Rice male fertility regulation gene, application thereof and method for regulating rice fertility by using CRISPR-Cas9

文档序号：354525 发布日期：2021-12-07 浏览：22次中文

阅读说明：本技术 水稻雄性育性调控基因、其应用以及利用CRISPR-Cas9调控水稻育性的方法 (Rice male fertility regulation gene, application thereof and method for regulating rice fertility by using CRISPR-Cas9 ) 是由龙湍唐杰吴春瑜韩晓斌曾翔李新鹏吴永忠黄培劲于 2020-06-02 设计创作，主要内容包括：本发明涉及生物技术领域,具体涉及水稻雄性育性调控基因、其应用以及利用CRISPR-Cas9调控水稻育性的方法。本发明提供具有调控水稻雄性生殖细胞发育和花粉育性功能的水稻基因GMS2,其核苷酸序列如SEQ ID NO:1所示,CDS序列如SEQ ID NO:2所示,氨基酸序列如SEQ ID NO:3所示。本发明还提供GMS2基因的CRISPR-Cas9敲除突变体。本发明提供的水稻基因GMS2及其突变体可用于水稻杂交种的不育化制种和生产,具有巨大的应用价值和经济价值。(The invention relates to the technical field of biology, in particular to a rice male fertility regulation gene, application thereof and a method for regulating rice fertility by using CRISPR-Cas 9. The invention provides a rice gene GMS2 with the function of regulating and controlling the development of male germ cells of rice and pollen fertility, the nucleotide sequence of which is shown as SEQ ID NO. 1, the CDS sequence is shown as SEQ ID NO. 2, and the amino acid sequence is shown as SEQ ID NO. 3. The invention also provides CRISPR-Cas9 knock-out mutants of the GMS2 gene. The rice gene GMS2 and the mutant thereof provided by the invention can be used for sterile seed production and production of rice hybrid seeds, and have great application value and economic value.)

1. A plant male fertility-related protein, wherein the plant male fertility-related protein is a protein described in the following (1) or (2):

(1) a protein having an amino acid sequence shown as SEQ ID NO.3, 9, 10, 11, 12, 13, 14, 15 or 16;

(2) 3, 9, 10, 11, 12, 13, 14, 15 or 16 through substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the activity of regulating the male fertility of the plant.

2. A nucleic acid encoding the plant male fertility-associated protein of claim 1;

preferably, when the plant male fertility-associated protein is derived from rice, the nucleic acid is any one of:

(1) a nucleic acid having the nucleotide sequence shown in SEQ ID NO 1 or 2;

(2) a nucleic acid having the nucleotide sequence shown as SEQ ID NO. 4 or 69;

(3) a DNA fragment capable of hybridizing with the DNA of any one of the sequences (1) and (2) under stringent conditions;

(4) a DNA fragment complementary to any one of the sequences (1) and (2);

(5) on the basis of any one of the sequences (1) and (2), forming a DNA fragment capable of influencing the fertility of plant pollen by replacing one to a plurality of bases and/or inserting and/or deleting one to a plurality of bases or inserting/deleting/translocating/inverting a nucleotide sequence of a large fragment;

(6) a DNA fragment encoding a rice male fertility-associated protein having 85%, 90%, 95%, 96%, 97%, 98% or 99% or more identity to the DNA fragment of any one of the sequences (1) and (2).

3. A biological material comprising a nucleic acid according to claim 2 or an inhibitor of a nucleic acid according to claim 2, wherein the biological material is an expression cassette, a vector, a host cell, a transgenic cell line or a transgenic plant.

4. A plant, plant tissue or plant cell characterized in that it exhibits a male sterility trait resulting from a mutation in the nucleic acid of claim 2, said mutation being a deletion, insertion or substitution mutation of one or more nucleotides or a mutation resulting from the transfer, co-suppression or introduction of a hairpin structure of an antisense gene; the mutation results in the reduction, non-expression or inactivation of the expression level of the plant male fertility-associated protein of claim 1;

preferably, the plant, plant tissue or plant cell is obtained by using a CRISPR-Cas9 method, wherein a target sequence used by the CRISPR-Cas9 method is positioned in the sequence of the nucleic acid as shown in claim 2, and a reverse complementary sequence of the target sequence has a 5 '- (N) X-NGG-3' structure, wherein N represents any one of A, T, C and G, and X is any nucleotide sequence of 19 or 20 nt.

5. The plant, plant tissue or plant cell according to claim 4, which is a plant, plant tissue or plant cell mutated at the target site or in the region adjacent to the target site using the method of CRISPR-Cas9 using GCGGTCGGTGGCGGCCATGG and CGCCTCCCTCGCCGTCGCGG as target sites.

6. Use of the plant male fertility-associated protein of claim 1, or the nucleic acid of claim 2, or the inhibitor of the nucleic acid of claim 2, or the biological material of claim 3, or the plant, plant tissue or plant cell of claim 4 or 5, for any of:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) use for restoring male fertility to recessive nuclear sterility resulting from a mutation in a nucleic acid of claim 2;

(4) the application in plant cross breeding;

(5) application in plant germplasm resource improvement.

7. A target site suitable for CRISPR-Cas9 directed knockout of the nucleic acid of claim 2, which is GCGGTCGGTGGCGGCCATGG and/or CGCCTCCCTCGCCGTCGCGG.

8. A sgRNA that specifically targets the target site of claim 7.

9. A CRISPR-Cas9 targeting vector containing the DNA sequence of the sgRNA of claim 8.

10. The target site of claim 7, or the sgRNA of claim 8, or the CRISPR-Cas9 targeting vector of claim 9 for any one of the following uses:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) the application in plant cross breeding;

(4) application in plant germplasm resource improvement.

11. A method for producing a male-sterile plant, which comprises reducing, not expressing or inactivating the expression level of the plant male fertility-associated protein of claim 1 in the plant.

12. A method for obtaining an orthologous gene fragment of the nucleic acid of claim 2 in a plant, comprising: performing a blastx search in a nucleotide database using the nucleic acid of claim 2, wherein all nucleotide sequences with Identities greater than or equal to 35% and poisitives greater than or equal to 50% are gene segments that are orthologous to the nucleic acid.

Technical Field

The invention relates to the technical field of biology, in particular to a gene knockout mutant of plant fertility regulation genes GMS2 and GMS2 coding proteins and GMS2, and application of the GMS2 gene, the protein and the mutant in cross breeding.

Background

Rice is one of the most important food crops in the world. With the increase of population and the improvement of life quality, the annual yield of rice is expected to be improved by 1-2 times in 2050 years to meet the development demand of human beings. The hybrid rice is a first filial generation obtained after the hybridization of parents, the yield of the hybrid rice is often improved by more than 15 percent compared with that of the conventional rice parents, and the resistance and the adaptability of the hybrid rice are far better than those of the parents. Therefore, the application and popularization of hybrid rice is an important way for increasing the rice yield.

The male sterile line is a key node of hybrid rice breeding technology. The male sterile line refers to a plant line with abnormal development of male gametes and loss of fertility and normal development of female gametes. It can only be used as female parent to accept pollen of male parent, and can not be fruited by selfing. The male sterile line applied in the present hybrid rice production has two types of nucleic-cytoplasmic interaction type and photo-thermo-sensitive type. The sterile gene of the nuclear-cytoplasmic-interaction-type male sterile line is in the cytoplasm, and the nucleus does not have a fertility restorer gene. Fertile first-generation hybrids can be produced when a restorer line with a fertility restorer gene in the nucleus is crossed with its counterpart, and sterile line seeds can be propagated when a maintainer line without a fertility restorer gene in the nucleus and without a sterile gene in the cytoplasm is crossed with it. The breeding technique of hybrid rice is often called "three-line method" because of the need of three lines of sterile line, maintainer line and restoring line. Several genes controlling cytoplasmic-nuclear sterility and the corresponding restoration of fertility have been cloned (Chen and Liu, 2014, Male sterility and fertility restoration in crops, Annu Rev Plant Biol, 65: 579-. The nucleoplasm interactive sterile line is the first sterile line applied in large scale in hybrid rice breeding, and lays a material foundation for the establishment and development of the hybrid rice industry. However, the combination of the nuclear-cytoplasmic interaction type sterile line is limited by the genotype of the restorer line, so that only about 5 percent of the germplasm resources can be utilized. The cytoplasmic sterile gene has the potential risk of causing poor rice quality and epidemic of specific diseases and insect pests.

