Osnop2 protein and application of coding gene thereof in stress tolerance and yield correlation
阅读说明：本技术 Osnop2蛋白及其编码基因关于耐逆性和产量相关的应用 (Osnop2 protein and application of coding gene thereof in stress tolerance and yield correlation ) 是由 谷晓峰 李秀兰 王晓蕾 于 2021-09-14 设计创作，主要内容包括：本发明公开了Osnop2蛋白及其编码基因关于耐逆性和产量相关的应用。本发明保护Osnop2蛋白在调控植物的耐逆性中的应用。本发明还保护抑制Osnop2基因的物质和/或抑制Osnop2蛋白的物质在植物育种的应用,所述育种的目标为如下：培育耐逆性增强的植物。本发明还保护抑制Osnop2基因的物质和/或抑制Osnop2蛋白的物质在植物育种的应用,所述育种的目标为如下：培育产量性状增强的植物。本发明可用于植物性状改良,对于植物育种特别是水稻育种,具有重大的应用推广价值。(The invention discloses an Osnop2 protein and application of a coding gene thereof related to stress tolerance and yield. The invention protects the application of the Osnop2 protein in regulating and controlling the stress tolerance of plants. The invention also protects the application of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding, and the breeding aims are as follows: and (5) cultivating the plants with enhanced stress tolerance. The invention also protects the application of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding, and the breeding aims are as follows: and (5) cultivating plants with enhanced yield traits. The invention can be used for improving plant traits and has great application and popularization values for plant breeding, particularly rice breeding.)
The application of the Osnop2 protein in regulating and controlling the stress tolerance of plants;
the Osnop2 protein is (a1) or (a2) or (a3) or (a4) as follows:
(a1) protein shown as a sequence 1 in a sequence table;
(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);
(a3) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and related to plant stress tolerance;
(a4) a protein derived from rice, having 98% or more identity to (a1) and having stress tolerance to plants.
2. Use of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding with the following objectives: cultivating a plant with enhanced stress tolerance; the Osnop2 protein is the Osnop2 protein of claim 1; the Osnop2 gene is a gene for coding the Osnop2 protein.
3. A plant breeding method for breeding a plant with enhanced stress tolerance, comprising the steps of: carrying out gene editing on an Osnop2 gene in a receptor plant to obtain a gene editing plant; (ii) an increased stress tolerance of the gene-edited plant as compared to the recipient plant; the Osnop2 gene is a gene encoding Osnop2 protein, and the Osnop2 protein is Osnop2 protein as claimed in claim 1.
4. The use according to claim 2 or the method according to claim 3, characterized in that:
the Osnop2 gene is (b1) or (b2) or (b3) or (b4) as follows:
(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;
(b2) DNA molecule shown in sequence 3 in the sequence table;
(b3) a DNA molecule derived from rice and having 95% or more identity to (b1) or (b2) and encoding the protein;
(b4) a DNA molecule which hybridizes with the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.
5. A method of making a plant with enhanced stress tolerance comprising the steps of: replacing "TCGGACGACGCCTCCTTTG" in the Osnop2 gene in the plant genome DNA with "TCGGACGACGCCTCCTTG" or "TCGGACGACGCCTCCTTTTGG" to obtain a plant with enhanced stress tolerance; the Osnop2 gene is a gene encoding Osnop2 protein, and the Osnop2 protein is Osnop2 protein as claimed in claim 1.
Application of Osnop2 protein in regulation and control of plant yield traits;
the Osnop2 protein is (a1) or (a2) or (a3) or (a4) as follows:
(a1) protein shown as a sequence 1 in a sequence table;
(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);
(a3) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and related to plant yield traits;
(a4) a protein derived from rice, having 98% or more identity to (a1) and being involved in plant yield traits.
7. Use of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding with the following objectives: cultivating plants with enhanced yield traits; the Osnop2 protein is the Osnop2 protein of claim 1; the Osnop2 gene is a gene for coding the Osnop2 protein.
8. A plant breeding method for breeding plants with enhanced yield traits, comprising the steps of: carrying out gene editing on an Osnop2 gene in a receptor plant to obtain a gene editing plant; the gene-edited plant has enhanced yield traits compared to the recipient plant; the Osnop2 gene is a gene encoding the Osnop2 protein, and the Osnop2 protein is the Osnop2 protein of claim 1.
9. The use according to claim 7 or the method according to claim 8, characterized by:
the Osnop2 gene is (b1) or (b2) or (b3) or (b4) as follows:
(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;
(b2) DNA molecule shown in sequence 3 in the sequence table;
(b3) a DNA molecule derived from rice and having 95% or more identity to (b1) or (b2) and encoding the protein;
(b4) a DNA molecule which hybridizes with the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.
10. A method for making a plant with enhanced yield traits comprising the steps of: replacing 'TCGGACGACGCCTCCTTTG' in the Osnop2 gene in plant genome DNA by 'TCGGACGACGCCTCCTTG' or 'TCGGACGACGCCTCCTTTTGG' to obtain a plant with enhanced yield traits; the Osnop2 gene is a gene encoding Osnop2 protein, and the Osnop2 protein is Osnop2 protein as claimed in claim 1.
Technical Field
The invention belongs to the technical field of biology, and relates to an Osnop2 protein and application of a coding gene thereof related to stress tolerance and yield.
Background
Rice is native to china and india. Is one of the main grain crops in the world. The rice seeding surface of China accounts for 1/4 of food crops all over the country, and the yield accounts for more than half. The cultivation history is 14000-18000 years. Is an important grain crop; besides the edible caryopsis, the rice bran can be used for preparing starch, brewing wine and vinegar, and the rice bran can be used for preparing sugar, extracting oil and extracting furfural for industrial and medical use; the rice straw is good feed, paper making raw material and weaving material, and the rice sprout and rice root can be used for medicine.
In recent years, the rapid development of biotechnology has greatly promoted the innovation of plant breeding research means and the continuous improvement of research level, and the breeding of plant by biotechnology for resisting diseases and insects and resisting herbicides has already entered the practical stage. The exogenous insecticidal and herbicide-resistant genes are introduced into the plant genome by a biotechnology means, so that the natural barrier that plant species and even species are difficult to hybridize is broken, and the transfer of the insect-resistant and herbicide-resistant genes is realized, so that the plant can rapidly and directionally obtain insect resistance and mechanized weeding, and the original good agronomic characters can be reserved. Because each plant of the transgenic corn has a certain degree of resistance, the insect-resistant and herbicide-resistant effects of the transgenic corn are better and more stable than the control effects of artificial control, and the transgenic corn can also save the investment of manpower and material resources and effectively save social resources. The development and application of other agronomic character improved transgenic plants are not as ideal as insect-resistant and herbicide-resistant characters, mainly because of the lack of excellent character improved genes, most agronomic characters are mainly caused by the control of a plurality of micro-effective genes, and no ideal genes are operated all the time.
Disclosure of Invention
The invention aims to provide an Osnop2 protein and an application of a coding gene thereof related to stress tolerance and yield.
The invention protects the application of the Osnop2 protein in regulating and controlling the stress tolerance of plants.
The regulation is negative regulation, namely the content of the Osnop2 protein is increased, and the stress tolerance of the plant is reduced.
The regulation is negative regulation, namely the content of the Osnop2 protein is reduced, and the stress tolerance of the plant is enhanced.
The invention also protects the application of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding, and the breeding aims are as follows: and (5) cultivating the plants with enhanced stress tolerance.
The invention also provides a plant breeding method for cultivating the plant with enhanced stress tolerance, which comprises the following steps: carrying out gene editing on an Osnop2 gene in a receptor plant to obtain a gene editing plant; the stress tolerance of the gene-edited plant is enhanced as compared to the recipient plant.
The invention also protects the application of the Osnop2 protein in regulation and control of plant yield traits.
The regulation is negative regulation, namely the content of the Osnop2 protein is increased, and the yield traits of the plant are reduced.
The regulation is negative regulation, namely the Osnop2 protein content is reduced, and the yield traits of the plant are enhanced.
The invention also protects the application of a substance inhibiting the Osnop2 gene and/or a substance inhibiting the Osnop2 protein in plant breeding, and the breeding aims are as follows: and (5) cultivating plants with enhanced yield traits.
The invention also provides a plant breeding method for cultivating plants with enhanced yield traits, which comprises the following steps: carrying out gene editing on an Osnop2 gene in a receptor plant to obtain a gene editing plant; the gene-edited plant has enhanced yield traits compared to the recipient plant.
The Osnop2 gene is used for inhibiting the activity of the Osnop2 gene and/or reducing the abundance of the Osnop2 gene. Reducing the abundance of the Osnop2 gene can be achieved by rendering RNA non-transcribable. The reduction of the abundance of the Osnop2 gene can be achieved by gene editing. The gene editing may specifically be a Cas9 system based gene editing. In the Cas9 system, the target sequence binding region in sgRNA is shown as sequence 7 in the sequence table. In the Cas9 system, sgRNA is shown as sequence 6 in the sequence table. The gene editing is realized by introducing a recombinant plasmid SG2027 into a plant.
The Osnop2 protein inhibitor is used for inhibiting the activity of Osnop2 protein and/or reducing the abundance of Osnop2 protein. The reduction in the abundance of the Osnop2 protein can be achieved by rendering the Osnop2 protein non-expressible.
Any of the above gene edits may specifically be a Cas9 system-based gene edit. Specifically, the sgRNA and Cas9 protein can be used as a substance for gene editing of the Osnop2 gene. The substance for gene editing of the Osnop2 gene can be specifically a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The substance for gene editing of the Osnop2 gene may specifically be an expression vector having a DNA molecule encoding sgRNA and an expression vector having a DNA molecule encoding Cas9 protein. The substance for gene editing of the Osnop2 gene may specifically be an expression vector having a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The target sequence binding region in the sgRNA is shown as a sequence 7 in a sequence table. The sgRNA is shown as a sequence 6 in a sequence table. The DNA molecule of the sgRNA is shown as a sequence 5 in a sequence table. The substance for gene editing of the Osnop2 gene is specifically recombinant plasmid SG 2027.
