阅读说明：本技术 一种荧光染料及其制备方法和用途 (Fluorescent dye and preparation method and application thereof ) 是由 不公告发明人 于 2020-03-23 设计创作，主要内容包括：一种荧光染料及其制备方法和用途,所述荧光染料对粘度响应敏感并且特异,本底荧光低等优点,还可以作为荧光激活点亮型探针,用于蛋白、酶或核酸的荧光标记、定量或检测。(The fluorescent dye has the advantages of sensitivity and specificity to viscosity response, low background fluorescence and the like, and can be used as a fluorescence activation lightening type probe for fluorescence labeling, quantification or detection of protein, enzyme or nucleic acid.)

1. A fluorescent dye, which is represented by formula (I):

wherein:

ar is an arylene group or a heteroarylene group, and the hydrogen atoms in Ar are optionally each independently substituted with a halogen atom; d-is HO-or N (X)₁)(X₂)-，X₁、X₂Each independently selected from hydrogen, alkyl or modified alkyl; x₁，X₂Optionally linked to each other, forming, together with the N atom, an aliphatic heterocycle; x₁，X₂Optionally independently forming a lipoheterocycle with Ar;

y is O or S;

R₁is hydrogen or alkyl;

R₂is a halogen atom, -OH or-CN;

wherein:

said "alkyl" is C₁-C₁₀A linear or branched alkyl group; alternatively, is C₁-C₆A linear or branched alkyl group; alternatively, is C₁-C₄A linear or branched alkyl group; alternatively, it is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1-dimethylbutyl, 2-dimethylbutyl, 3-dimethylbutyl, 1, 2-dimethylbutyl, 1, 3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 2-dimethylpentyl, 3-dimethylpentyl, 2-methylpentyl, 3-methylpentyl, 2-methylbutyl, 3-methylpentyl, 2-methylpentyl, 3-methylpentyl, 2-methylpentyl, 3-methylpentyl, 2-methylpentyl, 3-methylpentyl, and/or 2-methylpentyl, 2, 4-dimethylpentyl, 3-ethylpentyl or 2,2, 3-trimethylbutyl;

the "modified alkyl" groups are each independently C₁-C₁₆Any carbon atom of the linear or branched alkyl group being substituted by a halogen atom, -OH, -CO-, -O-, -CN, -SO₃H. A group resulting from replacement of one or more of the primary, secondary, tertiary amino groups, or wherein the carbon-carbon single bonds are optionally independently replaced by carbon-carbon double bonds or carbon-carbon triple bonds;

the carbon atom is replaced, and the carbon atom or the carbon atom and the hydrogen atom on the carbon atom are replaced by the corresponding group;

each of said "halogen atoms" is independently F, Cl, Br or I;

the 'aliphatic heterocyclic ring' is a saturated or unsaturated 4-15-membered monocyclic or polycyclic aliphatic heterocyclic ring containing N, O, S or one or more heteroatoms selected from Si, and when the aliphatic heterocyclic ring contains an S atom, the aliphatic heterocyclic ring is-S-, -SO-or-SO₂-; said aliphatic heterocyclic ring is optionally substituted with a halogen atom, an alkyl group, an aryl group or a modified alkyl group;

the arylene groups are each independently a 5-to 13-membered (optionally 6-or 10-membered) monocyclic or bicyclic or fused polycyclic arylene group;

each of the "heteroarylene groups" is independently a 5-13 membered (optionally 6-or 10-membered) monocyclic or bicyclic or fused polycyclic heteroarylene group containing one or more heteroatoms selected from N, O, S or Si in the ring;

the "primary amino group" is R' NH₂A group;

said "secondary amino" is an R' NHR "group;

the "tertiary amino" is an R 'NR "R'" group;

each R ', R ", R'" is independently a single bond, hydrogen, alkyl, alkylene;

said "alkylene" is C₁-C₁₀Linear or branched alkylene of (a); alternatively, is C₁-C₇A linear or branched alkylene group; alternatively, is C₁-C₅Straight or branched chain alkylene.

2. The fluorescent dye according to claim 1, wherein the "modified alkyl group" is a compound containing a group selected from-OH, -O-, -NH₂Ethylene glycol unit (- (CH)₂CH₂O)_n-)、-CN、-O-CO-、-NH-CO-、-SO₂-O-、-SO-、Me₂N-、Et₂One or more groups of N-, -CH ≡ CH-, -C ≡ CH, F, Cl, Br, I and cyano.

3. The fluorescent dye according to claim 1, wherein Ar is a structure selected from the following formulae (ii-1) to (ii-7):

4. the fluorescent dye according to claim 1, wherein the compound of formula (I) is selected from the group consisting of compounds of the following formulae:

5. a method for preparing a fluorescent dye according to any one of claims 1 to 4, comprising the step of subjecting a compound of formula (a) to aldol condensation with a compound of formula (b):

6. use of a fluorescent dye according to any one of claims 1 to 4 in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, other than for use in a diagnostic method for a disease.

7. Use of a fluorescent dye according to any one of claims 1 to 4 in the preparation of a reagent for viscosity testing, protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection, or nucleic acid quantification or detection.

8. A fluorescence-activated luminescent probe comprising the fluorescent dye according to any one of claims 1 to 4.

9. Use of the fluorescence-activated luminescent probe according to claim 8 for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, which is not used in a diagnostic method for a disease.

10. Use of the fluorescence-activated luminescent probe according to claim 8 for producing a reagent for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

Technical Field

The invention relates to the technical field of fluorescent dyes, in particular to a fluorescent dye with low viscosity responsiveness and low background fluorescence, and a preparation method and application thereof.

Background

The chromophore of the fluorescent protein is mainly an imidazolone dye, and the dye has the advantages of good biocompatibility, good photostability, adjustable fluorescence property and the like. Research shows that the dye is a molecular rotor, the fluorescence property of the dye changes along with the change of viscosity, when the dye is excited by illumination, the molecular rotor in a free state releases excited state energy in a non-radiative form through excited state intramolecular distortion, when the molecule is in a relatively high-viscosity or relatively rigid environment, the excited state intramolecular distortion is limited, the excited state energy is mainly released in a radiative light emitting form, the fluorescence enhancement property is shown, and therefore, the molecular rotor is often used for detecting the change of a microenvironment and the like.

At present, the intramolecular twisted luminescence based on the restricted molecular rotor is used for viscosity detection, and is also widely applied to the construction of fluorescence sensors, protein labeling, nucleic acid labeling and the like, for example, after DCVJ is combined with proteins such as BSA and the like, the excited state intramolecular twist of the molecular rotor is restricted, and the excited state energy is released in the form of radiation luminescence and is expressed as fluorescence activation, so that the molecular rotor is used for detection, quantification and the like of target proteins; the molecular conformation is limited after the dye such as thiazole orange is combined with DNA and RNA, so that the fluorescence is lightened, and the dye is used for the washing-free labeling and detection of the DNA and RNA; DHBI is used as a target molecule, and an aptamer capable of being specifically combined with the DHBI is obtained by SELEX screening, so that the fluorescent aptamer is constructed, the problem of no natural fluorescent RNA is solved, and the construction of the fluorescent RNA is possible; taking malachite green and the like as target molecules, obtaining a single-chain antibody which can be specifically combined with malachite green derivatives and activate fluorescence by a phage display technology and is used for labeling cell membrane proteins; the molecular rotor such as BODIPY is combined with amyloid and tua protein and lights fluorescence, so that the fluorescent probe is used for researching AIDS, Alzheimer's disease, Parkinson's disease and the like.

However, the types of the imidazolone molecular rotors completely derived from the fluorescent protein chromophore are very limited, the spectral range of the imidazolone is greatly expanded by modifying the imidazolone molecular rotors through an organic synthesis method, and meanwhile, the properties of other aspects, such as light stability, oil-water distribution coefficient and the like, can be effectively adjusted. However, the molecular rotor obtained by the method generally has the defect of high fluorescence background, so that the detection signal-to-noise ratio is low, and the method is difficult to be applied to sample detection and marking with small sample amount, complex components and low substrate abundance, therefore, the development of an imidazolone molecular rotor with low background fluorescence is necessary, and the application of the molecular rotor can be further expanded.

Disclosure of Invention

The invention aims to provide a fluorescent dye with viscosity responsiveness and low background fluorescence, and the viscosity responsiveness of the molecular rotor is 10^-5Under the mol condition, the ratio of the fluorescence intensity in the glycerol to the fluorescence intensity in the methanol is more than 10.

