Gene therapy DNA vector and application thereof

文档序号：108182 发布日期：2021-10-15 浏览：20次中文

阅读说明：本技术 基因疗法dna载体及其应用 (Gene therapy DNA vector and application thereof ) 是由 N.萨韦利瓦于 2019-12-20 设计创作，主要内容包括：本发明涉及基因工程,并且可以在生物技术、医学和农业中用于制造基因疗法产品。构建携带治疗性基因的基于基因疗法DNA载体VTvaf17的基因疗法DNA载体,以提高人和动物中该治疗性基因的表达水平,所述治疗性基因选自KRT5、KRT14、LAMB3、和COL7A1基因的组,其中基因疗法DNA载体VTvaf17-KRT5、或VTvaf17-KRT14、或VTvaf17-LAMB3、或VTvaf17-COL7A1分别具有核苷酸序列SEQ ID NO.1、或SEQ ID NO.2、或SEQ ID NO.3、或SEQ ID NO.4。基因疗法DNA不包含病毒起源的核苷酸序列和抗生素抗性基因,这保证其在人和动物中基因疗法的安全使用。还提供了获得特定载体的方法、载体的用途、携带特定载体的大肠杆菌菌株以及工业上生产特定载体的方法。(The present invention relates to genetic engineering and can be used in biotechnology, medicine and agriculture for the manufacture of gene therapy products. Constructing a gene therapy DNA vector carrying a therapeutic gene based on a gene therapy DNA vector VTvaf17 to improve the expression level of the therapeutic gene in humans and animals, wherein the therapeutic gene is selected from the group of KRT5, KRT14, LAMB3 and COL7A1 genes, wherein the gene therapy DNA vector VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 has the nucleotide sequence SEQ ID NO.1, or SEQ ID NO.2, or SEQ ID NO.3, or SEQ ID NO.4, respectively. Gene therapy DNA does not contain nucleotide sequences of viral origin and antibiotic resistance genes, which ensures its safe use in gene therapy in humans and animals. Also provided are methods for obtaining the specific vectors, uses of the vectors, E.coli strains harboring the specific vectors, and methods for industrially producing the specific vectors.)

1. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for the treatment of diseases related to structural disorders of the skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies, including epidermolysis bullosa, dow-deguss's disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-jadasssohn syndrome and brown enamel, wherein said gene therapy DNA vector has the coding region of a KRT5 therapeutic gene cloned into gene therapy DNA vector VTvaf17, yielding 4929bp gene therapy DNA vector VTvaf17-KRT5 having the nucleotide sequence SEQ ID No. 1.

2. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for the treatment of diseases related to structural disorganization of skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-de-gossypii, Oberst-Lehn-haus pigmentary dermatosis, Naegeli-franciscetti-Jadassohn syndrome and brown enamel, wherein said gene therapy DNA vector has the coding region of a KRT14 therapeutic gene cloned into gene therapy DNA vector VTvaf17, yielding 4575bp gene therapy DNA vector VTvaf17-KRT14 having the nucleotide sequence SEQ ID No. 2.

3. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for the treatment of diseases related to structural disorganization of the skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-deguss's disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-jadasssohn syndrome and brown enamel, wherein said gene therapy DNA vector has the coding region of the LAMB3 therapeutic gene cloned into gene therapy DNA vector VTvaf17, yielding gene therapy DNA vector VTvaf17-LAMB3 of 6674bp with the nucleotide sequence SEQ ID No. 3.

4. Gene therapy DNA vector based on gene therapy DNA vector VTvaf17 for the treatment of diseases related to structural disorganization of the skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-deguss's disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-jadasssohn syndrome and brown enamel, wherein said gene therapy DNA vector has the coding region of the COL7a1 therapeutic gene cloned into gene therapy DNA vector VTvaf17, resulting in the 11990bp gene therapy DNA vector VTvaf17-COL7a1 having the nucleotide sequence SEQ ID No. 4.

5. The gene therapy DNA vector of claim 1,2,3 or 4 based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 or COL7A1 therapeutic genes, said gene therapy DNA vector being unique due to the fact that each constructed gene therapy DNA vector: the VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7a1 of claim 1,2,3 or 4 has the ability to efficiently penetrate human and animal cells and express KRT5, or KRT14, or LAMB3, or COL7a1 therapeutic genes cloned therein due to the limited size of the VTvaf17 vector portion of no more than 3200 bp.

6. The gene therapy DNA vector of claim 1,2,3 or 4 based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 or COL7A1 therapeutic genes, said gene therapy DNA vector being unique due to the fact that each constructed gene therapy DNA vector: the VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7a1 of claims 1,2,3 or 4 using as structural elements a nucleotide sequence that is not an antibiotic resistance gene, a viral gene or a viral genome regulatory element, thereby ensuring its safety for gene therapy in humans and animals.

7. Method for the production of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 and COL7a1 therapeutic genes according to claims 1,2,3 or 4, said method involving obtaining each of the gene therapy DNA vectors as follows: VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A 1: cloning the coding region of KRT5, or KRT14, or LAMB3, or COL7a1 therapeutic gene according to claim 1,2,3 or 4 into a gene therapy DNA vector VTvaf17 and obtaining a gene therapy DNA vector VTvaf17-KRT5, SEQ ID No.1, or VTvaf17-KRT14, SEQ ID No.2, or VTvaf17-LAMB3, SEQ ID No.3, or VTvaf17-COL7a1, SEQ ID No.4, respectively, wherein the coding region of the KRT5, or KRT14, or LAMB3 or COL7a1 therapeutic gene is obtained by: by isolating total RNA from a human biological tissue sample, then carrying out reverse transcription reaction and PCR amplification using the obtained oligonucleotides, and cleaving the amplification product by means of corresponding restriction enzymes, wherein the cloning of the gene therapy DNA vector VTvaf17 is carried out by means of BamHII and HindIII, or SalI and EcoRI restriction sites, wherein the selection is carried out in the absence of antibiotics,

wherein the following oligonucleotides generated for this purpose were used in the reverse transcription reaction and PCR amplification during the gene therapy DNA vector VTvaf17-KRT5, SEQ ID No.1 production:

KRT5_FTTTGGATCCACCATGTCTCGCCAGTCAAGTGTGTCCTTC，

KRT5_RAATAAGCTTCTAGCTCTTGAAGCTCTTCCGGGAGG，

and cleavage of the amplified product by BamHII and HindIII restriction enzymes and cloning of the coding region of KRT5 gene into gene therapy DNA vector VTvaf17,

KRT14_FTTTGGATCCACCATGACCACCTGCAGCCGCCAG，

KRT14_RAATAAGCTTTCAGTTCTTGGTGCGAAGGACCTGC，

and cleavage of the amplified product by BamHII and HindIII restriction enzymes and cloning of the coding region of KRT14 gene into gene therapy DNA vector VTvaf17,

LAMB3_FTTAGTCGACCACCATGAGACCATTCTTCCTCTTG，

LAMB3_RATAGAATTCACTTGCAGGTGGCATAGTAGAG，

and cleavage of the amplified product by SalI and EcoRI restriction enzymes and cloning of the coding region of the LAMB3 gene into the gene therapy DNA vector VTvaf17,

COL7A1_FATCGTCGACCACCATGACGCTGCGGCTTCTGGT，

COL7A1_R ATAGAATTCAGTCCTGGGCAGTACCTGTC，

and cleavage of the amplified product by SalI and EcoRI restriction enzymes and cloning of the coding region of COL7A1 gene into gene therapy DNA vector VTvaf 17.

8. Use of a gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 and COL7A1 therapeutic genes according to claim 1,2,3 or 4 for the treatment of diseases associated with structural dysregulation of skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies, including epidermolysis bullosa, Dow-Drogos-disease, Obert-Lehn-Hauss pigmentary dermatosis, Naegeli-France schetti-Jadassohn syndrome and brown enamel, involving a method of treating a patient with a therapeutic gene carrying gene based on gene therapy DNA vector VTvaf17 selected from the group of constructed gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvaf17, or a selected number of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 for treating a patient with a therapeutic gene carrying gene therapy or organ tissue therapy DNA vector transfected with an animal tissue and organ therapy DNA vector A cell; and/or injecting autologous cells of the patient or animal transfected with the gene therapy DNA vector carrying the therapeutic gene selected from the gene therapy DNA vector based on the constructed gene therapy DNA vector carrying the therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying the therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal; and/or injecting a gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 selected from the group of constructed gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal, or a combination of the indicated methods.

9. A method for producing a strain for constructing the gene therapy DNA vector according to claim 1,2,3 or 4 for treating diseases associated with structural architecture disorder of skin, hair and nails, disorder of keratinocyte attachment and epidermal-sublayer attachment, disorder of wound healing, connective tissue pathology including epidermolysis bullosa, Dow-Drogos disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-France schetti-Jadassohn syndrome and brown enamel, the method involving preparing electrocompetent cells of E.coli strain SCS110-AF and electroporating these cells with gene therapy DNA vector VTvaf17-KRT5, or gene therapy DNA vector VTvaf17-KRT14, or gene therapy DNA vector VTvaf17-LAMB3, or gene therapy DNA vector VTvaf17-COL7A1, thereafter, the cells were poured into an agar plate (petri dish) containing a selective medium containing yeast extract, peptone, 6% sucrose and 10. mu.g/ml chloramphenicol, and as a result, Escherichia coli strain SCS110-AF/VTvaf17-KRT5, or Escherichia coli strain SCS110-AF/VTvaf17-KRT14, or Escherichia coli strain SCS110-AF/VTvaf17-LAMB3, or Escherichia coli strain SCS110-AF/VTvaf17-COL7A1 was obtained.

10. Coli strain SCS110-AF/VTvaf17-KRT5 obtained according to claim 9, carrying gene therapy DNA vector VTvaf17-KRT5 for its production, allowing antibiotic-free selection during the production of gene therapy DNA vector for the treatment of diseases related to structural architecture disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal and sub-layer junction, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-deguss disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-Jadassohn syndrome and brown enamel.

11. Coli strain SCS110-AF/VTvaf17-KRT14 obtained according to claim 9, carrying gene therapy DNA vector VTvaf17-KRT14 for its production, allowing antibiotic-free selection during the production of gene therapy DNA vector for the treatment of diseases related to structural architecture disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal and sub-layer junction, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-deguss disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-Jadassohn syndrome and brown enamel.

12. Coli strain SCS110-AF/VTvaf17-LAMB3 obtained according to claim 9, carrying gene therapy DNA vector VTvaf17-LAMB3 for its production, allowing antibiotic-free selection during the production of gene therapy DNA vector for the treatment of diseases related to structural architecture disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal and sub-layer connectivity, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-deguss disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-Jadassohn syndrome and brown enamel.

13. Escherichia coli strain SCS110-AF/VTvaf17-COL7a1 obtained according to claim 9, carrying gene therapy DNA vector VTvaf17-COL7a1 for its production, allowing antibiotic-free selection during gene therapy DNA vector production, for the treatment of diseases associated with structural architecture disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal and sub-layer connectivity, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, dow-degauss disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-francischetett-ti Jadassohn syndrome and brown enamel.

14. A method for the production of a gene therapy DNA vector carrying a KRT5, or KRT14, or LAMB3, or COL7A1 therapeutic gene based on a gene therapy DNA vector VTvaf17 according to claim 1,2,3 or 4 on an industrial scale, the gene therapy DNA vector is useful for treating diseases associated with structural disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal-sub-layer attachment, disorders of wound healing, connective tissue pathologies, including epidermolysis bullosa, Dow-Degos' disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-France schetti-Jadassohn syndrome and brown enamel, the method involves generating a gene therapy DNA vector VTvaf17-KRT5, or a gene therapy DNA vector VTvaf17-KRT14, or a gene therapy DNA vector VTvaf17-LAMB3, or a gene therapy DNA vector VTvaf17-COL7a1 as follows: the culture flasks containing the prepared medium were inoculated by seed culture selected from the group consisting of E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1, and the cell culture was then shake-incubated in an incubator and transferred to an industrial fermentor, then cultured to stationary phase, then fractions containing the target DNA product were extracted, multi-stage filtered, and purified by chromatography.

Technical Field

The present invention relates to genetic engineering and can be used in biotechnology, medicine and agriculture for the manufacture of gene therapy products.

Background

Gene therapy is an innovative approach in medicine aimed at treating genetic and acquired diseases by delivering new genetic material into the cells of patients to compensate or suppress the function of mutated genes and/or to treat genetic disorders (disorders). The end product of gene expression may be an RNA molecule or a protein molecule. However, most physiological processes in vivo are associated with the functional activity of protein molecules, while RNA molecules are either intermediates in protein synthesis or perform regulatory functions. Thus, in most cases, the goal of gene therapy is to inject into an organism genes that provide for the transcription and further translation of the protein molecules encoded by these genes. In the description of the present invention, gene expression refers to the production of a protein molecule having an amino acid sequence encoded by the gene.

The KRT5, KRT14, LAMB3 and COL7a1 genes comprised in a group of genes play a key role in several processes in the human and animal body. The correlation between low/insufficient concentrations of these proteins and various human diseases in some cases was demonstrated by interference in the normal gene expression encoding these proteins. Thus, gene therapy with increased gene expression selected from the group of KRT5, KRT14, LAMB3 and COL7a1 genes has the potential to correct various disorders in humans and animals.

The COL7a1 gene encodes type VII collagen. The three anterior alpha 1(VII) chains are intertwined to form a triplex procollagen molecule. Procollagen molecules are secreted by the cell and enzymatically processed to remove additional protein fragments from the termini. Once these molecules are processed, they arrange themselves into elongated bundles of mature type VII collagen.

Mutations in the COL7a1 gene lead to dystrophic epidermolysis bullosa (dystrophic epidermolysis bullosa). Blisters most often occur at the site of a minor injury, such as the extensor surface of the elbow and the dorsum of the hand and foot. Healing leads to scarring, superficial epidermal cysts and pigmentation. Some patients have nail dystrophy. Extradermal manifestations often occur, including damage to the urinary tract and gastrointestinal tract, the outer eye membrane, chronic anemia, osteoporosis and growth retardation. Epidermolysis bullosa patients are at high risk of cancer, especially the development of invasive squamous cell carcinoma. Debar International, established in the united kingdom in 1978, studied and treated epidermolysis bullosa globally. According to DEBRA International, one patient is generated every 5-10 million people in the world.

Current worldwide treatment of epidermolysis bullosa is variously studied in three directions: gene therapy, recombinant protein therapy and cell-based therapy (stem cell applications). All of these types of treatment are in different stages of development.

