The term "vector" encompasses any genetic element that is capable of replication when combined with appropriate control elements and is capable of transferring genetic material into a cell. Vectors may include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, artificial chromosomes, viruses, virosomes, and the like.

In some embodiments of any aspect, the vector is selected from the group consisting of a plasmid and a viral vector.

An expression vector is a vector that directs the expression of an RNA or polypeptide (e.g., an anti-PRPF 31 antibody) from a nucleic acid sequence contained therein that is linked to a transcriptional regulatory sequence on the vector. The expressed sequence is typically, but not necessarily, heterologous to the cell. The expression vector may comprise further elements, for example, the expression vector may have two replication systems allowing it to be maintained in both organisms, for example in human cells for expression and in prokaryotic hosts for cloning and amplification. "expression" refers to the participation in the production of RNA and protein cellular processes, and the appropriate case of secretion of proteins, including but not limited to such as transcription, transcript processing, translation and protein folding, modification and processing. "expression product" includes RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene.

The integration vector permanently incorporates the RNA/DNA it delivers into the host cell chromosome. The non-integrating vector remains episomal, meaning that the nucleic acid contained therein is never integrated into the host cell chromosome. Examples of integrating vectors include retroviral vectors, lentiviral vectors, hybrid adenoviral vectors, and herpes simplex viral vectors.

Non-integrating vectors include non-integrating viral vectors. Non-integrating viral vectors eliminate one of the major risks posed by integrating retroviruses, as they do not integrate their genome into the host DNA. One example is the Epstein Barr oriP/nuclear antigen-1 ("EBNA 1") vector, which is capable of limited self-replication and is known to function in mammalian cells. Comprising two elements from the oriP of Epstein-Barr virus (Epstein-Barr virus) and EBNA1, the binding of the EBNA1 protein to the oriP of the viral replicon region maintains the relatively long-term episomal presence of the plasmid in mammalian cells. This particular characteristic of oriP/EBNA1 vector makes it ideal for use in generating non-integrated host cells. Other non-integrating viral vectors include adenoviral vectors and adeno-associated virus (AAV) vectors.

Another non-integrating viral vector is the RNA Sendai virus vector, which can produce proteins without entering the nucleus of the infected cell. The F-deficient sendai virus vector remains in the cytoplasm of infected cells for several generations, but is rapidly diluted and lost completely after several generations (e.g., 10 generations). This allows self-limiting transient expression of the selected heterologous gene in the target cell.

Another example of a non-integrating vector is a minicircle vector. A minicircle vector is a circular vector in which the plasmid backbone has been released, leaving only the eukaryotic promoter and cDNA to be expressed.

As described above, in some embodiments, the agents described herein are expressed in a cell by a viral vector. "viral vector" includes nucleic acid vector constructs that include at least one element of viral origin and have the ability to be packaged into viral vector particles. The viral vector may contain nucleic acid encoding a polypeptide agent as described herein in place of a non-essential viral gene. The vectors and/or particles may be used for the purpose of transferring nucleic acids into cells in vitro or in vivo.

In some embodiments, the nucleic acids and vectors described herein can be used to provide antisense nucleic acids, RNAi, aptamers, or vectors comprising nucleic acids to cells in vitro or in vivo. The nucleic acids described herein can be delivered using any transfection reagent or other physical means that facilitates entry of the nucleic acid into a cell. Methods and compositions for administering, delivering, or contacting cells with nucleic acids are known in the art, e.g., liposomes, nanoparticles, exosomes, nanocapsules, conjugates, alcohols, polylysine-rich compounds, arginine-rich compounds, calcium phosphate, microbubbles, microinjection, and electroporation. An "agent that increases cellular uptake" is a molecule that facilitates transport of a molecule, such as a nucleic acid or peptide or polypeptide or other molecule that would otherwise not be able to efficiently cross a lipid membrane across a cell membrane. For example, the nucleic acid may be conjugated to a lipophilic compound (e.g., cholesterol, tocopherol, etc.), a Cell Penetrating Peptide (CPP) (e.g., transretin, TAT, Syn1B, etc.), or a polyamine (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed in, for example, Winkler (2013), Oligonucleotide conjugates for therapeutic applications, ther, deliv.4 (7); 791- "809.

Assays known in the art can be used to test the efficiency of nucleic acid delivery to cells or tissues differentiated in vitro. One skilled in the art can assess the efficiency of introduction by measuring the mRNA and/or protein levels of the desired transgene (e.g., via reverse transcription PCR, western blot analysis, and enzyme-linked immunosorbent assay (ELISA)). In some embodiments, the vectors described herein comprise a reporter protein that can be used to assess the expression of a desired transgene, for example by examining the expression of the reporter protein by fluorescence microscopy or luminescence plate reader.

In some embodiments, the agent that reduces the level or activity of PRPF31 is a nucleic acid encoding a polypeptide or a vector encoding a polypeptide. Polypeptides may encompass both singular "polypeptides" and plural "polypeptides" and include any chain of two or more amino acids. Conventional nomenclature for polynucleotide and polypeptide structures exists in the art. For example, the single and three letter abbreviations are widely used to describe amino acids: alanine (A; Ala), arginine (R; Arg), asparagine (n; ASN), aspartic acid (D; Asp), cysteine (C; Cys), glutamine (Q; Gln), glutamic acid (E; Glu), glycine (G; Gly), histidine (H; His), isoleucine (I; Ile), leucine (L; Leu), methionine (M; Met), phenylalanine (F; Phe), proline (P; Pro), serine (S, Ser), threonine (T; Thr), tryptophan (W; Trp), tyrosine (Y; Tyr), valine (V; Val) and lysine (K; Lys). The amino acid residues provided herein are preferably in the "L" isomeric form. However, the residue in "D" isomeric form may be substituted for any L-amino acid residue, provided that the desired properties of the polypeptide are retained.

In some embodiments, the agent that reduces the level or activity of PRPF31 is a fusion polypeptide. In some embodiments, the agent that reduces the level or activity of PRPF31 is an antibody, an intrabody (intrabody), a nucleic acid encoding an antibody, a nucleic acid encoding an intrabody, or a fragment thereof. In some embodiments, the antibody, intrabody, or fragment thereof inhibits or reduces the assembly of spliceosomes by targeting PRPF31 in a cell.

An "antibody" as described herein encompasses any antibody or antibody fragment (i.e., a functional antibody fragment), or antigen-binding fragment that retains antigen-binding activity to a desired antigen or epitope (e.g., PRFP 31). In one embodiment, the antibody or antigen binding fragment thereof comprises an immunoglobulin chain or fragment thereof and at least one immunoglobulin variable domain sequence. Examples of antibodies include, but are not limited to, scFv, Fab fragments, Fab ', F (ab')₂Single domain antibodies (dAbs), heavy chain, light chain, heavy and light chains, whole antibodies (e.g., includingFc. Each of Fab, heavy chain, light chain, variable region, etc.), bispecific antibodies, diabodies (diabodies), linear antibodies, single chain antibodies, intrabodies, monoclonal antibodies, chimeric antibodies, or multimeric antibodies. Furthermore, the antibody may be derived from any mammal, e.g., primate, human, rat, mouse, llama, horse, goat, and the like. In one embodiment, the antibody is human or humanized. In some embodiments, the antibody is a modified antibody. In some embodiments, components of the antibody may be expressed separately, such that the antibody self-assembles upon expression of two or more protein components. In one embodiment, the antibody or antigen binding fragment thereof comprises a framework region or an Fc region. An antibody fragment can retain 10-99% of the activity of an intact antibody (e.g., 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 50-99%, 50-90%, 50-80%, 50-70%, 50-60%, 20-99%, 30-99%, 40-99%, 60-99%, 70-99%, 80-99%, 90-99% or any activity therebetween). It is also contemplated herein that a functional antibody fragment comprises an activity greater than (e.g., at least 2-fold or greater than) the activity of an intact antibody. In another embodiment, the antibody fragment comprises an affinity for its target that is substantially similar to the affinity of an intact antibody for the same target (e.g., an epitope).

The antibodies or immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) or subclass of immunoglobulin molecules, as understood by those skilled in the art. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain.

