Method for increasing SMN protein expression based on CRISPR and application thereof

文档序号：30200 发布日期：2021-09-24 浏览：43次中文

阅读说明：本技术 基于crispr增加smn蛋白表达的方法及其应用 (Method for increasing SMN protein expression based on CRISPR and application thereof ) 是由梁德生周妙金胡志青邬玲仟于 2021-06-08 设计创作，主要内容包括：本发明涉及一种基于CRISPR增加SMN蛋白表达的方法,包括：构建特异性编辑TSL2位点的CRISPR基因编辑系统,该系统包括靶向TSL2位点的sgRNA和Cas9蛋白,或者是表达出靶向TSL2位点的特定sgRNA和Cas9蛋白的质粒或病毒载体；后将系统导入细胞内或小鼠体内,对SMN2基因7号外显子上的TSL2位点进行编辑,使其随机产生插入或缺失或插入和缺失,从而使TSL2结构破坏或不稳定,进而增加全长SMN的mRNA与蛋白表达。利用基因编辑技术精确编辑SMN2基因TSL2位点,编辑后的细胞能持续转录、翻译,蛋白增加的阳性克隆率达44％。(The invention relates to a method for increasing SMN protein expression based on CRISPR, which comprises the following steps: constructing a CRISPR gene editing system for specifically editing a TSL2 locus, wherein the system comprises sgRNA and Cas9 proteins targeting a TSL2 locus, or a plasmid or a viral vector for expressing a specific sgRNA and Cas9 proteins targeting a TSL2 locus; and then introducing the system into cells or mice, editing the TSL2 locus on the No. 7 exon of the SMN2 gene to randomly generate insertion or deletion or insertion and deletion, so that the TSL2 structure is damaged or unstable, and the mRNA and protein expression of the full-length SMN is increased. The TSL2 locus of the SMN2 gene is accurately edited by using a gene editing technology, the edited cell can continuously transcribe and translate, and the positive cloning rate of the protein is increased by 44%.)

1. A method of increasing SMN protein expression based on CRISPR, comprising: constructing a CRISPR gene editing system for specifically editing a TSL2 locus, wherein the system comprises sgRNA and Cas9 proteins targeting a TSL2 locus, or a plasmid or a viral vector for expressing a specific sgRNA and Cas9 proteins targeting a TSL2 locus; and then introducing the system into cells or mice, editing the TSL2 locus on the No. 7 exon of the SMN2 gene to randomly generate insertion or deletion or insertion and deletion, so that the TSL2 structure is damaged or unstable, and the mRNA and protein expression of the full-length SMN is increased.

2. The sgRNA is characterized in that the sequence of the sgRNA is shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4.

3. A plasmid capable of expressing a sgRNA targeting the TSL2 site; then, the plasmid is introduced into cells or mice, and the TSL2 site on the No. 7 exon of the SMN2 gene can be edited; preferably, the plasmid is capable of expressing sgrnas comprising a CRISPR/Cas9 PAM sequence within 100bp upstream and downstream of the TSL2 site, i.e., sgrnas comprising a 5 '-NGG-3' or 5 '-NNGRRT-3' sequence.

4. The plasmid of claim 3, wherein the plasmid is capable of expressing sgRNA as set forth in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, or SEQ ID No. 4.

5. The plasmid according to claim 3, wherein the plasmid is selected from the group consisting of the plasmids having the sequence shown in SEQ ID No.28, SEQ ID No.29, SEQ ID No.30 or SEQ ID No. 31.

6. An edited iPSC, characterized by an insertion, deletion or both insertion and deletion in the TSL2 structure.

7. The edited iPSC according to claim 6, wherein insertions, deletions, insertions and deletions occur in the stem portion "attctct" or "AAGGAGT" of the stem-loop structure of TSL 2.

8. The edited iPSC of claim 7, wherein said iPSCs have the sequence: GGTGCTCACATTAAGGAGTAAGTCTGC (SEQ ID NO.26) or GGTGCTCACATTCCTTAAGGAGTAAGTCTGC (SEQ ID NO. 27).

9. A method of constructing an edited iPSC according to any of claims 6 to 8 comprising: constructing a CRISPR gene editing system for specifically editing a TSL2 locus, wherein the system comprises sgRNA and Cas9 proteins targeting a TSL2 locus, or a plasmid or a viral vector for expressing a specific sgRNA and Cas9 proteins targeting a TSL2 locus; and then introducing the system into iPSC, editing the TSL2 site on the SMN2 gene exon 7 to generate insertion, deletion or insertion and deletion, thereby destroying or destabilizing the TSL2 structure and obtaining the edited iPSC.

10. The method of claim 9, wherein the ipscs are further derived neuroepithelial progenitors, motoneuron progenitors, or motoneurons.

11. A committed differentiated cell which is a NEP, MNP or iMNs, derived from committed differentiation of an edited iPSC according to any one of claims 6 to 8.

12. The application of SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA3 shown in SEQ ID No.3, SasgRNA2 shown in SEQ ID No.4 or plasmids shown in SEQ ID No.28-31 in preparing a reagent for relieving or treating spinal muscular atrophy.

13. An expression construct capable of expressing sgRNA, wherein the sgRNA is SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA1 shown in SEQ ID No.3 or SasgRNA2 shown in SEQ ID No. 4; preferably, the expression construct is a viral vector; further preferably, the viral vector is an AAV vector.

14. A kit comprising a sgRNA or expression construct that produces an insertion, a deletion, or both an insertion and a deletion to a TSL2 structure; preferably, the sgRNA that generates the insertion, deletion or both insertion and deletion to the TSL2 structure is SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA1 shown in SEQ ID No.3, SasgRNA2 shown in SEQ ID No.4, a plasmid shown in SEQ ID nos. 28-31 or an expression construct according to claim 13.

15. Use of the kit of claim 14 in the preparation of a medicament for alleviating or treating spinal muscular atrophy.

16. A pharmaceutical composition for alleviating or treating spinal muscular atrophy, comprising an edited iPSC according to any one of claims 6-8, or a committed differentiated cell according to claim 11.

Technical Field

The invention belongs to the field of genetic engineering, and relates to a method for improving the level of an SMN protein by utilizing a CRISPR/Cas9 to precisely delete a regulatory element at the gene level and application thereof.

Background

SMA is a neuromuscular disease with symmetric muscle weakness and muscle atrophy caused by degeneration of anterior motor neurons of spinal cord, is one of the most common autosomal recessive hereditary diseases in infancy, mainly manifested as myasthenia of proximal limbs, decline or loss of body motor function with aggravation of disease, dysphagia and spontaneous respiratory difficulty, and finally death due to paralysis of respiratory muscles. The incidence of SMA in the population is about 1/6000-1/10000. The carrying rate is 1/40-1/50^[1]The carrying rate of people in China is about 1/43^[2]. SMA is generally divided into 5 subtypes according to the severity of the disease and the age of the disease, wherein SMA-I accounts for about 50%, patients have diseases at birth or within 6 months of birth, the general body is severely weak, the infants cannot sit alone, and the infants cannot normally raise the head, often die before 20 months due to paralysis of respiratory muscles^[3]. SMA belongs to a serious lethal and disabling genetic disease, and brings huge burden to families and society of patients.

