Burkholderia homologous recombination system and application thereof

文档序号：900144 发布日期：2021-02-26 浏览：12次中文

阅读说明：本技术 伯克氏菌同源重组系统及其应用 (Burkholderia homologous recombination system and application thereof ) 是由符军李瑞娟史洪波赵晓雨张友明于 2020-10-21 设计创作，主要内容包括：本发明公开了伯克氏菌同源重组系统,该重组系统由一系列伯克氏菌同源重组系统表达质粒构成,分别命名为pBBR1-Rha-EThe_bdu8-kan、其核苷酸序列如SEQ ID No.1所示；pBBR1-Rha-ETh_tji49-kan、其核苷酸序列如SEQ ID No.2所示；pBBR1-Rha-ETh1h2e_yi23-kan、其核苷酸序列如SEQ ID No.3所示。本发明还公开了所述重组系统在伯克氏菌中介导短同源臂的同源重组进行基因组DNA遗传修饰中的应用和该重组系统在伯克氏菌中进行基因插入以激活沉默基因簇的应用。本发明所述的伯克氏菌同源重组系统能够极大地促进伯克氏菌的基因组修饰,使得伯克氏菌的遗传修饰变得简单快捷,也为进一步挖掘伯克氏菌中的次级代谢产物提供了重要的工具,具有广阔的应用前景。(The invention discloses a Burkholderia homologous recombination system, which consists of a series of Burkholderia homologous recombination system expression plasmids which are respectively named as pBBR1-Rha-EThe _ bdu8-kan, and the nucleotide sequence of the Burkholderia homologous recombination system expression plasmids is shown as SEQ ID No. 1; pBBR1-Rha-ETh _ tji49-kan, and the nucleotide sequence thereof is shown as SEQ ID No. 2; pBBR1-Rha-ETh1h2e _ yi23-kan, and the nucleotide sequence thereof is shown in SEQ ID No. 3. The invention also discloses application of the recombination system in genome DNA genetic modification through mediating homologous recombination of short homologous arms in Burkholderia and application of the recombination system in gene insertion in Burkholderia to activate silent gene clusters. The Burkholderia homologous recombination system can greatly promote genome modification of Burkholderia, so that genetic modification of Burkholderia becomes simple and rapid, an important tool is provided for further mining secondary metabolites in Burkholderia, and the Burkholderia homologous recombination system has a wide application prospect.)

1. A Burkholderia homologous recombination system is composed of a series of Burkholderia homologous recombination system expression plasmids and is characterized in that: the serial expression plasmids in the recombination system comprise a pBBR1 replication origin, a kanamycin resistance gene, a rhamnose inducible promoter and a Burkholderia source homologous recombination operon; the serial expression plasmids are respectively named as pBBR1-Rha-EThe _ bdu8-kan, and the nucleotide sequence of the serial expression plasmids is shown as SEQ ID No. 1; pBBR1-Rha-ETh _ tji49-kan, and the nucleotide sequence thereof is shown as SEQ ID No. 2; pBBR1-Rha-ETh1h2e _ yi23-kan, the nucleotide sequence of which is shown in SEQ ID No. 3; the homologous recombinases EThe _ BDU8, ETh _ TJI49 and ETh1h2e _ YI23 involved therein are respectively derived from Burkholderia sp.BDU8, Burkholderia sp.TJI49 and Burkholderia sp.YI 23.

2. Use of the Burkholderia homologous recombination system according to claim 1 for mediating homologous recombination of short homology arms in Burkholderia for genetic modification of genomic DNA, wherein the short homology arms are homology arms of 50bp to 150 bp.

3. Use according to claim 2, characterized in that: the serial expression plasmid of the Burkholderia homologous recombination system is pBBR1-P_Rha-ETh _ tji49-kan or pBBR1-P_Rha-ETh1h2e — yi23-kan, said Burkholderia is Burkholderia glumae PG1, and said expression plasmid is optimized for improved recombination efficiency in Burkholderia glumae PG1 under the conditions: pBBR1-Rha-ETh _ tji49-kan, starting OD₆₀₀0.1, the transfer time is 2h, the induction time is 60min, the induction is carried out at 35 ℃, the competent cells are prepared by 10 percent glycerol solution at 4 ℃ under the condition of 4 ℃, the amount of the exogenous DNA ranges from 500 to 1000ng, and the length of the homologous arm is 125 bp; pBBR1-Rha-ETh1h2e _ yi23-kan, starting OD₆₀₀0.1, the transfer time is 2h, the induction time is 60min, induction is carried out at 35 ℃, double-distilled deionized water at 4 ℃ is used for preparing competent cells under the condition of 4 ℃, the amount of exogenous DNA ranges from 500-1000 ng, and the length of a homology arm is 150 bp.

4. Use of the Burkholderia homologous recombination system according to claim 1 for gene insertion in Burkholderia to activate silent gene clusters in Burkholderia.

5. Use according to claim 4, characterized in that: the Burkholderia plantarii DSM 9509; the silent gene cluster comprises biosynthetic gene clusters of non-ribosomal peptides, polyketides and terpenoids; the gene insertion is carried out under the optimized working conditions as described in claim 3.

Technical Field

The invention relates to a homologous recombination system in gram-negative bacteria and construction and application thereof, in particular to a homologous recombination system in Burkholderia as well as construction and application thereof, belonging to the field of microbial genetic engineering.

Background

The Red/ET homologous recombination technology can be used for accurately modifying the genome of the Escherichia coli, wherein RecET homologous recombination proteins are derived from Rac prophage of the Escherichia coli, and Red alpha beta gamma homologous recombination proteins are derived from a Red operon of lambda phage of the Escherichia coli. RecET and Red alpha beta gamma homologous recombination technology greatly improves the recombination efficiency in Escherichia coli, and provides an effective method for genetic modification. Wherein RecE and Red alpha have 5 '-3' exonuclease activity, RecT and Red beta are DNA single-strand annealing proteins.

Red γ inhibits exonuclease activity of RecBCD, a multifunctional enzyme complex that processes DNA ends generated by double strand breaks. Red γ can form a dimeric DNA analog, interact with exonuclease and helicase in the RecBCD system and inhibit the activity of these enzymes, thereby improving the recombination efficiency of DNA.

In addition to RecET and Red α β γ homologous recombination systems derived from escherichia coli, many documents report recombination systems constructed by using recombinant functional operons of bacteriophage, such as Photorhabdus (Photorhabdus), Xenorhabdus (Xenorhabdus), Bacillus subtilis (Bacillus subtilis), Clostridium (Clostridium), Lactobacillus (Lactobacillus plantarum), Pseudomonas (Pseudomonas) and the like, but these recombination systems have significant host specificity, which results in a narrow range of applications of these recombination systems.

Burkholderia is a gram-negative bacterium, growing under aerobic conditions, belonging to the genus burkholderia. Bioinformatics analysis finds that a large number of unknown natural product biosynthesis gene clusters exist in burkholderia, and the biosynthesis gene clusters are predicted to be capable of coding and expressing different types of compounds including non-ribosomal peptides, polyketides, terpenoids and the like. Moreover, most of these biosynthetic gene clusters are silent or have very low expression levels. Thus, a large number of new natural products can be obtained by in situ activation strategies. However, the burkholderia lacks an efficient and simple genetic operation method, so that it is necessary to establish an efficient and simple genetic operation system in the burkholderia. Through retrieval, researches on a recombination system of the burkholderia as well as construction and application of the recombination system are not reported.

Disclosure of Invention

Aiming at the defect that the existing Burkholderia lacks a high-efficiency genetic operation system, the invention aims to provide a homologous recombination system in Burkholderia as well as construction and application thereof.

The technical scheme of the invention is as follows: excavating Burkholderia phage homologous recombinant protein, constructing Burkholderia homologous recombination system expression plasmid, optimizing recombination conditions of the Burkholderia homologous recombination system expression plasmid in Burkholderia, and realizing modification of Burkholderia genome by using the Burkholderia homologous recombination system to activate silent gene clusters.

The Burkholderia homologous recombination system consists of a series of Burkholderia homologous recombination system expression plasmids, and is characterized in that: the serial expression plasmids in the recombination system comprise a pBBR1 replication origin, a kanamycin resistance gene, a rhamnose inducible promoter and a Burkholderia-derived homologous recombination operon (shown in figure 1); the serial expression plasmids are respectively named as pBBR1-Rha-EThe _ bdu8-kan, and the nucleotide sequence of the serial expression plasmids is shown as SEQ ID No. 1; pBBR1-Rha-ETh _ tji49-kan, and the nucleotide sequence thereof is shown as SEQ ID No. 2; pBBR1-Rha-ETh1h2e _ yi23-kan, the nucleotide sequence of which is shown in SEQ ID No.3 (shown in FIG. 2); the homologous recombinases EThe _ BDU8, ETh _ TJI49 and ETh1h2e _ YI23 involved therein are respectively derived from Burkholderia sp.BDU8, Burkholderia sp.TJI49 and Burkholderia sp.YI 23.