Gene therapy approaches to the treatment of epidermolysis bullosa involve different experimental treatments. In several studies to correct mutations in the COL7a1 gene, ex vivo genome editing techniques (menciia et al, 2018), microinjection of linear DNA molecules encoding the COL7a1 gene (Mecklenbeck et al, 2002), cDNA integration using integrase (oriz-Urda et al, 2003), intradermal injection of lentiviral vectors (Woodley et al, 2004), TALEN nuclease-based mutation repair techniques (Osborn et al, 2013), and injection of autologous cells, i.e., fibroblasts or keratinocytes modified with various retroviral vectors (Jack w et al, 2016, Georgiadis et al, 2016, Goto et al, 2006) were successfully used. Currently, clinical trials of these approaches are in different stages of research (NCT01263379, NCT 02810951).

The KRT5 and KRT14 genes encode keratin 5 and keratin 14 proteins, respectively. Keratin is a group of rigid fibrous proteins that determine the structure of the skin, hair and nails. Keratin 5 is produced in keratinocytes. Keratin 5 forms with keratin 14 a molecule called the keratin intermediate filament. These filaments are collected into a network, necessary for the attachment of keratinocytes and for the connection between the epidermis and the underlying skin layers. The network of keratin intermediate filaments provides strength and elasticity to the skin and protects the skin from damage caused by friction and other mechanical stresses. Mutations in KRT5 and KRT14 resulted in approximately 75% of epidermolysis bullosa cases, and the severity of the disease was dependent on the region of the gene mutation (Bolling, Lemmink, Jansen and Jonkman, 2011; Pfundner et al, 2016). In KRT5 knock-out mice, there was a complete lack of linkage between the dermis and epidermis (Cao et al, 2001; Peters, Kirfel, Bussow, Vidal and Magin, 2001).

In addition to epidermolysis bullosa, mutations in the KRT5 and KRT14 genes also result in diseases such as reticulo-pigmentary abnormalities of the flaxures (Douling-Degos disease), reticulo-pigmentary dermatoses (Oberst-Lehn-Hauss-pigmentary dermatoses), Naegeli-France-Jadassohn syndrome (2017).

The LAMB3 gene encodes laminin beta 3 (i.e., laminin subunit). Laminins are a group of proteins that regulate cell growth, movement, and adhesion. They are also involved in the formation and organization (organization) of the basement membrane, which constitutes a lamellar structure, which separates and supports cells in many tissues. Laminin is the major component of fibers called anchored filaments that connect the two layers of basement membrane and help form a single skin structure, and mutations in the LAMB3 gene lead to epidermolysis bullosa. Studies have shown that laminin also has several other functions. This protein appears to be important in wound healing and enamel development (enameling).

It is known from the literature that mutations in the LAMB3 gene can cause hereditary brown enamel (Poulter et al 2014) and that some rare alleles of this gene are associated with the risk of painful adiposis dolorosa and type 2 diabetes (Jiao H et al 2016).

Experimental work on a volunteer patient with epidermolysis bullosa showed that transplantation of cells transfected with a retroviral vector expressing the LAMB3 gene resulted in a significant improvement in the site of administration lasting at least one year (Mavilio et al, 2006).

Phase I/II clinical trials indicate that injection of genetically modified autologous epithelial cells expressing the LAMB3 gene appears to be a promising approach to the treatment of epidermolysis bullosa (De Rosa L et al, 2013).

Thus, the background of the present invention suggests that mutations in or underexpression of the KRT5, KRT14, LAMB3 and COL7a1 genes are associated with the development of a range of diseases including, but not limited to, connective tissue diseases, wound healing, genetic and acquired pathological processes such as epidermolysis bullosa, and other adverse conditions to the body. This is why the KRT5, KRT14, LAMB3 and COL7A1 genes are included in this patent. Genetic constructs providing expression of proteins encoded by the KRT5, KRT14, LAMB3 and COL7a1 genes are useful for the development of medicaments for the prevention and treatment of different diseases and pathological conditions.

Furthermore, these data indicate that under-expression of the proteins encoded by the KRT5, KRT14, LAMB3 and COL7a1 genes contained in a panel of genes is not only associated with pathological conditions, but also with their susceptibility to development. Furthermore, these data indicate that under-expression of these proteins may not be unequivocally present in the pathological forms that can be unequivocally described within the framework of the current standards of clinical practice (e.g. using ICD codes), but at the same time lead to conditions that are unfavorable for humans and animals and that are associated with a worsening quality of life.

Analysis of methods to increase therapeutic gene expression implies the feasibility of using different gene therapy vectors.

Gene therapy vectors are divided into viral, cellular, and DNA vectors (EMA/COL 7A1/80183/2014 as guidelines for the quality, non-clinical, and clinical aspects of gene therapy drug products). Recently, gene therapy has focused on the development of non-viral gene delivery systems, in which the plasmid vector is the leader. Plasmid vectors have no limitations inherent to cellular and viral vectors. In target cells, they are present as episomes, do not integrate into the genome, but they are rather inexpensive to produce, and do not have the immune response or side effects caused by the administration of plasmid vectors, which makes them a convenient tool for gene therapy and prevention (DNA vaccination) of genetic diseases (Li L, Petrovsky N.// Expert Rev vaccines.2016; 15(3): 313-29).

However, limitations of plasmid vector use in gene therapy are: 1) the presence of an antibiotic resistance gene for the production of the construct in a bacterial strain; 2) the presence of various regulatory elements represented by viral genomic sequences; 3) the length of the therapeutic plasmid vector that determines the efficiency of vector delivery to the target cell.

It is well known that the european medicines agency considers that it is necessary to avoid adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (post-read report on design modification of gene therapy drug products during development)/2011 12/14 th EMA/COL7a1/GTWP/44236/2009 advanced therapy Committee (committed for advanced therapies)). This suggestion is primarily related to the potential risk of DNA vector penetration or horizontal transfer of antibiotic resistance genes into bacterial cells present in the body, which are part of a normal or opportunistic community of microorganisms. Furthermore, the presence of the antibiotic resistance gene significantly increases the length of the DNA vector, which reduces its efficacy in penetrating into eukaryotic cells.

It is to be noted that antibiotic resistance genes also make a fundamental contribution to the method of producing DNA vectors. If an antibiotic resistance gene is present, the strain used to produce the DNA vector is usually cultured in a medium containing a selective antibiotic, which poses the risk of antibiotic traces in DNA vector preparations that are not sufficiently purified. Thus, the production of DNA vectors for gene therapy without antibiotic resistance genes is linked to the production of strains with unique characteristics, such as the ability of stable amplification of the therapeutic DNA vector in antibiotic-free medium.

Furthermore, the European drug administration suggests avoiding the presence of regulatory elements (promoters, enhancers, post-translational regulatory elements) in the therapeutic plasmid vector that constitute the genomic nucleotide sequences of various viruses that increase the expression of therapeutic genes (Draft guide on the quality, non-clinical and clinical aspects of gene therapy drug products, http:// www.ema.europa.eu/docs/en _ GB/document _ library/Scientific _ guidine/2015/05/WC500187020. pdf) for the quality, non-clinical and clinical aspects of gene therapy drug products. Although these sequences may increase the expression level of the therapeutic transgene, they pose a risk of recombination with the genetic material of the wild-type virus and integration into the eukaryotic genome. Furthermore, the relevance of overexpression of specific genes for therapy remains an open question.

The size of the therapeutic vehicle is also necessary. It is well known that modern plasmid vectors often have unnecessary non-functional sites that significantly increase their length (Mairhofer J, Grabherr R.// Mol Biotechnol.2008.39(2): 97-104). For example, ampicillin resistance genes in pBR322 series vectors usually consist of at least 1000bp, accounting for more than 20% of the length of the vector itself. An inverse relationship between vector length and its ability to penetrate eukaryotic cells was observed; DNA vectors having a small length efficiently penetrate into human and animal cells. For example, in a series of experiments on transfection of HeLa cells with 383-19-4548 bp DNA vector, it was shown that the difference in infiltration efficacy can be up to two orders of magnitude (100-fold difference) (Hornstein BD et al// PLoS ONE.2016; 11(12): e 0167537.).

Therefore, in selecting DNA vectors, those constructs which do not contain antibiotic resistance genes, viral-derived sequences, and which are of a length that allows efficient infiltration into eukaryotic cells should be considered preferentially for reasons of safety and maximum efficiency. Strains producing such DNA vectors in sufficient amounts for gene therapy purposes should ensure the possibility of stable DNA vector amplification using antibiotic-free nutrient media.

An example of the use of a recombinant DNA vector for gene therapy is a method of producing a recombinant vector for genetic immunization (patent No. US 9550998B 2). Plasmid vectors are supercoiled plasmid DNA vectors that are used for expression of cloned genes in human and animal cells. The vector contains an origin of replication, regulatory elements including a human cytomegalovirus promoter and enhancer, and regulatory sequences from a human T-cell lymphotropic virus.

The vector was accumulated in antibiotic-free dedicated E.coli strains by antisense complementation of the sacB gene inserted in the strain using phage. The disadvantage of this invention is the presence of regulatory elements in the DNA vector composition that constitute the sequences of the viral genome.

The following application is a prototype of the present invention and relates to the use of gene therapy approaches to increase the expression levels of genes from the group of KRT5, KRT14, LAMB3 and COL7a1 genes.

Application No. US20020064876a1 describes an invention based on the injection of a complex oligonucleotide consisting of RNA and DNA for correcting expression disorders of genes from the group of KRT5, KRT14, LAMB3 and COL7a1 genes, for correcting dermatological pathological conditions, including genetic diseases such as epidermolysis bullosa. The disadvantage of this invention is the method for correcting obstacles in genes which alter the nucleotide sequence of these genes, however not all obstacles are limited to mutations in the coding region of the gene and may also be associated with insufficient functional activity not due to mutations or such mutations that cannot be corrected by this method.

Disclosure of Invention

The object of the present invention is to construct gene therapy DNA vectors in order to increase the expression levels of the group of KRT5, KRT14, LAMB3 and COL7a1 genes in human and animal organisms, which gene therapy vectors combine the following properties:

I) the efficiency of gene therapy DNA vectors in order to increase the expression level of therapeutic genes in eukaryotic cells;

II) the possibility of safe use in gene therapy of humans and animals due to the absence of regulatory elements representing the nucleotide sequence of the viral genome in gene therapy DNA vectors;

III) the possibility of safe use in gene therapy of humans and animals due to the absence of antibiotic resistance genes in gene therapy DNA vectors;

IV) Productibility and constructability of the DNA vector for gene therapy on an industrial scale.

Items II and III are provided herein according to the recommendations of the national regulatory bodies for gene therapy drugs, and in particular the requirements of the european drug administration, i.e. avoiding the addition of antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (post-read report on design modification of gene therapy drug products during development/EMA/COL 7a1/GTWP/44236/2009 advanced therapy committee 12/14/2011), and avoiding the addition of viral genomes to newly engineered plasmid vectors for gene therapy (guidelines on quality, non-clinical and clinical aspects of gene therapy drug products/23/3/2015 23/EMA/COL 7a1/80183/2014, advanced therapy committee).

The object of the present invention also includes the construction of strains carrying these gene therapy DNA vectors, and the development and production of these gene therapy DNA vectors on an industrial scale.

Specific objects are achieved by using a gene therapy DNA vector generated based on a gene therapy DNA vector VTvaf17 for the treatment of diseases associated with structural organisation (structural organisation) disorders of the skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer (sublayer), disorders of wound healing, connective tissue pathologies, including bullous epidermal lysis, dow-degos' disease, obest-Lehn-Hauss pigmentary dermatosis, Naegeli-francischetti-Jadassohn syndrome and brown enamel, wherein the gene therapy DNA vector VTvaf17-KRT5 contains the coding region of a KRT5 therapeutic gene cloned into the gene therapy DNA vector VTvaf17, having the nucleotide sequence ID No. SEQ 1; the gene therapy DNA vector VTvaf17-KRT14 contains the coding region of KRT14 therapeutic gene cloned onto gene therapy DNA vector VTvaf17, having nucleotide sequence SEQ ID No. 2; the gene therapy DNA vector VTvaf17-LAMB3 contains the coding region of the therapeutic gene LAMB3 cloned onto gene therapy DNA vector VTvaf17 and has the nucleotide sequence SEQ ID No. 3; the gene therapy DNA vector VTvaf17-COL7A1 contains the coding region of the COL7A1 therapeutic gene cloned onto gene therapy DNA vector VTvaf17 and has the nucleotide sequence SEQ ID No. 4. Because the VTvaf17 vector portion does not exceed the 3200bp limited size, each of the constructed gene therapy DNA vectors, VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1, has the ability to efficiently penetrate human and animal cells and express KRT5, or KRT14, or LAMB3, or COL7A 1.

Each of the constructed gene therapy DNA vectors, VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1, uses as a structural element a nucleotide sequence that is not an antibiotic resistance gene, a viral gene, or a regulatory element of the viral genome, which ensures its safe use in gene therapy in humans and animals.

Methods for the production of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 and COL7a1 therapeutic genes have also been developed, which involve obtaining each of the gene therapy DNA vectors as follows: VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A 1: cloning the coding region of KRT5, KRT14, LAMB3 or COL7a1 therapeutic genes into gene therapy DNA vector VTvaf17 and obtaining gene therapy DNA vector VTvaf17-KRT5, SEQ ID No.1, respectively; or VTvaf17-KRT14, SEQ ID No. 2; or VTvaf17-LAMB3, SEQ ID No. 3; or VTvaf17-COL7a1, SEQ ID No.4, wherein the coding region for the KRT5, or KRT14, or LAMB3, or COL7a1 therapeutic gene is obtained by: by isolating total RNA from human biological tissue samples, followed by reverse transcription and PCR amplification using the oligonucleotides obtained, and cleavage of the amplification product by the corresponding restriction endonucleases, wherein the cloning of the gene therapy DNA vector VTvaf17 is carried out from BamHI and HindII, or SalI and EcoRI restriction sites, selected in the absence of antibiotics,

among these, the following oligonucleotides generated for this purpose were used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-KRT5, SEQ ID No. 1:

KRT5_FTTTGGATCCACCATGTCTCGCCAGTCAAGTGTGTCCTTC，

KRT5_R AATAAGCTTCTAGCTCTTGAAGCTCTTCCGGGAGG，

and cleavage of the amplified product by BamHII and HindIII restriction endonucleases and cloning of the coding region of KRT5F gene into gene therapy DNA vector VTvaf17,

KRT14_F TTTGGATCCACCATGACCACCTGCAGCCGCCAG，

KRT14_R AATAAGCTTTCAGTTCTTGGTGCGAAGGACCTGC，

and cleavage of the amplified product by BamHII and HindIII restriction endonucleases and cloning of the coding region of KRT14 gene into gene therapy DNA vector VTvaf17,

among these, the following oligonucleotides produced for this purpose were used in the reverse transcription reaction and PCR amplification during the production of the gene therapy DNA vector VTvaf17-LAMB3, SEQ ID No. 3:

LAMB3_FTTAGTCGACCACCATGAGACCATTCTTCCTCTTG，

LAMB3_R ATAGAATTCACTTGCAGGTGGCATAGTAGAG，

and cleavage of the amplified product by SalI and EcoRI restriction endonucleases and cloning of the coding region of the LAMB3 gene into the gene therapy DNA vector VTvaf17,

COL7A1_FATCGTCGACCACCATGACGCTGCGGCTTCTGGT，

COL7A1_R ATAGAATTCAGTCCTGGGCAGTACCTGTC，

and cleavage of the amplified product by SalI and EcoRI restriction endonucleases and cloning of the coding region of COL7A1 gene into gene therapy DNA vector VTvaf 17.