The pathogenic gene of SMA is SMN1 gene encoding Survival protein (SMN) of Motor Neuron, and the human SMN gene is positioned at 5q11.2-5q13.3^[4]And two highly homologous copies, called SMN1/SMNt near the telomere end and SMN2/SMNc near the centromere, which differ in coding sequence by only 1 base and encode the same protein, with C at exon 6 of the SMN1 gene exon 7 and T at SMN2, resulting in production of SMN2 due to the difference in the basesAlternative splicing occurs, producing only about 10% or so of active SMN protein^[5]. Although the deletion of the SMN2 gene is not pathogenic, clinical statistics show that the copy number of SMN2 is inversely proportional to the severity of the disease^[6]Moreover, almost all patients with SMA contain at least one copy of the SMN2 gene, and thus SMN2 is an ideal therapeutic target for SMA. Elizabeth in 2005 found that the specificity of the "C-terminal" amino acid sequence of the SMN protein was not important, but had to be of a certain length^[7]. The "C-terminus" of SMN1 gene is 16 amino acids encoded by exon 7, the "C-terminus" of SMN2 is 4 amino acids encoded by exon 8 due to exon skipping, SMN2 can read the 1 st stop codon when treated with aminoglycoside (G418), and the "C-terminus" of SMN2 is 9 amino acids encoded by exon 8. Christopher et al found that treatment of fibroblasts from SMA type I patients with G418 resulted in a significant increase in SMN protein levels and a significant improvement in the motility of SMA mice treated with G418^[8]. Constructing a readthrough SMA model mouse, and greatly prolonging the survival time of the mouse^[9]. These studies further demonstrated that the "C-terminal" amino acid sequence of the SMN protein is not specific but must be of a certain length.

Since the weaker 5 'splice site exists on both sides of the No. 7 exon of the human SMN2 gene, the No. 7 exon is skipped during splicing, so that 90% of transcription products delete the No. 7 exon to generate truncated unstable SMN protein, the secondary structure of RNA (TSL 2) exists at the end of the No. 7 exon, and the TSL2 inhibits the splicing activity of the 5' splice site by blocking the combination of U1 snRNP in RNA splicing complex^[10]. Construction of miniSMN plasmid containing exon 6 to exon 8 genomic sequences of SMN2 gene and mutations at different sites of TSL2 transfected HeLa cells, researchers found that point mutations that stabilized TSL2 resulted in significantly reduced transcript levels of miniSMN-mRNA containing exon 7 (which contained only exon sequences of exon 6 to exon 8 of SMN2 gene), whereas point mutations that disrupted the TSL2 structure resulted in increased transcript levels of miniSMN-mRNA containing exon 7^[10,11]Although point mutations may increase miniSMN-mRNA transcription levels, this is trueminiSMN-mRNA cannot be effectively translated into functional SMN protein, and as SMA-affected motor neurons are terminal cells, homologous recombination cannot occur in these terminal cells, precise base mutagenesis cannot be achieved, and SMA treatment is difficult to develop. More importantly, the report is researched by aiming at a plasmid constructed by an exogenous source, related research is not carried out on the TSL2 locus of the SMN2 gene in a genome existing in an organism, and no suitable tool is available for realizing point mutation on the TSL2 locus of the genome at present.

In addition, it was found that small molecule homocarbonyltopsin (PK4C9) could increase the level of full-length SMN mRNA (FL-SMN mRNA) by binding to the GAGTAAG sequence (which is partially repeated with TSL2) to block the formation of TSL2 or alter the conformation of TSL2, and that the SMN protein level in GM03813C was increased by 1.5 fold when the investigator treated the SMA patient fibroblast line GM03813C with PK4C9 at a final concentration of 40. mu.M for 48 hours^[11]. This means that the small molecule must reach a certain drug concentration to function; meanwhile, the target point of the small molecule is only 7 bases, so that the risk of off-target is high; and repeated lifelong administration of the small molecule to maintain increased levels of SMN protein.

Therefore, there is a need to develop safe, effective, cost effective and sustainable methods for increasing SMN protein expression and explore its application in SMA treatment.

Reference documents:

[1]J.Pearn,Classification of spinal muscular atrophies[J].Lancet,1980,1:919-922.

[2]X.Wei,T.Hu,Y.Pu,et al.,Notable Carrier Risks for Individuals Having Two Copies of SMN1 in Spinal Muscular Atrophy Families with 2-copy Alleles:Estimation Based on Chinese Meta-analysis Data[J].Journal of Genetic Counseling,2017,1-7

[3]E.Mercuri,E.Bertini,S.T.Iannaccone,Childhood spinal muscular atrophy:controversies and challenges[J].The Lancet.Neurology,2012,11:443-452.

[4]S.Lefebvre,L.Burglen,S.Reboullet,et al.,Identification and characterization of a spinal muscular atrophy-determining gene[J].Cell,1995,80:155-165.

[5]B.Wirth,An update of the mutation spectrum of the survival motor neuron gene(SMN1)in autosomal recessive spinal muscular atrophy(SMA)[J].Human mutation,2000,15:228-237.

[6]E.Tizzano,Spinal muscular atrophy during human development:where are the early pathogenic findings？[J].Advances in experimental medicine and biology,2009,652:225-235.

[7]M.A.Passini,J.Bu,A.M.Richards,et al.,Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy[J].Science translational medicine,2011,3:72ra18.

[8]C.R.Heier,C.J.DiDonato,Translational readthrough by the aminoglycoside geneticin(G418)modulates SMN stability in vitro and improves motor function in SMA mice in vivo[J].Hum Mol Genet,2009,18:1310-1322.

[9]M.S.Cobb,F.F.Rose,H.Rindt,et al.,Development and characterization of an SMN2-based intermediate mouse model of Spinal Muscular Atrophy[J].Hum Mol Genet,2013,22:1843-1855.

[10]N.N.Singh,R.N.Singh,E.J.Androphy,Modulating role of RNA structure in alternative splicing of a critical exon in the spinal muscular atrophy genes[J].Nucleic Acids Res,2007,35:371-389.

[11]A.Garcia-Lopez,F.Tessaro,H.R.A.Jonker,et al.,Targeting RNA structure in SMN2reverses spinal muscular atrophy molecular phenotypes[J].Nat Commun,2018,9:2032.

[12]Miaojin Zhou,Zhiqing Hu,LiyanQiu,et al.Seamless genetic conversion of SMN2 to SMN1 via CRISPR/Cpf1 and single-stranded oligodeoxynucleotides in spinal muscular atrophy patient-specific iPSCs.Human Gene Therapy,2018,29(11):1252-1263

[13]Jin-Jing L,Xiang L,Cheng T,et al.Disruption of splicing-regulatory elements using CRISPR/Cas9 to rescue spinal muscular atrophy in human iPSCs and mice.National Science Review.2020；7(1):92-101.

disclosure of Invention

The invention aims to provide a gene editing TSL2 site to increase the expression of functional SMN protein, thereby relieving or treating spinal muscular atrophy.

In order to solve the technical problems, the technical scheme of the invention is as follows:

a method of increasing SMN protein expression comprising: constructing a CRISPR gene editing system for specifically editing a TSL2 locus, wherein the system comprises sgRNA and Cas9 proteins targeting a TSL2 locus, or a plasmid or a viral vector for expressing a specific sgRNA and Cas9 proteins targeting a TSL2 locus; and then introducing the system into cells or mice, editing the TSL2 locus on the No. 7 exon of the SMN2 gene to randomly generate insertion or deletion or insertion and deletion, so that the TSL2 structure is damaged or unstable, and the mRNA and protein expression of the full-length SMN is increased.

The system may be introduced into cells or mice by electroporation, lipofection, viral transduction, nanomaterial transfection, or the like, and may be introduced into cells or mice.

Preferably, the method of increasing the expression of a functional SMN protein is a non-therapeutic, non-diagnostic method.

The sequence of sgRNA is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO. 4.

A plasmid capable of expressing a sgRNA targeting the TSL2 site; the plasmid can then be introduced into cells or mice to edit the TSL2 site in exon 7 of the SMN2 gene.

Preferably, the plasmid is capable of expressing sgrnas comprising a CRISPR/Cas9 PAM sequence within 100bp upstream and downstream of the TSL2 site, i.e., sgrnas comprising a 5 '-NGG-3' or 5 '-NNGRRT-3' sequence.

