Rice male fertility regulation gene mutant and molecular marker and application thereof

文档序号：354526 发布日期：2021-12-07 浏览：22次中文

阅读说明：本技术 一种水稻雄性育性调控基因突变体及其分子标记和应用 (Rice male fertility regulation gene mutant and molecular marker and application thereof ) 是由龙湍唐杰李燕群李佳林刘昊曾翔李新鹏安保光吴永忠黄培劲于 2020-06-02 设计创作，主要内容包括：本发明涉及生物技术领域,具体涉及一种水稻雄性育性调控基因突变体及其分子标记和应用。本发明提供的水稻雄性育性调控蛋白GMS2突变体可使水稻花粉完全不育,导致水稻雄性不育,GMS2突变体的基因组核苷酸序列如SEQ ID NO:6所示,CDS序列如SEQ ID NO:7所示,氨基酸序列如SEQ ID NO:8所示。利用本发明的核不育突变体可培育新的核不育系,为水稻核不育系培育提供了一个简单、迅速、有效的方法。本发明的核不育水稻材料可用于在水稻杂交时取代人工去雄,节约劳力,尤其可用于需要进行大量杂交的轮回选择育种,对扩大水稻的种质基础具有重要作用。(The invention relates to the technical field of biology, in particular to a rice male fertility regulation gene mutant and a molecular marker and application thereof. The rice male fertility regulation protein GMS2 mutant provided by the invention can ensure that rice pollen is completely sterile, so that rice male sterility is caused, the genome nucleotide sequence of the GMS2 mutant is shown as SEQ ID NO.6, the CDS sequence is shown as SEQ ID NO. 7, and the amino acid sequence is shown as SEQ ID NO. 8. The genic sterile mutant of the invention can be used for cultivating new genic sterile lines, and provides a simple, rapid and effective method for cultivating the genic sterile lines of rice. The nuclear sterile rice material can be used for replacing manual emasculation during rice hybridization, saves labor, is particularly suitable for recurrent selective breeding requiring a large number of hybridizations, and has an important effect on expanding the germplasm basis of rice.)

1. A plant male fertility-associated protein mutant, wherein the mutant comprises the following amino acid mutations relative to a wild-type plant male fertility-associated protein: deletion of at least one of the three amino acids N, x and Y in the NxYL conserved sequence;

wherein x is S or N;

the wild type plant male fertility related protein is the protein described in the following (1) or (2):

(1) a protein having an amino acid sequence shown as SEQ ID NO.3, 9, 10, 11, 12, 13, 14, 15 or 16;

(2) 3, 9, 10, 11, 12, 13, 14, 15 or 16 through substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the activity of regulating the male fertility of the plant.

2. The mutant according to claim 1, wherein the mutant comprises the following amino acid mutations relative to a wild-type plant male fertility-related protein: deletion of three amino acids of N, x and Y occurs in NxYL conserved sequence; wherein x is S or N;

preferably, when the wild-type plant male fertility-related protein is derived from rice, the mutant comprises the following amino acid mutations relative to the wild-type plant male fertility-related protein: deletion of amino acids 40, 41 and 42;

more preferably, when the wild-type plant male fertility-related protein is derived from rice, the mutant has an amino acid sequence shown as SEQ ID No. 8.

3. Nucleic acid encoding the mutant of claim 1 or 2;

preferably, when the wild-type plant male fertility-related protein is derived from rice, the nucleic acid encoding the mutant comprises the following nucleotide mutations relative to the nucleic acid encoding the wild-type plant male fertility-related protein: AACAGCTAC nucleotides corresponding to 118 th to 126 th of the coding region of the LOC _ Os04g48490 gene are deleted;

more preferably, when the wild-type plant male fertility-related protein is derived from rice, the genomic sequence of the nucleic acid encoding the mutant is shown as SEQ ID NO.6, and the CDS sequence is shown as SEQ ID NO. 7.

4. A biological material which is an expression cassette, vector, host cell, transgenic cell line or transgenic plant comprising a nucleic acid according to claim 3.

5. Use of any one of the following mutants of claim 1 or 2 or the nucleic acids of claim 3 or the biological material of claim 4:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) the application in plant cross breeding;

(4) application in plant germplasm resource improvement.

6. A plant, plant tissue or plant cell having the trait of male sterility wherein the gene encoding a wild type plant male fertility associated protein in its genomic sequence has an amino acid mutation comprising: deletion of at least one of the three amino acids N, x and Y in the NxYL conserved sequence; the wild type plant male fertility associated protein is as described in claim 1;

preferably, the plant is rice, the plant tissue is rice tissue, the plant cell is rice cell, and the genome or transcriptome of the rice, the rice tissue or the rice cell comprises the following mutations: the AACAGCTAC bp of the 118 th to 126 th of the coding region of the LOC _ Os04g48490 gene is deleted, so that the asparagine, serine and tyrosine of the 40 th, 41 th and 42 th of the protein coded by the LOC _ Os04g48490 gene are deleted; the sequence of the coding region of the LOC _ Os04g48490 gene is shown as SEQ ID NO.67, and the sequence of the coding protein of the LOC _ Os04g48490 gene is shown as SEQ ID NO. 3;

more preferably, the sequence of the LOC _ Os04g48490 gene in the genome sequence of rice, rice tissue or rice cells is mutated to the sequence shown as SEQ ID NO.6, resulting in the mutation of the CDS of the LOC _ Os04g48490 gene to the sequence shown as SEQ ID NO. 7 and the mutation of the encoded protein to the sequence shown as SEQ ID NO. 8.

7. Molecular marker for detecting the mutant according to claim 1 or 2 or the plant, plant tissue or plant cell according to claim 6, characterized in that it is obtained by amplification with primers whose nucleotide sequences are shown in SEQ ID NO 19-20.

8. A detection reagent or a kit containing a primer with a nucleotide sequence shown as SEQ ID NO. 19-20.

9. The use of any one of the molecular marker of claim 7 or the detection reagent or kit of claim 8 for:

(1) use in the detection of a mutant according to claim 1 or 2 or a plant, plant tissue or plant cell according to claim 6;

(2) the application in screening or breeding male sterile rice;

preferably, when primers shown in SEQ ID NO.19-20 are selected to amplify the rice genomic DNA, if only one 140bp band can be amplified, the rice expresses the mutant of claim 2, has a homozygous genotype in which AACAGCTAC bp from 118 th to 126 th of the LOC _ Os04g48490 gene coding region are deleted, and shows a male sterile character; if only one 149bp band is amplified, the rice does not express the mutant of claim 2, does not have the genotype that AACAGCTAC nucleotides from 118 th to 126 th of the LOC _ Os04g48490 gene coding region are deleted, and shows male fertility traits; if the 140bp and 149bp bands are amplified simultaneously, the rice expresses the mutant of claim 2, has a heterozygous genotype of deletion of AACAGCTAC bp from 118 th to 126 th of the LOC _ Os04g48490 gene coding region, and shows male fertility.

10. A method of producing a male sterile plant comprising: mutating a wild type plant male fertility-associated protein, said mutation comprising a mutation of: deletion of at least one of the three amino acids N, x and Y in the NxYL conserved sequence; the wild type plant male fertility associated protein is as described in claim 1;

preferably, the plant is rice, and the method comprises: mutating the genome or transcriptome of rice, said mutation comprising: the AACAGCTAC bp of the 118 th to 126 th of the coding region of the LOC _ Os04g48490 gene is deleted, so that the asparagine, serine and tyrosine of the 40 th, 41 th and 42 th of the protein coded by the LOC _ Os04g48490 gene are deleted; the sequence of the coding region of the LOC _ Os04g48490 gene is shown as SEQ ID NO.67, and the sequence of the coding protein of the LOC _ Os04g48490 gene is shown as SEQ ID NO. 3;

more preferably, the method comprises: the rice expresses the male fertility-related protein mutant with the sequence shown in SEQ ID NO.8, and does not express the wild type plant male fertility-related protein shown in SEQ ID NO. 3.