The invention also provides a method for preparing a plant with enhanced stress tolerance, which comprises the following steps of replacing 'TCGGACGACGCCTCCTTTG' in an Osnop2 gene in plant genome DNA by 'TCGGACGACGCCTCCTTG' or 'TCGGACGACGCCTCCTTTTGG' to obtain the plant with enhanced stress tolerance.
The substitutions are homozygous, i.e. the same substitution occurs in homologous chromosomes.
The present invention also provides a method for producing a plant having enhanced yield traits, comprising the step of replacing "TCGGACGACGCCTCCTTTG" in the Osnop2 gene in the plant genomic DNA with "TCGGACGACGCCTCCTTG" or "TCGGACGACGCCTCCTTTTGG" to obtain a plant having enhanced yield traits.
The substitutions are homozygous, i.e. the same substitution occurs in homologous chromosomes.
The stress tolerance is stress tolerance to heat stress and/or stress tolerance to salt stress.
The yield trait is enhanced by at least one or any combination of the following indexes: the grain length is increased, the number of secondary branches is increased, the grain number of the grains is increased, the grain weight is increased, the grain length is increased, and the grain width is increased.
Any one of the Osnop2 proteins is (a1) or (a2) or (a3) or (a4) as follows:
(a1) protein shown as a sequence 1 in a sequence table;
(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);
(a3) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and related to plant stress tolerance;
(a4) a protein derived from rice, having 98% or more identity to (a1) and having stress tolerance to plants.
Any one of the above-mentioned Osnop2 genes is a gene encoding Osnop2 protein.
Any one of the Osnop2 genes is (b1) or (b2) or (b3) or (b4) as follows:
(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;
(b2) DNA molecule shown in sequence 3 in the sequence table;
(b3) a DNA molecule derived from rice and having 95% or more identity to (b1) or (b2) and encoding the protein;
(b4) a DNA molecule which hybridizes with the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.
Any of the above Cas9 proteins is a protein encoded by nucleotides 2696-6967 in sequence 4 of the sequence table.
Any one of the recombinant plasmids SG2027 is shown as a sequence 4 in a sequence table.
Any of the above plants is a monocot or a dicot. Any of the above plants is a gramineae plant. Any of the above plants is a plant of the genus oryza. Any of the above plants is rice, for example, Nipponbare.
The invention can be used for improving plant traits and has great application and popularization values for plant breeding, particularly rice breeding.
Drawings
FIG. 1 is a schematic structural diagram of recombinant plasmid SG 2027.
FIG. 2 shows the sequencing results of the mutation sites and their peripheral nucleotides of Osnop2#1 plant and Osnop2#2 plant.
FIG. 3 shows the ear phenotype of different lines of osnop2 and the complementary material.
FIG. 4 shows the spike length statistics for different lines of osnop2 and complementary material.
FIG. 5 shows statistics of the number of first and second branches of different strains of osnop2 and of complementary material.
FIG. 6 is a statistic of grains per spike for different lines of osnop2 and complementary material.
FIG. 7 shows the statistics of the thousand kernel weights of different strains of osnop2 and of the complementary material.
FIG. 8 shows the phenotype of length and width of shelled grains of different strains of osnop2 and the complementary material.
FIG. 9 shows the phenotype of dehulled grain length and grain width of different lines of osnop2 and the complementing material.
FIG. 10 shows statistics of length and width of shelled grains of different strains of osop 2 and complementary materials.
FIG. 11 shows the statistics of dehulled grain length and grain width for different lines of osnop2 and the complementary material.
FIG. 12 is a chart of the heat stress phenotype and statistics of different lines of osnop 2.
FIG. 13 is a statistical chart of salt stress phenotype of osnop2#1 and its complements.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.
Examples of the following,
The Osnop2 protein is shown as a sequence 1 in a sequence table. In the cDNA of Nipponbare, CDS of coding Osnop2 protein is shown as sequence 2 in the sequence table. In the genomic DNA of the rice Nipponbare, the gene coding the Osnop2 protein is shown as a sequence 3 in a sequence table.
Construction of recombinant plasmid
Recombinant plasmid SG2027 was constructed. The structure of recombinant plasmid SG2027 is schematically shown in FIG. 1. Through whole plasmid sequencing, the recombinant plasmid SG2027 is shown as a sequence 4 in a sequence table. In the sequence 4 of the sequence table, the 2696-6967 th nucleotide codes Cas9 protein. In the recombinant plasmid SG2027, the coding region of sgRNA is shown as sequence 5 in the sequence table. Correspondingly, the sgRNA is shown as a sequence 6 in a sequence table, and a target sequence binding region in the sgRNA is shown as a sequence 7 in the sequence table.
Secondly, genetic transformation is carried out and regeneration plants are obtained
The recombinant plasmid SG2027 is introduced into the agrobacterium EHA105 to obtain recombinant agrobacterium. Carrying out genetic transformation on the embryogenic callus of Nipponbare rice by recombinant agrobacterium by adopting an agrobacterium impregnation method, then screening resistant callus (the resistance screening adopts 100mg/L hygromycin), then carrying out differentiation regeneration culture, and then carrying out rooting culture to obtain a regeneration plant.
Thirdly, obtaining the gene editing plant and the descendant plant thereof
And D, identifying the regenerated plant obtained in the step two as follows: taking leaves, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of a primer F1 and a primer R1, and sequencing the PCR amplification product.
F1：5’-GCGGGGAAGAAGGGGAAG-3’；
R1：5’-TAGCTCGCGTGAATGCTACA-3’。
Through the identification, two homozygous mutant plants (homozygous mutants, namely, two chromosome-generated mutations are consistent) are obtained by screening from the regenerated plants obtained in the step two and are named as an Osnop2#1 plant and an Osnop2#2 plant respectively. Through sequencing identification, the Osnop2#1 plant is different from the genomic DNA of rice Nipponbare (expressed by Nip) only in that a nucleotide deletion (causing frame shift mutation and early termination) occurs in the gene coding the Osnop2 protein, and the sequencing results of the mutation site and the peripheral nucleotides are shown in figure 2. Through sequencing identification, the Osnop2#2 plant is different from the genomic DNA of rice Nipponbare (expressed by Nip) only in that two nucleotide insertions (frame shift mutation is caused and termination is advanced) are generated in the gene coding the Osnop2 protein, and the sequencing results of the mutation sites and the peripheral nucleotides are shown in figure 2.
The Osnop2#1 plant is selfed and seeds are harvested, and the seeds are cultivated into plants, namely T1 plants. T1 generation plants are self-crossed and harvested to obtain seeds, namely T2 generation seeds. The Osnop2#1 plant and the selfed progeny thereof are called the Osnop2#1 line.
And selfing the Osnop2#2 plant, harvesting seeds, and culturing the seeds into plants, namely T1 generation plants. T1 generation plants are self-crossed and harvested to obtain seeds, namely T2 generation seeds. The Osnop2#2 plant and the selfed progeny thereof are called the Osnop2#2 line.
Fourthly, obtaining the anaplerotic plant and the progeny plant thereof
1. Construction of recombinant plasmids
The recombinant plasmid is a circular double-stranded DNA molecule and is shown as a sequence 8 in a sequence table. In the sequence 8 of the sequence table, the 807-2296 th nucleotide is a promoter, and the 2297-4378 th nucleotide encodes the Osnop2 protein.
2. And (3) introducing the recombinant plasmid constructed in the step (1) into agrobacterium tumefaciens EHA105 to obtain recombinant agrobacterium tumefaciens. Adopting an agrobacterium impregnation method, carrying out genetic transformation on an embryonic callus of a receptor plant (the receptor plant is a plant grown from T2 generation seeds of Osnop2#1 plant) by recombinant agrobacterium, then screening a resistant callus (the resistance screening adopts 50mg/L hygromycin), then carrying out differentiation regeneration culture, and then carrying out rooting culture to obtain a regenerated plant.
3. And (3) identifying the regenerated plant obtained in the step (2) as follows: taking leaves, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of a primer F2 and a primer R2, and sequencing the PCR amplification product. And screening to obtain the anaplerotic plants according to the identification result. The sequencing result shows that the replenisher plant simultaneously has the sequence of the sequence table2 and a mutant DNA molecule (i.e. the mutant DNA molecule is "TCGGACGACGCCTCCTTG" substituted for "TCGGACGACGCCTCC" in the DNA molecule shown in sequence 2TTTG ″) derived DNA molecule).
F2：5’-GAGTTAGCTCACTCATTAG-3’；
R2：5’-CAACGTGCACAACAGAAT-3’。
4. Selfing the resupply plants obtained in the step 3, harvesting seeds, and culturing the seeds into plants, namely T1 generation plants. T1 generation plants are self-crossed and harvested to obtain seeds, namely T2 generation seeds. The selfed progeny of the replenisher plant is called the Osnop2-CP line.
Fifth, comparing the characters
The test seeds were: nipponbare seeds of rice, T2 generation seeds of Osnop2#1 strain, T2 generation seeds of Osnop2#2 strain, and T2 generation seeds of Osnop2-CP strain.
The test plants were cultured under parallel conditions, specifically: taking seeds, germinating in a greenhouse and culturing seedlings (counting time from white exposure, culturing for 3 weeks) to obtain 3-week seedlings; transplanting the 3-week seedlings to a field of a Hebei corridor and carrying out normal cultivation management.
And (5) observing the spike phenotype in the maturation period, photographing and counting the spike length. The photograph is shown in FIG. 3. Spike length is shown in FIG. 4 (average of 10 plants per line). Compared with the Nipponbare plants of rice, the panicle length of the plants of the Osnop2#1 line and the plants of the Osnop2#2 line are obviously increased, and the increase range is about 5.48-7.34%. Compared with the Nipponbare plants of rice, the spike length of the Osnop2-CP plants is not obviously different. Spike length was significantly reduced in Osnop2-CP plants compared to Osnop2#1 line plants.