The use of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying KRT5, KRT14, LAMB3 and COL7A1 therapeutic genes for the treatment of diseases associated with structural dysfunction of the skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies including epidermolysis bullosa, Dow-Drogos' disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-France schetti-Jadassohn syndrome and brown enamel, the method involves using a gene therapy DNA vector carrying a therapeutic gene based on gene therapy DNA vector VTvaf17 selected from the group of constructed gene therapy DNA vectors carrying a therapeutic gene based on gene therapy DNA vector VTvaf17, or a selection of several gene therapy DNA vectors carrying a therapeutic gene based on the gene therapy DNA vector VTvaf17 to transfect cells of patient or animal organs and tissues; and/or injecting autologous cells of the patient or animal transfected with the gene therapy DNA vector carrying the therapeutic gene selected from the gene therapy DNA vector based on the constructed gene therapy DNA vector carrying the therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying the therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal; and/or injecting a gene therapy DNA vector carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 selected from the group of constructed gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 or several selected gene therapy DNA vectors carrying a therapeutic gene of the gene therapy DNA vector VTvaf17 into organs and tissues of the same patient or animal, or a combination of the indicated methods.

A method for producing a strain for constructing a gene therapy DNA vector for treating diseases associated with structural disorders of skin, hair and nails, disorders of keratinocyte attachment and epidermal-sublayer attachment, disorders of wound healing, connective tissue pathologies, including epidermolysis bullosa, dow-deguss's disease, Oberst-Lehn-Hauss pigmentary dermatosis, Naegeli-franciscetti-jadasssohn syndrome and brown enamel, which involves preparing electrically competent cells of escherichia coli strain SCS110-AF and electroporating these cells with gene therapy DNA vector VTvaf17-KRT5, or gene therapy DNA vector VTvaf17-KRT14, or gene therapy DNA vector VTvaf17-LAMB3, or gene therapy DNA vector VTvaf17-COL7a1, was developed. Thereafter, the cells were poured into an agar plate (petri dish) containing a selective medium containing yeast extract, peptone, 6% sucrose, and 10. mu.g/ml chloramphenicol, and as a result, Escherichia coli strain SCS110-AF/VTvaf17-KRT5, or Escherichia coli strain SCS110-AF/VTvaf17-KRT14, or Escherichia coli strain SCS110-AF/VTvaf17-LAMB3, or Escherichia coli strain SCS110-AF/VTvaf17-COL7A1 was obtained.

The E.coli strain SCS110-AF/VTvaf17-KRT5 is claimed, which carries the gene therapy DNA vector VTvaf17-KRT5 for its production, allowing antibiotic-free selection during the production of the gene therapy DNA vector; or E.coli strain SCS110-AF/VTvaf17-KRT14 carrying gene therapy DNA vector VTvaf17-KRT14 for its production, allowing antibiotic-free selection during production of the gene therapy DNA vector; or E.coli strain SCS110-AF/VTvaf17-LAMB3 carrying gene therapy DNA vector VTvaf17-LAMB3 for its production, allowing antibiotic-free selection during gene therapy DNA vector production; or E.coli strain SCS110-AF/VTvaf17-COL7A1 carrying gene therapy DNA vector VTvaf17-COL7A1 for its production, allowing antibiotic-free selection during gene therapy DNA vector production, for the treatment of diseases associated with structural dysregulation of skin, hair and nails, disorders of keratinocyte attachment and epidermal to sub-layer attachment, disorders of wound healing, connective tissue pathologies, including epidermolysis bullosa, Darland-Degorski disease, Obert-Lehn-Hauss pigmentary dermatosis, Naegeli-France schetti-Jadassohn syndrome and brown enamel.

A method of developing a gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying KRT5, or KRT14, or LAMB3, or COL7a1 therapeutic genes for the treatment of diseases associated with structural dysfunction of skin, hair and nails, dysfunction of keratinocyte attachment and epidermal to sub-layer junctions, dysfunction of wound healing, connective tissue pathology including epidermolysis bullosa, dow-deguss's disease, obest-Lehn-Hauss pigmentary dermatosis, Naegeli-francischetti-jadasssohn syndrome, and brown enamel, on an industrial scale, which method involves producing gene therapy DNA vectors VTvaf17-KRT5, or gene therapy DNA vectors VTvaf17-KRT14, or gene therapy DNA vectors VTvaf17-LAMB3, or gene therapy DNA vectors VTvaf17-COL7a1, as follows: the culture flasks containing the prepared medium were inoculated by seed culture selected from the group consisting of E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A116, and the cell culture was then incubated on a incubator shaker and transferred to an industrial fermentor and then cultured to stationary phase, and then fractions containing the target DNA product were extracted, subjected to multi-stage filtration, and purified by chromatography.

Drawings

The essence of the invention is explained in the following figures, wherein:

FIG. 1 shows a schematic view of a

The structure of a gene therapy DNA vector VTvaf17 carrying a therapeutic gene selected from the group of KRT5, KRT14, LAMB3 and COL7a1 genes is shown, which constitutes a circular double stranded DNA molecule capable of autonomous replication in e.

Fig. 1 shows a structure corresponding to:

a-gene therapy DNA vector VTvaf17-KRT5,

b gene therapy DNA vector VTvaf17-KRT144,

c gene therapy DNA vector VTvaf17-LAMB3,

D-Gene therapy DNA vector VTvaf17-COL7A 1.

The following structural elements of the carrier are indicated in the following structure:

EF1 a-the promoter region of human elongation factor EF1A, which has an internal enhancer contained in the first intron of the gene. It ensures efficient transcription of the recombinant gene in most human tissues.

The reading frames of the therapeutic genes corresponding to the coding regions of KRT5 (FIG. 1A), or KRT14 (FIG. 1B), or LAMB3 (FIG. 1C), or COL7A1 (FIG. 1D), respectively,

hGH-TA-transcription terminator and polyadenylation site of human growth factor gene.

ori-origin of replication for autonomous replication, with single nucleotide substitutions to increase plasmid production in most E.coli strain cells.

RNA-out-in the case of the use of the E.coli strain SCS110-AF, the regulatory element RNA-out of transposon Tn10, which allows antibiotic-free positive selection.

Unique restriction sites are labeled.

FIG. 2

A graph showing the accumulation of cDNA amplicons of the therapeutic gene (i.e., KRT5 gene) in HDFa primary human dermal fibroblast cultures (ATCC PCS-201-012) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-KRT5 in order to assess the ability to infiltrate into eukaryotic cells and functional activity, i.e., expression of the therapeutic gene at the mRNA level, is shown.

During the reaction, the curve of amplicon accumulation is shown in fig. 2, corresponding to:

1-HDFa primary human dermal fibroblast cultures cDNA of the KRT5 gene prior to transfection with the DNA vector VTvaf17-KRT5,

2-HDFa primary human dermal fibroblast cultures after transfection with the DNA vector VTvaf17-KRT5 cDNA of the KRT5 gene,

3-HDFa primary human dermal fibroblast cell culture cDNA of the B2M gene before transfection with the DNA vector VTvaf17-KRT5,

4-HDFa primary human dermal fibroblast cultures cDNA of the B2M gene after transfection with the DNA vector VTvaf17-KRT 5.

The B2M (β -2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene.

FIG. 3

Graphs showing the accumulation of cDNA amplicons of the therapeutic gene (i.e., KRT14 gene) in HEKa primary human epidermal keratinocyte cultures (ATCC PCS-200-011) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-KRT14 in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e., expression of the therapeutic gene at the mRNA level.

During the reaction, the curve of amplicon accumulation is shown in fig. 3, corresponding to:

1-cDNA of the KRT14 gene in HEKa primary human epidermal keratinocyte culture before transfection with the DNA vector VTvaf17-KRT14,

2-cDNA of the KRT14 gene in HEKa primary human epidermal keratinocyte culture after transfection with the DNA vector VTvaf17-KRT14,

3-cDNA of the B2M gene in HEKa primary human epidermal keratinocyte culture before transfection with the DNA vector VTvaf17-KRT14,

4-cDNA of the B2M gene in HEKa primary human epidermal keratinocyte cultures after transfection with the DNA vector VTvaf17-KRT 14.

The B2M (Beta-2-microglobulin) gene listed under the number NM004048.2 in GenBank database was used as a reference gene.

FIG. 4

Shown in human skeletal myoblasts (HSKM) (HSKM)Cat. a12555), therapeutic genes (i.e. gene therapy DNA vector VTvaf17-LAMB 3) before and 48 hours after transfection of these cellsLAMB3 gene) in order to assess the ability to infiltrate eukaryotic cells and functional activity, i.e. the expression of therapeutic genes at the mRNA level.

During the reaction, the curve of amplicon accumulation is shown in fig. 4, corresponding to:

1-cDNA of the LAMB3 gene in HSKM human skeletal myoblasts before transfection with the DNA vector VTvaf17-LAMB3,

2-cDNA of the LAMB3 gene in HSKM human skeletal myoblasts after transfection with the DNA vector VTvaf17-LAMB3,

3-cDNA of the B2M gene in HSKM human skeletal muscle myoblasts before transfection with the DNA vector VTvaf17-LAMB3,

4-cDNA of the B2M gene in HSKM human skeletal myoblasts after transfection with the DNA vector VTvaf17-LAMB 3.

The B2M (β -2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene.

FIG. 5

Shows in normal human primary umbilical vein endothelial cells (HUVEC) ((HUVEC))PCS-100-010^TM) Graph of the accumulation of the cDNA amplicons of the therapeutic gene (i.e., the COL7A1 gene) before and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-COL7A1, in order to assess the ability to infiltrate eukaryotic cells and the functional activity, i.e., the expression of the therapeutic gene at the mRNA level.

During the reaction, the curve of amplicon accumulation is shown in fig. 5, corresponding to:

1-cDNA of the COL7A1 gene in HUVEC human primary umbilical vein endothelial cells before transfection with the DNA vector VTvaf17-COL7A1,

2-cDNA of the COL7A1 gene in HUVEC human primary umbilical vein endothelial cells after transfection with the DNA vector VTvaf17-COL7A1,

3-B2M Gene cDNA in HUVEC human primary umbilical vein endothelial cells before transfection with the DNA vector VTvaf17-COL7A1,

4-cDNA of the B2M gene in HUVEC human primary umbilical vein endothelial cells after transfection with the DNA vector VTvaf17-COL7A 1.

The B2M (Beta-2-microglobulin) gene listed under the number NM004048.2 in GenBank database was used as a reference gene.

FIG. 6

Shows a graph of the concentration of KRT5 protein in cell lysates of HDFa human primary dermal fibroblasts (ATCCPCS-201-01) after transfection of these cells with the DNA vector VTvaf17-KRT5 in order to assess functional activity, i.e. expression at the protein level based on changes in the concentration of KRT5 protein in the cell lysates.

The following elements are indicated in fig. 6:

culture a-HDFa human primary dermal fibroblast culture transfected with an aqueous dendrimer solution without plasmid DNA (reference),

culture B-HDFa primary human dermal fibroblast culture transfected with DNA vector VTvaf17,

culture C-HDFa human primary dermal fibroblast cultures transfected with the DNA vector VTvaf17-KRT 5.

FIG. 7

A graph showing the concentration of KRT14 protein in lysates of HEKa primary human epidermal keratinocytes (ATCC PCS-200-01) after transfection of these cells with the DNA vector VTvaf17-KRT14 in order to evaluate the functional activity, i.e. the expression of the therapeutic gene at the protein level and the possibility of increasing the protein expression level with the gene therapy DNA vector based on the gene therapy vector VTvaf17 carrying the KRT14 therapeutic gene.

The following elements are indicated in fig. 7:

culture A-HEKa primary human epidermal keratinocyte culture transfected with an aqueous dendrimer solution (reference) without plasmid DNA,

culture B-HEKa primary human epidermal keratinocyte culture transfected with DNA vector VTvaf17,

culture C-HEKa primary human epidermal keratinocyte culture transfected with DNA vector VTvaf17-KRT 14.

FIG. 8

Shown in human skeletal myoblasts (HSKM) (HSKM)Cat. a12555), plot of the protein concentration of LAMB3 after transfection of these cells with the DNA vector VTvaf17-LAMB3, in order to evaluate the functional activity, i.e. the expression of the therapeutic gene at the protein level and the possibility of the gene therapy DNA vector based on gene therapy vector VTvaf17 carrying the therapeutic gene of LAMB3 to increase the protein expression level.

The following elements are indicated in fig. 8:

culture A-HSKM human primary skeletal myoblasts transfected with an aqueous dendrimer solution without plasmid DNA (reference),

culture B-HSKM primary skeletal myoblasts transfected with the DNA vector VTvaf17,

culture C-HSKM human primary skeletal myoblasts transfected with DNA vector VTvaf17-LAMB 3.

FIG. 9

Shows in normal human primary umbilical vein endothelial cells (HUVEC) ((HUVEC))PCS-100-010^TM) In cell lysates of (a) cells, after transfection of these cells with the gene therapy DNA vector VTvaf17-COL7a1, a plot of COL7a1 protein concentration was performed in order to evaluate the functional activity, i.e., the expression of the therapeutic gene at the protein level and the possibility of increasing the protein expression level based on the gene therapy DNA vector VTvaf17-COL7a1 carrying the COL7a1 therapeutic gene.

The following elements are indicated in fig. 19:

culture A-HUVEC human umbilical vein endothelial cell culture transfected (reference) with aqueous dendrimer solution without plasmid DNA,

culture B-HUVEC human umbilical vein endothelial cell culture transfected with DNA vector VTvaf17,

culture C-HUVEC human umbilical vein endothelial cell culture transfected with DNA vector VTvaf17-COL7A 1.