Technical Field

The invention relates to the technical field of biology, in particular to a plant fertility-related protein GMS2 mutant, a coding gene of the mutant, a molecular marker of the mutant and application of the mutant in cross breeding.

Background

Rice is one of the most important food crops in the world. With the increase of population and the improvement of life quality, the annual yield of rice is expected to be improved by 1-2 times in 2050 years to meet the development demand of human beings. The hybrid rice is a first filial generation obtained after the hybridization of parents, the yield of the hybrid rice is often improved by more than 15 percent compared with that of the conventional rice parents, and the resistance and the adaptability of the hybrid rice are far better than those of the parents. Therefore, the application and popularization of hybrid rice is an important way for increasing the rice yield.

The male sterile line is a key node of hybrid rice breeding technology. The male sterile line refers to a plant line with abnormal development of male gametes and loss of fertility and normal development of female gametes. It can only be used as female parent to accept pollen of male parent, and can not be fruited by selfing. The male sterile line applied in the present hybrid rice production has two types of nucleic-cytoplasmic interaction type and photo-thermo-sensitive type. The sterile gene of the nuclear-cytoplasmic-interaction-type male sterile line is in the cytoplasm, and the nucleus does not have a fertility restorer gene. Fertile first-generation hybrids can be produced when a restorer line with a fertility restorer gene in the nucleus is crossed with its counterpart, and sterile line seeds can be propagated when a maintainer line without a fertility restorer gene in the nucleus and without a sterile gene in the cytoplasm is crossed with it. The breeding technique of hybrid rice is often called "three-line method" because of the need of three lines of sterile line, maintainer line and restoring line. Several genes controlling cytoplasmic-nuclear sterility and the corresponding restoration of fertility have been cloned (Chen and Liu, 2014, Male sterility and fertility restoration in crops, Annu Rev Plant Biol, 65: 579-. The nucleoplasm interactive sterile line is the first sterile line applied in large scale in hybrid rice breeding, and lays a material foundation for the establishment and development of the hybrid rice industry. However, the combination of the nuclear-cytoplasmic interaction type sterile line is limited by the genotype of the restorer line, so that only about 5 percent of the germplasm resources can be utilized. The cytoplasmic sterile gene has the potential risk of causing poor rice quality and epidemic of specific diseases and insect pests.

The photo-thermo-sensitive male sterile line is a sterile line with fertility regulated by photo-temperature environment. The sterile line keeps sterile under a certain light-temperature condition and can be used for matched hybridization. When the conditions are changed, the sterile line restores fertility and can be used for sterile line propagation. The photo-thermo sensitive male sterile line realizes the integration of the sterile line and the maintainer line, and only the male parent and the male parent are matched to produce the first filial generation hybrid, so the corresponding breeding technology is often called as a two-line method. Genes regulating photo-thermo-sensitive Male sterility in the nucleus, genes that have been cloned so far include PMS3, TMS5, CSA and TMS10(Chen and Liu, 2014, Male sterility and mobility restriction in crops, Annu Rev Plant Biol, 65: 579-. Compared with the nuclear-cytoplasmic interaction type sterile line, the photo-thermo sensitive type sterile line has simple breeding procedure and more free matching due to the wide existence of the restoring genes. The large-scale application of the photo-thermo-sensitive sterile line greatly consolidates and promotes the development of the hybrid rice industry. However, the fertility of the sterile line is influenced by the light and temperature environment, so that the seed production risk is high, and the seed production region is limited.

In order to overcome the key defects in the prior hybrid rice breeding technology, the creation and utilization of a new type of sterile line is an important breakthrough. The nuclear male sterility is generated by nuclear gene mutation, and has dominant mutation, recessive mutation, sporophyte gene mutation and gametophyte gene mutation. Dominant mutations and gametophytic gene mutations can only be inherited by female gametes, recessive mutations can be inherited by both female and male gametes, and Mendelian's law is followed. The invention provides a plant fertility related gene and a recessive genic sterile type male sterile line generated based on the gene mutation. The sterile line has stable fertility, is only regulated and controlled by a single gene of nuclear coding, and is not influenced by light and temperature environments. The fertility restorer gene of the sterile line is widely existed in rice germplasm resources, and can also restore fertility by transferring wild type genes. The gene and the sterile line generated by the gene mutation provide elements for developing a novel rice hybrid breeding technology, and lay a foundation for solving the problems in the prior art.

Disclosure of Invention

The invention aims to provide a plant fertility-related protein GMS2 mutant, a coding gene of the mutant, a molecular marker of the mutant and application of the mutant in cross breeding.

The invention discloses a rice fertility-related protein GMS2 mutant, which is deleted with 3 amino acids of asparagine, serine and tyrosine at positions 40-42 relative to a wild GMS2 protein.

GMS2 is located on No. 4 chromosome of rice, and its genome nucleotide sequence in japonica rice variety Nipponbare is shown as SEQ ID NO.1, CDS sequence is shown as SEQ ID NO. 2, and amino acid sequence is shown as SEQ ID NO. 3. The genome nucleotide sequence of indica rice variety 9311 is shown as SEQ ID NO. 4, the CDS sequence is shown as SEQ ID NO.67, and the amino acid sequence is the same as Nipponbare. The amino acid sequence of the fertility gene in Arabidopsis thaliana (Arabidopsis lyrata) is shown as SEQ ID NO. 9; the amino acid sequence of the fertility gene in banana (Musa acuminata) is shown as SEQ ID NO: 10; the amino acid sequence of the fertility gene in the African cultivated rice (Oryza glaberrima) is shown as SEQ ID NO. 11; the amino acid sequence of the fertility gene in the short drug wild rice (Oryza brachyantha) is shown as SEQ ID NO. 12; the amino acid sequence of the fertility gene in barley (Hordeum vulgare) is shown in SEQ ID NO: 13: the amino acid sequence of the fertility gene in Sorghum (Sorghum bicolor) is shown in SEQ ID NO: 14; the amino acid sequence of the fertility gene in the corn (Zea mays) is shown as SEQ ID NO: 15; the amino acid sequence of the fertility gene in millet (Setaria italica) is shown in SEQ ID NO: 16.

The fertility gene can be obtained by separating from various plants. It will be understood by those skilled in the art that the fertility gene of the present invention includes a highly homologous functionally equivalent sequence to the GMS2 gene and having the same fertility regulatory function. The highly homologous functionally equivalent sequences include DNA sequences that are capable of hybridizing under stringent conditions to the nucleotide sequence of the GMS2 gene disclosed herein. "stringent conditions" used in the present invention are well known and include, for example, hybridization at 60 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH6.4) and l mM EDTA, followed by washing with a washing solution containing 0.1% SDS, and 0.1 XSSC at 65 ℃ for 15 to 60 minutes.

Functionally equivalent sequences also include DNA sequences having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence similarity to the nucleotide sequence of the GMS2 gene disclosed herein, and having fertility regulatory functions, which may be isolated from any plant. The percentage of sequence similarity can be obtained by well-known Bioinformatics algorithms, including the Myers and Miller algorithms (Bioinformatics, 4 (1): 1117, 1988), the Needleman-Wunsch global alignment (J Mol Biol, 48 (3): 443-453, 1970), the Smith-Waterman local alignment (J Mol Biol, 147: 195-197, 1981), the Pearson and Lipman similarity search (PNAS, 85 (8): 2444-2448, 1988), the Karlin and Altschul algorithms (Altschul et al, J Mol Biol, 215 (3): 403-410, 1990; PNAS, 90: 5873-5877, 1993). This is familiar to the person skilled in the art.