And observing and counting the number of the first-stage and second-stage branches in the mature period. The results are shown in FIG. 5 (average of 10 plants per line). Compared with the Nipponbare plants of rice, the secondary branch number of the plants of the Osnop2#1 line and the plants of the Osnop2#2 line is remarkably increased, and the increase range is about 11.08-13.67%. The secondary shoot numbers of the Osnop2-CP plants were significantly reduced compared to the Osnop2#1 line plants.
And observing and counting the number of seeds per spike in the mature period. The results are shown in FIG. 6. Compared with the Nipponbare plants of rice, the number of seeds of the plants of the Osnop2#1 line and the plants of the Osnop2#2 line is obviously increased, and the increase range is about 15.32-17.04%. Compared with the Nipponbare plants of rice, the seed number of the Osnop2-CP plants has no obvious difference. The grain number of Osnop2-CP plants was significantly reduced compared to Osnop2#1 line plants.
And (5) harvesting seeds in the mature period and counting the thousand seed weight. The results are shown in FIG. 7. Compared with the Nipponbare plants of rice, the thousand seed weight of the plants of the Osnop2#1 line and the plants of the Osnop2#2 line are obviously increased by about 8.7-15.88%. Compared with the Nipponbare plants of rice, the thousand seed weight of the Osnop2-CP plants has no obvious difference. Thousand kernel weight of Osnop2-CP plants was significantly reduced compared to Osnop2#1 line plants.
And (4) harvesting seeds in the mature period, and observing and counting the length and width of the seeds with the shells and the length and width of the husked seeds. The results are shown in fig. 8, 9, 10 and 11. Compared with the Nipponbare plants of rice, the length of shelled grains, the width of shelled grains, the length of shelled grains and the width of shelled grains of the Osnop2#1 line and the Osnop2#2 line are obviously increased by about 12.4-16.2%, 22.6-23.2%, 11.4-15.7% and 16.1-17.9% respectively. Compared with the Nipponbare plants of rice, the Osnop2-CP plants have no significant difference in length of shelled grains, width of shelled grains, length of shelled grains and width of shelled grains. Compared with the Osnop2#1 strain, the Osnop2-CP strain has significantly reduced length of shelled grains, width of shelled grains, length of shelled grains and width of shelled grains.
VI Heat stress test
The test seeds were: the seeds of Nipponbare, seeds of T2 generation of Osnop2#1 strain and seeds of T2 generation of Osnop2#2 strain. The test plants were cultured under parallel conditions, specifically: seeds were taken, germinated and grown in the greenhouse to the trefoil stage (time point a, photographed), then transferred to a 45 ℃ incubator for 48 hours (time point B, photographed), then transferred back to the greenhouse and continued for 7 days (time point C, photographed), and then the survival rates were counted (at least 24 plants were counted per test plant). The greenhouse conditions were: at 28 ℃ 10 hours light/14 hours dark.
The photographs of the plants are shown in FIG. 12, with the left corresponding to time point A, the middle corresponding to time point B, and the right corresponding to time point C.
The survival results are shown in figure 12. The survival rate of the Nipponbare plants is about 40 percent, the survival rate of the Osnop2#1 line plants is about 90 percent, and the survival rate of the Osnop2#2 line plants is about 85 percent. Compared with Nipponbare, the heat resistance of the plants of the Osnop2#1 line and the Osnop2#2 line is obviously improved.
Salt stress test
The test seeds were: nipponbare seeds of rice, T2 generation seeds of Osnop2#1 strain, and T2 generation seeds of Osnop2-CP strain. The test plants were cultured under parallel conditions, specifically: seeds were taken, cultivated in a greenhouse using Hoagland nutrient solution to the trefoil stage (time point a, photographed), then cultivated instead using Hoagland nutrient solution containing 150mM NaCl for 6 days (time point B, photographed), then seedlings were washed, then cultivated instead using Hoagland nutrient solution for 7 days (time point C, photographed), and finally the survival rate was counted (at least 24 plants were counted per test plant). The greenhouse conditions were: at 28 ℃ 10 hours light/14 hours dark.
The photographs of the plants are shown in FIG. 13, with the left corresponding to time point A, the middle corresponding to time point B, and the right corresponding to time point C.
The survival results are shown in figure 13. The survival rate of the Nipponbare plants is 0, the survival rate of the Osnop2#1 line plants is about 20%, and the survival rate of the Osnop2-CP line plants is 0. Compared with Nipponbare, the salt tolerance of the Osnop2#1 strain is remarkably improved. The salt tolerance of the Osnop2-CP strain plant is basically consistent with that of Nipponbare.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Sequence listing
<110> institute of biotechnology of Chinese academy of agricultural sciences
<120> Osnop2 protein and application of coding gene thereof in stress tolerance and yield correlation
<130> GNCYX212426
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 693
<212> PRT
<213> Oryza sativa
<400> 1
Met Ala Lys Lys Gly Ala Pro Arg Arg Gln Pro Pro Pro Pro Pro Pro
1 5 10 15
Arg Gln Leu Ala Ala Gly Lys Lys Gly Lys Ala Ser Pro Lys Ala Ala
20 25 30
Lys Arg Ala Ala Pro Lys Lys Gln Arg Leu Leu Glu Ser Ser Ser Asp
35 40 45
Asp Ser Glu Leu Glu Gln Gln Gln Gly Gln Leu Gln Glu Val Glu Ser
50 55 60
Gly Ser Asp Leu Asp Val Pro Ser Asp Ser Gly Ala Glu Glu Leu Ser
65 70 75 80
Asp Ser Asp Asp Ala Ser Phe Glu Gly Gly Asp Ser Gly Asp Glu Glu
85 90 95
Glu Glu Glu Asp Asp Glu Asp Gly Asp Asp Asp Pro Leu Ala Asp Asp
100 105 110
Phe Leu Ala Gly Ser Asp Asp Glu Ser Asp Gly Gly Asp Asp Ser Gly
115 120 125
Val Asp Ser Asp Glu Ser Asp Asp Leu Glu Ala Lys Ser Arg Ala Ile
130 135 140
Asp Glu Glu Lys Glu Lys Ala Glu Glu Glu Ala Glu Glu Glu Leu Lys
145 150 155 160
Leu Asn Ile Arg Ser Glu Ser Asp Glu Phe Arg Leu Pro Thr Lys Glu
165 170 175
Glu Leu Glu Glu Glu Ala Leu Arg Pro Pro Asn Leu Pro Asn Leu Lys
180 185 190
Arg Arg Ile Ser Glu Ile Val Arg Val Leu Ser Asn Phe Ser Lys Leu
195 200 205
Arg Gln Lys Asp Val Pro Arg Lys Asp Tyr Val Asn Gln Leu Lys Thr
210 215 220
Asp Ile Met Ser Tyr Tyr Gly Tyr Asn Asp Phe Leu Val Glu Ala Phe
225 230 235 240
Ile Glu Met Phe Pro Ala Val Glu Leu Val Glu Leu Leu Glu Ser Phe
245 250 255
Glu Lys Arg Pro Pro Glu Cys Leu Arg Thr Asn Thr Leu Lys Thr Arg
260 265 270
Arg Arg Asp Leu Ala Ala Ala Leu Ile Pro Arg Gly Phe Asn Leu Asp
275 280 285
Pro Ile Gly Lys Trp Ser Lys Val Gly Leu Val Val Tyr Asp Ser Thr
290 295 300
Ile Ser Ala Gly Ala Thr Val Glu Tyr Met Ala Gly His Tyr Met Lys
305 310 315 320
Gln Gly Ala Ser Ser Phe Leu Pro Val Met Ala Leu Ala Pro Gln Glu
325 330 335
Lys Glu Arg Ile Val Asp Met Ala Ala Ala Pro Gly Gly Lys Thr Thr
340 345 350
Tyr Ile Gly Ala Leu Met Lys Asn Thr Gly Ile Ile Tyr Ala Asn Glu
355 360 365
Phe Asn Glu Lys Arg Leu His Gly Leu Leu Gly Asn Ile His Arg Met