The antigen-binding domain of an antibody molecule is part of an antibody molecule (e.g., an immunoglobulin (Ig) molecule) that is involved in antigen binding. The antigen-binding site of an antibody is typically formed by the amino acid residues of the variable regions (V) of the heavy (H) and light (L) chains. Three highly divergent segments within the variable regions of the heavy and light chains, termed hypervariable regions, are disposed between more conserved flanking segments termed "framework regions" (FR). FR is an amino acid sequence naturally occurring between and adjacent to hypervariable regions of an immunoglobulin. In a typical antibody molecule, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged in three-dimensional space relative to each other to form an antigen-binding surface which is complementary to the three-dimensional surface to which antigen is bound. The three hypervariable regions of each of the heavy and light chains are referred to as "complementarity determining regions" or "CDRs". Framework regions and CDRs have been defined and described, for example, in Kabat, E.A. et al, (1991) Sequences of Proteins of Immunological Interest, fifth edition, U.S. department of Health and Human Services, NIH Publication No.91-3242, and Chothia, C. et al, (1987) J.mol.biol.196: 901-. Each variable chain (e.g., variable heavy and variable light chains) typically consists of three CDRs and four FRs arranged in amino acid order from amino-terminus to carboxy-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR 4. CDRs within the antibody variable region confer antigen specificity and binding affinity. Typically, there are three CDRs in each heavy chain variable region (HCDR1, HCDR2, HCDR3) and three CDRs in each light chain variable region (LCDR1, LCDR2, LCDR 3). The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of known protocols, including those described in Kabat et Al, (1991), "Sequences of Proteins of Immunological Interest," 5th Ed.public Health Service, National Institutes of Health, Bethesda, Md. ("Kabat" numbering scheme), Al-Lazikani et Al, (1997) JMB 273, 927) 948 ("Chothia" numbering scheme). CDRs defined according to the "Chothia" numbering scheme are sometimes also referred to as "hypervariable loops". For example, the CDR amino acid residues in the human heavy chain variable region (VH) are numbered 31-35(HCDR1), 50-65(HCDR2) and 95-102(HCDR3) under Kabat; the CDR amino acid residues in the human light chain variable domain (VL) are numbered 24-34(LCDR1), 50-56(LCDR2) and 89-97(LCDR 3). CDR amino acids in the VH are numbered 26-32(HCDR1), 52-56(HCDR2) and 95-102(HCDR3) under Chothia; the amino acid residues in VL are numbered 26-32(LCDR1), 50-52(LCDR2) and 91-96(LCDR 3). Each VH and VL typically includes three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR 4.

Full-length antibodies are typically immunoglobulin (Ig) molecules (e.g., IgG, IgE, IgM antibodies), e.g., which are naturally occurring and are formed by the process of recombination of normal immunoglobulin gene fragments.

A functional antibody fragment or antigen-binding fragment binds to the same antigen or epitope as the intact (e.g., full-length) antibody recognizes. The term "antibody fragment" or "functional fragment" also includes isolated fragments consisting of variable regions, such as "Fv" fragments consisting of the variable regions of the heavy and light chains or recombinant single chain polypeptide molecules in which the light and heavy chain variable regions are linked by a peptide linker ("scFv protein"). In some embodiments, an antibody fragment does not include portions of the antibody that lack antigen binding activity, such as an Fc fragment or a single amino acid residue. In some embodiments, a functional antibody fragment retains at least 20% of the activity of an intact or full-length antibody, e.g., as assessed by measuring the degree of inhibition of a target protein (e.g., PRPF 31). In other embodiments, a functional antibody fragment retains at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or even 100% (i.e., substantially similar) of the activity of an intact antibody. It is also contemplated herein that a functional antibody fragment will comprise increased activity (e.g., at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 100-fold, or more) as compared to an intact antibody.

When an intrabody is desired, i.e., an antibody expressed in a cell to target an intracellular antigen, such as PRPF31, the nucleic acid or gene encoding the anti-PRPF 31 antibody or fusion protein typically does not encode a secretory sequence. Intrabodies may include scfvs. In some cases, it may encode a secretory sequence, but also have an intended targeting sequence. In other embodiments, the intrabody gene encodes another intracellular targeting sequence, such as a nuclear localization sequence. Thus, by incorporating signaling motifs such as C-terminal ER retention signals, mitochondrial targeting sequences, nuclear localization sequences, etc., intracellular antibodies can be directed to specific cellular compartments.

In some embodiments, the agent that reduces the level or activity of PRPF31 is a dominant negative mutant of PRPF31 or PRPF31 comprising one or more point mutations. Such PRPF31 mutations are known in the art and are described, for example, by vitana et al, Mol Cell (2001); deery et al, Hum Mol Gen. (2002); waseem et al, invest, optoal, vis, sci. (2007); and Rio Frio Clin Invest, (2008), each of which is incorporated herein by reference in its entirety.

Graft composition

In one aspect, described herein is a method of promoting survival and/or engraftment of transplanted differentiated cells in vitro, comprising contacting differentiated cells in vitro with an agent that reduces the level or activity of PRPF31, and transplanting the cells into a tissue of a subject in need thereof. In some embodiments, the cells differentiated in vitro are of mesodermal lineage. In some embodiments, the cells differentiated in vitro are cardiomyocytes. The cells differentiated in vitro may be any of the above cells, or other mesodermal lineage cells differentiated in vitro as known in the art.

For cells treated with an agent that reduces the level or activity of PRPF31, the formulation, dose, and time of treatment with the agent will vary depending on the nature of the agent. For example, small molecules or other agents that pass through the plasma membrane of a cell may only be administered into the medium in which the cell is maintained, while small molecules or other agents that do not readily pass through the plasma membrane may be formulated with moieties that facilitate delivery into the cell. Factors for determining whether a given agent will be transported Across its own plasma Membrane, e.g., by passive transport, or whether formulation with another agent or entity that facilitates or contributes to Membrane transport is required are discussed, for example, in the review article "mounting Across the Cell Membrane: An Overview for Small Molecules, Peptides, and Proteins," Yang & Hinner, Methods mol. biol.1266:29-53(2015), which is incorporated herein by reference in its entirety. The authors note that small non-polar gases such as oxygen, carbon dioxide and nitrogen and small polar molecules such as ethanol easily cross the membrane, but even slightly larger metabolites such as urea and glycerol have lower permeability, and the plasma membrane is practically impermeable to larger uncharged polar molecules and to all charged molecules, including ions. Thus, for many peptides, polypeptides, oligonucleotides or polynucleotides, as well as many organic compounds and small molecules, methods employing other mechanisms are contemplated.

Many molecules, including sugars (glucose, galactose, fructose), amino acids and nucleotides are transported across cell membranes by membrane transporters. Conjugation of an agent that is desired to be transported across a membrane to the natural substrate of the transporter can deliver some of the agent efficiently to the cytosol. See, e.g., Dahan et al, Expert Opin. drug Deliv.9:1001- > 1013(2012) and Majumdar et al, adv. drug Deliv.Rev.56:1437- > 1452(2004), each of which is incorporated herein by reference.

Limited mechanical disruption of the membrane can be used to introduce small molecule to protein range agents into cells. Thus, electroporation, a device that forces cells through a microfluidic channel in a solution containing the desired agent (see, e.g., Sharei et al, Proc. Natl. Acad. Sci. U.S.A.110:2082-2087(2013)), and cell membrane-penetrating silicon nanowires (Shalek et al, Proc. Natl. Acad. Sci. U.S.A.107:1870-1875(2010)) can facilitate the uptake of agents by cultured cells.

