Self-driven micro-fluidic detection device and application thereof

文档序号：112495 发布日期：2021-10-19 浏览：39次中文

阅读说明：本技术 一种自驱动微流控检测装置及其用途 (Self-driven micro-fluidic detection device and application thereof ) 是由尤其敏周艳琼帅金晓林艺志贾晓娟林元奎于 2021-04-19 设计创作，主要内容包括：本发明公开了一种自驱动微流控检测装置及其用途,装置包括：上盖,固定于上盖下的底板,设置于上盖和底板之间的夹层,设置于上盖上的加样孔,连接于加样孔的微流控导流组件,设置于夹层上并位置对应于微流控导流组件的加样槽,设置于夹层上并连接于微流控导流组件的功能腔室,连接于微流控导流组件的层析试纸；微流控导流组件包括：毛细管导流渠,连接于毛细管导流渠并控制毛细管导流渠的联通和断开的通断连接器；本装置实现了加样和检测过程的精确控制,提高检测准确性,无需专业培训即可快速简便的操作,安全可靠；本装置可对多种样本进行检测,具有十分广泛的适用范围。(The invention discloses a self-driven micro-fluidic detection device and application thereof, wherein the device comprises: the device comprises an upper cover, a bottom plate fixed below the upper cover, an interlayer arranged between the upper cover and the bottom plate, a sample adding hole arranged on the upper cover, a microfluidic flow guide assembly connected to the sample adding hole, a sample adding groove arranged on the interlayer and corresponding to the microfluidic flow guide assembly in position, a functional chamber arranged on the interlayer and connected to the microfluidic flow guide assembly, and chromatography test paper connected to the microfluidic flow guide assembly; the microfluidic flow guide assembly comprises: the capillary guide channel is connected with the capillary guide channel and is provided with an on-off connector for controlling the connection and disconnection of the capillary guide channel; the device realizes the accurate control of the sample adding and detecting processes, improves the detecting accuracy, can be operated quickly, simply and conveniently without professional training, and is safe and reliable; the device can detect various samples and has a very wide application range.)

1. A self-driven microfluidic detection device, comprising: the device comprises an upper cover, a bottom plate fixed below the upper cover, an interlayer arranged between the upper cover and the bottom plate, a sample adding hole arranged on the upper cover, a microfluidic flow guide assembly connected to the sample adding hole, a sample adding groove arranged on the interlayer and corresponding to the microfluidic flow guide assembly in position, a functional chamber arranged on the interlayer and connected to the microfluidic flow guide assembly, and a result display part for displaying a detection result; the microfluidic flow guide assembly comprises: the capillary diversion channel and the on-off connector are connected between the capillary diversion channels and used for controlling the connection and disconnection of the capillary diversion channels.

2. The self-propelled microfluidic detection device according to claim 1, wherein the capillary guide channel is comprised of a plurality of capillary guide channel units; the capillary flow guide channel unit comprises: two parallel capillary flow deflectors form a flow guide channel between the capillary flow deflectors.

3. The self-propelled microfluidic detection device according to claim 2, wherein the two parallel capillary baffles are spaced apart by a distance in the range of: 0.01-10 mm.

4. The self-driven microfluidic detection device according to claim 2, wherein the attraction force between the liquid molecules in the flow guide channel is cohesive force, and the attraction force between the liquid molecules in the flow guide channel and the capillary flow guide sheet is adhesive force; the adhesion is greater than the cohesion.

5. The self-driven microfluidic detection device according to claim 2, wherein the end of the capillary deflector is provided with a downwardly extending bridge.

6. The self-propelled microfluidic detection device according to claim 1, wherein the capillary guide channel is a tertiary capillary guide channel, and the functional chamber is a secondary functional chamber; the three-stage capillary guide channel comprises: the device comprises a sample adding groove, a first-stage capillary flow guide channel, a second-stage capillary flow guide channel and a third-stage capillary flow guide channel, wherein the first-stage capillary flow guide channel is connected between the sample adding groove and the first-stage function chamber, the second-stage capillary flow guide channel is connected between an on-off connector and the second-stage function chamber, and the third-stage capillary flow guide channel is connected between the second-stage function chamber and a result display piece.

7. The self-propelled microfluidic detection device according to claim 6, wherein the primary function chamber is provided with a notch.

8. The self-propelled microfluidic detection device according to claim 1, wherein said on-off connector comprises: the device comprises a functional cavity, a first buffer groove, a second buffer groove and a partition, wherein the first buffer groove is connected with the functional cavity; the height of the partition is lower than the height of the first buffer groove and the height of the second buffer groove.

9. The self-propelled microfluidic detection device according to claim 1, wherein said on-off connector comprises: and the connecting groove is connected with the functional cavity and is placed in the connecting groove and corresponds to the water absorption expansion piece below the capillary guide channel.

10. The self-propelled microfluidic detection device according to claim 1, wherein the capillary guide channels are positioned to intersect each other at a location below the well, and the intersection is located below the center of the well.

11. The self-propelled microfluidic detection device of claim 1, further comprising: the device comprises a result reading window, a heating module, a temperature control device, a power supply, a switch, an indicator light, a switch hole, an indicator light window and an indicator light hole, wherein the result reading window is arranged on an upper cover and positioned above a result display part, the heating module is attached to the bottom of a functional cavity and arranged in a bottom plate, the temperature control device is connected to the heating module, the power supply is connected to the heating module and fixed in the bottom plate, the switch and the indicator light are connected to the power supply and fixed in the bottom plate, the switch hole is arranged on the upper cover, the indicator light window is arranged on the upper cover, and the indicator light hole is arranged on an interlayer.

12. The self-propelled microfluidic detection device of claim 1, further comprising: the buckle that sets up on upper cover, bottom plate and be used for the equipment sets up the fixed subassembly of result display spare on upper cover, intermediate layer, sets up and covers and match in the function cavity upper cover of function cavity on the upper cover, is fixed in the application of sample handhole door on the application of sample hole.

13. Use of a self-driven microfluidic detection device according to claim 1, wherein the device is preloaded with nucleic acid detection reagents and used for biological nucleic acid detection.

14. Use of the self-driven microfluidic detection device according to claim 1, wherein the nucleic acid detection for detecting neo-corona/neo-corona mutant/influenza a/influenza b virus nucleic acid comprises the following steps:

a 4-channel self-driven micro-fluidic detection device is adopted, wherein the 4-channel self-driven micro-fluidic detection device is a sample adding hole and is connected with four functional chambers through capillary diversion channels, and each functional chamber corresponds to one chromatographic test paper and one result reading window;

the capillary guide vanes of the capillary guide channel are made of PE materials, and the distance between the capillary guide vanes is 0.2 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

step one, a new crown detection reagent system, a new crown B.1.1.7 detection reagent system, an A flow detection reagent system and a B flow detection reagent system are pre-arranged in 4 functional chambers;

the primer probe of the neocorona detection reagent system comprises:

forward peripheral primer: GGCAGTCAAGCCTCTTCTC the flow of the air in the air conditioner,

reverse peripheral primer: TCTGTCAAGCAGCAGCAAAG the flow of the air in the air conditioner,

forward crossover primer: TTCCCCTACTGCTGCCTGGAGTTCCTCATCACGTAGTCGC the flow of the air in the air conditioner,

reverse accelerating primer: AAGAGCAGCATCACCG the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GAATTTCTTGAACTGTTGCG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-TTCCCCTACTGCTGCCTGGA;

the primer probe of the detection reagent system of the Xinguan B.1.1.7 comprises:

forward peripheral primer: TTCTTTCACACGTGGTGT the flow of the air in the air conditioner,

reverse peripheral primer: GACAGGGTTATCAAACCTCT the flow of the air in the air conditioner,

forward crossover primer:

AGGTAAGAACAAGTCCTGAGTTGATTATTACCCTGACAAAGTTTTCAG，

reverse accelerating primer: AGTACCATTGGTCCCAGA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GTCCCAGAGATAGCATGG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-AGGTAAGAACAAGTCCTGAGTTGA;

the primer probe of the first-flow detection reagent system comprises:

forward peripheral primer: CAGAGGGCAATGATGGATCA the flow of the air in the air conditioner,

reverse peripheral primer: ATCCCGACCAGTGAGTACC the flow of the air in the air conditioner,

forward crossover primer: CCTCAGAATGAGTGCTGACCGTAAGTCGAAACCCAGGAAACG the flow of the air in the air conditioner,

reverse accelerating primer: CTTCCCTTTCAAAGTCATGCCCA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-AGGAAAATGAGGTCTTCAATCTCAG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CCTCAGAATGAGTGCTGACCGT;

the primer probe of the reagent system for detecting the second flow comprises:

forward peripheral primer: ACTTACCAATGGGTGCTTAA the flow of the air in the air conditioner,

reverse peripheral primer: CGAAAAACAGAAAGGCAACAA the flow of the air in the air conditioner,

forward crossover primer: CATCCCATTGGAACATGTCTTCAAATTTAGTAACATTGAAGGCTCAG the flow of the air in the air conditioner,

reverse accelerating primer: CCTCAGAAGATGGCTGGTCAGTTTTCATAACCTCTTGGTCTC the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GTCTTCTTTTCCCAAAAGAAACTG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CAAGAGCAGTGCTCAAACAAATGA;

collecting a throat swab sample of a tester;

step three, immersing the head of the swab in the sampling liquid and mixing uniformly;

placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover;

step five, standing for 10-30 minutes at the reaction temperature of 50-65 ℃;

step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes;

and step seven, reading the result.

15. The use of the self-driven microfluidic detection device according to claim 1, wherein the detection of escherichia coli and salmonella enteritidis comprises the following steps:

a 2-channel self-driven micro-fluidic detection device is adopted, wherein the 2-channel self-driven micro-fluidic detection device is a sample adding hole and is connected with two functional chambers through a capillary diversion channel, and each functional chamber corresponds to a chromatographic test paper and a result reading window;

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 1 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

step one, pre-arranging an escherichia coli detection reagent system and a salmonella enteritidis detection reagent system in 2 functional chambers;

the primer probe of the escherichia coli detection reagent system comprises:

forward peripheral primer: ACCGTCAGGAAGCGGTAC the flow of the air in the air conditioner,

reverse peripheral primer: TTTCACCCACTCTTCCTGGAT the flow of the air in the air conditioner,

forward crossover primer: AGACGGTTGGAGTTGGAGGAGTGCAGAACAGGCGGAAGTT the flow of the air in the air conditioner,

reverse accelerating primer: GTCTTTCGCATCGTCAATCAAAA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-TTTTCGAACCGACCACCAACAC, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-AGACGGTTGGAGTTGGAGGAGT;

the primer probe of the salmonella enterica detection reagent system comprises:

forward peripheral primer: CGTGATGCTGAAAGTACCGA the flow of the air in the air conditioner,

reverse peripheral primer: GGCCGCCAAAACTTTCCTGA the flow of the air in the air conditioner,

forward crossover primer: CCACCGCGTACGGACTTCACCGAAACACAAACGGGCAAG the flow of the air in the air conditioner,

reverse accelerating primer: AGATCTTTTAGCAATTGCTTCT the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-TGCCGCGCATACGGAACAG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CCACCGCGTACGGACTTCAC;

wiping the surface of the object to be detected for 5-20 times in a large range by using a swab stained with a small amount of sampling liquid;

step three, immersing the head of the swab in the sampling liquid and mixing uniformly;

placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover;

step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃;

step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes;

and step seven, reading the result.