370 375 380
Gly Val Thr Asn Thr Ile Val Cys Asn Tyr Asp Gly Lys Glu Leu Pro
385 390 395 400
Lys Val Leu Gly Met Asn Ser Val Asp Arg Val Leu Leu Asp Ala Pro
405 410 415
Cys Thr Gly Thr Gly Thr Ile Trp Lys Asp Pro Gln Ile Lys Thr Ser
420 425 430
Lys Gly Ile Glu Asp Ile Arg Asp Cys Ala Phe Val Gln Lys Gln Leu
435 440 445
Leu Leu Ala Ala Ile Asp Leu Val Asp Ala Asn Ser Lys Thr Gly Gly
450 455 460
Tyr Ile Val Tyr Ser Thr Cys Ser Leu Met Ile Pro Glu Asn Glu Ala
465 470 475 480
Val Val Asp Tyr Ala Leu Lys Lys Arg Asn Val Lys Leu Val Pro Cys
485 490 495
Gly Leu Asp Phe Gly Arg Pro Gly Phe Ile Arg Phe Arg Glu His Arg
500 505 510
Phe His Thr Ser Leu Asp Lys Thr Arg Arg Phe Tyr Pro His Val Asn
515 520 525
Asn Met Asp Gly Phe Phe Val Ala Lys Leu Lys Lys Leu Ser Asn Thr
530 535 540
Ile Pro Val Ala Ser Glu Ser Ser Asn Val Pro Glu Glu Ala Ile Glu
545 550 555 560
Lys Ala Asp Pro Ser Ser Asp Asp Pro Gln Lys Gln Pro Ile Gln Ser
565 570 575
Lys Lys His Lys Asp Val Lys Thr Thr Asn Glu Glu Thr Ser Ile Leu
580 585 590
Asp Gly Val Thr Lys Asp Lys Arg Gln Thr His Glu Thr Leu Lys Asn
595 600 605
His Lys Lys Gly Lys Lys Arg Asn Gly Pro Glu Ser Thr Lys Ile Lys
610 615 620
Gly Asp Gln Lys Glu Thr His Asn Glu Glu Glu Pro Thr Ser Glu Lys
625 630 635 640
Lys Gln Pro Val Ser Ala Lys Ile Lys Lys Ser Val Pro Lys Arg Ile
645 650 655
Ser Gly Asn Lys Gly Lys Lys Leu Asp Thr Gly Lys Gly Glu Lys Arg
660 665 670
Lys Arg Asn Trp Met Val Arg Arg Asp Trp Glu Ala Tyr Lys Lys Ser
675 680 685
Arg Ser Lys Gln Val
690
<210> 2
<211> 2082
<212> DNA
<213> Oryza sativa
<400> 2
atggcgaaga agggcgcgcc gcgcaggcag ccgccgccgc cgccgcctcg gcaactggcc 60
gcggggaaga aggggaaggc ctccccgaag gcggcgaaga gggcggcgcc caagaagcag 120
aggctgctcg agtcgtcctc cgacgactcc gagctggagc agcagcaggg gcagcttcag 180
gaggtggagt ccgggtcaga cctcgacgtc ccctctgatt ccggcgccga ggagctctcc 240
gactcggacg acgcctcctt tgagggagga gacagcggcg acgaggagga ggaggaagac 300
gatgaggatg gcgacgacga ccccctcgct gacgacttcc tcgccggcag tgacgacgaa 360
agtgacggag gagacgactc tggtgtggac tcagatgagt ctgatgactt agaggcgaag 420
tcgcgagcga ttgatgaaga gaaagagaag gcagaagaag aggctgagga ggagctcaag 480
ctcaatatta gatcagaatc tgatgagttc cgattgccca caaaggagga gttggaggaa 540
gaggcacttc gaccaccaaa cctgccgaat cttaaaagga ggatatcaga aattgtccgg 600
gtactctcaa actttagtaa gctgaggcaa aaagatgtgc cgcgaaagga ttatgtcaat 660
cagctgaaga cagatataat gtcatactat ggatacaatg attttctcgt tgaagcattt 720
attgagatgt tcccagctgt ggagcttgtt gaactactgg aatcttttga gaaaagaccg 780
cctgaatgct tacgaacaaa tacattgaag acccggagaa gggatcttgc tgctgctctt 840
ataccaagag gatttaatct ggatccgata gggaagtggt caaaggtagg ccttgttgta 900
tacgactcca ccatttcagc tggtgccact gttgaatata tggctgggca ttacatgaaa 960
caaggtgcaa gttctttctt acctgtgatg gctcttgctc ctcaggagaa agagcgaatt 1020
gttgatatgg cggctgcccc aggtggcaag actacatata ttggagctct tatgaagaat 1080
actggaataa tttatgcaaa tgagttcaat gagaaaaggc tgcatggact tttgggcaac 1140
atacatcgca tgggtgttac caataccata gtttgtaatt atgatggtaa agagctacct 1200
aaagttcttg ggatgaattc ggttgacaga gttcttttgg atgcaccctg cacaggcaca 1260
gggaccattt ggaaggatcc acaaattaaa acgtcgaagg gcattgagga catcagagac 1320
tgtgcttttg tacaaaagca attgctatta gctgctattg atttggttga tgccaactcc 1380
aaaactggag gttacattgt ttactcaaca tgttcattga tgattccaga gaatgaagcg 1440
gttgttgact atgcccttaa aaagagaaac gtaaagcttg taccttgtgg attagatttt 1500
gggcgtccag gattcatccg gttccgagag catcgattcc atacttcttt agataaaaca 1560
aggagatttt atccccatgt aaacaacatg gatggttttt ttgttgcgaa gcttaaaaaa 1620
ttgagcaata cgatcccagt ggcatctgag tcatctaatg tgcctgaaga agcaattgag 1680
aaggctgatc ctagcagtga cgatcctcaa aaacagccca ttcagtcaaa aaaacataaa 1740
gatgtgaaga cgacgaatga agagacaagc atccttgatg gggtgactaa ggacaaaagg 1800
cagacacatg agacactcaa gaaccacaag aagggtaaga aacgcaatgg ccctgagagt 1860
actaaaataa agggagacca gaaagaaaca cacaacgaag aagagcctac aagtgaaaaa 1920
aagcagcctg tgtctgctaa aataaaaaaa tctgttccca agagaatatc aggtaacaaa 1980
ggaaagaagc tggatacggg caaaggagag aagaggaaaa gaaactggat ggtgaggcga 2040
gactgggaag cttataagaa gtcgaggagt aaacaagtat ga 2082
<210> 3
<211> 5395
<212> DNA
<213> Oryza sativa
<400> 3
attaaaacga gcggctcttt cccctctccg ccctctctct ctctctctct ctctctctcc 60
catggcgaag aagggcgcgc cgcgcaggca gccgccgccg ccgccgcctc ggcaactggc 120
cgcggggaag aaggggaagg cctccccgaa ggcggcgaag agggcggcgc ccaagaagca 180
gaggctgctc gagtcgtcct ccgacgactc cgagctggag cagcagcagg ggcagcttca 240
ggaggtggag tccgggtcag acctcgacgt cccctctgat tccggcgccg aggagctctc 300
cgactcggac gacgcctcct ttgagggagg agacagcggc gacgaggagg aggaggaaga 360
cgatgaggat ggcgacgacg accccctcgc tgacgacttc ctcgccggca gtgacgacga 420
aagtggtaat gcacggatta ctattgaatc gaattagctt taacaacgtg cttttcagcc 480
ttttccccat caagtcattc gattgtagca ttcacgcgag ctagtattgt aataatcgat 540
aatgggaatg caatgctgta ttgtacatct aggggaatat ctattgatga ttgtattgtg 600
ttttgtagac ggaggagacg actctggtgt ggactcagat gagtctgatg acttagaggc 660
gaagtcgcga gcgattgatg aagagaaaga gaaggcagaa gaagaggctg aggaggagct 720
caagctcaat attagatcag aatctgatga gttccgattg cccacaaagg aggttgattt 780
ttccaccttc ttttatgtct tcagttttac gtgccgctga aggtccgcaa gtgatgtgca 840
catatatcat agtttgtatg ctctgcagga gttggaggaa gaggcacttc gaccaccaaa 900
cctgccgaat cttaaaagga ggatatcaga aagtgtgttc atatatatat tttgcattac 960
caagtttatg aattttttag atgaatcaga gaaaactcaa ttgagatttg gcataatatt 1020
agtgagctaa caagatgtag ctgttctctt gtgtaaactc caaggcactt cgaccaccaa 1080
acctgccgaa tcttaaaagg aggatatcag aaagtgtgtt catatatata ttttgcatta 1140
tcaagtttat gaatttttta gatgaatcag agaaaactca attgagattt ggcataatat 1200
tagtgagcta acaagatgta gctgttctct tgtgtaaact ccaagggcaa atttaagctt 1260
tataactatg gtcattttgc attgtgatag aagcattgaa tatttccctt tctgactttt 1320
ctttctgccc attggtcttc ccctctagtt gtccgggtac tctcaaactt tagtaagctg 1380
aggcaaaaag atgtgccgcg aaaggattat gtcaatcagc tgaagacaga tataatgtca 1440
tactatggat acaatgattt tctcgttgaa gcatttattg aggtgagctt ggtgccgttt 1500
gtttctttcc attgagctgt gcgtttcccc aactgcatca ggttataatt agaaattatt 1560
gtctgacatg cttattaaaa tatgatcatg gtttacctgc tatgagttaa cagtatacat 1620
atttttactg cgcagatgtt cccagctgtg gagcttgttg aactactgga atcttttgag 1680
aaaagaccgc ctgaatgctt acgaacaaat acattgaagg taactatttc agatctcctg 1740
atatgtatgt atgtggtgcc atggaataca tgattcttta tatgtgcttc agtcttttct 1800
ttgcgttctt catcgtcctt acctgctttg ttcatgatgt tggcagaccc ggagaaggga 1860
tcttgctgct gctcttatac caagaggatt taatctggat ccgataggga agtggtcaaa 1920
ggtatgcttt gttcgatctt ctcctttact caagtaatat atccaacatc ccaaagcaac 1980
tctcctggta taaatggcag gtaggccttg ttgtatacga ctccaccatt tcagctggtg 2040
ccactgttga atatatggct gggcattaca tggtaccttc ttctccgata tcattgtgtg 2100
tagattattt catttgctct ccttccacta atgttggtat taaaaaatgt gactacagaa 2160
acaaggtgca agttctttct tacctgtgat ggctcttgct cctcaggaga aagagcgaat 2220
tgttgatatg gcgtaagatg ttttcctttg tctcatacac ttttggcaat tgttcactat 2280
catgacttct aagttattat gtgatccttt tttttcaatg aacatgtaat tgtaatatgc 2340
catgtatgta atctagtcat gctgtcttga tataccactt tgcttctgaa tttgatgata 2400
cattcaactg aattaattac cttgaattca tggaattcat gtcctcgttt ctgatcagga 2460
actcattctt ttcttgtttc cagggctgcc ccaggtggca agactacata tattggagct 2520
cttatgaaga atactggtca gtatgctgcc tgtttttaaa tacattttgt tcctccattg 2580
gagtaatttt gttttgtgtg gtttcttgcc aattgaaatg caaatatact gttttattca 2640
tttgtcatgc acaggaataa tttatgcaaa tgagttcaat gagaaaaggc tgcatggact 2700