Conjugation of agents to Cell Penetrating Peptides (CPPs) may also facilitate uptake of macromolecules, including proteins. Examples of CPPS include viral TAT peptides (see, e.g., Fawell et al, Proc. Natl. Acad. Sci. U.S.A.91: 664. 668(1994), Nagahara et al, nat. Med.4: 1449. 1452(1998), and Langel, Handbook of cell-specific peptides.2^ndBoca Raton: CRC Press (2010)) and amphiphilic Pep-1 peptides (see e.g., Morris et al, nat. Biotechnol.19:1173-1176 (2001)). Other proteins that can facilitate uptake of conjugated cargo protein agents include, for example, autoantibodies 3E10, which can be transported across cell membranes, have been proposed to penetrate into the nucleus (see, e.g., Hansen et al, sci. trans. med.4157ra 142(2012)) and have been shown to deliver exogenous phosphatase across cell membranes (see, e.g., Lawlor et al, hum. mol. genet.22:1525-1538 (2013)). Alternatively, it has been reported that protein reagents are packaged in virus-like particles or attached to engineered phage T4 heads to facilitate cytoplasmic delivery (see, e.g., Kaczmarcczyk et al, Proc. Natl. Acad. Sci. U.S.A.108: 169998-. Each reference cited is incorporated herein by reference.

Lipid and polymer-based formulations for delivery of agents across cell membranes include those that encapsulate the agent in a liposome or those that complex the agent with a lipid. Such methods are well established for introducing nucleic acids (e.g., siRNA, antisense oligonucleotides, ribozymes, aptamers, constructs encoding proteinaceous agents, shRNA, antisense expression cassettes, aptamers, and the like) into cells. Commercial preparations for lipofection are readily available, e.g., LIPOFECTAMINE^TM(ThermoFisher Scientific) transfection reagent, and the like. Mixtures of cationic and neutral lipids have been reported to transport negatively charged proteins (see, e.g., Zelphati et al, J.biol. chem.276:35103-35110(2001) and Torchilin, Drug Discov. today technol.5: e95-e103(2008), each of which is incorporated herein by reference). Polymer-based formulations comprising Polyethyleneimine (PEI) and poly- β -aminoester nanoparticles enhance endosomal escape of cargo, including proteins, when administered to cells (see, e.g., Behr, Chim. int. J. chem.51:34-36(1997) and Su et al, Biomacromolecules 14:1093-1102(2013), each of which is incorporated herein by reference). Other examples of delivery formulations include, but are not limited to, multilamellar vesicles (MLVs), unilamellar vesicles (UMVs), PEG-coated liposomes, exosomes, nanoparticles, and(Promega Corporation,Madison WI)。

any of these or other methods or agents known in the art may be applied to a given agent for introducing an agent that reduces the level or activity of PRPF31 into differentiated cells in vitro as described herein.

In the context of delivering an agent described herein, the terms "contacting", "delivering" or "delivering" are intended to encompass both the delivery of the agent that reduces the level or activity of PRPF31 from outside the cell and the delivery within the cell, e.g., by expression of a nucleic acid construct or vector. For example, the agents described herein can be introduced from outside the cell by adding the agent to the cell culture medium in which the in vitro differentiated cells described herein are maintained or grown. Alternatively, the agents described herein can be delivered by expression from an exogenous construct (e.g., a virus or other expression vector) within a cell. Such constructs may be episomal or stably integrated into the genome of the cell. In one embodiment, the step of contacting in vitro differentiated cells of the mesodermal lineage or cardiomyocytes with an agent described herein comprises using cells that stably express the agent from the construct. In another embodiment, the step of contacting the in vitro differentiated cells or cardiomyocytes with an agent described herein comprises using cells transiently expressing the agent from the construct.

With respect to dosage, the amount of agent that reduces the level or activity of PRPF31 will depend on the agent and the nature of the formulation. Thus, an agent that will pass through the cell membrane without conjugation or complex formation with another agent can be applied to the cultured cells at a picomolar to micromolar concentration that can be optimized in a straightforward manner via dose-response titration. Agents that require conjugation or complex formation with another agent for transmembrane delivery can also be titrated over a range of concentrations to effectively knock down PRPF31 mRNA, protein, or activity. Once a working range for knocking down the level or activity of PRPF31 is identified, in vivo experiments in which treated cells are injected or otherwise administered, e.g., to an animal model, can be used to identify the dose that provides the best results for survival and/or implantation.

The siRNA targeting PRPF31 (e.g., SEQ ID NO:1) at a concentration of 5 nanomolar (nM) is shown in the examples herein to provide beneficial effects on in vitro differentiated cardiomyocytes when introduced via lipofection. In practice, the concentration may vary, for example, from 0.5nM to 50nM or any concentration therebetween.

With respect to time, the duration of treatment of cells with a given agent or formulation and the time of such treatment relative to administration of the treated cells to a subject can also vary with the nature of the agent and the nature of the cells (e.g., cardiomyocytes versus kidney, bone, or other mesodermal lineage cell types). However, one of ordinary skill in the art can determine how long to treat the cells to achieve optimal PRPF31 inhibition or knockdown for a given agent and formulation, and how long to begin treatment of the cells prior to administering the cells to the subject. Generally, with respect to the scheduled time of cell administration, agents that require longer time to achieve knockdown or inhibition should be administered earlier. In some embodiments of any aspect, the cells differentiated in vitro are contacted with the agent that reduces the level or activity of PRPF31 1-48 hours prior to administering the cells to the subject, e.g., 1-36 hours, 1-24 hours, 1-18 hours, 1-12 hours, 1-6 hours, 1-4 hours, or 1-2 hours prior to administering the cells to the subject. In some embodiments of any aspect, the cell is contacted with an agent that reduces the level or activity of PRPF31 at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 10 hours, at least 12 hours, at least 14 hours, at least 16 hours, at least 18 hours, at least 24 hours, at least 30 hours, at least 36 hours, at least 42 hours, or at least 48 hours prior to administering the cell to the subject.

The transplant composition as described herein comprises those cells treated with an agent that reduces the level or activity of PRPF31 in differentiated cells in vitro, in admixture with a pharmaceutically acceptable carrier. The transplant composition can be formulated for administration, e.g., by injection, to a tissue or organ in need of repair or functional enhancement. Alternatively, the graft composition may be formulated on or in a scaffold as described herein or as known in the art, e.g., to help retain the transplanted cells in a given physical location or to further increase survival and/or implantation. Cells associated with the scaffold may also be formulated for injection, for example, where the scaffold is a gel or other matrix having a fluid consistency. Alternatively, where the scaffold is stronger, the cells associated with the scaffold may be formulated for application to or surgically implanted into or onto a tissue or organ.

The number of cells required for transplantation or implantation can be determined by one skilled in the art based on, for example, the degree of damage and cell type to be repaired. For example, in vitro as described hereinThe differentiated cardiomyocytes can be administered to a subject in need of improved cardiac function. In some embodiments, about 1 million to about 100 million cardiomyocytes are administered to a subject. For use in the various aspects described herein, an effective amount of human cardiac myocytes can comprise at least 1X10⁷At least 2X10⁷At least 3X10⁷At least 4X10⁷At least 5X10⁷At least 6X10⁷At least 7X10⁷At least 8X10⁷At least 9X10⁷At least 1X10⁸At least 2X10⁸At least 3X10⁸At least 4X10⁸At least 5X10⁸At least 6X10⁸At least 7X10⁸At least 8X10⁸At least 9X10⁸At least 1X10⁹At least 2X10⁹At least 3X10⁹At least 4X10⁹At least 5X10⁹At least 6X10⁹At least 7X10⁹At least 8X10⁹At least 9X10⁹At least 1X10⁹At least 1X10¹⁰Or more cells for transplantation or implantation. A similar number of other in vitro differentiated cells of mesodermal lineage can be used for transplantation or implantation into different tissues.

While the cells described herein for implantation or transplantation are generally fully differentiated, they may have limited proliferative potential, meaning that long-term survival and/or implantation is preferred, and treatments that reduce the level or activity of PRPF31 in the cells may promote such survival and implantation. It is also contemplated that in some embodiments, cells differentiated in vitro from pluripotent stem cells to stem cells or precursor cells of mesodermal lineage developing upstream from the desired cell type may be treated as described herein to reduce the level or activity of PRPF31 and administered such that the treated cells expand in number and differentiate after administration to a subject.

