阅读说明：本技术 基因疗法dna载体及其应用 (Gene therapy DNA vector and application thereof ) 是由 N.萨韦利瓦 于 2019-12-20 设计创作，主要内容包括：本发明涉及基因工程,并且可在生物技术、医学和农业中用于制造基因疗法药物产品。提出了基于选自包含BMP-2、BMP-7、OPG、PDGFA、PDGFB基因的组的靶基因的携带基因疗法DNA载体VTvaf17的基因疗法DNA载体,以提高人和动物中该靶基因的表达水平。其中,基因疗法DNA载体VTvaf17-BMP-2、或VTvaf17-BMP-7、或VTvaf17-OPG、或VTvaf17-PDGFA、或VTvaf17-PDGFB分别具有SEQ ID NO.1或SEQ ID NO.2或SEQ ID NO.3或SEQ ID NO.4或SEQ ID NO.5的核苷酸序列。基因疗法DNA不包含病毒起源的核苷酸序列并且没有抗生素抗性基因,这为其在人和动物中的基因疗法提供了安全使用的可能性。还提出了生产特定载体的方法、使用载体的方法、携带特定载体的大肠杆菌菌株以及工业规模上生产特定载体的方法。(The present invention relates to genetic engineering and can be used in biotechnology, medicine and agriculture for the manufacture of gene therapy drug products. A gene therapy DNA vector carrying gene therapy DNA vector VTvaf17 based on a target gene selected from the group comprising BMP-2, BMP-7, OPG, PDGFA, PDGFB genes is proposed to increase the expression level of the target gene in humans and animals. Wherein the gene therapy DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB has the nucleotide sequence of SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.5, respectively. Gene therapy DNA does not contain nucleotide sequences of viral origin and does not have antibiotic resistance genes, which offers the possibility of safe use of it in gene therapy in humans and animals. Also proposed are methods for producing specific vectors, methods for using the vectors, E.coli strains harboring the specific vectors, and methods for producing the specific vectors on an industrial scale.)

1. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodontics titanium implants for allogenic or xenogenic bone grafts for improving the regeneration of bone defects in dentistry, wherein said gene therapy DNA vector has the coding region of a BMP-2 therapeutic gene cloned into gene therapy DNA vector VTvaf17 forming gene therapy DNA vector VTvaf17-BMP-2 with the nucleotide sequence SEQ ID No. 1.

2. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodontics titanium implants for allogenic or xenogenic bone grafts for improving the regeneration of bone defects in dentistry, wherein said gene therapy DNA vector has the coding region of a therapeutic gene of BMP-7 cloned into gene therapy DNA vector VTvaf17, forming gene therapy DNA vector VTvaf17-BMP-7 with the nucleotide sequence SEQ ID No. 2.

3. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodental titanium implants for allogenic or xenogenic bone grafts for improving the regeneration of bone defects in dentistry, wherein said gene therapy DNA vector has the coding region of an OPG therapeutic gene cloned into gene therapy DNA vector VTvaf17 forming gene therapy DNA vector VTvaf17-OPG with the nucleotide sequence SEQ ID No. 3.

4. A gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, comprising a titanium implant in orthodontics for optimizing or activating osteoinductive, orthodontics, of an allogeneic or xenogeneic bone graft after surgery or radiotherapy, for improving the regeneration of bone defects in dentistry, wherein said gene therapy DNA vector has the coding region of a PDGFA therapeutic gene cloned into gene therapy DNA vector VTvaf17, forming gene therapy DNA vector VTvaf17-PDGFA having the nucleotide sequence SEQ ID No. 4.

5. A gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, comprising a titanium implant in orthodontics for optimizing or activating osteoinductive, orthodontics, of allogenic or xenogenic bone grafts, after surgery or radiotherapy, for improving the regeneration of bone defects in dentistry, wherein said gene therapy DNA vector has the coding region of a PDGFB therapeutic gene cloned into gene therapy DNA vector VTvaf17, forming gene therapy DNA vector VTvaf17-PDGFB having the nucleotide sequence SEQ ID No. 5.

6. The gene therapy DNA vector of claim 1, 2, 3, 4 or 5 based on gene therapy DNA vector VTvaf17 carrying BMP-2, BMP-7, OPG, PDGFA or PDGFB therapeutic genes, said gene therapy DNA vector being unique for the fact that each constructed gene therapy DNA vector: the VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB of claim 1, 2, 3, 4, or 5, having the ability to effectively penetrate human and animal cells and express BMP-2, or BMP-7, or OPG, or PDGFA or PDGFB therapeutic gene cloned therein due to the limited size of the VTvaf17 vector portion of no more than 3200 bp.

7. The gene therapy DNA vector of claim 1, 2, 3, 4 or 5 based on gene therapy DNA vector VTvaf17 carrying BMP-2, BMP-7, OPG, PDGFA or PDGFB therapeutic genes, said gene therapy DNA vector being unique for the fact that each constructed gene therapy DNA vector: the VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB of claim 1, 2, 3, 4, or 5, using as structural elements a nucleotide sequence that is not an antibiotic resistance gene, a viral gene, or a viral genome regulatory element, thereby ensuring its safety for gene therapy in humans and animals.

8. A method of gene therapy DNA vector production based on gene therapy DNA vector VTvaf17 carrying BMP-2, BMP-7, OPG, PDGFA or PDGFB therapeutic genes according to claim 1, 2, 3, 4 or 5, the method involving obtaining each of the gene therapy DNA vectors by: VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf 17-PDGFB: cloning the coding region of a BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic gene into a gene therapy DNA vector VTvaf17 to obtain a gene therapy DNA vector VTvaf17-BMP-2, SEQ ID No.1, or VTvaf17-BMP-7, SEQ ID No.2, or VTvaf17-OPG, SEQ ID No.3, or VTvaf17-PDGFA, SEQ ID No.4, or VTvaf17-PDGFB, SEQ ID No.5, respectively, wherein the coding region of the BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic gene is obtained by: by isolating total RNA from a human biological tissue sample, then carrying out reverse transcription reaction and PCR amplification using the obtained oligonucleotides, and cleaving the amplified product with corresponding restriction enzymes, wherein the cloning of the gene therapy DNA vector VTvaf17 is carried out by NheI and HindIII, or SalI and KpnI, or BamHI and EcoRI restriction sites, wherein the selection is carried out in the absence of antibiotics,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-BMP-2, SEQ ID No. 1:

BMP2_F ACAGCTAGCCTCCTAAAGGTCCACCATGGT，

BMP2_R TATAAGCTTCTAGCGACACCCACAACCCT，

cutting the amplified product with NheI and HindIII restriction enzyme and cloning the BMP-2 gene coding region into gene therapy DNA carrier VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-BMP-7, SEQ ID No. 2:

BMP7_F TCAGCTAGCGTAGAGCCGGCGCGATGCA，

BMP7_R TATAAGCTTCTAGTGGCAGCCACAGGC，

cutting the amplified product with NheI and HindIII restriction enzyme and cloning the BMP-7 gene coding region into gene therapy DNA carrier VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-OPG, SEQ ID No. 3:

OPG_F AGGATCCACCATGAACAACTTGCTGTGCTGC，

OPG_R ATAGAATTCATAAGCAGCTTATTTTTACTGATTG，

and cleavage of the amplified product with BamHI and EcoRI restriction enzymes and cloning of the coding region of the OPG gene into the gene therapy DNA vector VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-PDGFA, SEQ ID No. 4:

PDGFA_F AGGATCCACCATGAGGACCTTGGCTTGCCT，

PDGFA_R TATGAATTCACCTCACATCCGTGTCCTCT，

and cutting the amplified product with BamHII and EcoRI restriction enzymes and cloning the coding region of PDGFA gene into gene therapy DNA vector VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-PDGFB, SEQ ID No. 5:

PDGFB_F TATGTCGACCACCATGAATCGCTGCTGGGCGCT，

PDGFB_R TATGGTACCTAGGCTCCAAGGGTCTCCTTC，

and cleavage of the amplified product with SalI and KpnI restriction enzymes and cloning of the coding region of the PDGFB gene into the gene therapy DNA vector VTvaf17 were carried out.

9. Use of the gene therapy DNA vector carrying BMP-2, BMP-7, OPG, PDGFA and PDGFB therapeutic genes VTvaf17 based on the gene therapy DNA vector of claim 1, 2, 3, 4 or 5 for treating diseases associated with bone tissue and cartilage regeneration disorders, including after surgery or radiation therapy, for optimizing or activating osteoinductive, orthodental titanium implants for allogenic or xenogenic bone grafts, a method for improving regeneration of bone defects in dentistry, said method involving transfecting cells of organs and tissues of a patient or an animal with a gene therapy DNA vector carrying a therapeutic gene selected from the group of gene therapy DNA vectors based on construction of gene therapy DNA vectors carrying a therapeutic gene of gene therapy DNA vector VTvaf17 VTvaf17 or several gene therapy DNA vectors carrying a therapeutic gene of gene therapy DNA vector VTvaf 17; and/or injecting autologous cells of the patient or animal transfected by the gene therapy DNA vector carrying the therapeutic gene selected from the gene therapy DNA vector carrying the construction of the therapeutic gene based on the gene therapy DNA vector VTvaf17 or the selected several gene therapy DNA vectors carrying the therapeutic gene based on the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal; and/or injecting a gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 selected from the group of gene therapy DNA vectors based on the construction of the gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal, or a combination of the indicated methods.

10. A method for producing a strain for constructing the gene therapy DNA vector of claim 1, 2, 3, 4 or 5 for treating diseases associated with bone tissue and cartilage regeneration disorders, including for optimizing or activating osteoinductive, orthodental titanium implants of allogenic or xenogenic bone grafts for improving regeneration of bone defects in dentistry after surgery or radiotherapy, the method involving preparing electrocompetent cells of the E.coli strain SCS110-AF and electroporating these cells with the gene therapy DNA vector VTvaf17-BMP-2, or the gene therapy DNA vector VTvaf17-BMP-7, or the gene therapy DNA vector VTvaf17-OPG, or the gene therapy DNA vector VTvaf17-PDGFA, or the gene therapy DNA vector VTvaf17-PDGFB, and then pouring the cells into agar plates (culture dishes) with selective medium, the selective culture medium contains yeast extract, peptone, 6% sucrose and 10 mug/ml chloramphenicol, so that an escherichia coli strain SCS110-AF/VTvaf17-BMP-2, an escherichia coli strain SCS110-AF/VTvaf17-BMP-7, an escherichia coli strain SCS110-AF/VTvaf17-OPG, an escherichia coli strain SCS110-AF/VTvaf17-PDGFA, or an escherichia coli strain SCS110-AF/VTvaf17-PDGFB is obtained.

11. Escherichia coli strain SCS110-AF/VTvaf17-BMP-2 obtained according to claim 10, carrying gene therapy DNA vector VTvaf17-BMP-2 for its production, allowing antibiotic-free selection during its production, for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy, for optimizing or activating osteoinductive, orthodental titanium implants of allo-or xeno-bone grafts, for improving the regeneration of bone defects in dentistry.

12. Escherichia coli strain SCS110-AF/VTvaf17-BMP-7 obtained according to claim 10, carrying gene therapy DNA vector VTvaf17-BMP-7 for its production, allowing antibiotic-free selection during its production, for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy, for optimizing or activating osteoinductive, orthodental titanium implants of allo-or xeno-bone grafts, for improving the regeneration of bone defects in dentistry.

13. Coli strain SCS110-AF/VTvaf17-OPG obtained according to claim 10, carrying gene therapy DNA vector VTvaf17-OPG for its production allowing antibiotic-free selection during its production for the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodental titanium implants of allogenic or xenogenic bone grafts for improving the regeneration of bone defects in dentistry.

14. Coli strain SCS110-AF/VTvaf17-PDGFA obtained according to claim 10, carrying gene therapy DNA vector VTvaf17-PDGFA for its production allowing antibiotic-free selection during its production for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodental titanium implants of allogenic or xenogenic bone grafts for improving regeneration of bone defects in dentistry.

15. Escherichia coli strain SCS110-AF/VTvaf17-PDGFB obtained according to claim 10, carrying gene therapy DNA vector VTvaf17-PDGFB for its production allowing antibiotic-free selection during its production for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy for optimizing or activating osteoinductive, orthodental titanium implants of allogenic or xenogenic bone grafts for improving regeneration of bone defects in dentistry.

16. A method of producing on an industrial scale a gene therapy DNA vector carrying BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic genes based on gene therapy DNA vector VTvaf17 for use in the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including use in optimizing or activating osteoinductive, titanium in orthodontics implants, for improving regeneration of bone defects in dentistry, following surgery or radiotherapy, according to claims 1, 2, 3, 4 or 5, involving the production of gene therapy DNA vector VTvaf17-BMP-2, or gene therapy DNA vector VTvaf17-BMP-7, or gene therapy DNA vector VTvaf17-OPG, or gene therapy DNA vector VTvaf17-PDGFA, or gene therapy DNA vector VTvaf 17-PDGFB: the culture flasks containing the prepared medium were inoculated by seed culture selected from the group consisting of E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf17-PDGFB, and the cell culture was incubated in a incubator shaker and transferred to an industrial fermentor, then cultured to stationary phase, then fractions containing the target DNA product were extracted, multi-stage filtered, and purified by chromatography.

Technical Field

The present invention relates to genetic engineering and may be used in biotechnology, medicine and agriculture to produce gene therapy products.

Background

Gene therapy is an innovative approach in medicine aimed at treating genetic and acquired diseases by delivering new genetic material into the cells of patients to compensate or suppress the function of mutated genes and/or to treat genetic disorders. The end product of gene expression may be an RNA molecule or a protein molecule. However, most physiological processes in vivo are associated with the functional activity of protein molecules, while RNA molecules are either intermediates in protein synthesis or perform regulatory functions. Thus, in most cases, the goal of gene therapy is to inject into an organism genes that provide for the transcription and further translation of the protein molecules encoded by these genes. In the description of the present invention, gene expression refers to the production of a protein molecule having an amino acid sequence encoded by the gene.

BMP-2, BMP-7, PDGFA, PDGFB and OPG genes play key roles in a variety of processes in human and animal organisms. In some cases, a correlation between low/insufficient concentrations of these proteins and various human diseases was demonstrated in some cases, which was confirmed by interference in normal gene expression encoding these proteins. Thus, up-regulation of gene therapy of gene expression selected from the group of BMP-2, BMP-7, PDGFA, PDGFB and OPG genes has the potential to correct a variety of disorders in humans and animals.

The OPG gene (alias TNFRSF11B) encodes Osteoprotegerin Protein (OPG), which is an inhibitor of osteoinductive genesis (osteoprotegeresis) due to competitive RANKL binding. The interaction of the RANK receptor with the RANKL ligand initiates a signaling cascade that leads to differentiation and maturation of osteoclast progenitors into active osteoclasts with bone resorption capacity. Many of the calcineurs and cytokines, including vitamin D3, parathyroid hormone, prostaglandin E2, and interleukin-11, stimulate osteo-mitogenesis through the dual effects of inhibiting OPG production and stimulating RANKL production. On the other hand, estrogen inhibits RANKL production and RANKL-stimulated bone mitogenesis. The RANK/RANKL/OPG paradigm provides a new understanding of osteoclast differentiation and activation, opening new possibilities for developing potential treatments for diseases characterized by excessive bone resorption. In addition to bone mitogenesis, OPG may also promote the survival and proliferation of cell migration by interacting with TRAIL, glycosaminoglycans or proteoglycans. Many in vitro, non-clinical and clinical studies have shown that OPG is involved in cardiovascular diseases, skeletal diseases, diseases of the immune system and neoplastic diseases.

Local injection of the Fc fragment-containing OPG recombinant protein into experimental mechanical tooth loosening in rats resulted in restoration of normal status, and this strategy was used in orthodontics (Schneider DA et al// ortho creatiofac Res.2015Apr; 18Suppl 1: 187-95). These data were confirmed by other research groups. (Fern ndez-Gonz-lez FJ et al// Eur J Orthod.2016Aug; 38 (4): 379-85; Hudson JB et al// calcium Tissue int.2012Apr; 90 (4): 330-42). Similar results were obtained using gene therapy (Zhao N et al// Am J ortho Dentofacial ortho.2012Jan; 141 (1): 30-40).

It was shown that the increase in expression of OPG gene by the plasmid vector carrying OPG gene suppressed the occurrence of bone-induced cleavage in vivo and the decrease in alveolar bone height caused by experimental periodontitis in rats. Therefore, gene therapy methods that increase the expression of the OPG gene can be used to develop tools to prevent progressive Periodontal bone loss (Tang H et al// J Periodotal Res.2015Aug; 50 (4): 434-43.).

In an experimental model of proinflammatory juvenile osteoporosis in mice, it was shown that the use of recombinant OPG proteins containing Fc fragments promotes the restoration of normal osteoblast/osteoclast balance and prevents skeletal growth disorders (Del Fattore A et al// Osteoporos int.2014Feb; 25 (2): 681-92).

In a collagen-induced arthritis model, rat joints were protected with a recombinant adeno-associated virus vector expressing an OPG gene (Bao L et al// Joint Bone spine.2012Oct; 79 (5): 482-7).