16. The use of the self-driven microfluidic detection device according to claim 1, wherein the salmonella enteritidis detection in the anal swab comprises the following contents:

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 0.5 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the primer probe of the amplification reagent system for the salmonella enteritidis comprises:

forward peripheral primer: CGTGATGCTGAAAGTACCGA the flow of the air in the air conditioner,

reverse peripheral primer: GGCCGCCAAAACTTTCCTGA the flow of the air in the air conditioner,

forward crossover primer: CCACCGCGTACGGACTTCACCGAAACACAAACGGGCAAG the flow of the air in the air conditioner,

reverse accelerating primer: AGATCTTTTAGCAATTGCTTCT the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-TGCCGCGCATACGGAACAG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CCACCGCGTACGGACTTCAC;

the primer probe of the quality control amplification reagent system filled with the human-derived GAPDH gene comprises:

forward peripheral primer: AGAACGGGAAGCTTGTCATC the flow of the air in the air conditioner,

reverse peripheral primer: CGAACATGGGGGCATCAG the flow of the air in the air conditioner,

forward crossover primer: CAGAGGGGGCAGAGATGAATCTTCCAGGAGCGAGATCC the flow of the air in the air conditioner,

reverse accelerating primer: ATCTTCCAGGAGCGAGATCCCAGAGGGGGCAGAGATGA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-CAAAATCAAGTGGGGCGA, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-GGGAGCCAAAAGGGTC;

collecting an anal swab;

step three, immersing the head of the swab into the sampling liquid, mixing uniformly, filtering the sampling liquid by using a filter membrane, and filtering out residues;

placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover;

step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃;

step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes;

and step seven, reading the result.

17. Use of a self-driven microfluidic detection device according to claim 1 for detecting microorganisms in a urine sample comprising:

a4-channel self-driven micro-fluidic detection device is adopted, a sample adding hole of the 4-channel self-driven micro-fluidic detection device is connected with four functional chambers through capillary diversion channels, and each functional chamber corresponds to a chromatographic test paper and a result reading window. (ii) a

The adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the capillary guide vanes of the capillary guide channel are made of PE materials, and the distance between the capillary guide vanes is 0.5 mm;

step one, pre-arranging an escherichia coli detection reagent system and a salmonella enteritidis detection reagent system in 4 functional chambers;

the primer probe of the reagent system for detecting ureaplasma urealyticum comprises:

forward peripheral primer: GTGATTTAACTGTAGAACAAGAACA the flow of the air in the air conditioner,

reverse peripheral primer: AGGACCACTATATTGTAGTAGTGC the flow of the air in the air conditioner,

forward crossover primer: GGCATGCGATATGAAACACCATAGATCTTTTTTGACCAGGATC the flow of the air in the air conditioner,

reverse accelerating primer: ATTATGATTTTTAACTGGTTCTTC the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-CACCATTTTTAATTACAGTAACT, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-GGCATGCGATATGAAACACCA;

the primer probe of the staphylococcus aureus detection reagent system comprises:

forward peripheral primer: CTGAATATGCAATGAAAGTAACTGA the flow of the air in the air conditioner,

reverse peripheral primer: TTTTTCTCTTTGCATATTATCGC the flow of the air in the air conditioner,

forward crossover primer: GACAACGCTTCTTTATCATTTGTGACAAGAGCTAGAGTCGTTAGC the flow of the air in the air conditioner,

reverse accelerating primer: ATAATTTCTTCAAGTCGTGCCGC the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GTGATACCAGCATGAATCGGTTTA, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-GACAACGCTTCTTTATCATTTGTGA;

the primer probe of the neisseria gonorrhoeae detection reagent system comprises:

forward peripheral primer: GCTTTTAAATCCAATACCGTATT the flow of the air in the air conditioner,

reverse peripheral primer: TTGAGTTCGATGGTGCTG the flow of the air in the air conditioner,

forward crossover primer: GAGGCCATTTACGCCCAATCAACAATAAAATATCCATCACCACTG the flow of the air in the air conditioner,

reverse accelerating primer: GTGCCGTCAAGGGAAGGTTG the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GCCCAATCCCAAGCCGTCG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-GAGGCCATTTACGCCCAATC;

the primer probe of the candida albicans detection reagent system comprises:

forward peripheral primer: CGAGTTGCCCCAAGACATG the flow of the air in the air conditioner,

reverse peripheral primer: AATGACCGCTCTGAGTGATG the flow of the air in the air conditioner,

forward crossover primer: CAGGCCACAAACCCACCAAAGAGAATTGTCGAAAATCGCCCG the flow of the air in the air conditioner,

reverse accelerating primer: GTGCTCTAATGGGGCAATTTCCA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-ATGCTGAGCCGGAGCCTTTA, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CAGGCCACAAACCCACCAAAGA;

step two, dipping a urine sample by using a dry swab head, and taking out the sample when the top of the swab absorbs the sample;

step three, immersing the head of the swab in the sampling liquid and mixing uniformly;

placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover;

step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃;

step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes;

and step seven, reading the result.

18. The self-driven microfluidic detection method according to claim 1, wherein the quantitative detection of the kidney markers comprises the following steps:

the capillary guide vanes of the capillary guide channel are made of PP materials, and the distance between the capillary guide vanes is 0.4 mm;

step one, preparing nanogold;

step two, preparing a gold-labeled RBP monoclonal antibody 1;

attaching the NC membrane to a PVC bottom plate, spraying RBP monoclonal antibody 2 and goat-anti-mouse secondary antibody at each position of the NC membrane by using a reciprocating membrane scribing instrument, wherein the RBP monoclonal antibody and the goat-anti-mouse secondary antibody are respectively a detection line (T line) and a quality control line (C line), and drying;

step four, adding a cell fusion agent into the gold-labeled RBP monoclonal antibody solution; then spraying the mixture on a bonding pad of a glass fiber membrane, and drying;

step five, assembling a sample pad of the glass cellulose membrane, a combination pad of the glass cellulose membrane, an NC membrane and a water absorption pad into a detection test strip, and adjusting the sensitivity of the test strip;

step six, assembling the detection test strip in a self-driven microfluidic detection device;

step seven, sequentially pre-filling four gradients of physiological saline in the 4 functional chambers;

and step eight, adding the urine sample into a sample adding hole of the detection device, sucking out the redundant sample, and entering 4 functional chambers under the control of the microfluidic flow guide device, wherein the sample is diluted by 100 times, diluted by 10 times, diluted by 2 times and undiluted in the 4 functional chambers respectively.

And step nine, reading the result.

19. The use of the self-driven microfluidic detection device according to claim 1, wherein the detection of the A-stream virus and the B-stream virus comprises the following steps:

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 0.2 mm;

step one, pre-filling a reagent system for detecting the influenza A virus and a reagent system for detecting the influenza B virus into two functional chambers in sequence according to the composition of the systems;

the primer probe of the influenza A virus detection reagent system comprises:

forward peripheral primer: CAGAGGGCAATGATGGATCA the flow of the air in the air conditioner,

reverse peripheral primer: ATCCCGACCAGTGAGTACC the flow of the air in the air conditioner,

forward crossover primer: CCTCAGAATGAGTGCTGACCGTAAGTCGAAACCCAGGAAACG the flow of the air in the air conditioner,

reverse accelerating primer: CTTCCCTTTCAAAGTCATGCCCA the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-AGGAAAATGAGGTCTTCAATCTCAG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CCTCAGAATGAGTGCTGACCGT;

the primer probe of the reagent system for detecting the virus B comprises:

forward peripheral primer: ACTTACCAATGGGTGCTTAA the flow of the air in the air conditioner,

reverse peripheral primer: CGAAAAACAGAAAGGCAACAA the flow of the air in the air conditioner,

forward crossover primer: GCATCCCATTGGAACATGTCTTCAAATTTAGTAACATTGAAGGCTCAG the flow of the air in the air conditioner,

reverse accelerating primer: CCTCAGAAGATGGCTGGTCAGTTTTCATAACCTCTTGGTCTC the flow of the air in the air conditioner,

reverse probe 1: a fluorescent marker-GTCTTCTTTTCCCAAAAGAAACTG, wherein the fluorescent marker is a fluorescent marker,

reverse probe 2: fluorescent marker-CAAGAGCAGTGCTCAAACAAATGA;

collecting a throat swab sample of a tester;

step three, immersing the head of the swab in the sampling liquid and mixing uniformly;

placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover;

step five, standing for 10-30 minutes at the reaction temperature of 50-65 ℃;

step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes;

and step seven, reading the result.

Technical Field

The invention relates to the field of biological detection, in particular to a self-driven micro-fluidic detection device and application thereof.

Background

With the development of scientific technology, detection techniques and equipment in the fields of pathogens, environmental microorganisms, biochemical indexes, tumor and organ markers, drugs and the like have been developed greatly. For example, PCR instruments and isothermal amplification instruments applying the nucleic acid amplification principle are gradually replacing the traditional smear or microscopic method in the field of pathogen and environmental microorganism detection; the automatic chemiluminescence platform provides a sensitive, rapid and high-flux solution for detection items such as biochemical indexes, tumor markers and the like.

The expansion of detection demand and the abundance of detection scenes make the detection of POCT (point-of-care testing) type one of the main directions of development of the detection field in recent years. POCT detection refers to a detection mode that analysis is carried out immediately on a sampling site and a detection result is obtained quickly. For example, POCT nucleic acid detecting instrument integrates the functions of nucleic acid extraction, amplification, fluorescence detection and the like into a miniaturized instrument, and can perform rapid and accurate nucleic acid detection under non-laboratory conditions.

Compared with the traditional large-scale equipment or standard laboratories, the POCT detection equipment provides a field detection means for vast basic units, remote areas or other scenes with insufficient medical conditions. Meanwhile, the method provides a convenient and fast scheme for detection items sensitive to detection time. Many POCT products such as small blood glucose meters, urine glucose strip devices, etc. have begun to move to home settings where testing is performed by the user in a self-test format.

In many cases, it is desirable to be able to perform the detection by means of self-testing; in some field environments or under the condition of lack of professional personnel and equipment, people further urgently need a detection device which is low in cost, quick and simple, accurate in result and capable of being used without professional training. The device should have extensive scene adaptability and safety in utilization, can detect under the condition that does not have external power supply, water source. Even if the wrong operation occurs, the device can not cause harmful effects to users.