tttgggcaac atacatcgca tgggtgttac caataccata gtttgtaatt atgatggtaa 2760
agaggtgagc aaacagtaca aatattgtta acgtgctatc tgatagccga aacacaatca 2820
actaatttta tgcattaaga aagaatcttg atttgtggta tttgtcaagt acttagtata 2880
atgtaactac agtatattgt tttgtacaaa acgataacag aatgaaaaca cattataagt 2940
attgttacat aatctctgac caataatttt tggtccattt taatcatgga gaagataaat 3000
gtcaagtcct aataattttt ggttgcttga attgggtgca gcattttctc attgaaaacc 3060
tattttgtga taacattctg tttatttcag ctacctaaag ttcttgggat gaattcggtt 3120
gacagagttc ttttggatgc accctgcaca ggcacagggg taagcatcat atagttcgta 3180
taagctccta ctcctgtcat attttctcat ttatttaaac agatgcttac tttttctgca 3240
gaccatttgg aaggatccac aaattaaaac gtcgaagggc attgaggaca tcagagactg 3300
tgcttttgta caaaaggtgc atttcttgta tttctaggtc ttgtttaaat tgaacctact 3360
taccatttgg catattccca cctaacaatt ctaaatgcaa ttcttcttat gttatcgagg 3420
aaaagaactg cattccactc acattattcc aattttgatt cttaaccaag tcacttgctt 3480
aaaacattat tggttcgtcc tcgtgttgag tttgtttttt gggggtcatt tctaagcaat 3540
ttatattgtg cagttgtgct gattcttaca tggaaataac atataacccc agaattgcta 3600
tgttctgttt gctcattttt atggattatg tttacttaat ctgtatttgc taagctatgt 3660
gattgtgttc aatcataatt tggtctttta agctacacaa tttttgtttg gtcagttttt 3720
tctaaatcga gctgttattc tatactggtt gagtacctca atcaccttga aattggtatg 3780
tataccacta tttactgtct aactgatgag ttgttttaca gcaattgcta ttagctgcta 3840
ttgatttggt tgatgccaac tccaaaactg gaggttacat tgtttactca acatgttcat 3900
tgatgattcc agaggtaagt tcattggcct tgccagttca atgatagtca acttagtttc 3960
ttgaacctct ctccattctt gcagaatgaa gcggttgttg actatgccct taaaaagaga 4020
aacgtaaagc ttgtaccttg tggattagat tttgggcgtc cagggtactg taaatctctc 4080
tcccatgacc tgttatgaag aatttctaca tttttatctt attactatcc gtttatccta 4140
cagattcatc cggttccgag agcatcgatt ccatacttct ttagataaaa caaggagatt 4200
ttatccccat gtaaacaaca tggatggttt ttttgttgcg aaggtaacac caatgctaaa 4260
cttcatggtg aaatatctaa tctattaaat aggttgtttg atcaggtgct tatttcatta 4320
ttaggatgtg ctgaatgtat tgaactctat tatgaaaagt ttaattttct ttgcttagtt 4380
tggacatacc atctgattag ggtacttcct ttgacgcagc ttaaaaaatt gagcaatacg 4440
atcccagtgg catctgagtc atctaatgtg cctgaagaag caattgagaa ggctgatcct 4500
agcagtgacg atcctcaaaa acagcccatt cagtcaaaaa aacataaaga tgtgaagacg 4560
acgaatgaag agacaagcat ccttgatggg gtgactaagg acaaaaggca gacacatgag 4620
acactcaaga accacaagaa gggtaagaaa cgcaatggcc ctgagagtac taaaataaag 4680
ggagaccaga aagaaacaca caacgaagaa gagcctacaa gtgaaaaaaa gcagcctgtg 4740
tctgctaaaa taaaaaaatc tgttcccaag agaatatcag gtaacaaagg aaagaagctg 4800
gatacgggca aaggagagaa gaggaaaaga aactggatgg tgaggcgaga ctggtgagat 4860
agtacaatga tgttgtgcct tttcatgcct tggaattgtt gttttcgttg ctttattctg 4920
atttggtgta atgatcttct aacagggaag cttataagaa gtcgaggagt aaacaagtat 4980
gaaaggcacg gatgaaggag ctctagccgt agacaaattg cagttaaatt tgaaaaccca 5040
catacgggga agatgttaga aggagcgaga atacacaatt ttggcgttgg ttcaagttcg 5100
aggcgaagga aaatttttgt tgtacttaag tctagtgaag tgatcgtctg tagttttacc 5160
ctttcttttc cgtcttggtt taatgtacca atactaaggc acttctcgga catgagttat 5220
gggagtatgt gattgacttc gtcatgttgc ctggtaagta ctatgctggc cgatggaaca 5280
gtatgatgtt ctgcttgcta agggcgacgt gtggttgtgc tcagggttag gggcggaaat 5340
cgtgctggct ccgcttttta ttgagctttc tttgaaatta atttaccttc atatt 5395
<210> 4
<211> 15897
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taaacgctct tttctcttag gtttacccgc caatatatcc tgtcaaacac tgatagttta 60
aactgaaggc gggaaacgac aatctgatcc aagctcaagc tgctctagca ttcgccattc 120
aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 180
gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 240
cgacgttgta aaacgacggc cagtgccaag cttggatcat gaaccaacgg cctggctgta 300
tttggtggtt gtgtagggag atggggagaa gaaaagcccg attctcttcg ctgtgatggg 360
ctggatgcat gcgggggagc gggaggccca agtacgtgca cggtgagcgg cccacagggc 420
gagtgtgagc gcgagaggcg ggaggaacag tttagtacca cattgcccag ctaactcgaa 480
cgcgaccaac ttataaaccc gcgcgctgtc gcttgtgttc ggacgacgcc tcctttggtt 540
ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaacttg aaaaagtggc 600
accgagtcgg tgcttttttg ttttagagct agaaatagca agttaaaata aggctagtcc 660
gtagcgcgtg cgccaattct gcagacaaat ggccccgggc ctgcaggtgc agcgtgaccc 720
ggtcgtgccc ctctctagag ataatgagca ttgcatgtct aagttataaa aaattaccac 780
atattttttt tgtcacactt gtttgaagtg cagtttatct atctttatac atatatttaa 840
actttactct acgaataata taatctatag tactacaata atatcagtgt tttagagaat 900
catataaatg aacagttaga catggtctaa aggacaattg agtattttga caacaggact 960
ctacagtttt atctttttag tgtgcatgtg ttctcctttt tttttgcaaa tagcttcacc 1020
tatataatac ttcatccatt ttattagtac atccatttag ggtttagggt taatggtttt 1080
tatagactaa tttttttagt acatctattt tattctattt tagcctctaa attaagaaaa 1140
ctaaaactct attttagttt ttttatttaa taatttagat ataaaataga ataaaataaa 1200
gtgactaaaa attaaacaaa taccctttaa gaaattaaaa aaactaagga aacatttttc 1260
ttgtttcgag tagataatgc cagcctgtta aacgccgtcg acgagtctaa cggacaccaa 1320
ccagcgaacc agcagcgtcg cgtcgggcca agcgaagcag acggcacggc atctctgtcg 1380
ctgcctctgg acccctctcg agagttccgc tccaccgttg gacttgctcc gctgtcggca 1440
tccagaaatt gcgtggcgga gcggcagacg tgagccggca cggcaggcgg cctcctcctc 1500
ctctcacggc acggcagcta cgggggattc ctttcccacc gctccttcgc tttcccttcc 1560
tcgcccgccg taataaatag acaccccctc cacaccctct ttccccaacc tcgtgttgtt 1620
cggagcgcac acacacacaa ccagatctcc cccaaatcca cccgtcggca cctccgcttc 1680
aaggtacgcc gctcgtcctc cccccccccc cctctctacc ttctctagat cggcgttccg 1740
gtccatggtt agggcccggt agttctactt ctgttcatgt ttgtgttaga tccgtgtttg 1800
tgttagatcc gtgctgctag cgttcgtaca cggatgcgac ctgtacgtca gacacgttct 1860
gattgctaac ttgccagtgt ttctctttgg ggaatcctgg gatggctcta gccgttccgc 1920
agacgggatc gatttcatga ttttttttgt ttcgttgcat agggtttggt ttgccctttt 1980
cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc atcttttcat gctttttttt 2040
gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc tagatcggag tagaattctg 2100
tttcaaacta cctggtggat ttattaattt tggatctgta tgtgtgtgcc atacatattc 2160
atagttacga attgaagatg atggatggaa atatcgatct aggataggta tacatgttga 2220
tgcgggtttt actgatgcat atacagagat gctttttgtt cgcttggttg tgatgatgtg 2280
gtgtggttgg gcggtcgttc attcgttcta gatcggagta gaatactgtt tcaaactacc 2340
tggtgtattt attaattttg gaactgtatg tgtgtgtcat acatcttcat agttacgagt 2400
ttaagatgga tggaaatatc gatctaggat aggtatacat gttgatgtgg gttttactga 2460
tgcatataca tgatggcata tgcagcatct attcatatgc tctaaccttg agtacctatc 2520
tattataata aacaagtatg ttttataatt attttgatct tgatatactt ggatgatggc 2580
atatgcagca gctatatgtg gattttttta gccctgcctt catacgctat ttatttgctt 2640
ggtactgttt cttttgtcga tgctcaccct gttgtttggt gttacttctg cagccatgga 2700
ctataaggac cacgacggag actacaagga tcatgatatt gattacaaag acgatgacga 2760
taagatggcc ccaaagaaga agcggaaggt cggtatccac ggagtcccag cagccgacaa 2820
gaagtacagc atcggcctgg acatcggcac caactctgtg ggctgggccg tgatcaccga 2880
cgagtacaag gtgcccagca agaaattcaa ggtgctgggc aacaccgacc ggcacagcat 2940
caagaagaac ctgatcggag ccctgctgtt cgacagcggc gaaacagccg aggccacccg 3000
gctgaagaga accgccagaa gaagatacac cagacggaag aaccggatct gctatctgca 3060
agagatcttc agcaacgaga tggccaaggt ggacgacagc ttcttccaca gactggaaga 3120
gtccttcctg gtggaagagg ataagaagca cgagcggcac cccatcttcg gcaacatcgt 3180
ggacgaggtg gcctaccacg agaagtaccc caccatctac cacctgagaa agaaactggt 3240
ggacagcacc gacaaggccg acctgcggct gatctatctg gccctggccc acatgatcaa 3300
gttccggggc cacttcctga tcgagggcga cctgaacccc gacaacagcg acgtggacaa 3360