Preferably, the plasmid can express sgRNA shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO. 4.

Preferably, the sequence number of the plasmid is shown as SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30 and SEQ ID NO. 31.

An edited iPSC having an insertion, deletion or both insertion and deletion in the TSL2 structure.

Preferably, insertions, deletions, insertions and deletions occur at the stem portion "attctct" or "AAGGAGT" of the stem-loop structure of TSL2 of the edited iPSC.

Preferably, the sequence of the iPSCs is as follows: GGTGCTCACATTAAGGAGTAAGTCTGC (SEQ ID NO.26) or GGTGCTCACATTCCTTAAGGAGTAAGTCTGC (SEQ ID NO. 27).

The construction method of the edited iPSC comprises the following steps: constructing a CRISPR gene editing system for specifically editing a TSL2 locus, wherein the system comprises sgRNA and Cas9 proteins targeting a TSL2 locus, or a plasmid or a viral vector for expressing a specific sgRNA and Cas9 proteins targeting a TSL2 locus; then, the system is introduced into iPSC, and the TSL2 site on the SMN2 gene exon 7 is edited to generate insertion, deletion or insertion and deletion, so that the TSL2 structure is damaged or unstable.

The iPSC is derived from cells separated from urine of SMA patients and is reprogrammed to form the iPSC.

Preferably, the iPSC may also be neuroepithelial progenitor cells (inenp), motor neuron progenitor cells (innp) or motor neurons (iMNs) derived therefrom.

A committed differentiated cell which is NEP, MNP or iMNs and is obtained by committed differentiation of the edited iPSCs.

In the present invention, any sgRNA that can express a target TSL2 site can be used as one of the options in the present embodiment.

The application of SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA3 shown in SEQ ID No.3, SasgRNA2 shown in SEQ ID No.4 or plasmids shown in SEQ ID No.28-31 in preparing a reagent for relieving or treating spinal muscular atrophy.

A reagent for relieving or treating spinal muscular atrophy contains SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA3 shown in SEQ ID No.3, SasgRNA2 shown in SEQ ID No.4 or plasmids shown in SEQ ID No. 28-31.

An expression construct capable of expressing sgRNA, wherein the sgRNA is SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA1 shown in SEQ ID No.3 or SasgRNA2 shown in SEQ ID No. 4.

Preferably, the expression construct is a viral vector.

Further preferably, the viral vector is an AAV vector.

Further preferably, the viral vector is an AAV9 vector.

A kit comprising a sgRNA or expression construct that produces an insertion, a deletion, or both an insertion and a deletion to a TSL2 structure; preferably, the sgRNA that generates the insertion, deletion or both insertion and deletion to the TSL2 structure is SpsgRNA1 shown in SEQ ID No.1, SpsgRNA2 shown in SEQ ID No.2, SasgRNA1 shown in SEQ ID No.3, SasgRNA2 shown in SEQ ID No.4, a plasmid shown in SEQ ID nos. 28-31 or an expression construct according to claim 13.

The application of the kit in preparing a reagent for relieving or treating spinal muscular atrophy is disclosed.

A pharmaceutical composition for alleviating or treating spinal muscular atrophy, comprising the edited iPSC or a qualitatively differentiated cell obtained by directional differentiation of the edited iPSCs.

The invention is further explained below:

there is currently no international report of increasing functional SMN protein levels by editing the TSL2 site. The introduction of point mutations at the TSL2 site of the constructed miniSMN gene was studied, and it was found that point mutations that stabilized TSL resulted in a significant decrease in the transcriptional level of miniSMN-mRNA containing exon 7, while point mutations that disrupted the TSL2 structure resulted in an increase in the transcriptional level of miniSMN-mRNA containing exon 7, but this miniSMN-mRNA was not efficiently translated into functional SMN protein, and since SMA-affected motor neurons were terminal cells, homologous recombination could not occur in the terminal cells, and point mutagenesis could not be achieved. But the inventors have found that deletions or insertions may occur. In another study, a small molecule drug PK4C9 is combined with 7 base sequences of GAGTAAG AAG of the No. 7 exon of the SMN2 gene (the sequences are partially repeated with TSL2), so that the formation of TSL2 is hindered, and the target point of the small molecule is only 7 bases, so that the small molecule has high possibility of non-specifically acting on other sites of a genome. The researchers treated SMA patient fibroblast line GM03813C with PK4C9 at a final concentration of 40 μ M for 48 hours increased SMN protein levels in GM03813C by 1.5-fold, meaning that the small molecule had to reach a certain drug concentration to function; and repeated administration of the small molecule drug for life is necessary to maintain SMN protein levels.

Therefore, the invention aims at the SMN2 gene TSL2 site existing in the organism to delete or insert, so as to realize the long-term stable increase of the transcript of the full-length SMN, improve the expression of the functional SMN protein and finally realize the gene therapy of the SMA.

The invention specifically edits the TSL2 site by using CRISPR/Cas9, so that the TSL 3526 site generates insertion or deletion or insertion and deletion randomly, thereby the TSL2 structure is damaged or unstable, although the insertion or deletion or insertion and deletion is generated randomly, the expression level of over 91 percent of clone functional SMN protein in the edited clone obtained in our research is obviously increased, and off-target is not detected. And animal experiments show that AAV carries SaCas9 to edit TSL2 locus, so that the motor ability and survival time of the mouse are obviously increased. Therefore, the invention establishes an effective, safe and efficient SMA in situ gene therapy technology.

The invention has the beneficial effects that:

the strategy of precisely editing the TSL2 locus of the SMN2 gene by using a gene editing technology so as to destroy or destabilize the TSL2 structure has the following advantages: (1) the TSL2(ATTCCTTAAATTAAGGAGT) is edited by using CRISPR/Cas9 at the gene level (particularly, the generated mutation occurs in the sequence 'ATTCCTT' or 'AAGGAGT'), and the edited cell can continuously transcribe and translate the functional SMN protein, so that long-term repeated administration is avoided; (2) the positive cloning rate of the FL-SMN mRNA and the SMN protein is increased by 44%, so that the method is an effective and efficient method; (3) the sgRNA used in this study did not detect off-target in the positive clones obtained, and is a safe editing method. In conclusion, the invention is an effective, safe and efficient treatment method.

Drawings

FIG. 1 is a flow chart of an annealing reaction;

fig. 2 shows the sgRNA sequencing identification result;

wherein, a. spsgrna1 sequencing results; spsgrna2 sequencing results; the sequencing result of SasgRNA 1; SasgRNA2 sequencing results; in the figure, sgRNA1 and sgRNA2 are specific recognition sequences, SpsgRNA Scaffold is a sgRNA framework sequence of SpCas9, and SasgRNA Scaffold is a sgRNA framework sequence of SaCas 9;

FIG. 3 shows that T7EI detects the cleavage efficiency of sgRNA to target site

M is Marker (Takara 20bp DNA Ladder); control is group of untransfected sgrnas;

fig. 4 shows positive clone identification and SMN protein expression detection after SpsgRNA1 editing;

A. analyzing the result of single cell cloning after nuclear transfer; B. randomly picked 3 single cell clones were Sanger sequenced after T-a cloning, WT: wild-type SMN2, Δ indicates deletion and x indicates the number of reads sequenced from the T-A clone; rt-qPCR was performed on all single cell clones that underwent editing with FL-SMN mRNA, P <0.01, # P <0.001, # P <0.0001, ns no significan; detecting the expression level of all edited unicellular clone SMN by Western blot, taking the hipSCs as normal human iPSCs as positive control, taking SMA-iPSCs as SMA patient specific iPSCs as negative control, and taking beta-actin as internal reference protein;

FIG. 5 is a sequencing test of potential off-target sites of positive clones

The PCR amplification randomly selected 3 positive clones C4, C5, C20 and 5 potential off-target sites of SMA-iPSCs, and then the Sanger sequencing result.