In some embodiments, the graft compositions described herein will lack or substantially lack an agent that reduces the level of PRPF 31. That is, cells can be transiently treated with the agent in vitro and then formulated for transplantation without the agent. By "substantially devoid" in this context is meant that the graft composition or formulation has the agent retained in the cells only after treatment and prior to or during administration. This is not required, but in some embodiments, and depending on the nature of the agent and the delivery formulation with which it is used, it may be advantageous to wash or remove the agent from the cultured adherent cells prior to formulation for transplantation. In other embodiments, it is contemplated that the cells can be formulated and administered in a transplant composition (e.g., in solution or suspension with the cells) comprising the agent.

Stent composition

In one aspect, the in vitro differentiated cells described herein may be mixed with or grown in or on an agent that provides a scaffold or substrate to support the cells. A scaffold is a structure comprising a biocompatible material (including, but not limited to, a gel, sheet, matrix, or lattice) that can contain cells at a desired location, but allows factors to enter or diffuse in the environment necessary for survival and function. A variety of biocompatible polymers suitable for use in stents are known in the art.

Such scaffolds or substrates may provide physical advantages in immobilizing cells at a given location (e.g. after implantation), as well as biochemical advantages in providing extracellular signals (extracellular cues) for example for further maturation or for example maintaining a phenotype until cells are established.

Biocompatible synthetic, natural, and semi-synthetic polymers can be used to synthesize polymer particles that can be used as scaffold materials. In general, to practice the methods described herein, it is preferred that the scaffold biodegrade, such that cells differentiated in vitro can be isolated from the polymer prior to implantation, or such that the scaffold degrades over time in the subject and does not need to be removed. Thus, in one embodiment, the scaffold provides a temporary structure for the growth and/or delivery of differentiated cells in vitro to a subject in need thereof. In some embodiments, the scaffold allows human cells to grow in a shape suitable for transplantation or administration to a subject in need thereof, thereby allowing the scaffold to be removed prior to implantation and reducing the risk of rejection or allergic reactions triggered by the scaffold itself.

Examples of polymers that can be used include natural polymers and synthetic polymers, although synthetic polymers are preferred for reproducibility and controlled release kinetics. Synthetic polymers that may be used include biodegradable polymers such as poly (lactide) (PLA), poly (glycolic acid) (PGA), poly (lactide-co-glycolide) (PLGA or PLA/PGA copolymers) and other polyhydroxy acids, poly (caprolactone), polycarbonates, polyamides, polyanhydrides, polyphosphazenes, polyaminoacids, polyorthoesters, polyacetals, polycyanoacrylates and biodegradable polyurethanes; non-biodegradable polymers such as polyacrylates, ethylene vinyl acetate polymers and other acyl substituted cellulose acetates and derivatives thereof; polyurethanes, polystyrenes, polyvinyl chlorides, polyvinyl fluorides, poly (vinylimidazoles), chlorosulfonated polyolefins, and polyethylene oxides. Examples of biodegradable natural polymers include proteins such as albumin, collagen, fibrin and silk fabrics, polysaccharides such as alginate, heparin and other naturally occurring biodegradable polymers of sugar units. Alternatively, a combination of the above polymers may be used. In one aspect, natural polymers that are not normally found in the extracellular matrix may be used.

PLA, PGA and PLA/PGA copolymers are particularly useful for forming biodegradable stents. PLA polymers are typically prepared from cyclic esters of lactic acid. Both L (+) and D (-) forms of lactic acid can be used to make PLA polymers, as well as optically inactive DL-lactic acid mixtures of D (-) and L (+) lactic acids. The methods for producing polylactide are well described in the patent literature. Suitable polylactides, their properties and their preparation are described in detail in the following U.S. patents (the teachings of which are incorporated herein by reference): U.S. Pat. nos. 1,995,970 to Dorough; schneider, U.S. patent No. 2,703,316; us patent No. 2,758,987 to Salzberg; U.S. patent No. 2,951,828 to Zeile; U.S. patent No. 2,676,945 to Higgins; and Trehu, U.S. patent No. 2,683,136; no. 3,531,561.

PGA is a homopolymer of glycolic acid (glycolic acid). In the conversion of glycolic acid to poly (glycolic acid), glycolic acid initially reacts with itself to form the cyclic ester glycolide, which is converted to a high molecular weight linear polymer in the presence of heat and a catalyst. PGA polymers and their properties are described in more detail in Cyanamid Research developments World's First Synthetic absorbent Structure, Chemistry and Industry,905 (1970).

The fibers may be formed by melt spinning, extrusion, casting, or other techniques well known in the polymer processing art. If used to remove the scaffold prior to implantation, the preferred solvent is one that is completely removed by processing or a residual amount of biocompatible solvent after processing.

The polymer used in the matrix should meet the mechanical and biochemical parameters necessary to provide adequate support for the cells and subsequent growth and proliferation. The mechanical properties of the polymer, such as tensile strength, can be characterized using an Instron tester, the polymer molecular weight of the polymer by Gel Permeation Chromatography (GPC), the glass transition temperature of the polymer by Differential Scanning Calorimetry (DSC), and the bond structure of the polymer by Infrared (IR) spectroscopy.

The substrate or scaffold may be nano-or micro-patterned with grooves and ridges that allow growth and promote maturation of cardiac cells or tissue on the scaffold. The stent may be any desired shape and may include a wide range of geometries useful in the methods described herein. A non-limiting list of shapes includes, for example, patches (patches), hollow particles, tubes, sheets, cylinders, spheres, fibers, and the like. The shape or size of the scaffold should not substantially prevent cell growth, cell differentiation, cell proliferation or any other cellular process, nor should the scaffold induce cell death via, for example, apoptosis or necrosis. Furthermore, care should be taken to ensure that the shape of the scaffold allows for the delivery of nutrients from the surrounding medium to the appropriate surface area of the cells in the population so as not to impair cell viability. One skilled in the art can also vary the scaffold porosity as desired.

In some embodiments, the cell culture or tissue engineering is performed by using compounds such as basement membrane components, fibronectin, agar, agarose, gelatin, gum arabic, collagen types I, II, III, IV, and V, laminin, glycosaminoglycans, polyvinyl alcohol, mixtures thereof, and the fields of cell culture or tissue engineeringOther hydrophilic and peptide attachment materials (peptide attachment materials) known to those skilled in the art coat the polymer to enhance cell-to-polymer attachment. Examples of materials for coating the polymer scaffold include polyvinyl alcohol and collagen. As will be understood by those skilled in the art, Matrigel^TMAre not suitable for administration to a human subject, and thus the compositions described herein do not include Matrigel^TM。

In some embodiments, it may be desirable to add bioactive molecules/factors to the scaffold. A variety of bioactive molecules can be delivered using the matrices described herein.

In one embodiment, the bioactive factor comprises a growth factor. Examples of growth factors include Platelet Derived Growth Factor (PDGF), transforming growth factor alpha or beta (TGF β), bone morphogenic protein 4(BMP4), fibroblast growth factor 7(FGF7), fibroblast growth factor 10(FGF10), epidermal growth factor (EGF/TGF β), Vascular Endothelial Growth Factor (VEGF), some of which are also angiogenic factors. These factors are known to those skilled in the art and are commercially available or described in the literature. The bioactive molecules may be incorporated into the matrix and released over time by diffusion and/or degradation of the matrix, or they may be suspended with the cell suspension.

Pharmaceutically acceptable carriers

The in vitro differentiated cells treated with an agent that reduces the level or activity of PRPF31 can be formulated for transplantation by mixing with a pharmaceutically acceptable carrier. As used herein, the terms "pharmaceutically acceptable", "physiologically tolerable" and grammatical variations thereof, when referring to compositions, carriers, diluents and reagents, are used interchangeably and refer to materials that can be administered to or on a mammal without producing undesirable physiological effects such as toxicity, transplant rejection, allergy, and the like. A pharmaceutically acceptable carrier will not promote an increase in the immune response to the agent with which it is mixed unless so desired.

Generally, compositions comprising in vitro differentiated cells described herein are administered as a liquid suspension formulation comprising the cells in combination with a pharmaceutically acceptable carrier. One skilled in the art will recognize that the pharmaceutically acceptable carrier used in the transplant composition will not include buffers, compounds, cryopreservatives, preservatives or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject. The cell-containing formulation may include, for example, a permeation buffer that allows for maintenance of cell membrane integrity and, optionally, nutrients that maintain cell viability or enhance implantation upon administration. Such formulations and suspensions are known to those skilled in the art and/or may be adapted for use with the cells described herein using routine experimentation.

