阅读说明：本技术 病毒抗性植物及其制备方法 (Virus-resistant plants and methods for making same ) 是由 新子泰规 中原健二 山田哲也 增田税 于 2019-01-31 设计创作，主要内容包括：本发明的目的是提供黄瓜花叶病毒(CMV)抗性茄科植物。本发明提供具有突变型eIF4E基因的CMV抗性茄科植物,所述突变型基因编码对CMV无功能的eIF4E蛋白。本发明还提供CMV抗性植物的制备方法,所述方法包括使茄科植物的eIF4E基因突变的步骤,所述突变为成为编码对CMV无功能的eIF4E蛋白的突变型eIF4E基因的突变。(The object of the present invention is to provide Cucumber Mosaic Virus (CMV) resistant solanaceous plants. The present invention provides CMV-resistant solanaceae plants with a mutant eIF4E gene encoding an eIF4E protein that is non-functional for CMV. The present invention also provides a method for making a CMV-resistant plant, comprising the step of mutating the eIF4E gene of a solanaceous plant to a mutation that becomes a mutant eIF4E gene encoding an eIF4E protein that is non-functional for CMV.)

A CMV-resistant solanaceous plant having a mutant eIF4E gene encoding an eIF4E protein that is non-functional for Cucumber Mosaic Virus (CMV).

2. The CMV-resistant solanaceous plant of claim 1, which is a solanum plant.

3. The CMV-resistant plant of claim 1 or 2, which is tomato, and the mutant eIF4E gene is the eIF4E gene on chromosome 3 of tomato.

4. The CMV-resistant plant of any one of claims 1-3, wherein the mutant eIF4E gene has any one or more of the following mutations in the base sequence of exon 2:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

5. The CMV-resistant plant of any one of claims 1-4, which is tomato, the mutant eIF4E gene having a mutation selected from the group consisting of an insertion of 1 base, a deletion of 3 bases, and a deletion of 9 bases in the base sequence (SEQ ID NO: 2) in exon 2 of the eIF4E gene on chromosome 3 of tomato.

6. The CMV-resistant plant of any one of claims 1-4, which is a tomato, the mutant eIF4E gene having a mutation selected from the group consisting of an insertion of 1 base between the 15 th and 16 th bases, a deletion of 3 bases at positions 16-18, and a deletion of any 9 bases at positions 8-18 in the base sequence AGGGTAAATCTGATACCAGC (SEQ ID NO: 3) in exon 2 of the eIF4E gene on chromosome 3 of tomato.

7. A method of making a Cucumber Mosaic Virus (CMV) -resistant plant, comprising the step of mutating the eIF4E gene of a solanaceous plant to a mutation that becomes a mutant eIF4E gene encoding an eIF4E protein that is non-functional for CMV.

8. The method of making a CMV-resistant plant of claim 7, wherein the plant is tomato and the mutating step is a step of mutating the eIF4E gene on chromosome 3 of tomato.

9. The method for producing a CMV-resistant plant according to claim 7 or 8, wherein the mutation step is a step of introducing any one or more of the following mutations into the base sequence of exon 2 of the eIF4E gene:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

Technical Field

The present invention relates to plant virus resistant plants, in particular to Cucumber Mosaic Virus (CMV) resistant plants of the solanaceae family. The invention also relates to a method for producing such virus-resistant plants.

Background

Cucumber mosaic virus (hereinafter, CMV) is a plant virus that causes severe diseases in various crops such as solanaceae crops such as tomatoes (solanum lycopersicum) and cucumbers (Cucumis sativus L). CMV is transmitted mainly by aphids, infecting more than 1000 plants, crops, and causing economic losses to important crops in temperate, subtropical, and tropical regions worldwide. Once the virus infects crops, after the virus is proliferated at the infected part, the virus is diffused to the whole plant through vascular bundles, particularly sieve tubes, so that symptoms such as flower leaves, yellowing, fernleaf (fernleaf), dwarfing, gangrene and the like are caused, and the quality and the yield of fruits and leaves are reduced. For example, it has been reported that in 1987 CMV suddenly occurs in the major habitat of italian, spain tomatoes and that the set tomato fruits are almost completely damaged and fall into a devastating condition. There have also been reports of severe damage to CMV in indonesia and in korean peppers, capsicum annuum. In addition, there are cases where diseases are caused by negligence in japan.