gctgttcatc cagctggtgc agacctacaa ccagctgttc gaggaaaacc ccatcaacgc 3420
cagcggcgtg gacgccaagg ccatcctgtc tgccagactg agcaagagca gacggctgga 3480
aaatctgatc gcccagctgc ccggcgagaa gaagaatggc ctgttcggaa acctgattgc 3540
cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc gacctggccg aggatgccaa 3600
actgcagctg agcaaggaca cctacgacga cgacctggac aacctgctgg cccagatcgg 3660
cgaccagtac gccgacctgt ttctggccgc caagaacctg tccgacgcca tcctgctgag 3720
cgacatcctg agagtgaaca ccgagatcac caaggccccc ctgagcgcct ctatgatcaa 3780
gagatacgac gagcaccacc aggacctgac cctgctgaaa gctctcgtgc ggcagcagct 3840
gcctgagaag tacaaagaga ttttcttcga ccagagcaag aacggctacg ccggctacat 3900
tgacggcgga gccagccagg aagagttcta caagttcatc aagcccatcc tggaaaagat 3960
ggacggcacc gaggaactgc tcgtgaagct gaacagagag gacctgctgc ggaagcagcg 4020
gaccttcgac aacggcagca tcccccacca gatccacctg ggagagctgc acgccattct 4080
gcggcggcag gaagattttt acccattcct gaaggacaac cgggaaaaga tcgagaagat 4140
cctgaccttc cgcatcccct actacgtggg ccctctggcc aggggaaaca gcagattcgc 4200
ctggatgacc agaaagagcg aggaaaccat caccccctgg aacttcgagg aagtggtgga 4260
caagggcgct tccgcccaga gcttcatcga gcggatgacc aacttcgata agaacctgcc 4320
caacgagaag gtgctgccca agcacagcct gctgtacgag tacttcaccg tgtataacga 4380
gctgaccaaa gtgaaatacg tgaccgaggg aatgagaaag cccgccttcc tgagcggcga 4440
gcagaaaaag gccatcgtgg acctgctgtt caagaccaac cggaaagtga ccgtgaagca 4500
gctgaaagag gactacttca agaaaatcga gtgcttcgac tccgtggaaa tctccggcgt 4560
ggaagatcgg ttcaacgcct ccctgggcac ataccacgat ctgctgaaaa ttatcaagga 4620
caaggacttc ctggacaatg aggaaaacga ggacattctg gaagatatcg tgctgaccct 4680
gacactgttt gaggacagag agatgatcga ggaacggctg aaaacctatg cccacctgtt 4740
cgacgacaaa gtgatgaagc agctgaagcg gcggagatac accggctggg gcaggctgag 4800
ccggaagctg atcaacggca tccgggacaa gcagtccggc aagacaatcc tggatttcct 4860
gaagtccgac ggcttcgcca acagaaactt catgcagctg atccacgacg acagcctgac 4920
ctttaaagag gacatccaga aagcccaggt gtccggccag ggcgatagcc tgcacgagca 4980
cattgccaat ctggccggca gccccgccat taagaagggc atcctgcaga cagtgaaggt 5040
ggtggacgag ctcgtgaaag tgatgggccg gcacaagccc gagaacatcg tgatcgaaat 5100
ggccagagag aaccagacca cccagaaggg acagaagaac agccgcgaga gaatgaagcg 5160
gatcgaagag ggcatcaaag agctgggcag ccagatcctg aaagaacacc ccgtggaaaa 5220
cacccagctg cagaacgaga agctgtacct gtactacctg cagaatgggc gggatatgta 5280
cgtggaccag gaactggaca tcaaccggct gtccgactac gatgtggacc atatcgtgcc 5340
tcagagcttt ctgaaggacg actccatcga caacaaggtg ctgaccagaa gcgacaagaa 5400
ccggggcaag agcgacaacg tgccctccga agaggtcgtg aagaagatga agaactactg 5460
gcggcagctg ctgaacgcca agctgattac ccagagaaag ttcgacaatc tgaccaaggc 5520
cgagagaggc ggcctgagcg aactggataa ggccggcttc atcaagagac agctggtgga 5580
aacccggcag atcacaaagc acgtggcaca gatcctggac tcccggatga acactaagta 5640
cgacgagaat gacaagctga tccgggaagt gaaagtgatc accctgaagt ccaagctggt 5700
gtccgatttc cggaaggatt tccagtttta caaagtgcgc gagatcaaca actaccacca 5760
cgcccacgac gcctacctga acgccgtcgt gggaaccgcc ctgatcaaaa agtaccctaa 5820
gctggaaagc gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc 5880
caagagcgag caggaaatcg gcaaggctac cgccaagtac ttcttctaca gcaacatcat 5940
gaactttttc aagaccgaga ttaccctggc caacggcgag atccggaagc ggcctctgat 6000
cgagacaaac ggcgaaaccg gggagatcgt gtgggataag ggccgggatt ttgccaccgt 6060
gcggaaagtg ctgagcatgc cccaagtgaa tatcgtgaaa aagaccgagg tgcagacagg 6120
cggcttcagc aaagagtcta tcctgcccaa gaggaacagc gataagctga tcgccagaaa 6180
gaaggactgg gaccctaaga agtacggcgg cttcgacagc cccaccgtgg cctattctgt 6240
gctggtggtg gccaaagtgg aaaagggcaa gtccaagaaa ctgaagagtg tgaaagagct 6300
gctggggatc accatcatgg aaagaagcag cttcgagaag aatcccatcg actttctgga 6360
agccaagggc tacaaagaag tgaaaaagga cctgatcatc aagctgccta agtactccct 6420
gttcgagctg gaaaacggcc ggaagagaat gctggcctct gccggcgaac tgcagaaggg 6480
aaacgaactg gccctgccct ccaaatatgt gaacttcctg tacctggcca gccactatga 6540
gaagctgaag ggctcccccg aggataatga gcagaaacag ctgtttgtgg aacagcacaa 6600
gcactacctg gacgagatca tcgagcagat cagcgagttc tccaagagag tgatcctggc 6660
cgacgctaat ctggacaaag tgctgtccgc ctacaacaag caccgggata agcccatcag 6720
agagcaggcc gagaatatca tccacctgtt taccctgacc aatctgggag cccctgccgc 6780
cttcaagtac tttgacacca ccatcgaccg gaagaggtac accagcacca aagaggtgct 6840
ggacgccacc ctgatccacc agagcatcac cggcctgtac gagacacgga tcgacctgtc 6900
tcagctggga ggcgacaaaa ggccggcggc cacgaaaaag gccggccagg caaaaaagaa 6960
aaagtaagga tcctgattga tcgatagagc tcgaatttcc ccgatcgttc aaacatttgg 7020
caataaagtt tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt 7080
ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga 7140
tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata 7200
tagcgcgcaa actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggaa 7260
ttcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca 7320
caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact 7380
cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct 7440
gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattggct agagcagctt 7500
gccaacatgg tggagcacga cactctcgtc tactccaaga atatcaaaga tacagtctca 7560
gaagaccaaa gggctattga gacttttcaa caaagggtaa tatcgggaaa cctcctcgga 7620
ttccattgcc cagctatctg tcacttcatc aaaaggacag tagaaaagga aggtggcacc 7680
tacaaatgcc atcattgcga taaaggaaag gctatcgttc aagatgcctc tgccgacagt 7740
ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 7800
acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac tctcgtctac 7860
tccaagaata tcaaagatac agtctcagaa gaccaaaggg ctattgagac ttttcaacaa 7920
agggtaatat cgggaaacct cctcggattc cattgcccag ctatctgtca cttcatcaaa 7980
aggacagtag aaaaggaagg tggcacctac aaatgccatc attgcgataa aggaaaggct 8040
atcgttcaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 8100
atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 8160
tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagacct tcctctatat 8220
aaggaagttc atttcatttg gagaggacac gctgaaatca ccagtctctc tctacaaatc 8280
tatctctctc gagctttcgc agatcccggg gggcaatgag atatgaaaaa gcctgaactc 8340
accgcgacgt ctgtcgagaa gtttctgatc gaaaagttcg acagcgtctc cgacctgatg 8400
cagctctcgg agggcgaaga atctcgtgct ttcagcttcg atgtaggagg gcgtggatat 8460
gtcctgcggg taaatagctg cgccgatggt ttctacaaag atcgttatgt ttatcggcac 8520
tttgcatcgg ccgcgctccc gattccggaa gtgcttgaca ttggggagtt tagcgagagc 8580
ctgacctatt gcatctcccg ccgtgcacag ggtgtcacgt tgcaagacct gcctgaaacc 8640
gaactgcccg ctgttctaca accggtcgcg gaggctatgg atgcgatcgc tgcggccgat 8700
cttagccaga cgagcgggtt cggcccattc ggaccgcaag gaatcggtca atacactaca 8760
tggcgtgatt tcatatgcgc gattgctgat ccccatgtgt atcactggca aactgtgatg 8820
gacgacaccg tcagtgcgtc cgtcgcgcag gctctcgatg agctgatgct ttgggccgag 8880
gactgccccg aagtccggca cctcgtgcac gcggatttcg gctccaacaa tgtcctgacg 8940
gacaatggcc gcataacagc ggtcattgac tggagcgagg cgatgttcgg ggattcccaa 9000
tacgaggtcg ccaacatctt cttctggagg ccgtggttgg cttgtatgga gcagcagacg 9060
cgctacttcg agcggaggca tccggagctt gcaggatcgc cacgactccg ggcgtatatg 9120
ctccgcattg gtcttgacca actctatcag agcttggttg acggcaattt cgatgatgca 9180
gcttgggcgc agggtcgatg cgacgcaatc gtccgatccg gagccgggac tgtcgggcgt 9240
acacaaatcg cccgcagaag cgcggccgtc tggaccgatg gctgtgtaga agtactcgcc 9300
gatagtggaa accgacgccc cagcactcgt ccgagggcaa agaaatagag tagatgccga 9360
ccggatctgt cgatcgacaa gctcgagttt ctccataata atgtgtgagt agttcccaga 9420
taagggaatt agggttccta tagggtttcg ctcatgtgtt gagcatataa gaaaccctta 9480