The transplant composition may optionally contain additional bioactive ingredients that further promote survival, implantation, or function of the administered cells or, optionally, the tissue, organ, or subject to which the composition is administered. Examples include, but are not limited to, growth factors, nutrients, analgesics, anti-inflammatory agents, and small molecule drugs, such as kinase activators and the like.

Physiologically tolerable carriers for cell suspensions of the graft composition include sterile physiological saline solutions containing no additional material other than cells or containing buffers such as sodium phosphate at physiological pH, e.g., phosphate buffered saline. In addition, the aqueous carrier may contain one or more buffer salts and salts, such as sodium and potassium chloride, dextrose, polyethylene glycol and other solutes.

Application and efficacy

Described herein are compositions and methods that facilitate survival and/or engraftment of transplanted in vitro differentiated human cells, including cells of mesodermal lineage, including but not limited to cardiomyocytes. Transplantation of cells treated with an agent that reduces the level or activity of PRPF31 may involve injecting a transplantation composition comprising cells in suspension (with or without a matrix or scaffold) into a desired location, such as a tissue in need of repair. Alternatively, transplantation may involve surgical placement of a transplantation composition comprising cells in a matrix or on a scaffold onto or into a desired location, tissue or organ (e.g., a tissue or organ in need of repair).

Survival or engraftment of the transplanted cells may be determined by any method known in the art, for example, by monitoring tissue or organ function after transplantation. Measured or measurable parameters of efficacy include clinically detectable markers of function or disease, e.g., elevated or decreased levels of clinical or biomarkers, functional parameters, and parameters associated with clinically accepted symptoms or grades of markers for health or disease or disorder. Survival and engraftment of the transplanted cells can be determined quantitatively or qualitatively by histological and molecular methods. In one approach, survival and implantation can be evaluated in an appropriate animal model (e.g., NOD scid γ mouse model as discussed in the examples herein). Using this model, human cells can be injected and survival and engraftment assessed by measuring human specific markers in recipient tissue (e.g., cardiac tissue). In short, measurement of the number of injected cells versus the number of transplants provides a measure of the efficiency of implantation. Measurement of viable transplanted cells in the tissue provides a measure of survival. Viability of the transplanted cells may be determined or measured by any of several methods, including, for example, histology and/or immunohistochemistry for human markers. The identification of cells from transplantation is based on the presence of human markers, and the morphology of the cells and/or their organization in the tissue may be indicative of cell viability. As an example, Masson elastic trichrome or Movat five-color histological stains are particularly useful for assessing interstitial fibrosis, myocardial cell necrosis and disorganization (disarray), in addition to the presence of a contractile zone in cardiac tissue. Alternatively, laser capture microdissection and quantification of human DNA sequences (e.g., human ALU repeats) can be used. As an alternative to assessing graft survival, human DNA sequences in homogenized tissue (e.g., heart tissue) may be quantified. For example, cells, e.g., cardiomyocytes, treated with or without a PRPF31 inhibitor can be transplanted into a tissue, e.g., heart tissue, of a plurality of mice. At selected time points after transplantation, tissues from individual mice can be harvested and evaluated for the presence and/or amount of human DNA as a measure of the maintenance or persistence of the transplanted cells.

The term "effective amount" as used herein refers to the amount of the population of differentiated cells in vitro that is treated as described herein required to alleviate at least one or more symptoms of a disease or disorder, including but not limited to injury, disease, or disorder. An "effective amount" relates to a sufficient amount of the composition to provide the desired effect, depending on the cell type administered and the disease or condition addressed, e.g., the amount necessary to treat a subject having an infarct zone following a myocardial infarction, improve implantation of cardiomyocytes, prevent onset of heart failure following cardiac injury, enhance vascularization of grafts, enhance renal function, etc. Thus, the term "therapeutically effective amount" refers to an amount of differentiated cells in vitro or a composition comprising such cells that is treated with an agent that reduces the level or activity of PRPF31, which is sufficient to promote a particular effect when administered to a typical subject (e.g., a subject having or at risk of having a heart disease, etc.). An effective amount as used herein also includes an amount sufficient to prevent or delay the development of disease symptoms, alter the progression of disease symptoms (such as, but not limited to, slowing the progression of disease symptoms), or reverse disease symptoms. It will be understood that for any given situation, an appropriate "effective amount" may be determined by one of ordinary skill in the art using routine experimentation.

In some embodiments, prior to administering the cells according to the methods described herein, a subject is first diagnosed with a disease or disorder affecting a tissue or organ comprising cells of an in vitro differentiated type. In some embodiments, prior to administering the cells, the subject is first diagnosed as being at risk of developing a disease (e.g., heart failure following myocardial injury or renal disease) or condition.

As described above, for use in the various aspects described herein, an effective amount of human cardiomyocytes is at least 1X10⁷At least 2X10⁷At least 3X10⁷At least 4X10⁷At least 5X10⁷At least 6X10⁷At least 7X10⁷At least 8X10⁷At least 9X10⁷At least 1X10⁸At least 2X10⁸At least 3X10⁸At least 4X10⁸At least 5X10⁸At least 6X10⁸At least 7X10⁸At least 8X10⁸At least 9X10⁸At least 1X10⁹At least 2X10⁹At least 3X10⁹At least 4X10⁹At least 5X10⁹At least 6X10⁹At least 7X10⁹At least 8X10⁹At least 9X10⁹At least 1X10⁹At least 1X10¹⁰One or more cells are used for transplantation or implantation. A similar number of other in vitro differentiated cells of mesodermal lineage can be used for transplantation or implantation into different tissues. The effective amount of cells or graft compositions containing them can be estimated initially by using appropriate animal models. As an example, murine, canine, and porcine models of myocardial infarction are known and can be used to measure the amount of cells or graft compositions containing them that are effective for treatment.

In some embodiments, a composition comprising differentiated cells in vitro treated with an agent that reduces the level or activity of PRPF31 allows for at least 20% greater efficiency of implanting the cells into a desired tissue or organ than when such cells are administered without such treatment; in other embodiments, such efficiency is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 100-fold or more of the efficiency of engraftment when the cells are administered without such treatment.

When the cell is an in vitro differentiated cardiomyocyte, an effective amount of the cardiomyocyte is administered to the subject by intracardiac administration or delivery. In this context, "intracardiac" administration or delivery refers to all routes of administration whereby a population of cardiomyocytes is administered in a manner that results in direct contact of these cells with the myocardium of a subject, including, but not limited to, direct cardiac injection, intramyocardial injection, injection within an infarct zone, injection of ischemic or periischemic areas, injection into areas of thinned walls, injection into areas not at risk of accommodating cardiac remodeling, injection or implantation during surgery (e.g., cardiac bypass surgery, during implantation of a cardiac micropump or pacemaker, etc.). In some such embodiments, the cells are injected into the myocardium (e.g., cardiomyocytes), or into the cavities of the atria and/or ventricles. In some embodiments, intracardiac delivery of cells comprises a method of administration whereby cells are administered, e.g., as a cell suspension, via a single injection or multiple "mini" injections into a desired region of a subject's heart undergoing surgery.

The choice of formulation will depend on the particular composition used and the number of treated cells to be administered; such formulations may be adjusted by the skilled practitioner. However, as an example, when the composition comprises cardiomyocytes in a pharmaceutically acceptable carrier, the composition can be a suspension of cells in an effective concentration of cells per mL of solution in an appropriate buffer (e.g., saline buffer). The preparation may also contain cell nutrients, monosaccharides (e.g., for osmotic regulation) or other components that maintain cell viability. Alternatively, as described above, the formulation may comprise a scaffold, for example a biodegradable scaffold as described herein or as known in the art.

In some embodiments, additional agents that facilitate treatment of a subject may be administered before or after treatment with the cells. Such additional agents may be used, for example, to prepare target tissues for cellular administration. Optionally, additional agents may be administered after the cells to support engraftment and growth or integration of the administered cells into the tissue or organ. In some embodiments, the additional agent comprises a growth factor, such as VEGF, PDGF, FGF, aFGF, bFGF, IGF, or Notch signaling compound. Other exemplary agents may be used, for example, to reduce the load on the heart upon cardiomyocyte transplantation (e.g., beta blockers, blood pressure lowering drugs, etc.).