The photo-thermo-sensitive male sterile line is a sterile line with fertility regulated by photo-temperature environment. The sterile line keeps sterile under a certain light-temperature condition and can be used for matched hybridization. When the conditions are changed, the sterile line restores fertility and can be used for sterile line propagation. The photo-thermo sensitive male sterile line realizes the integration of the sterile line and the maintainer line, and only the male parent and the male parent are matched to produce the first filial generation hybrid, so the corresponding breeding technology is often called as a two-line method. Genes regulating photo-thermo-sensitive Male sterility in the nucleus, genes that have been cloned so far include PMS3, TMS5, CSA and TMS10(Chen and Liu, 2014, Large steric and regulatory recovery in crops, Annu Rev Plant Biol, 65: 579-. Compared with the nuclear-cytoplasmic interaction type sterile line, the photo-thermo sensitive type sterile line has simple breeding procedure and more free matching due to the wide existence of the restoring genes. The large-scale application of the photo-thermo-sensitive sterile line greatly consolidates and promotes the development of the hybrid rice industry. However, the fertility of the sterile line is influenced by the light and temperature environment, so that the seed production risk is high, and the seed production region is limited.

In order to overcome the key defects in the prior hybrid rice breeding technology, the creation and utilization of a new type of sterile line is an important breakthrough. The nuclear male sterility is generated by nuclear gene mutation, and has dominant mutation, recessive mutation, sporophyte gene mutation and gametophyte gene mutation. Dominant mutations and gametophytic gene mutations can only be inherited by female gametes, recessive mutations can be inherited by both female and male gametes, and Mendelian's law is followed. The invention provides a plant fertility regulating gene and a male sterile line of a recessive genic sterile type generated based on the gene mutation. The sterile line has stable fertility, is only regulated and controlled by a single gene of nuclear coding, and is not influenced by light and temperature environments. The fertility restorer gene of the sterile line is widely existed in rice germplasm resources, and can also restore fertility by transferring wild type genes. The gene and the sterile line generated by the gene mutation provide elements for developing a novel rice hybrid breeding technology, and lay a foundation for solving the problems in the prior art.

Disclosure of Invention

The invention aims to provide a plant fertility-related protein, a coding gene thereof and application of the gene in regulating and controlling plant male fertility by operating. By way of non-limiting example, any of the methods described below can be used with the corresponding nucleotide sequence of a plant fertility-associated protein provided herein, e.g., mutating the plant's endogenous coding sequence for the plant fertility-associated protein, introducing an antisense sequence to the plant, using hairpin formation, or linking it to other nucleotide sequences to modulate the plant's phenotype, or any of a variety of methods known to those skilled in the art that can be used to affect the male fertility of a plant.

The invention discovers a pollen development regulating gene GMS2 with male fertility regulating function in rice. GMS2 is located on No. 4 chromosome of rice, and its genome nucleotide sequence in japonica rice variety Nipponbare is shown as SEQ ID NO. 1, CDS sequence is shown as SEQ ID NO. 2, and amino acid sequence is shown as SEQ ID NO. 3. The genome nucleotide sequence of indica rice variety 9311 is shown as SEQ ID NO. 4, the CDS sequence is shown as SEQ ID NO. 69, and the amino acid sequence is the same as that of japonica rice. The amino acid sequence of the fertility gene in Arabidopsis thaliana (Arabidopsis lyrata) is shown as SEQ ID NO. 9; the amino acid sequence of the fertility gene in banana (Musa acuminata) is shown as SEQ ID NO: 10; the amino acid sequence of the fertility gene in the African cultivated rice (Oryza glaberrima) is shown as SEQ ID NO. 11; the amino acid sequence of the fertility gene in the short drug wild rice (Oryza brachyantha) is shown as SEQ ID NO. 12; the amino acid sequence of the fertility gene in barley (Hordeum vulgare) is shown in SEQ ID NO: 13: the amino acid sequence of the fertility gene in Sorghum (Sorghum bicolor) is shown in SEQ ID NO: 14; the amino acid sequence of the fertility gene in the corn (Zea mays) is shown as SEQ ID NO: 15; the amino acid sequence of the fertility gene in millet (Setaria italica) is shown in SEQ ID NO: 16.

The fertility gene can be obtained by separating from various plants. It will be understood by those skilled in the art that the fertility gene of the present invention includes a highly homologous functionally equivalent sequence to the GMS2 gene and having the same fertility regulatory function. The highly homologous functionally equivalent sequences include DNA sequences that are capable of hybridizing under stringent conditions to the nucleotide sequence of the GMS2 gene disclosed herein. "stringent conditions" used in the present invention are well known and include, for example, hybridization at 60 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH6.4) and l mM EDTA, followed by washing with a washing solution containing 0.1% SDS, and 0.1 XSSC at 65 ℃ for 15 to 60 minutes.

Functionally equivalent sequences also include DNA sequences having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence similarity to the nucleotide sequence of the GMS2 gene disclosed herein, and having fertility regulatory functions, which may be isolated from any plant. The percentage of sequence similarity can be obtained by well-known Bioinformatics algorithms, including the Myers and Miller algorithms (Bioinformatics, 4 (1): 1117, 1988), the Needleman-Wunsch global alignment (J Mol Biol, 48 (3): 443-453, 1970), the Smith-Waterman local alignment (J Mol Biol, 147: 195-197, 1981), the Pearson and Lipman similarity search (PNAS, 85 (8): 2444-2448, 1988), the Karlin and Altschul algorithms (Altschul et al, J Mol Biol, 215 (3): 403-410, 1990; PNAS, 90: 5873-5877, 1993). This is familiar to the person skilled in the art.

Based on the above findings, the first aspect of the present invention provides a plant male fertility-related protein, which is the protein described in (1) or (2) below:

(1) a protein having an amino acid sequence shown as SEQ ID NO.3, 9, 10, 11, 12, 13, 14, 15 or 16;

The invention provides a nucleic acid encoding the plant male fertility associated protein.

The nucleic acid of the invention can be isolated from any plant, including but not limited to brassica, maize, wheat, sorghum, bredigo, african rice, brachypodium, crambe, white mustard, hemp seed, sesame, cottonseed, linseed, soybean, arabidopsis, phaseolus, peanut, lawn, oat, rapeseed, barley, oat, Rye (Rye), millet, milo, triticale, einkorn, Spelt, emmer, flax, grasses (Gramma grass), tripsacum, pseudomarshmallow, fescue, perennial wheat, licorice, red moss, papaya, banana, safflower, oil palm, cantaloupe, apple, cucumber, shikon, glauca, chrysanthemum, liliaceae, cotton, school, sunflower, brassica, sugar beet, coffee, ornamental plants, pine, and the like. Preferably, the plant comprises maize, millet, arabidopsis thaliana, brachypodium distachyon, soybean, safflower, mustard, wheat, barley, rye, brachypodium, african rice, cotton and sorghum.

Taking rice as an example, the sequence of the nucleic acid is any one of the following sequences:

(1) a nucleic acid having the nucleotide sequence shown in SEQ ID NO 1 or 2;

(2) a nucleic acid having the nucleotide sequence shown as SEQ ID NO. 4 or 69;

(3) a DNA fragment capable of hybridizing with the DNA of any one of the sequences (1) and (2) under stringent conditions;

(4) a DNA fragment complementary to any one of the sequences (1) and (2);

(6) a DNA fragment encoding a rice male fertility-associated protein having 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more identity to the DNA fragment of any one of the sequences (1) and (2).