In one aspect of the present invention, there is provided a fluorescent dye represented by formula (i):

wherein:

ar is an arylene group or a heteroarylene group, and the hydrogen atoms in Ar are optionally each independently substituted with a halogen atom; d-is HO-or N (X)₁)(X₂)-，X₁、X₂Each independently selected from hydrogen, alkyl or modified alkyl; x₁，X₂Optionally linked to each other to form, together with the N atom, an aliphatic heterocycle; x₁，X₂Optionally independently forming a lipoheterocycle with Ar;

y is O or S;

R₁is hydrogen or alkyl;

R₂is a halogen atom, -OH or-CN;

wherein:

said "alkyl" is C₁-C₁₀A linear or branched alkyl group; alternatively, is C₁-C₆A linear or branched alkyl group; alternatively, is C₁-C₄A linear or branched alkyl group; alternatively, selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1-dimethylbutyl, 2-dimethylbutyl, 3-dimethylbutyl, 1, 2-dimethylbutyl, 1, 3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 2-dimethylpentyl, 3-dimethylpentyl, 2, 3-dimethylpentyl.Cyclopentyl, 2, 4-dimethylpentyl, 3-ethylpentyl or 2,2, 3-trimethylbutyl;

the "modified alkyl" groups are each independently C₁-C₁₆Any carbon atom of the linear or branched alkyl group being substituted by a halogen atom, -OH, -CO-, -O-, -CN, -SO₃H. A group resulting from replacement of one or more of a primary, secondary, or tertiary amino group, or wherein a carbon-carbon single bond is optionally independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond;

the carbon atom is replaced, and the carbon atom or the carbon atom and the hydrogen atom on the carbon atom are replaced by corresponding groups;

each of said "halogen atoms" is independently F, Cl, Br or I;

the 'aliphatic heterocyclic ring' is a saturated or unsaturated 4-15-membered monocyclic or polycyclic aliphatic heterocyclic ring containing N, O, S or one or more heteroatoms selected from Si, and when the aliphatic heterocyclic ring contains an S atom, the aliphatic heterocyclic ring is-S-, -SO-or-SO₂-; said aliphatic heterocyclic ring is optionally substituted with a halogen atom, an alkyl group, an aryl group or a modified alkyl group;

the arylene groups are respectively and independently 5-13-membered (6-membered or 10-membered is selected) monocyclic or bicyclic or fused polycyclic arylene groups;

each of the "heteroarylene groups" is independently a 5-13 membered (optionally 6-or 10-membered) monocyclic or bicyclic or fused polycyclic heteroarylene group containing one or more heteroatoms selected from N, O, S or Si in the ring;

the "primary amino group" is R' NH₂A group;

said "secondary amino" is an R' NHR "group;

the "tertiary amino" is an R 'NR "R'" group;

each R ', R ", R'" is independently a single bond, hydrogen, alkyl, alkylene;

said "alkylene" is C₁-C₁₀Linear or branched alkylene of (a); alternatively, is C₁-C₇Straight or branched chain alkylene; alternatively, is C₁-C₅Straight-chain or branched alkylene；

Optionally, the "modified alkyl" is a compound containing a substituent selected from the group consisting of-OH, -O-, -NH-₂Ethylene glycol unit (- (CH)₂CH₂O)_n-)、-CN、-O-CO-、-NH-CO-、-SO₂-O-、-SO-、Me₂N-、Et₂One or more groups selected from N-, -CH ≡ CH-, -C ≡ CH, F, Cl, Br, I and cyano;

alternatively, Ar is a structure selected from the following formulas (II-1) to (II-7):

alternatively, the compound of formula (I) is selected from compounds of the formula:

the second aspect of the present invention provides a method for preparing the above fluorescent dye, which comprises the step of subjecting a compound of formula (a) to aldol condensation reaction with a compound of formula (b):

a third aspect of the present invention provides the use of the above-mentioned fluorescent dye in a viscosity test, a protein fluorescent label, a nucleic acid fluorescent label, a protein quantification or detection, or a nucleic acid quantification or detection, which is not a diagnostic method for a disease.

A fourth aspect of the present invention provides the use of a fluorescent dye as described above in the preparation of a reagent for viscosity testing, fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids.

A fifth aspect of the present invention is to provide a fluorescence-activated luminescent probe, which comprises the above fluorescent dye.

The sixth aspect of the present invention provides the use of the above fluorescence-activated luminescent probe for protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection, or nucleic acid quantification or detection, which is not used in a diagnostic method for a disease.

The seventh aspect of the present invention provides a use of the fluorescence-activated luminescent probe described above in the preparation of a reagent for protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection, or nucleic acid quantification or detection.

The fluorescent dye obtained by the invention can be used for measuring the viscosity of a sample, and is suitable for testing the microscopic viscosity. According to another specific embodiment, the obtained fluorescent dye can be specifically combined with corresponding antibody, aptamer, amyloid protein or the like, or can be bonded with protein label or enzyme through ligand or inhibitor, so as to obtain a series of fluorescence activated lightening probes for fluorescence labeling, quantification or monitoring of protein, enzyme or nucleic acid.

Drawings

FIG. 1 shows a molecular rotor IV-1 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 2 shows molecular rotor IV-2 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 3 shows molecular rotor IV-3 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 4 shows molecular rotor IV-4 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 5 shows molecular rotor IV-5 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 6 shows molecular rotor IV-6 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 7 shows molecular rotor IV-17 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 8 shows molecular rotor IV-18 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 9 shows molecular rotor IV-19 (1X 10)^-5M) inFluorescence emission intensity graph under the same viscosity condition;

FIG. 10 shows the molecular rotor IV-20 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 11 shows the molecular rotor IV-21 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 12 shows molecular rotor IV-22 (1X 10)^-5M) fluorescence emission intensity plots under different viscosity conditions;

FIG. 13 shows molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8 (1X 10)^-6M) contrast plot of fluorescence background in PBS;

FIG. 14 shows molecular rotors IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 (1X 10)^-6M) contrast plot of fluorescence background in PBS;

FIG. 15 shows molecular rotors IV-42 and IV-36 (1X 10)^-6M) contrast plot of fluorescence background in PBS;

FIG. 16 shows molecular rotors IV-45, IV-46 and IV-3 (1X 10)^-6M) fluorescence background contrast in PBS;

FIG. 17 shows molecular rotors IV-47, IV-48 and IV-20 (1X 10)^-6M) fluorescence background contrast in PBS;

FIG. 18 shows molecular rotors IV-49, IV-50 and IV-5 (1X 10)^-6M) fluorescence background contrast in PBS;

FIG. 19 shows molecular rotors IV-51 and IV-1 (1X 10)^-6M) contrast plot of fluorescence background in PBS;

FIG. 20 shows the molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 used for labeling RNA aptamers intracellularly, wherein A is a cell expressing a target RNA aptamer and B is a cell not expressing a target RNA aptamer.

FIG. 21 is a flow chart of the molecular rotors IV-21 and IV-41 labeled mRNA.

The specific implementation mode is as follows:

example 1:

the compound IV-1:

the compound 1(0.504g,2mmol) and p-cyanobenzaldehyde (0.626g,5mmol) are dissolved in 100ml of tetrahydrofuran in a 250ml round bottom flask, anhydrous zinc chloride (0.545 g,4mmol) is added under Ar protection, the system is heated and refluxed in an oil bath at 80 ℃, TLC detection is finished, the solvent is removed in vacuum, and the residue is separated by column chromatography to obtain the target product (0.292g, 40%).¹H NMR(400MHz, DMSO-d₆)δ11.07(s,1H),8.10(d,J＝8.5Hz,2H),8.06(dd,J＝7.8,2.1Hz,2H), 8.03(s,1H),7.94(d,J＝8.3Hz,2H),7.44(d,J＝15.9Hz,1H),7.03(s,1H),3.29(s, 3H).MS(ESI):m/z Calcd.For C₂₀H₁₃F₂N₃O₂ 365.0976；found 364.0902,[M-H]^-.

Example 2:

the compound IV-2:

according to the procedure for the synthesis of compound IV-1, (0.475g, 65%).¹H NMR(400MHz,DMSO-d₆) δ11.04(s,1H),8.49(d,J＝1.9Hz,1H),8.21(dt,J＝8.0,1.4Hz,1H),8.10-8.02(m, 2H),8.00(s,1H),7.88(dt,J＝7.7,1.4Hz,1H),7.67(t,J＝7.8Hz,1H),7.43(d,J＝ 16.0Hz,1H),7.01(s,1H),3.29(s,3H).MS(ESI):m/z Calcd.For C₂₀H₁₃F₂N₃O₂ 365.0976；found 364.0903,[M-H]^-.

Example 3:

the compound IV-3:

according to the procedure for the synthesis of compound IV-1, (0.221g, 31%).¹H NMR(400MHz,DMSO-d₆) δ10.94(s,1H),10.11(s,1H),8.07–8.01(m,2H),7.95(d,J＝15.7Hz,1H),7.74(d, J＝8.7Hz,2H),7.01(d,J＝15.7Hz,1H),6.90(s,1H),6.87–6.83(m,2H),3.26(s, 3H).MS(ESI):m/z Calcd.For C₁₉H₁₄F₂N₂O₃ 356.0972；found 355.0901,[M-H]^-.

Example 4:

the compound IV-4:

according to the procedure for the synthesis of compound IV-1, (0.207g, 29%).¹H NMR(400MHz,DMSO-d₆) δ9.70(s,1H),8.05(d,J＝8.9Hz,2H),7.98-7.89(m,1H),7.30(t,J＝6.2Hz,1H), 7.26(d,J＝8.9Hz,1H),7.15(d,J＝15.8Hz,1H),6.97(s,1H),6.87(d,J＝7.5Hz, 1H),3.27(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₄F₂N₂O₃ 356.0972；found 355.0900, [M-H]^-.