Prophylactic local injection of cells transduced with recombinant adenoviral vectors expressing the OPG Gene resulted in improved osseointegration and stability of titanium implants in rats (Yin G et al// Gene ther.2015Aug; 22 (8): 636-44). Similar results were obtained in complications caused by the presence of titanium microparticles using a murine model of knee arthroplasty (Zhang L et al// Gene Ther.2010Oct; 17 (10): 1262-9).

Phase I clinical studies of recombinant OPG protein (AMGN-0007, Amgen Corp.) in patients with radiation therapy-induced degenerative bone changes demonstrated its potential as a therapeutic agent for the treatment of bone resorption (Body JJ et al// cancer.2003Feb 1; 97(3 Suppl): 887-92).

In studies on the potential of the OPG for tumor diseases, it was shown that injection of a modified recombinant adenovirus vector expressing an OPG gene containing an Fc fragment into experimental animals inhibited metastatic prostate cancer cells and slowed tumor progression (Cody JJ et al// Lab invest.2013 Mar; 93 (3): 268-78).

In the case of cardiovascular diseases, injection of cells expressing the OPG gene reduced the size of atherosclerotic plaques and reduced vascular sclerosis in mice deficient in expression of the OPG gene (Callegari A et al// Arterioscler Thromb Vasc biol.2013 Nov; 33 (11): 2491-.

The BMP-2 and BMP-7 genes encode bone morphogenetic proteins 2 and 7, respectively. BMPs are cytokines belonging to the TGF family that are mainly present in bone tissue. The name "BMP" describes only one specific function, but in practice, these proteins have many other effects on the body, namely: chondrogenesis, development of internal organs, i.e. morphogenesis, proliferation, apoptosis and cell differentiation. In addition, BMPs also block myogenesis and adipogenesis. Some BMPs, including BMP-2, BMP-4, and BMP-7, are involved in the specialization of hematopoietic tissues from embryonic mesoderm. They regulate the proliferation and differentiation of human hematopoietic cells in adults and neonates. To date, 20 types of BMP proteins have been identified. The most intensive studies related to bone and cartilage repair are BMP-2 and BMP-7. They are known to be capable of inducing bone growth, i.e., inducing proliferation and differentiation of four types of cells, i.e., osteoblasts, osteoclasts, chondroblasts and chondrocytes. BMP-2, -4, -7, and-3 facilitates the growth of osteoblasts and osteocyte derivatives in vitro. The site of localization of BMP is the extracellular matrix of connective tissue containing osteoprogenitor cells and mesenchymal cells. It was demonstrated that BMP was distributed in periosteal osteoblast cells along collagen fibers of bone tissue; they are present in moderate amounts in lamellar bone cells and in excess in dental tissue. BMP is synthesized by osteoblasts, chondrocytes and their precursors. Increased activity of BMP was observed at the tibial growth site (epiphyseal, metaphyseal, cartilage). In addition to bone, BMP is expressed in extraosseous biological tissues. High amounts of BMP are found in the prostate and placenta (Paralkar V et al// j. biol. chem. 1998.-vol.273, N22. -p.13760-13767).

Many researchers have indicated a very unstable or low osteoinductive index of allograft produced in different tissue banks. The biological optimization or activation of osteoinduction of allogeneic or xenogeneic bone grafts can be achieved by the addition of demineralization of osteoinductive proteins or other growth factors. BMP-2 showed an increase in osteoid formation compared to when using autologous bone in combination with demineralized bone matrix in rat experiments (Schwartz Z et al// j.periodontol. -1998.-vol.69, N12. -p.1337-1345). In experiments in dogs, a higher percentage of bone healing was obtained by adding BMP-7 to the allograft than by using autologous bone (Lewandrowski k.// Spine j. -2007.-vol.7j5. -p.609-614). The osteogenic differentiation of mesenchymal stem cells was compared with the alkaline phosphatase activity of materials such as: demineralized Bone Matrix (DBM), demineralized bone matrix with addition of BMP-7 (DBM + BMP-7), collagen + BMP-7, collagen, frozen bone graft with BMP-7. DBM + BMP-7 was found to stimulate osteogenic differentiation of mesenchymal stem cells and activation of alkaline phosphatase to a greater extent (Tsiridis e.et al// j.ortho.res. -2007.-vol.25, N11. -p.1425-1437).

The efficiency of BMP-7 in spinal pathology for achieving bone healing is comparable to or slightly higher than that of autologous bone material (Johnsson R et al// spin-2002) -vol.27-p.2654-2661). This study included 9 patients between the ages of 21 and 24 with risk factors for bone nonunion (adrenal insufficiency, hypertension, long-term smoking, obesity, hyperthyroidism, rheumatoid arthritis) and revealed that BMP-7 was safe and effective for spinal fusion (goven S et al// j. bone Jt surg-2002-vol.84a. -p.2123-2134). Vaccaro et al examined 36 patients undergoing surgical treatment for degenerative lumbar spondylolisthesis with spinal stenosis. The bone graft paste containing rhBMP-7 was administered to one part of the patient (main group) together with the autograft from the iliac crest, and only the autograft from the iliac crest was administered to the other part (control group). After 1 year of observation, the rate of healing found in the major group of bones was 86% of cases, in the control group-in 73% of cases-after 4 years-69% and 50%, respectively (Vaccaro a.r.et al// eur.spine j. -2005.-vol.14. -p.623-629). Govender et al reported the clinical use of rhBMP-7 on collagen carriers at doses of 0.75mg/ml (total dose of 6mg) and 1.50mg/ml (total dose of 12mg), respectively. This study included 450 patients with open tibial fractures from 11 countries. All patients underwent intramedullary osteosynthesis with titanium nails. Fracture healing was achieved in 74% of patients without repeated intervention. The data of this study prompted the European medical product Evaluation Agency (EMEA) to approve the use of rhBMP-7/ACS in treating open tibial fractures by intramedullary osteosynthesis in 2002 and 2004 by the U.S. Food and Drug Administration (FDA) (goven S et al// j. bone Jt surg. -2002.-vol.84a. -p.2123-2134).

Bone healing of the vertebral body was observed to be equally or more frequent when rhBMP-7 was used on the collagen sponge compared to when autograft from the iliac crest was used. In fact, bone healing has been reported to occur in 100% of patients when rhBMP-7 is used (Schwender J.D.et al.// J.spin.Disord.Tech. -2005.-Vol.18.-P.S 1-S6). There were no complications characteristic of surgical sampling of autologous bone.

rhBMP-7 was used to treat patients with open fractures of the tibia in the form of a collagen paste, contributing to fracture healing in a larger percentage of cases, and reducing the frequency of repeated surgical interventions (fricdlaeder g.et al// j.bone Jt surg-2001-vol.83a. -p.s151-S158). When used in combination with autologous bone or allogeneic demineralized bone matrix, it showed a shortened fracture healing time compared to the same procedure using autologous bone alone (Bilic R et al// int. Orthop. -2006.-Vol.30. -P.128-134).

Advances in the use of recombinant BMPs have provided opportunities for many studies using gene therapy approaches. Thus, viruses, plasmids and Cell vectors have been successfully used to express the BMP gene in various studies of bone defect regeneration (Schwabe P et al// scientific Worldjournal.2012; 2012: 560142; Wegman F et al// Eur Cell Mater.2011Mar 15; 21: 230-42; discussion 242; Wang CJ et al// Arthroscopy.2010Jul; 26 (7): 968-76; Heggenes MH.// Spine J.2015Nov 1; 15 (11): 2410-1; Wu G et al// J Craniofac Surg.MAR 201515; 26 (2): 201581; Loozen LD et al// Tissue Eng Part A.378; 21 (9-10): 2-9). One of the studies showed that the gene therapy method using BMP-2 and BMP-7 genes in combination had a more significant therapeutic effect than using each of these genes alone (Koh JT et al// J Dent Res.2008Sep; 87 (9): 845-9).

In addition to the use of BMP proteins for regenerating bone and cartilage injuries, upregulation of BMP-7 gene expression has also been shown to promote wound healing and prevent the formation of tissue fibrosis (Tandon A et al// PLoS one.2013Jun 14; 8 (6): e 66434; 19; Zhong et al// Int J Med Sci.2013; 10 (4): 441-50.). In addition, adenovirus vectors expressing the BMP-7 gene have a regulatory effect on epithelial cells during ocular injury regeneration (Saika S et al// Am J Physiol Cell physiol.2006 Jan; 290 (1): C282-9). Indeed, it has been shown that adenovirus vectors expressing BMP-7 can have a beneficial effect on the course of experimental ulcerative colitis in rats (Hao Z et al// J Gene Med.2012Jul; 14 (7): 482-90).

The PDGFA and PDGFB genes encode platelet growth factors (platelet-derived growth factor-PDGF) a and B (PDGFA and PDGFB), which are secreted by platelets during the early stages of bone tissue repair. They are characterized by mitogenic activity on osteoblasts and progenitor cells. In addition, PDGFA and PDGFB have also been found to be involved in angiogenesis. In recent years, platelet growth factor has been applied in dentistry to optimize the regeneration of bone defects. A randomized placebo controlled trial of 180 patients showed that the defect was filled with trabecular bone tissue within 3 months. The method is also used after surgical treatment. Furthermore, the delivery of growth factors directly to the area of bone graft use significantly improves soft tissue recovery (Nevins et al.// j. periodontol. -2005.-vol.76. -p.2205-2215).

Gene therapy methods using plasmid vectors expressing the PDGFB gene have been successfully applied to skull regeneration in rats. The results of the study showed that a significant positive effect in skull healing was observed after 4 weeks of monitoring (Elangovan S et al// biomaterials.2014Jan; 35 (2): 737-47).

In ex vivo experimental studies on mouse and rat hearts, it was shown that adenoviral vectors expressing the PDGFB gene contribute to changes in the marker profile that predict graft success (Tuumen R et al// transplantation. 2016Feb; 100 (2): 303-13). In studies in rabbits and piglets, recombinant adeno-associated viral vectors specifically expressing the PDGFB gene promote neovascularization and improve myocardial function parameters (Kupatt C et al// J Am Coll cardio.2010 Jul 27; 56 (5): 414-22).

Gene therapy using constructs expressing the PDGFB Gene has also been shown to promote healing of ligament injury in rats (Nakamura N et al// Gene Ther.1998Sep; 5 (9): 1165-70).

In studies of wound healing and regeneration, the use of an adenovirus vector expressing the PDGFB gene helped to achieve significant therapeutic effects (Chandler LA et al// Mol ther.2000Aug; 2 (2): 153-60).

The use of fibroblasts expressing the PDGFA Gene has a significant positive effect in post-operative healing of the spinal column and spinal cord neck (Ijichi A et al// Gene Ther.1996 May; 3 (5): 389-95).

Gene therapy using plasmid vectors expressing the PDGFA and PDGFB genes has also proven effective in healing rabbit skin wounds (Tyron JW et al// J Surg Res.2000 Oct; 93 (2): 230-6).

Given the data, they show that they are a promising direction for regenerative medicine, since gene therapy methods using the PDGFA and PDGFB genes can stimulate regeneration of both bone tissue and surrounding soft tissue.

Thus, the background of the invention suggests that the BMP-2, BMP-7, OPG, PDGFA and PDGFB genes have the potential to correct a range of deviations including, but not limited to, injuries and degenerative changes in bone and surrounding soft tissue (including periodontal disease, periodontitis and osteoporosis), cardiovascular disease, autoimmune disease, cancer, genetic and acquired pathological conditions (such as connective tissue damage) and other processes. This is why the BMP-2, BMP-7, OPG, PDGFA and PDGFB genes are classified within this patent. Genetic constructs providing protein expression encoded by genes from the BMP-2, BMP-7, OPG, PDGFA and PDGFB groups are useful for the development of medicaments for the prevention and treatment of different diseases and pathological conditions.

Furthermore, these data indicate that under-expression of the proteins encoded by the BMP-2, BMP-7, OPG, PDGFA and PDGFB genes contained in a panel of genes is not only associated with pathological conditions, but also with their susceptibility to development. Furthermore, these data indicate that under-expression of these proteins may not be unequivocally present in the pathological forms that can be unequivocally described within the framework of the current standards of clinical practice (e.g. using ICD codes), but at the same time lead to conditions that are unfavorable for humans and animals and that are associated with a worsening quality of life.

Analysis of methods to increase therapeutic gene expression implies the feasibility of using different gene therapy vectors.

Gene therapy vectors are classified into viral, cellular, and DNA vectors (EMA/CAT/80183/2014 guidelines on the quality, non-clinical, and clinical aspects of gene therapy drug products). Recently, gene therapy has focused on the development of non-viral gene delivery systems, in which the plasmid vector is the leader. Plasmid vectors have no limitations inherent to cellular and viral vectors. In target cells, they are present as episomes, do not integrate into the genome, but they are rather inexpensive to produce, and do not have the immune response or side effects caused by the administration of plasmid vectors, which makes them a convenient tool for gene therapy and prevention (DNA vaccination) of genetic diseases (Li L, Petrovsky N.// Expert Rev vaccines.2016; 15(3): 313-29).

However, limitations of plasmid vector use in gene therapy are: 1) the presence of an antibiotic resistance gene for the production of the construct in a bacterial strain; 2) the presence of various regulatory elements represented by viral genomic sequences; 3) the length of the therapeutic plasmid vector that determines the efficiency of vector delivery to the target cell.

It is well known that the european medicines agency considers that it is necessary to avoid adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (post-read report on design modification of gene therapy drug products during development)/2011 12/14/day EMA/CAT/GTWP/44236/2009 advanced therapy Committee (Committee for advanced therapies)). This suggestion is primarily related to the potential risk of DNA vector penetration or horizontal transfer of antibiotic resistance genes into bacterial cells present in the body, which are part of a normal or opportunistic community of microorganisms. Furthermore, the presence of the antibiotic resistance gene significantly increases the length of the DNA vector, which reduces its efficacy in penetrating into eukaryotic cells.

It is to be noted that antibiotic resistance genes also make a fundamental contribution to the method of producing DNA vectors. If an antibiotic resistance gene is present, the strain used to produce the DNA vector is usually cultured in a medium containing a selective antibiotic, which poses the risk of antibiotic traces in DNA vector preparations that are not sufficiently purified. Thus, the production of DNA vectors for gene therapy without antibiotic resistance genes is linked to the production of strains with unique characteristics, such as the ability of stable amplification of the therapeutic DNA vector in antibiotic-free medium.

Furthermore, the European drug administration suggests avoiding the presence of regulatory elements (promoters, enhancers, post-translational regulatory elements) in the therapeutic plasmid vector that constitute the genomic nucleotide sequences of various viruses that increase the expression of therapeutic genes (Draft guide on the quality, non-clinical and clinical aspects of gene therapy drug products, http:// www.ema.europa.eu/docs/en _ GB/document _ library/Scientific _ guide/2015/05/WC500187020. pdf) for the quality, non-clinical and clinical aspects of gene therapy drug products. Although these sequences may increase the expression level of the therapeutic transgene, they pose a risk of recombination with the genetic material of the wild-type virus and integration into the eukaryotic genome. Furthermore, the relevance of overexpression of specific genes for therapy remains an open question.

The size of the therapeutic vehicle is also necessary. It is well known that modern plasmid vectors often have unnecessary non-functional sites that significantly increase their length (Mairhofer J, Grabherr R.// Mol Biotechnol.2008.39(2): 97-104). For example, ampicillin resistance genes in pBR322 series vectors usually consist of at least 1000bp, accounting for more than 20% of the length of the vector itself. An inverse relationship between vector length and its ability to penetrate eukaryotic cells was observed; DNA vectors having a small length efficiently penetrate into human and animal cells. For example, in a series of experiments on transfection of HELA cells with 383-19-bp 4548-DNA vector, it was shown that the difference in infiltration efficacy can be up to two orders of magnitude (100-fold difference) (Hornstein BD et al// PLoS ONE.2016; 11(12): e 0167537.).

Therefore, in selecting DNA vectors, those constructs which do not contain antibiotic resistance genes, viral-derived sequences, and which are of a length that allows efficient infiltration into eukaryotic cells should be considered preferentially for reasons of safety and maximum efficiency. Strains producing such DNA vectors in sufficient amounts for gene therapy purposes should ensure the possibility of stable DNA vector amplification using antibiotic-free nutrient media.

An example of the use of a recombinant DNA vector for gene therapy is a method of producing a recombinant vector for genetic immunization (patent No. US 9550998B 2). Plasmid vectors are supercoiled plasmid DNA vectors that are used for expression of cloned genes in human and animal cells. The vector contains an origin of replication, regulatory elements including a human cytomegalovirus promoter and enhancer, and regulatory sequences from a human T-cell lymphotropic virus.

The vector was accumulated in antibiotic-free dedicated E.coli strains by antisense complementation of the sacB gene inserted in the strain using phage. The disadvantage of this invention is the presence of regulatory elements in the DNA vector composition that constitute the sequences of the viral genome.

The following application is a prototype of the present invention for using gene therapy methods to increase the level of gene expression from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes.

Patent No. US5942496A describes a method for bone tissue regeneration and treatment of bone tissue-related diseases by introducing a gene selected from the group consisting of BMP-2 and BMP-7 genes into cells or human and animal organisms. The disadvantage of this invention is the vague requirements on the nature of the vector expressing these genes.