FIG. 6 is a schematic diagram of iPSCs directed differentiation of iMNs;

FIG. 7 shows the cell morphology and marker detection of iPSCs directionally differentiated iMNs;

wherein the differentiation is the neural epithelial progenitor cells positive to OTX2 and SOX1 on day6, the differentiation is the motor neuron progenitor cells positive to OLIG-2 on day12, the differentiation is the early motor neurons positive to SMI32 and ISL1 on day18, and the differentiation is the mature motor neurons positive to ChAT on day 28.

FIG. 8 shows the transcriptional and protein levels of full-length SMN measured at the iMNs stage

rt-qPCR detects FL-SMN mRNA levels, P < 0.0001; rt-qPCR detects levels of SMN transcripts lacking exon 7 (Δ 7-SMN mRNA) with P <0.01 and P < 0.0001; WB detected the SMN protein level in iMNs stage, and hMNs are iMNs differentiated from normal human iPSCs and used as positive control.

FIG. 9 is a graph of TUNEL detection of motor neuron apoptosis following Camptothecin treatment;

immunofluorescence was used to detect apoptosis of motile neurons on day24 of differentiation treated with Camptothecin/DMSO, which is a solvent for Camptothecin, as a negative control. Red fluorescence indicates TUNEL positive, DAPI stained nuclei;

FIG. 10 is an analysis of the results of in vivo editing of site TSL 2;

A. the movement ability and disease phenotype of an SMA mouse are remarkably improved by myelin injection of AAV9-SasgRNA1, HET is a heterozygous SMA mouse, tSMA is an SMA mouse injected with AAV9-SasgRNA1, and SMA is an SMA mouse injected with AAV 9-SasgRNA-scramble; B. body weight change of an SMA mouse injected with AAV9-SasgRNA1 in myelin, wherein the abscissa is days after birth, the ordinate is the mouse body weight, the detection time is 18 days, HET is a heterozygous SMA mouse, tSMA is an SMA mouse injected with AAV9-SasgRNA1, and SMA is an SMA mouse injected with AAV 9-SasgRNA-scramble; C. SpsgRNA1 was microinjected into mouse zygotes from the SMA model, and sequencing of mouse Sanger from F0 showed editing at the TSL site.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1

(1) sgRNA construction

1.1, designing sgRNA targeting TSL2 site, synthesizing sgRNA1-F/R, and annealing the sgRNA1-F/R and the sgRNA2-F/R, wherein the specific sequence is shown in Table 1:

primer sequences required for use in Table 1

The reaction system of annealing is as follows:

the annealing conditions are shown in the flow chart of FIG. 1.

1.2 purchase from Addgene SpCas9 plasmid (code: 42230) and SaCas9 plasmid (code: 61591), Cas9 plasmid is different, the purpose is to express Cas9 protein, but the size of different Cas9 plasmids is different, the size of AAV virus-loaded plasmid is limited, and Sacas9 is smaller than that of Spcas9, so that SaCas9 is selected when AAV package for in vivo experiments is directly made.

42230 is digested by BbsI, and the digestion system is as follows:

incubate at 37 ℃ for 2-3 hours.

The 61519 plasmid was digested with BsaI as follows:

incubate at 37 ℃ for 2-3 hours.

1.3 the annealing product is connected into the digested 42230 or 61591 vector, and the reaction system is as follows:

incubate at 22 ℃ for 2 hours.

Incubate at 22 ℃ for 2 hours.

The specific steps of the transformation are as follows:

1.3.1 taking out DH5 alpha competence from-80 ℃, and placing on ice for unfreezing for 5 min;

1.3.2 mix gently the above 10. mu.L ligation product with 50. mu.L DH 5. alpha. competence and let stand on ice for 30 min;

1.3.3 simultaneously opening the water bath box, and setting the temperature to be 42 ℃;

1.3.4 placing the mixture in a water bath box for heat shock for 90s, and then standing for 2min on ice;

1.3.5 adding 100 mul of LB solution without antibiotic into a super clean bench, placing on a shaker at 37 ℃, and culturing for 45min at 180 rpm;

1.3.6 coating the liquid on the solid LB plate containing the aminobenzyl resistance in a super clean bench, and culturing overnight at the constant temperature of 37 ℃;

1.3.7 on the next day, five white single colonies are picked and placed in a liquid LB culture medium containing ampicillin, marked, placed on a shaker at 37 ℃ and cultured for 7h at 220 rpm;

1.3.8 sending the bacterial liquid to a biological company for sequencing, wherein the sequencing result is shown in figure 2;

1.3.9 construction of SpsgRNA1(SEQ ID NO.1), the sequencing results of which are shown in FIG. 2A, comprising the sgRNA1 sequence and the backbone sequence SpsgRNA Scaffold; the sequencing result of the SpsgRNA2(SEQ ID No.2) is shown (fig. 2B), comprising the sgRNA2 sequence and the backbone sequence SpsgRNA Scaffold; the sequencing result of the SasgRNA1(SEQ ID No.3) is shown in fig. 2C, comprising a sgRNA1 sequence and a backbone sequence SasgRNA Scaffold; and SasgRNA2(SEQ ID No.4) the sequencing results are shown in fig. 2D, comprising the sgRNA2 sequence and the backbone sequence SasgRNA Scaffold.

(2) Middle-amount extraction of SpsgRNA1, SpsgRNA2, SasgRNA1 and SasgRNA2 plasmids

2.1A 50mL centrifuge tube was taken, the cell suspension was aspirated into the centrifuge tube in a clean bench, 30mL of liquid LB containing ampicillin was added, and the mixture was incubated at 37 ℃ on a shaker at 220rpm for 12 hours.

2.2 use OMEGA E.Z.N.A Plasmid Midi Kit, according to the instructions to extract Plasmid, marking.

2.3 plasmid concentration was measured with Nanodrop 1000, labeled on the vessel wall, stored at-20 ℃ for subsequent experiments.

(3) Optimal sgRNA screening

3.1 day before transfection, HEK-293T was digested with 0.05% Trypsin-EDTA, counted and plated into 6-well cell culture plates, each well was plated at 7X 10⁵A total of 6 HEK293T cells were plated, shaken and cultured in a 37 ℃ cell culture incubator.

3.2 when the cells grew to 70% confluence, the old medium was discarded. 2mL of fresh medium was added to each well;

3.3 after changing the liquid for 2h, taking out the jetPRIME kit (containing buffer and jetPRIME reagent) and balancing the room temperature;

3.4 Add 200. mu.L buffer, 2. mu.g GFP plasmid to the 1 st EP tube; adding 200 mu L of buffer and 2 mu g of the 4 plasmids (SpsgRNA1, SpsgRNA2, SasgRNA1 and SasgRNA2) constructed in the 2 nd to 5 th EP tube, mixing uniformly, adding 8 mu L of jetPRIME reagent into each tube, mixing uniformly again, and standing for 10min at room temperature;

3.5 add the liquid in the EP tube gently into the cell culture solution, shake up, and mark. Culturing in a cell culture box at 37 deg.C;

3.612-16 h later, replacing fresh culture medium;

3.7 cells were harvested 72h after transfection in drawer gDNA, amplified using F2/R1, and subsequently tested for cleavage activity of each sgRNA with T7 endonuclease I (T7 EI); t7EI, a structure-specific enzyme, recognizes and cleaves incompletely paired DNA. When heteroduplex DNA is formed, the two strands of the DNA molecule are cleaved to form the smaller two fragments. And the homologous DNA double strand is not cut by T7EI, the cutting efficiency of CRISPR/Cas9 can be calculated through the fragment gray value, and the calculation formula is as follows: cleavage efficiency (%) × (1- (1-cleavage cleaned) 1/2);