The serial expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan in the recombination system are constructed as follows:

(1) taking pBBR1-Rha-redgba-kan as an initial plasmid, carrying out double digestion on the initial plasmid by NdeI and HindIII, and carrying out gel recovery on a linear fragment pBBR1-Rha-kan of a digestion target;

(2) the glue recovery linear segment pBBR1-Rha-kan obtained in the step (1) and the synthesized recombinase segments EThe _ bdu8HA, ETh _ tji49HA and ETh1h2e _ yi23HA with homologous arms are co-transformed into E.coli GB05-dir for linear recombination;

(3) carrying out enzyme digestion verification on the recombinants obtained in the step (2) to obtain a series of expression plasmids of the Burkholderia homologous recombination system, wherein the series of expression plasmids are respectively named as pBBR1-Rha-EThe _ bdu8-kan, and the nucleotide sequence of the series of expression plasmids is shown as SEQ ID No. 1; pBBR1-Rha-ETh _ tji49-kan, and the nucleotide sequence thereof is shown as SEQ ID No. 2; pBBR1-Rha-ETh1h2e _ yi23-kan, and the nucleotide sequence thereof is shown in SEQ ID No. 3.

The Burkholderia homologous recombination system is applied to genome DNA genetic modification by mediating homologous recombination of short homologous arms in Burkholderia, wherein the short homologous arms refer to homologous arms of 50bp-150 bp.

In the above application: the preferred sequence expression plasmid of the Burkholderia homologous recombination system is pBBR1-P_Rha-ETh _ tji49-kan or pBBR1-P_Rha-ETh1h2e — yi23-kan, the Burkholderia preferably being Burkholderia glumae PG1, the optimal conditions for the expression plasmid to improve the efficiency of recombination in Burkholderia glumae PG1 being:

recombinant System expression plasmid pBBR1-Rha-ETh _ tji49-kan optimal recombination conditions in Burkholderia glumae PG 1: starting OD₆₀₀The amount of the exogenous DNA ranged from 500 and 1000ng, and the length of the homology arm was 125bp, when the competent cells were prepared at 4 ℃ in 10% glycerol solution at 35 ℃ for 60min and the foreign DNA amount ranged from 0.1 to 2 h.

Recombinant System expression plasmid pBBR1-Rha-ETh1h2e _ yi23-kan optimal recombination conditions in Burkholderia glumae PG 1: starting OD₆₀₀The transfer time is 2h, the induction time is 60min at 35 ℃, the competent cells are prepared by double-distilled deionized water at 4 ℃ under the condition of 4 ℃, the amount of the exogenous DNA ranges from 500 and 1000ng, and the length of the homologous arm is 150 bp.

The invention also discloses application of the Burkholderia homologous recombination system in gene insertion in Burkholderia to activate silent gene clusters in Burkholderia.

Wherein: the Burkholderia is preferably Burkholderia plantarii DSM 9509; the silent gene cluster comprises biosynthetic gene clusters of non-ribosomal peptides, polyketides and terpenoids; the gene insertion is preferably carried out under the optimized working conditions described above.

Compared with the prior art, the invention has the remarkable effects that:

the invention discloses a Burkholderia homologous recombination system consisting of a series of Burkholderia homologous recombination system expression plasmids, wherein the recombination system is not reported in the literature, and the recombination efficiency of the recombinant system expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan is optimized and applied in Burkholderia for the first time. The experimental result shows that the recombinant system expression plasmid contains an unknown protein coding gene in addition to the gene coding the exonuclease and the single-stranded DNA annealing protein. These unknown proteins, except for the protein expressed in h2 of pBBR1-Rha-ETh1h2e _ yi23-kan, were involved in recombination. The invention utilizes the constructed recombination system to realize genome excavation of Burkholderia plantarii DSM9509, and discovers a new class of compounds haereoplantin F, haereoplantin G and haereoplantin H, and the three compounds are reported for the first time. The Burkholderia recombination system can greatly promote genome modification of Burkholderia, provides a powerful tool for developing bioactive natural products, and has a very wide application prospect.

Drawings

FIG. 1: the structure of the Red alpha beta gamma and RecET operons from Escherichia coli and the homologous recombinant operons from Burkholderia. Wherein, the proteins encoded by the genes with the same color have similar functions.

FIG. 2: schematic construction of Burkholderia recombination system expression plasmid.

FIG. 3: optimization of Burkholderia glumae PG1 electrotransfer conditions.

(A) Growth curves of Burkholderia glumae PG 1.

(B) Effect of competent cells prepared at different culture times and different temperatures on the electroporation efficiency of Burkholderia glumae PG 1.

(C) Effect of different electrotransfer buffers and competent cells prepared at different temperatures on the electroporation efficiency of Burkholderia glumae PG 1.

(D) Effect of the amount of different DNA on the electroporation efficiency of Burkholderia glumae PG 1. Error bars, three replicates per experimental group, n-3.

FIG. 4: detection of recombination function in e.coli GB2005 and Burkholderia glumae PG1 for several recombination systems.

(A) Coli GB2005 using Doxorubicin resistance gene replacement recombination system expression plasmid on the recombinant enzyme fragment, the ring recombination diagram.

(B) Comparison of recombination efficiency of recombinant system expression plasmids in e.coli GB 2005.

(C) Schematic representation of the loop recombination in Burkholderia glumae PG1 with the insertion of the apramycin resistance gene in front of the gene BGL _ RS 05915.

(D) Comparison of recombination efficiency of recombinant expression plasmids in Burkholderia glumae PG 1.

FIG. 5: recombinant System expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan were subjected to colony PCR after genetic modification in Burkholderia glumae PG1 to verify the correctness of the recombinant modification.

Wherein M is TaKaRa DL2000 DNA Marker, and N is Burkholderia glumae PG1 wild strain.

(A) pBBR1-Rha-EThe _ bdu8-kan, (B) pBBR1-Rha-ETh _ tji49-kan, (C) pBBR1-Rha-ETh1h2e _ yi23-kan, all randomly picked monoclonals being correct. Error bars, seven replicates per experimental group, with n-7.

FIG. 6: comparison of recombination efficiency in different combinations of recombination systems in e.coli GB2005 and Burkholderia glumae PG 1.

(A) Coli GB2005 recombination efficiency comparisons of different combinations of ete _ bdu 8.

(B) Comparison of recombination efficiencies for different combinations of EThe _ bdu8 in Burkholderia glumae PG 1.

(D) Comparison of recombination efficiencies for different combinations of ETh _ tji49 in Burkholderia glumae PG 1.

(E) Coli GB2005, ETh1h2 — yi23 for different combinations of recombination efficiency comparison.

(F) Comparison of recombination efficiencies for different combinations of ETh1h2_ yi23 in Burkholderia glumae PG 1. Error bars, three replicates per experimental group, n-3.

FIG. 7: recombinant System expression plasmid pBBR1-Rha-ETh _ tji49-kan optimization of recombination efficiency in Burkholderia glumae PG 1.

(A) Effect of different transit times on recombination efficiency of recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(B) Effect of different induction times on the recombination efficiency of the recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(C) Effect of different induction temperatures on recombination efficiency of recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(D) Effect of different electrotransfer buffers on recombination efficiency of recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(E) The effect of the amount of different exogenous DNA on the efficiency of recombination of the recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(F) The effect of different homology arm lengths on the efficiency of recombination of the recombinant system expression plasmid pBBR1-Rha-ETh _ tji 49-kan.

(G) And (5) carrying out PCR verification on the colony after recombination on homologous arms with different lengths. M is TaKaRa DL2000 DNA Marker, C is Burkholderia glumae PG1 wild strain. Error bars, three replicates per experimental group, n-3.

FIG. 8: recombinant System expression plasmid pBBR1-Rha-ETh1h2e _ yi23-kan optimization of recombination efficiency in Burkholderia glumae PG 1.

(A) The effect of different transit times on the efficiency of recombination of recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

(B) Influence of different induction times on the recombination efficiency of recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

(C) Influence of different induction temperatures on the recombination efficiency of the recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

(D) Effect of different electrotransfer buffers on recombination efficiency of recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

(E) The effect of the amount of different exogenous DNA on the efficiency of recombination of the recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

(F) The effect of different homology arm lengths on the efficiency of recombination of the recombinant system expression plasmid pBBR1-Rha-ETh1h2e _ yi 23-kan.

FIG. 9: the silencing biosynthetic gene cluster in Burkholderia plantarii DSM9509 was activated using the Burkholderia recombination system.

(A) Burkholderia plantarri DSM9509 Chrom1Cluster4 Abbramycin expression gene and insertion and knockout position of promoter thereof.

(B) PCR verification chart of Burkholderia plantarri DSM9509 Chrom1Cluster4 gene insertion and gene knockout mutant strain colony, wherein M is TaKaRa DL5000 DNA Marker; n is the wild strain Burkholderia plantarii DSM 9509.

(C) The results of HPLC-MS detection of promoter insertion and gene knockout mutant fermentation products of Burkholderia plantarri DSM9509 Chrom1Cluster4 are shown as (a) fermentation products of wild bacteria, (b) fermentation products of gene knockout mutants, and (c) fermentation products of promoter insertion mutants.

(D) MS spectra of compounds obtained by activation of Burkholderia plantarii DSM9509 Chrom1Cluster4 by insertion of the Doxorubicin promoter.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

General description:

recombinant system expression strains E.coli GB2005 and E.coli GB05-dir, to which the following examples refer, were purchased from GeneBridges, Germany; burkhoderia glumae PG1 was obtained from university of Shandong, the institute of Helmholtz Biotechnology; burkhoderia plantarri DSM9509 was obtained from the institute of Biotechnology, Helmholtz, university of Shandong.

Plasmids pBBR1-Rha-GFP-kan, pBBR1-Rha-redgba-kan, pBBR1-Rha-BA _7029-kan, pBBR1-Rha-TEpsy-kan, pBBR1-Rha-BAS-kan, pBBR1-Rha-GBAS-kan and pBBR1-apra-kan were from university of Shandong-Helmholtz institute of Biotechnology.