Patent No. US6300127B1 describes a method for bone tissue regeneration using a vector expressing OPG gene. The disadvantage of this invention is the lack of safety requirements for the application of the vectors used.

Patent No. EP1017421B1 describes a method of regenerating lesions in mammalian tissue using a recombinant adenoviral vector expressing a gene selected from the group of genes comprising in particular the PDGFA and PDGFB genes. The disadvantage of this invention is the use of vectors carrying sequences of viral origin.

Disclosure of Invention

The object of the present invention is to construct gene therapy DNA vectors to increase the expression levels of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes in human and animal organisms, which combine the following properties:

I) the efficiency of gene therapy DNA vectors in order to increase the expression level of therapeutic genes in eukaryotic cells;

II) the possibility of safe use in gene therapy of humans and animals due to the absence of regulatory elements representing the nucleotide sequence of the viral genome in gene therapy DNA vectors;

III) the possibility of safe use in gene therapy of humans and animals due to the absence of antibiotic resistance genes in gene therapy DNA vectors;

IV) Productibility and constructability of the DNA vector for gene therapy on an industrial scale.

According to the recommendations of the national regulatory authorities for gene therapy drugs, and in particular the requirements of the european drug administration, i.e. avoiding the addition of antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (post-read report on design modification of gene therapy drug products during development/EMA/CAT/GTWP/44236/2009 advanced therapy council 12/14/2011), and avoiding the addition of viral genomes to newly engineered plasmid vectors for gene therapy (guidelines on quality, non-clinical and clinical aspects of gene therapy drug products/23/3/2015 3/23, EMA/CAT/80183/2014, advanced therapy council), items II and III are provided herein.

The object of the present invention also includes the construction of strains carrying these gene therapy DNA vectors, and the development and production of these gene therapy DNA vectors on an industrial scale.

A particular object is achieved by the use of a gene therapy DNA vector produced on the basis of gene therapy DNA vector VTvaf17 for the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including after surgery or radiotherapy, for optimizing or activating osteoinductive, orthodental titanium implants for allogenic or xenogenic bone grafts, for improving the regeneration of bone defects in dentistry, wherein the gene therapy DNA vector VTvaf17-BMP-2 comprises the coding region of the BMP-2 therapeutic gene cloned into gene therapy DNA vector VTvaf17, having the nucleotide sequence of SEQ ID No. 1; a gene therapy DNA vector VTvaf17-BMP-7 comprising the BMP-7 therapeutic gene coding region cloned into gene therapy DNA vector VTvaf17, having the nucleotide sequence of SEQ ID No. 2; a gene therapy DNA vector VTvaf17-OPG comprising the OPG therapeutic gene coding region cloned into gene therapy DNA vector VTvaf17, having the nucleotide sequence of SEQ ID No. 3; a gene therapy DNA vector VTvaf17-PDGFA comprising a PDGFA therapeutic gene coding region cloned into gene therapy DNA vector VTvaf17, having the nucleotide sequence of SEQ ID No. 4; a gene therapy DNA vector VTvaf17-PDGFB comprising a PDGFB therapeutic gene coding region cloned into gene therapy DNA vector VTvaf17 having the nucleotide sequence of SEQ ID No. 5.

Each constructed gene therapy DNA vector, VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB, has the ability to efficiently penetrate human and animal cells and express BMP-2, or BMP-7, or OPG, or PDGFA or PDGFB therapeutic genes cloned therein due to the limited size of the VTvaf17 vector portion not exceeding 3200 bp.

Each of the constructed gene therapy DNA vectors, VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB, uses as a structural element a nucleotide sequence that is not an antibiotic resistance gene, a viral gene, or a viral genome regulatory element, thereby ensuring its safety for gene therapy in humans and animals.

Methods for producing gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying BMP-2, BMP-7, OPG, PDGFA or PDGFB therapeutic genes have also been developed, which involve obtaining each of the gene therapy DNA vectors as follows: VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf 17-PDGFB: cloning the coding region of a BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic gene into a gene therapy DNA vector VTvaf17 to obtain a gene therapy DNA vector VTvaf17-BMP-2, SEQ ID No.1, or VTvaf17-BMP-7, SEQ ID No.2, or VTvaf17-OPG, SEQ ID No.3, or VTvaf17-PDGFA, SEQ ID No.4, or VTvaf17-PDGFB, SEQ ID No.5, respectively, wherein the coding region of the BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic gene is obtained by: by isolating total RNA from a human biological tissue sample, then carrying out reverse transcription reaction and PCR amplification using the obtained oligonucleotides, and cleaving the amplified product with corresponding restriction enzymes, wherein the cloning of the gene therapy DNA vector VTvaf17 is carried out by NheI and HindIII, or SalI and KpnI, or BamHI and EcoRI restriction sites, wherein the selection is carried out in the absence of antibiotics,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-BMP-2, SEQ ID No. 1:

BMP2_F ACAGCTAGCCTCCTAAAGGTCCACCATGGT，

BMP2_R TATAAGCTTCTAGCGACACCCACAACCCT，

cutting the amplified product with NheI and HindIII restriction enzyme and cloning the BMP-2 gene coding region into gene therapy DNA carrier VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-BMP-7, SEQ ID No. 2:

BMP7_F TCAGCTAGCGTAGAGCCGGCGCGATGCA，

BMP7_R TATAAGCTTCTAGTGGCAGCCACAGGC，

cutting the amplified product with NheI and HindIII restriction enzyme and cloning the BMP-7 gene coding region into gene therapy DNA carrier VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-OPG, SEQ ID No. 3:

OPG_F AGGATCCACCATGAACAACTTGCTGTGCTGC，

OPG_R ATAGAATTCATAAGCAGCTTATTTTTACTGATTG，

and cleavage of the amplified product with BamHI and EcoRI restriction enzymes and cloning of the coding region of the OPG gene into the gene therapy DNA vector VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-PDGFA, SEQ ID No. 4:

PDGFA_F AGGATCCACCATGAGGACCTTGGCTTGCCT，

PDGFA_R TATGAATTCACCTCACATCCGTGTCCTCT，

and cutting the amplified product with BamHII and EcoRI restriction enzymes and cloning the coding region of PDGFA gene into gene therapy DNA vector VTvaf17,

wherein the following oligonucleotides generated for this purpose are used in the reverse transcription reaction and PCR amplification in the production of the gene therapy DNA vector VTvaf17-PDGFB, SEQ ID No. 5:

PDGFB_F TATGTCGACCACCATGAATCGCTGCTGGGCGCT，

PDGFB_R TATGGTACCTAGGCTCCAAGGGTCTCCTTC，

and cleavage of the amplified product with SalI and KpnI restriction enzymes and cloning of the coding region of the PDGFB gene into the gene therapy DNA vector VTvaf17 were carried out.

A method of treating diseases associated with bone tissue and cartilage regeneration disorders using a gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying BMP-2, BMP-7, OPG, PDGFA and PDGFB therapeutic genes, including for optimizing or activating osteoinductive of allogeneic or xenogeneic bone grafts, titanium implants in orthodontics, for improving regeneration of bone defects in dentistry after surgery or radiotherapy, involving transfecting a patient or animal organ and tissue with a therapeutic gene carrying gene based gene therapy DNA vector of gene therapy DNA vector VTvaf17 or selected cells of several therapeutic gene carrying gene based gene therapy DNA vectors of gene therapy DNA vector VTvaf17 selected from a group of therapeutic gene carrying constructed gene therapy DNA vectors of gene therapy DNA vector VTvaf 17; and/or injecting autologous cells of the patient or animal transfected by the gene therapy DNA vector carrying the therapeutic gene selected from the gene therapy DNA vector carrying the construction of the therapeutic gene based on the gene therapy DNA vector VTvaf17 or the selected several gene therapy DNA vectors carrying the therapeutic gene based on the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal; and/or injecting a gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 selected from the group of gene therapy DNA vectors based on the construction of the gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal, or a combination of the indicated methods.

A method for producing a strain for constructing a gene therapy DNA vector for treating diseases associated with disorders of bone tissue and cartilage regeneration, including for optimizing or activating osteoinductive, orthodontics titanium implants for allogenic or xenogenic bone grafts for improving bone defect regeneration in dentistry after surgery or radiotherapy, the method involving preparing electrocompetent cells of escherichia coli strain SCS110-AF and electroporating these cells with gene therapy DNA vector VTvaf17-BMP-2, or gene therapy DNA vector VTvaf17-BMP-7, or gene therapy DNA vector VTvaf17-OPG, or gene therapy DNA vector VTvaf17-PDGFA, or gene therapy DNA vector VTvaf 17-PDGFB. The cells were then poured onto agar plates (petri dishes) with a selective medium containing yeast extract, peptone, 6% sucrose and 10. mu.g/ml chloramphenicol, thus obtaining E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf 17-PDGFB.

Escherichia coli strain SCS110-AF/VTvaf17-BMP-2 carrying gene therapy DNA vector VTvaf17-BMP-2 for its production allowing antibiotic-free selection during the production of said gene therapy DNA vector, or Escherichia coli strain SCS110-AF/VTvaf17-BMP-7 carrying gene therapy DNA vector VTvaf17-BMP-7 for its production allowing antibiotic-free selection during the production of said gene therapy DNA vector, Escherichia coli strain SCS110-AF/VTvaf17-OPG carrying gene therapy DNA vector VTvaf17-OPG for its production allowing antibiotic-free selection during the production of said gene therapy DNA vector, Escherichia coli strain SCS110-AF/VTvaf17-PDGFA carrying gene therapy DNA vector VTvaf17-PDGFA for its production, allowing antibiotic-free selection during production of said gene therapy DNA vector, escherichia coli strain SCS110-AF/VTvaf17-PDGFB carrying gene therapy DNA vector VTvaf17-PDGFB for its production, allowing antibiotic-free selection during production of said gene therapy DNA vector for use in treating diseases associated with disorders of bone tissue and cartilage regeneration, including optimizing or activating osteoinductive, orthodental titanium implants of allogenic or xenogenic bone grafts following surgery or radiotherapy to improve regeneration of bone defects in dentistry.

A method for the industrial scale production of a gene therapy DNA vector based on the gene therapy DNA vector VTvaf17 carrying a BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic gene for the treatment of diseases associated with disorders of bone tissue and cartilage regeneration, including the optimization or activation of osteoinductive properties of allogeneic or xenogeneic bone grafts, titanium implants in orthodontics, for improving the regeneration of bone defects in dentistry, has been developed, which involves the production of the gene therapy DNA vector VTvaf17-BMP-2, or the gene therapy DNA vector VTvaf17-BMP-7, or the gene therapy DNA vector VTvaf17-OPG, or the gene therapy DNA vector VTvaf17-PDGFA, or the gene therapy DNA vector VTvaf17-PDGFB, as follows: the culture flasks containing the prepared medium were inoculated by seed culture with a seed culture selected from the group consisting of E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFB, or E.coli strain SCS110-AF/VTvaf17-PDGFB, and the cell culture was then incubated in a incubator shaker and transferred to an industrial fermentor, then cultured to a stationary phase, and then fractions containing the target DNA product were extracted, multi-stage filtered, and purified by chromatography.

Drawings

The essence of the invention is explained in the attached drawings, wherein:

FIG. 1 shows a schematic view of a

The structure of a gene therapy DNA vector VTvaf17 carrying a therapeutic gene selected from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes, constituting a circular double stranded DNA molecule capable of autonomous replication in e.

Fig. 1 shows a structure corresponding to:

a-gene therapy DNA vector VTvaf17-BMP-2,

B-Gene therapy DNA vector VTvaf17-BMP-7,

C-Gene therapy DNA vector VTvaf17-OPG,

D-Gene therapy DNA vector VTvaf17-PDGFA,

E-Gene therapy DNA vector VTvaf 17-PDGFB.

The following structural elements of the support are indicated in the structure:

EF1 a-promoter region of human elongation factor EF1A, which has an internal enhancer contained in the first intron of the gene. It ensures the effective transcription of the recombinant gene in most human tissues,

the reading frame of the therapeutic gene corresponding to the coding region of the BMP-2 gene (FIG. 1A), or the BMP-7 gene (FIG. 1B), or BMP-7OPG (FIG. 1C), or PDGFA (FIG. 1D), or PDGFB (FIG. 1E), respectively,

the transcription terminator and polyadenylation site of hGH-TA-human growth factor gene,

ori-origin of replication for autonomous replication, with single nucleotide substitutions to increase plasmid production in most E.coli strain cells,

RNA-out-in the case of the use of the E.coli strain SCS110-AF, the regulatory element RNA-out of transposon Tn10, which allows antibiotic-free positive selection.

Unique restriction sites are labeled.

FIG. 2

The cDNA amplicon accumulation profile of the therapeutic gene, BMP-2 gene, in HOb human osteoblast cultures (Cell Applications, Inc Cat.406-05a) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-BMP-2, is shown to assess the ability to penetrate eukaryotic cells and functional activity, i.e., expression of the therapeutic gene at the mRNA level.

The accumulation curve of amplicons during the reaction is shown in FIG. 2, corresponding to:

1-cDNA of the BMP-2 gene in HOb human osteoblast cultures before transfection with the DNA vector VTvaf17-BMP-2,

2-cDNA of the BMP-2 gene in HOb human osteoblast cultures after transfection with the DNA vector VTvaf17-BMP-2,

3-cDNA of the B2M gene in HOb human osteoblast cultures prior to transfection with the DNA vector VTvaf17-BMP-2,

4-cDNA of the B2M gene in HOb human osteoblast cultures after transfection with the DNA vector VTvaf 17-BMP-2.

The B2M (beta-2-microglobulin) gene listed as accession No. NM004048.2 in GenBank database was used as a reference gene.

FIG. 3

Shows a culture of MG-63 human osteosarcoma: (CRL-1427^TM) Before transfection with the DNA vector VTvaf17-BMP-7 and 48 hours after transfection of these cells, the cDNA amplicon accumulation profile of the therapeutic gene, i.e., the BMP-7 gene, was used to assess the ability to infiltrate eukaryotic cells and the functional activity, i.e., the expression of the therapeutic gene at the mRNA level.

The accumulation curve of amplicons during the reaction is shown in FIG. 3, corresponding to:

1-DNA vector VTvaf17-BMP-7 cDNA of BMP-7 gene in MG-63 human osteosarcoma culture before transfection,

2-DNA vector VTvaf 17-cDNA of BMP-7 gene in MG-63 human osteosarcoma culture after transfection of BMP-7,

3-DNA vector VTvaf17-BMP-7 transfection of cDNA of B2M gene in pre-MG-63 human osteosarcoma culture,

4-DNA vector VTvaf 17-cDNA of the B2M gene in MG-63 human osteosarcoma cultures after transfection of BMP-7.

The B2M (beta-2-microglobulin) gene listed as accession No. NM004048.2 in GenBank database was used as a reference gene.

FIG. 4

Shows that in HGF-1 human gingival fibroblast line (CRL-2014^TM) Before transfection with the gene therapy DNA vector VTvaf17-OPG and 48 hours after transfection of these cells, the cDNA amplicon accumulation profile of the therapeutic gene, i.e., the OPG gene, was used to assess the ability to penetrate into eukaryotic cells and the functional activity, i.e., the expression of the therapeutic gene at the mRNA level.

The accumulation curve of amplicons during the reaction is shown in FIG. 4, corresponding to:

1-DNA vector VTvaf17-OPG transfects the cDNA of OPG gene of HGF-1 human gingival fibroblast cell line,

2-DNA carrier VTvaf17-OPG transfected HGF-1 human gingiva fibroblast cell line OPG gene cDNA,

3-DNA carrier VTvaf17-OPG transfects the cDNA of the pro-HGF-1 human gingival fibroblast line B2M gene,

4-DNA vector VTvaf17-OPG transfected HGF-1 human gingival fibroblast line B2M gene cDNA.

The B2M (beta-2-microglobulin) gene listed as accession No. NM004048.2 in GenBank database was used as a reference gene.

FIG. 5

The cDNA amplicon accumulation profile of the therapeutic gene, i.e., the PDGFA gene, in human chondrocyte culture (HC) (Cell Applications, Inc cat.402k-05a) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-PDGFA is shown to assess the ability to infiltrate eukaryotic cells and functional activity, i.e., the expression of the therapeutic gene at the mRNA level.

The accumulation curve of amplicons during the reaction is shown in FIG. 5, corresponding to:

1-DNA vector VTvaf17-PDGFA cDNA of PDGFA gene in human chondrocyte culture (HC) before transfection,

2-DNA vector VTvaf17-PDGFA cDNA of PDGFA gene in human chondrocyte culture (HC) after transfection,

3-DNA vector VTvaf17-PDGFA transfection of cDNA of B2M gene in human chondrocyte culture (HC),

cDNA of the B2M gene in human chondrocyte culture (HC) after transfection with the 4-DNA vector VTvaf 17-PDGFA.

The B2M (beta-2-microglobulin) gene listed as accession No. NM004048.2 in GenBank database was used as a reference gene.