3.8 adding 2 times volume of precooled absolute ethyl alcohol into the PCR product, and standing for 30 minutes at-20 ℃;

3.9 mixing by inversion, centrifuging at 17000g at 4 deg.C for 10min, discarding the supernatant, and adding 30 μ L of pre-cooled 75% ethanol;

3.10 reverse repeatedly 10 times, 17000g, 4 degrees C centrifugal 5 minutes, suction and discard the supernatant;

3.11 air-drying in a clean bench, adding 15 μ L ddH₂Dissolving O;

3.12 annealing the purified PCR product, wherein the annealing system is as follows:

the annealing reaction conditions are shown in FIG. 1;

3.13 after annealing, adding 0.5 mu L T7EI into the PCR tube for enzyme digestion, and carrying out enzyme digestion at 37 ℃ for 40 minutes;

3.14 configuring 10% polyacrylamide gel, electrophoresis at 150V constant pressure for 70 minutes, molecular imaging gel scanning, gray scale analysis, and analyzing CRISPR/Cas9 cleavage efficiency, the results are shown in FIG. 3.

It can be seen that the constructed sgRNAs can edit the TSL2 site, but the editing efficiencies are different, wherein the efficiencies of SpsgRNA1 and SasgRNA1 are higher, respectively 30.14% and 26.29%, and the efficiencies of SpsgRNA2 and SasgRNA2 are respectively 20.66% and 20.61%.

(4) sgRNA nuclear transfer SMA patient specificity iPSCs (SMA-iPSCs)

The SMA-iPSCs are derived from cells separated from urine of SMA patients and obtained by reprogramming. The reprogramming method is known, similar to the method reported in reference 12.

4.1 one day before nucleation, 4 wells of a 12-well plate were coated with diluted Matrigel;

4.2SMA-iPSCs were cultured to 70% -80% confluency (usually on day 3 or 4 in Matrigel-coated 12-well plates or 6-well plates), fresh mTeSR Plus medium was replaced and Y27632 was added at a final concentration of 10 nM. Putting the cells into an incubator to continue culturing for 2 hours;

after 4.32 h, taking out the nuclear transfer Kit Amaxa Human Stem Cell Nuclear extractor Kit, taking a sterilized EP tube, adding 18 mu L of Supplement 1 and 82 mu L of Solution 2, gently mixing uniformly, and standing for 15 min;

4.4 while standing, absorbing and discarding the SMA-iPSCs culture medium to be targeted, washing with 1 XDPBS for 4-5 times, adding a proper amount of TrypLE Select, digesting at 37 ℃ for 5min, and gently shaking the culture dish every 2 min;

4.5 when most cells are observed to be rounded under an inverted microscope, absorbing and discarding TrypLE Select digestive juice, and adding 3mL mTeSRplus culture medium to stop digestion;

4.6 taking a 15mL centrifuge tube, and transferring the cell suspension into the centrifuge tube;

4.7 counting with erythrocyte count plate, total number of cells should be more than 10⁶A plurality of;

4.8175 g, centrifuging for 5 min;

4.9 while centrifuging, adding 8 mug SpsgRNA1 of nuclear transfer plasmid into 4.3 nuclear transfer solution, mixing gently, standing for 5min at room temperature;

4.10 after centrifugation, the supernatant in a 15mL centrifuge tube is sucked and discarded, the liquid remained on the tube wall is dotted and removed, the cell sediment in the centrifuge tube is resuspended by using the nuclear transfer liquid in an EP tube, the nuclear transfer solution added with plasmids is sucked by using a middle tip to resuspend the cells, the cells are transferred to a special nuclear transfer electric shock cup, the generation of bubbles is avoided by resuspension and cell transfer, and if bubbles are generated, the bottom of the nuclear transfer cup can be lightly knocked on a table to break the cells;

4.11 opening the nuclear rotation instrument, selecting the program B016, placing the nuclear rotation cup into the nuclear rotation instrument, and starting nuclear rotation;

4.12 immediately adding 500 μ L mTeSR Plus culture medium into the nuclear transfer cup after the nuclear transfer is finished, and standing for 5 min;

4.13 absorbing and discarding the Matrigel for coating the pore plate;

4.14 inoculation of the cell suspension; add 10. mu.M Y27632;

4.15 shaking up, putting into a cell culture box, standing, changing the liquid after 12-16h of nuclear transfer (using mTeSR Plus culture medium containing 10 mu M Y27632);

4.16 nuclear transfer 24h after medium change with normal mTeSR Plus medium.

(5) Single cell clonal acquisition

5.1 Single cell inoculation day before, use Matrigel spread 1 cell culture dish of 6 cm;

5.2 taking out the cells after nuclear transfer, rinsing the cells once by 1 XDPBS, adding trypLE Select until the cells are submerged, and digesting for no more than 5min at 37 ℃;

5.3 remove TrypLE Select, gently blow cells 2-3 times with 1mL mTeSR Plus medium, and completely shed cells. The cells were counted and 300-500 cells suspended in Clone R medium were seeded into 6cm cell culture dishes.

5.4 culture month 10-14 days, when 6cm cell culture dish cells to half microscope field, the Matrigel coated 48 hole cell culture plate overnight.

5.5 aspirate the Matrigel in the well plate and add the appropriate amount of mTeSR Plus medium per well to submerge the plate bottom.

5.6 selecting unicellular clone with good growth state in a 6cm cell culture dish under a microscope, selecting the unicellular clone into a 48-hole cell culture plate by using small Tip, marking, and inoculating one clone into each hole; putting the mixture into a cell culture box for culture. The liquid was changed every two days.

(6) Clone identification and SMN expression detection

6.1 extracting the extracted single-cell clones, amplifying by using a primer F1/R1 for PCR amplification, sending the amplified single-cell clones to a biological company for Sanger sequencing to detect whether the single-cell clones are edited, and as a result, as shown in FIG. 4A, 12 single-cell clones are edited and Non-Homologous End Joining (NHEJ) occurs in the cells in 25 selected single-cell clones; for the clones with editing, after randomly picking PCR products of 3 positive single-cell clones (C4, C5 and C20) for T-ligation, picking not less than 20 single colonies for sequencing to analyze the specific situation of editing of the TSL sites of 3 SMN2 genes in each single-cell clone, and the result is shown in FIG. 4B, 9 single colonies of the single-cell clone C4 have 9 base deletions, 15 single colonies are unedited sequences (wildtype, WT), which indicates that the single-cell clone C4 contains 1 copy of TSL2 with 9 base deletions and 2 unedited copies; in the sequencing result of the single cell clone C5, 5 base deletions exist in 8 single colonies, and 15 single colonies are unedited sequences (WT), which means that the single cell clone C5 contains 1 copy of TSL2 with 5 base deletions and 2 unedited copies; the sequencing result of the single-cell clone C20 shows that 9 base deletions exist in 10 single colonies and 5 base deletions exist in 16 single colonies, which means that the TSL2 in the single-cell clone C20 has 1 copy of 9 base deletions and 2 copies of 5 base deletions.

6.2 mRNA of full-length SMN (FL-SMN mRNA), SMN mRNA lacking exon 7 (delta 7-SMN mRNA) levels were detected by RT-qPCR, and the results are shown in FIG. 4C, which shows that among the 12 edited clones obtained, the full-length SMN mRNA level of 11 single-cell clones was significantly higher than that of the control group SMA-iPSCs.

6.3 detection of full-length SMN protein levels by Western blot results are shown in FIG. 4D. Corresponding to the detection result of the full-length SMN mRNA, the full-length SMN protein level of the other 11 single-cell clones except the C22 clone in the obtained 12 edited clones is obviously higher than that of the full-length SMN protein in the SMA-iPSCs. The insertion, deletion or insertion and deletion of the TSL2 site of the SMN2 gene is shown to obviously improve the level of full-length SMN mRNA and the level of the SMN protein. And the correction efficiency reaches 44%.