Example 5:

the compound IV-5:

according to the procedure for the synthesis of compound IV-1, (0.186g, 26%).¹H NMR(400MHz,DMSO-d₆) δ8.16(d,J＝8.5Hz,2H),7.99-7.86(m,3H),7.31(t,J＝8.9Hz,2H),7.18(d,J＝ 15.9Hz,1H),6.95(s,1H),6.83-6.72(m,2H),3.59(t,J＝5.9Hz,2H),3.51(t,J＝5.9 Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₃F₃N₂O₂ 358.0929； found 357.0856,[M-H]^-.

Example 6:

the compound IV-6:

according to the synthetic procedure of the compound IV-1,(0.222g，31％)。¹H NMR(400MHz,DMSO-d₆) δ11.02(s,1H),8.09-8.03(m,2H),8.01(d,J＝15.8Hz,1H),7.85(dt,J＝10.6,2.1 Hz,1H),7.72(d,J＝7.8Hz,1H),7.51(td,J＝8.0,6.1Hz,1H),7.34(d,J＝15.9Hz, 1H),7.28(td,J＝8.7,2.7Hz,1H),7.00(s,1H),3.28(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₃F₃N₂O₂358.0929；found 357.0857,[M-H]^-.

example 7:

compound 2:

putting compound IV-5 (0.716g,2.0mmol), tert-butyldimethylsilyl chloride (0.450g,3.0mmol) and imidazole (0.204g,3.0mmol) in a 100ml round-bottom flask, adding 50ml of dried dimethylformamide for dissolution, stirring at room temperature under the protection of Ar, detecting by TLC, pouring the reacted system into 150ml of water, extracting dichloromethane three times, combining organic phases, drying with anhydrous sodium sulfate, filtering, removing the solvent under reduced pressure, and separating the participated substances by column chromatography to obtain compound 2(0.927g, 98%).¹H NMR(400MHz,DMSO-d₆)δ8.16 (d,J＝8.5Hz,2H),7.99-7.86(m,3H),7.31(t,J＝8.9Hz,2H),7.18(d,J＝15.9Hz, 1H),6.95(s,1H),6.83-6.72(m,2H),3.59(t,J＝5.9Hz,2H),3.51(t,J＝5.9Hz,2H), 3.27(s,3H),3.05(s,3H),1.50(s,9H),0.2(s,6H).MS(ESI):m/z Calcd.For C₂₅H₂₈F₃N₂O₂Si 473.2；found 473.2,[M+H]⁺.

The compound IV-7:

dissolving compound 2(0.473g,1mmol) and Lawson's reagent (0.808g,2mmol) in 250ml three-neck flask, adding 100ml toluene, dissolving, adding 2 drops of aniline, heating in oil bath under Ar protection and refluxing, detecting by TLC, removing solvent under reduced pressure after reaction, dissolving residue in 50ml dichloromethane, adding tetrabutyl fluorideAmine (0.313g,1.2mmol), Ar protected stirring at room temperature, TLC detection, reduced pressure after reaction to remove solvent, and column chromatography of the residue to obtain compound IV-7 (0.209g, 56%).¹H NMR(400MHz, DMSO-d₆)δ8.17(d,J＝8.5Hz,2H),7.98-7.86(m,3H),7.31(t,J＝8.9Hz,2H), 7.18(d,J＝15.9Hz,1H),6.95(s,1H),6.83-6.72(m,2H),3.59(t,J＝5.9Hz,2H), 3.51(t,J＝5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₃F₃N₂NaOS 397.0598；found 397.0597,[M+Na]⁺.

Example 8:

compound 3:

according to the synthetic procedure for Compound 2, (0.932g, 99%).¹H NMR(400MHz,DMSO-d₆) δ8.10(d,J＝8.5Hz,2H),8.06(dd,J＝7.8,2.1Hz,2H),8.03(s,1H),7.94(d,J＝8.3 Hz,2H),7.44(d,J＝15.9Hz,1H),7.03(s,1H),3.29(s,3H),1.51(s,9H),0.29(s, 9H).MS(ESI):m/z Calcd.For C₂₆H₂₈F₂N₃O₂Si 480.2；found 480.2,[M+H]⁺.

The compound IV-8:

according to the synthetic procedure for Compound IV-7, (0.332g, 49%).¹H NMR(400MHz,DMSO-d₆) δ11.00(s,1H),8.11(d,J＝8.5Hz,2H),8.07(dd,J＝7.8,2.1Hz,2H),8.04(s,1H), 7.94(d,J＝8.3Hz,2H),7.44(d,J＝15.9Hz,1H),7.03(s,1H),3.29(s, 3H).HMS(ESI):m/z Calcd.For C₂₀H₁₃F₂N₃NaOS 404.0645；found 404.0646,[M+Na] ⁺.

Example 9:

compound 5:

dissolving 3-fluoro-4-hydroxy-benzaldehyde (0.560g,4.0mmol) in 40ml of absolute ethanol in a 100ml round bottom flask, adding 10g of anhydrous sodium sulfate and 5ml of 33% methylamine water solution, stirring for 24h at room temperature under Ar protection condition, filtering, pressurizing to remove organic solvent, dissolving the residue in 10ml of absolute ethanol, adding compound 4(0.790g,5.0mmol), stirring overnight at room temperature under Ar protection condition, filtering the next day, and washing with cold ethanol three times to obtain compound 5(0.796g, 85%).¹H NMR(400MHz,DMSO-d₆)δ10.52(s, 1H),8.19(m,1H),7.76(m,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H),3.09(s,3H), 2.34(s,3H).MS(ESI):m/z Calcd.For C₁₂H₁₀FN₂O₂ 234.2；found 234.2,[M-H]^-.

The compound IV-9:

according to the procedure for the synthesis of Compound IV-1, (0.239g, 21%).¹H NMR(400MHz,DMSO-d₆) δ10.52(s,1H),8.11(d,J＝8.5Hz,2H),8.07(d，J＝7.8Hz,2H),7.84(d,J＝8.0Hz, 1H),7.67(d,J＝8.4Hz,1H),7.32(m,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H),6.78 (m,1H),2.34(s,3H).HR-MS(ESI):m/z Calcd.For C₂₀H₁₃FN₃O₂ 346.0997；found 346.0998,[M-H]^-.

Example 10:

compound 6:

following the synthetic procedure for compound 5, (0.812g, 91%).¹H NMR(400MHz,CD₃OD) δ7.28(s,1H),7.19(d,J＝8.0Hz,2H),3.59(t,J＝5.6Hz,3H),3.12(s,3H),1.23(q, J＝5.6Hz,3H).MS(ESI):m/z Calcd.For C₁₃H₁₁ClFN₂O₂ 281.0；found 281.0,[M-H]^-.

A compound IV-10:

according to the procedure for the synthesis of Compound IV-1, (0.239g, 21%).¹H NMR(400MHz,CD₃OD) δ7.84(s,2H),7.28(s,1H),7.19(d,J＝8.0Hz,2H),3.12(s,3H),1.23(q,J＝5.6Hz, 3H).HR-MS(ESI):m/z Calcd.For C₂₁H₁₄ClFN₃O₂ 395.0837；found394.0764, [M-H]^-.

Example 11:

compound 7:

following the synthetic procedure for compound 5, (0.812g, 91%).¹H NMR(400MHz,CD₃OD) δ7.28(s,1H),7.19(d,J＝8.0Hz,2H),3.81(s,3H),3.12(s,3H),3.12(s,3H), 1.58(m,1H),1.11(d,6H).MS(ESI):m/z Calcd.For C₁₅H₁₅BrFN₂O₂ 353.0；found 3.0,[M-H]^-.

The compound IV-11:

according to the procedure for the synthesis of compound IV-1, (0.209g, 22%).¹H NMR(400MHz,CD₃OD) δ8.15(d,J＝8.8Hz,2H),7.95(d,J＝15.7Hz,1H),7.74(d,J＝8.7Hz,2H),7.28(s, 1H),7.19(d,J＝8.0Hz,2H),7.01(d,J＝15.7Hz,1H),6.87–6.83(m,2H),3.12(s, 3H),1.58(m,1H),1.11(d,6H).HR-MS(ESI):m/z Calcd.For C₂₃H₁₉BrFN₃O₂ 467.0645；found 466.0572,[M-H]^-.

Example 12:

compound 8:

following the synthetic procedure for compound 5, (0.812g, 91%).¹H NMR(400MHz,CD3OD) δ10.52(s,1H),7.76(d,J＝8.5Hz,2H),6.95(s,1H),3.79(t,J＝5.2Hz,2H),3.35(s, 3H),2.39(t,J＝4.8Hz,2H),1.40(m,2H),1.20(t,J＝4.8Hz,3H).MS(ESI):m/z Calcd. For C₁₄H₂₁₄FIN₂O₂388.0；found 388.0,[M-H]^-.