Based on the above findings, the first aspect of the present invention provides a plant male fertility-related protein mutant comprising the following amino acid mutations relative to a wild-type plant male fertility-related protein: deletion of at least one of the three amino acids N, x and Y in the NxYL conserved sequence;

wherein x is S or N;

the wild type plant male fertility related protein is the protein described in the following (1) or (2):

(1) a protein having an amino acid sequence shown as SEQ ID NO.3, 9, 10, 11, 12, 13, 14, 15 or 16;

Preferably, the mutant comprises the following amino acid mutations relative to a wild-type plant male fertility-related protein: deletion of three amino acids of N, x and Y occurs in NxYL conserved sequence; wherein x is S or N.

For rice, the mutant comprises the following amino acid mutations relative to its wild-type male fertility-associated protein: and the amino acids at the 40 th, 41 th and 42 th positions are deleted, and the wild type male fertility related protein has a sequence shown in SEQ ID NO.3 or the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the SEQ ID NO.3 and has the activity of regulating the male fertility of the plant.

The invention provides a rice GMS2 protein mutant, which has an amino acid sequence shown in SEQ ID NO. 8.

The invention also provides a nucleic acid for coding the plant male fertility-related protein mutant.

The nucleic acid of the invention can be isolated from any plant, including but not limited to, brassica, maize, wheat, sorghum, bredigo, african rice, brachypodium, crambe, white mustard, sesame, soybean, arabidopsis, phaseolus, peanut, oriental wormwood, oat, barley, oat, Rye (Rye), millet, milo, triticale, einkorn, Spelt, emmer, flax, grasses (Gramma gramsma), tripsacum, sorghum, fescue, perennial wheat straw, licorice, russian rose, ruscus carob, papaya, banana, safflower, oil palm, cantaloupe, apple, cucumber, pepino, sword-weed, chrysanthemum, liliaceae, cotton, sunflower, sugar beet, coffee, ornamental plants, pine, and the like. Preferably, the plant comprises maize, millet, arabidopsis thaliana, brachypodium distachyon, soybean, safflower, mustard, wheat, barley, rye, brachypodium, african rice, cotton and sorghum.

Specifically, taking rice as an example, the nucleic acid encoding the mutant comprises the following nucleotide mutations relative to the nucleic acid encoding the wild-type plant male fertility-related protein: AACAGCTAC nucleotides corresponding to positions 118-126 of the coding region of the LOC _ Os04g48490 gene are deleted.

For the rice GMS2 protein mutant, the genome nucleotide sequence of the mutated GMS2 is shown as SEQ ID NO.6, and the CDS sequence is shown as SEQ ID NO. 7.

The invention also provides a biological material which is an expression cassette, a vector, a host cell, a transgenic cell line or a transgenic plant containing the nucleic acid encoding the plant male fertility-related protein mutant.

A second aspect of the invention provides the use of any one of the following for said mutant or said nucleic acid or said biological material:

(1) the application in regulating and controlling the male fertility of plants;

(2) the application in the preparation of male sterile plants;

(3) the application in plant cross breeding;

(4) application in plant germplasm resource improvement.

In the above (1), the male fertility of the plant may be controlled to be reduced or lost. The method can be realized by regulating and controlling the development of plant male germ cells and pollen. Wherein the male fertility of the plant is reduced or lost by mutating a gene encoding a male fertility-associated protein of the plant so that the expression level thereof is reduced or not expressed, or by introducing a suppressor of a nucleic acid encoding the male fertility-associated protein of the plant into the plant.

In the above (2), the male sterile plant is a recessive nuclear sterile line having homozygous mutation of nucleic acid encoding the male fertility-associated protein of the plant.

In the above (3), a recessive nuclear sterile line having a homozygous mutation of a nucleic acid encoding the plant male fertility-related protein is used for hybrid breeding.

In the above (4), the improvement includes yield improvement, quality improvement, disease and pest resistance, stress resistance, lodging resistance and the like.

The plants described above are self-pollinated or cross-pollinated crops, including but not limited to corn, wheat, sorghum, rice.

The third aspect of the invention provides a plant, plant tissue or plant cell, which has male sterility, wherein the genome sequence of the plant has amino acid mutation comprising the following gene code protein of wild plant male fertility relative protein: deletion of at least one of the three amino acids N, x and Y occurs in the NxYL conserved sequence, wherein the wild type plant male fertility associated protein is as described above.

Preferably, the gene encoding the wild type plant male fertility associated protein in the genomic sequence of the plant, plant tissue or plant cell has an amino acid mutation comprising: deletion of three amino acids of N, x and Y occurs in NxYL conserved sequence.

Preferably, the plant is rice, the plant tissue is rice tissue, and the plant cell is rice cell.

The invention provides rice, wherein the genome or transcriptome of the rice comprises the following mutations: the AACAGCTAC bp of the 118 th to 126 th of the coding region of the LOC _ Os04g48490 gene is deleted, so that the asparagine, serine and tyrosine of the 40 th, 41 th and 42 th of the protein coded by the LOC _ Os04g48490 gene are deleted; the sequence of the coding region of the LOC _ Os04g48490 gene is shown as SEQ ID NO.67, and the sequence of the coding protein of the LOC _ Os04g48490 gene is shown as SEQ ID NO. 3.

The invention also provides a rice tissue, wherein the genome or transcriptome of the rice tissue comprises the following mutations: the AACAGCTAC bp of the 118 th to 126 th positions of the coding region of the LOC _ Os04g48490 gene is deleted, which results in the deletion of asparagine, serine and tyrosine at the 40 th, 41 th and 42 th positions of the protein coded by the LOC _ Os04g48490 gene.

The invention also provides a rice cell, wherein the genome or transcriptome of the rice cell comprises the following mutations: the AACAGCTAC bp of the 118 th to 126 th positions of the coding region of the LOC _ Os04g48490 gene is deleted, which results in the deletion of asparagine, serine and tyrosine at the 40 th, 41 th and 42 th positions of the protein coded by the LOC _ Os04g48490 gene.

The invention further provides rice, rice tissues or rice cells, wherein the sequence of the LOC _ Os04g48490 gene in the genome sequence is mutated into the sequence shown as SEQ ID NO.6, the CDS of the LOC _ Os04g48490 gene is mutated into the sequence shown as SEQ ID NO. 7, and the encoded protein is mutated into the sequence shown as SEQ ID NO. 8.

The invention provides rice mutant material GMS2, GMS2 shows male sterility, the sequence mutation of LOC _ Os04g48490(GMS2) gene in the genome sequence is shown as SEQ ID NO.6, the CDS mutation of LOC _ Os04g48490 gene is shown as SEQ ID NO. 7, and the amino acid sequence mutation of encoded protein is shown as SEQ ID NO. 8; the genome sequence of the LOC _ Os04g48490 gene is shown in SEQ ID NO. 4.

Specifically, the genome sequence of the rice mutant material GMS2 is deleted at AACAGCTAC bases at 118 th to 126 th of the coding region (sequence shown as SEQ ID NO:67) of LOC _ Os04g48490 gene (GMS2), so that asparagine, serine and tyrosine at 40 th, 41 th and 42 th positions of the protein coded by LOC _ Os04g48490 gene (sequence shown as SEQ ID NO:3) are deleted.

The deletion of asparagine, serine and tyrosine at positions 40, 40 and 42 of GMS2 results in the loss of function of GMS2 protein, which in turn results in male sterility of rice.

It will be appreciated by those skilled in the art that the nucleotide sequence shown in SEQ ID NO 6 can be introduced into recipient plants by crossing, backcrossing or transgenic methods to obtain novel male sterile mutant material.

The fourth aspect of the invention provides a molecular marker for detecting the mutant or the mutant material, wherein the molecular marker is obtained by amplifying a primer with a nucleotide sequence shown as SEQ ID NO. 19-20.