The existing small-sized detection device still has a plurality of problems: 1, part of miniaturized detection instruments still need external power supplies and water sources, so that the application environment is limited; 2, the existing miniaturized detection instrument still has the problem of high cost for common people; 3, nucleic acid detection usually requires nucleic acid amplification or fluorescent signal acquisition and analysis, and complex equipment and professional skills, so that nucleic acid detection cannot be realized by domestic self-inspection equipment at present; 4, although the current test paper self-checking products meet certain requirements, the problems of inaccurate sample adding, difficult quantification, difficult multiple detection and the like still exist. 5, the current home detection device is lack of flexibility, and has the problems of repeated development and resource waste.

The market needs a disposable detection device which is low in cost, quick, simple and convenient, capable of realizing accurate control of sample adding and detection processes, safe and reliable and can be used without professional training, and the invention solves the problems.

Disclosure of Invention

In order to solve the defects of the prior art, the invention aims to provide a self-driven micro-fluidic detection device and application thereof.

In order to achieve the above object, the present invention adopts the following technical solutions:

a self-driven microfluidic detection device comprising: the device comprises an upper cover, a bottom plate fixed below the upper cover, an interlayer arranged between the upper cover and the bottom plate, a sample adding hole arranged on the upper cover, a microfluidic flow guide assembly connected to the sample adding hole, a sample adding groove arranged on the interlayer and corresponding to the microfluidic flow guide assembly in position, a functional chamber arranged on the interlayer and connected to the microfluidic flow guide assembly, and a result display part for displaying a detection result; the microfluidic flow guide assembly comprises: the capillary diversion channel and the on-off connector are connected between the capillary diversion channels and used for controlling the connection and disconnection of the capillary diversion channels.

In the self-driven micro-fluidic detection device, the capillary flow guide channel is composed of a plurality of capillary flow guide channel units; the capillary flow guide channel unit comprises: two parallel capillary flow deflectors form a flow guide channel between the capillary flow deflectors.

In the self-driven micro-fluidic detection device, the distance between two parallel capillary flow deflectors is in the range: 0.01-2 mm.

In the self-driven microfluidic detection device, the attraction force between the liquid molecules in the flow guide channel is cohesive force, and the attraction force between the liquid molecules in the flow guide channel and the capillary flow deflector is adhesive force; the adhesion is greater than the cohesion.

In the self-driven microfluidic detection device, the end of the capillary deflector is provided with a bridge extending downward.

In the self-driven micro-fluidic detection device, the capillary flow guide channel is a three-stage capillary flow guide channel, and the functional chamber is a two-stage functional chamber; the three-stage capillary guide channel comprises: the device comprises a sample adding groove, a first-stage capillary flow guide channel, a second-stage capillary flow guide channel and a third-stage capillary flow guide channel, wherein the first-stage capillary flow guide channel is connected between the sample adding groove and the first-stage function chamber, the second-stage capillary flow guide channel is connected between an on-off connector and the second-stage function chamber, and the third-stage capillary flow guide channel is connected between the second-stage function chamber and a result display piece.

In the self-driven micro-fluidic detection device, the primary function chamber is provided with a notch.

In the self-driven microfluidic detection device, the on-off connector comprises: the first buffer groove is connected with the functional cavity, the second buffer groove is connected with the first buffer groove and is used for placing the capillary diversion channel, and the partition is arranged between the first buffer groove and the second buffer groove; the height of the partition is lower than the height of the first buffer groove and the second buffer groove.

In the self-driven microfluidic detection device, the on-off connector comprises: and the connecting groove is connected with the functional cavity and is placed in the connecting groove and corresponds to the water absorption expansion piece below the capillary guide channel.

In the self-driven micro-fluidic detection device, the capillary flow guide channels are arranged in a mutually crossed manner at positions below the sample adding hole, and the cross point is positioned below the center of the sample adding hole.

The self-driven microfluidic detection device further comprises: the device comprises a result reading window, a heating module, a temperature control device, a power supply, a switch, an indicator light, a switch hole, an indicator light window and an indicator light hole, wherein the result reading window is arranged on an upper cover and positioned above a result display part, the heating module is attached to the bottom of a functional cavity and arranged in a bottom plate, the temperature control device is connected to the heating module, the power supply is connected to the heating module and fixed in the bottom plate, the switch and the indicator light are connected to the power supply and fixed in the bottom plate, the switch hole is arranged on the upper cover, the indicator light window is arranged on the upper cover, and the indicator light hole is arranged on an interlayer.

The self-driven microfluidic detection device further comprises: the buckle that sets up on upper cover, bottom plate and be used for the equipment sets up the fixed subassembly of result display spare on upper cover, intermediate layer, sets up and covers and match in the function cavity upper cover of function cavity on the upper cover, is fixed in the application of sample handhole door on the application of sample hole.

The self-driven micro-fluidic detection device is pre-filled with a nucleic acid detection reagent and used for biological nucleic acid detection.

The application of the self-driven microfluidic detection device for detecting nucleic acid of neocorona/neocorona mutant strain/A current/B current virus comprises the following contents:

the capillary guide vanes of the capillary guide canal are made of PE materials, and the distance between the capillary guide vanes is 0.2 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the primer probe of the neocorona detection reagent system comprises:

forward peripheral primer: GGCAGTCAAGCCTCTTCTC, reverse peripheral primer: TCTGTCAAGCAGCAGCAAAG, forward crossover primer: TTCCCCTACTGCTGCCTGGAGTTCCTCATCACGTAGTCGC, reverse accelerating primer: AAGAGCAGCATCACCG, reverse probe 1: fluorescent label-GAATTTCTTGAACTGTTGCG, reverse probe 2: fluorescent marker-TTCCCCTACTGCTGCCTGGA; the primer probe of the reagent system for detecting the neoforman B.1.1.7 comprises: forward peripheral primer: TTCTTTCACACGTGGTGT, reverse peripheral primer: GACAGGGTTATCAAACCTCT, forward crossover primer: AGGTAAGAACAAGTCCTGAGTTGATTATTACCCTGACAAAGTTTTCAG, reverse accelerating primer: GTACCATTGGTCCCAGA, reverse probe 1: fluorescent label-GTCCCAGAGATAGCATGG, reverse probe 2: fluorescent marker-AGGTAAGAACAAGTCCTGAGTTGA; the primer probe of the first-flow detection reagent system comprises: forward peripheral primer: CAGAGGGCAATGATGGATCA, reverse peripheral primer: TCCCGACCAGTGAGTACC, forward crossover primer: CCTCAGAATGAGTGCTGACCGTAAGTCGAAACCCAGGAAACG, reverse accelerating primer: CTTCCCTTTCAAAGTCATGCCCA, reverse probe 1: fluorescent label-AGGAAAATGAGGTCTTCAATCTCAG, reverse probe 2: fluorescent marker-CCTCAGAATGAGTGCTGACCGT; the primer probe of the reagent system for detecting the second flow comprises: forward peripheral primer: CTTACCAATGGGTGCTTAA, reverse peripheral primer: CGAAAAACAGAAAGGCAACAA, forward crossover primer: ATCCCATTGGAACATGTCTTCAAATTTAGTAACATTGAAGGCTCAG, reverse accelerating primer: CTCAGAAGATGGCTGGTCAGTTTTCATAACCTCTTGGTCTC, reverse probe 1: fluorescent label-GTCTTCTTTTCCCAAAAGAAACTG, reverse probe 2: fluorescent marker-CAAGAGCAGTGCTCAAACAAATGA;

collecting a throat swab sample of a tester; step three, immersing the head of the swab in the sampling liquid and mixing uniformly; placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover; step five, standing for 10-30 minutes at the reaction temperature of 50-65 ℃; step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes; and step seven, reading the result.

The application of the self-driven microfluidic detection device for detecting escherichia coli and salmonella enteritidis comprises the following steps:

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 1 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

step one, pre-arranging an escherichia coli detection reagent system and a salmonella enteritidis detection reagent system in 2 functional chambers;

the primer probe of the reagent system for detecting the escherichia coli comprises:

forward peripheral primer: ACCGTCAGGAAGCGGTAC, reverse peripheral primer: TTTCACCCACTCTTCCTGGAT, forward crossover primer: AGACGGTTGGAGTTGGAGGAGTGCAGAACAGGCGGAAGTT, reverse accelerating primer: GTCTTTCGCATCGTCAATCAAAA, reverse probe 1: fluorescent label-TTTTCGAACCGACCACCAACAC, reverse probe 2: fluorescent marker-AGACGGTTGGAGTTGGAGGAGT; the primer probe of the salmonella enterica detection reagent system comprises: forward peripheral primer: CGTGATGCTGAAAGTACCGA, reverse peripheral primer: GGCCGCCAAAACTTTCCTGA, forward crossover primer: CCACCGCGTACGGACTTCACCGAAACACAAACGGGCAAG, reverse accelerating primer: AGATCTTTTAGCAATTGCTTCT, reverse probe 1: fluorescent label-TGCCGCGCATACGGAACAG, reverse probe 2: fluorescent marker-CCACCGCGTACGGACTTCAC; wiping the surface of the object to be detected for 5-20 times in a large range by using a swab stained with a small amount of sampling liquid; step three, immersing the head of the swab in the sampling liquid and mixing uniformly; placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover; step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃; step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes; and step seven, reading the result.

The application of the self-driven microfluidic detection device for detecting the salmonella enteritidis in the anal swab comprises the following steps:

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 0.5 mm;

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

step one, an amplification reagent system for specifically detecting salmonella enteritidis and a quality control amplification reagent system containing human-derived GAPDH genes are pre-arranged in 2 functional chambers; the primer probe of the amplification reagent system of the salmonella enteritidis comprises: forward peripheral primer: CGTGATGCTGAAAGTACCGA, reverse peripheral primer: GGCCGCCAAAACTTTCCTGA, forward crossover primer: CCACCGCGTACGGACTTCACCGAAACACAAACGGGCAAG, reverse accelerating primer: AGATCTTTTAGCAATTGCTTCT, reverse probe 1: fluorescent label-TGCCGCGCATACGGAACAG, reverse probe 2: fluorescent marker-CCACCGCGTACGGACTTCAC; the primer probe of the quality control amplification reagent system filled with the human-derived GAPDH gene comprises: forward peripheral primer: AGAACGGGAAGCTTGTCATC, reverse peripheral primer: CGAACATGGGGGCATCAG, forward crossover primer: CAGAGGGGGCAGAGATGAATCTTCCAGGAGCGAGATCC, reverse accelerating primer: ATCTTCCAGGAGCGAGATCCCAGAGGGGGCAGAGATGA, reverse probe 1: fluorescent label-CAAAATCAAGTGGGGCGA, reverse probe 2: fluorescent marker-GGGAGCCAAAAGGGTC; collecting an anal swab; step three, immersing the head of the swab into the sampling liquid, mixing uniformly, filtering the sampling liquid by using a filter membrane, and filtering out residues; placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover; step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃; step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes; and step seven, reading the result.