FIG. 10 shows a schematic view of a

A graph showing COL7a1 protein concentration in skin biopsy samples of three patients after injection of the gene therapy DNA vector VTvaf17-COL7a1 into the skin of these patients in order to evaluate the functional activity, i.e., the expression of the therapeutic gene at the protein level and the possibility of increasing the protein expression level using the gene therapy DNA vector based on the gene therapy vector VTvaf17 carrying the COL7a1 therapeutic gene.

The following elements are indicated in fig. 10:

P1I-patient P1 biopsy performed in the injection area of gene therapy DNA vector VTvaf17-COL7A1,

p1 II-patient P1 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p1 III-patient P1 skin biopsy from an intact site,

P2I-patient P2 biopsy performed in the injection area of gene therapy DNA vector VTvaf17-COL7A1,

p2 II-patient P2 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p2 III-patient P2 skin biopsy from an intact site,

P3I-patient P3 biopsy performed in the injection area of the gene therapy DNA vector VTvaf17-COL7A1,

p3 II-patient P3 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p3 III-patient P3 skin biopsy from an intact site.

FIG. 11

A graph showing the concentration of LAMB3 protein in gastrocnemius biopsy samples of three patients after injection of the gene therapy DNA vector VTvaf17-LAMB3 into the gastrocnemius of these patients in order to evaluate the functional activity, i.e., the expression of the therapeutic gene at the protein level and the possibility of increasing the protein expression level using a gene therapy DNA vector based on the gene therapy vector VTvaf17 carrying the therapeutic gene of LAMB 3.

The following elements are indicated in fig. 11:

P1I-patient P1 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17-LAMB3,

p1 II-patient P1 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p1 III-patient P1 gastrocnemius biopsy from an intact site,

P2I-patient P2 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17-LAMB3,

p2 II-patient P2 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p2 III-patient P2 gastrocnemius biopsy from an intact site,

P3I-patient P3 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17-LAMB3,

p3 II-patient P3 gastrocnemius biopsy performed in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p3 III-patient P3 gastrocnemius biopsy from an intact site.

FIG. 12

A graph showing KRT14 protein concentration in biopsy samples of skin of three patients after injection of gene therapy DNA vector VTvaf17-KRT14 into their skin in order to evaluate functional activity, i.e., expression of therapeutic genes at the protein level and the possibility of increasing protein expression levels using gene therapy DNA vector based on gene therapy vector VTvaf17 carrying KRT14 therapeutic genes.

The following elements are indicated in fig. 12:

P1I-patient P1 skin biopsy performed in the injection area of gene therapy DNA vector VTvaf17-KRT14,

p1 II-patient P1 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p1 III-patient P1 skin biopsy from an intact site,

P2I-patient P2 skin biopsy performed in the injection area of gene therapy DNA vector VTvaf17-KRT14,

p2 II-patient P2 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p2 III-patient P2 skin biopsy from an intact site,

P3I-patient P3 skin biopsy performed in the injection area of gene therapy DNA vector VTvaf17-KRT14,

p3 II-patient P3 skin biopsy in the injection area of the gene therapy DNA vector VTvaf17 (placebo),

p3 III-patient P3 skin biopsy from an intact site.

FIG. 13

A graph showing the concentration of KRT14 protein in human skin biopsy samples after subcutaneous injection of autologous fibroblast cultures transfected with gene therapy DNA vector VTvaf17-KRT14 in order to demonstrate the method of use of autologous cells transfected by gene therapy DNA vector VTvaf17-KRT14 for injection.

The following elements are indicated in fig. 13:

P1C-patient P1 skin biopsy performed in the injection area of autologous fibroblast cultures of patients transfected with gene therapy DNA vector VTvaf17-KRT14,

P1B-patient P1 skin biopsy in the injection area of patient autologous fibroblast cultures transfected with gene therapy DNA vector VTvaf17,

P1A-patient from intact site P1 skin biopsy.

FIG. 14

The following gene therapy DNA vectors were shown to be injected: after a mixture of VTvaf17-KRT5, gene therapy DNA vector VTvaf17-KRT14, gene therapy DNA vector VTvaf17-LAMB3 and gene therapy DNA vector VTvaf17-COL7A1, the following proteins were present in three rat skin biopsy samples: graph of the concentrations of human KRT5 protein, human KRT14 protein, human LAMB3 protein, and human COL7a1 protein to illustrate the method of using the gene therapy DNA vector mixture.

The following elements are indicated in fig. 14:

K1I-in gene therapy DNA vector: rat K1 skin biopsy samples in the injection area of the mixture of VTvaf17-KRT5, VTvaf17-KRT14, VTvaf17-LAMB3 and VTvaf17-COL7A1,

k1 II-rat K1 skin biopsy specimen in the injection area of gene therapy DNA vector VTvaf17 (placebo),

k1 III-reference Whole site rat K1 skin biopsy samples,

K2I-in gene therapy DNA vector: rat K2 skin biopsy samples in the injection area of the mixture of VTvaf17-KRT5, VTvaf17-KRT14, VTvaf17-LAMB3 and VTvaf17-COL7A1,

k2 II-rat K2 skin biopsy specimen in the injection area of gene therapy DNA vector VTvaf17 (placebo),

k2 III-rat K2 skin biopsy samples at the reference intact site,

K3I-in gene therapy DNA vector: rat K3 skin biopsy samples in the injection area of the mixture of VTvaf17-KRT5, VTvaf17-KRT14, VTvaf17-LAMB3 and VTvaf17-COL7A1,

k3 II-rat K3 skin biopsy specimen in the injection area of gene therapy DNA vector VTvaf17 (placebo),

k3 III-reference intact site rat K3 skin biopsy samples.

FIG. 15 shows a schematic view of a

Shows MDBK bovine kidney epithelial cells (NBL-1) ((R))CCL-22^TM) Map of LAMB3 therapeutic gene cDNA amplicon accumulation before and 48 hours after transfection of these cells with DNA vector VTvaf17-LAMB3 in order to demonstrate the method of use of the DNA vector by injection of gene therapy in animals.

During the reaction, the curve of amplicon accumulation is shown in fig. 15, corresponding to:

1-cDNA of the LAMB3 gene in MDBK cells before transfection with the gene therapy DNA vector VTvaf17-LAMB3,

2-cDNA of LAMB3 gene of MDBK cells after transfection with gene therapy DNA vector VTvaf17-LAMB3,

3-cDNA of ACT gene before MDBK cells before transfection with gene therapy DNA vector VTvaf17-LAMB3,

4-cDNA of ACT gene after MDBK cells following transfection with the gene therapy DNA vector VTvaf17-LAMB 3.

The bull/bovine actin gene (ACT) listed under accession number AH001130.2 in the GenBank database was used as a reference gene.

Detailed Description

Based on the 3165bp DNA vector VTvaf17, gene therapy DNA vectors carrying human therapeutic genes were constructed, designed to increase the expression levels of these therapeutic genes in human and animal tissues. Method for the production of each gene therapy DNA vector carrying a therapeutic gene selected from the group of genes consisting of: human KRT5 gene (encoding KRT5 protein), human KRT14 gene (encoding KRT14 protein), human LAMB3 gene (encoding LAMB3 protein) and human COL7A1 gene (encoding COL7A1 protein). It is well known that the ability of a DNA vector to penetrate eukaryotic cells depends largely on the size of the vector. The smallest size DNA carrier has a higher permeability. Thus, it is preferred that no elements which do not bear a functional load, but which at the same time increase the size of the vector DNA, are present in the vector. These features of the DNA vector were taken into account during the production of gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying a therapeutic gene selected from the group of KRT5, KRT14, LAMB3 and COL7a1 genes, wherein no large non-functional sequences and antibiotic resistance genes are present in the vector, allowing, apart from technical advantages and safe use, a significant reduction in the size of the resulting gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of KRT5, KRT14, LAMB3 and COL7a1 genes). Thus, the ability of the obtained gene therapy DNA vector to penetrate into eukaryotic cells is due to its small length.

Each of the following gene therapy DNA vectors: VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 were produced as follows: cloning the coding region of the therapeutic gene from the group of KRT5, KRT14, LAMB3 and COL7a1 genes into the DNA vector VTvaf17 and obtaining the gene therapy DNA vector VTvaf17-KRT5, SEQ ID No.1, respectively; or VTvaf17-KRT14, SEQ ID No. 2; or VTvaf17-LAMB3, SEQ ID No. 3; or VTvaf17-COL7A1, SEQ ID No. 4. The coding region of KRT5 gene (1776bp), or KRT14 gene (1422bp), or LAMB3 gene (3521bp), or COL7A1 gene (8838bp) was generated by extracting total RNA from a biological normal human tissue sample. Reverse transcription reactions were used for the synthesis of first strand cDNA of human KRT5, KRT14, LAMB3, and COL7a1 genes. Amplification is carried out using oligonucleotides which have been produced for this purpose by chemical synthesis methods. The amplified product was cleaved by specific restriction endonucleases taking into account the optimal procedures for further cloning and cloned into the gene therapy DNA vector VTvaf17 by BamHI, SalI, EcoRI and HindIII restriction sites located in the polylinker of the VTvaf17 vector. The restriction sites are selected in such a way that the cloned fragment enters the reading frame of the expression cassette of the vector VTvaf17, whereas the protein coding sequence does not contain the restriction sites for the chosen endonuclease. The expert in the field recognizes that the methodological implementation of the generation of gene therapy DNA vectors VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 can vary within the selection framework of known molecular gene cloning and that these methods are included within the scope of the present invention. For example, different oligonucleotide sequences may be used to amplify the KRT5, or KRT14, or LAMB3, or COL7a1 genes, different restriction endonucleases, or laboratory techniques (e.g., independent of ligated gene cloning).

The gene therapy DNA vector VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 has the nucleotide sequence SEQ ID No.1, or SEQ ID No.2, or SEQ ID No.3, or SEQ ID No.4, respectively. At the same time, the degeneracy of the genetic code is known to the expert in the field and this means that variants of the nucleotide sequences are also included within the scope of the invention, differing by the insertion, deletion or substitution of nucleotides which do not lead to a change in the sequence of the polypeptide encoded by the therapeutic gene and/or do not lead to a loss of functional activity of the regulatory elements of the VTvaf17 vector. At the same time, genetic polymorphisms are known to the expert in the field and it is intended that the scope of the present invention also includes variants of the nucleotide sequences from the group of the KRT5, KRT14, LAMB3, or COL7a1 genes, which also encode different variants of the amino acid sequence of the KRT5, KRT14, LAMB3, or COL7a1 proteins, which under physiological conditions do not differ in their functional activity from those listed.

The ability to penetrate eukaryotic cells and express functional activity, i.e., the ability to express the therapeutic gene of the obtained gene therapy DNA vector VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1, was demonstrated by introducing the obtained vector into eukaryotic cells and subsequently analyzing the expression of specific mRNA and/or the protein product of the therapeutic gene. The presence of specific mRNA in cells into which the gene therapy DNA vector VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 was introduced demonstrates the ability of the obtained vector to penetrate eukaryotic cells and express mRNA of a therapeutic gene. Furthermore, experts in the field know that the presence of mRNA genes is a mandatory condition, but not evidence for translation of the protein encoded by the therapeutic gene. Therefore, to confirm the property of the gene therapy DNA vector VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 to express the therapeutic gene at the protein level in eukaryotic cells into which the gene therapy DNA vector was introduced, analysis of the concentration of the protein encoded by the therapeutic gene was performed using immunological methods. The presence of KRT5, or KRT14, or LAMB3, or COL7a1 protein confirms the efficacy of therapeutic gene expression in eukaryotic cells, and the possibility of increasing the protein concentration using a gene therapy DNA vector based on a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of KRT5, KRT14, LAMB3, and COL7a1 genes). Therefore, in order to confirm the expression efficacy of the constructed gene therapy DNA vector VTvaf17-KRT5 carrying the therapeutic gene (i.e., KRT5 gene), gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene (i.e., KRT14 gene), gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene (i.e., LAMB3 gene), gene therapy DNA vector VTvaf17-COL7a1 carrying the therapeutic gene (i.e., COL7a1 gene), the following methods were used:

A) real-time PCR, i.e., the change in mRNA accumulation of a therapeutic gene in human and animal cell lysates following transfection of different human and animal cell lines with a gene therapy DNA vector;

B) enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in human cell lysates or culture medium after transfection of different human cell lines with gene therapy DNA vectors.

C) Enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in the supernatant of human and animal tissue biopsy specimens after injection of gene therapy DNA vectors into these tissues;

D) enzyme-linked immunosorbent assay, i.e. the change in the quantitative level of therapeutic protein in the supernatant of human tissue biopsy after injection of these tissues with autologous cells of the human transfected with gene therapy DNA vectors.

To demonstrate the feasibility of using the constructed gene therapy DNA vector VTvaf17-KRT5 carrying the therapeutic gene (i.e., KRT5 gene), the gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene (i.e., KRT14 gene), the gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene (i.e., LAMB3 gene), the gene therapy DNA vector VTvaf17-COL7a1 carrying the therapeutic gene (i.e., COL7a1 gene), the following was performed:

A) transfecting different human and animal cell lines with a gene therapy DNA vector;

B) injecting gene therapy DNA vectors into different human and animal tissues;

C) injecting a mixture of gene therapy DNA vectors into animal tissue;

D) autologous cells transfected with gene therapy DNA vectors are injected into human tissue.

These methods of use lack the potential risk of gene therapy for humans and animals due to the lack of regulatory elements in the gene therapy DNA vector that make up the nucleotide sequence of the viral genome and the lack of antibiotic resistance genes in the gene therapy DNA vector, as evidenced by the lack of regions of homology to the viral genome and antibiotic resistance genes in the nucleotide sequence of gene therapy DNA vector VTvaf17-KRT5, or gene therapy DNA vector VTvaf17-KRT14, or gene therapy DNA vector VTvaf17-LAMB3, or gene therapy DNA vector VTvaf17-COL7a1(SEQ ID No.1, or SEQ ID No.2, or SEQ ID No.3, or SEQ ID No.4, respectively).

It is known to experts in the field that the use of antibiotic resistance genes in gene therapy DNA vectors allows to obtain a preparative scale of these vectors by increasing the bacterial biomass in a nutrient medium containing selective antibiotics. Within the framework of the present invention, in order to ensure safe use of the gene therapy DNA vector VTvaf17 carrying KRT5, or KRT14, or LAMB3 or COL7a1 therapeutic genes, it was not possible to use selective nutrient media containing antibiotics. A method for obtaining strains for producing these gene therapy vectors based on the escherichia coli strain SCS110-AF was proposed as a technical solution for obtaining a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of KRT5, KRT14, LAMB3, COL7a1 genes) in order to scale up the production of gene therapy vectors on an industrial scale. Methods of production of E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1 involve production of competent cells of E.coli strain SCS110-AF, wherein gene therapy DNA vector VTvaf17-KRT5, or DNA vector VTvaf17-KRT14, or DNA vector VTvaf17-LAMB3, or DNA vector VTvaf17-COL7A1, respectively, are injected into these cells using transformation (electroporation) methods well known to the expert in the art. The obtained E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1 was used to produce gene therapy DNA vectors VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1, respectively, allowing the use of antibiotic-free medium.