For such infection of CMV, which infects various crops, causing economic loss, technologies to protect plants against it are not common. Fungicides and the like are not effective against most plant viruses. Further, as a method for controlling various common plant viruses including CMV, there are a method of blocking the invasion of vector insects such as aphids with an insect net or the like, and a method of killing insects with an agricultural chemical or the like, but it is difficult to completely control virus diseases.

The host gene is also involved in infection with plant viruses, and not only is there genetically dominant virus resistance (N gene isolated from tobacco and preventing the amplification of tobacco mosaic virus infection, etc.), but also recessively inherited virus resistance is found. Representative examples of such phenomena include the relationship between viruses of the Potyvirus (Potyvirus) family and the eIF4E family (eIF4E, eIF (iso)4E, etc.) as resistance genes corresponding thereto. Potyviruses are very numerous, and are differentiated and present to infect a variety of plants. Furthermore, eIF4E is a eukaryotic translation initiation factor (eukaryotic translation initiation factor) and is a translation initiation factor of the host. For example, in order to translate various viral proteins such as RNA-dependent RNA polymerase for self-replication, the Turnip mosaic virus (Turnip mosaic virus) of potyviridae utilizes a translation initiation factor of a host plant for the purpose of binding viral RNA to a plant liposome. In addition, eIF4E is also known to be essential for virus replication and cell-to-cell movement. Thus, defects in the host translational genes can confer viral resistance.

It has been shown that resistance to potyviridae viruses is obtained by actually mutating eIF4E family genes in model plants, such as arabidopsis thaliana, nicotiana of solanaceae, tomato, capsicum, and the like (non-patent documents 1 and 2, and the like). However, resistance to CMV was only confirmed in arabidopsis thaliana, but not found in other plants including tomato. In particular, non-patent document 1 relates to potato Y virus infection and knock-down of eIF4E1 and eIF4E2 in tomato, but describes: in transgenic strains in which eIF4E or eIF (iso)4E is silenced, viral infection other than potyviridae such as CMV is not attenuated, and thus it is considered that the involvement of eIF4E in the viral infection cycle is limited to potyviridae (non-patent document 1, page 4, left column, lines 12 to 15, etc.). Furthermore, it has been reported that when a mutation that completely loses the function of eIF4E is introduced into cucumber, resistance is imparted to CVYV (cucumber vein yellow virus), ZYMV (Zucchini yellow mosaic virus), PRSV (Papaya ring mosaic virus), but resistance is not imparted to CMV (non-patent document 3, particularly table 2).

Disclosure of Invention

Problems to be solved by the invention

The viral resistance believed to result from inhibition of the eIF4E family gene varies with the respective homolog, host, of the gene. Moreover, most are resistant to plant viruses of the potyviridae family, and tomato is found only to be resistant to potato virus Y (pvy), pepper mottle virus (PepMov), Tobacco Etch Virus (TEV), and the like. On the other hand, resistance to CMV of viruses belonging to other families was not confirmed. CMV is a virus of the same genus as the virus of the family potyviridae, but its gene organization is very different, and its genomic RNA is also morphologically different from potyvirus. The virus of potyviridae is a segmented genome, whereas CMV consists of a three-segmented genome, each segment forming a viral particle, and all particles, segments, are grouped together for infectious propagation. Although the disease caused by CMV is an important disease showing severe symptoms, so far, even though not limited to a translation initiation factor, a resistance gene is hardly found in crops, and is more completely absent in solanaceae. Therefore, CMV control is dependent only on controlling the vector insect aphid, and the production of resistant varieties is desirable in breeding arenas.

Under the above circumstances, an object of the present invention is to provide a CMV-resistant solanaceous plant, a method for producing the same, a mutant gene for producing the CMV-resistant solanaceous plant, and uses thereof.

Means for solving the problems

In order to solve the above problems, the present inventors have conducted intensive studies, and as a result, have prepared an individual having a mutation at a predetermined site of a specific homologue of eIF4E of solanum lycopersicum belonging to the family solanaceae, and have confirmed that the individual has long-term CMV resistance when inoculated with CMV, thereby completing the present invention. The above CMV-resistant plants in solanaceae were first reported.