The invention provides a specific primer for amplifying the molecular marker, and the nucleotide sequence of the specific primer is shown as SEQ ID NO. 19-20.

The invention provides a detection reagent or a kit containing a primer with a nucleotide sequence shown as SEQ ID NO. 19-20.

The invention also provides any one of the following applications of the molecular marker or the detection reagent or the kit:

(1) the application of the mutant in detecting the plant male fertility-related protein mutant or the mutant material;

(2) application in screening or breeding male sterile rice mutants.

Specifically, when primers shown in SEQ ID NO.19-20 are selected to amplify rice genomic DNA, if only one 140bp band can be amplified, the rice expresses the plant male fertility-related protein mutant, has a homozygous genotype of which the AACAGCTAC bases at positions 118-126 of a LOC _ Os04g48490 gene coding region are deleted, and shows a male sterility character; if only one 149bp band is amplified, the rice does not express the plant male fertility-related protein mutant, does not have the genotype that AACAGCTAC bases at the 118 th site to the 126 th site of the LOC _ Os04g48490 gene coding region are deleted, and shows the male fertility character; if the two bands of 140bp and 149bp can be amplified simultaneously, the rice expresses a hybrid genotype that the plant male fertility-related protein mutant and AACAGCTAC nucleotides from 118 th to 126 th of the LOC _ Os04g48490 gene coding region are deleted, and the rice expresses male fertility traits.

In a fifth aspect of the invention, there is provided a method of producing a male sterile plant comprising: mutating a wild type plant male fertility-associated protein, said mutation comprising a mutation of: deletion of at least one of the three amino acids N, x and Y in the NxYL conserved sequence; the wild type plant male fertility related protein is the same as the above.

Preferably, the plant is rice, and the method comprises: mutating the genome or transcriptome of rice, said mutation comprising the following mutations: the AACAGCTAC bp of the 118 th to 126 th of the coding region of the LOC _ Os04g48490 gene is deleted, so that the asparagine, serine and tyrosine of the 40 th, 41 th and 42 th of the protein coded by the LOC _ Os04g48490 gene are deleted; the sequence of the coding region of the LOC _ Os04g48490 gene is shown as SEQ ID NO.67, and the sequence of the coding protein of the LOC _ Os04g48490 gene is shown as SEQ ID NO. 3.

More preferably, the method comprises: the rice expresses the male fertility-related protein mutant with the sequence shown in SEQ ID NO.8, and does not express the wild type plant male fertility-related protein shown in SEQ ID NO. 3.

The mutation can be realized by gene editing, hybridization, backcrossing, selfing or asexual propagation.

Compared with the prior art, the invention has the following beneficial effects: the rice male fertility regulation protein GMS2 mutant provided by the invention can ensure that rice pollen is completely sterile, so that rice male sterility is caused. The genic sterile mutant of the invention can be used for cultivating new genic sterile lines, and provides a simple, rapid and effective method for cultivating the genic sterile lines of rice. Compared with the existing three-line and two-line sterile lines, the rice sterile mutant caused by the GMS2 mutant has the advantages of stable sterile character, high utilization rate of germplasm resources and the like, can be used for recurrent selective breeding requiring a large number of hybrids, and has great application value in the field of hybrid rice breeding.

Drawings

FIG. 1 shows the plant morphology of the wild type (left) and the gms2 mutant (right) during the grain filling phase in example 2 of the present invention.

FIG. 2 is spikelet morphology of wild-type (left) and gms2 mutant (right) in example 2 of the present invention.

FIG. 3 shows the ear flowering patterns of the wild type (left) and the gms2 mutant (right) in example 2 of the present invention.

FIG. 4 is floret pattern of wild type (left) and gms2 mutant (right) after dissection in example 2 of the invention.

FIG. 5 shows the anther morphology of wild type (left) and gms2 mutant (right) in example 2 of the present invention.

FIG. 6 shows iodine staining of wild type (left) and gms2 mutant (right) pollen in example 2 of the present invention.

FIG. 7 shows the identification of the genotype of sterile individuals in a defined population by using the InD48490 marker in example 4 of the present invention. The size of the upper band is 149bp, and the size of the lower band is 140 bp. The DNA templates of the first 2 left lanes are gms2 mutant and Minghui 63, respectively, and the following lane is the sterile individual in the mapped population.

FIG. 8A is a map of the GMS2 gene clone in example 4 of the present invention.

FIG. 8B is a schematic diagram of the mutation site of gms2 mutant in example 4 of the present invention.

FIG. 9 shows the nucleotide sequence differences of the GMS2 gene in the 9311(48490-9311), Minghui 63(48490-MH63), Nipponbare (48490-Nip) and GMS2 mutant (48490-3148) materials in example 4 of the present invention. The areas of difference are highlighted with a grey background. The position of the last nucleotide in each row in the entire gene sequence is indicated at the end of the row. The initiation codon ATG and the termination codon TGA are boxed, respectively.

FIG. 10 shows the amino acid sequence differences between the 9311(48490-9311) and the GMS2 mutant (48490-3148) encoded by GMS2 in example 4 of the present invention. The difference is highlighted with a light grey background. The position of the last amino acid residue in each row in the entire protein sequence is indicated at the end of the row.

FIG. 11 shows the genotyping of the progeny of the GMS2 hybrid in example 4 of the present invention. The size of the upper band is 149bp, and the size of the lower band is 140 bp. Arrows indicate samples from male sterility.

FIG. 12 shows the expression levels of GMS2 in young ears of rice at different tissues and different developmental stages in example 5 of the present invention. Flowers 1-9 represent the glume primordium differentiation stage to pollen maturation stage of young ear development.

FIG. 13 is a schematic diagram of pC9M-GMS2 vector in example 6 of the present invention. T1 represents target site 1 and T2 represents target site 2.

FIG. 14A is the target site sequence analysis of partial transgenic positive plants after GMS2 gene knockout by using CRISPR/Cas9 system in example 6 of the present invention.

FIG. 14B is a diagram showing the sequencing peaks of transgenic plant PC9M-GMS2-Line17 at target site 1 and target site 2 in example 6 of the present invention. Wherein, in the sequencing peak plot at target site 1, the arrow points to the deletion site; in the sequencing peak plot at target site 2, the arrow points to the insertion site.

FIG. 15 shows the entire plant morphology of GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 16 shows glume morphologies of GMS2 wild type (left) and knockout plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 17 shows anther morphology of GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 18 shows the results of iodine staining of pollen with GMS2 wild type (left) and knock-out plant PC9M-GMS2-Line17 (right) in example 6 of the present invention.

FIG. 19 is a schematic diagram of pC1300-48490-genome vector in example 7 of the present invention.

FIG. 20 shows the plant morphology of the wild type plant (left) and the complementary plant of the gms2 mutant (right) in example 7 of the present invention.

FIG. 21 shows glume morphology of wild type plants (left) and gms2 mutant complementation plants (right) in example 7 of the invention.

FIG. 22 shows anther morphology of wild type plants (left) and gms2 mutant complementation plants (right) in example 7 of the invention.

FIG. 23 shows the results of iodine pollen staining of wild type plants (left) and complementary plants of gms2 mutant (right) in example 7 of the present invention.

FIG. 24 is a sequence alignment chart of a protein encoded by the rice GMS2 gene in example 8 of the present invention and homologous proteins in genomes of other species. Including Arabidopsis thaliana (Arabidopsis thaliana) protein AT3G60900.1, Musa acuminata (Musa acuminata) protein GSMUA _ Achr11P03090_001, Oryza glaberrima (Oryza glaberrima) protein ORGLA04G0194100.1, Brevibacterium paniculatum (Oryza brachyantha) protein OB04G29380.1, Hordeum vulgare (Hordeum vulgare) protein MLOC _7985.1, Sorghum (Sorghum biocolor) protein Sb06g026030.1, maize (Zea mays) protein MZM2G003752_ P01, and millet (Setaria italica) protein Si010135 m. NxYL conserved sequences are boxed.