The Burkhoderia glumae PG1 and Burkhoderia plantarii DSM9509 genomic sequences are known sequences and are detailed in the genomic sequences published in NCBI.

Gene sequencing in plasmid construction was accomplished by Huada Gene. Gene synthesis was performed by Jinzhi corporation. The plasmids are all conventional plasmids which are sold on the market, and the method for electrotransformation into recipient bacteria is a conventional method.

Other related reagents and consumables are all made in China. Unless otherwise specified, the experimental methods and reagents in the examples are those conventionally used in the art and those commercially available.

Example 1: construction of a series of Burkholderia homologous recombination expression plasmids

BLAST analysis of the genome from Burkholderia and phages thereof, with the amino acid sequence of lambda Beta or rac RecT as reference, searched for potential proteins with recombinant function. The operon for exonuclease-recombinase homology to RecET was found in Burkholderia sp.bdu8, Burkholderia sp.tji49 and Burkholderia sp.yi23, respectively, and was ETh _ bdu8, ETh _ tji49 and ETh1h2e _ yi23, respectively. Among them, EThe _ bdu8 encodes four proteins: e-bdu 8 contains 321 amino acids, the sequence has 34% homology with RecE, T-bdu 8 contains 320 amino acids, the sequence has 36% homology with RecT, h-bdu 8 and E-bdu 8 are hypothetical proteins; ETh — tji49 encodes three proteins: e _ tji49 contains 217 amino acids, the sequence has 24% homology with RecE, T _ tji49 contains 339 amino acids, the sequence has 34% homology with RecT, h _ tji49 is hypothetical protein; ETh1h2e — yi23 encodes five proteins: e _ yi23 contains 271 amino acids, the sequence has 34% homology with RecE, T _ yi23 contains 349 amino acids, the sequence has 46% homology with RecT, h1_ yi23 contains 159 amino acids, the sequence has 29% homology with Red γ, h2_ yi23 and E _ yi23 are hypothetical proteins.

The Burkholderia homologous recombination system is a series of recombination system expression plasmids which are constructed on the basis of a wide-host replicon pBBR1, and the recombination functional proteins are induced and expressed by a rhamnose promoter.

The homologous recombination system series expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan are constructed by the following steps:

Example 2: optimization of Burkholderia glumae PG1 electrotransfer conditions

The optimization exploration of Burkholderia glumae PG1 electric conversion conditions involves the following four parts:

(1) measurement of growth Curve of Burkholderia glumae PG1

First, the growth curve of Burkholderia glumae PG1 was determined to determine the optimal length of time for preparing competent cell cultures. Three Burkholderia glumae PG1 monoclonals were picked and separatelyInoculating into a 2ml EP tube containing 1.8ml LB liquid culture medium, shaking at 30 deg.C and 950rpm for 18-24 hr, sucking 100 μ l seed liquid, adding into 900 μ l liquid LB, blowing, mixing, and measuring OD₆₀₀. An appropriate amount of the seed solution was aspirated and inoculated into 50ml of LB liquid medium containing kanamycin (5. mu.g/ml) to make the starting OD₆₀₀Shaking culture at 200rpm at 30 deg.C under 0.1 for 2 hr, and sucking 1ml of bacterial liquid to measure OD₆₀₀According to OD of each time point₆₀₀The growth curve of Burkholderia glumae PG1 was plotted, and the experimental results are shown in FIG. 3A. Shows when the starting OD is₆₀₀When the cell number is 0.1, the cells are in the logarithmic growth phase after the acclimation phase and 2 hours later.

(2) Effect of different cultivation time and temperature on the electroporation efficiency of Burkholderia glumae PG1

According to the growth curve of Burkholderia glumae PG1, 2-3 time points are respectively taken before and after the logarithmic phase to optimize the electrotransfer and recombination culture time.

Respectively sucking 1ml of Burkholderia glumae PG1 bacterial liquid cultured for 1h, 1.5h, 2h, 2.5h and 3h, and measuring OD₆₀₀At the minimum OD in 1h of the bacterial liquid₆₀₀Is a standard uniform OD₆₀₀After washing twice with sterile water, competent cells were prepared at room temperature and 4 ℃ respectively, and 1. mu.g of the test plasmid pBBR1-Rha-GFP-kan was added thereto for electroporation. The results of the experiment are shown in FIG. 3B. The results show that the culture is carried out for 2 hours, and the room temperature preparation competence, OD is obtained₆₀₀The value is 0.381, the electric conversion efficiency is highest.

(3) Effect of different electrotransfer buffers and temperatures on the electrotransfer efficiency of Burkholderia glumae PG1

After 2 hours of culture in Burkholderia glumae PG1, each experimental group was washed 2 times with 10% sucrose solution, 10% glycerol solution, 10% sucrose + HEPES (SH), 10% glycerol + HEPES (GH), sterile water, and competent cells were prepared at room temperature and 4 ℃ respectively, and 1. mu.g of test plasmid pBBR1-Rha-GFP-kan was added thereto for electroporation. The results are shown in FIG. 3C, which shows that the electroporation efficiency is highest when the competent cells are prepared using a 10% sucrose solution.

(4) Effect of different amounts of DNA on the electroporation efficiency of Burkholderia glumae PG1

After 2h of culture of Burkholderia glumae PG1, centrifugation is carried out for 1min at 10000rpm, 10% sucrose solution is washed twice, 40-50 mul of suspended thallus is remained, 100ng, 500ng, 800ng, 1000ng, 1500ng and 2000ng of test plasmid pBBR1-Rha-GFP-kan are respectively added, 1300V electric shock is carried out, 30 ℃, 950rpm is recovered for 2h, the mixture is coated on an LB plate containing 5 mu g/ml kanamycin and is inversely cultured at 30 ℃. The results of the experiment are shown in FIG. 3D. The results showed that the number of recombinants obtained increased with the increase in the amount of DNA, and the efficiency of electroporation was the highest when the amount of exogenous DNA was 1500 ng.

By combining the optimization results of the transformation efficiency, the invention determines the optimal transformation conditions of Burkholderia glumae PG 1: starting OD₆₀₀0.1 bacterial solution, shaking cultured at 30 ℃ and 200rpm for 2h to OD₆₀₀The value was 0.381, a 10% sucrose solution was made competent at room temperature, and the amount of exogenous DNA was 1500 ng.

Example 3: detection of recombination function of recombinant expression plasmid in Burkholderia glumae PG1 and E.coli GB2005

The recombinant systemic expression plasmids pBBR1-Rha-redgba-kan, pBBR 1-Rha-BA-7029-kan, pBBR 1-Rha-EThe-bdu 8-kan, pBBR 1-Rha-ETh-tji 49-kan, pBBR1-Rha-ETh1h2e _ yi23-kan, pBBR1-Rha-TEpsy-kan, pBBR1-Rha-BAS-kan and pBBR1-Rha-GBAS-kan were electrotransformed into Burkholderia glumae PG1 and E.coli GB2005, respectively, in the following manner.

In Burkholderia glumae PG1, pBBR1-apra-kan is used as a template, the nucleotide sequence is shown in SEQ ID No.4, primer-PG1-chrom1C4-Papra-insert-5-80 and primer-PG1-chrom1C4-Papra-insert-3-80 are used as primers to amplify aprAR to obtain a PCR product, wherein the two ends of the aprAR-LCG are provided with homologous arms of a C1BGC4 preceding sequence in Burkholderia glumae PG1 genome, and the purified aprAR-LCG is inserted in front of gene BGL _ RS05915 in Burkholderia glumae PG1 genome to perform wireloop recombination, which is shown in FIGS. 4A and 4B.

primer-PG1-chrom1C4-Papra-insert-5-80：gagggctagatggccgcgatggatctttttcgctcgcgtcgcgagtctgtcatcaaggcgccgcaaccggcgcgcactccACGCTCAGTGGAACGAGGTT

primer-PG1-chrom1C 4-Papra-insert-3-80: gcggcctcgagatcgcgaaccgcgagcgcgatgtggtcgaggcgccggaacgcggcggcgtcgtcgacgcggttatccatAATCTGTACCTCCTTAAGT (lower case letters in the primers are homology arms and upper case letters are primers).

The specific procedure for PCR amplification of fragment aprAR with primers primer-PG1-chrom1C4-Papra-insert-5-80 and primer-PG1-chrom1C4-Papra-insert-3-80 was as follows:

PCR reaction procedure

In E.coli GB2005, using pBBR1-Apra-kan as a template and primer-Apra-5 and primer-Apra-3 as primers to amplify aprAR, to obtain a PCR product, wherein two ends of aprAR-LCP have homology arms with sequences at two ends of a recombinase coding gene in a recombinant system expression plasmid, and replacing the purified aprAR-LCP with a recombinase coding gene fragment in the recombinant system expression plasmid to carry out loop recombination, as shown in FIGS. 4C and 4D.

primer-Apra-5：TTGAGATGACGCCACTGGCTG

primer-Apra-3：GCTCTGGGAGGCAGAATAAATG

The specific method for PCR amplification of the fragment aprAR by using the primers primer-Apra-5 and primer-Apra-3 is as follows:

PCR reaction procedure

3 recombinant expression plasmids pBBR1-Rha-redgba-kan, pBBR1-Rha-BA _7029-kan, pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan, pBBR1-Rha-ETh1h2e _ yi23-kan, pBBR1-Rha-TEpsy-kan, pBBR1-Rha-BAS-kan or pBBR1-Rha-GBAS-kan Burkholderia PG1 or E.coli GB2005 monoclonal to 2ml EP tube containing 1.8ml liquid LB medium, kanamycin is used at 5. mu.g/ml, 30 ℃, 950rpm is shake cultured for 18-24h, 100. mu.l of seed liquid is sucked and added to 900. mu.l of liquid LB, mixed by blowing, and OD is measured₆₀₀. An appropriate amount of the seed solution was aspirated and inoculated into LB liquid medium containing kanamycin (5. mu.g/ml) to make the starting OD₆₀₀The recombinant enzyme was induced by shaking culture at 200rpm for 2h at 30 ℃ and 0.1, adding 200. mu.l of rhamnose at 100mg/ml, and shaking culture at 200rpm for 40min at 30 ℃. 1ml of the induced bacterial liquid is taken for OD measurement₆₀₀OD uniform according to the minimum value in the experimental group₆₀₀Sucking 1.3ml of the bacterial liquid into a punctured 1.5ml EP tube, centrifuging at room temperature and 10000rpm for 1min, discarding the supernatant, washing the thalli with 1ml of sterile water, centrifuging at 10000rpm for 1min, discarding the supernatant, washing the thalli with 1ml of sterile water again, centrifuging at 10000rpm for 1min, slightly sucking the supernatant, and leaving 30-50 μ l of suspended thalli. The same amount of purified PCR product (1. mu.g) was added to each experimental group, mixed well, transferred to a 1mm Burr electrode cup, shocked at 1300V, and 1ml of LB liquid medium was added to the electrode cup, blown up twice, and pipetted into the previous EP tube. Resuscitating and culturing at 30 ℃ and 950rpm for 2 h. The cells were pipetted at 800. mu.l and spread on LB plates containing Adoramycin (5. mu.g/ml), and 100. mu.l of the suspension was pipetted to dilute 10⁵After doubling, the mixture is coated on an LB flat plate and is inversely cultured for 18-24h in a constant temperature incubator at 30 ℃. The colony count was counted and the recombination efficiency of each recombination system was compared after counting, see FIG. 4.

Homologous recombination System series expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan were recombinantly modified in Burkholderia glumae PG1 and then the correctness of the recombinant modification was verified by colony PCR, see FIG. 5.

The 5' junction PCR (625bp) was amplified with the primers check-Papra-5 and check-Apra-up-3. The 3' junction PCR (651bp) was amplified with the primers check-Apra-down-5 and check-Papra-3.

check-Papra-5：GTCTGCCATCAATCCGTCAC

check-Apra-up-3：GACGCTACGGAAGGAGCTGTG

check-Apra-down-5：GAAGGTCCAGTCGGTCATGC

check-Papra-3：ATACTTGCCCGACTGCTCGAG

Colony PCR amplification system

5’junction PCR

3’junction PCR

PCR reaction procedure

The experimental results show that:

in Burkholderia glumae PG1, pBBR1-Rha-redgba-kan, pBBR1-Rha-BA _7029-kan, pBBR1-Rha-TEpsy-kan, pBBR1-Rha-BAS-kan, pBBR1-Rha-GBAS-kan have almost no recombination function, pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h 2_ yi23-kan are capable of performing the recombination function, and pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h 2_ yi23-kan have higher recombination efficiency than pBBR 27-Rha-36737-bdu 8.

Coli GB2005, all recombination system expression plasmids pBBR1-Rha-redgba-kan, pBBR 1-Rha-BA-7029-kan, pBBR 1-Rha-EThe-bdu 8-kan, pBBR 1-Rha-ETh-tji 49-kan, pBBR1-Rha-ETh1h 2e-yi23-kan, pBBR1-Rha-TEpsy-kan, pBBR1-Rha-BAS-kan, or pBBR1-Rha-GBAS-kan were all able to exert recombination efficiency, but the recombination system expression plasmid pBBR1-Rha-redgba-kan was highest in Escherichia coli origin, and the recombination system expression plasmid pBBR 1-Rha-HE-bdu 8-686, pBBR 8-Rha-1-Rha-e-Rha-ETh-tji 49-366-b-tji 49-b.

Colony PCR validation showed that all randomly picked monoclonals were correct. It was shown that in Burkholderia glumae PG1, recombination accuracy of Burkholderia homologous recombination system series expression plasmids pBBR1-Rha-EThe _ bdu8-kan, pBBR1-Rha-ETh _ tji49-kan and pBBR1-Rha-ETh1h2e _ yi23-kan were all high.

Example 4: recombination System expression plasmids of various combinations recombination efficiency comparisons between Burkholderia glumae PG1 and E.coli GB2005

During the process of the excavation of the recombination system, the applicant finds that a plurality of unknown protein coding genes (h or e) exist in an operon of the exonuclease-recombinase homologous to RecET, and the hypothetical proteins possibly have the same functions as Red gamma or Plu gamma, interact with exonuclease and helicase in the RecBCD system and inhibit the activities of the exonuclease and the helicase, so that the recombination efficiency of DNA can be improved. In order to study the influence of these hypothetical proteins on the recombination efficiency, we inserted restriction enzyme sites at both ends of the hypothetical protein-encoding gene (h or e) during gene synthesis, and then excised the hypothetical protein-encoding genes in pBBR1-PRha-EThe _ bdu8-kan, pBBR1-PRha-ETh _ tji49-kan and pBBR1-PRha-ETh1h2e _ yi23-kan with the corresponding restriction enzymes, and then linked them with T4 DNA ligase, to construct a series of recombinant system expression plasmids in different combinations, specifically named as follows: pBBR1-Rha-ETh _ bdu8-kan, pBBR1-Rha-ETe _ bdu8-kan, pBBR1-Rha-ET _ bdu8-kan, pBBR1-PRha-ET _ tji49-kan, pBBR1-PRha-ETh2e _ yi23-kan, pBBR1-PRha-ETh 11 _ yi 1-kan, pBBR1-PRha-ETh1h 1_ yi 1-kan, pBBR1-PRha-ETh1_ yi 1-kan, pBBR 1-PRha-1 _ yi 1-kan, and pBBR1-PRha-ETh1_ 1-kan.

Besides, Red gamma derived from E.coli or Plu gamma derived from Pseudomonas is used to replace these hypothetical proteins, and Red/ET and ccdB reverse screening method is adopted to construct recombinant system expression plasmids with different combination forms, the specific names are as follows: pBBR1-Rha-ET-red gamma _ bdu8-kan, pBBR1-Rha-ET-plu gamma _ bdu8-kan, pBBR1-PRha-ET-red gamma _ tji49-kan, pBBR1-PRha-ET-plu gamma _ tji49-kan, pBBR1-PRha-ET-red gamma _ yi23-kan and pBBR1-PRha-ET-plu gamma _ yi 23-kan.

The expression plasmids of these recombination systems in different combinations were electrically transferred to Burkholderia glumae PG1 and E.coli GB2005, respectively, and the comparison of recombination efficiency was made with reference to the method of experimental operation in example 3.

The experimental results show that:

homologous recombination System expression plasmid pBBR1-PRha-EThe _ bdu8-kan in Burkholderia glumae PG1, see FIG. 6A, the recombination efficiency was reduced after removal of either hypothetical protein h or e, and slightly improved when both hypothetical proteins h and e were removed compared to removal of only one, but the recombination efficiency was reduced compared to the complete EThe _ bdu8 recombination system, and when either Red γ or Plu γ was used in place of the hypothetical protein, the recombination efficiency was reduced compared to the complete EThe _ bdu8 recombination system, indicating that hypothetical proteins h and e had some recombination function in Burkholderia glumae 1.

Homologous recombination system expression plasmid pBBR1-PRha-EThe _ bdu8-kan in E.coli GB2005, see FIG. 6B, the recombination efficiency is not changed after hypothetical protein h is removed or hypothetical proteins h and e are removed simultaneously, the recombination efficiency is slightly improved after hypothetical protein e is removed, the recombination efficiency is improved after hypothetical protein e is replaced by Red gamma, the recombination efficiency is almost not changed after hypothetical protein is replaced by Plu gamma, which indicates that in E.coli GB2005, hypothetical protein h does not affect the recombination efficiency of EThe _ bdu8, hypothetical protein e has repression on the homologous recombination system of EThe _ bdu8, and Red gamma can be used for improving the recombination efficiency.

Homologous recombination System expression plasmid pBBR1-PRha-ETh _ tji49-kan in Burkholderia glumae PG1, see FIG. 6C, the recombination efficiency decreased by about 7-fold when the hypothetical protein h was removed or replaced with either Red γ or Plu γ, indicating that in Burkholderia glumae PG1, the hypothetical protein h was associated with DNA homologous recombination.

The homologous recombination system expression plasmid pBBR1-PRha-ETh _ tji49-kan is in E.coli GB2005, see FIG. 6D, when the hypothetical protein h is removed, and the hypothetical protein h in the ETh _ tji49 recombination system is replaced by Plu gamma, the recombination efficiency is not changed, and when the hypothetical protein h is replaced by Red gamma, the recombination efficiency is improved, which indicates that the hypothetical protein h has no effect in E.coli GB 2005.

Homologous recombination System expression plasmid pBBR1-PRha-ETh1h2E _ yi23-kanETh1h2E _ yi23 in Burkholderia glumae PG1, see FIG. 6E, when only hypothetical protein h2 was removed, there was no significant change in recombination efficiency compared to the ETh1h2E _ yi23 homologous recombination system, otherwise the recombination efficiency was reduced, indicating that hypothetical protein h2 had no effect on the recombination efficiency in Burkholderia glumae PG1, and could be removed in order to reduce the metabolic load on the cells, while hypothetical protein h1, E all had a function that could help to increase the recombination efficiency.