To confirm the construction of E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1, transformation, selection, subsequent biomass growth, and extraction of plasmid DNA were performed.

To confirm the producibility, constructability and scale-up to production scale of the gene therapy DNA vector VTvaf17-KRT5 carrying the therapeutic gene (i.e., KRT5 gene), the gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene (i.e., LAMB 14 gene), the gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene (i.e., LAMB3 gene), the gene therapy DNA vector VTvaf17-COL7A1 carrying the therapeutic gene (i.e., COL7A1 gene), coli strains SCS110-AF/VTvaf17-KRT5, or e.coli strains SCS110-AF/VTvaf17-KRT14, or e.coli strains SCS110-AF/VTvaf17-LAMB3, or e.coli strains SCS110-AF/VTvaf17-COL7a1, each containing a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (i.e., KRT5, or KRT14, or LAMB3, or COL7a1 gene), are fermented on an industrial scale.

A method of expanding the production of bacterial consortia to an industrial scale for the isolation of a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of KRT5, KRT14, LAMB3, and COL7a1 genes) involving incubating a seed culture of escherichia coli strain SCS110-AF/VTvaf17-KRT5, or escherichia coli strain SCS110-AF/VTvaf17-KRT14, or escherichia coli strain SCS110-AF/VTvaf17-LAMB3, or escherichia coli strain SCS110-AF/VTvaf17-COL7a1 in an antibiotic-free nutrient medium that provides suitable biomass accumulation dynamics. After a sufficient amount of biomass has been reached in the logarithmic growth phase, the bacterial culture is transferred to an industrial fermentor and then cultured to stationary phase, then the fraction containing the therapeutic DNA product (i.e. gene therapy DNA vector VTvaf17-KRT5, or gene therapy DNA vector VTvaf17-KRT14, or gene therapy DNA vector VTvaf17-LAMB3, or gene therapy DNA vector VTvaf17-COL7a1) is extracted, multi-stage filtered, and purified by chromatographic methods. It is known to the expert in the field that the culture conditions of the strains, the composition of the nutrient medium (except for the absence of antibiotics), the equipment used, and the DNA purification method can vary within the framework of standard procedures, depending on the particular production line, but known methods of expansion, industrial production, and purification of DNA vectors using the E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1 fall within the scope of the present invention.

The disclosure described herein is illustrated by way of examples of embodiments of the invention.

The essence of the invention is explained in the following examples.

Example 1.

Generation of Gene therapy DNA vector VTvaf17-KRT5 carrying the therapeutic Gene, KRT5 gene.

The coding region (1776bp) of KRT5 gene was cloned into 3165bp DNA vector VTvaf17 via BamHI and HindIII restriction sites to construct gene therapy DNA vector VTvaf17-KRT 5. Total RNA was isolated from biological human tissue samples, followed by reverse transcription reaction using commercial kit Mint-2 (Evagen, Russia), and using the following oligonucleotides and commercial kitThe coding region (1776bp) of the KRT5 gene was obtained by PCR amplification with high fidelity DNA polymerase (New England Biolabs, USA):

KRT5_FTTTGGATCCACCATGTCTCGCCAGTCAAGTGTGTCCTTC，

KRT5_RAATAAGCTTCTAGCTCTTGAAGCTCTTCCGGGAGG，

the gene therapy DNA vector VTvaf17 was constructed by integrating six fragments of DNA derived from different sources:

(a) the origin of replication was generated by PCR amplification of the pBR322 region of a commercially available plasmid with point mutations;

(b) the EF1a promoter region was generated by PCR amplification of a site of human genomic DNA;

(d) the RNA-OUT regulatory site of transposon Tn10 was synthesized from oligonucleotides;

(e) the kanamycin resistance gene was generated by PCR amplification of a site of the commercially available human plasmid pET-28;

(f) polylinkers are generated by annealing two synthetic oligonucleotides.

According to the manufacturer's instructions, use the commercial kitHigh fidelity DNA polymerase (New England B)iolabs, USA) were subjected to PCR amplification. These fragments have overlapping regions that allow them to be combined with subsequent PCR amplification. The oligonucleotides Ori-F and EF1-R integration fragments (a) and (b) were used, and the oligonucleotides hGH-F and Kan-R integration fragments (c), (d) and (e) were used. The resulting fragments were then integrated by restriction with sites BamHI and NcoI, followed by ligation. This results in a plasmid still lacking polylinkers. To add it, the plasmid was cut through BamHI and EcoRI sites and then ligated with fragment (f). Thus, a 4182bp vector was constructed which carried the kanamycin resistance gene flanked by SpeI restriction sites. The gene was then cleaved with the SpeI restriction site and the remaining fragment ligated to itself. This resulted in a 3165bp gene therapy DNA vector VTvaf17, which was recombinant and allowed antibiotic-free selection.

The amplified product of the coding region of KRT5 gene was cleaved with the DNA vector VTvaf17 using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

This gave the 4929bp DNA vector VTvaf17-KRT5 having the nucleotide sequence SEQ ID No.1 and the general structure shown in FIG. 1A.

Example 2.

Generation of Gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic Gene, KRT14 gene.

The KRT14 gene coding region (1422bp) was cloned into 3165bp DNA vector VTvaf17 via BamHI and HindIII restriction sites to construct gene therapy DNA vector VTvaf17-KRT 14. Total RNA was isolated from biological human tissue samples, followed by reverse transcription reaction using commercial kit Mint-2 (Evagen, Russia), and using the following oligonucleotides and commercial kitThe coding region (1422bp) of the KRT14 gene was obtained by PCR amplification with high fidelity DNA polymerase (New England Biolabs, USA):

KRT14_F TTTGGATCCACCATGACCACCTGCAGCCGCCAG，

KRT14_RAATAAGCTTTCAGTTCTTGGTGCGAAGGACCTGC，

the amplified product and the DNA vector VTvaf17 were cut with the restriction enzymes BamHI and HindIII (New England Biolabs, USA).

This gave a 4575bp DNA vector VTvaf17-KRT14 having the nucleotide sequence SEQ ID No.2 and the general structure shown in FIG. 1B.

The gene therapy DNA vector VTvaf17 was constructed as described in example 1.

Example 3.

Production of gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene, human LAMB3 gene.

The coding region (3521bp) of the LAMB3 gene was cloned into a 3165bp DNA vector VTvaf17 via SalI and EcoRI restriction sites to construct a gene therapy DNA vector VTvaf17-LAMB 3. Total RNA was isolated from biological human tissue samples, followed by reverse transcription reaction using commercial kit Mint-2 (Evagen, Russia), and using the following oligonucleotides and commercial kitPCR amplification with high fidelity DNA polymerase (New England Biolabs, USA) yielded the coding region of LAMB3 gene (3521 bp):

LAMB3_FTTAGTCGACCACCATGAGACCATTCTTCCTCTTG，

LAMB3_R ATAGAATTCACTTGCAGGTGGCATAGTAGAG，

the amplification product and the DNA vector VTvaf17 were cut with the restriction enzymes SalI and EcoRI (New England Biolabs, USA).

This gave the 6674bp DNA vector VTvaf17-LAMB3 which had the nucleotide sequence SEQ ID No.3 and the general structure is shown in FIG. 1C.

The gene therapy DNA vector VTvaf17 was constructed as described in example 1.

Example 4.

Production of the Gene therapy DNA vector VTvaf17-COL7A1 carrying the therapeutic Gene, COL7A1 gene.

The coding region (8838bp) of COL7A1 gene was cloned into 3165bp DNA vector VTvaf17 through SalI and EcoRI restriction sites to construct gene therapy DNA vector VTvaf17-COL7A 1. Total RNA was isolated from biological human tissue samples, followed by reverse transcription using the commercial kit Mint-2 (Evagen), andusing the following oligonucleotides and a commercially available kitPCR amplification with high fidelity DNA polymerase (New England Biolabs, USA) yielded the coding region (8838bp) of COL7A1 gene:

COL7A1_FATCGTCGACCCATGACGCTGCGGCTTCTGGT，

COL7A1_R ATAGAATTCAGTCCTGGGCAGTACCTGTC；

the amplification product and the DNA vector VTvaf17 were cut with the restriction enzymes SalI and EcoRI (New England Biolabs, USA).

This gave the 11990bp DNA vector VTvaf17-COL7A1 which had the nucleotide sequence SEQ ID No.4 and the general structure is shown in FIG. 1D.

The gene therapy DNA vector VTvaf17 was constructed as described in example 1.

Example 5.

Evidence of the ability of the gene therapy DNA vector VTvaf17-KRT5 carrying the therapeutic gene, KRT5 gene, to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Changes in mRNA accumulation of KRT5 therapeutic genes were evaluated 48h after transfection with the gene therapy DNA vector VTvaf17-KRT5 carrying the human KRT5 gene in HDFa primary human dermal fibroblast cultures (ATCC PCS-201-01). The amount of mRNA was determined dynamically by accumulation of cDNA amplicons in real-time PCR.

Primary human dermal fibroblast cultures were used to evaluate changes in the accumulation of therapeutic KRT5mRNA with HDFa. Serum-free fibroblast growth kit was used under standard conditions (37 ℃, 5% CO2) (iii)PCS-201-040). The growth medium was changed every 48 hours during the culture.

To achieve 90% confluence, at 5 × 10 per well 24 hours prior to transfection procedure⁴Amount of Individual cells were seeded 24In the well plate. Transfection of the gene therapy DNA vector VTvaf17-KRT5 expressing the human KRT5 gene was performed using Lipofectamine3000 (Thermifier scientific, USA) according to the manufacturer's recommendations. In test tube 1, 1. mu.L of the DNA vector VTvaf17-KRT5 solution (concentration 500 ng/. mu.L) and 1. mu.L of reagent P3000 were added to 25. mu.L of medium Opti-MEM (Gibco, USA). The preparation was mixed by gentle shaking. In tube 2, 1. mu.L of Lipofectamine3000 solution was added to 25. mu.L of culture medium Opti-MEM (Gibco, USA). The preparation was mixed by gentle shaking. The contents from tube 1 were added to the contents of tube 2 and the mixture was incubated for 5 minutes at room temperature. The resulting solution was added dropwise to the cells in a volume of 40. mu.l.

HDFa cells transfected with gene therapy DNA vector VTvaf17 lacking the inserted therapeutic gene (cDNA of KRT5 gene is not shown in the figure before and after transfection with gene therapy DNA vector VTvaf17 lacking the inserted therapeutic gene) were used as reference. The reference vector for transfection VTvaf17 was prepared as described above.

Extraction of HDFa cell total RNA was performed using Trizol reagent (Invitrogen, USA) according to the manufacturer's recommendations. 1ml Trizol reagent was added to the wells containing the cells, homogenized, and heated at 65 ℃ for 5 minutes. The sample was then centrifuged at 14000g for 10 minutes and reheated at 65 ℃ for 10 minutes. Then 200. mu.L of chloroform was added, and the mixture was gently stirred and centrifuged at 14000g for 10 minutes. The aqueous phase was then separated and mixed with 1/10 volumes of 3M sodium acetate pH 5.2 and an equal volume of isopropanol. The samples were incubated at-20 ℃ for 10 minutes and then centrifuged at 14000g for 10 minutes. The precipitated RNA was washed in 1ml of 70% ethanol, air-dried, and dissolved in 10. mu.L of RNase-free water. Evaluation of cDNA amplicon accumulation by real-time PCR kinetic determination of KRT5mRNA expression levels after transfection. For the production and amplification of cDNA specific to the human KRT5 gene, the following KRT5_ SF and KRT5_ SR oligonucleotides were used:

KRT5_SF CGAAGCCGAGTCCTGGTATC，

KRT5_SR TTGGCGCACTGTTCTTGAC

the length of the amplification product is 162 bp.

Reverse transcription reactions and PCR amplifications were performed using SYBR GreenQuantitect RT-PCR kit for real-time PCR (Qiagen, USA). The reaction was carried out in a volume of 20 μ L, comprising: 25 μ L QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM magnesium chloride, 0.5 μm each primer and 5 μ L RNA. For the reaction, a CFX96 amplification apparatus (Bio-Rad, USA) was used under the following conditions: reverse transcription at 42 ℃ for 30min, denaturation at 98 ℃ for 15min for 1 cycle, followed by 40 cycles comprising denaturation at 94 ℃ for 15s, primer annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30 s. The B2M (human β 2-microglobulin) gene listed in GenBank database accession No. NM004048.2 was used as a reference gene. Positive controls included amplicons from PCR on a matrix represented by plasmids containing cDNA sequences of KRT5 and B2M genes at known concentrations. The negative control included deionized water. Dynamic real-time quantification of the accumulation of KRT5 and B2M gene cDNA amplicons was performed using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The graph derived from the assay is shown in figure 2.

Figure 2 shows that the specific mRNA levels of the human KRT5 gene were greatly increased due to transfection of HDFa primary human fibroblast cultures with gene therapy DNA vector VTvaf17-KRT5, confirming the ability of the vector to penetrate eukaryotic cells and express the KRT5 gene at the mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-KRT5 in order to increase the expression level of the KRT5 gene in eukaryotic cells.

Example 6.

Evidence of the ability of the gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene, KRT14 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Changes in mRNA accumulation of KRT14 therapeutic genes were evaluated in HEKa primary human epidermal keratinocyte cultures (ATCC PCS-200-011) 48 hours after transfection with the gene therapy DNA vector VTvaf17-KRT14 carrying the human KRT14 gene. The amount of mRNA was determined by the cumulative kinetics of cDNA amplicons in real-time PCR.

In keratinocyte growth kit (PCS-200-040^TM) HEKa primary human epidermal keratinocyte cultures were cultured under standard conditions (37 ℃, 5% CO 2). To achieve 90% confluence, 24 hours prior to transfection procedure, at 5 × 10 per well⁴Amount of individual cells were seeded into 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-KRT14 expressing the human KRT14 gene according to the procedure described in example 5. The B2M (Beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. HEKa cell cultures transfected with the gene therapy DNA vector VTvaf17 lacking the therapeutic gene (cDNA for KRT14 gene is not shown in the figure before and after transfection with the gene therapy DNA vector VTvaf17 lacking the inserted therapeutic gene) were used as reference. RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 5, except for oligonucleotides having different sequences from example 5. For amplification of cDNA specific to the human KRT14 gene, the following KRT14_ SF and KRT14_ SR oligonucleotides were used:

KRT14_SF TCCAGGAGATGATTGGCAGC，

KRT14_SR GGATGACTGCGATCCAGAGG

the length of the amplification product is 197 bp.