FIG. 25 is a phylogenetic tree analysis of the protein encoded by the GMS2 gene of rice in example 8 of the present invention.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the scope of the invention. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless indicated to the contrary, all techniques used or referred to herein are standard techniques recognized by those of ordinary skill in the art. The test materials are, unless otherwise specified, all materials commonly used in the field of the present invention. The test reagents used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

The male sterility of the present invention refers to the abnormal development of the male reproductive organ of a plant (normal stamens, anthers or normal male gametophytes cannot be produced) and the loss of fertility caused by the functional change of the nuclear gene of the plant, namely the male sterility (Genic male sterility) rather than the Cytoplasmic nuclear sterility. Both the abnormality and restoration of fertility in the male reproductive organs are controlled by genes in the nucleus.

Therefore, the invention also comprises the purpose of utilizing the sequence described in the sequence table to regulate the male gamete fertility of the plant, namely utilizing the gene sequence provided by the invention to influence the functions of the same or homologous genes in other plants at the genome, and/or transcriptome, and/or proteome level so as to achieve the purpose of controlling the male reproductive organ fertility. For example, including but not limited to the following methods: the function of a plant gene is influenced or altered by the inhibition of gene expression or loss of protein function through variation of the native sequence, by transferring the antisense sequence of the gene or introducing hairpin structures into the plant, or by combining the gene with other sequences (DNA or RNA) to produce new functionally active DNA or RNA strands. Or any other technique known to those skilled in the art that can be used to affect male fertility in a plant.

The invention comprises a rice GMS2 gene, wherein the dominant allele of the gene has a key effect on the male fertility of plants, and the recessive allele with the function deletion can cause male sterility. The gene is located on the No. 4 chromosome of rice, and the specific positions of the gene are shown in FIGS. 8A and 8B.

The gene sequence and its homologous sequences can be obtained from various plants including, but not limited to, Selaginella moellendorffii, Populus deltoides (Populus trichocarpa), Brassica rapa (Brassica rapa), Arabidopsis thaliana (Arabidopsis thaliana), Glycine max, Solanum tuberosum, Vitis vinifera, Musa acuminata (Musa acuminata), Setaria Setaria italica, Sorghum bicolor, Zea mays, Brachypodium brachycanthum (Brachypodum distyrum), Hordeum vulgare (Hordeum vulgare), Brachypodium brevicum (Oryza sativa), Oryza sativa (Oryza sativa), Oryza Japonica (Oryza sativa), Oryza sativa Indica (Oryza sativa, etc. Methods of obtaining include, but are not limited to: calling from the genome sequence database, and/or cDNA sequence database, and/or protein sequence database of other plants by blastx, blastn using rice GMS2 gene sequence, or blastp using rice GMS2 amino acid sequence; designing a primer by taking the DNA or cDNA or RNA sequence of the rice GMS2 gene as a reference sequence, and directly obtaining the primer from the genomic DNA or cDNA or RNA of other plants by using a PCR method; probes were designed based on the gene sequence of rice GMS2, and DNA or cDNA or RNA fragments containing homologous gene sequences were isolated from genomic libraries by nucleic acid hybridization.

GMS2 gene homologous sequence refers to the plant gene sequence with Identities greater than or equal to 35% and Positives greater than or equal to 50% after blastp comparative analysis with the amino acid sequence of SEQ ID NO 3. When performing blastp, all parameters were performed following the default settings shown by http:// blast. ncbi. nlm. nih. gov/.

The following more detailed description is provided by way of illustration and description and is not intended to limit the scope of the invention.

Example 1 screening of Rice Male sterile mutant gms2

Irradiating 93-11 seeds with cobalt 60 in 6 months in 2013 to obtain M₀And (4) generation. Planting the irradiated seeds in the test field of Lingao county of Hainan province, harvesting seeds by single plant after maturation to obtain M₁About 6500 parts of substitute material. In 2014 spring, 3617M with large seed quantity are selected₁The generation material was planted in lines, 50 individuals were planted in each line. Screening various mutants of plant type, spike type, fertility, yield and the like at a tillering stage, a booting stage, a heading stage, a flowering stage and a filling stage respectively, and harvesting and storing. In this case, a sterile mutant, designated gms2, was found in line No. 3148.

Example 2 phenotypic analysis of Rice Male sterile mutant gms2

The gms2 mutant plants (FIG. 1) and spikelets (FIG. 2) were morphologically normal and flowering later compared to wild type. The size of the palea, the size of the small flower and the opening time have no obvious difference with the wild type (figure 3). The shape of the florets of the mutants is observed under a microscope, and the ovary, the style and the stigma are slightly larger than those of the wild type (figure 4), but the anther is thinner and lighter than the wild type (figure 5). With iodine-potassium iodide solution (0.6% KI, 0.3% I)₂W/w) solution stains pollen, as shown in FIG. 6, wild type pollen grains are large and round and stained a blue-black color, while mutant pollen grains shrink and cannot be stained. Wild type plants of the same family are normally fruited after bagging and selfing, while the gms2 mutant is not fruitful. And pollination of the gms2 mutant by using the rice variety 93-11 as a male parent can produce fruit. This indicates that the mutant is a male sterile mutant.

Example 3 genetic analysis of Rice Male sterile mutant gms2

Planting 80 segregation population strains of gms2 in M5 generation, wherein 64 strains have normal fertility, 16 strains are sterile, and the segregation ratio of fertile strains to sterile strains is 3:1 (chi)²＝0.57，P>0.05). Backcross 93-11 with gms2, and plants in generation F1 were all fertile. Planting 70 segregation population strains of gms2 in the F2 generation, wherein 57 strains have normal fertility, 13 strains are sterile, and the segregation ratio of fertile strains to sterile strains meets 3:1 (chi)²＝0.85，P>0.05). The above results indicate that the sterility trait of gms2 is controlled by a recessive single gene.

Example 4 cloning of Male sterile Gene GMS2 of Rice

The GMS2 gene was mapped using the map-based cloning method. An F containing 66 mutant plants is constructed by taking Minghui 63 as a male parent and hybridizing with gms2 mutant₂And (4) a group. This population was used to locate GMS2 within the 6861.252Kb range between chromosome 4 SSR markers RM17332 and RM280, closely linked to SSR marker RM303 and Indel marker 4826. The number of crossover individuals between the GMS2 gene and the four markers was 8, 1, and 32, respectively. Selection of F Using linkage markers₂The gms2 heterozygous individual in the population developed an F₃The population comprises 1937 mutant individuals. At F₃The number of crossover individuals between RM303, 4826, S10 and GMS2 genes in the population was 10, 7 and 8, respectively. By analyzing and comparing the sequences of 93-11 and Minghui 63 genomes between RM303 and S10, 5 novel single nucleotide polymorphism markers S4b, S3b, S2, S1, S8 were developed and experimentally confirmed. In the F3 population, the above-mentioned labeled crossover individuals were 6, 1, 4, and 8, respectively (FIG. 7). Taking 77kb upstream and downstream of S2 as candidate segments, a total of 11 annotated genes were found in the segments, of which LOC _ Os04g48490 is predicted to encode a fascin-like arabinogalactan protein, presumably the GMS2 gene. In Nipponbare, LOC _ Os04g48490 genome nucleotide sequence length 1582bp (48490-Nip, sequence as SEQ ID NO:1), CDS nucleotide sequence length 1296bp (sequence as SEQ ID NO:2), contains 1 exon (FIG. 8A and FIG. 8B), encodes a protein 432 amino acid residues (sequence as SEQ ID NO: 3). The sequences of the pair of labeled primers used to locate the GMS2 gene are shown in Table 1 (SEQ ID NO. 37-66).