Homologous recombination system expression plasmid pBBR1-PRha-ETh1h2e _ yi23-kanETh1h2e _ yi23 in E.coli GB2005, see FIG. 6F, when hypothetical proteins h1, h2 and e are respectively removed, recombination efficiency is not obviously changed, when Red gamma or Plu gamma is used for replacing hypothetical protein h1h2e, recombination efficiency is about improved by 4 times, even when Plu gamma is used for replacing hypothetical protein, recombination efficiency is higher than that of Red alpha beta gamma recombination system, which shows that hypothetical proteins h1, h2 and e have no functions in E.coli GB2005, ETh1h2e _ yi23 recombination system can be combined with Plu gamma to improve the recombination efficiency of E.coli.

Example 5: optimization of recombination system expression plasmid recombination working condition in Burkholderia glumae PG1 to improve recombination efficiency

The absorption rate of the bacteria to the exogenous DNA is greatly different under different growth states, and in order to ensure that the recombination efficiency meets the requirement of genetic modification on microbial DNA molecules, the working condition of a recombination system needs to be optimized. Based on the study of the optimal transformation conditions of Burkholderia glumae PG1 in example 2, this example expresses plasmid pBBR1-P for a recombination system having a higher recombination efficiency_Rha-ETh _ tji49-kan and pBBR1-P_RhaETh1h2e _ yi23-kan for optimization of the working conditions of the recombination, which will be described below from the cultivation time, induction temperature,And (3) optimizing the recombination working conditions in seven aspects of preparing an electrotransformation buffer solution for competent cells, preparing the temperature of the competent cells, using the DNA and the length of the homologous arm.

(1) Effect of cultivation time on the efficiency of Burkholderia glumae PG1 recombination

The uptake capacity of cells for foreign DNA has a great influence on the efficiency of homologous recombination of DNA molecules, and the best time period for the uptake capacity of cells for foreign DNA is before and after the logarithmic growth phase, so that the optimal culture time is determined according to the growth curve of Burkholderia glumae PG 1. The seed liquid was transferred to 20ml of LB liquid medium containing kanamycin (5 μ g/ml) so that the starting OD600 became 0.1. Performing shaking culture at 30 ℃ and 200rpm, measuring the OD600 of the bacteria at 1.5h, 2h, 2.5h, 3h and 3.5h respectively, ensuring that the uniform OD600 is consistent with the OD600 of 1.5h, inducing the expression of recombinase, preparing competent cells, adding 500ng of PG1-Chrom1C4-Papra-insert-HA100PCR product, mixing uniformly, transferring the mixture into a 1mm electric transfer cup, performing electric shock, and screening recombinants by using proper antibiotics.

The PG1-Chrom1C4-Papra-insert-HA100PCR product is obtained by carrying out PCR amplification on aprAR by taking pBBR1-apra-kan as a template and primer-PG1-Chrom1C4-Papra-insert-HA100-5 and primer-PG1-Chrom1C4-Papra-insert-HA100-3 as primers.

primer-PG1-chrom1C4-Papra-insert-HA100-5：agcgctacgagaatcagagagagggctagatggccgcgatggatctttttcgctcgcgtcgcgagtctgtcatcaaggcgccgcaaccggcgcgcactccACGCTCAGTGGAACGAGGTT

primer-PG1-chrom1C4-Papra-insert-HA 100-3: gcacgtcgcgaaacaggtgcacggcggcctcgagatcgcgaaccgcgagcgcgatgtggtcgaggcgccggaacgcggcggcgtcgtcgacgcggttatccatAATCTGTACCTCCTTAAGT (lower case letters in the primers are homology arms and upper case letters are primers).

The specific PCR reaction system and procedure were the same as in example 3.

The results of the experiments are shown in FIGS. 7A and 8A, and the results show that pBBR1-P takes 2h for the transit time_Rha-ETh _ tji49-kan and pBBR1-P_RhaThe highest recombination efficiency of ETh1h2e _ yi23-kan was achieved, and the recombination efficiency did not increase or decrease with the increase of the culture time, demonstrating that the bacteriumThe uptake capacity for foreign DNA is related to the incubation time.

(2) Effect of Induction time on Burkholderia glumae PG1 recombination efficiency

The inducible promoter is used for controlling the expression of the homologous recombinase, when the recombinase is required to act, the induction agent is added for inducing the expression of the recombinase, when the recombinase is not required, the induction agent is not added, so that the metabolic load of bacteria can be reduced, and unnecessary molecular recombination can be reduced. By controlling the time for inducing the expression of the recombinase, the recombinase can be accumulated to a concentration capable of playing a role, and when the time for inducing the expression and the concentration of the inducer are optimal, the recombination efficiency reaches the maximum value. Specifically, the seed liquid was transferred to 20ml of LB liquid medium containing kanamycin (5. mu.g/ml), and the starting OD was determined₆₀₀Culturing 0.1 strain solution for 2 hr, adding rhamnose to induce expression of recombinase, inducing for 20min, 40min, 60min and 80min, respectively, adding appropriate amount of strain solution into 1.5ml EP tube, and homogenizing OD₆₀₀And OD at 20min₆₀₀In agreement, competent cells were prepared, 500ng of PCR product PG1-Chrom1C4-Papra-insert-HA100 was added, mixed well, transferred to a 1mm electroporation cuvette, shocked and recombinants screened with the appropriate antibiotics.

The results are shown in FIGS. 7B and 8B, and show that pBBR1-P was obtained when the induction time was 60min_Rha-ETh _ tji49-kan and pBBR1-P_RhaThe recombination efficiency of-ETh 1h2e _ yi23-kan reaches the highest.

(3) Effect of Induction temperature on the efficiency of Burkholderia glumae PG1 recombination

Since the optimal temperature for growth of the cells and expression of the protein and the optimal temperature for expression of the recombinase are both available, the optimal expression temperature of the recombinase can be determined by studying different induction times of the recombinase, thereby obtaining high recombination efficiency. Starting OD₆₀₀After culturing the strain at 0.1 for 2 hours, rhamnose was added to induce the expression of the recombinase at 28 ℃, 30 ℃, 35 ℃, 37 ℃ and 39 ℃, respectively.

The results are shown in FIGS. 7C and 8C and show that pBBR1-P when induced at 35 deg.C_Rha-ETh _ tji49-kan and pBBR1-P_RhaThe recombination efficiency of-ETh 1h2e _ yi23-kan is highest.

(4) Effect of electrotransfer buffer on the efficiency of Burkholderia glumae PG1 recombination

Since different buffers are used for treating cells, the permeability of cell membranes is different, and thus the cell uptake of exogenous DNA by the cells can be increased by treating the cells with different buffers and increasing the permeability of the cell membranes, thereby improving the recombination efficiency. Starting OD₆₀₀After culturing the strain of 0.1 for 2 hours, rhamnose was added at 35 ℃ to induce the recombinant enzyme to express for 60 minutes, 5 kinds of electrotransfer buffer solutions 10% sucrose, 10% glycerol, sterile water, 10% sucrose plus hepes (gh), 10% glycerol plus hepes (sh) were selected, and competent cells were prepared at room temperature and on ice, respectively.

The results are shown in FIGS. 7D and 8D, and the results show that pBBR1-P_RhaETh-tji 49-kan, which was the most efficient in recombination when competent cells were prepared at 4 ℃ in 10% glycerol at 4 ℃. pBBR1-P_RhaETh1h2e _ yi23-kan, double distilled deionized water at 4 ℃ is used for preparing competent cells, and the recombination efficiency is highest.

(5) Effect of the amount of exogenous DNA on the recombination efficiency of Burkholderia glumae PG1

The uptake of exogenous DNA by cells has a certain threshold, and when the capacity of the cells reaches saturation, redundant DNA cannot be absorbed, so that the waste of experimental materials can be greatly reduced by researching the influence of the addition of exogenous DNA on the recombination efficiency. Starting OD₆₀₀Culturing 0.1 strain for 2h, adding rhamnose to induce recombinase expression at 35 deg.C for 60min, preparing competent cells at low temperature, washing with cold 10% glycerol solution containing pBBR1-P_RhaCells of ETh-tji 49-kan, containing pBBR1-P washed with cold sterile water_Rha-cells of ETh1h2e-kan, 100ng, 500ng, 1000ng, 1500ng and 2000ng of PG1-Chrom1C4-Papra-insert-HA100PCR products were added, respectively.

The results of the experiments are shown in FIGS. 7E and 8E, and the recombination efficiency increases with the amount of the foreign DNA, but does not change much after reaching a certain amount, and pBBR1-P when the amount of the foreign DNA is 800-_Rha-ETh_tji49-kan and pBBR1-P_RhaThe recombination efficiency of ETh1h2e _ yi23-kan did not vary much. pBBR1-P_RhaETh-tji 49-kan, when 100ng of PCR product was added, the recombinants were obtained in quantities that allowed the next operation. pBBR1-P_RhaETh1h2e _ yi23-kan, when 500ng of PCR product was added, recombinants satisfying the experimental manipulations were obtained. Therefore, the amount of the foreign DNA ranges from 500 to 1000 ng.

(6) Effect of homology arm Length on Burkholderia glumae PG1 recombination efficiency

The Red recombination system consists of three proteins: the RecE and Red α proteins are exonucleases, bind to the ends of double-stranded DNA, and degrade the DNA from the 5 ' end to the 3 ' end, producing a 3 ' end or single-stranded DNA; RecT and Red β are single-stranded DNA binding proteins and mediate annealing of complementary single-stranded DNA; the Red gamma protein is combined with RecBCD protein to inhibit the activity of degrading exogenous DNA. The length of recognition sequences of RecE and Red alpha proteins having exonuclease activity is in a certain range, and it is not the longer the homology arm, the better. Therefore, the use of homology arms can be shortened by studying the effect of the length of the homology arms on recombination efficiency. The lengths of the homology arms used in the present invention are 50bp, 100bp, 125bp, and 150bp, respectively.