(7) CRISPR potential off-target site detection

CRISPR RGEN Tools (http:// www.rgenome.net/cas-offder /) is used for predicting potential off-target sites of SpsgRNA1, and it is found that in the human genome, SpsgRNA1 has no target point with less than 3 base mismatches, and only 5 target points with 3 base mismatches, therefore, primers OT-1F/1R, OT2F/2R, OT3F/3R, OT4F/4R, OT5F/5R are respectively arranged for the 5 target points, and after randomly picked 3 positive clones (C4, C5 and C22) and SMA-SCs which are not edited are respectively amplified, the PCR sequence is sent to Sanger for sequencing, and the sequencing result is shown in FIG. 5.

The results show that over these 5 potential off-target sites, 3 positive clones (C4, C5, and C22) picked at random were identical to the unedited SMA-iPSCs sequence, indicating that no off-target occurred at the predicted off-target site.

(8) Directed differentiation of iPSCs into iMNs

As shown in FIG. 6, iPSCs were finally differentiated into mature iMNs via neuroepithelial progenitors (NEPs), Motor Neuron Progenitors (MNPs) using MN induced differentiation Medium (50% DMEM/F12, 50% Neurobasal Medium, 0.5 XN 2, 0.5 XB 27, 0.1mM ascorbic acid) by adding different chemical small molecules. At each stage of redifferentiation, detection of cells by immunofluorescence indicates a marker^[12]. The steps of the directional differentiation process are as follows:

8.1 coating 12-well cell culture plates with Matrigel, digesting iPSCs with Accutase or dispase (1mg/mL), inoculating the iPSCs into the coated wells at a ratio of 1:6, and culturing for 1-2 days with mTeSR plus;

8.2 the medium was changed to MN induction medium with the addition of 3. mu.M CHIR99021, 2. mu.M DMH1, 2. mu.M SB421542 at the final concentration, now labeled Day 0;

8.3 changing the culture solution every other Day, and finding that the cell clone clusters slowly become loose and are not as dense as the iPSCs in the culture process, when Day5, pre-paving Matrigel, coating overnight at room temperature, and coating a pore plate with a 24-pore plate slide;

8.4 differentiation of Day6, digesting the cells with dispase (1mg/mL) for 3-5min, pipetting DMEM/F12 with big tip, gently blowing down the cells, transferring to a 15mL centrifuge tube, and centrifuging at 150g at room temperature for 5 min;

8.5 carefully discard the supernatant, resuspend the cells in MN induction medium, inoculate the cells in Matrigel coated overnight 12-well plates and 24-well plates with reptiles at a ratio of 1:4-1:6, while adding 1. mu.M CHIR99021, 2. mu.M DMH1, 2. mu.M SB431542, 0.1. mu.M RA, 0.5. mu.M MPur;

8.6 changing the liquid every other Day, pre-spreading Matrigel at room temperature for coating overnight by Day11, and coating a pore plate with a 24-pore plate slide;

8.7Day12, digesting the cells in a 12-well plate with dispase (1mg/mL) for 3-5min, sucking DMEM/F12 with big tip to gently blow the cells down, transferring the cells into a 15mL centrifuge tube, <175g (150 g in this experiment) centrifuging at room temperature for 5min, and performing immunofluorescence detection on the cells inoculated on the slide to obtain a cell surface marker OLIG-2 when Day 12;

8.8 carefully discard the supernatant, resuspend the cells in MN induction medium, inoculate the cells in Matrigel coated overnight well plates in a ratio of 1:4 to 1:6, while adding 0.5. mu.M RA, 0.1. mu.MPur final concentration;

8.9 changing the liquid every other Day, pre-spreading Matrigel at room temperature for coating overnight by Day17, and coating a pore plate with a 24-pore plate slide sheet;

at 8.10 Day18, digesting the cells with Accutase in a 12-well plate for 3-5min, sucking DMEM/F12 with big tip to slightly blow the cells down, transferring the cells into a 15mL centrifuge tube, centrifuging the cells at 175g at room temperature for 5min, and performing immunofluorescence detection on the cells inoculated on a slide to obtain a cell surface marker MNX1 when Day18 is detected;

8.11 carefully discard the supernatant, resuspend the cells in MN induction medium, inoculate the cells in Matrigel coated overnight 12-well plates and 24-well plates with creepers at a ratio of 1:2-1:3, while adding 0.5. mu.M RA, 0.1. mu.M DAPT final concentrations;

8.12 alternate days, a large number of ChAT + motor neuron cells can be obtained by Day24-28, and cells inoculated on the slide are used for immunofluorescence detection of cell surface markers when Day 24.

SMA-iPSCs, normal human iPSCs (hipSCs) and edited clones C4, C5 and C20 are directionally differentiated into SMA-iMNs, himNs, C4-iMNs, C5-iMNs and C20-iMNs respectively, as shown in FIG. 6, cell morphology and marker detection results in the differentiation process show that neuron epithelial cells (NEP) expressing OTX2 and SOX1, OLIG-2 positive motor neuron progenitor cells (MNPs), SMI32 and ISL1 positive early motor neurons and ChAT positive mature motor neurons in the differentiation process, which indicates that the motor neuron cells are successfully differentiated.

(9) Detection of SMN expression at iMNs stage

9.1 the mRNA level of full length SMN (FL-SMNmRNA), SMN mRNA lacking exon 7 (Δ 7-SMN mRNA) was determined by RT-qPCR. The results show that the transcription level of FL-SMN mRNA in compiled clonal differentiated motor neurons C4-iMNs, C5-iMNs and C20-iMNs is significantly higher than that of SMA-iPSCs differentiated motor neurons (SMN-iMNs) (FIG. 8A), and that Δ 7-SMN mRNA is lower than that of SMA-iMNs (FIG. 8B).

9.2 full-length SMN protein levels were detected by Western blot. Results if 8C shows that full-length SMN protein levels in C4-iMNs and C20-iMNs are significantly higher than SMA-iMNs. The results show that the full-length SMN mRNA level and the SMN protein level in the motor neuron can be obviously improved after the insertion, deletion or insertion and deletion of the TSL2 site of the SMN2 gene.

(10) iMNs function improvement detection

In SMA patients, motoneurons were mainly apoptotic due to endoplasmic reticulum stress, so on day24 of iMNs differentiation, we induced endoplasmic reticulum stress by treating mature motoneurons with Camptothecin (Camptothecin) at a concentration of 10 μ M for 21 hours, followed by immunofluorescence of motoneurons with TUNEL to detect apoptosis^[13]. The results are shown in fig. 9, when DMSO solvent was added only, there were few TUNEL positive cells in both unedited SMA-iMNs and edited clonally differentiated motoneurons (C4-iMNs and C20-iMNs), indicating a low level of apoptosis, and when camptothecin was treated, the TUNEL positive cells of SMA-iMNs were significantly increased, and much more than those in C4-iMNs and C20-iMNs, indicating an increase in motoneuron apoptosis after camptothecin-induced endoplasmic reticulum stress, and the edited clonally differentiated iMNs were effective against camptothecin-induced endoplasmic reticulum stress. The result shows that the SMN2 gene TSL2 site is inserted, deleted or inserted and deleted, so that the resistance of motor neurons to endoplasmic reticulum stress can be obviously improved.