TABLE 1 sequence of the marker primer pairs for mapping the GMS2 Gene

Design of primers based on 48490-Nip sequence amplification and sequencing of alleles of LOC _ Os04g48490 gene in the 93-11, Minghui 63 and gms2 mutants was performed, with primer sequences as shown in Table 2. All PCR amplifications were performed using KOD FX DNA Polymerase (TOYOBO CO., LTD. Life Science Department, Osaka, Japan) on a Thermo scientific Arktik thermal cycler according to the reaction system and conditions described in the product. The PCR product was sent to Nanjing Kingsrei Biotech Ltd for sequencing. Sequencing results were spliced using DNAman 6.0. The LOC _ Os04g48490 genes in 93-11, Minghui 63 and gms2 mutants were designated 48490-9311 (SEQ ID NO:4), 48490-MH63 (SEQ ID NO:5) and 48490-3148 (SEQ ID NO:6), respectively.

TABLE 2 primer pair sequences for amplification of LOC _ Os04g48490

Multiple sequence alignments were performed for 48490-9311, 48490-3148, 48490-MH63, and 48490-Nip, and the results are shown in FIG. 9. 48490-9311 and 48490-3148 compared to 48490-3148, 48490-3148 had only one AACAGCTAC deletion starting at the 118 th base after ATG (FIGS. 8B and 9). Amino acid sequence analysis showed that this mutation would result in the deletion of asparagine, serine and tyrosine residues at positions 40 to 42 in the protein encoded by the LOC _ Os04g48490 gene (FIG. 10). 48490-MH63 and 48490-Nip also differ from 48490-3148 by 118 bases after ATG (FIG. 9). This indicates that the deletion mutation of AACAGCTAC starting at base 118 after ATG is responsible for male sterility of the gms2 mutant. Furthermore, the sequences of 48490-9311 and 48490-MH63 were completely identical, whereas compared to 48490-Nip, there was a SNP with a C-to-A at position 8, a SNP with a G-to-C at position 109, a SNP with a C-to-T at position 1288, and a G base insertion at position 1515 (FIG. 9). Two nucleotide differences fall within the 5 'UTR and 3' UTR, respectively, and the other two nucleotide differences, although falling within exons, do not affect the encoded protein. This indicates that the LOC _ Os04g48490 gene is highly conserved in rice, and its nucleotide sequence has only 4 bases difference even between indica and japonica subspecies, while the protein sequence has no difference. In 93-11 LOC _ Os04g48490 has CDS nucleotide sequence shown in SEQ ID NO:67, and encoding protein sequence shown in SEQ ID NO: 3. The CDS nucleotide sequence and amino acid sequence of LOC _ Os04g48490 in the gms2 mutant are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

Based on the sequencing result of LOC _ Os04g48490 gene mutation site, specific primers InD48490_ F are designed on both sides of the mutation site: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO: 20). A149 bp band will be generated when InD48490_ F and InD48490_ R pairs amplify wild-type LOC _ Os04g48490 gene and a 140bp band will be generated when mutant LOC _ Os04g48490 gene is amplified. Genotyping was performed on the M6 isolate population of 41 strains gms2 using InD48490_ F and InD48490_ R primer pairs. As shown in FIG. 11, the wild type amplified either two bands of 149bp and 140bp, or one band of 149bp, while the sterile mutant amplified only one band of 140 bp. This indicates that the mutant genotype cosegregated with the sterile phenotype, LOC _ Os04g48490 is the GMS2 gene.

Example 5 expression analysis of GMS2 Gene

93-11 tissues at each stage are taken to extract total RNA and are reversely transcribed into cDNA. Using primer pair InD48490 — F: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO:20), the expression level of GMS2 was measured using the primer pair GAPDH-RTF: GAATGGCTTTCCGTGTT (SEQ ID NO:25) and GAPDH-RTR: CAAGGTCCTCCTCAACG (SEQ ID NO:26) to detect the expression level of rice reference gene GAPDH. And (3) analyzing the expression quantity by adopting a real-time quantitative PCR method. As shown in FIG. 12, the expression level of GMS2 gene was significantly lower in roots and stems than in other tissues and significantly higher in seeds than in other tissues. The expression level of GMS2 gene was moderate but not identical in stem nodes, leaves, leaf sheaths and ears. In the ears from the current glume flower primordium differentiation period to the pollen maturation period of flower 1 (flower length 1mm), flower 2 (flower length 2mm), flower 3 (flower length 3mm), flower 4 (flower length 4mm), flower 5 (flower length 5mm), flower 6 (flower length 5.5mm), flower 7 (flower length 6mm), flower 8 (flower length 7mm), and flower 9 (flower length 8mm), the expression level of GMS2 shows a fluctuation that decreases first, then increases, and then decreases last.

Example 6 acquisition and phenotypic analysis of GMS2 Gene knockout lines

The GMS2 gene is subjected to targeted knockout by using a CRISPR/Cas9 system. To increase the efficiency of the knockdown, two target sites were selected for simultaneous knockdown. Target site 1 is located on the minus strand of the exon, sequence GCGGTCGGTGGCGGCCATGG (SEQ ID NO: 17, located at position 45 and position 64 of sequence SEQ ID NO:1), target site 2 is located on the exon, and sequence CGCCTCCCTCGCCGTCGCGG (SEQ ID NO: 18, located at positions 85 to 104 of sequence SEQ ID NO: 1). The target site 1 and the target site 2 were ligated into the vector pC9M according to the method of Ma et al (Ma X, et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot plants. mol Plant,2015,8:1274-84) to obtain the vector pC9M-GMS2 (FIG. 13). Coli with pC9M-GMS2 was named E.coli-pC9M-GMS 2. pC9M-GMS2 was transferred into Agrobacterium strain EHA105 by electric shock and the resulting strain was named Ab-pC9M-GMS 2.

The recombinant agrobacterium Ab-pC9M-GMS2 is used for infecting calluses of japonica rice middle flower 11(ZH11), and a regenerated transgenic strain 25 is obtained through hygromycin resistance screening, differentiation and rooting. Obtaining 22 surviving plants after hardening and transplanting, extracting total DNA of plant leaves, and carrying out mass transfer on the total DNA by using a primer SP 1: CCCGACATAGATGCAATAACTTC (SEQ ID NO:29) and SP 2: GCGCGGTGTCATCTATGTTACT (SEQ ID NO:30) were tested positive and all were positive strains. With primer targets 1-F on both sides of target site 1: AAACCCACGCCCAGAAA (SEQ ID NO:31) and target 1-R: GCCAGGAGGAAGAGCAG (SEQ ID NO:32) and the primer targets 2-F: GCCTGCTCTTCCTCCTG (SEQ ID NO:33) and target 2-R: GTGCTCCGGCTGTTGAT (SEQ ID NO:34), amplifying the genomic DNA, and aligning the amplified product with the genome after sequencing. The results showed that 14T 0 plants underwent gene editing, one of which underwent homozygous mutation, and 8T 0 seedlings were not edited.

The genomic DNA of plant PC9M-GMS2-Line17 underwent homozygous mutations at both target site 1 and target site 2, in which a TG base deletion (SEQ ID NO:27) occurred at target site 1 and a T base insertion (SEQ ID NO:28) occurred at target site 2 (FIG. 14B). The genomic DNA of PC9M-GMS2-Line1 has biallelic mutation at the target site 1, wherein A base insertion occurs in allele 1, and T base deletion occurs in allele 2; the genomic DNA of PC9M-GMS2-Line1 also underwent biallelic mutation at target site 2, G/T base SNP at allele 1, and G/C base SNP at allele 2. The genomic DNA of PC9M-GMS2-Line3 has biallelic mutation at the target site 1, wherein TG base deletion occurs on the allele 1 and A base insertion occurs on the allele 2; the genomic DNA of PC9M-GMS2-Line3 also underwent biallelic mutation at target site 2, G/T base SNP at allele 1, and C base deletion at allele 2. The transgenic negative individuals, PC9M-GMS2-Line2, PC9M-GMS2-Line5 and PC9M-GMS2-Line7, did not have any change in genotype (FIG. 14A).