FIG. 6

The cDNA amplicon accumulation profile of the therapeutic gene, i.e., the PDGFB gene, in human chondrocyte culture (HC) (Cell Applications, Inc cat.402k-05a) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-PDGFB is shown in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e., the expression of the therapeutic gene at the mRNA level.

The accumulation curve of amplicons during the reaction is shown in FIG. 6, corresponding to:

1-DNA vector VTvaf17-PDGFB cDNA of PDGFB gene in human chondrocyte culture (HC) before transfection,

2-DNA vector VTvaf 17-cDNA of PDGFB gene in human chondrocyte culture (HC) after transfection of PDGFB,

3-DNA vector VTvaf17-PDGFB transfected human chondrocyte culture (HC) in B2M gene cDNA,

cDNA of the B2M gene in human chondrocyte culture (HC) after transfection with the 4-DNA vector VTvaf 17-PDGFB.

The B2M (beta-2-microglobulin) gene listed as accession No. NM004048.2 in GenBank database was used as a reference gene.

FIG. 7

A graph showing the concentration of BMP-2 protein in cell lysates of HOb human osteoblast cultures following transfection of HOb human osteoblasts with the DNA vector VTvaf17-BMP-2, and assessing functional activity, i.e., expression at the protein level, based on changes in the concentration of BMP-2 protein in the cell lysates.

Fig. 7 shows the following elements:

culture A-HOb human osteoblast culture transfected with aqueous dendrimer solution without plasmid DNA (reference),

culture B-HOb human osteoblast culture transfected with the DNA vector VTvaf17,

culture C-HOb human osteoblast culture transfected with DNA vector VTvaf 17-BMP-2.

FIG. 8

Shows that MG-63 human osteosarcoma cells were transfected with the DNA vector VTvaf 17-BMP-7: (CRL-1427^TM) Thereafter, the BMP-7 protein concentration in these cell culture lysates was plotted in order to assess the functional activity, i.e., the expression of the therapeutic gene at the protein level, and the possibility of increasing the protein expression level by gene therapy DNA vectors based on the gene therapy vector VTvaf17 carrying the BMP-7 therapeutic gene.

Fig. 8 shows the following elements:

culture A-MG-63 human osteosarcoma culture (reference) transfected with aqueous dendrimer solution free of plasmid DNA,

culture B-MG-63 human osteosarcoma culture transfected with the DNA vector VTvaf17,

culture C-MG-63 human osteosarcoma culture transfected with the DNA vector VTvaf 17-BMP-7.

FIG. 9

Shows that HGF-1 human gingival fibroblast is transfected with DNA vector VTvaf17-OPGCRL-2014^TM) Thereafter, the OPG protein concentration in these cell culture lysates was plotted to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the protein expression level by gene therapy DNA vectors based on the gene therapy vector VTvaf17 carrying the OPG therapeutic gene.

Fig. 9 shows the following elements:

culture A-cell culture of HGF-1 human gingival fibroblast cell line transfected with aqueous dendrimer solution without plasmid DNA (reference),

culture B-cell culture of HGF-1 human gingival fibroblast cell line transfected with DNA vector VTvaf17,

culture C-cell culture of HGF-1 human gingival fibroblast cell line transfected with DNA vector VTvaf 17-OPG.

FIG. 10 shows a schematic view of a

A graph of PDGFA protein concentration in these Cell culture lysates after transfection of Human Chondrocytes (HC) (Cell Applications, Inc cat.402k-05a) with the gene therapy DNA vector VTvaf17-PDGFA is shown to assess the functional activity, i.e., therapeutic gene expression at the protein level, and the likelihood of increased protein expression levels by the gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying the PDGFA therapeutic gene.

Fig. 10 shows the following elements:

culture A-Human Chondrocyte (HC) cell culture transfected with aqueous dendrimer solution without plasmid DNA (reference),

culture B-Human Chondrocyte (HC) cell culture transfected with gene therapy DNA vector VTvaf17,

culture C-Human Chondrocyte (HC) cell culture transfected with gene therapy DNA vector VTvaf 17-PDGFA.

FIG. 11

A graph of the PDGFB protein concentration in these Cell culture lysates after transfection of Human Chondrocytes (HC) (Cell Applications, Inc cat.402k-05a) with the gene therapy DNA vector VTvaf17-PDGFB is shown to assess the potential for functional activity, i.e., therapeutic gene expression at the protein level, and increased protein expression levels by the gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying the PDGFB therapeutic gene.

Fig. 10 shows the following elements:

culture A-Human Chondrocyte (HC) cell culture transfected with aqueous dendrimer solution without plasmid DNA (reference),

culture B-Human Chondrocyte (HC) cell culture transfected with gene therapy DNA vector VTvaf17,

culture C-Human Chondrocyte (HC) cell culture transfected with gene therapy DNA vector VTvaf 17-PDGFB.

FIG. 12

Shown are the PDGFA protein concentration profiles in skin biopsy samples of 3 patients after injection of the gene therapy DNA vector VTvaf17-PDGFA into their skin to assess the functional activity, i.e., expression of the therapeutic gene at the protein level, and the likelihood of increasing the protein expression level using a gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying the PDGFA therapeutic gene.

Fig. 12 shows the following elements:

P1I-patient P1 biopsy in the region where the gene therapy DNA vector VTvaf17-PDGFA was injected,

p1 II-patient P1 skin biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p1 III-patient P1 skin biopsy from an intact site,

P2I-patient P2 biopsy in the region where the gene therapy DNA vector VTvaf17-PDGFA was injected,

p2 II-patient P2 skin biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p2 III-skin from patient P2 examined intact on site,

P3I-patient P3 biopsy in the region where the gene therapy DNA vector VTvaf17-PDGFA was injected,

p3 II-patient P3 biopsy in the area of the injected gene therapy DNA vector VTvaf17 (placebo),

p3 III-skin from patient P3 taken on an intact site biopsy.

FIG. 13

A graph of OPG protein concentration in gastrocnemius biopsy samples of 3 patients after injection of the gene therapy DNA vector VTvaf17-OPG into their gastrocnemius is shown to assess functional activity, i.e. expression of the therapeutic gene at the protein level, and the possibility of increasing the protein expression level using a gene therapy DNA vector based on the gene therapy vector VTvaf17 carrying the OPG therapeutic gene.

Fig. 13 shows the following elements:

P1I-patient P1 gastrocnemius biopsy in the region of injection of the gene therapy DNA vector VTvaf17-OPG,

p1 II-patient P1 gastrocnemius biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p1 III-patient P1 gastrocnemius muscle from intact site biopsy,

P2I-patient P2 gastrocnemius biopsy in the region of injection of the gene therapy DNA vector VTvaf17-OPG,

p2 II-patient P2 gastrocnemius biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p2 III-patient P2 gastrocnemius muscle from an intact site biopsy,

P3I-patient P3 gastrocnemius biopsy in the region of injection of the gene therapy DNA vector VTvaf17-OPG,

p3 II-patient P3 gastrocnemius biopsy in the region of the injection of the gene therapy DNA vector VTvaf17 (placebo),

p3 III-patient P3 gastrocnemius muscle from an intact site biopsy.

FIG. 14

A graph of BMP-7 protein concentration in biopsy samples of skin from 3 patients after injection of the gene therapy DNA vector VTvaf17-BMP-7 into their skin is shown to assess the functional activity, i.e., the expression of the therapeutic gene at the protein level, and the possibility of increasing the protein expression level using a gene therapy DNA vector based on the gene therapy vector VTvaf17 carrying the BMP-7 therapeutic gene.

Fig. 14 shows the following elements:

P1I-patient P1 skin biopsy in the region of injection of gene therapy DNA vector VTvaf17-BMP-7,

p1 II-patient P1 skin biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p1 III-skin from patient P1 examined intact on site,

P2I-patient P2 skin biopsy in the region of injection of gene therapy DNA vector VTvaf17-BMP-7,

p2 II-patient P2 skin biopsy in the region injected with gene therapy DNA vector VTvaf17 (placebo),

p2 III-skin from patient P2 examined intact on site,

P3I-patient P3 skin biopsy in the region of injection of gene therapy DNA vector VTvaf17-BMP-7,

p3 II-patient P3 biopsy in the area of the injected gene therapy DNA vector VTvaf17 (placebo),

p3 III-skin from patient P3 taken on an intact site biopsy.

FIG. 15 shows a schematic view of a

A graph of BMP-7 protein concentration in human skin biopsy samples after subcutaneous injection of autologous fibroblast cultures transfected with gene therapy DNA vector VTvaf17-BMP-7 is shown to illustrate the method of use of autologous cells transfected with gene therapy DNA vector VTvaf17-BMP-7 by injection.

Fig. 15 shows the following elements:

P1C-patient P1 skin biopsy in the area of autologous fibroblast cultures of patients transfected with the gene therapy DNA vector VTvaf17-BMP-7 for injection,

P1B-patient P1 skin biopsy in the area of autologous fibroblasts of patients transfected with gene therapy DNA vector VTvaf17 for injection,

P1A-patient P1 skin from an intact site biopsy.

FIG. 16

A graph showing the concentration of human BMP-2 protein, human BMP-7 protein, human OPG protein, human PDGFA protein and human PDGFB protein in mechanically damaged areas of gingival soft tissue after injection of the gene therapy vector mixture in three Wistar rats: gene therapy DNA vector VTvaf17-BMP-2, gene therapy DNA vector VTvaf17-BMP-7, gene therapy DNA vector VTvaf17-IFNA2, gene therapy DNA vector VTvaf17-OPG, gene therapy DNA vector VTvaf17-PDGFA, gene therapy DNA vector VTvaf17-PDGFB to illustrate methods of using the gene therapy DNA vector cocktail.

Fig. 16 shows the following elements:

K1I-in the injection of gene therapy DNA vector mixture: k1 rats in the region of VTvaf17-BMP-2, VTvaf17-BMP-7, VTvaf17-OPG, VTvaf17-PDGFA and VTvaf17-PDGFB damaged gingival tissue fragments,

k1 II-K1 rats in the region of injection of the gene therapy DNA vector VTvaf17 (placebo) injured gingival tissue fragments,

k1 III-fragments of rat gingival tissue from the reference intact site K1,

K2I-in the injection of gene therapy DNA vector mixture: k2 rats in the region of VTvaf17-BMP-2, VTvaf17-BMP-7, VTvaf17-OPG, VTvaf17-PDGFA and VTvaf17-PDGFB damaged gingival tissue fragments,

k2 II-K2 rats in the region of injection of the gene therapy DNA vector VTvaf17 (placebo) injured gingival tissue fragments,

k2 III-fragments of rat gingival tissue from the reference intact site K2,

K3I-in the injection of gene therapy DNA vector mixture: k3 rats in the region of VTvaf17-BMP-2, VTvaf17-BMP-7, VTvaf17-OPG, VTvaf17-PDGFA and VTvaf17-PDGFB damaged gingival tissue fragments,

k3 II-K3 rats in the region of injection of the gene therapy DNA vector VTvaf17 (placebo) injured gingival tissue fragments,

k3 III-K3 rat gingival tissue fragments from the reference intact site.

FIG. 17

Shows the transfection of BT bovine turbinate cells (bone turbinate cells) with the DNA vector VTvaf17-OPG (Bt cells)CRL-1390^TM) OPG therapeutic gene cDNA amplicon accumulation profiles before and after 48 hours to illustrate the method of use by injecting gene therapy DNA vectors into animals.

The accumulation curve of amplicons during the reaction is shown in FIG. 17, corresponding to:

1-Gene therapy DNA vector VTvaf17-OPG the cDNA of the OPG gene in bovine turbinate cells before transfection,

2-Gene therapy DNA vector VTvaf 17-cDNA of OPG gene in bovine turbinate cells after OPG transfection,

3-Gene therapy DNA vector VTvaf17-OPG transfected ox nasal turbinate cell ACT gene cDNA,

4-Gene therapy DNA vector VTvaf17-OPG transfected bovine turban cell ACT gene cDNA.

The bull/bovine actin gene (ACT) listed in the GenBank database under accession number AH001130.2 was used as the reference gene.

Detailed Description

Based on the 3165bp DNA vector VTvaf17, gene therapy DNA vectors carrying therapeutic genes were constructed, designed to increase the expression levels of these therapeutic genes in human and animal tissues. Method for the production of each gene therapy DNA vector carrying a human therapeutic gene selected from the group of genes consisting of: BMP-2 gene (encoding BMP-2 protein), BMP-7 gene (encoding BMP-7 protein), OPG gene (encoding OPG protein), PDGFA gene (encoding PDGFA protein) and PDGFB gene (encoding PDGFB protein). It is well known that the ability of a DNA vector to penetrate eukaryotic cells depends largely on the size of the vector. The smallest size DNA carrier has a higher permeability. Thus, it is preferred that no elements which do not bear a functional load, but which at the same time increase the size of the vector DNA, are present in the vector. These features of the DNA vector were taken into account during the production of a gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying a therapeutic gene selected from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes, wherein there are no large non-functional sequences and antibiotic resistance genes in the vector, allowing for a significant reduction in the size of the resulting gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes), in addition to technical advantages and safe use. Thus, the ability of the obtained gene therapy DNA vector to penetrate into eukaryotic cells is due to its small length.

Each of the following gene therapy DNA vectors was generated as follows: the DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf 17-PDGFB: cloning the coding region of the therapeutic gene selected from the group of BMP-2 or BMP-7 or OPG or PDGFA or PDGFB gene into gene therapy DNA vector VTvaf17 to obtain gene therapy DNA vector VTvaf17-BMP-2, SEQ ID No.1, respectively; or VTvaf17-BMP-7, SEQ ID No. 2; or VTvaf17-OPG, SEQ ID No. 3; or VTvaf17-PDGFA, SEQ ID No. 4; or VTvaf17-PDGFB, SEQ ID No. 5. Total RNA is extracted from a biological normal tissue specimen to generate coding regions of a BMP-2 gene (1219bp), a BMP-7 gene (1322bp), an OPG gene (1207bp), a PDGFA gene (592bp) and a PDGFB gene (729 bp). First strand cDNA of human BMP-2, BMP-7, OPG, PDGFA and PDGFB genes was synthesized by reverse transcription. Amplification is carried out using oligonucleotides produced by chemical synthesis for this purpose. The amplified product was cleaved with specific restriction endonucleases taking into account the optimal procedures for further cloning and cloned into the gene therapy DNA vector VTvaf17 with BamHI, EcoRI, HindIII, KpnI, SalI, NheI restriction sites located on the VTvaf17 vector polylinker. The restriction sites are selected such that the cloned fragment enters the reading frame of the expression cassette of the vector VTvaf17, and the protein coding sequence does not contain the restriction sites for the chosen endonuclease. Those skilled in the art recognize that the methodological implementation of gene therapy DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA or VTvaf17-PDGFB production may vary within the framework of selecting known molecular gene cloning methods, and that these methods are included within the scope of the present invention. For example, different oligonucleotide sequences can be used to amplify BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB genes, different restriction enzymes, or laboratory techniques such as ligation-independent gene cloning.

The gene therapy DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGB has the nucleotide sequence of SEQ ID No.1, or SEQ ID No.2, or SEQ ID No.3, or SEQ ID No.4, or SEQ ID No.5, respectively. At the same time, the degeneracy of the genetic code is known to the expert in the field and this means that variants of the nucleotide sequences are also included within the scope of the invention, differing by the insertion, deletion or substitution of nucleotides which do not lead to a change in the sequence of the polypeptide encoded by the therapeutic gene and/or do not lead to a loss of functional activity of the regulatory elements of the VTvaf17 vector. At the same time, genetic polymorphisms are known to the expert in the field and it is intended that the scope of the invention also includes variants of the nucleotide sequences from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes, which also encode different variants of the amino acid sequences of BMP-2, BMP-7, OPG, PDGFA and PDGFB proteins, which do not differ from those listed in their functional activity under physiological conditions.

The ability to penetrate eukaryotic cells and express functional activity, i.e., the ability to express the therapeutic gene of the obtained gene therapy DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA or VTvaf17-PDGFB, was confirmed by injecting the obtained vector into eukaryotic cells and then analyzing the expression of specific mRNA and/or the protein product of the therapeutic gene. The presence of specific mRNA in cells into which gene therapy DNA vectors were introduced VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB demonstrates the ability of the obtained vectors to penetrate eukaryotic cells and express mRNA of therapeutic genes. Furthermore, experts in the field know that the presence of mRNA genes is a mandatory condition, but not evidence for translation of the protein encoded by the therapeutic gene. Therefore, to confirm the property of the gene therapy DNA vector VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB to express the therapeutic gene at the protein level in eukaryotic cells into which the gene therapy DNA vector was introduced, analysis of the concentration of the protein encoded by the therapeutic gene was performed using an immunological method. The efficacy of the expression of the therapeutic gene in eukaryotic cells was demonstrated by the presence of BMP-2, or BMP-7, or OPG, or PDGFA or PDGFB protein, and the possibility of increasing the protein concentration using gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying the therapeutic gene (selected from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes). To confirm the efficacy of the resulting gene therapy DNA vector VTvaf17-BMP-2 (i.e., BMP-2 gene), gene therapy DNA vector VTvaf17-BMP-7 (i.e., BMP-7 gene) carrying a therapeutic gene, gene therapy DNA vector VTvaf17-OPG (i.e., OPG gene) carrying a therapeutic gene, gene therapy DNA vector VTvaf17-PDGFA (i.e., PDGFA gene), gene therapy DNA vector VTvaf17-PDGFB (i.e., PDGFB gene) carrying a therapeutic gene, the following methods were used:

A) real-time PCR, i.e., the change in mRNA accumulation of therapeutic genes in human and animal cell lysates following transfection of different human and animal cell lines with gene therapy DNA vectors;

B) enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in human cell lysates after transfection of different human cell lines with gene therapy DNA vectors.

C) Enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in the supernatant of human and animal tissue biopsy specimens after injection of gene therapy DNA vectors into these tissues;

D) enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in the supernatant of human tissue biopsy after injection of these tissues with autologous cells of the human transfected with gene therapy DNA vectors.

To confirm the feasibility of using the constructed gene therapy DNA vector VTvaf17-BMP-2 carrying the therapeutic gene (i.e., BMP-2 gene), gene therapy DNA vector VTvaf17-BMP-7 carrying the therapeutic gene (i.e., BMP-7 gene), gene therapy DNA vector VTvaf17-OPG carrying the therapeutic gene (i.e., OPG gene), gene therapy DNA vector VTvaf17-PDGFA carrying the therapeutic gene (i.e., PDGFA gene), the following operations were performed:

A) transfection of different human and animal cell lines with gene therapy DNA vectors,

B) gene therapy DNA vectors are injected into different human and animal tissues,

C) injecting the gene therapy DNA carrier mixture into animal tissue,

D) autologous cells transfected with the gene therapy DNA vector are injected into human tissue.

These methods of use lack the potential risk of gene therapy for humans and animals due to the lack of regulatory elements in the gene therapy DNA vector that make up the nucleotide sequence of the viral genome and the lack of antibiotic resistance genes in the gene therapy DNA vector, as evidenced by the lack of regions of homology to the viral genome and antibiotic resistance genes in the nucleotide sequence of gene therapy DNA vector VTvaf17-BMP-2, or gene therapy DNA vector VTvaf17-BMP-7, or gene therapy DNA vector VTvaf17-OPG, or gene therapy DNA vector VTvaf17-PDGFA, or gene therapy DNA vector VTvaf17-PDGFB (SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, respectively).

It is known to experts in the field that the use of antibiotic resistance genes in gene therapy DNA vectors allows to obtain a preparative scale of these vectors by increasing the bacterial biomass in a nutrient medium containing selective antibiotics. Within the framework of the present invention, it is not possible to use selective nutrient media containing antibiotics in order to ensure the safe use of the gene therapy DNA vector VTvaf17 carrying the BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB therapeutic genes. A method of obtaining strains for producing these gene therapy vectors based on the escherichia coli strain SCS110-AF is proposed as a technical solution for obtaining a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of BMP-2, BMP-7, OPG, PDGFA, and PDGFB genes) in order to expand the production of gene therapy vectors on an industrial scale. Methods of production of E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf17-PDGFB, involve the production of competent cells of E.coli strain SCS110-AF, wherein gene therapy DNA vector VTvaf17-BMP-2, or DNA vector VTvaf17-BMP-7, or DNA vector VTvaf17-OPG, or DNA vector VTvaf17-PDGFA, or DNA vector VTvaf17-PDGFB, respectively, are injected into these cells using transformation (electroporation) methods well known to the expert in the art. The obtained E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or SCS110-AF/VTvaf17-PDGFB was used to produce gene therapy DNA vectors VTvaf17-NOS2, or VTvaf17-NOS3, or VTvaf17-VIP, or VTvaf17-KCNMA1, or VTvaf17-CGRP, respectively, allowing the use of antibiotic-free medium.

To confirm the production of E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf17-PDGFB, transformation, selection and subsequent termination with extraction of plasmid DNA were performed.

To confirm the producibility, constructability and scale-up to production scale of gene therapy DNA vector VTvaf17-PDGFA carrying therapeutic gene (i.e., PDGFB gene), gene therapy DNA vector VTvaf17-PDGFB carrying therapeutic gene (i.e., PDGFB gene), VTvaf17-PDGFA, E.coli strain 110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, respectively containing gene therapy DNA vector VTvaf 2 carrying therapeutic gene (i.e., BMP-2 or BMP-7 or OPG or PDGFA or PDGFB gene), for gene therapy DNA vector VTvaf17-OPG carrying therapeutic gene (i.e., BMP-7 gene), gene therapy DNA vector VTvaf17-PDGFA carrying therapeutic gene, for gene therapy DNA vector VTvaf, or PDGFA gene VTvaf, on an industrial scale, Or carrying out fermentation on an Escherichia coli strain SCS110-AF/VTvaf17-OPG, an Escherichia coli strain SCS110-AF/VTvaf17-PDGFA, or an Escherichia coli strain SCS110-AF/VTvaf 17-PDGFB.

A method of expanding the production of bacterial colonies to an industrial scale for isolating a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of BMP-2, BMP-7, OPG, PDGFA, and PDGFB genes) involving incubating a seed culture of escherichia coli strain SCS110-AF/VTvaf17-BMP-2, or escherichia coli strain SCS110-AF/VTvaf17-BMP-7, or escherichia coli strain SCS110-AF/VTvaf17-OPG, or escherichia coli strain SCS110-AF/VTvaf17-PDGFA, or escherichia coli strain SCS110-AF/VTvaf17-PDGFB in an antibiotic-free nutrient medium that provides suitable biomass accumulation dynamics. After a sufficient amount of biomass has been reached in the logarithmic growth phase, the bacterial culture is transferred to an industrial fermentor and then cultured to stationary phase, then the fraction containing the therapeutic DNA product (i.e., gene therapy DNA vector VTvaf17-BMP-2, or gene therapy DNA vector VTvaf17-BMP-7, or gene therapy DNA vector VTvaf17-OPG, or gene therapy DNA vector VTvaf17-PDGFA or gene therapy DNA vector VTvaf17-PDGFB) is extracted, multi-stage filtered, and purified by chromatographic methods. It is known to experts in the field that the culture conditions of the strains, the composition of the nutrient medium (except for the absence of antibiotics), the equipment used, and the DNA purification methods may vary within the framework of standard procedures with the particular production line, but known methods of expansion, industrial production, and purification of DNA vectors using the escherichia coli strain SCS110-AF/VTvaf17-BMP-2, escherichia coli strain SCS110-AF/VTvaf17-BMP-7, escherichia coli strain SCS110-AF/VTvaf17-OPG, escherichia coli strain SCS110-AF/VTvaf17-PDGFA, or escherichia coli strain SCS110-AF/VTvaf17-PDGFB fall within the scope of the present invention.

The disclosure of the present invention is illustrated by way of examples of embodiments of the invention.

The essence of the invention will be explained in the following examples.

Example 1.

A gene therapy DNA vector VTvaf17-BMP-2 carrying a therapeutic gene (i.e., BMP-2 gene) was prepared.

The BMP-2 gene coding region (1219bp) is cloned to the 3165bp DNA vector VTvaf17 through NheI and HindIII restriction sites to construct the gene therapy DNA vector VTvaf 17-BMP-2. Total RNA was isolated from a biological human tissue sample, followed by reverse transcription using commercial kit Mint-2 (Evagen, Russia), and the following oligonucleotides and commercial kit were usedThe coding region of BMP-2 gene (1219bp) was obtained by PCR amplification with high fidelity DNA polymerase (New England Biolabs, USA):

BMP2_F ACAGCTAGCCTCCTAAAGGTCCACCATGGT，

BMP2_R TATAAGCTTCTAGCGACACCCACAACCCT。

the gene therapy DNA vector VTvaf17 was constructed by integrating 6 DNA fragments derived from different sources:

(a) the origin of replication was generated by PCR amplification of the pBR322 region of a commercially available plasmid with point mutations;

(b) the EF1a promoter region was generated by PCR amplification of a site of human genomic DNA;

(c) hGH-TA transcriptional terminator was generated by PCR amplification of the human genomic DNA locus;

(d) the RNA-OUT regulatory site of transposon Tn10 was synthesized from oligonucleotides;

(e) the kanamycin resistance gene was generated by PCR amplification of a site of the commercially available plasmid pET-28;

(f) polylinkers are generated by annealing two synthetic oligonucleotides.

According to the manufacturer's instructions, use the commercially available kitPCR amplification was performed with high fidelity DNA polymerase (New England Biolabs, USA). The fragments have overlapping regions allowing them to be combined with subsequent PCR amplification. The oligonucleotides Ori-F and EF1-R integration fragments (a) and (b) were used, and the oligonucleotides hGH-F and Kan-R integration fragments (c), (d), and (e) were used. The resulting fragments were then integrated by restriction with sites BamHI and NcoI, followed by ligation. This results in a plasmid still lacking polylinkers. To add it, the plasmid was cut through BamHI and EcoRI sites and then ligated with fragment (f). Thus, a 4182bp vector carrying the kanamycin resistance gene flanked by SpeI restriction sites was constructed. The gene was then cleaved by the SpeI restriction site, and the remaining fragment was ligated to itself. This resulted in the recombinant 3165bp gene therapy DNA vector VTvaf17 and allowed antibiotic-free selection.

The amplification product of the coding region of the BMP-2 gene and the DNA vector VTvaf17 were cleaved with NheI and HindIII restriction enzymes (New England Biolabs, USA).

This gave a 4360bp DNA vector VTvaf17-BMP-2, which had the nucleotide sequence SEQ ID No.1 and the overall structure is shown in FIG. 1A.

Example 2.

A gene therapy DNA vector VTvaf17-BMP-7 carrying a therapeutic gene (i.e., BMP-7 gene) was prepared.

The BMP-7 gene coding region (1322bp) is cloned to the 3165bp DNA vector VTvaf17 through NheI and HindIII restriction sites, and the gene therapy DNA vector VTvaf17-BMP-7 is constructed. Total RNA was isolated from a biological human tissue sample, followed by reverse transcription using commercial kit Mint-2 (Evagen, Russia), and the following oligonucleotides and commercial kit were usedThe coding region (1322bp) of the BMP-7 gene was obtained by PCR amplification with high fidelity DNA polymerase (New England Biolabs, USA):

BMP7_F TCAGCTAGCGTAGAGCCGGCGCGATGCA，

BMP7_ R TATAAGCTTCTAGTGGCAGCCACAGGC; the amplification product and the DNA vector VTvaf17 were cut with the restriction enzymes NheI and HindIII (New England Biolabs, USA).

This gave the 4463bp DNA vector VTvaf17-BMP-7, which had the nucleotide sequence SEQ ID No.2 and the overall structure is shown in FIG. 1B.

The construction of the gene therapy DNA vector VTvaf17 is described in example 1.

Example 3.

A gene therapy DNA vector VTvaf17-OPG carrying a therapeutic gene (i.e., the human OPG gene) was prepared.

The coding region (1207bp) of the OPG gene was cloned into a 3165bp DNA vector VTvaf17 through BamHI and EcoRI restriction sites to construct a gene therapy DNA vector VTvaf 17-OPG. Total RNA was isolated from a biological human tissue sample, followed by reverse transcription using commercial kit Mint-2 (Evagen, Russia), and the following oligonucleotides and commercial kit were usedThe coding region of the OPG gene (1207bp) was obtained by PCR amplification with high fidelity DNA polymerase (New England Biolabs, USA):

OPG_F AGGATCCACCATGAACAACTTGCTGTGCTGC，

OPG _ R ATAGAATTCATAAGCAGCTTATTTTTACTGATTG; the amplified product and the DNA vector VTvaf17 were cut with the restriction enzymes BamHI and EcoRI (New England Biolabs, USA).

This gave a 4348bp DNA vector VTvaf17-OPG having the nucleotide sequence SEQ ID No.3 and the overall structure as shown in FIG. 1C.

The construction of the gene therapy DNA vector VTvaf17 is described in example 1.

Example 4.

A gene therapy DNA vector VTvaf17-PDGFA carrying a therapeutic gene (i.e., the PDGFA gene) was prepared.

The PDGFA gene coding region (592bp) was cloned into the 3165bp DNA vector VTvaf17 through BamHI and EcoRI restriction sites to construct the gene therapy DNA vector VTvaf 17-PDGFA. Total RNA was isolated from biological human tissue samples, followed by reverse transcription using commercial kit Mint-2 (Evagen, Russia)And the following oligonucleotides and commercially available kits were usedPCR amplification with high fidelity DNA polymerase (New England Biolabs, USA) yielded the coding region for the PDGFA gene (592 bp):

PDGFA_F AGGATCCACCATGAGGACCTTGGCTTGCCT，

PDGFA _ R TATGAATTCACCTCACATCCGTGTCCTCT; the amplification product and the DNA vector VTvaf17 were cleaved with the restriction enzymes BamHII and EcoRI (New England Biolabs, USA).

This gave the 3733bp DNA vector VTvaf17-PDGFA having the nucleotide sequence SEQ ID No.4 and the overall structure as shown in FIG. 1D.

The construction of the gene therapy DNA vector VTvaf17 is described in example 1.

Example 5.

A gene therapy DNA vector VTvaf17-PDGFB was prepared which carried the therapeutic gene (i.e., the PDGFB gene).

The PDGFB gene coding region (729bp) was cloned into the 3165bp DNA vector VTvaf17 via SalI and KpnI restriction sites, and the gene therapy DNA vector VTvaf17-PDGFB was constructed. Total RNA was isolated from a biological human tissue sample, followed by reverse transcription using a commercial kit Mint-2 (Evagen), and the following oligonucleotides and commercial kits were usedPCR amplification with high fidelity DNA polymerase (New England Biolabs, USA) yielded the PDGFB gene coding region (729 bp):

PDGFB_F TATGTCGACCACCATGAATCGCTGCTGGGCGCT，

PDGFB _ R TATGGTACCTAGGCTCCAAGGGTCTCCTTC; the amplification product and the DNA vector VTvaf17 were cut with the restriction enzymes SalI and KpnI (New England Biolabs, USA).

This gave the 3888bp DNA vector VTvaf17-PDGFB which had the nucleotide sequence SEQ ID No.5 and the overall structure is shown in FIG. 1D.

The construction of the gene therapy DNA vector VTvaf17 is described in example 1.

Example 6.

The gene therapy DNA vector carrying the therapeutic gene (i.e., BMP-2 gene) VTvaf17-BMP-2 demonstrates its ability to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

48 hours after transfection of HOb human osteoblast cultures (Cell Applications, Inc Cat.406-05a) with the gene therapy DNA vector VTvaf17-BMP-2 carrying the human BMP-2 gene, changes in the accumulation of mRNA for the BMP-2 therapeutic gene were assessed. In real-time PCR, the amount of mRNA is determined by the accumulation kinetics of cDNA amplicons.

Changes in the accumulation of BMP-2 therapeutic gene mRNA were assessed using primary HOb human osteoblast cultures. Human osteoblast growth medium was used: all-in-one ready-to-use (Cell Applications, Inc Cat.417-500) HOb Cell cultures were cultured under standard conditions (37 ℃, 5% CO 2). The medium was changed every 48 hours during the culture.

To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Transfection of the gene therapy DNA vector VTvaf17-BMP-2 expressing the human BMP-2 gene was performed using Lipofectamine3000(ThermoFisher Scientific, USA) according to the manufacturer's recommendations. In test tube 1, 1. mu.L of the DNA vector VTvaf17-BMP-2 solution (concentration 500 ng/. mu.L) and 1. mu.L of reagent P3000 were added to 25. mu.L of medium Opti-MEM (Gibco, USA). The preparations were mixed by gentle shaking. In tube 2, 1. mu.L of Lipofectamine3000 solution was added to 25. mu.L of culture medium Opti-MEM (Gibco, USA). The preparations were mixed by gentle shaking. The contents from tube 1 were added to the contents of tube 2 and the mixture was incubated for 5 minutes at room temperature. The resulting solution was added dropwise to the cells in a volume of 40. mu.L.

HOb cells transfected with the gene therapy DNA vector VTvaf17 without the inserted therapeutic gene (cDNA of BMP-2 gene before and after transfection of gene therapy DNA vector VTvaf17 without the inserted therapeutic gene is not shown in the figure) were used as reference. The reference vector for transfection, VTvaf17, was prepared as described above.

Total RNA from HOb cells was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer's recommendations. 1ml of Trizol reagent was added to the wells with cells, homogenized and heated at 65 ℃ for 5 minutes. The sample was then centrifuged at 14000g for 10 minutes and reheated at 65 ℃ for 10 minutes. Then 200. mu.L of chloroform was added, and the mixture was gently stirred and centrifuged at 14000g for 10 minutes. The aqueous phase was then separated and mixed with 1/10 volumes of 3M sodium acetate, ph5.2 and an equal volume of isopropanol. The samples were incubated at-20 ℃ for 10 minutes and then centrifuged at 14000g for 10 minutes. The precipitated RNA was rinsed in 1ml 70% ethanol, air-dried, and dissolved in 10. mu.L of RNase-free water. The kinetics of cDNA amplicon accumulation was assessed by real-time PCR and the expression level of BMP-2mRNA was determined after transfection. For the production and amplification of human BMP-2 gene-specific cDNA, the following BMP-2_ SF and BMP-2_ SR oligonucleotides were used

BMP-2_SF ATGCAAGCAGGTGGGAAAGT,

BMP-2_FR GGGAGCCACAATCCAGTCAT

The length of the amplification product is 353 bp.