Positive controls included amplicons from PCR on a matrix represented by plasmids containing the KRT14 and B2M gene cDNA sequences at known concentrations. The negative control included deionized water. The PCR products obtained by amplification, i.e., KRT14 and B2M gene cDNA, were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The graph derived from the assay is shown in figure 3.

Figure 3 shows that due to gene therapy DNA vector VTvaf17-KRT14 transfected HEKa cell cultures, the specific mRNA levels of the human KRT14 gene were greatly increased, confirming the ability of the vector to penetrate eukaryotic cells and express the KRT14 gene at the mRNA level. The research result also proves the feasibility of improving the expression level of the KRT14 gene in eukaryotic cells by using the gene therapy DNA vector VTvaf17-KRT 14.

Example 7.

Evidence of the ability of the gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene, i.e., the LAMB3 gene, to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

Human Skeletal myoblasts (HSKM) 48 hours after transfection with gene therapy DNA vector VTvaf17-LAMB3 carrying Human LAMB3 geneCat 12555), changes in the accumulation of mRNA of the therapeutic gene LAMB3 were evaluated. The amount of mRNA was determined dynamically by accumulation of cDNA amplicons in real-time PCR.

Modified Eagle Medium (DMEM) in Dulbecco30-2002^TM) HSKM human skeletal muscle myoblast cell cultures were cultured under standard conditions (37 ℃, 5% CO2), supplemented with 2% horse serum (Gibco Cat.16050130). To achieve 90% confluence, 24 hours prior to transfection procedure, at 5 × 10 per well⁴Amount of individual cells were seeded into 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-LAMB3 expressing the human LAMB3 gene according to the procedure described in example 5. The B2M (Beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. HSKM cell cultures transfected with the gene therapy DNA vector VTvaf17 lacking the therapeutic gene (cDNA of the LAMB3 gene is not shown in the figure before and after transfection with the gene therapy DNA vector VTvaf17 lacking the inserted therapeutic gene) were used as reference. RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 5, except for oligonucleotides having different sequences from example 5. For amplification of cDNA specific to the human LAMB3 gene, the following LAMB3_ SF and LAMB3_ SR oligonucleotides were used:

LAMB3_SF CAGAGGAGCTGTTTGGGGAG，

LAMB3_SR CCCATTGATGTGGTCACGGA

the length of the amplification product is 155 bp.

Positive controls included amplicons from PCR on a matrix represented by plasmids containing cDNA sequences of the LAMB3 and B2M genes at known concentrations. The negative control included deionized water. The PCR products obtained by amplification, i.e., LAMB3 and B2M gene cDNA, were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The graph derived from the assay is shown in figure 4.

FIG. 4 shows that the specific mRNA level of human LAMB3 gene is greatly increased due to transfection of HSKM human skeletal myoblast cell culture with gene therapy DNA vector VTvaf17-LAMB3, confirming the ability of the vector to penetrate eukaryotic cells and express LAMB3 gene at the mRNA level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-LAMB3 in order to increase the expression level of the LAMB3 gene in eukaryotic cells.

Example 8.

Evidence of the ability of the gene therapy DNA vector VTvaf17-COL7A1 carrying the therapeutic gene, i.e., the COL7A1 gene, to penetrate eukaryotic cells and its functional activity at the therapeutic gene mRNA expression level. This example also demonstrates the feasibility of using gene therapy DNA vectors carrying therapeutic genes.

(HUVEC) in Normal human Primary umbilical vein endothelial cells (HUVEC) 48 hours after transfection with Gene therapy DNA vector carrying human COL7A1 Gene VTvaf17-COL7A1PCS-100-010^TM) In (1), the change in accumulation of mRNA of COL7A1 therapeutic gene was evaluated. The amount of mRNA was determined dynamically by accumulation of cDNA amplicons in real-time PCR.

Under standard conditions (37 ℃, 5% CO2), in the presence of an endothelial cell growth kit, BBE: (B)PCS-100-040^TM) The vascular cell basic medium (ATCC PCS-100-030) of the culture medium is used for culturing the HUVEC human endothelial cell culture so as to achieve90% confluence, 24 hours before transfection, at 5 × 10 per well⁴Amount of individual cells were seeded into 24-well plates. Lipofectamine3000(ThermoFisher Scientific, USA) was used as the transfection reagent. Transfection was performed with the gene therapy DNA vector VTvaf17-COL7A1 expressing the human COL7A1 gene according to the procedure described in example 5. HUVEC human endothelial cell cultures transfected with the gene therapy DNA vector VTvaf17 not carrying the therapeutic gene (cDNA for the COL7A1 gene is not shown in the figure before and after transfection with the gene therapy DNA vector VTvaf17 lacking the inserted therapeutic gene) were used as reference. RNA isolation, reverse transcription reaction and real-time PCR were performed as described in example 5, except for oligonucleotides having different sequences from example 5. For amplification of cDNA specific to human COL7a1 gene, the following COL7a1_ SF and COL7a1_ SR oligonucleotides were used:

COL7A1_SFTTTGGATCCACCATGTCTCGCCAGTCAAGTGTGTCCTTC，

COL7A1_SR ATCATTCCACTGGGGCCTG

the length of the amplification product is 184 bp.

Positive controls included amplicons from PCR on a matrix represented by plasmids containing COL7a1 and B2M gene cDNA sequences at known concentrations. The B2M (Beta-2-microglobulin) gene listed under accession No. NM004048.2 in GenBank database was used as reference gene. The negative control included deionized water. The PCR products obtained by amplification, i.e., COL7A1 and B2M gene cDNAs, were quantified in real time using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). The graph derived from the assay is shown in figure 5.

FIG. 5 shows that the specific mRNA level of human COL7A1 gene was greatly increased due to transfection of HUVEC human endothelial cell culture with gene therapy DNA vector VTvaf17-COL7A1, confirming the ability of the vector to penetrate eukaryotic cells and express COL7A1 gene at the mRNA level. The presented results also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-COL7A1 in order to increase the expression level of the COL7A1 gene in eukaryotic cells.

Example 9.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-KRT5 carrying the KRT5 gene to facilitate increased expression of KRT5 protein in mammalian cells.

After transfection of HDFa human dermal fibroblasts (ATCC PCS-201-01) with a DNA vector VTvaf17-KRT5 carrying the human KRT5 gene, lysates of these cells were evaluated for changes in the concentration of KRT5 protein.

Human dermal fibroblast cultures were cultured as described in example 5.

To achieve 90% confluence, 24 hours prior to transfection procedure, at 5 × 10 per well⁴Amount of individual cells were seeded into 24-well plates. Transfection was performed using the 6 th generation Superpect transfection reagent (Qiagen, Germany). An aqueous dendrimer solution (a) without a DNA carrier and a DNA carrier VTvaf17(B) lacking the cDNA of the KRT5 gene were used as references, and a DNA carrier VTvaf17-KRT5(C) carrying the human KRT5 gene was used as transfection agent. The DNA-dendrimer complexes were prepared according to the manufacturer's procedure (QIAGEN, SuperFect transformation Reagent Handbook,2002), with some modifications. For cell transfection in 1 well of a 24-well plate, the medium was added to 1 μ g of DNA vector dissolved in TE buffer to a final volume of 60 μ L, then 5 μ L of SuperFect transfection reagent was added and gently mixed by pipetting 5 times. The complex was incubated at room temperature for 10-15 minutes. The medium was then removed from the wells, which were washed with 1ml PBS buffer. To the resulting complex, 350. mu.L of medium containing 10. mu.g/ml gentamicin was added, gently mixed, and cells were added. Cells were incubated with the complexes at 37 ℃ in the presence of 5% CO2 for 2-3 hours.

The medium was then carefully removed and the viable cell array was washed with 1ml of PBS buffer. Then, a medium containing 10. mu.g/ml gentamicin was added and incubated at 37 ℃ for 24-48 hours in the presence of 5% CO 2.

KRT5 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using human KRT5/CK5/Cytokeratin 5ELISA kit (Sandwich ELISA) (Life span BioSciences CAT. LS-F8194-1, USA) according to the manufacturer's protocol, using optical density detection using ChemWell Automatic EIA and Chemistry Analyzer (Awancy Technology Inc., USA).

To measure the value of concentration, a calibration curve was used, which was constructed using a reference sample from the kit with known concentrations of KRT5 protein. The sensitivity is at least 15.6pg/ml, measured in the range of 15.6pg/ml to 1000 pg/ml. Statistical processing of results and visualization of data was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 6.

Fig. 6 shows that transfection of HDFa human dermal fibroblasts with gene therapy DNA vector VTvaf17-KRT5 resulted in an increase in KRT5 protein concentration compared to the reference sample, confirming the ability of the vector to penetrate eukaryotic cells and express the KRT5 gene at the protein level. The presented results also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-KRT5 to facilitate increasing the expression level of the KRT5 gene in eukaryotic cells.

Example 10.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene in order to increase the expression of KRT14 protein in mammalian cells.

After transfection of a culture of HEKa primary human epidermal keratinocytes (ATCC PCS-200-01) with a DNA vector VTvaf17-KRT14 carrying the human KRT14 gene, lysates of these cells were evaluated for changes in the concentration of KRT14 protein. Cells were cultured as described in example 6.

Transfection was performed using the 6 th generation Superpect transfection reagent (Qiagen, Germany). The aqueous dendrimer solution without DNA carrier (A) and the DNA carrier VTvaf17(B) lacking the cDNA of the KRT14 gene were used as references, and the DNA carrier VTvaf17-KRT14(C) carrying the human KRT14 gene was used as transfection agent. The preparation of DNA dendrimers and transfection of HEKa cells were performed according to the procedure described in example 9.

After transfection, cells were washed 3 times with PBS, then 1ml PBS was added to the cells and the cells were frozen/thawed 3 times. The suspension was then centrifuged at 15000rpm for 15 minutes and the supernatant was collected and used for quantification and determination of the therapeutic protein. The KRT14 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the human KRT14/CK14/Cytokeratin 14 ELISA kit (Sandwich ELISA) (Life span BioSciences CAT. LS-F7936, USA) using densitometric detection with ChemWell Automatic EIA and Chemistry Analyzer (Awarency Technology Inc., USA) according to the manufacturer's method.

To measure the value of concentration, a calibration curve was used, which was constructed using a reference sample from the kit with known concentrations of KRT14 protein. The sensitivity is at least 156pg/ml and the measurement range is 156pg/ml to 10000 pg/ml. Statistical processing of results and visualization of data was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in figure 7.

Figure 7 shows that transfection of HEKa primary human epidermal keratinocyte cultures with gene therapy DNA vector VTvaf17-KRT14 resulted in increased concentrations of KRT14 protein compared to the reference samples, demonstrating the ability of the vector to penetrate eukaryotic cells and express the KRT14 gene at the protein level. The research result also proves the feasibility of improving the expression level of the KRT14 gene in eukaryotic cells by using the gene therapy DNA vector VTvaf17-KRT 14.

Example 11.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-LAMB3 carrying the LAMB3 gene in order to increase the expression of the LAMB3 protein in mammalian cells.

In transfecting human skeletal myoblasts (HSKM) with DNA vector VTvaf17-LAMB3 carrying human LAMB3 gene(s) ((HSKM))Cat 12555), the change in the concentration of LAMB3 protein in the lysates of these cells was evaluated. Cells were cultured as described in example 7.

Transfection was performed using the 6 th generation Superpect transfection reagent (Qiagen, Germany). The aqueous dendrimer solution (a) without DNA carrier and the DNA vector VTvaf17(B) lacking the cDNA of the LAMB3 gene were used as references, and the DNA vector VTvaf17-LAMB3(C) carrying the human LAMB3 gene was used as transfection agent. The preparation of DNA dendrimers and transfection of HSKM cells were performed according to the procedure described in example 9.

Enzyme-linked immunosorbent assay (ELISA) assays were carried out on LAMB3 protein using the human LAMB3/Laminin beta 3 ELISA kit (Sandwich ELISA) (Life span BioSciences CAT. LS-F33141, USA) and densitometric measurements were carried out using ChemWell Automatic EIA and Chemistry Analyzer (Awanency Technology Inc., USA) according to the manufacturer's method.

To measure the values of the concentrations, a calibration curve was used, which was constructed using reference samples from the kit with known concentrations of the LAMB3 protein. The sensitivity is at least 9.375pg/ml, and the measurement range is 15.625-8000 pg/ml. Statistical processing of results and visualization of data was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 8.

Fig. 8 shows that transfection of HSKM human skeletal myoblast cell cultures with gene therapy DNA vector VTvaf17-LAMB3 resulted in increased concentrations of LAMB3 protein compared to the reference samples, confirming the ability of the vector to penetrate eukaryotic cells and express the LAMB3 gene at the protein level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-LAMB3 in order to increase the expression level of the LAMB3 gene in eukaryotic cells.

Example 12.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-COL7A1 carrying the COL7A1 gene in order to increase the expression of COL7A1 protein in mammalian cells.

Transfection of Normal human Primary umbilical vein endothelial cells (HUVEC) with Gene therapy DNA vector carrying human COL7A1 Gene VTvaf17-COL7A1 (HUVEC)PCS-100-010^TM) The change in concentration of COL7a1 protein in lysates of these cells was assessed 48 hours later. Cells were cultured as described in example 8.

Transfection was performed using the 6 th generation Superpect transfection reagent (Qiagen, Germany). The aqueous dendrimer solution (A) without a DNA carrier and the DNA carrier VTvaf17(B) lacking the cDNA of COL7A1 gene were used as references, and the DNA carrier VTvaf17-COL7A1(C) carrying human COL7A1 gene was used as transfection agent. The preparation of the DNA dendrimers and transfection of HUVEC cells were carried out according to the method described in example 9.

COL7A1 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using human COL7A1/Collagen VII ELISA kit (Sandwich ELISA) (Life span BioSciences CAT. LS-F11164, USA) using densitometric detection with ChemWell Automatic EIA and Chemistry Analyzer (Awarency Technology Inc., USA) according to the manufacturer's protocol.

To measure the value of the concentration, a calibration curve was used, which was constructed using a reference sample from the kit with a known concentration of COL7a1 protein. The sensitivity is at least 156pg/ml and the measurement range is 156pg/ml to 10000 pg/ml. Statistical processing of results and visualization of data was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 9.