The results are shown in FIGS. 7F and 8F, and the recombinases pBBR1-PRha-ETh _ tji49-kan and pBBR1-PRha-ETh1h2e-yi23-kan can satisfy the recombination requirement when the length of the homologous arm is 50 bp. The recombination efficiency of pBBR1-PRha-ETh _ tji49-kan reaches the maximum when the length of the homology arm is 125 bp. The recombination efficiency of pBBR1-PRha-ETh1h2e-kan reaches the maximum when the length of the homology arm is 150 bp.

The PCR products of homologous arms with different lengths for recombination are obtained by carrying out PCR amplification on the aprAR by taking pBBR1-apra-kan as a template. The method comprises the following specific steps:

PG1-Chrom1C4-Papra-insert-HA50 PCR product is obtained by PCR amplification of aprAR with pBBR1-apra-kan as template and primer-PG1-Chrom1C4-Papra-insert-5-50 and primer-PG1-Chrom1C4-Papra-insert-3-50 as primers.

PG1-Chrom1C4-Papra-insert-HA125 PCR product is obtained by PCR amplification of aprAR by taking pBBR1-apra-kan as a template and primer-PG1-Chrom1C4-Papra-insert-5-125 and primer-PG1-Chrom1C4-Papra-insert-3-125 as primers.

PG1-Chrom1C4-Papra-insert-HA150 PCR product is obtained by PCR amplification of aprAR by taking pBBR1-apra-kan as a template and primer-PG1-Chrom1C4-Papra-insert-5-150 and primer-PG1-Chrom1C4-Papra-insert-3-150 as primers.

primer-PG1-chrom1C4-Papra-insert-5-50：cgctcgcgtcgcgagtctgtcatcaaggcgccgcaaccggcgcgcactccACGCTCAGTGGAACGAGGTT

primer-PG1-chrom1C4-Papra-insert-3-50：gcgatgtggtcgaggcgccggaacgcggcggcgtcgtcgacgcggttatccatAATCTGTACCTCCTTAAGT

primer-PG1-chrom1C4-Papra-insert-5-125：ggggcaatttgaccatgtcgaatgcAGCGCTACGAGAATCAGAGAG

primer-PG1-chrom1C4-Papra-insert-3-125：aggcggcgcttgagcgcgaagccgaGCACGTCGCGAAACAGGTG

primer-PG1-chrom1C4-Papra-insert-5-150：gcgtggcgtccggcgcgtgttgacaggggcaatttgaccatgtcgaatgcAGCGCTACGAGAATCAGAGAG

primer-PG1-chrom1C 4-Papra-insert-3-150: gcccgtgcgcgcgcccttgatctgcaggcggcgcttgagcgcgaagccgaGCACGTCGCGAAACAGGTG (lower case letters in the primers are homology arms and upper case letters are primers).

The specific PCR reaction system and procedure were the same as in example 3.

Recombinant System expression plasmid pBBR1-Rha-ETh _ tji49-kan was used to verify the correctness of the recombinant modification by colony PCR after recombinant modification in Burkholderia glumae PG 1.

The 5' junction PCR (625bp) was amplified with the primers check-Papra-5(GTCTGCCATCAATCCGTCAC) and check-Apra-up-3 (GACGCTACGGAAGGAGCTGTG).

The 3' junction PCR (651bp) was amplified with the primers check-Apra-down-5(GAAGGTCCAGTCGGTCATGC) and check-Papra-3 (ATACTTGCCCGACTGCTCGAG).

Full-length PCR (1815bp) was amplified with primers check-Papra-5(GTCTGCCATCAATCCGTCAC) and check-Papra-3 (ATACTTGCCCGACTGCTCGAG).

The PCR reaction system and procedure were the same as in example 3.

The experimental results show that:

Colony PCR results showed that all randomly picked monoclonals were correct.

Example 6: application of Burkholderia plantarii DSM9509 in activating silencing gene cluster by using Burkholderia novel recombination system

(1) Electrotransformation stage of Burkholderia plantarri DSM9509

Single colonies were picked and inoculated into 2ml EP tubes containing 1.8ml of CYMG broth and cultured at 30 ℃ for 16-18 h with shaking at 950 rpm. Mu.l of the seed broth was pipetted into 1.5ml of EP tube containing 1.3ml of CYMG broth and cultured at 30 ℃ for 3h with shaking at 950 rpm. Centrifuging at 10000rpm for 1min, discarding the supernatant, adding 1ml 10% sucrose solution to suspend the cells, centrifuging at 10000rpm for 1min, and discarding the supernatant. And (5) repeating the step (3). The cells were suspended leaving 40-50. mu.l of the solution. The recombinase plasmid pBBR1-Rha-ETh1h2e _ yi23-kan 500ng was added, mixed well and transferred to a 1mm electrode cup. 1300V shock, 1ml liquid CYMG medium was added to the electrode cup, whipped twice, and transferred to a 1.5ml EP tube. The cells were cultured at 30 ℃ for 2 hours with shaking at 950 rpm. Centrifugation at 8000rpm for 1min left a portion of the supernatant discarded, leaving 100. mu.l of suspended bacteria, streaking onto CYMG solid medium containing kanamycin (10. mu.g/mL) in the three zones, and incubation at 30 ℃ in a very stable incubator for 24-36 h resulted. And picking out a single clone for verification.

The same effect was obtained in a repeat experiment using the same method to select another plasmid.

(2) Recombination in Burkholderia plantarri DSM9509

Single colonies containing the recombinant enzyme were picked and inoculated into 1.5ml EP tubes containing 1.3ml of CYMG broth with a central puncture and cultured with shaking at 30 ℃ and 950rpm for 16-18 h. The appropriate amount of seed liquid was aspirated and inoculated into 1.3ml of 1.5ml EP tube punctured in the middle of CYMG liquid medium, and shaking cultured at 30 ℃ and 950rpm for 3 h. Addition of 100mg/ml rhamnose 20. mu.l, shaking culture at 35 ℃ and 950rpm for 60min induced expression of Red/ET homologous recombinase in Burkholderia plantarri DSM 9509. Homologous recombination was carried out according to the Burkholderia plantarri DSM9509 electrotransformation procedure described above, with the addition of the corresponding PCR product DSM9509-chrom1C4-Papra-insert for gene insertion and the knock-out PCR product DSM9509-chrom1C4-KO 500 ng. Selecting a solid plate with proper resistance to screen the recombinants.

During recombination, the PCR product DSM9509-chrom1C4-Papra-insert for gene insertion was amplified using pBBR1-apra-kan as template and the following primer pairs:

primer-DSM9509-chrom1C4-Papra-insert-5：cttgcacgccgacgcgccggcacgcccgcgcgcggcgttcgcgcgccccaatgcgcactctcgtttggcaggacagatccACGCTCAGTGGAACGAGGTT

primer-DSM9509-chrom1C4-Papra-insert-3：gcgatgtcaacggccgcgccgtcccgcggggtctcggcgcgatcggccgtgcgggccgcgtcccgggagagtctgtccatAATCTGTACCTCCTTAAGTCAG

in the recombination process, a PCR product DSM9509-chrom1C4-KO for gene knockout is obtained by taking pBBR1-apra-kan as a template and amplifying the following primer pairs:

primer-DSM9509-chrom1C4-KO-5：tcgatgaggtgagcgtagccgcgcaagcggcgctgccgcccttgagcgccgccgacgtggcacgcctgcctgccgacgtgACGCTCAGTGGAACGAGGTT

primer-DSM9509-chrom1C 4-KO-3: tcgacgtcggccggcagcttcgcgcggtcggcttcgccgagcgagagcgccgagccgtcctgcgtggggctgacttcatcAATCTGTACCTCCTTAAGTCAG (lower case letters in the primers are homology arms and upper case letters are primers). The specific PCR reaction system and procedure were the same as in example 3.

Single colonies were picked for colony PCR validation for the genetically manipulated mutant strains, see FIG. 9B.

The 5' junction PCR (730bp) was amplified with the primers check-DSM9509-chrom1C4-Papra-insert-5(GCGGCATGCGTTCGGATCTC) and check-Apra-up-3.

The 3' junction PCR (748bp) was amplified with the primers check-Apra-down-5 and check-DSM9509-chrom1C4-Papra-insert-3 (GAGCGACTCGATCAGCGACG).

The 5' junction PCR (699bp) was amplified with the primers check-DSM9509-chrom1C4-KO-5(CACTTCGTGACGCTCGACCG) and check-Apra-up-3.

The 3' junction PCR (730bp) was amplified with the primers check-Apra-down-5 and check-DSM9509-chrom1C4-KO-3 (GATACGCGCCGAACAGCTCG).

The PCR reaction system and procedure were the same as in example 3.