In some embodiments of any aspect, the additional agent is administered at least 1 hour, at least 5 hours, at least 10 hours, at least 15 hours, at least 20 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days before administration of the treated cells. In some embodiments of any aspect, the additional agent is administered simultaneously with or subsequent to the administration of the treated cells.

The efficacy of the treatment can be determined by a skilled clinician. However, if any or all symptoms of a disease, e.g., a heart disease, heart failure, heart injury or disorder, kidney disease or disorder, etc., or other clinically acceptable symptoms or markers, are reduced, e.g., by at least 10%, and include, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, following administration of a transplant composition comprising treated cells as described herein, treatment is considered to be "effective treatment" as that term is used herein. Methods of measuring these indices are known to those skilled in the art and/or described herein.

Where the transplanted cells are cardiomyocytes, the indicators of heart disease or heart condition or heart injury include functional indicators or parameters, e.g., stroke volume, heart rate, left ventricular ejection fraction, heart rate, blood pressure, heart volume, regurgitation, etc., as well as biochemical indicators, such as a decrease in a marker of heart injury, e.g., serum lactate dehydrogenase or serum troponin, etc. As one example, myocardial ischemia and reperfusion are associated with reduced cardiac function. A subject that has experienced an ischemic cardiac event and/or has received reperfusion therapy has reduced cardiac function when compared to prior to ischemia and/or reperfusion. Measurements of cardiac function include, for example, ejection fraction and fractional shortening. Ejection fraction is the fraction of blood pumped from the ventricle with each heartbeat. The term "ejection fraction" applies to the right and left ventricles. LVEF refers to Left Ventricular Ejection Fraction (LVEF). The fractional shortening refers to the difference between the end diastole and end systole dimensions divided by the end diastole dimension.

Non-limiting examples of clinical tests that may be used to assess cardiac functional parameters include echocardiography (with or without doppler flow imaging), Electrocardiogram (EKG), exercise stress testing, Holter monitoring, or measurement of natriuretic peptides (e.g., atrial natriuretic peptides).

Where necessary or desired, animal models of injury or disease can be used to measure the effectiveness of a particular composition as described herein. For example, an isolated working rabbit or rat heart model, or a coronary artery ligation model in dogs or pigs may be used. Animal models of cardiac function can be used to monitor infarct zone, coronary perfusion, electrical conduction, left ventricular end diastolic pressure, left ventricular ejection fraction, heart rate, blood pressure, hypertrophy, diastolic relaxation function, cardiac output, heart rate variability, ventricular wall thickness, and the like.

To monitor engraftment or survival of transplanted cells, the cells may be labeled or tagged, for example, by introducing a construct that directs expression of a marker, such as, but not limited to, GFP or other fluorescent protein or epitope tag. When cells expressing such markers are administered to an animal model, functional parameters of any cell can be measured, but it is also possible to remove tissue after administration of the cells and test or determine the expression of the marker, e.g., via fluorescence microscopy or immunohistochemistry. Thus, the persistence or level of expression of a marker can be used to measure the efficacy of a cell treatment described herein in enhancing or promoting cell survival and/or implantation using such animal models.

In addition to treating the cells with an agent that reduces the level or activity of PRPF31, where the cells are cardiomyocytes, other methods or treatments known in the art to promote or enhance survival, engraftment, maturation and/or function of the transplanted cardiomyocytes can be performed prior to, concurrently with, or in parallel with, or after administration of the treated cells. See, e.g., WO2018/170280, which describes, inter alia, in vitro differentiation and co-transplantation of epicardial cells with in vitro differentiated cardiomyocytes. Such treatments have also been found to promote cardiomyocyte implantation and enhance cardiac function after transplantation. WO2018/170280 is incorporated herein by reference in its entirety, but with particular attention to the methods described therein for cardiomyocyte transplantation, markers and measurements of cardiomyocyte maturation, co-transplantation with epicardial cells, measurement of graft implantation, survival and/or function, and measurement of the efficacy of such transplantation.

In other embodiments, the transplant compositions described herein can be used to treat disease or improve survival, for example, to reduce the incidence of onset, severity of cardiovascular disease. The efficacy of a therapeutic treatment can be assessed for the presence of disease symptoms by functional output (e.g., measuring cardiac output or renal function), markers, levels or expression (e.g., serum levels of myocardial enzyme, markers of ischemia, renal function or insufficiency), and/or electrographic means (e.g., electrocardiogram). Furthermore, as will be understood by those skilled in the art, the ability to modify the transplant compositions described herein may allow them to tailor the treatment based on the particular symptom set of the subject and/or severity of the disease, and further minimize side effects or toxicity.

Some embodiments of the compositions and methods described herein may be defined according to any one of the following numbered paragraphs:

1. a composition comprising a human cell differentiated in vitro from a stem cell and an agent that reduces the level or activity of pre-mRNA processing factor 31(PRPF 31).

2. The composition of paragraph 1, wherein said cells differentiated in vitro from stem cells are cardiomyocytes.

3. The composition of any of paragraphs 1-2, wherein the cells differentiated in vitro from stem cells are cells of mesodermal lineage.

4. The composition of any of paragraphs 1-3, wherein the in vitro differentiated cells are a cell type selected from the group consisting of: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

5. The composition of any of paragraphs 1-4, wherein the in vitro differentiated human cells are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

6. The composition of any of paragraphs 1-5, wherein the stem cells are derived from a healthy subject.

7. The composition of any of paragraphs 1-6, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

8. The composition of any of paragraphs 1-7, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

9. The composition of paragraph 7 wherein said vector is selected from the group consisting of plasmids and viral vectors.

10. The composition of paragraph 8, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

11. A transplant composition for transplantation into a recipient, the composition comprising in vitro differentiated human myocardial cells that have been contacted with an agent that reduces the level or activity of PRPF31 and a pharmaceutically acceptable carrier.

12. The graft composition of paragraph 11, wherein the agent is selected from a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

13. The graft composition of any of paragraphs 11-12, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

14. The transplant composition of paragraph 12 wherein the vector is selected from the group consisting of a plasmid and a viral vector.

15. The transplant composition of paragraph 13 wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID No. 1.

16. The graft composition of any of paragraphs 11-15, wherein the in vitro differentiated human cardiomyocytes are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

17. The transplant composition of any one of paragraphs 11-16 wherein the cardiomyocytes are differentiated from ipscs derived from the transplant recipient.

18. A method of transplanting in vitro differentiated human cardiomyocytes, the method comprising transplanting in vitro differentiated human cardiomyocytes, which have been contacted with an agent that reduces the level or activity of PRPF31, into cardiac tissue of a subject.

19. The method of paragraph 18, wherein the contacted cardiomyocytes survive to a greater extent following transplantation than cardiomyocytes not contacted with the agent.

20. The method of any of paragraphs 18-19, wherein the subject has a myocardial infarction.

21. The method of any of paragraphs 18-20, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

22. The method of any of paragraphs 18-20, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

23. The method of paragraph 21 wherein said vector is selected from the group consisting of a plasmid and a viral vector.

24. The method of paragraph 22, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

25. The method of any one of paragraphs 18-24, wherein the human cardiomyocytes are differentiated from induced pluripotent stem cells (ipscs) or from embryonic stem cells.

26. The method of paragraph 25, wherein the iPSC is derived from the subject.

27. The method of paragraph 25, wherein said ipscs are derived from healthy donors.

28. A method of promoting survival and/or engraftment of transplanted in vitro differentiated cardiomyocytes, the method comprising contacting in vitro differentiated cardiomyocytes with an agent that reduces the level or activity of PRPF31, and transplanting the cells into cardiac tissue of a human subject in need thereof.

29. The method of any of paragraphs 28, wherein the subject has a myocardial infarction.

30. The method of any of paragraphs 28-29, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

31. The method of any of paragraphs 28-30, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

32. The method of paragraph 30 wherein said vector is selected from the group consisting of a plasmid and a viral vector.