FIG. 9 shows that transfection of HUVEC primary human endothelial cell cultures with gene therapy DNA vector VTvaf17-COL7A1 resulted in increased concentrations of COL7A1 protein compared to the reference samples, confirming the ability of the vector to penetrate eukaryotic cells and express the COL7A1 gene at the protein level. The results of this study also demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-COL7A1 to facilitate increased expression levels of the COL7A1 gene in eukaryotic cells.

Example 13.

Gene therapy DNA vector carrying COL7a1 gene VTvaf17-COL7a1 in order to improve the efficacy and proof of feasibility of expression of COL7a1 protein in human tissues.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-COL7A1 carrying the therapeutic gene, i.e., the COL7A1 gene, and the feasibility of its use, the change in COL7A1 protein concentration in human skin was evaluated after injection of the gene therapy DNA vector VTvaf17-COL7A1 carrying the human COL7A1 gene.

To analyze the change in COL7a1 protein concentration, the gene therapy DNA vector VTvaf17-COL7a1 carrying the COL7a1 gene was injected into the forearm skin of three patients, together with a placebo, which is the gene therapy DNA vector VTvaf17 lacking cDNA of the COL7a1 gene.

Patient 1, female, 44 years old (P1); patient 2, female, 50 years old (P2); patient 3, male, 53 years old (P3). The use of polyethyleneimine Transfection reagent cGMP grade in vivo-JetPEI (Polyplus Transfection, France) as a transport system. The gene therapy DNA vector VTvaf17-COL7A1 containing COL7A1 gene cDNA and the gene therapy DNA vector VTvaf17 without COL7A1 gene cDNA used as placebo were dissolved in sterile nuclease-free water. To obtain the genetic construct, the DNA-cGMP grade in vivo-JetPEI complex was prepared according to the manufacturer's recommendations.

For each genetic construct, the gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector carrying the COL7A1 gene VTvaf17-COL7A1 were injected in an amount of 1mg using a channel method in which a 30G needle was directed to a depth of 2-3 mm. The injectable volume of gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector carrying COL7a1 gene VTvaf17-COL7a1 was 0.3ml for each genetic construct. The injection point for each genetic construct was located at 8 to 10cm intervals of the forearm site.

After injection of the genetic construct of the gene therapy DNA vector, a biopsy sample was taken on day 2. Biopsy samples were taken from the skin of patients injected with the sites of the gene therapy DNA vector VTvaf17-COL7A1(I) carrying the COL7A1 gene, the gene therapy DNA vector VTvaf17 (placebo) (II) and the intact skin (III) using the skin biopsy device Epithesasy 3.5 (Memax SRL, Italy). The patient's skin at the biopsy site was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3 and weighed about 11 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used to assay for therapeutic proteins using enzyme-linked immunosorbent assay (ELISA). COL7A1 protein assay was performed by enzyme-linked immunosorbent assay (ELISA) as described in example 12, and densitometric detection was performed using ChemWell automated EIA and Chemistry Analyzer (Awanency Technology Inc., USA).

Optical density measurements were performed using ChemWell Automatic EIA and Chemical Analysis (Awarence Technology Inc., USA) according to the manufacturer's method, statistical processing of results and data visualization was performed using R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 10.

FIG. 10 shows that the concentration of COL7A1 protein in the skin of all three patients in the injection site of the gene therapy DNA vector VTvaf17-COL7A1 carrying the therapeutic gene for human COL7A1 is increased compared to the concentration of COL7A1 protein in the injection site of the gene therapy DNA vector VTvaf17 (placebo) lacking the human COL7A1 gene, demonstrating the efficacy of the gene therapy DNA vector VTvaf17-COL7A1 and demonstrating the feasibility of its use (particularly after intradermal injection of the gene therapy DNA vector in human tissue).

Example 14.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-LAMB3 carrying the LAMB3 gene in order to improve the expression of the LAMB3 protein in human tissues.

To confirm the efficacy of the gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene of LAMB3 and the feasibility of its use, the change in the concentration of LAMB3 protein in human muscle tissue was evaluated after injection of the gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene, i.e., the human LAMB3 gene.

To analyze the change in the concentration of LAMB3 protein, gene therapy DNA vector VTvaf17-LAMB3 carrying the LAMB3 gene was injected into the gastrocnemius muscles of three patients along with a transport molecule, along with a placebo, gene therapy DNA vector VTvaf17 lacking the LAMB3 gene cDNA, and a transport molecule.

Patient 1, female, 40 years old (P1); patient 2, female, 43 years old (P2); patient 3, male, 54 years old (P3). Adopting a polyethyleneimine Transfection reagent cGMP grade in vivo-JetPEI (Polyplus Transfection, France) as a transport system; sample preparation was performed according to the manufacturer's recommendations.

For each genetic construct, the gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector carrying the LAMB3 gene VTvaf17-LAMB3 were injected in an amount of 1mg using the channel method (where a 30G needle was brought to a depth of about 10 mm). The injectable volume of gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-LAMB3 carrying the LAMB3 gene was 0.3ml for each genetic construct. The injection point for each genetic construct was located in the middle of the 8 to 10cm interval.

After injection of the genetic construct of the gene therapy DNA vector, a biopsy sample was taken on day 2. Biopsy samples were taken from the muscle tissue of patients injected with the site of gene therapy DNA vector VTvaf17-LAMB3(I) carrying the LAMB3 gene, gene therapy DNA vector VTvaf17 (placebo) (II) and the intact site of the gastrocnemius muscle (III) using the skin biopsy device MAGNUM (BARD, USA). The patient's skin in the biopsy site was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. The biopsy sample was approximately 20mm3 in size and weighed up to 22 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used for the assay of therapeutic proteins.

The LAMB3 protein was assayed by enzyme-linked immunosorbent assay (ELISA) as described in example 11, using optical density detection by ChemWell Automatic EIA and Chemistry Analyzer (Awarency Technology Inc., USA).

Statistical processing of results and visualization of data was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 11.

Figure 11 shows that the concentration of LAMB3 protein in the gastrocnemius muscle of all three patients in the injection site of gene therapy DNA vector VTvaf17-LAMB3 carrying the therapeutic gene, human LAMB3 gene, is increased compared to the concentration of LAMB3 protein in the injection site of gene therapy DNA vector VTvaf17 (placebo) lacking the human LAMB3 gene, indicating the efficacy of gene therapy DNA vector VTvaf17-LAMB3 and demonstrating the feasibility of its use (particularly after intramuscular injection of gene therapy DNA vector in human tissue).

Example 15.

Evidence of the efficacy and feasibility of using a gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene in order to increase the expression of KRT14 protein in human tissues.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene, i.e., the KRT14 gene, and the feasibility of its use, changes in the concentration of KRT14 protein in human skin were evaluated after injection of the gene therapy DNA vector VTvaf17-KRT14 carrying the human KRT14 gene.

To analyze changes in KRT14 protein concentration, gene therapy DNA vector VTvaf17-KRT14 carrying KRT14 gene was injected into the forearm skin of three patients simultaneously with placebo, gene therapy DNA vector VTvaf17 lacking KRT14 gene cDNA.

Patient 1, female, 39 years old (P1); patient 2, male, 61 years old (P2); patient 3, male, 38 years old (P3). The use of polyethyleneimine Transfection reagent cGMP grade in vivo-JetPEI (Polyplus Transfection, France) as a transport system. The gene therapy DNA vector VTvaf17-KRT14 containing KRT14 gene cDNA and the gene therapy DNA vector VTvaf17 lacking KRT14 gene cDNA used as placebo were dissolved in sterile nuclease-free water. To obtain the genetic construct, the DNA-cGMP grade in vivo-JetPEI complex was prepared according to the manufacturer's recommendations.

For each genetic construct, the gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector carrying the KRT14 gene VTvaf17-KRT14 were injected in an amount of 1mg using a channel method in which a 30G needle was used to a depth of 3 mm. The injectable volume of gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene was 0.3ml for each genetic construct. The injection point for each genetic construct was located at 8 to 10cm intervals of the forearm site.

After injection of the genetic construct of the gene therapy DNA vector, a biopsy sample was taken on day 2. Biopsy samples were taken from the patient's skin at the site injected with gene therapy DNA vector VTvaf17-KRT14(I) carrying KRT14 gene, gene therapy DNA vector VTvaf17 (placebo) (II) and from intact skin (II) using skin biopsy device Epitheasy 3.5(Medax SRL, Italy). The patient's skin in the biopsy site was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3 and weighed about 11 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. Therapeutic angiogenin proteins were assayed using enzyme-linked immunosorbent assay (ELISA) as described in example 10, and densitometric detection was performed using ChemWell Automated EIA and Chemistry Analyzer (Aware Technology Inc., USA).

Statistical processing and data visualization of the results was performed with R-3.0.2 (https:// www.r-project. org /). The graph derived from the assay is shown in fig. 12.

Figure 12 shows that the concentration of KRT14 protein in the skin of all three patients in the injection site of the gene therapy DNA vector VTvaf17-KRT14 carrying the human KRT14 therapeutic gene is increased compared to the concentration of KRT14 protein in the injection site of the gene therapy DNA vector VTvaf17 (placebo) lacking the human KRT14 gene, indicating the efficacy of the gene therapy DNA vector VTvaf17-KRT14 and demonstrating the feasibility of its use (particularly after intradermal injection of the gene therapy DNA vector in human tissue).

Example 16.

Evidence of the efficacy of the gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene and its feasibility to increase the use of expression levels of KRT14 protein in human tissues by injecting autologous fibroblasts transfected with the gene therapy DNA vector VTvaf17-KRT 14.

To demonstrate the efficacy of the gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene and the feasibility of its use, changes in the concentration of KRT14 protein in the skin of patients were evaluated after injection of autologous fibroblast cultures of the same patients transfected with the gene therapy DNA vector VTvaf17-KRT14 in the skin of the patients.

Suitable autologous fibroblast cell cultures transfected with the gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene were injected into the skin of the forearm of the patient, simultaneously with placebo in the form of autologous fibroblast cell cultures transfected with the gene therapy DNA vector VTvaf17 not carrying the KRT14 gene.

Human primary fibroblast cultures were isolated from patient skin biopsy samples. Biopsy samples were taken from the skin in the uv protected area (i.e. behind the ear or inside the elbow) using a skin biopsy device Epitheasy 3.5(Medax SRL, Italy). The biopsy sample was about 10mm and about 11 mg. The skin of the patient was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. Primary cell cultures were cultured in DMEM medium containing 10% fetal bovine serum and 100U/ml ampicillin in the presence of 5% CO2 at 37 ℃. Subculture and medium change were performed every 2 days. The total duration of culture growth does not exceed 25-30 days. Then 5x10 was removed from the cell culture broth⁴Aliquots of individual cells. Fibroblast cultures of patients were transfected with gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene and placebo (i.e., VTvaf17 vector not carrying the KRT14 therapeutic gene).

Transfection is carried out using cationic polymers, such as polyethyleneimine JETPEI (Polyplus transfection, France) according to the manufacturer's instructions. Cells were cultured for 72 hours and then injected into patients. Injection of autologous fibroblast cell cultures from patients transfected with gene therapy DNA vectors and autologous fibroblast cell cultures from patients transfected with gene therapy DNA vector VTvaf17 (as placebo) was performed in the forearm using the channel method (where a 13mm long 30G needle was brought to a depth of about 3 mm). The concentration of modified autologous fibroblasts in the injected suspension was about 5mln cells per 1ml of suspension, and the dose of cells injected did not exceed 15 mln. The injection points for the autologous fibroblast cultures were located at 8 to 10cm intervals.

After injection of autologous fibroblast cell cultures transfected with gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene, KRT14 gene, and placebo, biopsy samples were taken on day 4. Biopsy was taken from the patient's skin at the site of injection of autologous fibroblast cultures (C) transfected with gene therapy DNA vector VTvaf17-KRT14 carrying the therapeutic gene, KRT14 gene, non-transfected autologous fibroblast cultures (placebo) (B) with gene therapy DNA vector VTvaf17 not carrying the KRT14 therapeutic gene, and from the intact skin site (a) using the skin biopsy device epithemease 3.5(Medax SRL, Italy). The patient's skin in the biopsy site was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3 and weighed about 11 mg. The sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used to assay for therapeutic proteins as described in example 15.

The graph derived from the assay is shown in fig. 13.

Figure 13 shows the increased concentration of KRT14 protein in the region of the patient's skin in the injection site of autologous fibroblast cultures transfected with the gene therapy DNA vector VTvaf17-KRT14 carrying the KRT14 gene compared to the concentration of KRT14 protein in the injection site of autologous fibroblast cultures (placebo) transfected with the gene therapy DNA vector VTvaf17 not carrying the KRT14 gene, demonstrating the efficacy of the gene therapy DNA vector VTvaf17-KRT14 and its feasibility for increasing the level of KRT14 expression in human tissues (particularly after injection of autologous fibroblast cultures transfected with the gene therapy DNA vector VTvaf17-KRT14 into the skin).

Example 17.

Evidence of the efficacy and feasibility of using a combination of a gene therapy DNA vector carrying the KRT5 gene, VTvaf17-KRT5, a gene therapy DNA vector carrying the KRT14 gene, VTvaf17-KRT14, a gene therapy DNA vector carrying the LAMB3 gene, VTvaf17-LAMB3, and a gene therapy DNA vector carrying the COL7a1 gene, VTvaf17-COL7a1 for increasing the expression levels of KRT5, KRT14, LAMB3, and COL7a1 proteins in mammalian tissues.

After injecting a mixture of gene therapy vectors into a Wistar rat skin site, changes in concentrations of KRT5, KRT14, LAMB3, and COL7a1 proteins in the site were evaluated.

The use of polyethyleneimine Transfection reagent cGMP grade in vivo-JetPEI (Polyplus Transfection, France) as a transport system. An equimolar mixture of the four gene therapy DNA vectors, as well as the gene therapy DNA vector VTvaf17 as placebo, was dissolved in sterile nuclease-free water. To obtain the gene construct, the DNA-cGMP grade in vivo-JetPEI complex was prepared according to the manufacturer's recommendations. The injection volume of each genetic construct (mixture of gene therapy DNA vectors and placebo) was 0.3ml, the total amount of DNA equaling 100. mu.g. The solution was injected into the skin of rats with an insulin syringe to a depth of 1-1.5 mm.