(3) Detection and identification of fermentation products

Fermenting single colony with correct sequencing result, selecting single colony, inoculating into 1.3ml of CYMG liquid culture medium containing corresponding antibiotic, 1.5ml of EP tube with hole in the middle, performing shake culture at 30 deg.C and 950rpm for 16-18 h to obtain seed liquid, and performing seed liquid: medium 1: 50, inoculating the seed liquid into 50ml conical flask containing CYMG liquid culture medium containing corresponding antibiotic, culturing at 30 deg.C and 200rpm for 48 hr under shaking, adding 1ml XD-600 resin for adsorption, and culturing at 30 deg.C and 200rpm for 12 hr under shaking. Centrifuge at 8000rpm for 10min, and discard the supernatant. Adding 30ml methanol to elute the compound, and culturing at 30 deg.C and 200rpm for 3-4 h under shaking. The methanol was evaporated to dryness and the compound was dissolved in 1ml of methanol. After filtration through a 0.22 μm filter, 3 μ l was taken for HPLC-MS analysis.

The HPLC model is Thermo Scientific Dionex Ultimate 3000 system. The chromatographic conditions are as follows: thermo Scientific^TMAcclaim^TMC18 column (2.1X 100mm,2.2 μm); the solvent A is ultrapure water (0.1% trifluoroacetic acid) and acetonitrile B (0.1% trifluoroacetic acid); the solvent gradient is 0-5 min, 5% B, 5-20 min, 5% -95% B, 20-25 min, 95% B; the column flow rate was 0.30 ml/min. The high resolution mass spectrometer model was Bruker amaZon SL, ESI-Ion trap MS (electrospray Ion hydrazine mass spectrometer). Mass spectrum conditions: auto MS²，Mass range(70–2000)，precursor ion 2。

And analyzing the collected liquid quality Data by using Data Analysis software.

Comparison of BPC profiles (FIG. 9C) with extracts of the wild strain Burkholderia plantarri DSM9509 as a negative control revealed 7 new peaks in the engineered strain DSM5029-Papra-C1BGC4 activity corresponding to 7 secondary metabolites: 1M/z [ M + H]⁺759、2m/z[M+H]⁺743、3m/z[M+H]⁺757、4m/z[M+H]⁺809、5m/z[M+H]⁺793、6m/z[M+H]⁺773 and 7M/z [ M + H ]]⁺757 (FIG. 9D). The 7 compounds are separated and purified, and the structures of the compounds are analyzed by various spectrum technologies, and finally the compounds are identified as non-ribosomal polypeptide compounds, wherein the compounds 1 (haeerplantin F), 2 (haeerplantin G) and 3 (haeerplantin H) are new compounds.