(11) AAV carrying SacAS9 for in vivo gene therapy studies

11.1 packaging the SasgRNA1 with higher efficiency in the SasgRNA into AAV9 virus carrying SasgRNA 1;

11.2 subpackaging the virus and storing at-80 ℃;

11.3 the SMA model mouse to be treated by the invention is introduced from Jackson Lab (Stock No.007952), on the day of birth of the offspring mouse, a little mouse tail is cut, the genotype identification is carried out, and each young mouse is marked, and the marking is carried out at this moment, and the day is marked as P0 days;

11.4 on day P1, mice model SMA were injected with myelin AAV9-SasgRNA1 via lumbar vertebrae L5-L6 in a volume of 5. mu.L and a virus titer of 1X 10¹⁰vg, the SMA mice in the control group are injected with AAV9-sgRNA-scram with equal volume and equal titerble, the survival time of the experimental and control groups was recorded.

The results show that: at day 10 post-injection, the body weight of mice in the AAV9-SasgRNA1 group was significantly higher than in the AAV9-sgRNA-scramble group (fig. A, B), with improved locomotor ability, AAV9-SasgRNA-scramble mice died at day11 post-natal, while experimental mice survived with carriers within 18 days of the experimental observation period (fig. 10B).

(12) Microinjection of SpCas9 to edit TSL2

12.1 taking a female mouse born for 3-6 weeks, injecting gonadotropin PMSG into the abdominal cavity, injecting hCG after 48 hours, and immediately closing the female mouse with a male mouse;

12.2 in the morning of the next day, female mice with pessaries were examined for embryo recovery;

12.3 injecting the plasmid into the pronuclei under a microinjection instrument;

12.4 transfer the injected embryos to the uterus of pseudopregnant mice;

112.5 after the birth of the first generation of mice, the editing is detected by sequencing after amplification with F1/R1, and each edited mouse is established as a separate line.

Sanger sequencing was performed after PCR amplification of F0 mice with F1/R1 by microinjection of SpsgRNA1 through fertilized eggs, and the results showed that microinjection of SpsgRNA1 also efficiently edited TSL2, resulting in indels (FIG. 10C).

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

SEQUENCE LISTING

<110> university of south-middle school

<120> method for increasing SMN protein expression based on CRISPR and application thereof

<130> 13

<160> 31

<170> PatentIn version 3.5

<210> 1

<211> 97

<212> DNA

<213> Artificial Synthesis

<400> 1

gtgctcacat tccttaaatt agttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgc 97

<210> 2

<211> 97

<212> DNA

<213> Artificial Synthesis

<400> 2

gcagacttac tccttaattt agttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgc 97

<210> 3

<211> 97

<212> DNA

<213> Artificial Synthesis

<400> 3

gtgctcacat tccttaaatt agttttagta ctctggaaac agaatctact aaaacaaggc 60

aaaatgccgt gtttatctcg tcaacttgtt ggcgaga 97

<210> 4

<211> 97

<212> DNA

<213> Artificial Synthesis

<400> 4

gcagacttac tccttaattt agttttagta ctctggaaac agaatctact aaaacaaggc 60

aaaatgccgt gtttatctcg tcaacttgtt ggcgaga 97

<210> 5

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 5

caccgtgctc acattcctta aatta 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 6

aaactaattt aaggaatgtg agcac 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 7

caccgcagac ttactcctta attta 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 8

aaactaaatt aaggagtaag tctgc 25

<210> 9

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 9

gctgatgctt tgggaagtat gtta 24

<210> 10

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 10

caccttcctt ctttttgatt ttgtc 25

<210> 11

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 11

tggaccacca ataattcccc 20

<210> 12

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 12

atgccagcat ttccatataa tagcc 25

<210> 13

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 13

aaaatgtctt gtgaaacaaa atgc 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 14

aatcaaaaag aaggaaggtg ctca 24

<210> 15

<211> 26

<212> DNA

<213> Artificial Synthesis

<400> 15

cctttcaact ttctaacatc tgaact 26

<210> 16

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 16

atggctaagg cttccaacag g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 17

tgcccaaggg acatacctta c 21

<210> 18

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 18

agaggtcagg aaggtgacca 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 19

tctgtggagg ggtcgtagag 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 20

agtcagccca acccattcag 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 21

catgcctgaa ctcccactgt 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 22

acgttagcag gagaaacgga 20

<210> 23

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 23

ccttaccaag gtcgtaccca c 21

<210> 24

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 24

agggctgtgt ttcttctgga 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 25

ggggaattaa ggttgcaggt 20

<210> 26

<211> 27

<212> DNA

<213> Artificial Synthesis

<400> 26

ggtgctcaca ttaaggagta agtctgc 27

<210> 27

<211> 31

<212> DNA

<213> Artificial Synthesis

<400> 27

ggtgctcaca ttccttaagg agtaagtctg c 31

<210> 28

<211> 8487

<212> DNA

<213> Artificial Synthesis

<400> 28

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg tgctcacatt ccttaaatta gttttagagc tagaaatagc aagttaaaat 300

aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttgttttaga 360

gctagaaata gcaagttaaa ataaggctag tccgttttta gcgcgtgcgc caattctgca 420

gacaaatggc tctagaggta cccgttacat aacttacggt aaatggcccg cctggctgac 480

cgcccaacga cccccgccca ttgacgtcaa tagtaacgcc aatagggact ttccattgac 540

gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata 600

tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattgtgccc 660

agtacatgac cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta 720

ttaccatggt cgaggtgagc cccacgttct gcttcactct ccccatctcc cccccctccc 780

cacccccaat tttgtattta tttatttttt aattattttg tgcagcgatg ggggcggggg 840

gggggggggg gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg gcggcagcca 900

atcagagcgg cgcgctccga aagtttcctt ttatggcgag gcggcggcgg cggcggccct 960

ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgcg ctgccttcgc cccgtgcccc 1020