The use of the self-driven microfluidic detection device for detecting microorganisms in a urine sample comprises the following steps:

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the capillary guide vanes of the capillary guide channel are made of PE materials, and the distance between the capillary guide vanes is 0.5 mm;

step one, pre-arranging an escherichia coli detection reagent system and a salmonella enteritidis detection reagent system in 4 functional chambers;

the primer probe of the reagent system for detecting ureaplasma urealyticum comprises:

forward peripheral primer: GTGATTTAACTGTAGAACAAGAACA, reverse peripheral primer: AGGACCACTATATTGTAGTAGTGC, forward crossover primer: GGCATGCGATATGAAACACCATAGATCTTTTTTGACCAGGATC, reverse accelerating primer: ATTATGATTTTTAACTGGTTCTTC, reverse probe 1: fluorescent label-CACCATTTTTAATTACAGTAACT, reverse probe 2: fluorescent marker-GGCATGCGATATGAAACACCA; the primer probe of the staphylococcus aureus detection reagent system comprises: forward peripheral primer: CTGAATATGCAATGAAAGTAACTGA, reverse peripheral primer: TTTTTCTCTTTGCATATTATCGC, forward crossover primer: GACAACGCTTCTTTATCATTTGTGACAAGAGCTAGAGTCGTTAGC, reverse accelerating primer: ATAATTTCTTCAAGTCGTGCCGC, reverse probe 1: fluorescent label-GTGATACCAGCATGAATCGGTTTA, reverse probe 2: fluorescent marker-GACAACGCTTCTTTATCATTTGTGA; the primer probe of the neisseria gonorrhoeae detection reagent system comprises: forward peripheral primer: GCTTTTAAATCCAATACCGTATT, reverse peripheral primer: TTGAGTTCGATGGTGCTG, forward crossover primer: GAGGCCATTTACGCCCAATCAACAATAAAATATCCATCACCACTG, reverse accelerating primer: GTGCCGTCAAGGGAAGGTTG the flow of the air in the air conditioner,

reverse probe 1: fluorescent label-GCCCAATCCCAAGCCGTCG, reverse probe 2: fluorescent marker-GAGGCCATTTACGCCCAATC; the primer probe of the candida albicans detection reagent system comprises: forward peripheral primer: CGAGTTGCCCCAAGACATG, reverse peripheral primer: AATGACCGCTCTGAGTGATG, forward crossover primer: CAGGCCACAAACCCACCAAAGAGAATTGTCGAAAATCGCCCG, reverse accelerating primer: GTGCTCTAATGGGGCAATTTCCA, reverse probe 1: fluorescent label-ATGCTGAGCCGGAGCCTTTA, reverse probe 2: fluorescent marker-CAGGCCACAAACCCACCAAAGA; step two, dipping a urine sample by using a dry swab head, and taking out the sample when the top of the swab absorbs the sample; step three, immersing the head of the swab in the sampling liquid and mixing uniformly; placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover; step five, standing for 10-30 minutes at the reaction temperature of 50-75 ℃; step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes; and step seven, reading the result.

The self-driven microfluidic detection method for quantitatively detecting the kidney marker comprises the following steps:

the capillary guide vanes of the capillary guide channel are made of PP materials, and the distance between the capillary guide vanes is 0.4 mm;

step one, preparing nanogold; step two, preparing a gold-labeled RBP monoclonal antibody 1; attaching the NC membrane to a PVC bottom plate, spraying RBP monoclonal antibody 2 and goat-anti-mouse secondary antibody at each position of the NC membrane by using a reciprocating membrane scribing instrument, wherein the RBP monoclonal antibody and the goat-anti-mouse secondary antibody are respectively a detection line (T line) and a quality control line (C line), and drying; step four, adding a cell fusion agent into the gold-labeled RBP monoclonal antibody solution; then spraying the mixture on a bonding pad of a glass fiber membrane, and drying; step five, assembling a sample pad of the glass cellulose membrane, a combination pad of the glass cellulose membrane, an NC membrane and a water absorption pad into a detection test strip, and adjusting the sensitivity of the test strip; step six, assembling the detection test strip in a self-driven microfluidic detection device; step seven, sequentially pre-filling four gradients of physiological saline in the 4 functional chambers; and step eight, adding the urine sample into a sample adding hole of the detection device, sucking out the redundant sample, and entering 4 functional chambers under the control of the microfluidic flow guide device, wherein the sample is diluted by 100 times, diluted by 10 times, diluted by 2 times and undiluted in the 4 functional chambers respectively. And step nine, reading the result.

The application of the self-driven microfluidic detection device to the detection of the viruses A and B comprises the following contents:

the adopted chromatography test paper is nucleic acid immunochromatographic test paper;

the capillary guide vanes of the capillary guide channel are made of glass, and the distance between the capillary guide vanes is 0.2 mm;

the primer probe of the reagent system for detecting the influenza A virus comprises: forward peripheral primer: CAGAGGGCAATGATGGATCA, reverse peripheral primer: ATCCCGACCAGTGAGTACC, forward crossover primer: CCTCAGAATGAGTGCTGACCGTAAGTCGAAACCCAGGAAACG, reverse accelerating primer: CTTCCCTTTCAAAGTCATGCCCA, reverse probe 1: fluorescent label-AGGAAAATGAGGTCTTCAATCTCAG, reverse probe 2: fluorescent marker-CCTCAGAATGAGTGCTGACCGT; the primer probe of the reagent system for detecting the influenza B virus comprises: forward peripheral primer: ACTTACCAATGGGTGCTTAA, reverse peripheral primer: CGAAAAACAGAAAGGCAACAA, forward crossover primer: GCATCCCATTGGAACATGTCTTCAAATTTAGTAACATTGAAGGCTCAG, reverse accelerating primer: CCTCAGAAGATGGCTGGTCAGTTTTCATAACCTCTTGGTCTC, reverse probe 1: fluorescent label-GTCTTCTTTTCCCAAAAGAAACTG, reverse probe 2: fluorescent marker-CAAGAGCAGTGCTCAAACAAATGA; collecting a throat swab sample of a tester; step three, immersing the head of the swab in the sampling liquid and mixing uniformly; placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole, and covering the sample adding hole cover; step five, standing for 10-30 minutes at the reaction temperature of 50-65 ℃; step six, immediately adding the cleaning solution into the sample adding hole, covering the sample adding hole cover, and standing for 5-15 minutes; and step seven, reading the result.

The invention has the advantages that:

the device adopts a microfluidic flow guide design, the capillary flow guide channels are mutually crossed, and the crossed structure can play a role in storing and buffering liquid, so that the liquid balance of each flow direction can be realized; the structure and the material of the capillary guide vane are matched, so that the adhesive force is larger than the cohesive force, liquid can infiltrate the contact surface and form a capillary action, and the space between the two capillary guide vanes is filled with the liquid, so that the flow guide effect is realized; thereby realizing the accurate control of the liquid flow, improving the accuracy, avoiding cross contamination and realizing the home self-inspection of nucleic acid detection;

the device of the invention does not need an external power supply and a water source; a professional laboratory environment is not needed; professional training is not needed; under the condition of improper operation, harmful consequences such as electric shock, mechanical injury and the like can not occur, the operation is simple and convenient, and the device is suitable for common people to carry out household detection and detection under the conditions of some field environments or lack of professionals and equipment;

the device can carry out quantitative detection under the support of microfluidics and multiple detection;

the device has high flexibility, and can be applied to multiple fields of infectious disease detection, pathogen typing detection, environmental microorganism detection, biochemical index detection, marker detection, drug detection and the like.

Drawings

FIG. 1 is a top view of one embodiment of a cover of the present invention;

FIG. 2 is a bottom view of one embodiment of the upper cover of the present invention;

FIG. 3 is a side view of one embodiment of the upper cover of the present invention;

FIG. 4 is a top view of one embodiment of a sandwich of the present invention;

FIG. 5 is a cross-sectional view of one embodiment of the apparatus of the present invention;

FIG. 6 is a schematic structural view of one embodiment of the on-off connector of the present invention;

FIG. 7 is a schematic block diagram of an open state of another embodiment of the on/off connector of the present invention;

FIG. 8 is a schematic view of the connection state of another embodiment of the on/off connector of the present invention;

FIG. 9 is a schematic diagram of one embodiment of a capillary deflector of the present invention;

fig. 10 is a schematic diagram of another embodiment of a capillary deflector of the present invention.

The meaning of the reference symbols in the figures:

1 upper cover, 2 bottom plate, 3 interlayer, 4 sample adding holes, 5 capillary guide channels, 51 capillary guide channel unit, 511 capillary guide plates, 5111 bridging parts, 512 guide channels, 501 first-level capillary guide channels, 502 second-level capillary guide channels, 503 third-level capillary guide channels, 6 on-off connectors, 601 first buffer grooves, 6011 gaps, 602 second buffer grooves, 603 partitions, 604 water absorption pads, 605 connecting grooves, 7 sample adding grooves, 8 functional chambers, 801 first-level functional chambers, 802 second-level functional chambers, 9 chromatography test paper, 10 heating modules, 11 result reading windows, 12 batteries, 13 switches, 14 functional chamber upper covers, 15 switch holes, 16 indicator light windows, 17 indicator light holes, 18 buckles, 19 sample adding hole covers, 20 and 21 result display piece fixing components.

Detailed Description

The invention is described in detail below with reference to the figures and the embodiments.

As shown in fig. 1, 2, 3, 4, and 5, a self-driven microfluidic detection device includes: an upper cover 1, a bottom plate 2 fixed under the upper cover 1, an interlayer 3 arranged between the upper cover 1 and the bottom plate 2, a sample adding hole 4 arranged on the upper cover 1, a microfluidic flow guide component connected to the sample adding hole 4, a sample adding groove 7 arranged on the interlayer 3 and corresponding to the microfluidic flow guide component, a functional chamber 8 arranged on the interlayer 3 and connected to the microfluidic flow guide component, a result display part for displaying the detection result, a result reading window 11 arranged on the upper cover 1 and above the result display part, a heating module 10 attached to the bottom of the functional chamber 8 and arranged in the bottom plate 2, a temperature control device connected to the heating module 10, a power supply connected to the heating module 10 and fixed in the bottom plate 2, a switch 13 and an indicator light connected to the power supply and fixed in the bottom plate 2, a switch hole 15 arranged on the upper cover 1, and an indicator light window 16 arranged on the upper cover 1, an indicator light hole 17 arranged on the interlayer 3, a buckle 18 arranged on the upper cover 1 and the bottom plate 2 and used for assembly, result display part fixing components 20 and 21 arranged on the upper cover 1 and the interlayer 3, a functional chamber upper cover 14 arranged on the upper cover 1 and matched with the functional chamber 8, and a sample hole cover 19 fixed on the sample hole 4. The result display part can be connected with different parts according to the detection type, and can be connected with an upper cover, an interlayer, a bottom plate and the like without limitation.

Reaction reagents: the materials used for detection are preset in the functional cavity, and the materials contained in the materials and the pre-loading mode can be combined in various ways according to different detection items.

The result display member includes: the chromatographic test paper 9, a fluorescence detector or test paper, a visible dye detection test paper or device, an electric signal detector and the like, and the detection method and the detection equipment are not limited, and the invention is applicable to products which can be connected with reagents after reaction and display detection results; the chromatographic test paper 9 is used for presenting a detection result, a strip-shaped fiber chromatographic material fixed with a detection line and a quality control line is used as a stationary phase, a test solution is used as a mobile phase, a fluorescence labeling antibody or antigen is fixed on a connecting pad, and an analyte is moved and captured on the chromatographic strip through capillary action so as to carry out detection.