The compound IV-12:

according to the procedure for the synthesis of compound IV-1, (0.156g, 18%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),7.98-7.86(m,3H),7.76(d,J＝8.5Hz,2H),7.31(t,J＝8.9Hz,2H), 7.18(d,J＝15.9Hz,1H),6.95(s,1H),3.79(t,J＝5.2Hz,2H),3.35(s,3H),2.39(t, J＝4.8Hz,2H),1.40(m,2H),1.20(t,J＝4.8Hz,3H).HR-MS(ESI):m/z Calcd.For C₂₁H₁₇ClFIN₂O₂510.0007；found408.9936,[M-H]^-.

Example 13:

compound 9:

according to the synthetic procedure for compound 5, (0.732g, 93%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),7.76(d,J＝8.5Hz,2H),6.95(s,1H),3.10(s,3H),2.39(s,3H). MS(ESI):m/z Calcd.For C₁₂H₁₀Cl₂N₂O₃ 284.0；found 283.0,[M-H]^-.

The compound IV-13:

according to the procedure for the synthesis of compound IV-1, (0.156g, 18%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J＝15.7Hz,1H),7.76(d,J＝8.5Hz,2H), 7.01(d,J＝15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),3.10(s,3H),2.39(s, 3H).HR-MS(ESI):m/z Calcd.For C₁₉H₁₃BrCl₂N₂O₂ 449.9537；found 448.9455, [M-H]^-.

Example 14:

compound 10:

according to the synthetic procedure for compound 5, (0.732g, 93%).¹H NMR(400MHz,DMSO-d₆) δ10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H),3.01 (q,J＝4.8Hz,2H),2.34(s,3H),1.21(t,J＝4.8Hz,3H).MS(ESI):m/z Calcd.For C₁₃H₁₃ClN₂O₂ 264.1；found 263.1,[M-H]^-.

The compound IV-13:

according to the procedure for the synthesis of compound IV-1, (0.156g, 18%).¹H NMR(400MHz,DMSO-d₆) δ10.52(s,1H),8.19(m,1H),8.07–8.01(m,2H),7.95(d,J＝15.7Hz,1H),7.76(m, 1H),7.01(d,J＝15.7Hz,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H),6.87–6.83(m, 2H),3.01(q,J＝4.8Hz,2H),2.34(s,3H),1.21(t,J＝4.8Hz,3H).HR-MS(ESI):m/z Calcd.For C₂₁H₁₃ClIN₂O₂486.9716；found 486.9715,[M-H]^-.

Example 15:

compound 11:

according to the synthetic procedure for compound 5, (0.732g, 93%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H),3.05 (s,3H),2.34(s,3H).MS(ESI):m/z Calcd.For C₁₂H₁₁BrN₂O₂ 294.0；found 293.0, [M-H]^-.

Compound IV-15:

according to the procedure for the synthesis of compound IV-1, (0.156g, 18%).¹H NMR(400MHz,CD3OD) δ10.52(s,1H),8.19(m,1H),7.95(d,J＝15.7Hz,1H),7.76(m,1H),7.49(m,1H), 7.40-7.22(m,3H),7.01(d,J＝15.7Hz,1H),6.99(t,J＝8.8Hz,1H),6.89(s,1H), 3.05(s,2H),2.34(s,3H).HR-MS(ESI):m/z Calcd.For C₁₉H₁₄BrClN₂O₂ 415.9927； found 414.9854,[M-H]^-.

Example 16:

compound 9:

according to the synthetic procedure for compound 5, (0.732g, 93%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),7.76(d,J＝8.5Hz,2H),6.95(s,1H),2.39(s,3H).MS(ESI):m/z Calcd. For C₁₁H₈Cl₂N₂O₂270.0；found 271.0,[M+H]^-.

The compound IV-16:

according to the synthetic procedure of the compound IV-1,(0.156g，18％)。¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J＝15.7Hz,1H),7.76(d,J＝8.5Hz,2H), 7.01(d,J＝15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),2.39(s,3H).HR-MS(ESI): m/z Calcd.For C₁₈H₁₁BrCl₂N₂O₂ 435.9381；found 436.9459,[M+H]^-.

example 17:

compound IV-17:

according to the procedure for the synthesis of Compound IV-1, (0.286g, 28%).¹H-NMR(400MHz,DMSO-d₆): δ8.15(d,J＝8.6Hz,2H),7.82(d,J＝15.8Hz,1H),7.31–7.22(m,2H),7.21–7.17 (m,1H),7.10(d,J＝15.8Hz,1H),6.94(s,1H),6.88–6.73(m,3H),3.59(t,J＝5.8 Hz,2H),3.51(t,J＝6.0Hz,2H),3.26(s,3H),3.05(s,3H).HR-MS(ESI):m/z Calcd. For C₂₂H₂₄N₃O₃ 378.1818；found 378.1819,[M+H]⁺.

Example 18:

compound IV-18:

according to the procedure for the synthesis of compound IV-1, (0.486g, 60%).¹H-NMR(400MHz,DMSO- d₆):δ8.43(d,J＝1.8Hz,1H),8.16(t,J＝8.5Hz,3H),7.93(d,J＝15.9Hz,1H),7.85 (dt,J＝7.8,1.4Hz,1H),7.66(t,J＝7.8Hz,1H),7.40(d,J＝15.9Hz,1H),6.98(s, 1H),6.86-6.71(m,2H),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.28(s,3H), 3.06(s,3H).HR-MS(ESI):m/z Calcd.For C₂₃H₂₃N₄O₂ 387.1821；found 387.1822, [M+H]⁺.

Example 19:

compound IV-19:

according to the procedure for the synthesis of Compound IV-1, (0.286g, 38%).¹H-NMR(400MHz,DMSO-d₆): δ8.17(d,J＝8.6Hz,2H),7.91(d,J＝15.8Hz,1H),7.79(dt,J＝10.6,2.1Hz,1H), 7.66(d,J＝7.8Hz,1H),7.50(td,J＝8.0,6.2Hz,1H),7.34-7.20(m,2H),6.97(s,1H), 6.84-6.73(m,2H),3.59(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.27(s,3H),3.06 (s,3H).MS(ESI):m/z Calcd.For C₂₂H₂₃N₃O₃F 380.1774；found 380.1775,[M+H]⁺.

Example 20:

and (3) a compound IV-20:

according to the procedure for the synthesis of compound IV-1, (0.222g, 30%).¹H NMR(400MHz,DMSO-d₆): 8.14(d,J＝8.5Hz,2H),7.84(d,J＝15.7Hz,1H),7.68(d,J＝8.4Hz,2H),6.97(d,J ＝15.8Hz,1H),6.88(s,1H),6.84(d,J＝8.5Hz,2H),6.79(d,J＝8.8Hz,2H),3.59 (q,J＝5.4Hz,2H),3.51(t,J＝5.9Hz,2H),3.24(s,3H),3.05(s,3H).MS(ESI):m/z Calcd.For C₂₂H₂₄N₃O₃378.1818；found 378.1819,[M+H]⁺.

Example 21:

the compound IV-21:

according to the procedure for the synthesis of compound IV-1, (0.352g, 56%).¹H-NMR(400MHz,DMSO-d₆): δ8.18(d,J＝8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J＝15.9Hz, 1H),7.00(s,1H),6.86-6.72(m,2H),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.6Hz,2H), 3.28(s,3H),3.06(s,3H).MS(ESI):m/z Calcd.For C₂₃H₂₃N₄O₂ 387.1821；found 387.1820,[M+H]⁺.

Example 22:

compound IV-22:

according to the procedure for the synthesis of compound IV-1, (0.252g, 32%).¹H-NMR(400MHz,DMSO-d₆): δ8.16(d,J＝8.5Hz,2H),7.93(t,J＝4.4Hz,2H),7.90(d,J＝6.1Hz,1H),7.31(t,J ＝8.9Hz,2H),7.18(d,J＝15.9Hz,1H),6.95(s,1H),6.83-6.72(m,2H),3.59(t,J＝ 5.9Hz,2H),3.51(t,J＝5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m/z Calcd. For C₂₂H₂₃FN₃O₂ 380.1774；found 380.1775,[M+H]⁺.

Example 23:

compound 13:

according to the procedure for the synthesis of compound IV-1, (0.252g, 32%).¹H-NMR(400MHz,DMSO-d₆): δ8.43(d,J＝1.8Hz,1H),8.16(t,J＝8.5Hz,3H),7.93(d,J＝15.9Hz,1H),7.85(dt, J＝7.8,1.4Hz,1H),7.66(t,J＝7.8Hz,1H),7.40(d,J＝15.9Hz,1H),6.98(s,1H), 6.86-6.71(m,2H),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.28(s,3H),3.06 (s,3H).MS(ESI):m/z Calcd.For C₂₃H₂₃N₄O₂ 387.2；found 387.2,[M+H]⁺.

Compound 14:

adding compound 13(0.774g,2.0mmol) and potassium carbonate (0.276g,2.0mmol) into 250ml round bottom flask, adding 100ml acetonitrile to dissolve, adding 2ml bromopropylene under Ar protection condition, heating in oil bath under reflux, detecting by TLC, and finishing reactionFiltration, removal of the solvent under reduced pressure and column chromatography of the residue yielded Compound 18 (0.673g, 79%).¹H-NMR(400MHz,DMSO-d₆):δ8.43(d,J＝1.8Hz,1H),8.16(t, J＝8.5Hz,3H),7.93(d,J＝15.9Hz,1H),7.85(dt,J＝7.8,1.4Hz,1H),7.66(t,J＝ 7.8Hz,1H),7.40(d,J＝15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.81(s,2H), 3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.41(s,3H),3.06(s,3H).MS(ESI): m/z Calcd.For C₂₆H₂₇N₄O₂ 427.2；found 427.2,[M+H]⁺.