Namely, the present invention relates to the following items:

(1) a CMV-resistant solanaceous plant having a mutant eIF4E gene encoding an eIF4E protein that is non-functional for Cucumber Mosaic Virus (CMV).

(2) The CMV-resistant Solanaceae plant of (1), which is a plant of the genus Solanum.

(3) The CMV-resistant plant of (1) or (2), wherein the plant is tomato and the mutant eIF4E gene is the eIF4E gene on chromosome 3 of tomato.

(4) The CMV-resistant plant according to any one of (1) to (3), wherein the mutant eIF4E gene has any one or more of the following mutations in the base sequence of exon 2:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

(5) The CMV-resistant plant of any one of (1) to (4), which is a tomato plant, wherein the mutant eIF4E gene has a mutation selected from the group consisting of an insertion of 1 base, a deletion of 3 bases, and a deletion of 9 bases in a base sequence (SEQ ID NO: 2) in exon 2 of the eIF4E gene on chromosome 3 of tomato.

(6) The CMV-resistant plant according to any one of (1) to (4), wherein the plant is a tomato plant, and the mutant eIF4E gene has a mutation selected from the group consisting of an insertion of 1 base between the 15 th and 16 th bases, a deletion of 3 bases at the 16 th to 18 th positions, and a deletion of any 9 bases at the 8 th to 18 th positions in the base sequence AGGGTAAATCTGATACCAGC (SEQ ID NO. 3) in exon 2 of the eIF4E gene on chromosome 3 of tomato.

(7) A method of making a Cucumber Mosaic Virus (CMV) -resistant plant, comprising the step of mutating the eIF4E gene of a solanaceous plant to a mutation that becomes a mutant eIF4E gene encoding an eIF4E protein that is non-functional for CMV.

(8) The method for producing a CMV-resistant plant according to (7), wherein the plant is a tomato, and the step of mutating is a step of mutating the eIF4E gene on chromosome 3 of the tomato.

(9) The method for producing a CMV-resistant plant according to (7) or (8), wherein the mutation step is a step of introducing any one or more of the following mutations into the base sequence of exon 2 of the eIF4E gene:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

The invention also relates to the following:

(10) a processed product of the CMV-resistant plant according to any one of (1) to (4).

(11) A method for producing a processed product of a Cucumber Mosaic Virus (CMV) -resistant plant, comprising a step of mutating an eIF4E gene of a solanaceous plant, wherein the mutation is a mutation of an eIF4E gene which is a mutant type and encodes an eIF4E protein that is not functional for CMV.

(12) The method according to (11), wherein the plant is a tomato, and the mutation step is a step of mutating the eIF4E gene on chromosome 3 of tomato.

(13) The method of producing a processed product according to (11) or (12), wherein the mutation step is a step of introducing any one or more of the following mutations into the base sequence of exon 2 of eIF4E gene:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

The invention also relates to the following:

(14) a mutant eIF4E gene encoding an eIF4E protein that is non-functional for Cucumber Mosaic Virus (CMV).

(15) The mutant eIF4E gene of (14), which is derived from a plant of the family Solanaceae.

(16) The mutant eIF4E gene of (14) or (15), which is derived from the eIF4E gene on chromosome 3 of tomato.

(17) The mutant eIF4E gene according to any one of (14) to (16), wherein the nucleotide sequence of exon 2 has at least one of the following mutations:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

(18) The mutant eIF4E gene according to any one of (14) to (17), which is derived from tomato, and has a mutation selected from the group consisting of an insertion of 1 base, a deletion of 3 bases, and a deletion of 9 bases in the base sequence (SEQ ID NO: 2) of exon 2 of the eIF4E gene on chromosome 3 of tomato.

(19) The mutant eIF4E gene according to any one of (14) to (18), which is derived from tomato, and has a mutation selected from the group consisting of an insertion of 1 base between the 15 th and 16 th bases, a deletion of 3 bases at positions 16 to 18, and a deletion of any 9 bases at positions 8 to 18 in the base sequence AGGGTAAATCTGATACCAGC (SEQ ID NO: 3) in exon 2 of the eIF4E gene on chromosome 3 of tomato.