The invention provides a suppressor of a nucleic acid encoding the plant male fertility-related protein, wherein the suppressor is capable of being introduced into a plant to reduce, prevent or mutate and inactivate the expression level of the nucleic acid encoding the plant male fertility-related protein. The inhibitor can be a protein or a nucleic acid (including but not limited to antisense genes, siRNA and DNA thereof, dsRNA and DNA thereof, sgRNA and DNA thereof, and the like).

The invention provides a biological material containing a nucleic acid for coding the plant male fertility-related protein or a suppressor factor containing the nucleic acid for coding the plant male fertility-related protein, wherein the biological material is an expression cassette, a vector, a host cell, a transgenic cell line or a transgenic plant.

The invention provides a plant, plant tissue or plant cell exhibiting a male sterility trait resulting from a mutation in a nucleic acid encoding a male fertility-associated protein of said plant, said mutation being a deletion, insertion or substitution mutation of one or more nucleotides or a mutation resulting from the transfer, co-suppression or introduction of a hairpin structure of an antisense gene; the mutation causes the expression level of the plant male fertility-related protein to be reduced, not expressed or inactivated.

The plant, plant tissue or plant cell can be obtained by natural mutation or artificial mutagenesis, and can be a transgenic plant, plant tissue or plant cell or a non-transgenic plant, plant tissue or plant cell.

The artificial mutagenesis comprises physicochemical mutagenesis, insertion mutation, gene targeting knockout, transfer of antisense gene, cosuppression or introduction of hairpin structure and the like.

Such plants include, but are not limited to, brassica, maize, wheat, sorghum, bredigo, african rice, brachypodium, crambe, white mustard, sesame, soybean, arabidopsis, phaseolus, peanut, oriental wormwood, oat, rapeseed, barley, oat, Rye (Rye), millet, milo, triticale, einkorn, Spelt, emmer, linum, grassland (Gramma grass), rubia graminis, pseudobroomcorn, fescue, perennial wheat straw, licorice, rose berry, papaya, banana, safflower, oil palm, cantaloupe, apple, cucumber, grapeseed, sword, chrysanthemum, liliaceae, cotton, sunflower, brassica, sugar beet, coffee, ornamental plants, pine, and the like. Preferably, maize, millet, Arabidopsis, brachypodium distachyon, mustard, wheat, barley, rye, brevicoryne, African rice, cotton and sorghum are included.

Optionally, the plant, plant tissue or plant cell is obtained by using a CRISPR-Cas9 method, wherein a target sequence used by the CRISPR-Cas9 method is located in a sequence of a nucleic acid encoding the plant male fertility-related protein, and a reverse complementary sequence of the target sequence has a 5 '- (N) X-NGG-3' structure, wherein N represents any one of a, T, C and G, and X is any nucleotide sequence of 19 or 20 nt.

Specifically, the plant, plant tissue or plant cell derived line is a plant which is mutated at the target site or in the region adjacent to the target site by using GCGGTCGGTGGCGGCCATGG (SEQ ID NO:17) and CGCCTCCCTCGCCGTCGCG G (SEQ ID NO:18) as target sites using the CRISPR-Cas9 method.

A second aspect of the invention provides a use of the plant male fertility-related protein or a nucleic acid encoding the plant male fertility-related protein or a suppressor of the nucleic acid or any of the following of the biological material or the plant, plant tissue or plant cell:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) use for restoring male fertility to recessive nuclear sterility resulting from a mutation in a nucleic acid encoding a male fertility-associated protein of said plant;

(4) the application in plant cross breeding;

(5) application in plant germplasm resource improvement.

In the above (1), the male fertility of the plant may be controlled to be reduced or lost. The method can be realized by regulating and controlling the development of plant male germ cells and pollen. Wherein the male fertility of the plant is reduced or lost by mutating a gene encoding a male fertility-associated protein of the plant so that the expression level thereof is reduced or not expressed, or by introducing a suppressor of a nucleic acid encoding the male fertility-associated protein of the plant into the plant.

In the above (2), the male sterile plant is a recessive nuclear sterile line having homozygous mutation of nucleic acid encoding the male fertility-associated protein of the plant.

In the above (3), the male fertility of the plant recessive nuclear sterility caused by mutation or inactivation of the plant male fertility-related protein is restored by introducing a nucleic acid encoding the plant male fertility-related protein into the plant, so that an exogenous gene is introduced to obtain a transgenic crop of good quality.

In the above (4), a recessive nuclear sterile line having a homozygous mutation of a nucleic acid encoding the plant male fertility-related protein is used for hybrid breeding.

In the above (5), the improvement includes yield improvement, quality improvement, disease and pest resistance, stress resistance, lodging resistance and the like.

The plants described above are self-pollinated or cross-pollinated crops, including but not limited to rice, corn, wheat, sorghum.

In a third aspect, the invention provides a method for influencing plant fertility by influencing the sequence of the plant male fertility-associated protein or the nucleic acid encoding the protein, or by influencing the transcription and translation of the nucleic acid. By affecting fertility of a plant is meant altering the fertility of the plant, such as resulting in male sterility of the plant. Specifically, depending on the practical application requirements, the sequence of the plant male fertility-related protein or the nucleic acid encoding the protein or the expression and translation of the protein in the plant can be affected by various methods, so as to achieve the effect of regulating the male fertility of the plant. More specifically, the sequence affecting the plant male fertility-associated protein or the nucleic acid encoding the protein, or the expression and translation thereof in plants can be carried out using many tools available to those of ordinary skill in the art, for example, by physicochemical mutagenesis, insertional mutation, gene targeting knockout, transfer of antisense genes, cosuppression, or introduction of hairpin structures, etc., all of which can be used to disrupt the normal expression of the plant male fertility-associated protein, thereby obtaining male sterile plants.

The fourth aspect of the invention provides a mutant of the plant male fertility-related protein, which is obtained by inserting, deleting and/or substituting a plurality of nucleotides in a coding gene of the plant male fertility-related protein, and the mutant can cause rice male sterility.

The invention provides a target site suitable for CRISPR-Cas9 method to carry out directional knockout on nucleic acid encoding the plant fertility-related protein, which is a target site 1: GCGGTCGGTGGCGGCCATGG (SEQ ID NO:17) and/or target site 2: CGCCTCCCTCGCCGTCGCGG (SEQ ID NO: 18).

The present invention also provides sgrnas that specifically target the above-described target sites 1 and 2.

The CRISPR-Cas9 targeting vector containing the DNA sequence of the sgRNA also belongs to the protection scope of the invention.

A fifth aspect of the invention provides any one of the following uses of the target site or sgRNA targeting the target site or CRISPR-Cas9 targeting vector containing DNA of the sgRNA:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) the application in plant cross breeding;

(4) application in plant germplasm resource improvement.

In the above (2), the male sterile plant is a recessive nuclear sterile line having homozygous mutation of nucleic acid encoding the male fertility-associated protein of the plant.

In the above (3), the use of the nucleotide repressor inactivates the fertility regulator protein, thereby creating a plant with recessive nuclear male sterility for use in hybrid breeding and seed production.

In the above (4), the improvement includes yield improvement, quality improvement, disease and pest resistance, stress resistance, lodging resistance and the like.

The invention also provides a method for preparing male sterile plants, which is used for reducing, not expressing or inactivating the expression level of the plant male fertility related protein in the plants.

As a preferred scheme, the invention provides a method for preparing male sterile rice by using CRISPR-Cas9 technology, which is to knock out or mutate nucleic acid encoding the plant fertility-related protein in rice by using CRISPR-Cas9 technology.

Specifically, the target site GCGGTCGGTGGCGGCCATGG (SEQ ID NO:17) and/or the target site CGCCTCCCTCGCCGTCGCGG (SEQ ID NO:18) are used as the target site using CRISPR-Cas9 technology, so that the target site or the target site and the adjacent nucleotide sequence are mutated.