Compound IV-14:

according to the procedure for the synthesis of compound IV-7, (0.152g, 72%).¹H-NMR(400MHz,DMSO-d₆): δ8.43(d,J＝1.8Hz,1H),8.16(t,J＝8.5Hz,3H),7.93(d,J＝15.9Hz,1H),7.85(dt, J＝7.8,1.4Hz,1H),7.66(t,J＝7.8Hz,1H),7.40(d,J＝15.9Hz,1H),6.98(s,1H), 6.86-6.71(m,2H),3.81(s,2H),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.41 (s,3H),3.06(s,3H).MS(ESI):m/z Calcd.For C₂₆H₂₇N₄OS 443.1906；found 443.1905,[M+H]⁺.

Example 24:

compound 15:

following the synthetic procedure for compound 5, (0.692g, 82%).¹H NMR(400MHz,CD₃OD) δ＝8.02(d,J＝2.4Hz,1H),7.44(dd,J＝8.7Hz,J＝2.4Hz,1H),7.09(s,1H),6.51 (d,J＝8.7Hz,1H),3.56(t,J HH＝7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s, 3H),0.95(t,J＝7.6Hz,3H).MS(ESI):m/z Calcd.For C₁₅H₂₁N₄O 273.2；found 273.2,[M+H]⁺.

Compound 16:

according to the procedure for the synthesis of compound IV-1, (0.452g, 34%).¹H NMR(400MHz,CD₃OD) δ＝8.02(d,J＝2.4Hz,1H),7.95(m,2H),7.68-7.50(m,1H),7.44(dd,J＝8.7Hz,J＝ 2.4Hz,1H),7.34-7.06(m,2H),7.09(s,1H),7.00(d,J＝15.7Hz,1H),6.51(d,J＝8.7 Hz,1H),3.56(t,J HH＝7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s,3H),0.95 (t,J＝7.6Hz,3H).MS(ESI):m/z Calcd.For C₂₂H₂₄FN₄O 379.2；found 379.2, [M+H]⁺.

The compound IV-24:

according to the procedure for the synthesis of compound IV-7, (0.152g, 72%).¹H NMR(400MHz,CD₃OD) δ＝8.02(d,J＝2.4Hz,1H),7.95(m,2H),7.68-7.50(m,1H),7.44(dd,J＝8.7Hz,J＝ 2.4Hz,1H),7.34-7.06(m,2H),7.09(s,1H),7.00(d,J＝15.7Hz,1H),6.51(d,J＝8.7 Hz,1H),3.56(t,J HH＝7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s,3H),0.95 (t,J＝7.6Hz,3H).HR-MS(ESI):m/z Calcd.For C₂₂H₂₄FN₄S 395.1706；found 395.1705,[M+H]⁺.

Example 25:

compound 17:

following the synthetic procedure for compound 5, (0.892g, 80%).¹H NMR(400MHz,CD₃OD) δ8.41(d,J＝1.5Hz,1H),7.97(d,J＝1.5Hz,1H),7.31(s,1H),5.86(s,1H),3.46 (t,J＝6.6Hz,4H),3.15(s,3H),2.32(s,3H),1.61(m,4H),1.32(m,12H),0.89(t,6 H).MS(ESI):m/z Calcd.For C₂₂H₃₆N₅O 386.3；found 386.3,[M+H]⁺.

Compound IV-25:

according to the procedure for the synthesis of compound IV-1, (0.452g, 34%).¹H NMR(400MHz,CD₃OD) δ8.41(d,J＝1.5Hz,1H),7.97(d,J＝1.5Hz,1H),7.85(d,J＝15.7Hz,1H),7.49(m, 1H),7.40-7.22(m,3H),7.31(s,1H),7.01(d,J＝15.7Hz,1H),5.86(s,1H),3.46 (t,J＝6.6Hz,4H),3.15(s,3H),2.32(s,3H),1.61(m,4H),1.32(m,12H),0.89(t,6 H).MS(ESI):m/z Calcd.For C₂₉H₃₉ClN₅O 508.2843；found 508.2842,[M+H]⁺.

Example 26:

compound 18:

following the synthetic procedure for compound 5, (0.812g, 81%).¹H NMR(400MHz,CDCl₃)δ 7.93(s,2H),7.31(s,1H),4.24(t,J＝6.8Hz,2H),3.44(s,3H)，2.82(s,2H),2.43(s,3H). MS(ESI):m/z Calcd.For C₁₄H₁₇N₆O 285.1；found 285.1,[M+H]⁺.

Compound IV-25:

according to the procedure for the synthesis of compound IV-1, (0.312g, 26%).¹H NMR(400MHz,CDCl₃) δ＝8.02(d,J＝15.7Hz,1H),7.93(m,3H),7.68-7.50(m,1H),7.31(s,1H),7.24-7.06 (m,2H),7.01(d,J＝15.7Hz,1H),4.24(t,J＝6.8Hz,2H),3.44(s,3H)，2.82(s,2H), 2.43(s,3H).MS(ESI):m/z Calcd.For C₂₁H₂₀lN₆O 499.0743；found 499.0742, [M+H]⁺.

Example 27:

compound 19:

according to the synthetic procedure for compound 5, (0.932g, 85%).¹H NMR(400MHz,CDCl₃)δ＝7.59 (s,2H),6.71(s,1H),3.24(t,J＝5.6Hz,4H),3.06(t,J＝8.4Hz,2H),2.67(t,J＝6.2 Hz,4H),2.29(s,3H),1.86–1.82(m,4H),1.46(m,2H),1.21(t,J＝8.4Hz,3H). MS(ESI):m/z Calcd.For C₂₀H₂₅N₃O 323.2；found 324.2,[M+H]⁺.

The compound IV-27:

according to the synthetic procedure for compound 5, (0.932g, 85%).¹H NMR(400MHz,CDCl₃)δ＝ 8.31(dd,J＝8.3Hz,J＝2.1Hz,1H),8.16(s,1H),7.94(d,J＝8.3Hz,1H),7.95(d,J＝ 15.7Hz,1H),7.59(s,2H),7.01(d,J＝15.7Hz,1H),6.71(s,1H),3.24(t,J＝5.6Hz, 4H),3.06(t,J＝8.4Hz,2H),2.67(t,J＝6.2Hz,4H),2.29(s,3H),1.86–1.82(m, 4H),1.46(m,2H),1.21(s,J＝8.4Hz,3H).MS(ESI):m/z Calcd.For C₂₈H₂₈N₄O₂ 436.2263；found 437.2340,[M+H]⁺.

Example 28:

compound 20:

compound iv-21 (0.792g,2.0mmol), p-toluenesulfonyl chloride (0.476g,2.5mmol) and triethylamine (0.303g,3.0mmol) were dissolved in a 250ml round bottom flask, 100ml of dried dichloromethane was added to dissolve, the mixture was stirred at room temperature under the protection of Ar, after completion of the TLC detection reaction, the system was poured into 200ml of water, dichloromethane was extracted three times, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, the solution was removed under reduced pressure, and the residue was subjected to column chromatography to obtain compound 27(0.822g, 76%).¹H-NMR(400MHz,DMSO-d₆):δ8.18(d, J＝8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J＝15.9Hz,1H),7.18 (d,J＝8.2Hz,2H),7.00(s,1H),6.86-6.72(m,2H),6.47(d,J＝8.2Hz,2H),4.06 (t,J＝6.1Hz,2H),3.49(t,J＝6.1Hz,2H),3.28(s,3H),2.77(s,3H),2.31(s,3H). MS(ESI):m/z Calcd.For C₃₀H₂₉N₄O₄S 541.2；found 541.2,[M+H]⁺.

Compound IV-28:

compound 20(0.541g,1.0mmol) and sodium sulfite (0.630g,5.0mmol) are placed in a 100ml round bottom flask, 20ml of anhydrous DMF is added, the mixture is heated in a 50 ℃ oil bath under the protection of Ar for reaction for 24h, after the reaction is detected by TLC, the solvent is removed under reduced pressure, and the residue is separated by reversed phase chromatography to obtain the product (0.301g, 60%).¹H-NMR(400MHz,DMSO-d₆):δ8.18(d,J＝8.5Hz,2H),8.08-8.02(m,2H), 7.98-7.90(m,3H),7.40(d,J＝15.9Hz,1H),7.00(s,1H),6.86-6.72(m,2H),3.85(m, 4H),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.6Hz,2H),3.28(s,3H),3.16(m,4H),2.77 (s,3H).MS(ESI):m/z Calcd.For C₂₃H₂₁N₄O₄S 499.1289；found 499.1288,[M-H]^-.