(20) Use of the mutant eIF4E gene of any one of (14) to (19) in the preparation of a CMV-resistant solanaceous plant.

(21) Use of the CMV-resistant solanaceous plant of any one of (1) to (6) for the manufacture of a processed product of a solanaceous plant.

(22) A plant cell of a Solanaceae plant, which comprises the mutant eIF4E gene according to any one of (14) to (19).

(23) The method for producing a plant cell of a CMV-resistant Solanaceae plant according to any one of (1) to (6).

(24) The method for producing a seed of a CMV-resistant solanaceous plant according to any one of (1) to (6).

(25) Use of the mutant eIF4E gene of any one of (14) to (19) for the preparation of seeds of CMV-resistant solanaceous plants.

(26) A vector, promoter or kit comprising the mutant eIF4E gene according to any one of (14) to (19).

(27) Use of the vector, promoter or kit of (26) in the preparation of a CMV-resistant solanaceous plant, plant cell thereof, plant seed thereof or progeny thereof.

Effects of the invention

The present invention provides a CMV-resistant solanaceous plant, a method for producing the same, a mutant gene for producing the CMV-resistant solanaceous plant, and uses thereof.

Drawings

FIG. 1 shows the base sequence (SEQ ID NO: 1) corresponding to the mRNA sequence of eIF4E present in chromosome 3 of wild-type tomato. In the actual RNA, T (thymine) in the figure is U (uracil). The positions shown by the wavy line (166 bases) are the base sequence of exon 2 (SEQ ID NO: 2), and the hatched portions are the editing target sites (SEQ ID NO: 3). The base (A) present 3 bases before the TGG (PAM sequence) within the rectangular frame in the figure is edited upstream.

FIG. 2 is a graph showing the amount of accumulated virus 26 days after CMV inoculation in 6 individuals of A127 line, 4 individuals of B95 line, and 5 individuals of B100 line (all T1 individuals). A127-1 was sampled from 4 sites and the other lines were sampled from 2 sites, and the anti-CMV antibody was used to measure ELISA values (absorbance values) for the above samples, whereby CMV resistance of A127-1 and A127-8 was confirmed.

FIG. 3 is a graph showing the amount of virus accumulated 20 days after CMV inoculation in 18 individuals (all T1 individuals) of the A127 strain. The CMV resistance of A127-14, A127-21 and A127-24 was confirmed by measuring the ELISA values (absorbance values) using anti-CMV antibodies.

FIG. 4 is a graph showing the amount of virus accumulated 30 days after CMV inoculation in 5 individuals of A132 line and 4 individuals of A143 line (all T1 individuals). The CMV resistance of A132-1 and A132-5 was confirmed by measuring ELISA values (absorbance values) using an anti-CMV antibody.

FIG. 5 is a photograph showing the symptoms 23 days after CMV inoculation of T1 individuals of the A127 line. FIG. 5 a: asymptomatic A127-8. FIG. 5 b: a127-2 of mosaic, yellowing and leaf atrophy was observed.

FIG. 6-1 shows the results of sequence analysis in the vicinity of the editing site in the eIF4E gene present on chromosome 3 of individuals T1 of A127-14, A127-21 and A127-24. Among the sequences in each group, the top sequence was the Wild Type (WT) sequence. The underlined position in the figure is the editing target site and the boxed bases show the mutation compared to the wild type.

FIG. 6-2 shows the results of sequence analysis of the vicinity of the editing site in the eIF4E gene present on chromosome 3 of T1 individuals of A132-1 and A132-5. Among the sequences in each group, the top sequence was the Wild Type (WT) sequence. The underlined position in the figure is the editing target site and the boxed bases show the mutation compared to the wild type.

FIG. 7 is a graph showing the amount of virus accumulated 24 days after PVY inoculation of 4 individuals of the A132 line and 3 individuals of the A143 line (both T1 individuals). ELISA values (absorbance) were measured using anti-PVY antibody, and PVY resistance was confirmed for all individuals.

FIG. 8 is a diagram showing the confirmation of CMV resistance of each T2 generation in example 5. Prevalence was determined based on both visual morbidity and infection rate based on ELISA (virus accumulation) detection. Thus, the prevalence indicates the sum of the incidence and infection rates. The numbers in parentheses show the number of strains tested.