Reverse transcription reactions and PCR amplifications were performed using SYBR GreenQuantitect RT-PCR kit (Qiagen, USA) for real-time PCR. The reaction was carried out in a volume of 20 μ l, comprising: 25 μ l QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM magnesium chloride, 0.5 μ M each primer and 5 μ l RNA. For the reaction, a CFX96 amplification apparatus (Bio-Rad, USA) was used under the following conditions: reverse transcription at 42 ℃ for 30 min, denaturation at 98 ℃ for 15 min for 1 cycle followed by 40 cycles comprising denaturation at 94 ℃ for 15s, annealing at 60 ℃ for 30s and elongation at 72 ℃ for 30 s. The B2M (beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. The positive control included PCR amplicons on a matrix represented by plasmids of known concentration containing the cDNA sequences of the BMP-2 and B2M genes. The negative control included deionized water. The accumulation kinetics of BMP-2 and B2M gene cDNA amplicons were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The analysis results are shown in FIG. 2.

FIG. 2 shows that, due to transfection of HOb human osteoblasts with the gene therapy DNA vector VTvaf17-BMP-2, the specific mRNA level of the human BMP-2 gene was greatly increased, confirming the ability of the vector to penetrate eukaryotic cells and express the BMP-2 gene at the mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-BMP-2 to increase the expression level of the BMP-2 gene in eukaryotic cells.

Example 7.

The gene therapy DNA vector carrying the therapeutic gene (i.e., BMP-7 gene) VTvaf17-BMP-7 demonstrated its ability to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Transfection of MG-63 human osteosarcoma cultures with the Gene therapy DNA vector carrying the human BMP-7 Gene VTvaf17-BMP-7(CRL-1427^TM) 48 hours later, changes in the accumulation of mRNA for the BMP-7 therapeutic gene were assessed. In real-time PCR, the amount of mRNA is determined by the accumulation kinetics of cDNA amplicons.

EMEM (added with 10% bovine serum (Paneko, Russia)30-2003^TM) In (b), primary MG-63 human osteosarcoma cells were cultured under standard conditions (37 ℃, 5% CO2) (b)CRL-1427^TM). To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-BMP-7 expressing the human BMP-7 gene following the procedure described in example 6. The B2M (beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. MG-63 human osteosarcoma cell cultures transfected with the gene therapy DNA vector VTvaf17 without the therapeutic gene (cDNA of BMP-7 gene before and after transfection of the gene therapy DNA vector VTvaf17 without the inserted therapeutic gene is not shown in the figure) were used as reference.RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 6, except for oligonucleotides having a different sequence from example 6. To amplify the human BMP-7 gene-specific cDNA, the following BMP-7_ SF and BMP-7_ SR oligonucleotides were used:

BMP-7_SF GCTGGCTGGTGTTTGACATC，

BMP-7_SR TGGTGGCGTTCATGTAGGAG

the length of the amplification product is 459 bp.

The positive control included PCR amplicons on a matrix represented by plasmids of known concentration containing the cDNA sequences of the BMP-7 and B2M genes. The negative control included deionized water. PCR products (i.e., BMP-7 and B2M gene cDNAs) were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The analysis results are shown in FIG. 3.

FIG. 3 shows that the specific mRNA level of human BMP-7 gene is greatly increased due to transfection of MG-63 human osteosarcoma cells with gene therapy DNA vector VTvaf17-BMP-7, confirming the ability of the vector to penetrate eukaryotic cells and express BMP-7 gene at mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-BMP-7 to increase the expression level of the BMP-7 gene in eukaryotic cells.

Example 8.

The gene therapy DNA vector carrying the therapeutic gene (i.e., the OPG gene) VTvaf17-OPG demonstrated its ability to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

HGF-1 human gingival fibroblast cells transfected with Gene therapy DNA vector carrying human OPG Gene VTvaf17-OPG (II)CRL-2014^TM) At 48 hours later, changes in the accumulation of mRNA from the therapeutic gene for OPG were assessed. In real-time PCR, the amount of mRNA is determined by the accumulation kinetics of cDNA amplicons.

Adding 10% bovine serum (30-2020^TM) Dulbecco's Modified Eagle Medium (DMEM) ((DMEM))30-2002^TM) In (1), HGF-1 human gingival fibroblast cell line (C) was cultured under standard conditions (37 ℃, 5% CO2) (C)CRL-2014^TM). To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-OPG expressing the human OPG gene according to the method described in example 6. The B2M (beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. HGF-1 human gingival fibroblast cell line was transfected with gene therapy DNA vector VTvaf17 without a therapeutic gene (cDNA of OPG gene before and after transfection of gene therapy DNA vector VTvaf17 without an inserted therapeutic gene is not shown in the figure) for reference. RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 6, except for oligonucleotides having a different sequence from example 6. To amplify human OPG gene specific cDNA, the following OPG _ SF and OPG _ SR oligonucleotides were used:

OPG_SF CTACACAGACAGCTGGCACA，

OPG_SR CTCCAAATCCAGGAGGGCAG

the length of the amplification product is 182 bp.

The positive control included PCR amplicons on a substrate represented by plasmids of known concentration containing the cDNA sequence of the OPG and B2M genes. The negative control included deionized water. The accumulation kinetics of OPG and B2M gene cDNA amplicons were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The analysis results are shown in FIG. 4.

FIG. 4 shows that the specific mRNA level of human OPG gene is greatly increased due to transfection of HGF-1 human gingival fibroblast with gene therapy DNA vector VTvaf17-OPG, confirming the ability of the vector to penetrate eukaryotic cells and express OPG gene at mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-OPG to increase the expression level of the OPG gene in eukaryotic cells.

Example 9.

The ability of gene therapy DNA vectors VTvaf17-PDGFA carrying a therapeutic gene (i.e., the PDGFA gene) to penetrate eukaryotic cells and their functional activity at the therapeutic gene mRNA expression level was demonstrated. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Changes in PDGFA therapeutic gene mRNA accumulation were assessed 48 hours after transfection of human chondrocyte cultures (HC) with the gene therapy DNA vector carrying the human PDGFA gene, VTvaf17-PDGFA (Cell Applications, Inc cat.402k-05 a). In real-time PCR, the amount of mRNA is determined by the accumulation kinetics of cDNA amplicons.

Growth medium on human chondrocytes under standard conditions (37 ℃, 5% CO 2): human chondrocyte line (HC) was cultured in All-in-one ready-to-use (Cell Applications, Inc Cat.402K-05 a). To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-PDGFA expressing the human PDGFA gene according to the method described in example 6. Human chondrocyte line (HC) was transfected with gene therapy DNA vector VTvaf17 not carrying a therapeutic gene (cDNA of PDGFA gene before and after transfection of gene therapy DNA vector VTvaf17 not carrying an inserted therapeutic gene is not shown in the figure) for reference. RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 6, except for oligonucleotides having a different sequence from example 6. To amplify human PDGFA gene-specific cDNA, the following PDGFA _ SF and PDGFA _ SR oligonucleotides were used:

PDGFA_SF CTGCCCATTCGGAGGAAGAG，

PDGFA_SR CTTGACACTGCTCGTGTTGC

the length of the amplified product is 180 bp.

Positive controls included PCR amplicons on matrices represented by plasmids of known concentration containing cDNA sequences of the PDGFA and B2M genes. The B2M (beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. The negative control included deionized water. PCR products obtained by amplification (i.e., PDGFA and B2M gene cDNAs) were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The analysis results are shown in FIG. 5.

Fig. 5 shows that, since the gene therapy DNA vector VTvaf17-PDGFA transfects human chondrocyte line HC, the mRNA level specific to human PDGFA gene was greatly increased, confirming that the vector was able to infiltrate eukaryotic cells and express the PDGFA gene at the mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-PDGFA to increase the expression level of the PDGFA gene in eukaryotic cells.

Example 10.

The ability of the gene therapy DNA vector VTvaf17-PDGFB carrying the therapeutic gene (i.e., the PDGFB gene) to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level was demonstrated. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Changes in PDGFB therapeutic gene mRNA accumulation were assessed 48 hours after transfection of human chondrocyte cultures (HC) (Cell Applications, Inc Cat.402K-05a) with the gene therapy DNA vector VTvaf17-PDGFB carrying the human PDGFB gene. In real-time PCR, the amount of mRNA is determined by the accumulation kinetics of cDNA amplicons.

Growth medium on human chondrocytes under standard conditions (37 ℃, 5% CO 2): human chondrocyte line (HC) was cultured in All-in-one ready-to-use (Cell Applications, Inc Cat.402K-05 a). To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-PDGFB expressing the human PDGFB gene as described in example 6. The gene therapy DNA vector VTvaf17 transfected human chondrocyte line (HC) not carrying the therapeutic gene (cDNA of PDGFB gene before and after transfection of gene therapy DNA vector VTvaf17 not inserted with the therapeutic gene is not shown in the figure) was used as reference. Except that it has a different sequence from example 6In addition to the oligonucleotides of (1), RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 6. To amplify the human PDGFB gene-specific cDNA, the following PDGFB _ SF and PDGFB _ SR oligonucleotides were used:

PDGFB_SF CGCTCTTCCTGTCTCTCTGC，

PDGFB_SR CGGGTCATGTTCAGGTCCAA

the length of the amplification product is 181 bp.

The positive control included PCR amplicons on a matrix represented by plasmids of known concentration containing cDNA sequences of the PDGFB and B2M genes. The B2M (beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. The negative control included deionized water. PCR products obtained by amplification (i.e., PDGFB and B2M gene cDNAs) were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The analysis results are shown in FIG. 6.

Fig. 6 shows that, since the gene therapy DNA vector VTvaf17-PDGFB transfects human chondrocyte line HC, the specific mRNA level of human PDGFB gene was greatly increased, confirming that the vector is able to infiltrate eukaryotic cells and express PDGFB gene at the mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-PDGFB to increase the expression level of the PDGFB gene in eukaryotic cells.

Example 11.

The efficiency and feasibility of gene therapy DNA vector VTvaf17-BMP-2 carrying BMP-2 gene to increase BMP-2 protein expression in mammalian cells were demonstrated.

After HOb human osteoblasts (Cell Applications, Inc Cat.406-05a) were transfected with the DNA vector VTvaf17-BMP-2 carrying the human BMP-2 gene, lysates of these cells were evaluated for changes in BMP-2 protein concentration.

The growth of the HOb human osteoblast culture was as described in example 6.

To achieve 90% confluence, cells were plated at 5 × 10 per well 24 hours prior to transfection procedure⁴The amount of individual cells was seeded in 24-well plates. Transfection was performed using the 6 th generation SuperFect transfection reagent (Qiagen, Germany). Using an aqueous dendrimer solution (A) free of a DNA carrier and a DNA carrier VTvaf17(B) free of BMP-2 gene cDNA as a controlAnd using a DNA vector VTvaf17-BMP-2(C) carrying the human BMP-2 gene as a transfection agent. The DNA-dendrimer complexes were prepared according to the manufacturer's procedure (QIAGEN, SuperFect Transfection Reagent Handbook,2002) with some modifications. For cell transfection in 1 well of a 24-well plate, the medium was added to 1 μ g of DNA vector dissolved in TE buffer to a final volume of 60 μ L, then 5 μ L of SuperFect transfection reagent was added and gently mixed by pipetting five times. The complex was incubated at room temperature for 10-15 minutes. The medium was then removed from the wells and the wells were washed with 1ml of PBS buffer. To the resulting complex, 350. mu.L of medium containing 10. mu.g/ml gentamicin was added, gently mixed, and added to the cells. Cells and complexes were incubated at 37 ℃ in the presence of 5% CO2 for 2-3 hours.

The medium was then carefully removed and the viable cell array was washed with 1ml of PBS buffer. Then, a medium containing 10. mu.g/ml gentamicin was added and cultured in the presence of 5% CO2 at 37 ℃ for 24-48 hours.

After transfection, 0.1ml of 1N HCl was added to 0.5ml of the culture broth, mixed well, and incubated at room temperature for 10 minutes. Then, 0.1ml of 1.2M NaOH/0.5M HEPES (pH7-7.6) was added to neutralize the mixture and thoroughly stirred. The supernatant was collected and used to assay for therapeutic proteins. BMP-2 protein was detected by enzyme-linked immunosorbent assay (ELISA) using human BMP-2DuoSet ELISA (R & D Systems Cat DY355-05, USA) according to the manufacturer's method, and optical density detection was performed using ChemWell Automated EIA and chemical Analyzer (Awinenes Technology Inc., USA).

To measure the value of the concentration, a calibration curve was constructed using a kit of known BMP-2 protein concentrations with reference to the sample. The sensitivity was 50pg/ml and the measurement range was 50pg/ml to 4000 pg/ml. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 7.

FIG. 7 shows that transfection of HOb human osteoblasts with the gene therapy DNA vector VTvaf17-BMP-2 resulted in an increase in BMP-2 protein concentration compared to the reference sample, confirming the ability of the vector to penetrate eukaryotic cells and express the BMP-2 gene at the protein level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-BMP-2 to increase the expression level of the BMP-2 gene in eukaryotic cells.

Example 12.

The efficiency and feasibility of gene therapy DNA vector VTvaf17-BMP-7 carrying BMP-7 gene to increase BMP-7 protein expression in mammalian cells were demonstrated.

MG-63 human osteosarcoma cells transfected with DNA vector VTvaf17-BMP-7 carrying human BMP-7 Gene (CRL-1427^TM) Thereafter, lysates of these cells were evaluated for changes in BMP-7 protein concentration. The cells were grown as described in example 7.

Transfection was performed using the 6 th generation SuperFect transfection reagent (Qiagen, Germany). The aqueous dendrimer solution (A) without a DNA carrier and the DNA carrier VTvaf17 without BMP-7 gene cDNA were used as reference (B), and the DNA carrier VTvaf17-BMP-7(C) carrying the human BMP-7 gene was used as transfection agent. Preparation of DNA dendrimer complexes and transfection of MG-63 cells were carried out as described in example 11.

After transfection, 0.1ml of 1N HCl was added to 0.5ml of the culture broth, mixed well, and incubated at room temperature for 10 minutes. Then, 0.1ml of 1.2M NaOH/0.5M HEPES (pH7-7.6) was added to neutralize the mixture and thoroughly stirred. The supernatant was collected and used to assay for therapeutic proteins. BMP-7 protein was detected by enzyme-linked immunosorbent assay (ELISA) using human BMP-7ELISA (Raybiotech, Inc Cat. ELH-BMP7-1, USA) according to the manufacturer's method, using ChemWell Automated EIA and chemical Analyzer (Aware Technology Inc., USA) for densitometry.

To measure the concentration values, a calibration curve was constructed using a kit of known BMP-7 protein concentrations with reference to the samples. The sensitivity is 10pg/ml, and the measurement range is 10pg/ml-6000 pg/ml. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 8.

FIG. 8 shows that transfection of MG-63 human osteosarcoma cell cultures with the gene therapy DNA vector VTvaf17-BMP-7 resulted in an increased concentration of BMP-7 protein compared to the reference samples, confirming the ability of the vector to penetrate eukaryotic cells and express the BMP-7 gene at the protein level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-BMP-7 to increase the expression level of the BMP-7 gene in eukaryotic cells.

Example 13.

The efficiency and feasibility of gene therapy DNA vector VTvaf17-OPG carrying the OPG gene to increase OPG protein expression in mammalian cells were demonstrated.

HGF-1 human gingival fibroblast cell line transfected with gene therapy DNA vector carrying human OPG gene VTvaf17-OPG (CRL-2014^TM) Thereafter, lysates of these cells were evaluated for changes in the concentration of OPG protein. The cells were cultured as described in example 8.

Transfection was performed using the 6 th generation SuperFect transfection reagent (Qiagen, Germany). The dendrimer aqueous solution (A) containing no DNA carrier and the DNA carrier VTvaf17 containing no OPG gene cDNA were used as reference (B), and the DNA carrier VTvaf17-OPG (C) carrying the human OPG gene was used as transfection agent. Preparation of DNA dendrimer complex and transfection of HGF-1 human gingival fibroblast cell line were performed according to the method described in example 11.

After transfection, 0.1ml of 1N HCl was added to 0.5ml of the culture broth, mixed well, and incubated at room temperature for 10 minutes. Then, 0.1ml of 1.2M NaOH/0.5M HEPES (pH7-7.6) was added to neutralize the mixture and thoroughly stirred. The supernatant was collected and used to assay for therapeutic proteins. OPG proteins were detected by enzyme-linked immunosorbent assay (ELISA) using human Osteoprotegerin (OPG) ELISA (RayBiotech, cat. elh-OPG-1, USA) with densitometric detection using ChemWell Automated EIA and a chemical analyzer (aware Technology inc., USA) according to the manufacturer's method.

To measure the value of the concentration, a calibration curve was constructed using a kit reference sample of known OPG protein concentration. The sensitivity is at least 1pg/ml, and the measurement range is 1pg/ml-900 pg/ml. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The results from the assay are shown in fig. 9.