Example 29:

the compound IV-29:

compound IV-21 (0.386g,1.0mmol), compound 31(0.265g,1.2mmol), EDCI (0.382g,2.0mmol), DMAP (0.183g,1.5mmol) were dissolved in a 100mL round-bottomed flask with 30mL anhydrous DMF, stirred under Ar protection at room temperature, TLC checked for completion of the reaction, the solvent was removed under reduced pressure, and the residue was isolated by column chromatography to give product (0.490g, 83%).¹H-NMR(400MHz,DMSO-d₆): δ8.18(d,J＝8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J＝15.9Hz, 1H),7.00(s,1H),6.86-6.72(m,2H),4.17(s,2H),3.75(s,3H),3.6-3.7(m,10H), 3.57(m,2H),3.52(t,J＝5.6Hz,2H),3.38(s,3H),3.28(s,3H),3.06(s,3H). MS(ESI):m/z Calcd.For C₃₂H₃₉N₄O₇S 591.2819；found 591.2820,[M+H]⁺.

Example 30:

compound 22:

following the synthetic procedure for compound 5, (0.612g, 87%).¹H NMR(400MHz,CDCl₃)δ 8.15(d,J＝9.0Hz,2H),8.14(d,J＝9.0Hz,2H),7.21(s,1H),4.23(s,2H),4.11(s,3 H),3.38(t,J＝6.4Hz,2H),3.01(s,3H),2.92(t,J＝6.4Hz,2H),2.41(s,3H). MS(ESI):m/z Calcd.For C₁₈H₂₅N₄O₃ 345.2；found 345.2,[M+H]⁺.

A compound IV-30:

according to the procedure for the synthesis of compound IV-1, (0.422g, 36%).¹H NMR(400MHz,CDCl₃) δ8.15(d,J＝9.0Hz,2H),8.14(d,J＝9.0Hz,2H),7.95(d,J＝16.0Hz,1H),7.82(d, J＝8.4Hz,2H),7.32(d,J＝8.4Hz,2H),7.21(s,1H),7.01(d,J＝16.0Hz,1H),4.23(s, 2H),4.11(s,3H),3.38(t,J＝6.4Hz,2H),3.01(s,3H),2.92(t,J＝6.4Hz,2 H).MS(ESI):m/z Calcd.For C₂₅H₂₈BrN₄O₃ 511.1345；found 511.1344,[M+H]⁺.

Example 31:

compound 23:

following the synthetic procedure for compound 23, (0.912g, 89%).¹H-NMR(400MHz,DMSO-d₆): δ8.17(d,J＝8.6Hz,2H),7.91(d,J＝15.8Hz,1H),7.79(dt,J＝10.6,2.1Hz,1H), 7.66(d,J＝7.8Hz,1H),7.50(td,J＝8.0,6.2Hz,1H),7.34-7.20(m,2H),7.18 (d,J＝8.2Hz,2H),6.97(s,1H),6.84-6.73(m,2H),6.47(d,J＝8.2Hz,2H),4.06 (t,J＝6.1Hz,2H),3.49(t,J＝6.1Hz,2H),3.27(s,3H),3.06(s,3H),2.77(s,3H),2.31 (s,3H).MS(ESI):m/z Calcd.For C₂₉H₂₉FN₃O₄S 534.2；found 534.2,[M+H]⁺.

Compound IV-31:

compound 23(0.534g,1.0mmol) was dissolved in a 100ml round bottom flask with 35ml DMF, NaN3(0.195g,3.0mmol) was added carefully, heated overnight in a 50 ℃ oil bath under Ar protection, the next day the system was cooled to room temperature, poured into 100ml water, extracted three times with DCM, the organic phases were combined, washed twice with saturated brine, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, the solvent was removed under reduced pressure and the residue was used in the next reaction without purification.

The residue was dissolved in 30ml THF, Ph was added₃P (0.524g,2.0mmol), 2ml water, Ar protected at room temperature overnight, the next day the solvent was removed under pressure, and the residue was purified by column chromatography to give the desired product (0.301g, 79%).¹H-NMR(400MHz,DMSO-d₆):δ8.17(d,J＝8.6Hz,2H),7.91(d, J＝15.8Hz,1H),7.79(dt,J＝10.6,2.1Hz,1H),7.66(d,J＝7.8Hz,1H),7.50(td,J＝ 8.0,6.2Hz,1H),7.34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.38(t,J＝6.4 Hz,2H),2.92(t,J＝6.4Hz,2H),3.27(s,3H),3.06(s,3H).MS(ESI):m/z Calcd. For C₂₂H₂₄FN₄O 379.1934；found 379.1935,[M+H]⁺.

Example 32:

compound IV-32:

compound 24(0.534g,1.0mmol) was dissolved in 50ml ethanol in a 100ml round bottom flask, 33% dimethylamine solution was added, heated to reflux in a 90 ℃ oil bath under Ar protection, TLC checked, after completion of the reaction, the system was returned to room temperature, the solvent was removed under reduced pressure, and the desired product (0.276g, 68%) was isolated by column chromatography as residue.¹H-NMR(400MHz,DMSO-d₆):δ8.17(d,J＝8.6Hz,2H),7.91(d,J＝15.8 Hz,1H),7.79(dt,J＝10.6,2.1Hz,1H),7.66(d,J＝7.8Hz,1H),7.50(td,J＝8.0,6.2 Hz,1H),7.34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.47(t,J＝7.6Hz,2H), 2.96(s,3H),2.49(t,J＝7.6Hz,2H),2.31(s,6H).MS(ESI):m/z Calcd.For C₂₄H₂₈FN₄O 407.2247；found 407.2246,[M+H]⁺.

Example 33:

compound 25:

following the synthetic procedure for compound 5, (0.842g, 89%).¹H NMR(400MHz,CDCl₃)δ＝7.97 (d,J＝8.6Hz,1H),7.88(s,1H),6.85(s,1H),6.56(d,J＝8.6Hz,1H),5.40(s,1H), 3.07(s,3H),2.84(s,3H),2.31(s,3H),1.94(s,3H),1.32(s,6H).MS(ESI):m/z Calcd.For C₁₉H₂₄N₃O 310.2；found 310.2,[M+H]⁺.

Compound IV-33:

according to the procedure for the synthesis of compound IV-1, (0.222g, 21%).¹H NMR(400MHz,CDCl₃) δ＝7.97(d,J＝8.6Hz,1H),7.90(d,J＝16.0Hz,1H),7.88(s,1H),7.87(d,J＝4.0Hz, 2H),7.43(d,J＝4.0Hz,2H),7.01(d,J＝16.0Hz,1H),6.85(s,1H),6.56(d,J＝8.6 Hz,1H),5.40(s,1H),3.07(s,3H),2.84(s,3H),1.94(s,3H),1.32(s, 6H).MS(ESI):m/z Calcd.For C₂₇H₂₆N₄O 422.2107；found 423.2186,[M+H]⁺.

Example 34:

compound 26:

following the synthetic procedure for compound 5, (0.732g, 81%).¹H NMR(400MHz,CDCl₃)δ＝7.40 (dd,J＝8.32,1.93Hz,1H),7.29(d,J＝1.89Hz,1H),7.15(s,1H),6.68(d,J＝8.35Hz, 1H),4.23-4.31(m,2H),3.40-3.49(m,2H),3.21(s,3H),3.03(s,3H),2.42(s,3 H).MS(ESI):m/z Calcd.For C₁₅H₁₈N₃O₂ 227.1；found 227.1,[M+H]⁺.

The compound IV-34:

according to the procedure for the synthesis of compound IV-1, (0.222g, 21%).¹H NMR(400MHz,CDCl₃) δ＝7.95(d,J＝16.0Hz,1H),7.87(d,J＝4.0Hz,2H),7.43(d,J＝4.0Hz,2H),7.40 (dd,J＝8.32,1.93Hz,1H),7.29(d,J＝1.89Hz,1H),7.15(s,1H),7.01(d,J＝16.0Hz, 1H),6.68(d,J＝8.35Hz,1H),4.23-4.31(m,2H),3.40-3.49(m,2H),3.03(s,3H), 2.42(s,3H).MS(ESI):m/z Calcd.For C₂₂H₂₀FN₃O₂ 377.1540；found 378.1681, [M+H]⁺.

Example 35:

compound 28:

according to the procedure for the synthesis of Compound IV-1, (0.732g, 39%).¹H NMR(400MHz,CDCl₃) δ8.19(d,J＝8.5Hz,2H),8.07(m,4H),8.04(s,1H),7.94(d,J＝8.3Hz,2H),7.44(d, J＝15.9Hz,1H),7.03(s,1H),3.29(s,3H)..MS(ESI):m/z Calcd.For C₂₀H₁₅N₄O₃ 359.1；found 359.1,[M+H]⁺.