On day 2 after injection of the gene therapy DNA vector, a biopsy sample was taken. Biopsy samples were taken from a mixture of four gene therapy DNA vectors carrying genes KRT5, KRT14, LAMB3 and COL7a1 (site I), a scar area on the skin of animals at the injection site of gene therapy DNA vector VTvaf17 (placebo) (site II) and a similar skin site without any manipulation (site III) using a skin biopsy device Epitheasy 3.5(Medax SRL). The biopsy sample site was initially rinsed with sterile normal saline and anesthetized with lidocaine solution. The biopsy sample size was about 10mm3 and weighed about 11 mg. Each sample was placed in a buffer solution containing 50mM Tris-HCl, pH7.6, 100mM NaCl, 1mM EDTA and 1mM phenylmethylsulfonyl fluoride, and homogenized to obtain a homogenized suspension. The suspension was then centrifuged at 14000g for 10 minutes. The supernatant was collected and used to determine the therapeutic protein as described in example 9 (quantification of KRT5 protein), example 10 (quantification of KRT14 protein), example 11 (quantification of LAMB3 protein) and example 12 (quantification of COL7a1 protein). The graph derived from the assay is shown in fig. 14.

Figure 14 shows that the concentrations of KRT5, KRT14, LAMB3 and COL7a1 protein were increased in rat skin sites (site I) injected with a mixture of gene therapy DNA vector VTvaf17-KRT5 carrying KRT5 therapeutic gene, therapeutic DNA vector VTvaf17-KRT14 carrying KRT14 therapeutic gene, gene therapy DNA vector VTvaf17-LAMB3 carrying LAMB3 therapeutic gene, gene therapy DNA vector VTvaf17-COL7a1 carrying COL7a1 therapeutic gene, compared to site II (placebo site) and site III (intact site). The results obtained demonstrate the efficacy of the combination of gene therapy DNA vectors and their feasibility for increasing the expression levels of therapeutic proteins in mammalian tissues.

Example 18.

Efficacy of gene therapy DNA vector VTvaf17-LAMB3 carrying the LAMB3 gene and evidence of its feasibility of use to facilitate increased expression levels of the LAMB3 protein in mammalian cells.

To confirm the efficacy of the gene therapy DNA vector VTvaf17-LAMB3 carrying the human LAMB3 gene, MDBK bovine kidney epithelial cells (NBL-1) ((NBL-1)) were transfected 48 hours after transfection with the gene therapy DNA vector VTvaf17-LAMB3 carrying the human LAMB3 geneCCL-22^TM) Changes in mRNA accumulation of the therapeutic gene of middle LAMB3 were evaluated.

In Eagle's Minimal Essential Medium (EMEM) ((II))30-2003，^TM) MDBK bovine kidney epithelial cells (NBL-1) were cultured in medium supplemented with 10% horse serum (N: (N-acetyl-L)) (M)30-2040^TM). Transfection, RNA extraction, reverse transcription reaction, PCR amplification and data analysis of gene therapy DNA vector VTvaf17-LAMB3 carrying human LAMB3 gene and DNA vector VTvaf17 (reference) not carrying human LAMB3 gene were performed as described in example 7. The bull/bovine actin gene (ACT) listed under accession number AH001130.2 in the GenBank database was used as a reference gene. Positive controls included amplicons from PCR on a matrix represented by plasmids containing the LAMB3 and ACT gene sequences at known concentrations. The negative control included deionized water. Real-time quantification of PCR products (i.e., LAMB3 and ACT gene cDNA obtained by amplification) was performed using Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA).

The graph derived from the assay is shown in fig. 15.

FIG. 15 shows that the level of human LAMB3 gene-specific cDNA was greatly increased due to transfection of MDBK bovine kidney epithelial cells with gene therapy DNA vector VTvaf17-LAMB3, confirming the ability of the vector to penetrate eukaryotic cells and express LAMB3 gene at mRNA level. The presented results demonstrate the feasibility of using the gene therapy DNA vector VTvaf17-LAMB3 to facilitate increasing the expression level of the LAMB3 gene in mammalian cells.

Example 19.

Escherichia coli strain SCS110-AF/VTvaf17-KRT5 carrying gene therapy DNA vector, or Escherichia coli strain SCS110-AF/VTvaf17-KRT14, or Escherichia coli strain SCS110-AF/VTvaf17-LAMB3, or Escherichia coli strain SCS110-AF/VTvaf17-Col7A1 carrying gene therapy DNA vector, and its production method

Constructed for the production on an industrial scale of a gene carrying a gene selected from the group consisting of: strains of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 of the therapeutic genes of KRT5, KRT14, LAMB3 and COL7A1, i.e.the E.coli strain SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain 110-AF/VTvaf17-LAMB3, or E.coli strain 110-AF/VTvaf17-COL7A1, carrying the gene therapy DNA vector VTvaf17-KRT5, VTvaf17-KRT14, VTvaf17-LAMB 17-COL7A1, respectively, for its production, allowing antibiotic-free selection, the construction method involves the preparation of electrocompetent cells of the E.coli strain SCS110-AF, and these cells were electroporated with gene therapy DNA vector VTvaf17-KRT5, or DNA vector VTvaf17-KRT14, or DNA vector VTvaf17-LAMB3, or DNA vector VTvaf17-COL7A 1. Thereafter, the cells were poured into agar plates (petri dishes) with a selective medium containing yeast extract, peptone, 6% sucrose, and 10 μ g/ml chloramphenicol. Wherein the production of the escherichia coli strain SCS110-AF to produce the gene therapy DNA vector VTvaf17 or a gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, allows for antibiotic-free positive selection, which involves the construction of a 64bp linear DNA fragment containing the transposon Tn10 regulatory element RNA-IN that allows for antibiotic-free positive selection; the 1422bp fructan sucrase gene sacB (the product of which ensures selection in a medium containing sucrose), the 763bp chloramphenicol resistance gene catR required for cloning of the strain undergoing homologous recombination and the two homologous sequences 329bp and 233bp (ensuring homologous recombination in the region of the gene recA concurrent with the inactivation of the gene) were selected, then the e.coli cells were transformed by electroporation and clones surviving in a medium containing 10 μ g/ml chloramphenicol were selected.

The obtained strains used for production are included in the collections of National center for Biological resources (National Biological Resource Centre), Russian National Collection of Industrial Microorganisms (NBRC RNCIM), RF and NCIMB patent deposit services in the UK under the following accession numbers:

coli strain SCS110-AF/VTvaf17-KRT 5-registered at Russian national collections of Industrial microorganisms, accession No. B-13386, date of deposit: 14.12.2018, respectively; accession number NCIMB:43310, date of deposit: 13.12.2018.

coli strain SCS110-AF/VTvaf17-KRT 14-registered at Russian national collections of Industrial microorganisms, accession No. B-13345, date of deposit: 22.11.2018, respectively; accession number NCIMB:43282, date of deposit: 22.11.2018.

example 20.

Method for the scale-up of gene therapy DNA vectors based on gene therapy DNA vector VTvaf17 carrying a therapeutic gene (selected from the group of KRT5, KRT14, LAMB3 and COL7a1) to industrial scale.

To demonstrate the producibility and constructability of the gene therapy DNA vectors VTvaf17-KRT5(SEQ ID No.1), VTvaf17-KRT14(SEQ ID No.2), VTvaf17-LAMB3(SEQ ID No.3), VTvaf17-COL7A1(SEQ ID No.4) on an industrial scale, large-scale fermentation was performed on E.coli strains SCS110-AF/VTvaf17-KRT5, or SCS110-AF/VTvaf17-KRT14, or SCS110-AF/VTvaf17-LAMB3, or SCS110-AF/VTvaf17-COL7A1, each containing a gene therapy DNA vector VTvaf17 carrying a therapeutic gene (i.e., KRT5, or KRT14, or LAMB3, or COL7A 1). Each of the E.coli strains SCS110-AF/VTvaf17-KRT5, or E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1 was produced based on E.coli SCS110-AF (Cell and Gene Therapy LLC, United Kingdom) by the following method, as described in example 19: competent cells of this strain were electroporated with gene therapy DNA vectors VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7a1 carrying the therapeutic gene (i.e., KRT5, or KRT14, or LAMB3, or COL7a1), the transformed cells were further inoculated in agar plates (petri dishes) with selective medium containing zymosine, peptone and 6% sucrose, and individual clones were selected.

Fermentation of E.coli SCS110-AF/VTvaf17-KRT5 carrying gene therapy DNA vector VTvaf17-KRT5 was performed in a 10L fermentor, and then gene therapy DNA vector VTvaf17-KRT5 was extracted.

For the fermentation of the E.coli strain SCS110-AF/VTvaf17-KRT5, a preparation containing (per 10l volume): a medium of 100g tryptone and 50g yeast extract (Becton Dickinson, USA); the medium was then diluted to 8800ml with water and autoclaved at 121 ℃ for 20 minutes and then 1200ml of 50% (w/v) sucrose was added. Thereafter, a seed culture of the E.coli strain SCS110-AF/VTvaf17-KRT5 was inoculated in a volume of 100ml into a culture flask. The cultures were incubated at 30 ℃ for 16 hours in a shaker incubator. The seed culture was transferred to a Techfors S bioreactor (Infors HT, Switzerland) and cultured to stationary phase. The process was controlled by measuring the optical density of the culture at 600 nm. Cells were pelleted at 5,000-10,000g for 30 min. The supernatant was removed and the cell pellet was resuspended in 10% (by volume) phosphate buffered saline. The cells were centrifuged again at 5,000-10,000g for 30 min. The supernatant was removed, a solution containing 20mM TrisCl, 1mM EDTA, 200g/l sucrose (pH 8.0) was added to the cell pellet in a volume of 1000ml, and the mixture was stirred well to a homogenized suspension. The egg lysozyme solution was then added to a final concentration of 100. mu.g/ml. The mixture was incubated on ice for 20 minutes with gentle stirring. Then 2500ml of 0.2M NaOH, 10g/l Sodium Dodecyl Sulfate (SDS) was added, the mixture was incubated on ice for 10 minutes while stirring gently, then 3500ml of 3M sodium acetate, 2M acetic acid (pH 5-5.5) were added, and the mixture was incubated on ice for 10 minutes while stirring gently. The resulting sample was centrifuged at 15,000g or more for 20-30 minutes. The solution was carefully decanted and the residual precipitate was removed by a strainer (filter paper). RNase A (Sigma, USA) was then added to a final concentration of 20. mu.g/ml and the solution was incubated overnight at room temperature for 16 hours. The solution was then centrifuged at 15,000g for 20-30 minutes and passed through a 0.45 μm membrane filter (Millipore, USA). Then, ultrafiltration was performed with a 100kDa membrane (Millipore, USA), and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCl (pH 7.0). This operation was performed three to four times. The solution was applied to a column containing 250ml DEAE Sepharose HP (GE, USA) and equilibrated with 25mM TrisCl (pH 7.0). After loading, the column was washed with three times the volume of the same solution, and then the gene therapy DNA vector VTvaf17-KRT5 was eluted using a linear gradient of 25mM Tris-HCl (pH 7.0) to obtain a solution of 25mM Tris-HCl (pH 7.0), 1M NaCl, five times the column volume. The elution process was controlled by measuring the optical density of the effluent solution at 260 nm. The chromatograms containing the gene therapy DNA vector VTvaf17-KRT5 were pooled and gel filtered using Superdex 200(GE, USA). The column was equilibrated with phosphate buffered saline. The elution process was controlled by measuring the optical density of the effluent solution at 260nm and the fractions were analyzed by agarose gel electrophoresis. Fractions containing the gene therapy DNA vector VTvaf17-KRT5 were pooled and stored at-20 ℃. To evaluate the reproducibility of the process, the specified treatment operations were repeated five times. All the treatments of the E.coli strain SCS110-AF/VTvaf17-KRT14, or E.coli strain SCS110-AF/VTvaf17-LAMB3, or E.coli strain SCS110-AF/VTvaf17-COL7A1 were carried out in a similar manner.

The processing reproducibility and quantitative properties of the final product yields confirm the productivity and construction of gene therapy DNA vectors VTvaf17-KRT5, or VTvaf17-KRT14, or VTvaf17-LAMB3, or VTvaf17-COL7A1 on an industrial scale.

Thus, the resulting gene therapy DNA vectors containing a therapeutic gene can be used to deliver it to human and animal cells with reduced or insufficient expression of the protein encoded by the gene, thereby ensuring the desired therapeutic effect.

The present invention sets out the object of constructing a gene therapy DNA vector to increase the expression levels of KRT5, KRT14, LAMB3 and COL7A1 genes, in combination with the following properties:

I) increasing the effectiveness of therapeutic gene expression in eukaryotic cells due to gene therapy vectors obtained with vector portions not exceeding 3200 bp;

II) the possibility of safe use in gene therapy of humans and animals due to the absence of regulatory elements and antibiotic resistance genes representing the nucleotide sequence of the viral genome in gene therapy DNA vectors;

III) producibility and constructability of the strain on an industrial scale;

IV) and for the purpose of achieving the construction of strains carrying these gene therapy DNA vectors for the production of these gene therapy DNA vectors,

for I-examples 1,2,3,4, 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18;

for II-examples 1,2,3, 4;

for III and IV-examples 19, 20.

INDUSTRIAL APPLICABILITY

All the examples listed above demonstrate the industrial applicability of the proposed gene therapy DNA vector based on gene therapy DNA vector VTvaf17 carrying therapeutic genes (selected from the group of KRT5, KRT14, LAMB3 and COL7a1 genes), escherichia coli strain SCS110-AF/VTvaf17-KRT5 carrying gene therapy DNA vectors, or escherichia coli strain SCS110-AF/VTvaf17-KRT14, or escherichia coli strain SCS110-AF/VTvaf17-LAMB3 carrying gene therapy DNA vectors, or escherichia coli strain SCS110-AF/VTvaf17-COL7a1 carrying gene therapy DNA vectors, and the production process thereof on an industrial scale.

And (3) a abbreviation list:

VTvaf 17: gene therapy vectors lacking the viral genome and antibiotic resistance marker sequences (virus-free-antibiotic therapeutic vectors)

DNA: deoxyribonucleic acid

cDNA: complementary deoxyribonucleic acid

RNA: ribonucleic acid

mRNA: messenger ribonucleic acid

bp: base pairing

And (3) PCR: polymerase chain reaction

ml: ml, μ l: microlitre

mm 3: cubic millimeter

l: lifting of wine

μ g: microgram of

mg: milligrams of

g: keke (Chinese character of 'Keke')

μ M: micromolar

And (mM): millimole

min: minute (min)

s: second of

rpm: revolutions per minute

nm: nano meter

cm: centimeter

mW: milliwatt meter

RFU: relative fluorescence unit

PBS: phosphate buffered saline

50页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：用于调节经工程化的基因的表达的微环境传感器

Gene therapy DNA vector and application thereof

相关技术

网友询问留言