The functional chamber is a chamber giving a space where a physical reaction or a chemical reaction occurs; and is not limited by the detection type and the object.

The sample adding hole 4 and the sample adding hole cover 19 are positioned on the outer surface of one end of the top of the upper cover 1, the inner diameter of the sample adding hole 4 is matched with the outer diameter of the cylindrical part below the sample adding hole cover 19, and the sample adding hole 4 can be opened and closed by covering and opening the sample adding hole cover 19.

A functional chamber cover 14 is located on the inside surface of the top of the cover 1 and is shaped and positioned to match the functional chambers on the mezzanine 3. When the device is completely assembled, the functional chamber upper cover 14 can cover the functional chamber to prevent the liquid from overflowing out of order.

The result display piece fixing members 20, 21 are formed of result display piece fixing projections on the inner surface of the top of the upper cover 1 and the upper surface of the sandwich 3. When the device is completely assembled, the fixing bulge of the result display part plays a role in fixing and supporting the immune test paper.

The result reading window 11 is located on the top of the upper cover 1 and is made of transparent material, and when the device is assembled, the result reading window 11 is located above the result display. When the device is used for testing, the reading of the test results can be performed through the result reading window 11. The result reading window 11 can be printed with graphics for guiding the result reading as required.

The upper cover 1 and the bottom plate 2 are both provided with a buckle 18, and the buckle 18 of the upper cover 1 is positioned on the inner surface of the side part of the upper cover 1 and is used for being assembled with the interlayer 3; the buckle 18 of the bottom plate 2 is used for being fixedly assembled with the upper cover 1.

Sample feeding groove 7 is located the upper surface of intermediate layer 3, and sample feeding groove 7 includes: the sample adding bulges arranged at the edge position play a role of accommodating liquid, and a plurality of sample adding grooves which are mutually crossed are formed between the sample adding bulges. When the device is completely assembled, the position of the sample adding groove 7 corresponds to that of the sample adding hole 4, and the position of the sample adding groove 7 corresponds to that of the microfluidic flow guide assembly of the upper cover 1.

One end of the functional cavity is connected with the sample adding groove 7, and the other end is connected with the microfluidic flow guide assembly. The functional chamber is the location where the reagent reacts or mixes with the sample.

The microfluidic flow guide assembly is connected with the sample adding hole 4, the functional chamber and the result display part. The microfluidic flow guide assembly comprises: the capillary guide channel 5 is connected with the capillary guide channel 5, and the on-off connector 6 is used for controlling the connection and disconnection of the capillary guide channel 5.

The capillary flow guide channel 5 is composed of a plurality of capillary flow guide channel units 51; the capillary flow guide channel unit 51 includes: two parallel capillary flow deflectors 511, and a flow guide channel 512 formed between the capillary flow deflectors 511. The attraction between the liquid molecules in the flow guide channel 512 is cohesion, and the attraction between the liquid molecules in the flow guide channel 512 and the capillary flow guide piece 511 is adhesion; the adhesion is greater than the cohesion. The material and surface texture of the capillary flow deflector 511 are not limited and can be adjusted according to the detected object; as an example, the capillary flow-guiding plate 511 may be made of plastic, metal, glass, high molecular polymer, etc.; the surface texture of the capillary deflector 511 may be a smooth surface, a frosted surface, or a specific texture. As an example, the spacing between two parallel capillary baffles 511 ranges from: 0.01-2 mm. It should be noted that: the examples are not exhaustive, and any material, texture, and spacing that would allow adhesion to be greater than cohesion is within the scope of the present invention.

As shown in fig. 9 and 10, the end of capillary guide 511 is provided with a downwardly extending bridge 5111. as an example, as shown in fig. 9, one end of capillary guide 511 is provided with a bridge 5111, and the bridge 5111 is bent downwardly, and the bridge 5111 allows the end of capillary guide 511 to contact the reactant pre-loaded in the functional chamber. As an example, as shown in fig. 10, two bridges 5111 are provided at both ends of the capillary guide plate 511, and the bridges 5111 extend downward and have a U-shape as a whole.

The capillary guide channels 5 are arranged in a mutually crossed mode below the sample adding holes 4, and the crossed point is located below the centers of the sample adding holes 4.

The device also can be according to the detection demand of difference, and the constitution of function cavity and capillary water conservancy diversion canal can be multistage structure: as shown in fig. 6 and 7, the specific structure is as follows.

As an example, as shown in fig. 6, the capillary flow guide channel 5 is a tertiary capillary flow guide channel 503, and the functional chamber 8 is a secondary functional chamber 802; the third-stage capillary guide channels 503 are respectively: a first-stage capillary flow guide channel 501 connected between the sample adding slot 7 and the first-stage function chamber 801, a second-stage capillary flow guide channel 502 connected between the on-off connector 6 and the second-stage function chamber 802, and a third-stage capillary flow guide channel 503 connected between the second-stage function chamber 802 and the chromatography test paper 9. As shown in fig. 6, the on-off connector 6 includes: a first buffer tank 601 connected to the primary function chamber 801, a second buffer tank 602 connected to the first buffer tank 601 and provided with a secondary capillary diversion trench 502, and a partition 603 arranged between the first buffer tank 601 and the second buffer tank 602; the height of the partition 603 is lower than the height of the first buffer tank 601 and the second buffer tank 602. A gap 6011 is disposed between the first buffer tank 601 and the primary function chamber 801 to guide the liquid to flow into the first buffer tank 601. The operation process is as follows: after the test sample is added from the sample adding hole 4, the test sample is guided to the primary functional chamber 801 through the primary capillary diversion channel 501 for reaction; after the reaction is finished, more liquid is added, so that the liquid overflows from the primary function chamber 801 and enters the first buffer tank 601, when a sample added into the primary function chamber 801 is slightly excessive, the liquid overflows from a notch 6011 of the primary function chamber 801 to the first buffer tank 601, at this time, the first buffer tank 601 plays a role of separating 603 the primary function chamber 801 from the second buffer tank 602, because the height of the separation 603 is lower than that of the first buffer tank 601 and the second buffer tank 602, when more liquid is continuously added subsequently, the liquid entering the first buffer tank 601 enters the second buffer tank 602 through the separation 603, so that the on-off connector 6 is communicated, enters the secondary function chamber 802 through the secondary capillary diversion canal 502 for reaction, and then the liquid is guided to the chromatography test paper 9 through the tertiary capillary diversion canal 503 to obtain a result.

As another example, the on-off connector 6 includes: the connecting groove 605 connected to the primary function chamber 801 is placed in the connecting groove 605 and corresponds to the water-absorbing expansion member under the secondary capillary guide channel 502. As an example, the water-absorbent swelling member is a water-absorbent pad 604; the description is as follows: the shape of the material of the water-absorbing expansion piece is not limited, and the water-absorbing expansion piece can be applied to the invention as long as the water-absorbing expansion piece can realize on-off. When detecting salmonella enteritidis in the anal swab, as shown in fig. 7, in a disconnected state, a sample is added and then uniformly distributed into the primary functional chamber 801 to react, liquid in the primary functional chamber 801 flows into the connecting groove 605 through the notch 6011, the water absorption pad 604 absorbs water to expand, as shown in fig. 8, the water absorption pad 604 enters a connected state, the water absorption pad 604 contacts the secondary capillary flow guide channel 502, amplification products of two reactions are guided to the secondary functional chamber 802 through the secondary capillary flow guide channel 502, the amplification products are mixed in the secondary functional chamber 802, then the secondary functional chamber 802 is connected with the nucleic acid immunochromatographic test paper 9 through the tertiary capillary flow guide channel 503, a C line of the chromatographic test paper 9 captures positive amplification products of a GAPDH system, and a T line captures positive products of the salmonella enteritidis amplification system. It should be noted that: the primary, secondary and tertiary stages are for clarity of illustration only, and it is not necessary to have a secondary functional chamber and a tertiary capillary channel to use the on/off connector as described above, and the number of functional chambers and capillary channels is not limited.

It should be noted that the present invention is only two examples, but these are not exhaustive, and it is within the scope of the present invention to provide the connection and disconnection between the reagent liquid and the capillary flow channel. In addition to the structure of the present invention, a connection pipe may be disposed between the secondary capillary flow guide channel 502 and the primary function chamber 801, the connection pipe is connected to the primary function chamber 801 in an inclined or vertical manner, and the secondary capillary flow guide channel 502 can be connected only after the liquid flow reaches a predetermined amount, so as to achieve connection and disconnection. The on-off can also be realized by hydraulic pressure. The on-off can also be realized by mechanical devices, such as valves and the like; the expansion member may also be expanded by the principle of thermal expansion, for example.

The heating module 10 assembly comprises: the heating module 10 is attached to the bottom of the functional cavity and arranged in the bottom plate 2, the temperature control device is connected to the heating module 10, the power supply is connected to the heating module 10 and fixed in the bottom plate 2, the switch 13 and the indicating lamp are connected to the power supply and fixed in the bottom plate 2, the switch hole 15 is arranged on the upper cover 1, the indicating lamp window 16 is arranged on the upper cover 1, and the indicating lamp hole 17 is arranged on the interlayer 3.

A battery 12, a heating module 10, an indicator light and a switch 13 are fixed inside the base plate 2. A heating module 10: the function of heating is provided for the reaction, the bottom of the functional cavity is attached to the functional cavity, and the temperature of the functional cavity is controlled through the electric heating and temperature control device. The battery 12: the battery 12 is pre-installed in the space between the interlayer 3 and the base plate 2, and is connected with the heating module 10, the switch 13 and the indicator lamp through electric wires to supply power to the heating module 10. An indicator light: the indicator light plays the effect of instructing whether the power switches on, and when the power switches on, the indicator light lights. The indicator light window 16 is located at one end of the sample adding hole 4 of the upper cover 1, is made of a light-transmitting material, and has a protruding structure at a part of the inner surface of the upper cover 1 for fixing the indicator light. The switch hole 15 is located at one end of the side sample hole 4 of the upper cover 1 and is used for installing the switch 13. The indicator light hole 17 is a round hole for accommodating an indicator light and is positioned at one end of the sample adding hole 4 of the device; the switch 13: the power switch 13 of the device is turned on and off by turning on and off the switch 13, thereby controlling the progress of the detection reaction.

The device can adjust the channel quantity according to different detection demands, for example: the 2-channel self-driven microfluidic detection device is characterized in that a sample adding hole 4 is connected with two functional chambers through a capillary diversion channel 5, and each functional chamber corresponds to a chromatographic test paper 9 and a result reading window. The 4-channel self-driven microfluidic detection device is characterized in that a sample adding hole 4 is connected with four functional chambers through a capillary diversion channel 5, and each functional chamber corresponds to one chromatographic test paper 9 and one result reading window. The 6-channel self-driven microfluidic detection device is characterized in that a sample adding hole 4 is connected with 6 functional chambers through a capillary diversion channel 5, and each functional chamber corresponds to a chromatographic test paper 9 and a result reading window.