The invention also provides a method for obtaining the orthologous gene fragment of the GMS2 gene in plants, and an amino acid sequence of the homologous GMS2 obtained by the method, such as arabidopsis thaliana, banana, African rice, brettanomyces oryza sativa, barley, sorghum, maize and millet, and application thereof.

The method for obtaining the orthologous gene segment of the GMS2 gene in the plant comprises the following steps: performing a blastx search in a nucleotide database using the aforementioned DNA fragment of the GMS2 gene; all obtained Identities are more than or equal to 35 percent, Positives is more than or equal to 50 percent, and the obtained Identities and Positives are the orthologous gene segments of the GMS2 gene.

Compared with the prior art, the invention has the following beneficial effects: the rice pollen development regulation gene GMS2 provided by the invention directly participates in pollen development regulation, and after the gene is knocked out or expression is inhibited, pollen is completely sterile, so that the plant is male sterile. The invention utilizes CRISPR-Cas9 gene editing technology to edit GMS2 gene, and obtains GMS2 gene mutant rice male sterile mutant. Compared with the existing three-line and two-line sterile lines, the sterile mutant of the rice caused by GMS2 mutation has stable sterile character and is not influenced by environmental conditions. The GMS2 gene and its mutant can be used to cultivate new genic sterile line by transgenic method and provide the method for restoring the fertility of sterile line, which lays the foundation for the cultivation and reproduction of genic sterile line of rice and plays an important role in the heterosis utilization of crops and the production of sterile hybrid seed.

Drawings

FIG. 1 shows the plant morphology of the wild type (left) and the gms2 mutant (right) during the grain filling phase in example 2 of the present invention.

FIG. 2 is spikelet morphology of wild-type (left) and gms2 mutant (right) in example 2 of the present invention.

FIG. 3 shows the ear flowering patterns of the wild type (left) and the gms2 mutant (right) in example 2 of the present invention.

FIG. 4 is floret pattern of wild type (left) and gms2 mutant (right) after dissection in example 2 of the invention.

FIG. 5 shows the anther morphology of wild type (left) and gms2 mutant (right) in example 2 of the present invention.

FIG. 6 shows iodine staining of wild type (left) and gms2 mutant (right) pollen in example 2 of the present invention.

FIG. 7 shows the identification of the genotype of sterile individuals in a defined population by using the InD48490 marker in example 4 of the present invention. The size of the upper band is 149bp, and the size of the lower band is 140 bp. The DNA templates of the first 2 left lanes are gms2 mutant and Minghui 63, respectively, and the following lane is the sterile individual in the mapped population.

FIG. 8A is a map of the GMS2 gene clone in example 4 of the present invention.

FIG. 8B is a schematic diagram of the mutation site of gms2 mutant in example 4 of the present invention.

FIG. 9 shows the nucleotide sequence differences of the GMS2 gene in the 9311(48490-9311), Minghui 63(48490-MH63), Nipponbare (48490-Nip) and GMS2 mutant (48490-3148) materials in example 4 of the present invention. The areas of difference are highlighted with a grey background. The position of the last nucleotide in each row in the entire gene sequence is indicated at the end of the row. The initiation codon ATG and the termination codon TGA are boxed, respectively.

FIG. 10 shows the amino acid sequence differences between the 9311(48490-9311) and the GMS2 mutant (48490-3148) encoded by GMS2 in example 4 of the present invention. The difference is highlighted with a light grey background. The position of the last amino acid residue in each row in the entire protein sequence is indicated at the end of the row.

FIG. 11 shows the genotyping of the progeny of the GMS2 hybrid in example 4 of the present invention. The size of the upper band is 149bp, and the size of the lower band is 140 bp. Arrows indicate samples from male sterility.

FIG. 12 shows the expression levels of GMS2 in young ears of rice at different tissues and different developmental stages in example 5 of the present invention. Flowers 1-9 represent the glume primordium differentiation stage to pollen maturation stage of young ear development.

FIG. 13 is a schematic diagram of pC9M-GMS2 vector in example 6 of the present invention. T1 represents target site 1 and T2 represents target site 2.

Fig. 14A is the target site sequence analysis of partially transgenic positive plants after GMS2 gene knockout using CRISPR-Cas9system in example 6 of the invention.

FIG. 14B is a diagram showing the sequencing peaks of transgenic plant PC9M-GMS2-Line17 at target site 1 and target site 2 in example 6 of the present invention. Wherein, in the sequencing peak plot at target site 1, the arrow points to the deletion site; in the sequencing peak plot at target site 2, the arrow points to the insertion site.

FIG. 15 shows the entire plant morphology of GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 16 shows glume morphologies of GMS2 wild type (left) and knockout plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 17 shows anther morphology of GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 18 shows the results of iodine staining of pollen with GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 19 is a schematic diagram of pUbi1301-48490-CDS vector in example 7 of the present invention.

FIG. 20 shows the analysis of the RT-PCR expression of GMS2 in overexpressed plants in example 7 of the present invention. The histogram is the result of quantifying the intensity of bands in the RT-PCR gel image and dividing the intensity value of 48490 by the intensity value of GAPDH.

FIG. 21 is a schematic diagram of pC1300-48490-genome vector in example 8 of the present invention.

FIG. 22 shows the plant morphology of the wild type plant (left) and the complementary plant of the gms2 mutant (right) in example 8 of the present invention.

FIG. 23 shows glume morphology of wild type plants (left) and gms2 mutant complementation plants (right) in example 8 of the invention.

FIG. 24 shows anther morphology of wild type plants (left) and gms2 mutant complementation plants (right) in example 8 of the present invention.

FIG. 25 shows the results of iodine pollen staining of wild type plants (left) and complementary plants of gms2 mutant (right) in example 8 of the present invention.

FIG. 26 is a diagram showing an alignment of the sequences of the protein encoded by the rice GMS2 gene and the homologous proteins in the genomes of other species in example 9 of the present invention. Including Arabidopsis thaliana (Arabidopsis thaliana) protein AT3G60900.1, Musa acuminata (Musa acuminata) protein GSMUA _ Achr11P03090_001, Oryza glaberrima (Oryza glaberrima) protein ORGLA04G0194100.1, Brevibacterium paniculatum (Oryza brachyantha) protein OB04G29380.1, Hordeum vulgare (Hordeum vulgare) protein MLOC _7985.1, Sorghum (Sorghum biocolor) protein Sb06g026030.1, maize (Zea mays) protein MZM2G003752_ P01, and millet (Setaria italica) protein Si010135 m. NxYL conserved sequences are boxed.

FIG. 27 is a phylogenetic tree analysis of the protein encoded by the rice GMS2 gene in example 9 of the present invention.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the scope of the invention. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless indicated to the contrary, all techniques used or referred to herein are standard techniques recognized by those of ordinary skill in the art. The test materials are, unless otherwise specified, all materials commonly used in the field of the present invention. The test reagents used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

The male sterility of the present invention refers to the abnormal development of the male reproductive organ of a plant (normal stamens, anthers or normal male gametophytes cannot be produced) and the loss of fertility caused by the functional change of the nuclear gene of the plant, namely the male sterility (Genic male sterility) rather than the Cytoplasmic nuclear sterility. Both the abnormality and restoration of fertility in the male reproductive organs are controlled by genes in the nucleus.

Therefore, the invention also comprises the purpose of utilizing the sequence described in the sequence table to regulate the male gamete fertility of the plant, namely utilizing the gene sequence provided by the invention to influence the functions of the same or homologous genes in other plants at the genome, and/or transcriptome, and/or proteome level so as to achieve the purpose of controlling the male reproductive organ fertility. For example, including but not limited to the following methods: the function of a plant gene is influenced or altered by the inhibition of gene expression or loss of protein function through variation of the native sequence, by transferring the antisense sequence of the gene or introducing hairpin structures into the plant, or by combining the gene with other sequences (DNA or RNA) to produce new functionally active DNA or RNA strands. Or any other technique known to those skilled in the art that can be used to affect male fertility in a plant.