Sequence listing

<110> Shandong university

Homologous recombination system for <120> Burkholderia and application thereof

<141> 2020-10-20

<160>4

<210> 1

<211> 9279

<212> DNA

<213> Artificial sequence

<221> nucleotide sequence of pBBR1-Rha-EThe _ bdu8-kan

<222>（1）…（9279）

<400>1

ctaccggcgc ggcagcgtga cccgtgtcgg cggctccaac ggctcgccat cgtccagaaa 60

acacggctca tcgggcatcg gcaggcgctg ctgcccgcgc cgttcccatt cctccgtttc 120

ggtcaaggct ggcaggtctg gttccatgcc cggaatgccg ggctggctgg gcggctcctc 180

gccggggccg gtcggtagtt gctgctcgcc cggatacagg gtcgggatgc ggcgcaggtc 240

gccatgcccc aacagcgatt cgtcctggtc gtcgtgatca accaccacgg cggcactgaa 300

caccgacagg cgcaactggt cgcggggctg gccccacgcc acgcggtcat tgaccacgta 360

ggccgacacg gtgccggggc cgttgagctt cacgacggag atccagcgct cggccaccaa 420

gtccttgact gcgtattgga ccgtccgcaa agaacgtccg atgagcttgg aaagtgtctt 480

ctggctgacc accacggcgt tctggtggcc catctgcgcc acgaggtgat gcagcagcat 540

tgccgccgtg ggtttcctcg caataagccc ggcccacgcc tcatgcgctt tgcgttccgt 600

ttgcacccag tgaccgggct tgttcttggc ttgaatgccg atttctctgg actgcgtggc 660

catgcttatc tccatgcggt agggtgccgc acggttgcgg caccatgcgc aatcagctgc 720

aacttttcgg cagcgcgaca acaattatgc gttgcgtaaa agtggcagtc aattacagat 780

tttctttaac ctacgcaatg agctattgcg gggggtgccg caatgagctg ttgcgtaccc 840

ccctttttta agttgttgat ttttaagtct ttcgcatttc gccctatatc tagttctttg 900

gtgcccaaag aagggcaccc ctgcggggtt cccccacgcc ttcggcgcgg ctccccctcc 960

ggcaaaaagt ggcccctccg gggcttgttg atcgactgcg cggccttcgg ccttgcccaa 1020

ggtggcgctg cccccttgga acccccgcac tcgccgccgt gaggctcggg gggcaggcgg 1080

gcgggcttcg ccttcgactg cccccactcg cataggcttg ggtcgttcca ggcgcgtcaa 1140

ggccaagccg ctgcgcggtc gctgcgcgag ccttgacccg ccttccactt ggtgtccaac 1200

cggcaagcga agcgcgcagg ccgcaggccg gaggcttttc cccagagaaa attaaaaaaa 1260

ttgatggggc aaggccgcag gccgcgcagt tggagccggt gggtatgtgg tcgaaggctg 1320

ggtagccggt gggcaatccc tgtggtcaag ctcgtgggca ggcgcagcct gtccatcagc 1380

ttgtccagca gggttgtcca cgggccgagc gaagcgagcc agccggtggc cgctcgcggc 1440

catcgtccac atatccacgg gctggcaagg gagcgcagcg accgcgcagg gcgaagcccg 1500

gagagcaagc ccgtagggcg ccgcagccgc cgtaggcggt cacgactttg cgaagcaaag 1560

tctagtgagt atactcaagc attgagtggc ccgccggagg caccgccttg cgctgccccc 1620

gtcgagccgg ttggacacca aaagggaggg gcaggcatgg cggcatacgc gatcatgcga 1680

tgcaagaagc tggcgaaaat gggcaacgtg gcggccagtc tcaagcacgc ctaccgcgag 1740

cgcgagacgc ccaacgctga cgccagcagg acgccagaga acgagcactg ggcggccagc 1800

agcaccgatg aagcgatggg ccgactgcgc gagttgctgc cagagaagcg gcgcaaggac 1860

gctgtgttgg cggtcgagta cgtcatgacg gccagcccgg aatggtggaa gtcggccagc 1920

caagaacagc aggcggcgtt cttcgagaag gcgcacaagt ggctggcgga caagtacggg 1980

gcggatcgca tcgtgacggc cagcatccac cgtgacgaaa ccagcccgca catgaccgcg 2040

ttcgtggtgc cgctgacgca ggacggcagg ctgtcggcca aggagttcat cggcaacaaa 2100

gcgcagatga cccgcgacca gaccacgttt gcggccgctg tggccgatct agggctgcaa 2160

cggggcatcg agggcagcaa ggcacgtcac acgcgcattc aggcgttcta cgaggccctg 2220

gagcggccac cagtgggcca cgtcaccatc agcccgcaag cggtcgagcc acgcgcctat 2280

gcaccgcagg gattggccga aaagctggga atctcaaagc gcgttgagac gccggaagcc 2340

gtggccgacc ggctgacaaa agcggttcgg caggggtatg agcctgccct acaggccgcc 2400

gcaggagcgc gtgagatgcg caagaaggcc gatcaagccc aagagacggc ccgagacctt 2460

cgggagcgcc tgaagcccgt tctggacgcc ctggggccgt tgaatcggga tatgcaggcc 2520

aaggccgccg cgatcatcaa ggccgtgggc gaaaagctgc tgacggaaca gcgggaagtc 2580

cagcgccaga aacaggccca gcgccagcag gaacgcgggc gcgcacattt ccccgaaaag 2640

tgccacctgg gatgaatgtc agctactggg ctatctggac aagggaaaac gcaagcgcaa 2700

agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat 2760

ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt gggaagccct 2820

gcaaagtaaa ctggatggct ttcttgccgc caaggatctg atggcgcagg ggatcaagat 2880

ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag 2940

gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg 3000

gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca 3060

agaccgacct gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc 3120

tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg 3180

actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg 3240

ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta 3300

cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag 3360

ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac 3420

tgttcgccag gctcaaggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg 3480

atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg 3540

gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg 3600

aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg 3660

attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgagcg ggactctggg 3720

gttcgaaatg accgaccaag cgacgcccaa cctgccatca cgagatttcg attccaccgc 3780

cgccttctat gaaaggttgg gcttcggaat cgttttccgg gacgccggct ggatgatcct 3840

ccagcgcggg gatctcatgc tggagttctt cgcccacccc catgggcaaa tattatacgc 3900

aaggcgacaa ggtgctgatg ccgctggcga ttcaggttca tcatgccgtt tgtgatggct 3960

tccatgtcgg cagaatgctt aatgaattac aacagttttt atgcattaat ctttctgcga 4020

attgagatga cgccactggc tgggcgtcat cccggtttcc cgggtaaaca ccaccgaaaa 4080

atagttacta tcttcaaagc cacattcggt cgaaatatca ctgattaaca ggcggctatg 4140

ctggagaaga tattgcgcat gacacactct gacctgtcgc agatattgat tgatggtcat 4200

tccagtctgc tggcgaaatt gctgacgcaa aacgcgctca ctgcacgatg cctcatcaca 4260

aaatttatcc agcgcaaagg gacttttcag gctagccgcc agccgggtaa tcagcttatc 4320

cagcaacgtt tcgctggatg ttggcggcaa cgaatcactg gtgtaacgat ggcgattcag 4380

caacatcacc aactgcccga acagcaactc agccatttcg ttagcaaacg gcacatgctg 4440

actactttca tgctcaagct gaccgataac ctgccgcgcc tgcgccatcc ccatgctacc 4500

taagcgccag tgtggttgcc ctgcgctggc gttaaatccc ggaatcgccc cctgccagtc 4560

aagattcagc ttcagacgct ccgggcaata aataatattc tgcaaaacca gatcgttaac 4620

ggaagcgtag gagtgtttat cgtcagcatg aatgtaaaag agatcgccac gggtaatgcg 4680

ataagggcga tcgttgagta catgcaggcc attaccgcgc cagacaatca ccagctcaca 4740

aaaatcatgt gtatgttcag caaagacatc ttgcggataa cggtcagcca cagcgactgc 4800

ctgctggtcg ctggcaaaaa aatcatcttt gagaagtttt aactgatgcg ccaccgtggc 4860

tacctcggcc agagaacgaa gttgattatt cgcaatatgg cgtacaaata cgttgagaag 4920

attcgcgtta ttgcagaaag ccatcccgtc cctggcgaat atcacgcggt gaccagttaa 4980

actctcggcg aaaaagcgtc gaaaagtggt tactgtcgct gaatccacag cgataggcga 5040

tgtcagtaac gctggcctcg ctgtggcgta gcagatgtcg ggctttcatc agtcgcaggc 5100

ggttcaggta tcgctgaggc gtcagtcccg tttgctgctt aagctgccga tgtagcgtac 5160

gcagtgaaag agaaaattga tccgccacgg catcccaatt cacctcatcg gcaaaatggt 5220

cctccagcca ggccagaagc aagttgagac gtgatgcgct gttttccagg ttctcctgca 5280

aactgctttt acgcagcaag agcagtaatt gcataaacaa gatctcgcga ctggcggtcg 5340

agggtaaatc attttcccct tcctgctgtt ccatctgtgc aaccagctgt cgcacctgct 5400

gcaatacgct gtggttaacg cgccagtgag acggatactg cccatccagc tcttgtggca 5460

gcaactgatt cagcccggcg agaaactgaa atcgatccgg cgagcgatac agcacattgg 5520

tcagacacag attatcggta tgttcataca gatgccgatc atgatcgcgt acgaaacaga 5580

ccgtgccacc ggtgatggta tagggctgcc cattaaacac atgaataccc gtgccatgtt 5640

cgacaatcac aatttcatga aaatcatgat gatgttcagg aaaatccgcc tgcgggagcc 5700

ggggttctat cgccacggac gcgttaccag acggaaaaaa atccacacta tgtaatacgg 5760

tcatactggc ctcctgatgt cgtcaacacg gcgaaatagt aatcacgagg tcaggttctt 5820

accttaaatt ttcgacggaa aaccacgtaa aaaacgtcga tttttcaaga tacagcgtga 5880

attttcagga aatgcggtga gcatcacatc accacaattc agcaaattgt gaacatcatc 5940

acgttcatct ttccctggtt gccaatggcc cattttcctg tcagtaacga gaaggtcgcg 6000

aattcaggcg ctttttagac tggtcgtaat gaacaattct taagaaggag atatacatat 6060

gtccgaaatg aatcgccttg gcttcatcgg cggcagcgac gttgccgcca tccttggtgt 6120

aagcccgtgg aaaacgccgc acgaactgtg gcttcagaag acgggccgcg cgccgcgcga 6180

agaagtcacg cctgagcaac aaaagcgctt cgaccgtggt caccgcctgg agccggtcgt 6240

gctgcaaatg ctcatcgatc gcctcgagga tgaagggatc gaagtcgagc tcatgcgcac 6300

gaacaagcgc tacaccgatg ccgaacatcc ctttttggcg tgtgagatcg acttcgagct 6360

gcgcgtgaca ggcgaaatcg aaatcgccgg cgaactggtc cagttctcgg gcgagcatat 6420

caatggcgac tgcaagacgg tgcacccgtt cgctgcgaag aagtggggcg aagaaggaac 6480

cgacgaagtg ccgatcgatt acgccgcgca gttcatgcac ggcctcggca tcactggccg 6540

tgacttctgc atcgtggcaa ccctcatcgg catggacgac ctgctcattt attgggtgaa 6600

gcgcgaccaa gaaaccatcg acggtattcg cagccacgtc gtggaattct ggaacgaatg 6660

cgtgctcgcc gacgtggcgc ccgacccgat cgacttcgac gactgcaagg cgatctacgc 6720

gaagagcaac ggcggctcaa tcgaagcaaa caccgagatc cgcgacgcag tgttcaacct 6780

gatcgacgtg aaagccaaga tcaagatcct agaagcgtcc gaagaggaat tgagctatcg 6840

catcacggcg tatatgcagc ccaacgcggt tctcacggcc ggtggcaaca cgatcgccac 6900

gtggaagaac cagaacgata cgcgcatcga ccagaagctg ctgaaggatg acgcacccga 6960

ggtctacgcg aagtactcgc gtacgaagga aatccgcgtg ctgcgtcttt cgaagatcaa 7020

gtaaaggagg cagctatatg agcaccgccc aactgaagca agtcgcaacc ggcaagaaag 7080

acaatccggt tgcttcgttc agcagcttcc tcgacaagtt caagccgcag atggcgctcg 7140

cgctgccgaa gcacctgacg gcggatcgca tggcgcgcct cgccgtgacc gcgttcagct 7200

cgacgccgaa gctgcaggag tgcgagccga agacgatcgt cgccggaatc atgacggccg 7260

cgacgctcgg cctcgagatc ggcgtcgacg gtcaaggctt cctcgtgccg tacggccgca 7320

cgtgccagtt cgtgccgggc tggaaaggtc tcgtcgacct ggtgtcgcgt agcggccgcg 7380

caaccgtctg gacgggcgct gtattcgagg gcgacgagtt cgactatgcc ctcggcgatt 7440

cgccgttcat tcgccatcgc ccgggcgaag agaacgatcc ggacaagatc acgcacgtgt 7500

atgcagtcgg ccgcgtgaac ggttcggact acccggtgat cgaagtctgg accattagga 7560

aggtctggaa gcaccgtgac aagtacaaca aggtcggcgc gaagcactac agcttccgcg 7620

acccggaaat gtacgcgcgc aaagtgccgc tgctgcaggt gctcaagtac atgccgaaat 7680

cgatcgaact acagaatgca atggcgatcg cgaacgcagc cgataacggc catcacgccg 7740

tcatcgacgg aaacttcgtc acggtcaccg atccggatac cggcgcgacg gtcgatccat 7800

cgactggcga actcactgac cagcgtgcgc agcagtccga catgacgctg cccgcctacg 7860

acgacctgct cggccagatc cagaaagcag acgacgtcga ggtactggcg ctcgtgatgg 7920

acagcgcacg cgatctccct gccgatcagc tcacgaagct gaaacaggca tacgaagatc 7980

gcaaagaagt cctgatgtga ttatctagaa ggaggggtac ctatgaaacc catcctcttc 8040

tacgacaccg aaacgaacgg cctgccgctg tggaacgagc catccaacca tcctagccaa 8100

ccgcacatca cgcaacttgc ggccgagctt ttcgatgccg atagtggacg cacactcgcg 8160

ttcatggatc tgatgatccg accggaagat tggacgattc cggaggagct tgagcagctc 8220

accggaatca cgaacgatct cgcacatcgc ttcggccatt cgctgaatca tgcgctcggc 8280

acgttcatct gcatgtggtc ggaagccgag ctgcgcgtcg cgcacaacga atcgttcgac 8340

caacgtctcg tgcgcattgc cgcgatgcgc gcgctcggcg cggaccacgg tttccacgag 8400

gactggaaga agggagccgt cttctgcacg cagacgaaca gcacgaagat tctgaatctg 8460

ccgccgaccg agaagatggt gcgtgcaggc cgcaaccatg cgaagtcgcc gaacctcgcc 8520

gaagcctacg aatttttcac cggcaaaaaa ctcgagggcg cacataacgc cgcggtagat 8580

ctggcggcat gcaaggccgt ctacttcggc atccaaactc atcatgaagc gatggcctcg 8640

tgaggatcca ggaggggtac ctatgaccaa caccaaatac gaaaagctcg atgcgctgat 8700

cctctcgaag atcggcgtcg ccccgatcaa attcgcatcg atacacagtg gcgatatcga 8760

agacgagagc aaccgaatcg tctcggaaca aggccctcac tcgttatatg gtttcaccga 8820

tccatggcgc atcgtcgatc gccgccttca gtcgcttcgc aaggccggaa agatccgctc 8880

gacaccgaag ggatgggttc ggacggcacc acaaaagccg tagggatcct ctagacccag 8940

cccgcctaat gagcgggctt ttttttgaac aaagcttacc ggtttattga ctaccggaag 9000

cagtgtgacc gtgtgcttct caaatgcctg aggccagttt gctcaggctc tccccgtgga 9060

ggtaataatt gacgatatga tcatttattc tgcctcccag agcctgataa aaacggtgaa 9120

tccgttagcg aggtgccgcc ggcttccatt caggtcgagg tggcccggct ccatgcaccg 9180

cgacgcaacg cggggaggca gacaaggtat agggcggcga ggcggctaca gccgatagtc 9240

tggaacagcg cacttacggg ttgctgcgca acccaagtg 9279

<210> 2

<211> 8294

<212> DNA

<213> Artificial sequence

<221> nucleotide sequence of pBBR1-Rha-ETh _ tji49-kan

<222>（1）…（8294）

<400> 2