It should be noted that: the device can select to use each component according to the requirement of the detection item. For example, the battery 12, the heating module 10, the switch 13, etc. may be omitted when the detection reaction does not require heating to save the manufacturing cost.

The operation steps of the device of the invention comprise:

1. sample application

The detection device is placed on a horizontal table, the orifice cover 19 is opened, and the sample is added to the sample addition well 4. The liquid is guided by the micro-fluidic flow guide device to uniformly flow to each functional cavity.

2. Detection reaction

Cover the sample injection hole 19, open the switch 13 (if the non-heating detection method is adopted, the switch 13 is not needed), and keep standing for 0-60 minutes.

3. Chromatography reaction

After the detection reaction is completed, the port cover 19 is opened and buffer solution is added to allow the liquid inside the device to flow from the functional chamber to the chromatographic test paper 9. And (5) covering the upper cover 1 again, and standing for 5-15 minutes.

4. The test results are read from the sample reading window.

The detection accuracy of the device is verified by several detection applications of the device.

The application I is a method for applying a self-driven micro-fluidic nucleic acid detection device to detecting new corona/new corona mutant strain/A current/B current virus nucleic acid.

Detecting items: novel coronavirus, novel coronavirus mutant B.1.1.7, influenza A virus and influenza B virus.

1, materials and methods

A 4-channel self-driven microfluidic detection device is adopted. The 4-channel self-driven microfluidic detection device is characterized in that a sample adding hole 4 is connected with four functional chambers through a capillary diversion channel 5, and each functional chamber corresponds to one chromatographic test paper 9 and one result reading window.

According to the characteristics of the detection liquid, the material of the microfluidic flow guide device in the scheme is PE, and the distance between the flow guide sheets is 0.2 mm.

The adopted chromatographic test paper 9 is nucleic acid immunochromatographic test paper 9.

The primers and probes are shown in table 1 below:

TABLE 1

DNA polymerase: bst 3.0DNA polymerase (NEB)

Reverse transcriptase: AMV reverse transcriptase (NEB)

Each functional chamber is pre-filled with the following components: forward peripheral primer: 1-50pmol, reverse peripheral primer: 1-50pmol, forward crossover primer: 10-500pmol, reverse cross primer: 10-500pmol, Forward Probe: 1-100pmol, reverse probe: 1 to 100pmol, 5 to 50U of DNA polymerase, 0.5 to 8U of reverse transcriptase, 10 to 300nmol of dNTP, and 0.1 to 5. mu.g of BSA.

The materials of the four detection systems are pre-filled in 4 functional chambers in sequence according to the composition of the systems.

The components of the sampling solution are as follows: 5-100mM Tris-HCl, 0.5-40 μ M DTT, 0.1-1M Betaine, 0.1-5% TritonX-100, 2-15 mM MgSO₄[email protected] ℃. Cleaning fluid components: 5-100mM Tris-HCl, 2-15 mM NaCl.

The detection method comprises the following steps:

1, collecting a throat swab sample of a tester;

2, immersing the head of the swab in 0.2-1ml of sampling solution, and uniformly mixing by rotating or shaking for 5-15 seconds;

3, placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole 4, and covering the sample adding hole cover 19;

4, turning on a power switch 13, keeping the reaction temperature at 50-65 ℃, and standing for 10-30 minutes;

5, after the step 4 is finished, immediately adding 0.2-1ml of cleaning solution into the sample adding hole 4, covering the sample adding hole cover 19, and standing for 5-15 minutes;

and 6, reading the result.

As a result:

false viruses respectively containing four pathogen nucleic acids of the novel coronavirus, the novel coronavirus mutant B.1.1.7, the influenza A virus and the influenza B virus are used as detection samples for detection; pseudoviruses were added to the collected swabs at a sample concentration of 100000 copies/swab, 10000 copies/swab, 1000 copies/swab, 100 copies/swab, 10 copies/swab, 1 copy/swab. For each pseudovirus, the number of replicates per sample concentration was 10 (n-10). The test is tested with a negative control 10.

And (3) displaying a detection result:

when the sample concentration is 100000 copies/swab, the novel coronavirus pseudovirus, the novel coronavirus B.1.1.7 pseudovirus, the influenza A virus pseudovirus and the influenza B virus pseudovirus are all detected, and the detection rate is 100%.

When the sample concentration is 10000 copies/swab, the novel coronavirus pseudovirus, the novel coronavirus B.1.1.7 pseudovirus, the influenza A virus pseudovirus and the influenza B virus pseudovirus are all detected, and the detection rate is 100 percent.

When the sample concentration is 1000 copies/swab, the novel coronavirus pseudovirus, the novel coronavirus B.1.1.7 pseudovirus, the influenza A virus pseudovirus and the influenza B virus pseudovirus are all detected, and the detection rate is 100 percent.

When the sample concentration is 100 copies/swab, the detection rate of the novel coronavirus pseudovirus is 80%; the detection rate of the novel coronavirus B.1.1.7 pseudovirus is 50 percent; the detection rate of the influenza A virus false virus is 30 percent; the false virus detection rate of the influenza B virus is 40 percent;

when the sample concentration is 10 copies/swab, the novel coronavirus pseudovirus, the novel coronavirus B.1.1.7 pseudovirus, the influenza A virus pseudovirus and the influenza B virus pseudovirus are not detected, and the detection rate is 0%.

When the sample concentration is 1 copy/swab, the novel coronavirus pseudovirus, the novel coronavirus B.1.1.7 pseudovirus, the influenza A virus pseudovirus and the influenza B virus pseudovirus are not detected, and the detection rate is 0%.

The negative control result was negative.

And (4) conclusion:

the experimental result proves that the self-driven micro-fluidic detection device is applied to the detection of four nucleic acids, namely novel coronavirus, novel coronavirus mutant B117A-flow virus and B-flow virus, and the sensitivity reaches or is superior to 1000 copies/swab.

And secondly, a method for detecting food microorganisms by using the self-driven micro-fluidic nucleic acid detection device.

Detecting items: escherichia coli, Salmonella enteritidis.

1. Materials and methods

Adopts a 2-channel self-driven micro-fluidic detection device, wherein the 2-channel self-driven micro-fluidic detection device is a sample adding hole 4 which is connected with two functional chambers through a capillary guide channel 5,

each functional chamber corresponds to a chromatographic test strip 9 and a result reading window.

According to the characteristics of the detection liquid, the microfluidic flow guide device is made of glass, and the distance between the flow guide sheets is 1 mm.

The adopted chromatographic test paper 9 is nucleic acid immunochromatographic test paper 9.

The primers and probes are shown in table 2 below:

TABLE 2

DNA polymerase: bst 3.0DNA polymerase (NEB)

Each functional chamber is pre-filled with the following components:

forward peripheral primer: 1-50pmol, reverse peripheral primer: 1-50pmol, forward crossover primer: 10-500pmol, reverse cross primer: 10-500pmol, Forward Probe: 1-100pmol, reverse probe: 1 to 100pmol, 5 to 50U of DNA polymerase, 10 to 300nmol of dNTP, and 0.1 to 5. mu.g of BSA.

The materials of the two detection systems are pre-filled in the two functional cavities in sequence according to the composition of the systems.

The components of the sampling solution are as follows: 5-100mM Tris-HCl, 0.5-40 mu M DTT, 0.1-50 mg/ml BSA, 0.1-1M Betaine, 0.1-5% TritonX-100, 2-15 mM MgSO₄[email protected] ℃. Cleaning fluid components: 5-100mM Tris-HCl, 2-15 mM NaCl.

The detection method comprises the following steps:

step one, wiping the surface of the food material for 5-20 times in a large range by using a swab stained with a small amount of sampling liquid;

step two, immersing the head of the swab in 0.2-1ml of sampling solution, and uniformly mixing by rotating or shaking for 5-15 seconds;

step three, placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole 4, and covering the sample adding hole cover 19;

turning on a power switch 13, keeping the reaction temperature at 50-75 ℃, and standing for 10-30 minutes;

step five, after the step four is finished, immediately adding 0.2-1ml of cleaning solution into the sample adding hole 4, covering the sample adding hole cover 19, and standing for 5-15 minutes;

and step six, reading the result.

As a result:

3 batches of food material contaminated with escherichia coli, 3 batches of food material contaminated with salmonella enteritidis, and three batches of food material not contaminated with escherichia coli and salmonella enteritidis were used. The swab samples were collected in duplicate, and one sample was collected and tested as described above. And the other part is used for measuring the bacterial content by using a qPCR method, and the bacterial content in swab samples collected from three batches of food materials polluted by escherichia coli is as follows: 13500 strain/swab, 6500 strain/swab, 16000 strain/swab; the bacterium content in the swab specimens collected from three batches of food materials contaminated by salmonella enteritidis is as follows: 3500 bacteria/swab, 1200 bacteria/swab, 700 bacteria/swab.

The results of the detection of the self-driven microfluidic nucleic acid detection device applied to the method for detecting food microorganisms are shown in the following table 3:

TABLE 3

And (4) conclusion:

and (3) displaying a detection result: the method for detecting food microorganisms by using the self-driven micro-fluidic detection device can detect whether food materials are polluted by specific microorganisms within one hour, the result is accurate, and the detection sensitivity of the self-driven micro-fluidic detection device is superior to 1000 bacteria/swabs.

Third, method for applying self-driven micro-fluidic detection device to detecting microorganisms in urine sample

Detecting items: mycoplasma urealyticum, staphylococcus aureus, neisseria gonorrhoeae, candida albicans

2, materials and methods

A4-channel self-driven micro-fluidic nucleic acid detection device is adopted, wherein the 4-channel self-driven micro-fluidic detection device is characterized in that a sample adding hole 4 is connected with four functional chambers through a capillary flow guide channel 5, and each functional chamber corresponds to a chromatographic test paper 9 and a result reading window.

According to the characteristics of the detection liquid, the microfluidic flow guide device adopted by the scheme is made of PE (polyethylene), and the distance between the flow guide sheets is 0.5 mm.

The adopted chromatographic test paper 9 is nucleic acid immunochromatographic test paper 9.

Primer probes are shown in table 4 below:

TABLE 4

DNA polymerase: bst 3.0DNA polymerase (NEB)

Each functional chamber is pre-filled with the following components: forward peripheral primer: 1-50pmol, reverse peripheral primer: 1-50pmol, forward crossover primer: 10-500pmol, reverse cross primer: 10-500pmol, Forward Probe: 1-100pmol, reverse probe: 1 to 100pmol, 5 to 50U of DNA polymerase, 10 to 300nmol of dNTP, and 0.1 to 5. mu.g of BSA. The materials of the four detection systems are pre-filled in 4 functional chambers in sequence according to the composition of the systems.