The invention comprises a rice GMS2 gene, wherein the dominant allele of the gene has a key effect on the male fertility of plants, and the recessive allele with the function deletion can cause male sterility. The gene is located on the No. 4 chromosome of rice, and the specific positions of the gene are shown in FIGS. 8A and 8B.

The gene sequence and its homologous sequences can be obtained from various plants including, but not limited to, Selaginella moellendorffii, Populus deltoides (Populus trichocarpa), Brassica rapa (Brassica rapa), Arabidopsis thaliana (Arabidopsis thaliana), Glycine max, Solanum tuberosum, Vitis vinifera, Musa acuminata (Musa acuminata), Setaria Setaria italica, Sorghum bicolor, Zea mays, Brachypodium brachycanthum (Brachypodum distyrum), Hordeum vulgare (Hordeum vulgare), Brachypodium brevicum (Oryza sativa), Oryza sativa (Oryza sativa), Oryza Japonica (Oryza sativa), Oryza sativa Indica (Oryza sativa, etc. Methods of obtaining include, but are not limited to: calling from the genome sequence database, and/or cDNA sequence database, and/or protein sequence database of other plants by blastx, blastn using rice GMS2 gene sequence, or blastp using rice GMS2 amino acid sequence; designing a primer by taking the DNA or cDNA or RNA sequence of the rice GMS2 gene as a reference sequence, and directly obtaining the primer from the genomic DNA or cDNA or RNA of other plants by using a PCR method; probes were designed based on the gene sequence of rice GMS2, and DNA or cDNA or RNA fragments containing homologous gene sequences were isolated from genomic libraries by nucleic acid hybridization.

GMS2 gene homologous sequence refers to the plant gene sequence with Identities greater than or equal to 35% and Positives greater than or equal to 50% after blastp comparative analysis with the amino acid sequence of SEQ ID NO 3. When performing blastp, all parameters were performed following the default settings shown by http:// blast. ncbi. nlm. nih. gov/.

The following more detailed description is provided by way of illustration and description and is not intended to limit the scope of the invention.

Example 1 screening of Rice Male sterile mutant gms2

Irradiating 93-11 seeds with cobalt 60 in 6 months in 2013 to obtain M₀And (4) generation. Planting the irradiated seeds in the test field of Lingao county of Hainan province, harvesting seeds by single plant after maturation to obtain M₁Substitute materialAbout 6500 parts. In 2014 spring, 3617M with large seed quantity are selected₁The generation material was planted in lines, 50 individuals were planted in each line. Screening various mutants of plant type, spike type, fertility, yield and the like at a tillering stage, a booting stage, a heading stage, a flowering stage and a filling stage respectively, and harvesting and storing. In this case, a sterile mutant, designated gms2, was found in line No. 3148.

Example 2 phenotypic analysis of Rice Male sterile mutant gms2

The gms2 mutant plants (FIG. 1) and spikelets (FIG. 2) were morphologically normal and flowering later compared to wild type. The size of the palea, the size of the small flower and the opening time have no obvious difference with the wild type (figure 3). The shape of the florets of the mutants is observed under a microscope, and the ovary, the style and the stigma are slightly larger than those of the wild type (figure 4), but the anther is thinner and lighter than the wild type (figure 5). With iodine-potassium iodide solution (0.6% KI, 0.3% I)₂W/w) solution stains pollen, as shown in FIG. 6, wild type pollen grains are large and round and stained a blue-black color, while mutant pollen grains shrink and cannot be stained. Wild type plants of the same family are normally fruited after bagging and selfing, while the gms2 mutant is not fruitful. And pollination of the gms2 mutant by using the rice variety 93-11 as a male parent can produce fruit. This indicates that the mutant is a male sterile mutant.

Example 3 genetic analysis of Rice Male sterile mutant gms2

Planting 80 segregation population strains of gms2 in M5 generation, wherein 64 strains have normal fertility, 16 strains are sterile, and the segregation ratio of fertile strains to sterile strains is 3:1 (chi)²＝0.57，P>0.05). Backcross 93-11 with gms2, and plants in generation F1 were all fertile. Planting 70 segregation population strains of gms2 in the F2 generation, wherein 57 strains have normal fertility, 13 strains are sterile, and the segregation ratio of fertile strains to sterile strains meets 3:1 (chi)²＝0.85，P>0.05). The above results indicate that the sterility trait of gms2 is controlled by a recessive single gene.

Example 4 cloning of Male sterile Gene GMS2 of Rice

The GMS2 gene was mapped using the map-based cloning method. Crossing with gms2 mutant by using Minghui 63 as male parent to construct a plant containing 66 mutationsF of (A)₂And (4) a group. This population was used to locate GMS2 within the 6861.252Kb range between chromosome 4 SSR markers RM17332 and RM280, closely linked to SSR marker RM303 and Indel marker 4826. The number of crossover individuals between the GMS2 gene and the four markers was 8, 1, and 32, respectively. Selection of F Using linkage markers₂The gms2 heterozygous individual in the population developed an F₃The population comprises 1937 mutant individuals. At F₃The number of crossover individuals between RM303, 4826, S10 and GMS2 genes in the population was 10, 7 and 8, respectively. By analyzing and comparing the sequences of 93-11 and Minghui 63 genomes between RM303 and S10, 5 novel single nucleotide polymorphism markers S4b, S3b, S2, S1, S8 were developed and experimentally confirmed. In the F3 population, the above-mentioned labeled crossover individuals were 6, 1, 4, and 8, respectively (FIG. 7). Taking 77kb upstream and downstream of S2 as candidate segments, a total of 11 annotated genes were found in the segments, of which LOC _ Os04g48490 is predicted to encode a fascin-like arabinogalactan protein, presumably the GMS2 gene. In Nipponbare, LOC _ Os04g48490 genome nucleotide sequence length 1582bp (48490-Nip, sequence as SEQ ID NO:1), CDS nucleotide sequence length 1296bp (sequence as SEQ ID NO:2), contains 1 exon (FIG. 8A and FIG. 8B), encodes a protein 432 amino acid residues (sequence as SEQ ID NO: 3). The sequences of the pair of labeled primers used to locate the GMS2 gene are shown in Table 1 (SEQ ID Nos. 39-68).

TABLE 1 sequence of the marker primer pairs for mapping the GMS2 Gene

Design of primers based on 48490-Nip sequence amplification and sequencing of alleles of LOC _ Os04g48490 gene in the 93-11, Minghui 63 and gms2 mutants was performed, with primer sequences as shown in Table 2. All PCR amplifications were performed using KOD FX DNA Polymerase (TOYOBO CO., LTD. Life Science Department, Osaka, Japan) on a Thermo scientific Arktik thermal cycler according to the reaction system and conditions described in the product. The PCR product was sent to Nanjing Kingsrei Biotech Ltd for sequencing. Sequencing results were spliced using DNAman 6.0. The LOC _ Os04g48490 genes in 93-11, Minghui 63 and gms2 mutants were designated 48490-9311 (SEQ ID NO:4), 48490-MH63 (SEQ ID NO:5) and 48490-3148 (SEQ ID NO:6), respectively.