FIG. 9 shows that transfection of HGF-1 human gingival fibroblast cell line with gene therapy DNA vector VTvaf17-OPG results in an increase in the concentration of OPG protein compared to the reference sample, confirming the ability of the vector to penetrate eukaryotic cells and express the OPG gene at the protein level. The presented results also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-OPG to increase the expression level of the OPG gene in eukaryotic cells.

Example 14.

The efficiency and feasibility of gene therapy DNA vector VTvaf17-PDGFA carrying PDGFA gene to increase PDGFA protein expression in mammalian cells are demonstrated.

After transfection of Human Chondrocytes (HC) with the DNA vector VTvaf17-PDGFA carrying the human PDGFA gene (Cell Applications, Inc Cat.402K-05a), the change in PDGFA protein concentration in the culture lysates of these cells was assessed. The cells were cultured as described in example 9.

Transfection was performed using the 6 th generation SuperFect transfection reagent (Qiagen, Germany). The dendrimer aqueous solution (a) containing no DNA vector and the DNA vector VTvaf17(B) containing no PDGFA gene cDNA were used as references, and the DNA vector VTvaf17-PDGFA (c) carrying human PDGFA gene was used as transfection agent. Preparation of DNA dendrimer complexes and transfection of HC cells were performed as described in example 11.

After transfection, 0.1ml of 1N HCl was added to 0.5ml of the culture broth, mixed well, and incubated at room temperature for 10 minutes. Then, 0.1ml of 1.2M NaOH/0.5M HEPES (pH7-7.6) was added to neutralize the mixture and thoroughly stirred. The supernatant was collected and used to assay for therapeutic proteins.

PDGFA protein was detected by enzyme-linked immunosorbent assay (ELISA) using the PDGF-AA ELISA kit (Sandwich ELISA) (Life span Bioscience Cat. LS-F6082-1, USA) according to the manufacturer's protocol, densitometry using ChemWell Automated EIA and a chemical analyzer (Aware Technology Inc., USA).

To measure the concentration values, a calibration curve was constructed using a kit reference sample of known PDGFA protein concentration. The sensitivity was 57pg/ml and the measurement range was 156pg/ml-10000 pg/ml. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 10.

Fig. 10 shows that transfection of human chondrocyte culture (HC) with gene therapy DNA vector VTvaf17-PDGFA results in increased PDGFA protein concentration compared to the reference sample, confirming the ability of the vector to penetrate eukaryotic cells and express the PDGFA gene at the protein level. The presented results also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-PDGFA to increase the expression level of the PDGFA gene in eukaryotic cells.

Example 15.

The efficiency and feasibility of gene therapy DNA vector VTvaf17-PDGFB carrying the PDGFB gene to increase PDGFB protein expression in mammalian cells was demonstrated.

After transfection of Human Chondrocytes (HC) (Cell Applications, Inc Cat.402K-05a) with the DNA vector VTvaf17-PDGFB carrying the human PDGFB gene, the change in PDGFB protein concentration in the culture lysates of these cells was evaluated. The cells were cultured as described in example 10.

Transfection was performed using the 6 th generation SuperFect transfection reagent (Qiagen, Germany). An aqueous dendrimer solution (a) containing no DNA vector and a DNA vector VTvaf17 containing no PDGFB gene cDNA were used as reference (B), and a DNA vector VTvaf17-PDGFB (c) carrying a human PDGFB gene was used as transfection agent. Preparation of DNA dendrimer complexes and transfection of HC cells were performed as described in example 11.

After transfection, 0.1ml of 1N HCl was added to 0.5ml of the culture broth, mixed well, and incubated at room temperature for 10 minutes. Then, 0.1ml of 1.2M NaOH/0.5M HEPES (pH7-7.6) was added to neutralize the mixture and thoroughly stirred. The supernatant was collected and used to assay for therapeutic proteins.

PDGFB protein was detected by enzyme-linked immunosorbent assay (ELISA) using the human PDGF-BB ELISA kit (Sandwich ELISA) (Life span Bioscience Cat. LS-F12289, USA) according to the manufacturer's method, using ChemWell Automated EIA and chemical Analyzer (Aware Technology Inc., USA) for densitometry.

To measure the value of the concentration, a calibration curve was constructed using kit reference samples of known PDGFB protein concentration. The sensitivity is at least 31.2pg/ml, and the measurement range is 31.2pg/ml-2000 pg/ml. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 11.

Fig. 11 shows that transfection of human chondrocyte culture (HC) with gene therapy DNA vector VTvaf17-PDGFB resulted in an increase in PDGFB protein concentration compared to the reference sample, confirming the ability of the vector to penetrate eukaryotic cells and express the PDGFB gene at the protein level. The presented results also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-PDGFB to increase the expression level of the PDGFB gene in eukaryotic cells.

Example 16.

The efficiency and feasibility of using the gene therapy DNA vector VTvaf17-PDGFA carrying the PDGFA gene to improve PDGFA protein expression in human tissues are proved.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-PDGFA carrying a therapeutic gene (i.e., the PDGFA gene) and the feasibility of its use, the change in PDGFA protein concentration in human skin following injection of the gene therapy DNA vector VTvaf17-PDGFA carrying the human PDGFA gene was evaluated.

To analyze the change in PDGFA protein concentration, the gene therapy DNA vector VTvaf17-PDGFA carrying the PDGFA gene was injected into the forearm skin of three patients, along with placebo, which was the gene therapy DNA vector VTvaf17 without PDGFA gene cDNA.

Patient 1, male, 33 years old (P1); patient 2, female, 47 years old (P2); patient 3, female, 43 years old (P3). The polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. The gene therapy DNA vector VTvaf17-PDGFA containing PDGFA gene cDNA and the gene therapy DNA vector VTvaf17 without PDGFA gene cDNA were dissolved in sterile nuclease-free water as placebo. To obtain the genetic construct, the DNA-cGMP grade in-vivo-jetPEI complex was prepared according to the manufacturer's recommendations.

Gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-PDGFA carrying the PDGFA gene were injected in an amount of 1mg for each genetic construct using a tunnel method with 30G needles to a depth of 3 mm. For each genetic construct, the injection volume of gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector carrying the PDGFA gene VTvaf17-PDGFA was 0.3 ml. The injection point for each genetic construct was located at 8 to 10cm intervals on the forearm site.

Biopsy specimens were taken on day 2 after injection of the genetic construct of the gene therapy DNA vector. Using the skin biopsy device epithemease 3.5(Medax SRL, Italy), biopsy samples were taken from patient skin in the site injected with gene therapy DNA vector VTvaf17-PDGFA (i) carrying the PDGFA gene, gene therapy DNA vector VTvaf17 (placebo) (II) and from whole skin (III). The patient's skin at the biopsy site was initially rinsed with sterile saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3, and weighed about 11 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used to assay the therapeutic protein by using enzyme-linked immunosorbent assay (ELISA). PDGFA protein was assayed by enzyme-linked immunosorbent assay (ELISA) as described in example 14.

To measure the concentration values, a calibration curve was constructed using a kit reference sample of known PDGFA protein concentration. Optical density measurements were performed using a ChemWell Automated EIA chemical Analyzer (Aware Technology Inc., USA) according to the manufacturer's method, with statistical processing and data visualization of the results using R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 12.

Figure 12 shows that the PDGFA protein concentration in the skin of all three patients in the injection site of the gene therapy DNA vector VTvaf17-PDGFA carrying the human PDGFA therapeutic gene was increased compared to the PDGFA protein concentration in the injection site of the gene therapy DNA vector VTvaf17 (placebo) that did not contain the human PDGFA gene, indicating the efficiency of the gene therapy DNA vector VTvaf17-PDGFA and demonstrating the feasibility of its use, particularly when the gene therapy DNA vector was injected into human tissue.

Example 17.

The efficiency and feasibility of using gene therapy DNA vector VTvaf17-OPG carrying the OPG gene to improve the expression of OPG protein in human tissues was demonstrated.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-OPG carrying the therapeutic gene of OPG and the feasibility of its use, the change in OPG protein concentration in human muscle tissue following injection of the gene therapy DNA vector VTvaf17-OPG carrying the therapeutic gene (i.e., the human OPG gene) was evaluated.

To analyze the change in the concentration of OPG protein, the gene therapy DNA vector VTvaf17-OPG carrying the OPG gene together with a transport molecule was injected into the skin of three patients, along with placebo, which is the gene therapy DNA vector VTvaf17 without OPG gene cDNA together with a transport molecule.

Patient 1, female, 40 years old (P1); patient 2, male, 43 years old (P2); patient 3, male, 54 years old (P3). The use of polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) as a transport system; sample preparation was performed according to the manufacturer's recommendations.

The gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector VTvaf17-OPG carrying the OPG gene were injected in an amount of 1mg for each genetic construct using a tunnel method with a 30G needle to a depth of about 10 mm. For each genetic construct, the injection volume of gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-OPG carrying the OPG gene was 0.3 ml. The injection point for each genetic construct was located at 8 to 10cm intervals on the forearm site.

Biopsy specimens were taken on day 2 after injection of the genetic construct of the gene therapy DNA vector. Using the skin biopsy device MAGNUM (BARD, USA), biopsy specimens were taken from the patient's muscle tissue in the site injected with the gene therapy DNA vector VTvaf17-OPG (i) carrying the OPG gene, gene therapy DNA vector VTvaf17 (placebo) (II), and from the intact site of the gastrocnemius muscle (III). The patient's skin in the biopsy site was initially rinsed with sterile saline and anesthetized with lidocaine solution. The biopsy sample size is about 20mm3 and the body weight is up to 22 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used to assay for therapeutic proteins.

The OPG protein was assayed by enzyme-linked immunosorbent assay (ELISA) as described in example 13.

To measure the value of the concentration, a calibration curve was constructed using a kit reference sample of known OPG protein concentration. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 13.

FIG. 13 shows that the OPG protein concentration in the gastrocnemius muscle of all three patients in the injection site of the gene therapy DNA vector VTvaf17-OPG carrying the therapeutic gene (i.e., the OPG gene) is increased compared to the OPG protein concentration in the injection site of the gene therapy DNA vector VTvaf17 (placebo) not containing the human OPG gene, which indicates the efficiency of the gene therapy DNA vector VTvaf17-OPG and demonstrates the feasibility of its use, particularly when the gene therapy DNA vector is injected into human tissue muscle.

Example 18.

The efficiency and feasibility of using gene therapy DNA vector VTvaf17-BMP-7 carrying BMP-7 gene to improve the expression of BMP-7 protein in human cells were demonstrated.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-BMP-7 carrying the therapeutic gene (i.e., the BMP-7 gene) and the feasibility of its use, the change in BMP-7 protein concentration in human skin after injection of the gene therapy DNA vector VTvaf17-BMP-7 carrying the human BMP-7 gene was evaluated.

To analyze the change in the BMP-7 protein concentration, the gene therapy DNA vector VTvaf17-BMP-7 carrying the BMP-7 gene was injected into the forearm skin of three patients, together with a placebo, which is the gene therapy DNA vector VTvaf17 without BMP-7 gene cDNA.

Patient 1, male, 62 years old (P1); patient 2, male, 55 years old (P2); patient 3, female, 58 years old (P3). The polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. The gene therapy DNA vector VTvaf17-BMP-7 containing BMP-7 gene cDNA and the gene therapy DNA vector VTvaf17 without BMP-7 gene cDNA were dissolved in sterile nuclease-free water as placebo. To obtain the genetic construct, the DNA-cGMP grade in-vivo-jetPEI complex was prepared according to the manufacturer's recommendations.

The gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector VTvaf17-BMP-7 carrying the BMP-7 gene were injected in an amount of 1mg for each genetic construct using a tunnel method with a 30G needle to a depth of 3 mm. For each genetic construct, the injection volume of the gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector carrying the BMP-7 gene VTvaf17-BMP-7 was 0.3 ml. The injection point for each genetic construct was located at 8 to 10cm intervals on the forearm site.

Biopsy specimens were taken on day 2 after injection of the genetic construct of the gene therapy DNA vector. Using the skin biopsy device epithemease 3.5(Medax SRL, Italy), biopsy samples were taken from the patient's skin in the area injected with the gene therapy DNA vector VTvaf17-BMP-7(I) carrying the BMP-7 gene, the gene therapy DNA vector VTvaf17 (placebo) (II) and from the intact skin (III). The patient's skin in the biopsy site was initially rinsed with sterile saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3, and weighed about 11 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and the therapeutic protein was assayed by using enzyme-linked immunosorbent assay (ELISA) as described in example 12.

To measure the concentration values, a calibration curve was constructed using a kit of known BMP-7 protein concentrations with reference to the samples. Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in FIG. 14.

FIG. 14 shows that the BMP-7 protein concentration in the skin of all three patients in the injection site of the gene therapy DNA vector VTvaf17-BMP-7 carrying the human BMP-7 therapeutic gene is increased compared to the BMP-7 protein concentration in the injection site of the gene therapy DNA vector VTvaf17 (placebo) not containing the human BMP-7 gene, which indicates the efficiency of the gene therapy DNA vector VTvaf17-BMP-7 and demonstrates the feasibility of its use, particularly when the gene therapy DNA vector is injected intradermally into human tissues.

Example 19.

The efficiency of the gene therapy DNA vector VTvaf17-BMP-7 carrying the BMP-7 gene and its feasibility of using autologous fibroblasts transfected with the gene therapy DNA vector VTvaf17-BMP-7 to increase the expression level of BMP-7 protein in human tissues by injection were demonstrated.

To confirm the feasibility of the gene therapy DNA vector VTvaf17-BMP-7 carrying the BMP-7 gene for its efficiency in its use, the change in BMP-7 protein concentration in the skin of patients following injection of autologous fibroblast cultures of the same patient transfected with the gene therapy DNA vector VTvaf17-BMP-7 was evaluated.

Appropriate autologous fibroblast cell cultures transfected with the gene therapy DNA vector carrying the BMP-7 gene VTvaf17-BMP-7 were injected into the skin of the forearm of the patient, along with placebo in the form of autologous fibroblast cell cultures transfected with the gene therapy DNA vector VTvaf17 that did not carry the BMP-7 gene.

Human primary fibroblast cultures were isolated from patient skin biopsy specimens. Biopsy specimens of the skin were taken from the area protected by uv light, i.e. behind the ear or inside the elbow, using a skin biopsy device epithemease 3.5(Medax SRL, Italy). The biopsy specimen was about 10mm and about 11 mg. The patient's skin was initially rinsed with sterile saline and anesthetized with lidocaine solution. Primary cell cultures were cultured in DMEM medium containing 10% fetal bovine serum and 100U/ml ampicillin in the presence of 5% CO2 at 37 ℃. Medium passaging and replacement were performed every 2 days. The total duration of culture growth does not exceed 25-30 days. Then 5x10 was removed from the cell culture broth⁴Aliquots of individual cells. Fibroblast cultures from patients were transfected with the gene therapy DNA vector carrying the BMP-7 gene, VTvaf17-BMP-7, or placebo (i.e., the VTvaf17 vector which does not carry the BMP-7 therapeutic gene).

Transfection is carried out using cationic polymers such as polyethyleneimine JETPEI (Polyplus transfection, France) according to the manufacturer's instructions. Cells were cultured for 72 hours and then injected into patients. Autologous fibroblast cell cultures of patients transfected with gene therapy DNA vector VTvaf17-BMP-7 and autologous fibroblast cell cultures of patients transfected with gene therapy DNA vector VTvaf17 were injected in the forearm as placebo using the tunnel method with a 30G needle 13mm long to a depth of about 3 mm. The concentration of the modified autologous fibroblasts in the injection suspension is about 5mln cells per 1ml of suspension, and the dose of the injected cells does not exceed 15 mln. Injection points for autologous fibroblast cultures were positioned at intervals of 8 to 10 cm.

After injection of autologous fibroblast cell cultures transfected with gene therapy DNA vector VTvaf17-BMP-7 carrying the therapeutic gene (i.e., BMP-7 gene) and placebo, biopsy samples were taken on day 4. A biopsy was taken from the skin of a patient at a site injected with autologous fibroblast cell culture (C) transfected with gene therapy DNA vector VTvaf17-BMP-7 carrying a therapeutic gene (i.e., BMP-7 gene), with a non-transfected autologous fibroblast cell culture (placebo) (B) not carrying gene therapy DNA vector VTvaf17 of BMP-7 therapeutic gene, and from an intact skin site (a) using a skin biopsy device epithemease 3.5(Medax SRL, Italy). The patient's skin in the biopsy site was initially rinsed with sterile saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3 and weighed about 11 mg. The samples were placed in a buffer solution containing 50mM Tris-HCl (pH 7.6), 100mM NaCl, 1mM EDTA, and 1mM phenylmethylsulfonylated fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14,000g for 10 minutes. The supernatant was collected and used to assay for the therapeutic protein as described in example 12.

The graph derived from the assay is shown in fig. 15.