gtatgtattt gtatttgtaa aatacttcta tcaataaaat ttctaattcc taaaaccaaa 9540
atccagtact aaaatccaga tcccccgaat taattcggcg ttaattcagt acattaaaaa 9600
cgtccgcaat gtgttattaa gttgtctaag cgtcaatttg tttacaccac aatatatcct 9660
gccaccagcc agccaacagc tccccgaccg gcagctcggc acaaaatcac cactcgatac 9720
aggcagccca tcagtccggg acggcgtcag cgggagagcc gttgtaaggc ggcagacttt 9780
gctcatgtta ccgatgctat tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg 9840
atgatctcgc ggagggtagc atgttgattg taacgatgac agagcgttgc tgcctgtgat 9900
caccgcggtt tcaaaatcgg ctccgtcgat actatgttat acgccaactt tgaaaacaac 9960
tttgaaaaag ctgttttctg gtatttaagg ttttagaatg caaggaacag tgaattggag 10020
ttcgtcttgt tataattagc ttcttggggt atctttaaat actgtagaaa agaggaagga 10080
aataataaat ggctaaaatg agaatatcac cggaattgaa aaaactgatc gaaaaatacc 10140
gctgcgtaaa agatacggaa ggaatgtctc ctgctaaggt atataagctg gtgggagaaa 10200
atgaaaacct atatttaaaa atgacggaca gccggtataa agggaccacc tatgatgtgg 10260
aacgggaaaa ggacatgatg ctatggctgg aaggaaagct gcctgttcca aaggtcctgc 10320
actttgaacg gcatgatggc tggagcaatc tgctcatgag tgaggccgat ggcgtccttt 10380
gctcggaaga gtatgaagat gaacaaagcc ctgaaaagat tatcgagctg tatgcggagt 10440
gcatcaggct ctttcactcc atcgacatat cggattgtcc ctatacgaat agcttagaca 10500
gccgcttagc cgaattggat tacttactga ataacgatct ggccgatgtg gattgcgaaa 10560
actgggaaga agacactcca tttaaagatc cgcgcgagct gtatgatttt ttaaagacgg 10620
aaaagcccga agaggaactt gtcttttccc acggcgacct gggagacagc aacatctttg 10680
tgaaagatgg caaagtaagt ggctttattg atcttgggag aagcggcagg gcggacaagt 10740
ggtatgacat tgccttctgc gtccggtcga tcagggagga tatcggggaa gaacagtatg 10800
tcgagctatt ttttgactta ctggggatca agcctgattg ggagaaaata aaatattata 10860
ttttactgga tgaattgttt tagtacctag aatgcatgac caaaatccct taacgtgagt 10920
tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 10980
tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 11040
gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 11100
agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 11160
tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 11220
ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 11280
cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 11340
tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg 11400
acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg 11460
gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat 11520
ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt 11580
tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 11640
attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa 11700
cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc 11760
tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt acaatctgct 11820
ctgatgccgc atagttaagc cagtatacac tccgctatcg ctacgtgact gggtcatggc 11880
tgcgccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc 11940
atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc 12000
gtcatcaccg aaacgcgcga ggcagggtgc cttgatgtgg gcgccggcgg tcgagtggcg 12060
acggcgcggc ttgtccgcgc cctggtagat tgcctggccg taggccagcc atttttgagc 12120
ggccagcggc cgcgataggc cgacgcgaag cggcggggcg tagggagcgc agcgaccgaa 12180
gggtaggcgc tttttgcagc tcttcggctg tgcgctggcc agacagttat gcacaggcca 12240
ggcgggtttt aagagtttta ataagtttta aagagtttta ggcggaaaaa tcgccttttt 12300
tctcttttat atcagtcact tacatgtgtg accggttccc aatgtacggc tttgggttcc 12360
caatgtacgg gttccggttc ccaatgtacg gctttgggtt cccaatgtac gtgctatcca 12420
caggaaagag tccttttcga cctttttccc ctgctagggc aatttgccct agcatctgct 12480
ccgtacatta ggaaccggcg gatgcttcgc cctcgatcag gttgcggtag cgcatgacta 12540
ggatcgggcc agcctgcccc gcctcctcct tcaaatcgta ctccggcagg tcatttgacc 12600
cgatcagctt gcgcacggtg aaacagaact tcttgaactc tccggcgctg ccactgcgtt 12660
cgtagatcgt cttgaacaac catctggctt ctgccttgcc tgcggcgcgg cgtgccaggc 12720
ggtagagaaa acggccgatg ccgggatcga tcaaaaagta atcggggtga accgtcagca 12780
cgtccgggtt cttgccttct gtgatctcgc ggtacatcca atcagctagc tcgatctcga 12840
tgtactccgg ccgcccggtt tcgctcttta cgatcttgta gcggctaatc aaggcttcac 12900
cctcggatac cgtcaccagg cggccgttct tggccttctt cgtacgctgc atggcaacgt 12960
gcgtggtgtt taaccgaatg caggtttcta ccaggtcgtc tttctgcttt ccgccatcgg 13020
ctcgccggca gaacttgagt acgtccgcaa cgtgtggacg gaacacgcgg ccgggcttgt 13080
ctcccttccc ttcccggtat cggttcatgg attcggttag atgggaaacc gccatcagta 13140
ccaggtcgta atcccacaca ctggccatgc cggccggccc tgcggaaacc tctacgtgcc 13200
cgtctggaag ctcgtagcgg atcacctcgc cagctcgtcg gtcacgcttc gacagacgga 13260
aaacggccac gtccatgatg ctgcgactat cgcgggtgcc cacgtcatag agcatcggaa 13320
cgaaaaaatc tggttgctcg tcgcccttgg gcggcttcct aatcgacggc gcaccggctg 13380
ccggcggttg ccgggattct ttgcggattc gatcagcggc cgcttgccac gattcaccgg 13440
ggcgtgcttc tgcctcgatg cgttgccgct gggcggcctg cgcggccttc aacttctcca 13500
ccaggtcatc acccagcgcc gcgccgattt gtaccgggcc ggatggtttg cgaccgtcac 13560
gccgattcct cgggcttggg ggttccagtg ccattgcagg gccggcagac aacccagccg 13620
cttacgcctg gccaaccgcc cgttcctcca cacatggggc attccacggc gtcggtgcct 13680
ggttgttctt gattttccat gccgcctcct ttagccgcta aaattcatct actcatttat 13740
tcatttgctc atttactctg gtagctgcgc gatgtattca gatagcagct cggtaatggt 13800
cttgccttgg cgtaccgcgt acatcttcag cttggtgtga tcctccgccg gcaactgaaa 13860
gttgacccgc ttcatggctg gcgtgtctgc caggctggcc aacgttgcag ccttgctgct 13920
gcgtgcgctc ggacggccgg cacttagcgt gtttgtgctt ttgctcattt tctctttacc 13980
tcattaactc aaatgagttt tgatttaatt tcagcggcca gcgcctggac ctcgcgggca 14040
gcgtcgccct cgggttctga ttcaagaacg gttgtgccgg cggcggcagt gcctgggtag 14100
ctcacgcgct gcgtgatacg ggactcaaga atgggcagct cgtacccggc cagcgcctcg 14160
gcaacctcac cgccgatgcg cgtgcctttg atcgcccgcg acacgacaaa ggccgcttgt 14220
agccttccat ccgtgacctc aatgcgctgc ttaaccagct ccaccaggtc ggcggtggcc 14280
catatgtcgt aagggcttgg ctgcaccgga atcagcacga agtcggctgc cttgatcgcg 14340
gacacagcca agtccgccgc ctggggcgct ccgtcgatca ctacgaagtc gcgccggccg 14400
atggccttca cgtcgcggtc aatcgtcggg cggtcgatgc cgacaacggt tagcggttga 14460
tcttcccgca cggccgccca atcgcgggca ctgccctggg gatcggaatc gactaacaga 14520
acatcggccc cggcgagttg cagggcgcgg gctagatggg ttgcgatggt cgtcttgcct 14580
gacccgcctt tctggttaag tacagcgata accttcatgc gttccccttg cgtatttgtt 14640
tatttactca tcgcatcata tacgcagcga ccgcatgacg caagctgttt tactcaaata 14700
cacatcacct ttttagacgg cggcgctcgg tttcttcagc ggccaagctg gccggccagg 14760
ccgccagctt ggcatcagac aaaccggcca ggatttcatg cagccgcacg gttgagacgt 14820
gcgcgggcgg ctcgaacacg tacccggccg cgatcatctc cgcctcgatc tcttcggtaa 14880
tgaaaaacgg ttcgtcctgg ccgtcctggt gcggtttcat gcttgttcct cttggcgttc 14940
attctcggcg gccgccaggg cgtcggcctc ggtcaatgcg tcctcacgga aggcaccgcg 15000
ccgcctggcc tcggtgggcg tcacttcctc gctgcgctca agtgcgcggt acagggtcga 15060
gcgatgcacg ccaagcagtg cagccgcctc tttcacggtg cggccttcct ggtcgatcag 15120
ctcgcgggcg tgcgcgatct gtgccggggt gagggtaggg cgggggccaa acttcacgcc 15180
tcgggccttg gcggcctcgc gcccgctccg ggtgcggtcg atgattaggg aacgctcgaa 15240
ctcggcaatg ccggcgaaca cggtcaacac catgcggccg gccggcgtgg tggtgtcggc 15300
ccacggctct gccaggctac gcaggcccgc gccggcctcc tggatgcgct cggcaatgtc 15360
cagtaggtcg cgggtgctgc gggccaggcg gtctagcctg gtcactgtca caacgtcgcc 15420
agggcgtagg tggtcaagca tcctggccag ctccgggcgg tcgcgcctgg tgccggtgat 15480
cttctcggaa aacagcttgg tgcagccggc cgcgtgcagt tcggcccgtt ggttggtcaa 15540
gtcctggtcg tcggtgctga cgcgggcata gcccagcagg ccagcggcgg cgctcttgtt 15600