The components of the sampling solution are as follows: 5-100mM Tris-HCl, 0.5-40 mu M DTT, 0.1-50 mg/ml BSA, 0.1-1M Betaine, 0.1-5% TritonX-100, 2-15 mM MgSO₄pH [email protected] ℃. Cleaning fluid components: 5-100mM Tris-HCl, 2-15 mM NaCl.

The detection method comprises the following steps:

step one, dipping a urine sample by using a dry swab head, and taking out the sample when the top of the swab absorbs the sample;

step two, immersing the head of the swab in 0.2-1ml of sampling solution, uniformly mixing by rotating or shaking for 5-15 seconds, and then standing for 5-10 minutes;

step three, placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole 4, and covering the sample adding hole cover 19;

turning on a power switch 13, and standing for 30 minutes;

step five, after the step four is finished, immediately adding 0.2-1ml of cleaning solution into the sample adding hole 4, covering the sample adding hole cover 19, and standing for 5-15 minutes;

and step six, reading the result.

As a result:

the urine containing ureaplasma urealyticum, staphylococcus aureus, neisseria gonorrhoeae and candida albicans is detected, and each pathogen in the urine is diluted and adjusted to be 100000cfu/ml, 10000cfu/ml, 5000cfu/ml, 2000cfu/ml, 1000cfu/ml, 500cfu/ml and 200 cfu/ml. For each pathogen, the number of replicates per concentration was 10 (n-10).

When the sample concentration is 100000cfu/ml, the detection rates of mycoplasma urealyticum, staphylococcus aureus, neisseria gonorrhoeae and candida albicans are all 100%.

When the sample concentration is 10000cfu/ml, the detection rate of mycoplasma urealyticum, staphylococcus aureus, neisseria gonorrhoeae and candida albicans is 100%.

When the sample concentration is 5000cfu/ml, the detection rates of mycoplasma urealyticum, staphylococcus aureus, neisseria gonorrhoeae and candida albicans are all 100%.

When the sample concentration is 2500cfu/ml, the detection rate of mycoplasma urealyticum, staphylococcus aureus and neisseria gonorrhoeae is 100%, and the detection rate of candida albicans is 60%.

When the sample concentration is 1000cfu/ml, the detection rate of ureaplasma urealyticum is 100%, the detection rate of staphylococcus aureus is 80%, and the detection rate of neisseria gonorrhoeae is 50%. The detection rate of the candida albicans is 30 percent.

When the concentration of the sample is 500cfu/ml, the detection rate of ureaplasma urealyticum is 50%, the detection rate of staphylococcus aureus is 40%, the detection rate of neisseria gonorrhoeae is 20%, and candida albicans is not detected.

When the concentration of the sample is 250cfu/ml, the detection rate of ureaplasma urealyticum is 10 percent, and staphylococcus aureus, neisseria gonorrhoeae and candida albicans are not detected.

And (4) conclusion:

the experimental conclusion proves that the self-driven microfluidic detection device can detect pathogens in urine by applying the method for detecting microorganisms in urine samples. The lower detection limits are respectively: 250cfu/ml of ureaplasma urealyticum, 500cfu/ml of staphylococcus aureus, 500cfu/ml of neisseria gonorrhoeae and 1000cfu/ml of candida albicans.

And fourthly, the method for quantitatively detecting the kidney marker by using the self-driven micro-fluidic detection device.

Detecting items: retinol Binding Protein (RBP)

Materials and methods:

a4-channel self-driven micro-fluidic detection device is adopted, wherein a sample adding hole 4 is connected with four functional chambers through a capillary flow guide channel 5, and each functional chamber corresponds to one chromatographic test paper 9 and one result reading window.

According to the characteristics of the detected liquid, the flow deflectors of the micro-fluidic flow guide device adopted in the scheme are made of PP materials, and the distance between the flow deflectors is 0.4 mm.

Reagents and preparation steps:

step one, heating a 0.01-0.1% gold chlorate solution to boil, and adding 1% trisodium citrate in a stirring state, wherein the volume ratio of the two is 10/1-100/1; when the solution is completely changed into transparent red, the solution is continuously boiled for 5 to 30 minutes, and after stirring and cooling, the required nanogold is obtained.

And step two, regulating the pH value of the nano gold solution obtained in the step 1 to 8-10 by using a potassium carbonate solution, adding the rat anti-RBP monoclonal antibody 1 into the solution, uniformly mixing, stirring at room temperature for 5-40 minutes at the concentration of 20-50 ng/mu l, adding 10% of calf serum solution, and stirring for 20 minutes at the volume ratio of 10/1-100/1.

Step three, centrifuging the solution prepared in the step 2 at 10000-. The pellet was resuspended in 5% BSA in borate buffer, the supernatant was centrifuged again in the same manner, and 5% BSA in borate buffer was added to the pellet and resuspended in 1/20 in the same volume to obtain gold-labeled RBP monoclonal antibody 1.

And step four, attaching the NC film to the PVC bottom plate 2, spraying RBP monoclonal antibody Tang 2 and goat anti-mouse secondary antibody at different positions of the NC film by using a reciprocating film scribing instrument, wherein the RBP monoclonal antibody Tang 2 and the goat anti-mouse secondary antibody are respectively a detection line (T line) and a quality control line (C line), and drying for 2 hours at 37 ℃.

And step five, adding PVP, PEG and sucrose into the gold-labeled RBP monoclonal antibody solution obtained in the step 3, wherein the addition amount is 0.02g/mL,0.02g/mL and 0.5 g/mL. Then spraying the mixture on a bonding pad of a glass fiber membrane, and drying the mixture at 37 ℃ for later use.

And step six, assembling the sample pad, the combination pad, the NC membrane and the water absorption pad 604 of the glass cellulose membrane into the detection test strip. The lower sensitivity limit of the test strip was adjusted to 100mg/L by adjusting the antibody concentrations of the conjugate pad and the test line.

And step seven, assembling the detection test strip in a self-driven microfluidic detection device.

Step eight, 0.2475mL, 0.225mL, 0.125mL and 0mL of physiological saline are pre-filled in the 4 functional chambers in sequence.

Step nine, adding 0.6mL of urine sample into the sample adding hole 4 of the detection device, and sucking out the residual sample in the hole after 1 minute. Under the control of a microfluidic flow guide device, into 4 functional chambers, and the final volume of each chamber was 0.25 mL. Thus the sample was diluted 100-fold, 10-fold, 2-fold, and undiluted in 4 functional chambers, respectively.

And step ten, reading the result.

As a result: 4 samples were tested separately, with RBP levels from healthy population, sample A at 150mg/L, sample B at 300mg/L, and population with renal inflammation at 1200mg/L for C and 1600mg/L for D.

The results of the test device are shown in table 5:

TABLE 5

Sample(s)	No. 1 test paper	No. 2 test paper	No. 3 test paper	No. 4 test paper
					A	-	-	-	+
B	-	-	+	+
					C	-	+	+	+
D	-	+	+	+

The results show that the concentration of RBP in the sample A is more than 100mg/L, the concentration of the sample B is more than 200mg/L, the concentration of the sample C is more than 1000mg/L, and the concentration of the sample D is more than 1000 mg/L. The experimental results suggest that inflammation of the kidney in two subjects with kidney verification is consistent with the actual sample.

And (4) conclusion: the self-driven microfluidic detection device can be used for detecting the kidney markers, and carrying out preliminary quantification on the kidney markers, so as to provide a preliminary judgment basis for the health of the kidney.

And fifthly, the method for applying the self-driven micro-fluidic nucleic acid detection device to the detection of the first current and the second current.

Detecting items: influenza A virus and influenza B virus.

1, materials and methods

A2-channel multistage self-driven micro-fluidic detection device is adopted, the 2-channel self-driven micro-fluidic detection device is characterized in that a sample adding hole 4 is connected with two functional chambers through a capillary guide channel 5, and each functional chamber corresponds to a chromatographic test paper 9 and a result reading window.

After entering from the sample adding hole 4, a sample enters the primary functional chamber 801 through the primary microfluidic flow guide channel, the sample is heated by a heating device in the primary functional chamber 801 to carry out nucleic acid amplification reaction, then cleaning liquid is added to enable the volume of the added liquid to exceed the critical value of the on-off connector 6, so that the on-off connector 6 is started to enable the liquid to enter the secondary functional chamber 802 through the secondary microfluidic flow guide channel, and in the secondary functional chamber 802, two reactants are fully mixed and then flow to the nucleic acid immunochromatographic test paper 9 through the tertiary microfluidic flow guide channel. Two T lines are arranged on the nucleic acid immunity test paper and respectively display the detection results of the A flow and the B flow.

According to the characteristics of the sampling liquid, the microfluidic flow guide device is made of glass, and the distance between the flow guide sheets is 0.2 mm.

The adopted chromatographic test paper 9 is nucleic acid immunochromatographic test paper 9, and the detection result of the A flow and the B flow is presented on one test paper.

The primers and probes are shown in table 6 below:

TABLE 6

DNA polymerase: bst 3.0DNA polymerase (NEB); reverse transcriptase: AMV reverse transcriptase (NEB); each functional chamber is pre-filled with the following components: forward peripheral primer: 1-50pmol, reverse peripheral primer: 1-50pmol, forward crossover primer: 10-500pmol, reverse cross primer: 10-500pmol, Forward Probe: 1-100pmol, reverse probe: 1 to 100 pmol; 5-50U of DNA polymerase; reverse transcriptase 0.5-8U; 10-300nmol of dNTP; BSA 0.1-5. mu.g.

The materials of the two detection systems are pre-filled in the two functional cavities in sequence according to the composition of the systems.

The detection method comprises the following steps:

1, collecting a throat swab sample of a tester;

2, immersing the head of the swab in 0.2-1ml of sampling solution, and uniformly mixing by rotating or shaking for 5-15 seconds;

3, placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole 4, and covering the sample adding hole cover 19;

4, turning on a power switch 13, keeping the reaction temperature at 50-65 ℃, and standing for 10-30 minutes;

5, after the step 4 is finished, immediately adding 0.2-1ml of cleaning solution into the sample adding hole 4, covering the sample adding hole cover 19, and standing for 5-15 minutes;

and 6, reading the result.

As a result:

detecting by using pseudoviruses respectively containing the A flow virus and the B flow virus as detection samples; pseudoviruses were added to the collected swabs at a sample concentration of 100000 copies/swab, 10000 copies/swab, 1000 copies/swab, 100 copies/swab, 10 copies/swab. For each pseudovirus, the number of replicates per sample concentration was 10 (n-20). The test is tested with a negative control 10.

And (3) displaying a detection result:

when the sample concentration is 100000 copies/swab, the A-flow virus pseudoviruses and the B-flow virus pseudoviruses are all detected, and the detection rate is 100 percent.

When the sample concentration is 10000 copies/swab, the A flow virus pseudovirus and the B flow virus pseudovirus are all detected, and the detection rate is 100 percent.

When the sample concentration is 1000 copies/swab, the detection rate of the virus A pseudoviruses is 85%, and the detection rate of the virus B pseudoviruses is 90%.