33. The method of paragraph 31, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

34. A method of promoting survival and/or engraftment of transplanted cells of mesodermal lineage, the method comprising: administering to a subject in need thereof a cell of mesodermal lineage contacted with or treated with an agent that reduces the level or activity of PRPF31 in the subject.

35. The method of paragraph 34, wherein the mesoderm-derived cells are cells of mesoderm lineage differentiated in vitro.

36. The method of paragraph 35, wherein the cells of the mesodermal lineage are differentiated in vitro from iPS cells or embryonic stem cells.

37. The method of any of paragraphs 34-36, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

38. The method of paragraph 37, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

39. The method of paragraph 37 wherein said vector is selected from the group consisting of a plasmid and a viral vector.

40. The method of paragraph 38, wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

41. The method of any of paragraphs 36-40, wherein the iPSC is derived from the subject.

42. The method of any of paragraphs 36-40, wherein the iPSC is derived from a healthy donor.

43. The method of any one of paragraphs 34-42, wherein the transplanted cells of mesodermal lineage are of a cell type selected from: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

44. A transplantation composition for transplantation into a recipient, the composition comprising in vitro differentiated mesodermal lineage cells that have been contacted with or treated with an agent that reduces the level or activity of PRPF31, and a pharmaceutically acceptable carrier.

45. The graft composition of paragraph 44, wherein the agent is selected from a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

46. The graft composition of any one of paragraphs 44-45, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

47. The transplant composition of paragraph 45 wherein the vector is selected from the group consisting of a plasmid and a viral vector.

48. The transplant composition of paragraph 46 wherein the RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

49. The graft composition of any one of paragraphs 44-48, wherein the in vitro differentiated cells of the mesodermal lineage are differentiated from Induced Pluripotent Stem Cells (iPSCs) or from embryonic stem cells.

50. The transplant composition of any one of paragraphs 44 to 49 wherein the cells of the mesodermal lineage are differentiated from iPSCs derived from a transplant recipient.

51. A method of transplanting cells of in vitro differentiated mesodermal lineage, the method comprising transplanting cells of in vitro differentiated mesodermal lineage that have been contacted with or treated with an agent that reduces the level or activity of PRPF31 into a tissue of a subject.

52. The method of paragraph 51, wherein the contacted in vitro differentiated mesodermal lineage cells survive a greater extent following transplantation than in vitro differentiated mesodermal lineage cells not contacted with the agent.

53. The method of any of paragraphs 51-52, wherein the subject has a myocardial infarction.

54. The method of any of paragraphs 51-53, wherein the agent is a small molecule, a polypeptide, a nucleic acid molecule, or a vector comprising a nucleic acid molecule.

55. The method of any of paragraphs 51-54, wherein the agent comprises or encodes a nucleic acid molecule comprising an antisense sequence, aptamer, or RNA interference molecule (RNAi) targeting PRPF31 or an RNA transcript thereof.

56. The method of any one of paragraphs 54, wherein said vector is selected from the group consisting of a plasmid and a viral vector.

57. The method of paragraph 55 wherein said RNAi molecule comprises the nucleic acid sequence of SEQ ID NO 1.

58. The method of any one of paragraphs 51-57, wherein the cells of the mesodermal lineage are differentiated from Induced Pluripotent Stem Cells (iPSCs) or from embryonic stem cells.

59. The method of paragraph 58, wherein said iPSC is derived from said subject.

60. The method of paragraph 58, wherein said iPSC is derived from a healthy donor.

61. The method of any one of paragraphs 51-60, wherein the transplanted cells of mesodermal lineage are of a cell type selected from the group consisting of: cardiac muscle cells, skeletal muscle cells, smooth muscle cells, kidney cells, endothelial cells, skin cells, adrenal cortex cells, bone cells, leukocytes, and microglia.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

It is to be understood that this disclosure is not limited to the particular methodology, protocols, reagents, etc. described herein, and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present disclosure, which is defined only by the claims.

All patents and other publications identified herein are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present disclosure. These publications were provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure or for any other reason. All statements as to the date or representation of the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

Examples

Example 1: improving survival of transplanted stem cell-derived cardiomyocytes by PRPF31 gene expression knockdown

Background

LaMacchia et al (2015) describe the effect of knocking down a panel of genes on c. The candidate gene list was selected for testing its knockdown effect in human pluripotent stem cell-derived cardiomyocytes (hPSC-CM). 6 candidate genes were selected based on the following criteria. First, they show a robust effect in the caenorhabditis elegans model. Second, the human homolog shows high sequence identity to the caenorhabditis elegans gene. Table 1 below includes six candidate genes selected for analysis.

Table 1: candidate gene

Gene knock-down

Gene knockdown was performed in hPSC-CM derived from the RUES2 embryonic stem cell line. For each gene of interest, hPSC-CM was transfected with 5nM siRNA using liposomal rnaimax (thermo fisher) incubation for 48 hours. Controls were untreated or transfected with negative control scrambled siRNA. Knockdown efficiency was confirmed by quantitative rtPCR. The resulting cells were cryopreserved for transplantation (fig. 1).

Transplantation

For transplantation, male NOD scid γ (NSG) mice underwent myocardial infarction by permanent occlusion of the left anterior descending branch. 2.5X 10 in 10. mu.L RPMI Medium immediately after occlusion⁵Individual cells were injected into the left ventricular wall at the site of infarction. Three days after injection, mice were sacrificed and hearts were collected and snap frozen in liquid nitrogen for subsequent analysis.

Tissue analysis

DNA was isolated from heart Tissue using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer's instructions. The presence of human ALU sequences in the resulting DNA samples was determined by quantitative PCR using SYBR MasterMix (Applied Biosystems) and CFX Connect PCR instrument (BioRad). Human ALU element primers were GTC AGG AGA TCG AGA CCA TCC C (forward) and TCC TGC CTC AGC CTC CCA AG (reverse), as described by Robey et al (2008). 1-100,000pg of human DNA incorporated into 100ng of native mouse cardiac DNA was used to generate a standard curve in each assay.

Results

Increased survival of hPSC-CM with PRPF31 knockdown compared to untreated and control siRNA treated hPSC-CM (p 0.008 and p 0.007, respectively; unpaired t-test) (fig. 2).

Summary of the results

Note that while each of the six different genes showed robust survival enhancement after knockout in c.elegans, only one, PRPF31, provided the benefit of survival of transplanted cardiomyocytes in a mouse model. Based on these results, down-regulation of PRPF31 expression can improve engraftment/survival of transplanted mammalian cells, such as in vitro differentiated hPSC-CM.

Reference to the literature

LaMacchia JC,Frazier HN,III,Roth MB(2015)Glycogen fuels survival during hyposmotic-anoxic stress in Caenorhabditis elegans.Genetics 201:65-74.

Robey TE,Saiget MK,Reinecke H,Murry CE(2008)Systems approaches to preventing transplanted cell death in cardiac repair.J Mol Cell Cardiol 45(4):567-581.

Sequence of

siRNA sequence of SEQ ID NO. 1

CGGGAUAAGUACUCAAAGATT

Alternatively, the TT overhang at the 3' end of SEQ ID NO:1 may be replaced by UU (SEQ ID NO: 3).