catggcgtaa tgtctccggt tctagtcgca agtattctac tttatgcgac taaaacacgc 15660
gacaagaaaa cgccaggaaa agggcagggc ggcagcctgt cgcgtaactt aggacttgtg 15720
cgacatgtcg ttttcagaag acggctgcac tgaacgtcag aagccgactg cactatagca 15780
gcggaggggt tggatcaaag tactttgatc ccgaggggaa ccctgtggtt ggcatgcaca 15840
tacaaatgga cgaacggata aaccttttca cgccctttta aatatccgtt attctaa 15897
<210> 5
<211> 95
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tcggacgacg cctcctttgg ttttagagct agaaatagca agttaaaata aggctagtcc 60
gttatcaact tgaaaaagtg gcaccgagtc ggtgc 95
<210> 6
<211> 95
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ucggacgacg ccuccuuugg uuuuagagcu agaaauagca aguuaaaaua aggcuagucc 60
guuaucaacu ugaaaaagug gcaccgaguc ggugc 95
<210> 7
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ucggacgacg ccuccuuug 19
<210> 8
<211> 5413
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gcatcttgaa cgatagcctt tcctttatcg caatgatggc atttgtaggt gccaccttcc 60
ttttctactg tccttttgat gaagtgacag atagctgggc aatggaatcc gaggaggttt 120
cccgatatta ccctttgttg aaaagtctca atagcccttt ggtcttctga gactgtatct 180
ttgatattct tggagtagac gagagtgtcg tgctccacca tgttcacatc aatccacttg 240
ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc 300
atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt tatcgcaatg 360
atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt gacagatagc 420
tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag tctcaatagc 480
cctttggtct tctgagactg tatctttgat attcttggag tagacgagag tgtcgtgctc 540
caccatgttg gcaagctgct ctagccaata cgcaaaccgc ctctccccgc gcgttggccg 600
attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 660
gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 720
gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 780
atgattacga attcgagctc ggtaccagta gctgataatt ccacattcaa ggtctctcag 840
gttgttatga tgctcaaatg tactctctct ggtttttaat gtttgacgct attgactttt 900
aaacacatgt ttgatatttt ttcttgttca aaagaaatat agaattatca tttattttgt 960
tgttatttgt tacctcataa ctatggcttt tttgtatata tgtatagttt ttaaaataag 1020
acaagtggta aaggtatgtt taaatgccaa caatgtcagc cattaaaaac tgaagggaga 1080
aacgtcctgg ggttttccgg ctagcttcac aaggtggtgg gttagacgac ctgggttcga 1140
agcctcaccc ctcctaatta tttgatatta ggtccttccc taatacttgt gtttttcatt 1200
aaaaactgaa tgagtaacat tttcagcttg ttggagacag agattagcac accacatcat 1260
gtcaactatc aagaagtcct atttatcatg taccatacta ttggttcctg aaaacagttt 1320
ggccatgcat cacttttcag tcatggctgc aacaatcact ccatttctgc aataaaatgc 1380
agcttggaga tcacttctaa ctaacttgct cttgatcgtt gcagcgcaac atcagctctg 1440
tcacacgttg tgctggggca attcaagacc atagtcataa tgctctcagg ttacctgatc 1500
ttcagctcgg atcctggaat caccagcatc tgcggagcca tcgtcgctct cggtggcatg 1560
tccgtctaca cctatctggg tctgaaagag tcgacgacaa ccgggaagaa accgccttta 1620
gcacagaagc ccaaagctgc tggggatggt gagaagcctg gtttggagca tgaggattct 1680
gtatgagctg acgaggatta ttcatcctgg ttggtcgatt gtactataag catacttagg 1740
tgattctcca agagttgtac gccattgctg agtccattgt acatagaaac acttcatgat 1800
tttacccttt tacagttctt aaaaagttca aaaacattgc ctcacaattc tcttcgtttc 1860
ttttttcttg ctgataagtt ccacagttga tgtcacgtaa gatgaagaac atgtcagcat 1920
gtcacatagg ataggaacca cgtaggagga aaccacgctc taaaccattc gggaaggtaa 1980
attggtccgg ttttaataat tgacggagca tctatacccg gttttgtagt tcatgaacat 2040
gaattggact cggcctgcag attgagggag aatatatgaa ccttttgcca tattgttttt 2100
ctaagttgaa acgggggacg cgtgcgaaac tggcccatta tttctttgga tcaatatact 2160
caagttttgg gccggcctgg cccatctagc aagcgaggta gttatagctc tctcgccgag 2220
ggcccgaggc ccagcattaa aacgagcggc tctttcccct ctccgccctc tctctctctc 2280
tctctctctc tctcccatgg cgaagaaggg cgcgccgcgc aggcagccgc cgccgccgcc 2340
gcctcggcaa ctggccgcgg ggaagaaggg gaaggcctcc ccgaaggcgg cgaagagggc 2400
ggcgcccaag aagcagaggc tgctcgagtc gtcctccgac gactccgagc tggagcagca 2460
gcaggggcag cttcaggagg tggagtccgg gtcagacctc gacgtcccct ctgattccgg 2520
cgccgaggag ctctccgact cggacgacgc ctcctttgag ggaggagaca gcggcgacga 2580
ggaggaggag gaagacgatg aggatggcga cgacgacccc ctcgctgacg acttcctcgc 2640
cggcagtgac gacgaaagtg acggaggaga cgactctggt gtggactcag atgagtctga 2700
tgacttagag gcgaagtcgc gagcgattga tgaagagaaa gagaaggcag aagaagaggc 2760
tgaggaggag ctcaagctca atattagatc agaatctgat gagttccgat tgcccacaaa 2820
ggaggagttg gaggaagagg cacttcgacc accaaacctg ccgaatctta aaaggaggat 2880
atcagaaatt gtccgggtac tctcaaactt tagtaagctg aggcaaaaag atgtgccgcg 2940
aaaggattat gtcaatcagc tgaagacaga tataatgtca tactatggat acaatgattt 3000
tctcgttgaa gcatttattg agatgttccc agctgtggag cttgttgaac tactggaatc 3060
ttttgagaaa agaccgcctg aatgcttacg aacaaataca ttgaagaccc ggagaaggga 3120
tcttgctgct gctcttatac caagaggatt taatctggat ccgataggga agtggtcaaa 3180
ggtaggcctt gttgtatacg actccaccat ttcagctggt gccactgttg aatatatggc 3240
tgggcattac atgaaacaag gtgcaagttc tttcttacct gtgatggctc ttgctcctca 3300
ggagaaagag cgaattgttg atatggcggc tgccccaggt ggcaagacta catatattgg 3360
agctcttatg aagaatactg gaataattta tgcaaatgag ttcaatgaga aaaggctgca 3420
tggacttttg ggcaacatac atcgcatggg tgttaccaat accatagttt gtaattatga 3480
tggtaaagag ctacctaaag ttcttgggat gaattcggtt gacagagttc ttttggatgc 3540
accctgcaca ggcacaggga ccatttggaa ggatccacaa attaaaacgt cgaagggcat 3600
tgaggacatc agagactgtg cttttgtaca aaagcaattg ctattagctg ctattgattt 3660
ggttgatgcc aactccaaaa ctggaggtta cattgtttac tcaacatgtt cattgatgat 3720
tccagagaat gaagcggttg ttgactatgc ccttaaaaag agaaacgtaa agcttgtacc 3780
ttgtggatta gattttgggc gtccaggatt catccggttc cgagagcatc gattccatac 3840
ttctttagat aaaacaagga gattttatcc ccatgtaaac aacatggatg gtttttttgt 3900
tgcgaagctt aaaaaattga gcaatacgat cccagtggca tctgagtcat ctaatgtgcc 3960
tgaagaagca attgagaagg ctgatcctag cagtgacgat cctcaaaaac agcccattca 4020
gtcaaaaaaa cataaagatg tgaagacgac gaatgaagag acaagcatcc ttgatggggt 4080
gactaaggac aaaaggcaga cacatgagac actcaagaac cacaagaagg gtaagaaacg 4140
caatggccct gagagtacta aaataaaggg agaccagaaa gaaacacaca acgaagaaga 4200
gcctacaagt gaaaaaaagc agcctgtgtc tgctaaaata aaaaaatctg ttcccaagag 4260
aatatcaggt aacaaaggaa agaagctgga tacgggcaaa ggagagaaga ggaaaagaaa 4320
ctggatggtg aggcgagact gggaagctta taagaagtcg aggagtaaac aagtatgagg 4380
tacccgggga tcctctagag tcgacctgca ggcatgccct gctttaatga gatatgcgag 4440
acgcctatga tcgcatgata tttgctttca attctgttgt gcacgttgta aaaaacctga 4500
gcatgtgtag ctcagatcct taccgccggt ttcggttcat tctaatgaat atatcacccg 4560
ttactatcgt atttttatga ataatattct ccgttcaatt tactgattgt ccaagcttgg 4620
cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 4680
gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 4740
gcccttccca acagttgcgc agcctgaatg gcgaatgcta gagcagcttg agcttggatc 4800
agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata tattggcggg 4860
taaacctaag agaaaagagc gtttattaga ataatcggat atttaaaagg gcgtgaaaag 4920
gtttatccgt tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaaa 4980
gtactttgat ccaacccctc cgctgctata gtgcagtcgg cttctgacgt tcagtgcagc 5040
cgtcttctga aaacgacatg tcgcacaagt cctaagttac gcgacaggct gccgccctgc 5100
cctttttctg ggcgttttct tgtcgcgtgt tttagtcgca taaaagtaga atacttgcga 5160
ctaggaaccg ggagacatta cgccatgaac aagaagcgcg acgctggcct gctggctatg 5220
cccgcgtcag caccgacgaa ccaggacttg aaccacaacg gacgaactgc acgcggcggc 5280
ctgcactaag ctgttttccg aaaaagaatc accgtacaca ggccgaccgc ccgaacctgc 5340
cagaatgctt gaacacctac ccttgcgcac gtggtgaaca atacaagcct agaaccgccc 5400
ctgaccgcgc gag 5413