TABLE 2 primer pair sequences for amplification of LOC _ Os04g48490

Multiple sequence alignments were performed for 48490-9311, 48490-3148, 48490-MH63, and 48490-Nip, and the results are shown in FIG. 9. 48490-9311 and 48490-3148 compared to 48490-3148, 48490-3148 had only one AACAGCTAC deletion starting at the 118 th base after ATG (FIGS. 8B and 9). Amino acid sequence analysis showed that this mutation would result in the deletion of asparagine, serine and tyrosine residues at positions 40 to 42 in the protein encoded by the LOC _ Os04g48490 gene (FIG. 10). 48490-MH63 and 48490-Nip also differ from 48490-3148 by 118 bases after ATG (FIG. 9). This indicates that the deletion mutation of AACAGCTAC starting at base 118 after ATG is responsible for male sterility of the gms2 mutant. Furthermore, the sequences of 48490-9311 and 48490-MH63 were completely identical, whereas compared to 48490-Nip, there was a SNP with a C-to-A at position 8, a SNP with a G-to-C at position 109, a SNP with a C-to-T at position 1288, and a G base insertion at position 1515 (FIG. 9). Two nucleotide differences fall within the 5 'UTR and 3' UTR, respectively, and the other two nucleotide differences, although falling within exons, do not affect the encoded protein. This indicates that the LOC _ Os04g48490 gene is highly conserved in rice, and its nucleotide sequence has only 4 bases difference even between indica and japonica subspecies, while the protein sequence has no difference. In 93-11 LOC _ Os04g48490 has CDS nucleotide sequence shown in SEQ ID NO:69, and encoding protein sequence shown in SEQ ID NO: 3. The CDS nucleotide sequence and amino acid sequence of LOC _ Os04g48490 in the gms2 mutant are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

Based on the sequencing result of LOC _ Os04g48490 gene mutation site, specific primers InD48490_ F are designed on both sides of the mutation site: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO: 20). A149 bp band will be generated when InD48490_ F and InD48490_ R pairs amplify wild-type LOC _ Os04g48490 gene and a 140bp band will be generated when mutant LOC _ Os04g48490 gene is amplified. Genotyping was performed on the M6 isolate population of 41 strains gms2 using InD48490_ F and InD48490_ R primer pairs. As shown in FIG. 11, the wild type amplified either two bands of 149bp and 140bp, or one band of 149bp, while the sterile mutant amplified only one band of 140 bp. This indicates that the mutant genotype cosegregated with the sterile phenotype, LOC _ Os04g48490 is the GMS2 gene.

Example 5 expression analysis of GMS2 Gene

93-11 tissues at each stage are taken to extract total RNA and are reversely transcribed into cDNA. Using primer InD48490 — F: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO:20), the expression level of GMS2 gene was measured using a primer GAPDH-RTF: GAATGGCTTTCCGTGTT (SEQ ID NO:25) and GAPDH-RTR: CAAGGTCCTCCTCAACG (SEQ ID NO:26) to detect the expression level of the reference gene GAPDH. And (3) analyzing the expression quantity by adopting a real-time quantitative PCR method. As shown in FIG. 12, the expression level of GMS2 gene was significantly lower in roots and stems than in other tissues and significantly higher in seeds than in other tissues. The expression level of GMS2 gene was moderate but not identical in stem nodes, leaves, leaf sheaths and ears. In the ears from the current glume flower primordium differentiation period to the pollen maturation period of flower 1 (flower length 1mm), flower 2 (flower length 2mm), flower 3 (flower length 3mm), flower 4 (flower length 4mm), flower 5 (flower length 5mm), flower 6 (flower length 5.5mm), flower 7 (flower length 6mm), flower 8 (flower length 7mm), and flower 9 (flower length 8mm), the expression level of GMS2 shows a fluctuation that decreases first, then increases, and then decreases last.

Example 6 acquisition and phenotypic analysis of GMS2 Gene knockout lines

The GMS2 gene is subjected to targeted knockout by using a CRISPR-Cas9 system. To increase the efficiency of the knockdown, two target sites were selected for simultaneous knockdown. Target site 1 is located on the minus strand of the exon, sequence GCGGTCGGTGGCGGCCATGG (SEQ ID NO:17, located at position 45 and position 64 of sequence SEQ ID NO:1), target site 2 is located on the exon, and sequence CGCCTCCCTCGCCGTCGCGG (SEQ ID NO:18, located at positions 85 to 104 of sequence SEQ ID NO: 1). The target site 1 and the target site 2 were ligated into the vector pC9M according to the method of Ma et al (Ma X, et al. A Robust CRISPR-Cas9System for Convenient, High-Efficiency Multiplex Genome Editing in monomer and Dicot plants. mol Plant,2015,8:1274-84) to obtain the vector pC9M-GMS2 (FIG. 13). Coli with pC9M-GMS2 was named E.coli-pC9M-GMS 2. pC9M-GMS2 was transferred into Agrobacterium strain EHA105 by electric shock and the resulting strain was named Ab-pC9M-GMS 2.

The recombinant agrobacterium Ab-pC9M-GMS2 is used for infecting calluses of japonica rice middle flower 11(ZH11), and a regenerated transgenic strain 25 is obtained through hygromycin resistance screening, differentiation and rooting. Obtaining 22 surviving plants after hardening and transplanting, extracting total DNA of plant leaves, and carrying out mass transfer on the total DNA by using a primer SP 1: CCCGACATAGATGCAATAACTTC (SEQ ID NO:29) and SP 2: GCGCGGTGTCATCTATGTTACT (SEQ ID NO:30) were tested positive and all were positive strains. With primer targets 1-F on both sides of target site 1: AAACCCACGCCCAGAAA (SEQ ID NO:31) and target 1-R: GCCAGGAGGAAGAGCAG (SEQ ID NO:32) and the primer targets 2-F: GCCTGCTCTTCCTCCTG (SEQ ID NO:33) and target 2-R: GTGCTCCGGCTGTTGAT (SEQ ID NO:34), amplifying the genomic DNA, and aligning the amplified product with the genome after sequencing. The results showed that 14T 0 plants underwent gene editing, one of which underwent homozygous mutation, and 8T 0 seedlings were not edited.

The genomic DNA of plant PC9M-GMS2-Line17 underwent homozygous mutations at both target site 1 and target site 2, in which a TG base deletion (SEQ ID NO:27) occurred at target site 1 and a T base insertion (SEQ ID NO:28) occurred at target site 2 (FIG. 14B). The genomic DNA of PC9M-GMS2-Line1 has biallelic mutation at the target site 1, wherein A base insertion occurs in allele 1, and T base deletion occurs in allele 2; the genomic DNA of PC9M-GMS2-Line1 also underwent biallelic mutation at target site 2, G/T base SNP at allele 1, and G/C base SNP at allele 2. The genomic DNA of PC9M-GMS2-Line3 has biallelic mutation at the target site 1, wherein TG base deletion occurs on the allele 1 and A base insertion occurs on the allele 2; the genomic DNA of PC9M-GMS2-Line3 also underwent biallelic mutation at target site 2, G/T base SNP at allele 1, and C base deletion at allele 2. The transgenic negative individuals, PC9M-GMS2-Line2, PC9M-GMS2-Line5 and PC9M-GMS2-Line7, did not have any change in genotype (FIG. 14A).

Phenotypic analysis was performed on the positive strains after flowering. Compared with wild type ZH11, GMS2 knock-out plant PC9M-GMS2-Line17 did not differ significantly in plant leaf and spikelet morphology (FIGS. 15 and 16). However, the GMS2 knockout plants showed significantly smaller anthers (FIG. 17). Pollen iodine staining results showed that pollen from wild type ZH11 was large and round and could be stained, whereas pollen from GMS2 knock-out plants was small and shrunken and could not be stained (FIG. 18). Other GMS2 biallelic mutant plants also exhibited male sterility.

Example 7 acquisition and phenotypic analysis of GMS2 Gene overexpression lines

Taking the RNA reverse transcription product of 9311 as a template, and performing amplification reaction by using a primer 3148OX-F CgggtaccATGGCCGCCGCCACCGAC: (SEQ ID NO:35) and 3148 OX-R: CGCggatccTCACAAGAACGACGC (SEQ ID NO:36) A DNA fragment with the complete coding nucleotide sequence of GMS2 (SEQ ID NO:2) was obtained. This fragment was double-digested with Kpn I and BamH I and ligated into pBLU5 to obtain plasmid pUbi1301-48490-CDS (FIG. 19). Coli having pUbi1301-48490-CDS was named E.coli-pUbi 1301-48490-CDS. pUbi1301-48490-CDS was transferred to Agrobacterium strain EHA105 by electric shock and the resulting strain was named Ab-pUbi 1301-48490-CDS.