2siRNA antisense strand of SEQ ID NO

UCUUUGAGUACUUAUCCCGGA

SEQ ID NO 4-Homo sapiens (Homo sapiens) precursor mRNA processing factor 31(PRPF31), mRNA NCBI reference sequence NM-015629.4

5-U4/U6 Small ribonucleoprotein Prp31[ homo sapiens ] SEQ ID NO

NCBI reference sequence XP _006723200.1

Sequence listing

<110> Washington UNIVERSITY (UNIVERSITY OF WASHINGTON)

<120> knockdown of PRPF31 Gene expression enhances survival of human cells differentiated in vitro

<130> 034186-094370WOPT

<140>

<141>

<150> 62/818,979

<151> 2019-03-15

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> description of Artificial sequences Synthesis of oligonucleotides

<220>

<223> description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1

cgggauaagu acucaaagat t 21

<210> 2

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> description of Artificial sequences Synthesis of oligonucleotides

<400> 2

ucuuugagua cuuaucccgg a 21

<210> 3

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> description of Artificial sequences Synthesis of oligonucleotides

<400> 3

cgggauaagu acucaaagau u 21

<210> 4

<211> 1833

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 4

ggtgagcgac taacgctaga aacagtggtg cgcggagagg agaggcctcg ggatgtctct 60

ggcagatgag ctcttagctg atctcgaaga ggcagcagaa gaggaggaag gaggaagcta 120

tggggaggaa gaagaggagc cagcgatcga ggatgtgcag gaggagacac agctggatct 180

ttccggggat tcagtcaaga ccatcgccaa gctatgggat agtaagatgt ttgctgagat 240

tatgatgaag attgaggagt atatcagcaa gcaagccaaa gcttcagaag tgatgggacc 300

agtggaggcc gcgcctgaat accgcgtcat cgtggatgcc aacaacctga ccgtggagat 360

cgaaaacgag ctgaacatca tccataagtt catccgggat aagtactcaa agagattccc 420

tgaactggag tccttggtcc ccaatgcact ggattacatc cgcacggtca aggagctggg 480

caacagcctg gacaagtgca agaacaatga gaacctgcag cagatcctca ccaatgccac 540

catcatggtc gtcagcgtca ccgcctccac cacccagggg cagcagctgt cggaggagga 600

gctggagcgg ctggaggagg cctgcgacat ggcgctggag ctgaacgcct ccaagcaccg 660

catctacgag tatgtggagt cccggatgtc cttcatcgca cccaacctgt ccatcattat 720

cggggcatcc acggccgcca agatcatggg tgtggccggc ggcctgacca acctctccaa 780

gatgcccgcc tgcaacatca tgctgctcgg ggcccagcgc aagacgctgt cgggcttctc 840

gtctacctca gtgctgcccc acaccggcta catctaccac agtgacatcg tgcagtccct 900

gccaccggat ctgcggcgga aagcggcccg gctggtggcc gccaagtgca cactggcagc 960

ccgtgtggac agtttccacg agagcacaga agggaaggtg ggctacgaac tgaaggatga 1020

gatcgagcgc aaattcgaca agtggcagga gccgccgcct gtgaagcagg tgaagccgct 1080

gcctgcgccc ctggatggac agcggaagaa gcgaggcggc cgcaggtacc gcaagatgaa 1140

ggagcggctg gggctgacgg agatccggaa gcaggccaac cgtatgagct tcggagagat 1200

cgaggaggac gcctaccagg aggacctggg attcagcctg ggccacctgg gcaagtcggg 1260

cagtgggcgt gtgcggcaga cacaggtaaa cgaggccacc aaggccagga tctccaagac 1320

gctgcagcgg accctgcaga agcagagcgt cgtatatggc gggaagtcca ccatccgcga 1380

ccgctcctcg ggcacggcct ccagcgtggc cttcacccca ctccagggcc tggagattgt 1440

gaacccacag gcggcagaga agaaggtggc tgaggccaac cagaagtatt tctccagcat 1500

ggctgagttc ctcaaggtca agggcgagaa gagtggcctt atgtccacct gaatgactgc 1560

gtgtgtccaa ggtggcttcc cactgaaggg acacagaggt ccagtccttc tgaagggcta 1620

ggatcgggtt ctggcaggga gaacctgccc tgccactggc cccattgctg ggactgccca 1680

gggaggaggc cttggaagag tccggcctgg cctcccccag gaccgagatc accgcccagt 1740

atgggctaga gcaggtcttc atcatgcctt gtctttttta actgagaaag gagatttttt 1800

gaaaagagta caattaaaag gacattgtca aga 1833

<210> 5

<211> 499

<212> PRT

<213> Intelligent (Homo sapiens)

<400> 5

Met Ser Leu Ala Asp Glu Leu Leu Ala Asp Leu Glu Glu Ala Ala Glu

1 5 10 15

Glu Glu Glu Gly Gly Ser Tyr Gly Glu Glu Glu Glu Glu Pro Ala Ile

20 25 30

Glu Asp Val Gln Glu Glu Thr Gln Leu Asp Leu Ser Gly Asp Ser Val

35 40 45

Lys Thr Ile Ala Lys Leu Trp Asp Ser Lys Met Phe Ala Glu Ile Met

50 55 60

Met Lys Ile Glu Glu Tyr Ile Ser Lys Gln Ala Lys Ala Ser Glu Val

65 70 75 80

Met Gly Pro Val Glu Ala Ala Pro Glu Tyr Arg Val Ile Val Asp Ala

85 90 95

Asn Asn Leu Thr Val Glu Ile Glu Asn Glu Leu Asn Ile Ile His Lys

100 105 110

Phe Ile Arg Asp Lys Tyr Ser Lys Arg Phe Pro Glu Leu Glu Ser Leu

115 120 125

Val Pro Asn Ala Leu Asp Tyr Ile Arg Thr Val Lys Glu Leu Gly Asn

130 135 140

Ser Leu Asp Lys Cys Lys Asn Asn Glu Asn Leu Gln Gln Ile Leu Thr

145 150 155 160

Asn Ala Thr Ile Met Val Val Ser Val Thr Ala Ser Thr Thr Gln Gly

165 170 175

Gln Gln Leu Ser Glu Glu Glu Leu Glu Arg Leu Glu Glu Ala Cys Asp

180 185 190

Met Ala Leu Glu Leu Asn Ala Ser Lys His Arg Ile Tyr Glu Tyr Val

195 200 205

Glu Ser Arg Met Ser Phe Ile Ala Pro Asn Leu Ser Ile Ile Ile Gly

210 215 220

Ala Ser Thr Ala Ala Lys Ile Met Gly Val Ala Gly Gly Leu Thr Asn

225 230 235 240

Leu Ser Lys Met Pro Ala Cys Asn Ile Met Leu Leu Gly Ala Gln Arg

245 250 255

Lys Thr Leu Ser Gly Phe Ser Ser Thr Ser Val Leu Pro His Thr Gly

260 265 270

Tyr Ile Tyr His Ser Asp Ile Val Gln Ser Leu Pro Pro Asp Leu Arg

275 280 285

Arg Lys Ala Ala Arg Leu Val Ala Ala Lys Cys Thr Leu Ala Ala Arg

290 295 300

Val Asp Ser Phe His Glu Ser Thr Glu Gly Lys Val Gly Tyr Glu Leu

305 310 315 320

Lys Asp Glu Ile Glu Arg Lys Phe Asp Lys Trp Gln Glu Pro Pro Pro

325 330 335

Val Lys Gln Val Lys Pro Leu Pro Ala Pro Leu Asp Gly Gln Arg Lys

340 345 350

Lys Arg Gly Gly Arg Arg Tyr Arg Lys Met Lys Glu Arg Leu Gly Leu

355 360 365

Thr Glu Ile Arg Lys Gln Ala Asn Arg Met Ser Phe Gly Glu Ile Glu

370 375 380

Glu Asp Ala Tyr Gln Glu Asp Leu Gly Phe Ser Leu Gly His Leu Gly

385 390 395 400

Lys Ser Gly Ser Gly Arg Val Arg Gln Thr Gln Val Asn Glu Ala Thr

405 410 415

Lys Ala Arg Ile Ser Lys Thr Leu Gln Arg Thr Leu Gln Lys Gln Ser

420 425 430

Val Val Tyr Gly Gly Lys Ser Thr Ile Arg Asp Arg Ser Ser Gly Thr

435 440 445

Ala Ser Ser Val Ala Phe Thr Pro Leu Gln Gly Leu Glu Ile Val Asn

450 455 460

Pro Gln Ala Ala Glu Lys Lys Val Ala Glu Ala Asn Gln Lys Tyr Phe

465 470 475 480

Ser Ser Met Ala Glu Phe Leu Lys Val Lys Gly Glu Lys Ser Gly Leu

485 490 495

Met Ser Thr

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> description of artificial sequences: synthesis of primers

<400> 6

gtcaggagat cgagaccatc cc 22

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> description of artificial sequences: synthesis of primers

<400> 7

tcctgcctca gcctcccaag 20