FIG. 15 shows the increased concentration of NOS2 protein in the region of the patient's skin in the injection site of autologous fibroblast cultures transfected with the gene therapy DNA vector VTvaf17-BMP-7 carrying the BMP-7 gene compared to the concentration of BMP-7 protein in the injection site of autologous fibroblast cultures transfected with the gene therapy DNA vector VTvaf17 (placebo) not carrying the BMP-7 gene, demonstrating the efficacy of the gene therapy DNA vector VTvaf17-BMP-7 and its feasibility of its use to facilitate increased BMP-7 expression levels in human organs, particularly after injection of autologous fibroblasts transfected with the gene therapy DNA vector VTvaf17-BMP-7 into the skin.

Example 20.

The feasibility of the combined application of gene therapy DNA vector VTvaf17-BMP-2 carrying BMP-2 therapeutic gene, gene therapy DNA vector VTvaf17-BMP-7 carrying BMP-7 therapeutic gene, gene therapy DNA vector VTvaf17-OPG carrying OPG therapeutic gene, gene therapy DNA vector VTvaf17-PDGFA carrying PDGFA therapeutic gene, gene therapy DNA vector VTvaf17-PDGFB carrying PDGFB therapeutic gene for increasing BMP-2, BMP-7, OPG, PDGFA, and PDGFB protein expression levels in mammalian tissues was demonstrated.

After injection of the gene therapy vector cocktail into the rat thigh, changes in BMP-2, BMP-7, OPG, PDGFA and PDGFB protein concentrations at this site were assessed. The study was performed on 3 experimental animals-8 months old, 240-and 290g old male Wistar rats. Under anesthesia (Zoletil dose 40mg/kg body weight, IP), a 12mm long solid metal needle was inserted into the marginal gingiva closely along the teeth from the lower incisor at the medial vestibular surface with little effort to tear the tissue.

The polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. Equimolar gene therapy DNA vector mixtures were dissolved in sterile nuclease-free water. To obtain the genetic construct, the DNA-cGMP grade in-vivo-jetPEI complex was prepared according to the manufacturer's recommendations. The injection volume was 0.1ml and the total amount of DNA was 100. mu.g. The solution was injected into the soft tissue of the gums with an insulin syringe. Rats were decapitated 2 days after the procedure.

Samples were taken on day 2 after injection of gene therapy DNA vector. Biopsy material was taken from the right gingival part (site I) of the injection site of a mixture of five gene therapy DNA vectors carrying BMP-2, BMP-7, OPG, PDGFA and PDGFB genes, from the left gingival part (site II) of the injection site of gene therapy DNA VTvaf17 (placebo), and from the upper gingival part (site III) without any manipulation. Each sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatants were collected and used to determine the therapeutic proteins as described in example 11 (quantitation of BMP-2 protein), example 12 (quantitation of BMP-7 protein), example 13 (quantitation of OPG protein), example 14 (quantitation of PDGFA protein) and example 15 (quantitation of PDGFB protein). The graph derived from the assay is shown in FIG. 16.

FIG. 16 shows increased BMP-2, BMP-7, OPG, PDGFA, and PDGFB protein concentrations in damaged gingival tissue (site I) injected with a mixture of gene therapy DNA vector VTvaf17-BMP-2 carrying a BMP-2 therapeutic gene, gene therapy DNA vector VTvaf17-BMP-7 carrying a BMP-7 therapeutic gene, gene therapy DNA vector VTvaf17-OPG carrying an OPG therapeutic gene, gene therapy DNA vector VTvaf17-PDGFA carrying a PDGFA therapeutic gene, gene therapy DNA vector VTvaf17-PDGFB carrying a PDGFB therapeutic gene, compared to site II (placebo site) and site III (intact site). The results obtained show the efficiency of the combined use of gene therapy DNA vectors and the feasibility of using up-regulated therapeutic protein expression levels in mammalian tissues.

Example 21.

The efficacy of the treatment with the DNA vector VTvaf17-OPG gene carrying the OPG gene and its feasibility to use to increase the expression level of OPG protein in mammalian cells were demonstrated.

To demonstrate the efficiency of the gene therapy DNA vector VTvaf17-OPG carrying the human OPG gene, the transfection of BT bovine turbinate cells with the gene therapy DNA vector VTvaf17-OPG carrying the human OPG gene(s) ((S))CRL-1390^TM) Change in the accumulation of OPG therapeutic gene mRNA in the BT bovine turbinate cells 48 hours later.

At standard conditions with addition of 10% horse serum: (30-2040^TM) DMEM Medium (C) ((II))30-2002^TM) Cultured BT cells of bovine turbinate: (CRL-1390^TM). Transfection, RNA extraction, reverse transcription reaction, PCR amplification and data analysis with the gene therapy DNA vector VTvaf17-OPG carrying the human OPG gene and the DNA vector VTvaf17 not carrying the human OPG gene (reference) were carried out as described in example 8. The bull/bovine actin gene (ACT) listed in the GenBank database under accession number AH001130.2 was used as the reference gene. The positive control included PCR amplicons on a substrate represented by plasmids of known concentration containing the OPG and ACT gene sequences. The negative control included deionized water. PCR products (i.e., OPG and ACT gene cDNAs) were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA).

The graph derived from the assay is shown in FIG. 17.

FIG. 17 shows that the specific mRNA level of human OPG gene is greatly increased due to transfection of BT bovine turbinate cells with gene therapy DNA vector VTvaf17-OPG, confirming the ability of the vector to penetrate eukaryotic cells and express OPG gene at mRNA level. The presented results demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-OPG to increase the expression level of the OPG gene in mammalian cells.

Example 22.

Escherichia coli strain SCS110-AF/VTvaf17-BMP-2, or Escherichia coli strain SCS110-AF/VTvaf17-BMP-7, or Escherichia coli strain SCS110-AF/VTvaf17-OPG, or Escherichia coli strain SCS110-AF/VTvaf17-PDGFA carrying gene therapy DNA vector, and its production method.

Constructed for the production on an industrial scale of a gene carrying a gene selected from the group consisting of: gene therapy DNA vector-based strains of BMP-2, BMP-7, OPG, PDGFA and PDGFB therapeutic genes VTvaf17, i.e., E.coli SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or SCS 110-VTAF/VTvaf 17-PDGFB, carrying gene therapy DNA vectors VTvaf17-BMP-2, or VTvaf17-PDGFB, respectively, for their production, allowing antibiotic-free selection, the construction method involving preparing competent cells of E.coli strain 110-AF, and gene therapy DNA vectors VTvaf 17-VTvaf 17-PDGFB for production thereof, involves preparing SCS110-AF receptor cells of E.coli strain 110-AF, and using gene therapy DNA vectors VTvaf 5632-VTvaf 5639-BMP-7, or PDGFB 2-PDGFB, respectively, allowing antibiotic-free selection, Or DNA vector VTvaf17-BMP-7, or DNA vector VTvaf17-OPG, or DNA vector VTvaf17-PDGFA, or DNA vector VTvaf 17-PDGFB. Thereafter, the cells were poured into agar plates (petri dishes) with a selective medium containing yeast extract, peptone, 6% sucrose, and 10 μ g/ml chloramphenicol. Wherein the production of the escherichia coli strain SCS110-AF to produce the gene therapy DNA vector VTvaf17 or a gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, allows for antibiotic-free positive selection, which involves the construction of a 64bp linear DNA fragment containing the transposon Tn10 regulatory element RNA-IN that allows for antibiotic-free positive selection; the 1422bp fructan sucrase gene sacB (the product of which ensures selection in a medium containing sucrose), the 763bp chloramphenicol resistance gene catR required for cloning of the strain undergoing homologous recombination and the two homologous sequences 329bp and 233bp (ensuring homologous recombination in the region of the gene recA concurrent with the inactivation of the gene) were selected, then the e.coli cells were transformed by electroporation and clones surviving in a medium containing 10 μ g/ml chloramphenicol were selected.

The strains obtained for production were registered in national center for biological resources (national Resource Centre), russian national collections of Industrial Microorganisms (NBRC RNCIM), RF and NCIMB Patent Deposit Service Centre (Patent Deposit Service), the Collection of UK, under the following accession numbers:

escherichia coli strain SCS110-AF/VTvaf 17-BMP-2-registered in Russian national Industrial collections of microorganisms, accession number B-13167, date of deposit 5/11/2018; INTERNATIONAL depository (INTERNATIONAL depository) number NCIMB43034, deposit date 2018, 4 months and 20 days,

escherichia coli strain SCS110-AF/VTvaf 17-BMP-7-registered in Russian national Industrial collections of microorganisms, accession No. B-13166, deposited on 2018, 5 months and 11 days; international depository organization number NCIMB 43036, date of deposit 2018, 4 months and 20 days,

escherichia coli strain SCS110-AF/VTvaf 17-OPG-registered in Russian national Industrial microorganism Collection, accession No. B-13272, date of deposit 2018, 10 months and 16 days; international depository number NCIMB 43036, deposit date 2018, 12 months 31,

escherichia coli strain SCS110-AF/VTvaf 17-PDGFA-registered in Russian national Industrial microorganism Collection, number B-13344, date of deposit 2018, 11 months and 22 days; international depository organization number NCIMB 43252, date of deposit 2018, 11/8,

escherichia coli strain SCS110-AF/VTvaf 17-PDGFB-in Russian national Industrial microorganism Collection, number B-13271, preservation date 2018, 10 months and 16 days; international depository number NCIMB 43302, deposit date 2018, 12 months and 13 days.

Example 23.

A method for expanding gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of BMP-2, BMP-7, OPG, PDGFA and PDGFB) to industrial scale.

To confirm the producibility and constructability of the gene therapy DNA vector VTvaf17-BMP-2(SEQ ID No.1), or VTvaf17-BMP-7(SEQ ID No.2), or VTvaf17-OPG (SEQ ID No.3), or VTvaf17-PDGFA (SEQ ID No.4), or VTvaf17-PDGFB (SEQ ID No.5) on an industrial scale, large-scale fermentation was performed on E.coli strain SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf17-PDGFB, each of which contained gene therapy DNA vector VTvaf17 carrying a therapeutic gene (i.e., BMP-2 or BMP-7 or OPG or PDGFA or PDGFB). Each of E.coli SCS110-AF/VTvaf17-BMP-2, or E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA or E.coli strain SCS110-AF/VTvaf17-PDGFB was produced based on E.coli strain SCS110-AF (Cell and Gene Therapy LLC, United Kingdom), as described in example 22, by: competent cells of this strain were electroporated with gene therapy DNA vectors VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB carrying the therapeutic gene (i.e., BMP-2, or BMP-7, or OPG, or PDGFA, or PDGFB), wherein the transformed cells were further inoculated in agar plates (petri dishes) with a selective medium containing yeast extract, peptone, and 6% sucrose, and selection of individual clones was performed.

Fermentation of E.coli SCS110-AF/VTvaf17-BMP-2 carrying gene therapy DNA vector VTvaf17-BMP-2 was performed in a 10l fermenter, followed by extraction of gene therapy DNA vector VTvaf 17-BMP-2.

For the fermentation of the E.coli strain SCS110-AF/VTvaf17-BMP-2, a preparation containing (per 10l volume): a medium of 100g tryptone and 50g yeast extract (Becton Dickinson, USA); the medium was then diluted to 8800ml with water and autoclaved at 121 ℃ for 20 minutes and then 1200ml of 50% (w/v) sucrose was added. Thereafter, a seed culture of the E.coli strain SCS110-AF/VTvaf17-BMP-2 was inoculated in a volume of 100ml into a culture flask. The cultures were incubated at 30 ℃ for 16 hours in a shaker incubator. The seed culture was transferred to a Techfors S bioreactor (Infors HT, Switzerland) and cultured to stationary phase. The process was controlled by measuring the optical density of the culture at 600 nm. Cells were pelleted at 5,000-10,000g for 30 min. The supernatant was removed and the cell pellet was resuspended in 10% (by volume) phosphate buffered saline. The cells were centrifuged again at 5,000-10,000g for 30 min. The supernatant was removed, a solution of 20mM TrisCl, 1mM EDTA, 200g/l sucrose (pH 8.0) was added to the cell pellet in a volume of 1000ml, and the mixture was stirred well to a homogenized suspension. The egg lysozyme solution was then added to a final concentration of 100. mu.g/ml. The mixture was incubated on ice for 20 minutes with gentle stirring. Then 2500ml of 0.2M NaOH, 10g/l Sodium Dodecyl Sulfate (SDS) was added, the mixture was incubated on ice for 10 minutes while stirring gently, then 3500ml of 3M sodium acetate, 2M acetic acid (pH 5-5.5) were added, and the mixture was incubated on ice for 10 minutes while stirring gently. The resulting sample was centrifuged at 15,000g or more for 20-30 minutes. The solution was carefully decanted and the residual precipitate was removed by a strainer (filter paper). RNase A (Sigma, USA) was then added to a final concentration of 20. mu.g/ml and the solution was incubated overnight at room temperature for 16 hours. The solution was then centrifuged at 15,000g for 20-30 minutes and passed through a 0.45 μm membrane filter (Millipore, USA). Then, ultrafiltration was performed with a 100kDa membrane (Millipore, USA), and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCl (pH 7.0). This operation was performed three to four times. The solution was applied to a column containing 250ml DEAE Sepharose HP (GE, USA) equilibrated with 25mM TrisCl (pH 7.0). After loading, the column was washed with three times the volume of the same solution, and then the gene therapy DNA vector VTvaf17-BMP-2 was eluted using a linear gradient of 25mM Tris-HCl (pH 7.0) to obtain a solution of 25mM Tris-HCl (pH 7.0), 1M NaCl, five times the column volume. The elution process was controlled by measuring the optical density of the effluent solution at 260 nm. The chromatograms containing the gene therapy DNA vector VTvaf17-BMP-2 were pooled and gel filtered using Superdex 200(GE, USA). The column was equilibrated with phosphate buffered saline. The elution process was controlled by measuring the optical density of the effluent solution at 260nm and the fractions were analyzed by agarose gel electrophoresis. Fractions containing the gene therapy DNA vector VTvaf17-BMP-2 were pooled and stored at-20 ℃. To evaluate the reproducibility of the process, the specified treatment operations were repeated five times. All the treatments of the E.coli strain SCS110-AF/VTvaf17-BMP-7, or E.coli strain SCS110-AF/VTvaf17-OPG, or E.coli strain SCS110-AF/VTvaf17-PDGFA, or E.coli strain SCS110-AF/VTvaf17-PDGFB were carried out in a similar manner.

The processing reproducibility and quantitative characteristics of the final product yield confirm the productivity and construction of gene therapy DNA vectors VTvaf17-BMP-2, or VTvaf17-BMP-7, or VTvaf17-OPG, or VTvaf17-PDGFA, or VTvaf17-PDGFB on an industrial scale.

Thus, the resulting gene therapy DNA vectors containing a therapeutic gene can be used to deliver it to human and animal cells with reduced or insufficient expression of the protein encoded by the gene, thereby ensuring the desired therapeutic effect.

The invention aims to construct a gene therapy DNA carrier to improve the expression levels of BMP-2, BMP-7, OPG, PDGFA and PDGFB genes, and combines the following characteristics:

I) the effectiveness of up-regulating therapeutic gene expression in eukaryotic cells due to the obtained gene therapy vector having a minimum length;

II) the possibility of safe use in gene therapy of humans and animals due to the absence of regulatory elements and antibiotic resistance genes representing the nucleotide sequence of the viral genome in gene therapy DNA vectors;

III) producibility and constructability of the strain on an industrial scale;

IV) and the construction objectives of strains carrying these gene therapy DNA vectors for the production of these gene therapy DNA vectors have been achieved, which are supported by the following examples:

item I-examples 1, 2, 3, 4, 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18. 19, 20, 21;

item II-examples 1, 2, 3, 4, 5;

item III and item IV-examples 22, 23.

INDUSTRIAL APPLICABILITY

All of the examples listed above demonstrate the industrial applicability of the proposed gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying therapeutic genes (selected from the group of BMP-2, BMP-7, OPG, PDGFA, and PDGFB genes) in order to increase the expression levels of these therapeutic genes, e.coli strain SCS110-AF/VTvaf17-BMP-2, or e.coli strain SCS110-AF/VTvaf17-BMP-7, or e.coli strain SCS110-AF/VTvaf17-OPG, or e.coli strain SCS110-AF/VTvaf17-PDGFA, or e.coli strain SCS110-AF/VTvaf17-PDGFB carrying gene therapy DNA vectors, or e.coli strain SCS110-AF/VTvaf 3552-PDGFB, and methods for their production on an industrial scale.

List of acronyms:

VTvaf 17: gene therapy vectors free of viral genomic sequences and antibiotic resistance markers (viral-antibiotic-free therapeutic vectors)

DNA: deoxyribonucleic acid

cDNA: complementary deoxyribonucleic acid

RNA: ribonucleic acid

mRNA: messenger ribonucleic acid

bp: base pairing

And (3) PCR: polymerase chain reaction

ml: ml, μ l: microlitre

mm 3: cubic millimeter

l: lifting of wine

μ g: microgram of

mg: milligrams of

g: keke (Chinese character of 'Keke')

μ M: micromolar

And (mM): millimole

min: minute (min)

s: second of

rpm: revolutions per minute

nm: nano meter

cm: centimeter

mW: milliwatt meter

RFU: relative fluorescence unit

PBS: phosphate buffered saline