Compound IV-35:

adding compound 28(0.718g,2.0mmol) and stannous chloride (0.758g,4.0mmol) into a 250ml round-bottom flask, adding 100ml of ethyl acetate to dissolve, stirring at room temperature under the protection of Ar, detecting by TLC, after the reaction is finished, pouring the system into 150ml of water, extracting by ethyl acetate for three times, combining organic phases, drying by anhydrous sodium sulfate, excessive, removing the solvent under reduced pressure, and separating and purifying the residue by column chromatography to obtain the target product (0.586g, 89%).¹H NMR(400MHz,CDCl₃)δ8.19(d,J＝8.5Hz,2H),7.97(m,4H),8.04(s, 1H),7.94(d,J＝8.3Hz,2H),7.44(d,J＝15.9Hz,1H),7.03(s,1H),3.29(s,3H). MS(ESI):m/z Calcd.For C₂₀H₁₇N₄O 329.1402；found 329.1403,[M+H]⁺.

Example 36:

compound 29:

following the synthetic procedure for compound 5, (0.756g, 74%).¹H NMR(400MHz,CDCl₃)δ 8.15(1H,s),7.81(2H,m),7.65(1H,d,J＝9.0Hz),7.16(1H,dd,J＝9.0,J＝3.0Hz), 6.95(s,1H),6.88(1H,d,J＝3.0Hz),3.60(t,J＝5.9Hz,2H),3.52(t,J＝5.9Hz,2H),3.28 (s,3H),3.06(s,3H).MS(ESI):m/z Calcd.For C₁₉H₂₁N₃O₂ 323.2；found 324.2,[M+H]⁺.

Compound IV-36:

according to the procedure for the synthesis of compound IV-1, (0.272g, 24%).¹H NMR(400MHz,CDCl₃) δ8.15(1H,s),7.81(2H,m),7.65(1H,d,J＝9.0Hz),7.49(m,1H),7.40-7.22(m,3H), 7.16(1H,dd,J＝9.0,J＝3.0Hz),6.95(s,1H),6.88(1H,d,J＝3.0Hz),3.60(t,J＝5.9 Hz,2H),3.52(t,J＝5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m/z Calcd.For C₂₆H₂₅N₃O₃ 427.1896；found 428.1974,[M+H]⁺.

Example 37:

compound IV-37:

following the synthetic procedure for compound 13, (0.322g, 79%).¹H-NMR(400MHz,DMSO-d₆): δ8.16(d,J＝8.5Hz,2H),7.93(t,J＝4.4Hz,2H),7.90(d,J＝6.1Hz,1H),7.31(t,J＝8.9Hz, 2H),7.18(d,J＝15.9Hz,1H),6.95(s,1H),6.83-6.72(m,2H),4.21(s,2H),3.59(t,J＝5.9Hz, 2H),3.51(t,J＝5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m/z Calcd.For C₂₅H₂₅FN₃O₂418.1931；found 418.1932,[M+H]⁺.

Example 38:

compound 30:

following the synthetic procedure for compound 5, (0.816g, 89%).¹H NMR(400MHz,CDCl₃)δ 9.02(d,1H,J＝2.1Hz),8.59(d,1H,J＝2.1Hz),7.93(d,1H,J＝9.1Hz),7.34(dd, 1H,J＝9.1,2.5Hz),7.21(s,1H),7.00(d,1H,J＝2.5Hz),3.11(s,6H),3.06(s,3H). MS(ESI):m/z Calcd.For C1₇H₁₈N₄O 294.1；found 295.1,[M+H]⁺.

Compound IV-38

According to the synthetic procedure for the compound IV-1, (0).272g，24％)。¹H NMR(400MHz,CDCl₃) δ＝9.02(d,1H,J＝2.1Hz),8.59(d,1H,J＝2.1Hz),7.95(d,J＝16.0Hz,1H), 7.93(d,1H,J＝9.1Hz),7.49(m,1H),7.40-7.22(m,3H),7.34(dd,1H,J＝9.1,2.5 Hz),7.21(s,1H),7.15(d,J＝16.0Hz,1H),7.00(d,1H,J＝2.5Hz),3.11(s,6H), 3.06(s,3H).MS(ESI):m/z Calcd.For C₂₅H₂₁N₅O 407.1821；found 408.1825, [M+H]⁺.

Comparative example 1:

compound IV-39:

according to the procedure for the synthesis of compound IV-1, (0.275g, 75%).¹H NMR(400MHz,DMSO-d₆) δ11.00(s,1H),8.08-8.04(m,2H),8.02(d,J＝15.9Hz,1H),7.92-7.87(m,2H), 7.49-7.45(m,2H),7.26(d,J＝15.9Hz,1H),6.98(s,1H),3.29(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₃F₂N₃O₂339.0951；found 339.0950,[M-H]^-.

Comparative example 2:

compound IV-40:

according to the procedure for the synthesis of compound IV-1, (0.327g, 55%).¹H NMR(400MHz,DMSO-d₆) δ9.70(s,1H),8.05(d,J＝8.9Hz,2H),7.98-7.89(m,1H),7.30(t,J＝6.2Hz,1H), 7.26(d,J＝8.9Hz,1H),7.15(d,J＝15.8Hz,1H),6.97(s,1H),6.87(d,J＝7.5Hz, 1H),3.27(s,3H).MS(ESI):m/z Calcd.For C₁₈H₁₂F₂N₃O₂ 340.0903；found 340.090, [M-H]^-.

Comparative example 3:

compound IV-41:

according to the procedure for the synthesis of compound IV-1, (0.342g, 46%).¹H-NMR(400MHz,DMSO-d₆): δ＝8.21(d,2H,J＝8.8Hz),8.00(d,1H,J＝16Hz),7.85(d,2H,J＝8.0Hz),7.50-7.43(m, 2H),7.42(d,J＝2.6Hz,1H),7.24(s,1H),7.01(s,1H),6.92(d,2H,J＝8.8Hz),3.85 (t,2H,J＝5.6Hz),3.60(t,2H,J＝5.6Hz),3.10(s,3H).MS(ESI):m/z Calcd.For C₂₂H₂₄N₃O₂362.1869；found 362.1868,[M+H]⁺.

Comparative example 4:

compound IV-42:

according to the procedure for the synthesis of compound IV-1, (0.312g, 43%).¹H NMR(400MHz,CDCl₃) δ＝8.15(1H,s),8.00(d,1H,J＝16Hz),7.85(d,2H,J＝8.0Hz),7.81(2H,m),7.65(1H, d,J＝9.0Hz),7.20(s,1H),7.50-7.43(m,3H),7.42(d,1H,J＝16Hz),7.16(1H,dd,J＝ 9.0,J＝3.0Hz),6.88(1H,d,J＝3.0Hz),3.65(t,J＝7.2Hz,2H),3.45(t,J＝7.2Hz,2 H),3.35(s,3H)3.03(s,3H).MS(ESI):m/z Calcd.For C₂₆H₂₆N₃O₂ 412.2025；found 412.2026,[M+H]⁺.

Comparative example 5:

compound IV-43:

according to the procedure for the synthesis of compound IV-1, (0.412g, 46%).¹H-NMR(400MHz,DMSO-d₆): δ＝8.72(s,2H),8.00(d,1H,J＝16Hz),7.50-7.43(m,2H),7.42(d,J＝2.6Hz, 1H),7.24(s,1H),7.01(s,1H),6.92(d,2H,J＝8.8Hz),3.75(t,J＝6.8Hz,2H),3.60(t,2 H,J＝6.8Hz),3.05(s,3H).MS(ESI):m/z Calcd.For C₂₁H₂₁lN₆O 373.1777；found 373.1778,[M+H]⁺.

Comparative example 6:

according to the procedure for the synthesis of compound IV-1, (0.192g, 33%).¹H NMR(400MHz,DMSO-d₆) δ7.96-7.99(m,4H),7.33-7.37(m,3H),6.98(s,1H),3.24(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₂F₄N₂O₂ 376.0835；found 376.0830,[M-H]^-.

Comparative example 7:

according to the procedure for the synthesis of compound IV-1, (0.192g, 33%).¹H NMR(400MHz,DMSO-d₆) δ7.96-7.99(m,4H),7.33-7.37(m,3H),6.98(s,1H),3.24(s,3H).MS(ESI):m/z Calcd.For C₁₉H₁₂F₄N₂O₂ 376.0835；found 376.0830,[M-H]^-.

Comparative example 8:

according to the synthetic procedure of the compound IV-1,¹H NMR(400MHz,DMSO-d₆)δppm 10.70(s, 1H),8.35(s,2H),8.15(s,2H),7.82(d,J＝15.8Hz,1H),7.22(d,J＝15.9Hz,1H),6.95 (s,1H),3.27(s,3H)；HRMS(ESI)m/z:546.8647found(calcd for C₁₉H₁₂Br₂Cl₂N₂O₃, [M+H]⁺546.8644).

comparative example 9:

according to the synthetic procedure of the compound IV-1,¹H NMR(400MHz,DMSO-d₆)δppm 10.38(s, 1H),8.18(d,J＝2.0Hz,2H),8.12(s,2H),7.81(d,J＝4.8Hz,1H),7.18(d,J＝4.8Hz, 1H),6.93(s,1H),6.78(d,J＝2.0Hz,2H),3.25(s,3H),3.04(s,6H)；HRMS(ESI)m/z: 505.9855found(calcd for C₂₁H₁₉Br₂N₃O₂,[M+H]⁺505.9896).

comparative example 10:

according to the synthetic procedure of the compound IV-1,¹H NMR(400MHz,DMSO-d₆)δppm 10.38(s， 1H),8.16(d,J＝2.0Hz,2H),8.11(s,2H),7.80(d,J＝4.8Hz,1H),7.18(d,J＝4.8Hz, 1H),6.91(s,1H),6.74(d,J＝2.0Hz,2H),3.44(d,J＝4.8Hz,2H),3.25(s,3H),1.14(t, J＝4.8Hz,6H)；HRMS(ESI)m/z:534.0154found(calcd for C₂₃H₂₃Br₂N₃O₂,[M+H]⁺ 534.0209).

comparative example 11:

according to the procedure for the synthesis of compound IV-1, (0.156g, 18%).¹H NMR(400MHz,CD₃OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J＝15.7Hz,1H),7.76(d,J＝8.5Hz,2H), 7.01(d,J＝15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),4.12(s,3H),3.62(s,3H), 1.50(s,9H).HR-MS(ESI):m/z Calcd.For C₂₄H₂₁F₃N₂O₄ 457.5381；found457.5380, [M-H]^-.