Infecting the calluses of japonica rice middle flower 11 by using recombinant agrobacterium Ab-pUbi1301-48490-CDS, and obtaining 6 transgenic positive plants through hygromycin resistance screening, differentiation and rooting. Using a real-time quantitative PCR method, primers InD48490-F in example 5 were used: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD 48490-R: GCCTGCTCTTCCTCCTG (SEQ ID NO:20), GAPDH-RTF: GAATGGCTTTCCGTGTT (SEQ ID NO:25) and GAPDH-RTR: CAAGGTCCTCCTCAACG (SEQ ID NO:26) were analyzed for the expression level of GMS2 in transgenic positive plants. As shown in FIG. 20, compared with transgenic negative individuals 2 and 8, the expression levels of GMS2 in the over-expressed plants 20 and 28 were increased by 9 times and 45 times, respectively, but the over-expressed plants did not have an obvious phenotype co-separated with the expression levels, indicating that the GMS2 gene over-expression did not have an obvious effect on the rice phenotype.

Example 8 acquisition and phenotypic analysis of transgenic complementation lines of gms2 mutant

Genome DNA of 9311 is used as a template, and primers 3148 HB-F: CgcgtttcgaaatttTGATTTCTTCATCGCACT (SEQ ID NO:37) and 3148 HB-R: GtcgcgatcgcatgcACAACATGGTGCAACAGTG (SEQ ID NO:38) the full-length fragment of the gene was obtained with a GMS2 start codon ATG 2kb upstream and a stop codon TGA 515bp downstream. This fragment was double-digested with Kpn I and BamH I and ligated into pC1300 to obtain plasmid pC1300-48490-genome (FIG. 21). Coli with pC1300-48490-genome was named E.coli-pC 1300-48490-genome. The pC1300-48490-genome was transferred to Agrobacterium strain EHA105 by electric shock, and the resulting strain was named Ab-pC 1300-48490-genome. The recombinant agrobacterium Ab-pC1300-48490-genome is used to infect the gms2 mutant callus, 4 transgenic positive plants are obtained after resistance screening, differentiation and rooting, and the fertility of the 4 transgenic positive plants is recovered to be normal (figure 22, figure 23, figure 24 and figure 25). This further demonstrates that the GMS2 gene regulates pollen development and that mutations in this gene lead to pollen abortion.

Example 9 sequence alignment and evolutionary Tree analysis of GMS 2-encoded proteins and their homologous proteins

Homology search of amino acid sequences of proteins encoded by GMS2 gene of rice was performed in NCBI's Genbank database using blastp tool, and homologous proteins predicted in genomes of Arabidopsis thaliana (Arabidopsis lyrata), banana (Musa acuminata), African rice (Oryza glaberrima), Brevibacterium Oryza sativa (Oryza brachyantha), barley (Hordeum vulgare), Sorghum (Sorghum biocolor), maize (Zea mays), and millet (Setaria italica) were obtained, and these protein sequences were analyzed by alignment, and it was revealed that homologous proteins from different plants all have very similar conserved sequences and have high homology to each other (FIGS. 26 and 27), indicating that the protein plays a very important role in conservation of biological functions during the development of male organs of flowers.

The amino acid sequence of the fertility gene in Arabidopsis thaliana (Arabidopsis lyrata) is shown as SEQ ID NO. 9; the amino acid sequence of the fertility gene in banana (Musa acuminata) is shown in SEQ ID NO: 10; the amino acid sequence of the fertility gene in the African cultivated rice (Oryza glaberrima) is shown as SEQ ID NO. 11; the amino acid sequence of the fertility gene in the short drug wild rice (Oryza brachyantha) is shown as SEQ ID NO. 12; the amino acid sequence of the fertility gene in barley (Hordeum vulgare) is shown in SEQ ID NO: 13: the amino acid sequence of the fertility gene in Sorghum (Sorghum bicolor) is shown in SEQ ID NO: 14; the amino acid sequence of the fertility gene in the corn (Zea mays) is shown as SEQ ID NO: 15; the amino acid sequence of the fertility gene in millet (Setaria italica) is shown in SEQ ID NO: 16.

Example 10 transformation of a recessive Nuclear sterile line harboring the GMS2 Gene

Hybridization, backcrossing and selfing are carried out on the GMS2 mutant and a receptor with normal fertility, such as H28B, and molecular markers are used for GMS2 gene and genetic background selection in the process, so that the recessive nuclear sterile line with homozygous GMS2 mutant genes under the H28B background is finally obtained. The specific implementation steps are as follows:

1. crossing with receptor parent such as H28B as male parent and gms2 to obtain F₁。

2. With F₁Backcrossing the female parent with the recipient parent, e.g., H28B, to obtain BC₁F₁。

3. Planting BC₁F₁Primer InD48490_ F: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO:20) detects the gms2 genotype. Selecting gms2 heterozygous genotype, namely, a plant with 149bp and 140bp bands can be amplified simultaneously.

4. Using a group (e.g., 100, or 200, etc.) of genotypes having polymorphism between the gms2 mutant and the recurrent parent genome and uniformly distributed molecular markers (which may be but not limited to SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, scarr, etc.), genetic background identification is performed on the individuals selected in step 3, and plants with high similarity (e.g., greater than 88% similarity, or 2% selection rate, etc.) to the recurrent parent genotype are selected.

5. Using the plants and seeds selected in step 4Somatic parents, e.g. H28B, backcrossed to obtain BC₂F₁。

6. Planting BC₂F₁Repeating the steps 3 and 4, selecting plants heterozygous for the gms2 genotype and having high genetic background recovery rate (such as more than 98 percent, or 2 percent medium selection rate) and harvesting the plants from the inbred BC₂F₂。

7. Planting BC₂F₂Repeating the step 3 and the step 4, selecting the plant with the gene type of gms2 heterozygous and the highest genetic background homozygous rate, and harvesting the inbred seeds BC₂F₃。BC₂F₃The gms2 homozygous isolated from the progeny, i.e., gms2 recessive genic male sterile line, BC₂F₃Used for preserving the germplasm resources of the gms2 recessive genic male sterile line.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> rice male fertility regulation gene, application thereof and method for regulating rice fertility by using CRISPR-Cas9

<130> KHP201111609.1

<160> 69

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1582

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctccccaccg tgtcacacca caccacacaa caccaccacc gccgccatgg ccgccaccga 60