Phenotypic analysis was performed on the positive strains after flowering. Compared with wild type ZH11, GMS2 knock-out plant PC9M-GMS2-Line17 did not differ significantly in plant leaf and spikelet morphology (FIGS. 15 and 16). However, the GMS2 knockout plants showed significantly smaller anthers (FIG. 17). Pollen iodine staining results showed that pollen from wild type ZH11 was large and round and could be stained, whereas pollen from GMS2 knock-out plants was small and shrunken and could not be stained (FIG. 18). Other GMS2 biallelic mutant plants also exhibited male sterility.

Example 7 acquisition and phenotypic analysis of transgenic complementation lines of gms2 mutant

Genome DNA of 9311 is used as a template, and primers 3148 HB-F: CgcgtttcgaaatttTGATTTCTTCATCGCACT (SEQ ID NO:35) and 3148 HB-R: GtcgcgatcgcatgcACAACATGGTGCAACAGTG (SEQ ID NO:36) the full-length fragment of the gene was obtained with a GMS2 start codon ATG 2kb upstream and a stop codon TGA 515bp downstream. This fragment was double-digested with Kpn I and BamH I and ligated into pC1300 to obtain plasmid pC1300-48490-genome (FIG. 19). Coli with pC1300-48490-genome was named E.coli-pC 1300-48490-genome. The pC1300-48490-genome was transferred to Agrobacterium strain EHA105 by electric shock, and the resulting strain was named Ab-pC 1300-48490-genome. The recombinant agrobacterium Ab-pC1300-48490-genome is used to infect the gms2 mutant callus, 4 transgenic positive plants are obtained through resistance screening, differentiation and rooting, and the fertility of the 4 transgenic positive plants is recovered to be normal (figure 20, figure 21, figure 22 and figure 23). This further demonstrates that the GMS2 gene regulates pollen development and that mutations in this gene lead to pollen abortion.

Example 8 sequence alignment and evolutionary Tree analysis of GMS 2-encoded proteins and their homologous proteins

Homology search of amino acid sequences of proteins encoded by GMS2 gene of rice was performed in NCBI's Genbank database using blastp tool, and homologous proteins predicted in genomes of Arabidopsis thaliana (Arabidopsis lyrata), banana (Musa acuminata), African rice (Oryza glaberrima), Brevibacterium Oryza sativa (Oryza brachyantha), barley (Hordeum vulgare), Sorghum (Sorghum biocolor), maize (Zea mays), and millet (Setaria italica) were obtained, and these protein sequences were analyzed by alignment, and it was revealed that homologous proteins from different plants all have very similar conserved sequences and have high homology to each other (FIGS. 24 and 25), indicating that the protein plays a very important role in conservation of biological functions during the development of male organs of flowers.

The amino acid sequence of the fertility gene in Arabidopsis thaliana (Arabidopsis lyrata) is shown as SEQ ID NO. 9; the amino acid sequence of the fertility gene in banana (Musa acuminata) is shown in SEQ ID NO: 10; the amino acid sequence of the fertility gene in the African cultivated rice (Oryza glaberrima) is shown as SEQ ID NO. 11; the amino acid sequence of the fertility gene in the short drug wild rice (Oryza brachyantha) is shown as SEQ ID NO. 12; the amino acid sequence of the fertility gene in barley (Hordeum vulgare) is shown in SEQ ID NO: 13: the amino acid sequence of the fertility gene in Sorghum (Sorghum bicolor) is shown in SEQ ID NO: 14; the amino acid sequence of the fertility gene in the corn (Zea mays) is shown as SEQ ID NO: 15; the amino acid sequence of the fertility gene in millet (Setaria italica) is shown in SEQ ID NO: 16.

Example 9 transformation of a recessive genic male sterile line carrying the GMS2 Gene

Hybridization, backcrossing and selfing are carried out on the GMS2 mutant and a receptor with normal fertility, such as H28B, and molecular markers are used for GMS2 gene and genetic background selection in the process, so that the recessive nuclear sterile line with homozygous GMS2 mutant genes under the H28B background is finally obtained. The specific implementation steps are as follows:

1、crossing with receptor parent such as H28B as male parent and gms2 to obtain F₁。

2. With F₁Backcrossing the female parent with the recipient parent, e.g., H28B, to obtain BC₁F₁。

3. Planting BC₁F₁Primer InD48490_ F: GCTCCGGCTGTTGATCT (SEQ ID NO:19) and InD48490_ R: GCCTGCTCTTCCTCCTG (SEQ ID NO:20) detects the gms2 genotype. Selecting gms2 heterozygous genotype, namely, a plant with 149bp and 140bp bands can be amplified simultaneously.

4. Using a group (e.g., 100, or 200, etc.) of genotypes having polymorphism between the gms2 mutant and the recurrent parent genome and uniformly distributed molecular markers (which may be but not limited to SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, scarr, etc.), genetic background identification is performed on the individuals selected in step 3, and plants with high similarity (e.g., greater than 88% similarity, or 2% selection rate, etc.) to the recurrent parent genotype are selected.

5. Backcrossing the plant selected in step 4 with a recipient parent, such as H28B, to obtain BC₂F₁。

6. Planting BC₂F₁Repeating the steps 3 and 4, selecting plants heterozygous for the gms2 genotype and having high genetic background recovery rate (such as more than 98 percent, or 2 percent medium selection rate) and harvesting the plants from the inbred BC₂F₂。

7. Planting BC₂F₂Repeating the step 3 and the step 4, selecting the plant with the gene type of gms2 heterozygous and the highest genetic background homozygous rate, and harvesting the inbred seeds BC₂F₃。BC₂F₃The gms2 homozygous isolated from the progeny, i.e., gms2 recessive genic male sterile line, BC₂F₃Used for preserving the germplasm resources of the gms2 recessive genic male sterile line.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> rice male fertility regulation gene mutant and molecular marker and application thereof

<130> KHP201111607.9

<160> 67

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1582

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctccccaccg tgtcacacca caccacacaa caccaccacc gccgccatgg ccgccaccga 60