Comparative example 12:

synthesized according to the published methods (JACS,2018,140,7381 and 7384.).¹H NMR(400MHz, CD₃OD)δ8.17(d,J＝8.3Hz,2H),7.79(d,J＝15.6Hz,1H),7.55(d,J＝8.8Hz,2H), 6.84(s,1H),6.80(dd,J＝9.9,2.8Hz,2H),6.75(dd,J＝8.8,5.6Hz,2H),6.66(d, J＝15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H), 3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m/z Calcd.For C₃₇H₄₄ClF₃N₄O₆ 732.2901；found 733.2980,[M-H]^-.

Comparative example 13:

synthesized according to the published methods (JACS,2018,140,7381 and 7384.).¹H NMR(400MHz, CD₃OD)δ8.17(d,J＝8.3Hz,2H),7.79(d,J＝15.6Hz,1H),7.55(d,J＝8.8Hz,2H), 6.84(s,1H),6.80(dd,J＝9.9,2.8Hz,2H),6.75(dd,J＝8.8,5.6Hz,2H),6.66(d, J＝15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H), 3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m/z Calcd.For C₃₈H₄₄ClF₃N₅O₆ 739.2948；found 740.3026,[M+H]^-.

Test example 1:

the fluorescent dyes IV-1-IV-38 (molecular rotors) prepared in examples 1-38 were each dissolved in dimethylsulpholane to give a concentration of 1X 10^-2M mother liquor, adding each mother liquor into glycerol and methanol respectively, mixing uniformly, each prepared final concentration is 1 × 10^-5According to the difference of the fluorescent dyes, the solution of M is used for sequentially detecting the fluorescence emission spectra of the fluorescent dyes under the same condition by using the maximum excitation wavelength of each fluorescent dye, and the result is shown in Table 1, which indicates that the fluorescent dyes have sensitive viscosity change response.

TABLE 1

Test example 2:

adding molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 into the mixed solution of diethanol-glycerol to obtain final concentration of 1 × 10^-5The solution of M is excited at 480nm, the fluorescence emission spectra under different viscosity conditions are shown in figures 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12, the fluorescence intensity of the molecular rotor with the same concentration is gradually increased under different viscosity conditions, the fluorescence intensity of the molecular rotor is enhanced along with the increase of the environmental viscosity, and the molecular rotor is proved to be sensitive to the viscosity reaction and is a molecular rotor.

Test example 3:

molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8; IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22; IV-42 and IV-36; IV-45, IV-46 and IV-3; IV-47, IV-48 and IV-20; IV-49, IV-50 and IV-5; IV-51 and IV-1; dissolved in DMSO and configured at 1X 10^-3Adding the mother solution of M into PBS solution to obtain final concentration of 1 × 10^-6M, respectively, were excited at the maximum excitation wavelength of each compound, their fluorescence intensity in PBS was measured, and each sample was normalized to the maximum fluorescence of each group as 100, as shown in FIGS. 13, 14, 15, 16, 17, 18, and 19, respectively. The results of fig. 13, 14, and 15 show that: compared with a molecular rotor which is not substituted on an aromatic ring on an electron withdrawing group, the molecular rotor which is substituted by hydroxyl, cyano, fluorine atom, chlorine atom, bromine atom and iodine atom on the aromatic ring on the electron withdrawing group has lower background fluorescence; the results of fig. 16 and 17 show that a single substituted molecular rotor has relatively low background fluorescence compared to a molecular rotor with multiple substitutions on the aromatic ring on the electron withdrawing group, probably because the multiple substitutions change the electron cloud distribution of the aromatic structure on the electron withdrawing group, resulting in an increase in fluorescence background; the results in FIGS. 18 and 19 show that R is₁Background fluorescence when substituted by simple alkyl groupsLower, probably R₁The hetero atoms (such as oxygen atoms and nitrogen atoms) on the large-volume or modified alkyl groups have weak interaction with the aromatic ring on the electron withdrawing group, so that the non-radiative energy-consuming movements such as double bond rotation at the electron withdrawing group are inhibited, and the fluorescence background of the compound is increased.

Test example 4:

compounds IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 specifically bind to RNA aptamers (UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUU GUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGC CGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCGGCGG ACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA), the bound compounds are significantly activated for fluorescence and emit bright fluorescence under excitation of excitation light of appropriate wavelength, the optical properties after binding are shown in Table 2, compounds can also bind to the aptamers inside the cells, and the cells expressing the RNA aptamers have bright fluorescence, as shown in FIG. 20A; cells that do not express the RNA aptamer are non-fluorescent, as shown in FIG. 20B, indicating that the series of dyes can be used for labeling nucleic acids.

TABLE 2

Note: the fluorescence quantum yield was measured by a relative method using rhodamine 6G as a standard (QY ═ 0.94).

Test example 5:

using a stable cell line (293T/17) continuously expressing the cytoskeletal protein of RNA aptamer (AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAU GUGCAAGGCCGGCUUCGCGGGCGACGAUGCCCCCCGGGCCGUCUUCCCC UCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAUGGUGGGCAUGGGU CAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUC CUCACCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACG ACAUGGAGAAAAUCUGGCACCACACCUUCUACAAUGAGCUGCGUGUGG CUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUGAACCCCAA GGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACC CCAGCCAUGUACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUG GCCGUACCACUGGCAUCGUGAUGGACUCCGGUGACGGGGUCACCCACAC UGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCGUCUG GACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCG AGCGCGGCUACAGCUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGA CAUUAAGGAGAAGCUGUGCUACGUCGCCCUGGACUUCGAGCAAGAGAU GGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCCU GACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGG CACUCUUCCAGCCUUCCUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGA AACUACCUUCAACUCCAUCAUGAAGUGUGACGUGGACAUCCGCAAAGA CCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGC AUUGCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAA UGAAGAUCAAGAUCAUUGCUCCUCCUGAGCGCAAGUACUCCGUGUGGA UCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAGCAGAUGUGGAU CAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAA UGCUUCUAGCACUCGCUAGAGCAUGGUUAAGCUUGGAAGAUUGUAAAC ACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAG AUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGG ACACUUCCGGCGGACACUUCC) -labeled mRNA and control cells (293T/17), after they had grown to 90% confluency in the conventional mammalian cell culture conditions (37 ℃, 5% carbon dioxide, 100% relative humidity), the cells were digested, centrifuged at 800rpm, and resuspended in PBS containing 0.2. mu.M of IV-21 and IV-41 molecules and incubated for 5 minutes for flow assay, as seen (FIG. 21), the IV-21 molecules specifically labeled ACTB mRNA in the cell line expressing the target RNA, with no significant background fluorescence (21A), whereas the background fluorescence of the IV-41 molecule is higher than that of IV-21, it is impossible to clearly distinguish whether ACTB is expressed (21B).

Sequence listing

<110> Nanying (Shanghai) Biotechnology Ltd

<120> fluorescent dye and preparation method and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 2

<211> 3

<212> RNA

<213> Artificial sequence

<220>

<223> UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA

<220>

<223> AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUGUGCAAGGCCGGCUUCGCGGGCGACGAUGCCCCCCGGGCCGUCUUCCCCUCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAUGGUGGGCAUGGGUCAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCCUCACCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGACAUGGAGAAAAUCUGGCACCACACCUUCUACAAUGAGCUGCGUGUGGCUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUGAACCCCAAGGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCCCAGCCAUGUACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGGCCGUACCACUGGCAUCGUGAUGGACUCCGGUGACGGGGUCACCCACACUGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCGUCUGGACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGAGCGCGGCUACAGCUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGACAUUAAGGAGAAGCUGUGCUACGUCGCCCUGGACUUCGAGCAAGAGAUGGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCCUGACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGCACUCUUCCAGCCUUCCUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAAACUACCUUCAACUCCAUCAUGAAGUGUGACGUGGACAUCCGCAAAGACCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAUUGCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUGAAGAUCAAGAUCAUUGCUCCUCCUGAGCGCAAGUACUCCGUGUGGAUCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAGCAGAUGUGGAUCAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUGCUUCUAGCACUCGCUAGAGCAUGGUUAAGCUUGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCC

<400> 2