gctccgccgc cgcctcgcgc cgcccgcccc ggctctgact gaccgcgtta ctcccacagg 1080

tgagcgggcg ggacggccct tctcctccgg gctgtaatta gctgagcaag aggtaagggt 1140

ttaagggatg gttggttggt ggggtattaa tgtttaatta cctggagcac ctgcctgaaa 1200

tcactttttt tcaggttgga ccggtgccac catggactat aaggaccacg acggagacta 1260

caaggatcat gatattgatt acaaagacga tgacgataag atggccccaa agaagaagcg 1320

gaaggtcggt atccacggag tcccagcagc cgacaagaag tacagcatcg gcctggacat 1380

cggcaccaac tctgtgggct gggccgtgat caccgacgag tacaaggtgc ccagcaagaa 1440

attcaaggtg ctgggcaaca ccgaccggca cagcatcaag aagaacctga tcggagccct 1500

gctgttcgac agcggcgaaa cagccgaggc cacccggctg aagagaaccg ccagaagaag 1560

atacaccaga cggaagaacc ggatctgcta tctgcaagag atcttcagca acgagatggc 1620

caaggtggac gacagcttct tccacagact ggaagagtcc ttcctggtgg aagaggataa 1680

gaagcacgag cggcacccca tcttcggcaa catcgtggac gaggtggcct accacgagaa 1740

gtaccccacc atctaccacc tgagaaagaa actggtggac agcaccgaca aggccgacct 1800

gcggctgatc tatctggccc tggcccacat gatcaagttc cggggccact tcctgatcga 1860

gggcgacctg aaccccgaca acagcgacgt ggacaagctg ttcatccagc tggtgcagac 1920

ctacaaccag ctgttcgagg aaaaccccat caacgccagc ggcgtggacg ccaaggccat 1980

cctgtctgcc agactgagca agagcagacg gctggaaaat ctgatcgccc agctgcccgg 2040

cgagaagaag aatggcctgt tcggaaacct gattgccctg agcctgggcc tgacccccaa 2100

cttcaagagc aacttcgacc tggccgagga tgccaaactg cagctgagca aggacaccta 2160

cgacgacgac ctggacaacc tgctggccca gatcggcgac cagtacgccg acctgtttct 2220

ggccgccaag aacctgtccg acgccatcct gctgagcgac atcctgagag tgaacaccga 2280

gatcaccaag gcccccctga gcgcctctat gatcaagaga tacgacgagc accaccagga 2340

cctgaccctg ctgaaagctc tcgtgcggca gcagctgcct gagaagtaca aagagatttt 2400

cttcgaccag agcaagaacg gctacgccgg ctacattgac ggcggagcca gccaggaaga 2460

gttctacaag ttcatcaagc ccatcctgga aaagatggac ggcaccgagg aactgctcgt 2520

gaagctgaac agagaggacc tgctgcggaa gcagcggacc ttcgacaacg gcagcatccc 2580

ccaccagatc cacctgggag agctgcacgc cattctgcgg cggcaggaag atttttaccc 2640

attcctgaag gacaaccggg aaaagatcga gaagatcctg accttccgca tcccctacta 2700

cgtgggccct ctggccaggg gaaacagcag attcgcctgg atgaccagaa agagcgagga 2760

aaccatcacc ccctggaact tcgaggaagt ggtggacaag ggcgcttccg cccagagctt 2820

catcgagcgg atgaccaact tcgataagaa cctgcccaac gagaaggtgc tgcccaagca 2880

cagcctgctg tacgagtact tcaccgtgta taacgagctg accaaagtga aatacgtgac 2940

cgagggaatg agaaagcccg ccttcctgag cggcgagcag aaaaaggcca tcgtggacct 3000

gctgttcaag accaaccgga aagtgaccgt gaagcagctg aaagaggact acttcaagaa 3060

aatcgagtgc ttcgactccg tggaaatctc cggcgtggaa gatcggttca acgcctccct 3120

gggcacatac cacgatctgc tgaaaattat caaggacaag gacttcctgg acaatgagga 3180

aaacgaggac attctggaag atatcgtgct gaccctgaca ctgtttgagg acagagagat 3240

gatcgaggaa cggctgaaaa cctatgccca cctgttcgac gacaaagtga tgaagcagct 3300

gaagcggcgg agatacaccg gctggggcag gctgagccgg aagctgatca acggcatccg 3360

ggacaagcag tccggcaaga caatcctgga tttcctgaag tccgacggct tcgccaacag 3420

aaacttcatg cagctgatcc acgacgacag cctgaccttt aaagaggaca tccagaaagc 3480

ccaggtgtcc ggccagggcg atagcctgca cgagcacatt gccaatctgg ccggcagccc 3540

cgccattaag aagggcatcc tgcagacagt gaaggtggtg gacgagctcg tgaaagtgat 3600

gggccggcac aagcccgaga acatcgtgat cgaaatggcc agagagaacc agaccaccca 3660

gaagggacag aagaacagcc gcgagagaat gaagcggatc gaagagggca tcaaagagct 3720

gggcagccag atcctgaaag aacaccccgt ggaaaacacc cagctgcaga acgagaagct 3780

gtacctgtac tacctgcaga atgggcggga tatgtacgtg gaccaggaac tggacatcaa 3840

ccggctgtcc gactacgatg tggaccatat cgtgcctcag agctttctga aggacgactc 3900

catcgacaac aaggtgctga ccagaagcga caagaaccgg ggcaagagcg acaacgtgcc 3960

ctccgaagag gtcgtgaaga agatgaagaa ctactggcgg cagctgctga acgccaagct 4020

gattacccag agaaagttcg acaatctgac caaggccgag agaggcggcc tgagcgaact 4080

ggataaggcc ggcttcatca agagacagct ggtggaaacc cggcagatca caaagcacgt 4140

ggcacagatc ctggactccc ggatgaacac taagtacgac gagaatgaca agctgatccg 4200

ggaagtgaaa gtgatcaccc tgaagtccaa gctggtgtcc gatttccgga aggatttcca 4260

gttttacaaa gtgcgcgaga tcaacaacta ccaccacgcc cacgacgcct acctgaacgc 4320

cgtcgtggga accgccctga tcaaaaagta ccctaagctg gaaagcgagt tcgtgtacgg 4380

cgactacaag gtgtacgacg tgcggaagat gatcgccaag agcgagcagg aaatcggcaa 4440

ggctaccgcc aagtacttct tctacagcaa catcatgaac tttttcaaga ccgagattac 4500

cctggccaac ggcgagatcc ggaagcggcc tctgatcgag acaaacggcg aaaccgggga 4560

gatcgtgtgg gataagggcc gggattttgc caccgtgcgg aaagtgctga gcatgcccca 4620

agtgaatatc gtgaaaaaga ccgaggtgca gacaggcggc ttcagcaaag agtctatcct 4680

gcccaagagg aacagcgata agctgatcgc cagaaagaag gactgggacc ctaagaagta 4740

cggcggcttc gacagcccca ccgtggccta ttctgtgctg gtggtggcca aagtggaaaa 4800

gggcaagtcc aagaaactga agagtgtgaa agagctgctg gggatcacca tcatggaaag 4860

aagcagcttc gagaagaatc ccatcgactt tctggaagcc aagggctaca aagaagtgaa 4920

aaaggacctg atcatcaagc tgcctaagta ctccctgttc gagctggaaa acggccggaa 4980

gagaatgctg gcctctgccg gcgaactgca gaagggaaac gaactggccc tgccctccaa 5040

atatgtgaac ttcctgtacc tggccagcca ctatgagaag ctgaagggct cccccgagga 5100

taatgagcag aaacagctgt ttgtggaaca gcacaagcac tacctggacg agatcatcga 5160

gcagatcagc gagttctcca agagagtgat cctggccgac gctaatctgg acaaagtgct 5220

gtccgcctac aacaagcacc gggataagcc catcagagag caggccgaga atatcatcca 5280

cctgtttacc ctgaccaatc tgggagcccc tgccgccttc aagtactttg acaccaccat 5340

cgaccggaag aggtacacca gcaccaaaga ggtgctggac gccaccctga tccaccagag 5400

catcaccggc ctgtacgaga cacggatcga cctgtctcag ctgggaggcg acaaaaggcc 5460

ggcggccacg aaaaaggccg gccaggcaaa aaagaaaaag taagaattcc tagagctcgc 5520

tgatcagcct cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg 5580

ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt 5640

gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc 5700

aagggggagg attgggaaga gaatagcagg catgctgggg agcggccgca ggaaccccta 5760

gtgatggagt tggccactcc ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca 5820

aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagc 5880

tgcctgcagg ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac 5940

cgcatacgtc aaagcaacca tagtacgcgc cctgtagcgg cgcattaagc gcggcgggtg 6000

tggtggttac gcgcagcgtg accgctacac ttgccagcgc cttagcgccc gctcctttcg 6060

ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 6120

ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 6180

tgggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 6240

tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaactcta 6300

tctcgggcta ttcttttgat ttataaggga ttttgccgat ttcggtctat tggttaaaaa 6360

atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg tttacaattt 6420

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 6480

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 6540

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac 6600

gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa 6660

tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 6720

tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 6780

ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc 6840

ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 6900

aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 6960

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 7020

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 7080

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 7140

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 7200

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 7260

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 7320

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 7380

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 7440

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 7500

aatctggagc cggtgagcgt ggaagccgcg gtatcattgc agcactgggg ccagatggta 7560

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 7620

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 7680

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 7740

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 7800

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 7860

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 7920

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 7980

ctgttcttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 8040

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 8100

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 8160

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 8220

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 8280

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 8340

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 8400

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 8460

ccttttgctg gccttttgct cacatgt 8487

<210> 29

<211> 8487

<212> DNA

<213> Artificial Synthesis

<400> 29

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg cagacttact ccttaattta gttttagagc tagaaatagc aagttaaaat 300