ccgccgcctg ctcttcctcc tggccgcctc cctcgccgtc gcggcggtga gctcccacaa 120

catcacggac atcctcgacg gctacccgga gtactcgctg tacaacagct acctctccca 180

gaccaaggtg tgcgacgaga tcaacagccg gagcacggtc acctgcctcg tgctcaccaa 240

cggcgccatg tcctccctcg tctccaacct ctccctcgcc gacatcaaga acgcgctccg 300

cctcctcacc ctcctcgact actacgacac caagaagctg cactccctca gcgacggctc 360

cgagctcacc accacgctgt accagaccac cggcgacgcc tccggtaaca tgggccacgt 420

caacatcacc aacctgcgcg gcggcaaggt tgggttcgcc tccgccgcgc ccggctccaa 480

gttccaggcc acctacacca agtccgtcaa gcaggagccg tacaacctct ccgttcttga 540

ggtctccgac cccatcacct tccccggcct cttcgactcc ccgtcggccg cgtcgaccaa 600

cctcaccgcg cttcttgaga aggccgggtg caagcagttc gcgcggctca tcgtgtcgtc 660

cggggtgatg aagatgtacc aggcggccat ggacaaggcg ctgacgctgt tcgcgcccaa 720

cgacgacgcg ttccaggcca agggcctgcc ggatctgagc aagctgacca gcgccgagct 780

ggtgacgctt ctgcagtacc acgccttgcc gcagtacgcg cccaaggcgt cgctcaagac 840

catcaagggc cacatccaga ccctggcctc caccggagcg ggtaagtacg acctctccgt 900

cgtcactaag ggcgacgacg tgtccatgga caccggcatg gacaagtccc gcgtcgcgtc 960

caccgtgctg gacgacaccc cgacggttat ccacacggtg gacagcgtgc tgctgccgcc 1020

agagctcttc ggtggcgcac cttcccccgc gccggcgccc ggaccggcaa gcgatgtgcc 1080

agccgcttct cccgcgccag aaggctcctc gccggcgccc tcccccaagg cggcgggcaa 1140

gaagaaaaag aagggcaagt cgccttccca ttccccaccc gcgcctccgg ccgacacgcc 1200

tgacatgtcg cccgccgacg cgcccgcggg agaagaggct gcagacaaag ccgagaagaa 1260

gaacggcgcc accgcggcgg ccacgagcgt tgcggccact gtggcctccg ccgccgctct 1320

gctcgccgcg tcgttcttgt gagcgtcagg tgttcgacgt tgagctctcg ttgttccccc 1380

ctgggcatgc atggtgtgat gcagtccggt gttcgcttct gagctcgtgg gctccatgga 1440

taatctcatc ctgaagttgt gttcttctct tcctggttgg tagtactcgg tagttagata 1500

ggatttgaat gattggatcc tcaggtggag aacggtgatt gtgatgccta ttttgttaga 1560

gctcggaacc atgttttgtt tt 1582

<210> 2

<211> 1296

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggccgcca ccgaccgccg cctgctcttc ctcctggccg cctccctcgc cgtcgcggcg 60

gtgagctccc acaacatcac ggacatcctc gacggctacc cggagtactc gctgtacaac 120

agctacctct cccagaccaa ggtgtgcgac gagatcaaca gccggagcac ggtcacctgc 180

ctcgtgctca ccaacggcgc catgtcctcc ctcgtctcca acctctccct cgccgacatc 240

aagaacgcgc tccgcctcct caccctcctc gactactacg acaccaagaa gctgcactcc 300

ctcagcgacg gctccgagct caccaccacg ctgtaccaga ccaccggcga cgcctccggt 360

aacatgggcc acgtcaacat caccaacctg cgcggcggca aggttgggtt cgcctccgcc 420

gcgcccggct ccaagttcca ggccacctac accaagtccg tcaagcagga gccgtacaac 480

ctctccgttc ttgaggtctc cgaccccatc accttccccg gcctcttcga ctccccgtcg 540

gccgcgtcga ccaacctcac cgcgcttctt gagaaggccg ggtgcaagca gttcgcgcgg 600

ctcatcgtgt cgtccggggt gatgaagatg taccaggcgg ccatggacaa ggcgctgacg 660

ctgttcgcgc ccaacgacga cgcgttccag gccaagggcc tgccggatct gagcaagctg 720

accagcgccg agctggtgac gcttctgcag taccacgcct tgccgcagta cgcgcccaag 780

gcgtcgctca agaccatcaa gggccacatc cagaccctgg cctccaccgg agcgggtaag 840

tacgacctct ccgtcgtcac taagggcgac gacgtgtcca tggacaccgg catggacaag 900

tcccgcgtcg cgtccaccgt gctggacgac accccgacgg ttatccacac ggtggacagc 960

gtgctgctgc cgccagagct cttcggtggc gcaccttccc ccgcgccggc gcccggaccg 1020

gcaagcgatg tgccagccgc ttctcccgcg ccagaaggct cctcgccggc gccctccccc 1080

aaggcggcgg gcaagaagaa aaagaagggc aagtcgcctt cccattcccc acccgcgcct 1140

ccggccgaca cgcctgacat gtcgcccgcc gacgcgcccg cgggagaaga ggctgcagac 1200

aaagccgaga agaagaacgg cgccaccgcg gcggccacga gcgttgcggc cactgtggcc 1260

tccgccgccg ctctgctcgc cgcgtcgttc ttgtga 1296

<210> 3

<211> 431

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ala Ala Thr Asp Arg Arg Leu Leu Phe Leu Leu Ala Ala Ser Leu

1 5 10 15

Ala Val Ala Ala Val Ser Ser His Asn Ile Thr Asp Ile Leu Asp Gly

20 25 30

Tyr Pro Glu Tyr Ser Leu Tyr Asn Ser Tyr Leu Ser Gln Thr Lys Val

35 40 45

Cys Asp Glu Ile Asn Ser Arg Ser Thr Val Thr Cys Leu Val Leu Thr

50 55 60

Asn Gly Ala Met Ser Ser Leu Val Ser Asn Leu Ser Leu Ala Asp Ile

65 70 75 80

Lys Asn Ala Leu Arg Leu Leu Thr Leu Leu Asp Tyr Tyr Asp Thr Lys

85 90 95

Lys Leu His Ser Leu Ser Asp Gly Ser Glu Leu Thr Thr Thr Leu Tyr

100 105 110

Gln Thr Thr Gly Asp Ala Ser Gly Asn Met Gly His Val Asn Ile Thr

115 120 125

Asn Leu Arg Gly Gly Lys Val Gly Phe Ala Ser Ala Ala Pro Gly Ser

130 135 140

Lys Phe Gln Ala Thr Tyr Thr Lys Ser Val Lys Gln Glu Pro Tyr Asn

145 150 155 160

Leu Ser Val Leu Glu Val Ser Asp Pro Ile Thr Phe Pro Gly Leu Phe

165 170 175

Asp Ser Pro Ser Ala Ala Ser Thr Asn Leu Thr Ala Leu Leu Glu Lys

180 185 190

Ala Gly Cys Lys Gln Phe Ala Arg Leu Ile Val Ser Ser Gly Val Met

195 200 205

Lys Met Tyr Gln Ala Ala Met Asp Lys Ala Leu Thr Leu Phe Ala Pro

210 215 220

Asn Asp Asp Ala Phe Gln Ala Lys Gly Leu Pro Asp Leu Ser Lys Leu

225 230 235 240

Thr Ser Ala Glu Leu Val Thr Leu Leu Gln Tyr His Ala Leu Pro Gln

245 250 255

Tyr Ala Pro Lys Ala Ser Leu Lys Thr Ile Lys Gly His Ile Gln Thr

260 265 270

Leu Ala Ser Thr Gly Ala Gly Lys Tyr Asp Leu Ser Val Val Thr Lys

275 280 285

Gly Asp Asp Val Ser Met Asp Thr Gly Met Asp Lys Ser Arg Val Ala

290 295 300

Ser Thr Val Leu Asp Asp Thr Pro Thr Val Ile His Thr Val Asp Ser

305 310 315 320

Val Leu Leu Pro Pro Glu Leu Phe Gly Gly Ala Pro Ser Pro Ala Pro

325 330 335

Ala Pro Gly Pro Ala Ser Asp Val Pro Ala Ala Ser Pro Ala Pro Glu

340 345 350

Gly Ser Ser Pro Ala Pro Ser Pro Lys Ala Ala Gly Lys Lys Lys Lys

355 360 365

Lys Gly Lys Ser Pro Ser His Ser Pro Pro Ala Pro Pro Ala Asp Thr

370 375 380

Pro Asp Met Ser Pro Ala Asp Ala Pro Ala Gly Glu Glu Ala Ala Asp

385 390 395 400

Lys Ala Glu Lys Lys Asn Gly Ala Thr Ala Ala Ala Thr Ser Val Ala

405 410 415

Ala Thr Val Ala Ser Ala Ala Ala Leu Leu Ala Ala Ser Phe Leu

420 425 430

<210> 4

<211> 1583

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctccccaacg tgtcacacca caccacacaa caccaccacc gccgccatgg ccgccaccga 60

ccgccgcctg ctcttcctcc tggccgcctc cctcgccgtc gcggcggtca gctcccacaa 120