ccgccgcctg ctcttcctcc tggccgcctc cctcgccgtc gcggcggtga gctcccacaa 120

catcacggac atcctcgacg gctacccgga gtactcgctg tacaacagct acctctccca 180

gaccaaggtg tgcgacgaga tcaacagccg gagcacggtc acctgcctcg tgctcaccaa 240

cggcgccatg tcctccctcg tctccaacct ctccctcgcc gacatcaaga acgcgctccg 300

cctcctcacc ctcctcgact actacgacac caagaagctg cactccctca gcgacggctc 360

cgagctcacc accacgctgt accagaccac cggcgacgcc tccggtaaca tgggccacgt 420

caacatcacc aacctgcgcg gcggcaaggt tgggttcgcc tccgccgcgc ccggctccaa 480

gttccaggcc acctacacca agtccgtcaa gcaggagccg tacaacctct ccgttcttga 540

ggtctccgac cccatcacct tccccggcct cttcgactcc ccgtcggccg cgtcgaccaa 600

cctcaccgcg cttcttgaga aggccgggtg caagcagttc gcgcggctca tcgtgtcgtc 660

cggggtgatg aagatgtacc aggcggccat ggacaaggcg ctgacgctgt tcgcgcccaa 720

cgacgacgcg ttccaggcca agggcctgcc ggatctgagc aagctgacca gcgccgagct 780

ggtgacgctt ctgcagtacc acgccttgcc gcagtacgcg cccaaggcgt cgctcaagac 840

catcaagggc cacatccaga ccctggcctc caccggagcg ggtaagtacg acctctccgt 900

cgtcactaag ggcgacgacg tgtccatgga caccggcatg gacaagtccc gcgtcgcgtc 960

caccgtgctg gacgacaccc cgacggttat ccacacggtg gacagcgtgc tgctgccgcc 1020

agagctcttc ggtggcgcac cttcccccgc gccggcgccc ggaccggcaa gcgatgtgcc 1080

agccgcttct cccgcgccag aaggctcctc gccggcgccc tcccccaagg cggcgggcaa 1140

gaagaaaaag aagggcaagt cgccttccca ttccccaccc gcgcctccgg ccgacacgcc 1200

tgacatgtcg cccgccgacg cgcccgcggg agaagaggct gcagacaaag ccgagaagaa 1260

gaacggcgcc accgcggcgg ccacgagcgt tgcggccact gtggcctccg ccgccgctct 1320

gctcgccgcg tcgttcttgt gagcgtcagg tgttcgacgt tgagctctcg ttgttccccc 1380

ctgggcatgc atggtgtgat gcagtccggt gttcgcttct gagctcgtgg gctccatgga 1440

taatctcatc ctgaagttgt gttcttctct tcctggttgg tagtactcgg tagttagata 1500

ggatttgaat gattggatcc tcaggtggag aacggtgatt gtgatgccta ttttgttaga 1560

gctcggaacc atgttttgtt tt 1582

<210> 2

<211> 1296

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggccgcca ccgaccgccg cctgctcttc ctcctggccg cctccctcgc cgtcgcggcg 60

gtgagctccc acaacatcac ggacatcctc gacggctacc cggagtactc gctgtacaac 120

agctacctct cccagaccaa ggtgtgcgac gagatcaaca gccggagcac ggtcacctgc 180

ctcgtgctca ccaacggcgc catgtcctcc ctcgtctcca acctctccct cgccgacatc 240

aagaacgcgc tccgcctcct caccctcctc gactactacg acaccaagaa gctgcactcc 300

ctcagcgacg gctccgagct caccaccacg ctgtaccaga ccaccggcga cgcctccggt 360

aacatgggcc acgtcaacat caccaacctg cgcggcggca aggttgggtt cgcctccgcc 420

gcgcccggct ccaagttcca ggccacctac accaagtccg tcaagcagga gccgtacaac 480

ctctccgttc ttgaggtctc cgaccccatc accttccccg gcctcttcga ctccccgtcg 540

gccgcgtcga ccaacctcac cgcgcttctt gagaaggccg ggtgcaagca gttcgcgcgg 600

ctcatcgtgt cgtccggggt gatgaagatg taccaggcgg ccatggacaa ggcgctgacg 660

ctgttcgcgc ccaacgacga cgcgttccag gccaagggcc tgccggatct gagcaagctg 720

accagcgccg agctggtgac gcttctgcag taccacgcct tgccgcagta cgcgcccaag 780

gcgtcgctca agaccatcaa gggccacatc cagaccctgg cctccaccgg agcgggtaag 840

tacgacctct ccgtcgtcac taagggcgac gacgtgtcca tggacaccgg catggacaag 900

tcccgcgtcg cgtccaccgt gctggacgac accccgacgg ttatccacac ggtggacagc 960

gtgctgctgc cgccagagct cttcggtggc gcaccttccc ccgcgccggc gcccggaccg 1020

gcaagcgatg tgccagccgc ttctcccgcg ccagaaggct cctcgccggc gccctccccc 1080

aaggcggcgg gcaagaagaa aaagaagggc aagtcgcctt cccattcccc acccgcgcct 1140

ccggccgaca cgcctgacat gtcgcccgcc gacgcgcccg cgggagaaga ggctgcagac 1200

aaagccgaga agaagaacgg cgccaccgcg gcggccacga gcgttgcggc cactgtggcc 1260

tccgccgccg ctctgctcgc cgcgtcgttc ttgtga 1296

<210> 3

<211> 431

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ala Ala Thr Asp Arg Arg Leu Leu Phe Leu Leu Ala Ala Ser Leu

1 5 10 15

Ala Val Ala Ala Val Ser Ser His Asn Ile Thr Asp Ile Leu Asp Gly

20 25 30

Tyr Pro Glu Tyr Ser Leu Tyr Asn Ser Tyr Leu Ser Gln Thr Lys Val

35 40 45

Cys Asp Glu Ile Asn Ser Arg Ser Thr Val Thr Cys Leu Val Leu Thr

50 55 60

Asn Gly Ala Met Ser Ser Leu Val Ser Asn Leu Ser Leu Ala Asp Ile

65 70 75 80

Lys Asn Ala Leu Arg Leu Leu Thr Leu Leu Asp Tyr Tyr Asp Thr Lys

85 90 95

Lys Leu His Ser Leu Ser Asp Gly Ser Glu Leu Thr Thr Thr Leu Tyr

100 105 110

Gln Thr Thr Gly Asp Ala Ser Gly Asn Met Gly His Val Asn Ile Thr

115 120 125

Asn Leu Arg Gly Gly Lys Val Gly Phe Ala Ser Ala Ala Pro Gly Ser

130 135 140

Lys Phe Gln Ala Thr Tyr Thr Lys Ser Val Lys Gln Glu Pro Tyr Asn

145 150 155 160

Leu Ser Val Leu Glu Val Ser Asp Pro Ile Thr Phe Pro Gly Leu Phe

165 170 175

Asp Ser Pro Ser Ala Ala Ser Thr Asn Leu Thr Ala Leu Leu Glu Lys

180 185 190

Ala Gly Cys Lys Gln Phe Ala Arg Leu Ile Val Ser Ser Gly Val Met

195 200 205

Lys Met Tyr Gln Ala Ala Met Asp Lys Ala Leu Thr Leu Phe Ala Pro

210 215 220

Asn Asp Asp Ala Phe Gln Ala Lys Gly Leu Pro Asp Leu Ser Lys Leu

225 230 235 240

Thr Ser Ala Glu Leu Val Thr Leu Leu Gln Tyr His Ala Leu Pro Gln

245 250 255

Tyr Ala Pro Lys Ala Ser Leu Lys Thr Ile Lys Gly His Ile Gln Thr

260 265 270

Leu Ala Ser Thr Gly Ala Gly Lys Tyr Asp Leu Ser Val Val Thr Lys

275 280 285

Gly Asp Asp Val Ser Met Asp Thr Gly Met Asp Lys Ser Arg Val Ala

290 295 300

Ser Thr Val Leu Asp Asp Thr Pro Thr Val Ile His Thr Val Asp Ser

305 310 315 320

Val Leu Leu Pro Pro Glu Leu Phe Gly Gly Ala Pro Ser Pro Ala Pro

325 330 335

Ala Pro Gly Pro Ala Ser Asp Val Pro Ala Ala Ser Pro Ala Pro Glu

340 345 350

Gly Ser Ser Pro Ala Pro Ser Pro Lys Ala Ala Gly Lys Lys Lys Lys

355 360 365

Lys Gly Lys Ser Pro Ser His Ser Pro Pro Ala Pro Pro Ala Asp Thr

370 375 380

Pro Asp Met Ser Pro Ala Asp Ala Pro Ala Gly Glu Glu Ala Ala Asp

385 390 395 400

Lys Ala Glu Lys Lys Asn Gly Ala Thr Ala Ala Ala Thr Ser Val Ala

405 410 415

Ala Thr Val Ala Ser Ala Ala Ala Leu Leu Ala Ala Ser Phe Leu

420 425 430

<210> 4

<211> 1583

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctccccaacg tgtcacacca caccacacaa caccaccacc gccgccatgg ccgccaccga 60

ccgccgcctg ctcttcctcc tggccgcctc cctcgccgtc gcggcggtca gctcccacaa 120