When the sample concentration is 100 copies/swab, the detection rate of the influenza A virus pseudovirus is 30 percent; the false virus detection rate of the influenza B virus is 40 percent;

when the sample concentration is 10 copies/swab, the A flow virus pseudoviruses and the B flow virus pseudoviruses are not detected, and the detection rate is 0 percent.

The negative control result was negative.

And (4) conclusion:

experimental results prove that the self-driven micro-fluidic detection device can be applied to detection of four nucleic acids of the virus A and the virus B, and the result is finally displayed on one test strip through the multi-stage micro-fluidic flow guide devices, so that the result is clear and definite and is more visual.

And sixthly, the method for detecting the salmonella enteritidis in the anal swab by using the self-driven micro-fluidic nucleic acid detection device.

Detecting items: salmonella enteritidis

1. Materials and methods

A 2-channel self-driven microfluidic detection device is adopted.

According to the characteristics of the detected liquid, the microfluidic flow guide device is made of glass, the distance between the flow guide sheets is 0.5mm, and the adopted switch 13 device is a water absorption pad 604 switch 13 device.

As shown in fig. 7 and 8, when less liquid is added, the absorbent pad 604 in the switch 13 device cannot be connected because it absorbs less liquid and has a lower height than the secondary capillary channel 502. As more liquid is added during operation, the absorbent pad 604 increases in height and connects to the secondary capillary flow channel 502, thereby communicating with the secondary capillary flow channel 502 and transporting the liquid to the secondary function chamber 802 for mixing in the secondary function chamber 802. And then connecting the secondary functional chamber 802 with a nucleic acid immunochromatographic test paper 9 through a tertiary capillary diversion channel 503, wherein a C line of the chromatographic test paper 9 captures a positive amplification product of a GAPDH system, and a T line captures a positive amplification product of a Salmonella enteritidis amplification system.

The adopted chromatographic test paper 9 is nucleic acid immunochromatographic test paper 9.

The primers and probes are shown in table 7 below:

TABLE 7

DNA polymerase: bst 3.0DNA polymerase (NEB)

Each functional chamber is pre-filled with the following components:

forward peripheral primer: 1-50 pmol; reverse peripheral primer: 1-50 pmol; forward crossover primer: 10 to 500 pmol; reverse cross primer: 10 to 500 pmol; a forward probe: 1 to 100 pmol; reverse probe: 1 to 100 pmol; 5-50U of DNA polymerase; 10-300nmol of dNTP; 0.1-5 mu g of BSA; the materials of the two detection systems are pre-filled in 2 functional cavities in sequence according to the composition of the components.

The components of the sampling solution are as follows:

5-100mM Tris-HCl，0.5-40μM DTT，0.1～50mg/ml BSA，0.1～1M Betaine，0.1％～5％TritonX-100，2～15mM MgSO₄[email protected] ℃; cleaning fluid components: 5-100mM Tris-HCl, 2-15 mM NaCl.

The detection method comprises the following steps:

firstly, collecting an anus swab;

step two, immersing the head of the swab in 0.2-1ml of sampling solution, uniformly mixing by rotating or shaking for 5-15 seconds, filtering the sampling solution by using a filter membrane, and filtering out large-volume residues;

step three, placing the device on a horizontal table, adding all the sampling liquid into the sample adding hole 4, and covering the sample adding hole cover 19;

turning on a power switch 13, keeping the reaction temperature at 50-75 ℃, and standing for 10-30 minutes;

step five, after the step four is finished, immediately adding 0.2-1ml of cleaning solution into the sample adding hole 4, covering the sample adding hole cover 19, and standing for 5-15 minutes;

and step six, reading the result.

As a result:

the operation method is used for collecting samples and detecting the samples.

The results of the self-driven microfluidic nucleic acid detection device applied to the detection of salmonella enteritidis in the anal swab are shown in the following table 8:

TABLE 8

And (4) conclusion:

and (3) displaying a detection result: the self-driven micro-fluidic detection device is applied to detecting salmonella enteritidis in the anal swab and can stably detect a sample with the sample concentration of 1000 bacteria/swab. The device can be used for detecting salmonella enteritidis in the anal swab.

The invention adopts the microfluidic flow guide design, realizes the accurate control of the liquid flow, has clear result, short report time, does not need professional training and expensive instruments and can obtain accurate detection results. The product can not generate harmful result when being operated improperly, has extremely high safety, and is very suitable for the common people to carry out self-detection at home. The product can be used for scraping and taking samples such as swabs on the surfaces of urine, oropharynx swabs, anus swabs and food materials for detection, and has a very wide application range. Through family self-checking, select suitable countermeasure, can alleviate masses 'anxiety, avoid unnecessary medical resources to occupy and crowd's gathering.

The foregoing illustrates and describes the principles, general features, and advantages of the present invention. It should be understood by those skilled in the art that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by using equivalent alternatives or equivalent variations fall within the scope of the present invention.

Sequence listing

<110> Hangzhou Yosida Biotechnology Co., Ltd

<120> self-driven micro-fluidic detection device and application thereof

<141> 2021-04-19

<160> 83

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 1

ggcagtcaag cctcttctc 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

tctgtcaagc agcagcaaag 20

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 3

ttcccctact gctgcctgga gttcctcatc acgtagtcgc 40

<210> 4

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 4

aagagcagca tcaccg 16

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

gaatttcttg aactgttgcg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

ttcccctact gctgcctgga 20

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 7

ttctttcaca cgtggtgt 18

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

gacagggtta tcaaacctct 20

<210> 9

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 9

aggtaagaac aagtcctgag ttgattatta ccctgacaaa gttttcag 48

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 10

agtaccattg gtcccaga 18

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 11

gtcccagaga tagcatgg 18

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 12

aggtaagaac aagtcctgag ttga 24

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

cagagggcaa tgatggatca 20

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 14

atcccgacca gtgagtacc 19

<210> 15

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 15

cctcagaatg agtgctgacc gtaagtcgaa acccaggaaa cg 42

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 16

cttccctttc aaagtcatgc cca 23

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 17

aggaaaatga ggtcttcaat ctcag 25

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 18

cctcagaatg agtgctgacc gt 22

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 19

acttaccaat gggtgcttaa 20

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 20

cgaaaaacag aaaggcaaca a 21

<210> 21

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 21

gcatcccatt ggaacatgtc ttcaaattta gtaacattga aggctcag 48

<210> 22

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 22

cctcagaaga tggctggtca gttttcataa cctcttggtc tc 42

<210> 23

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 23

gtcttctttt cccaaaagaa actg 24

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 24

caagagcagt gctcaaacaa atga 24

<210> 25

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 25

accgtcagga agcggtac 18

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 26

tttcacccac tcttcctgga t 21

<210> 27

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 27

agacggttgg agttggagga gtgcagaaca ggcggaagtt 40

<210> 28

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 28

gtctttcgca tcgtcaatca aaa 23

<210> 29

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 29

ttttcgaacc gaccaccaac ac 22

<210> 30

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 30

agacggttgg agttggagga gt 22

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 31

cgtgatgctg aaagtaccga 20

<210> 32

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 32

ggccgccaaa actttcctga 20

<210> 33

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 33

ccaccgcgta cggacttcac cgaaacacaa acgggcaag 39

<210> 34

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 34

agatctttta gcaattgctt ct 22

<210> 35

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 35

tgccgcgcat acggaacag 19

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 36

ccaccgcgta cggacttcac 20

<210> 37

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 37

gtgatttaac tgtagaacaa gaaca 25

<210> 38

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 38

aggaccacta tattgtagta gtgc 24

<210> 39

<211> 43

<212> DNA

<213> Artificial Sequence

<400> 39

ggcatgcgat atgaaacacc atagatcttt tttgaccagg atc 43

<210> 40

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 40

attatgattt ttaactggtt cttc 24

<210> 41

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 41

caccattttt aattacagta act 23

<210> 42

<211> 0

<212> DNA

<213> Artificial Sequence

<400> 42

<210> 43

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 43

ctgaatatgc aatgaaagta actga 25

<210> 44

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 44

tttttctctt tgcatattat cgc 23

<210> 45

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 45

gacaacgctt ctttatcatt tgtgacaaga gctagagtcg ttagc 45

<210> 46

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 46

ataatttctt caagtcgtgc cgc 23

<210> 47

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 47

gtgataccag catgaatcgg ttta 24

<210> 48

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 48

gacaacgctt ctttatcatt tgtga 25

<210> 49

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 49

gcttttaaat ccaataccgt att 23

<210> 50

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 50

ttgagttcga tggtgctg 18

<210> 51

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 51

gaggccattt acgcccaatc aacaataaaa tatccatcac cactg 45

<210> 52

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 52

gtgccgtcaa gggaaggttg 20

<210> 53

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 53

gcccaatccc aagccgtcg 19

<210> 54

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 54

gaggccattt acgcccaatc 20

<210> 55

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 55

cgagttgccc caagacatg 19

<210> 56

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 56

aatgaccgct ctgagtgatg 20

<210> 57

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 57

caggccacaa acccaccaaa gagaattgtc gaaaatcgcc cg 42

<210> 58

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 58

atgctgagcc ggagccttta 20

<210> 59

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 59

caggccacaa acccaccaaa ga 22

<210> 60

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 60

cagagggcaa tgatggatca 20

<210> 61

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 61

atcccgacca gtgagtacc 19

<210> 62

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 62

cctcagaatg agtgctgacc gtaagtcgaa acccaggaaa cg 42

<210> 63

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 63

cttccctttc aaagtcatgc cca 23

<210> 64

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 64

aggaaaatga ggtcttcaat ctcag 25

<210> 65

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 65

cctcagaatg agtgctgacc gt 22

<210> 66

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 66

acttaccaat gggtgcttaa 20

<210> 67

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 67

cgaaaaacag aaaggcaaca a 21

<210> 68

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 68

gcatcccatt ggaacatgtc ttcaaattta gtaacattga aggctcag 48

<210> 69

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 69

cctcagaaga tggctggtca gttttcataa cctcttggtc tc 42

<210> 70

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 70

gtcttctttt cccaaaagaa actg 24

<210> 71

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 71

caagagcagt gctcaaacaa atga 24

<210> 72

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 72

cgtgatgctg aaagtaccga 20

<210> 73

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 73

ggccgccaaa actttcctga 20

<210> 74

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 74

ccaccgcgta cggacttcac cgaaacacaa acgggcaag 39

<210> 75

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 75

agatctttta gcaattgctt ct 22

<210> 76

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 76

tgccgcgcat acggaacag 19

<210> 77

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 77

ccaccgcgta cggacttcac 20

<210> 78

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 78

agaacgggaa gcttgtcatc 20

<210> 79

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 79

cgaacatggg ggcatcag 18

<210> 80

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 80

cagagggggc agagatgaat cttccaggag cgagatcc 38

<210> 81

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 81

atcttccagg agcgagatcc cagagggggc agagatga 38

<210> 82

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 82

caaaatcaag tggggcga 18

<210> 83

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 83

gggagccaaa agggtc 16

46页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：一种恒温式采样组件

Self-driven micro-fluidic detection device and application thereof

相关技术

网友询问留言