FIG. 9-1 is a graph comparing the prevalence of each T2 generation from A132-5 and A127-24 in example 6 based on visual inspection and ELISA with wild type controls. Since all plants with observed disease were positive for ELISA, only the disease incidence was shown when the disease incidence was the same as the virus infection rate.

FIG. 9-2 shows the results of measuring the virus accumulation of T2 generation of several plants in example 6 by ELISA.

FIG. 10 the results of the aphid-borne CMV inoculation test carried out in example 7, confirming CMV resistance of the T2 generation are shown in FIG. 10.

Detailed Description

Hereinafter, embodiments for carrying out the present invention (hereinafter also referred to as "the present embodiments") will be described in detail. The present invention is not limited to the embodiments and the drawings, and can be implemented by being variously modified within the scope of the present invention.

In one aspect, the present embodiments relate to CMV-resistant solanaceous plants. In the present embodiment, a CMV-resistant plant is a plant that has the property of inhibiting the proliferation of CMV after infection and/or the property of inhibiting the manifestation of infection symptoms of CMV.

CMV, an RNA virus, is composed of three segments of genomes, each segment forming a viral particle, and all the particles, when segmented together, infect plants and proliferate. When CMV infects a plant, it utilizes the translation initiation factor eIF4E of the genome of the plant as a host, and the translation of viral movement proteins starts by binding to eIF4E through a cap structure at the RNA terminus of CMV. CMV has a cap structure at the 5 'end of viral genomic RNA, which is similar to animal and plant mRNA, but is structurally different from potato virus Y, which has a protein called VPg bound to the 5' end of viral genomic RNA. For viruses with VPg, VPg has a high affinity for plant eIF4E, VPg binds strongly to plant eIF4E, and viral genes utilize the plant translation system, but CMV is considered to be different from the aforementioned viruses with VPg in the infection mechanism.

Whether or not a certain plant is a CMV-resistant plant can be determined, for example, by infecting the plant with CMV by a conventional method and confirming accumulation of CMV in the plant by a known means such as ELISA or PCR, as shown in examples described later. In addition, it can be judged whether a CMV-infected plant has CMV infection symptoms (floral leaves, yellowing, fern leaves, dwarfing, gangrene, etc.). As for CMV, there are known a plurality of strains such as CMV-Y, CMV-O, CMV-Fny and CMV-Nt9, and it is known that the symptoms of CMV infection in plants infected by each strain may differ, and the presence or absence of symptoms can be confirmed by the strain used for the infected CMV. In one aspect, a CMV-resistant plant of the present embodiments is a plant that has a low accumulation of CMV in the plant and/or has mild symptoms of CMV infection when infected with CMV as compared to a plant that does not have the mutant eIF4E gene described below. In one aspect, the CMV-resistant plant of the present embodiment is a plant in which, even after 20 days or more have passed after CMV infection, CMV accumulation in the plant is at the same level as that of a CMV-uninoculated strain, and/or CMV infection symptoms are not confirmed.

The CMV-resistant plant in the present embodiment may be a complex-resistant plant as long as it exhibits CMV resistance, and may, for example, exhibit resistance against the following viruses or the like: all potato virus Y (PVY, etc.) infecting the Solanaceae family; viruses belonging to the genera barley yellowing mosaic virus (Bymovirus) and southern bean mosaic virus (Sobemovirus), which have VPg at the 5' -end of the viral genome as in PVY and are reported to be resistant to mutation of translation initiation factor; viruses belonging to the genus carnation spotted virus (Carmovirus) which have been reported to be resistant due to mutation of translation initiation factor; viruses of Geminivirus family (Geminivirus) which are resistant to mutation of translation initiation factors but cause serious damage in crop production including tomato (tomato yellow leaf curl virus (TYLCV), etc.) have not been reported so far.

In the present embodiment, the CMV-resistant plant is a plant of the Solanaceae family, and is not particularly limited as long as it is a plant belonging to the Solanaceae family (Solanum), and examples thereof include plants belonging to the Solanum genus (Solanum genus), the Nicotiana genus (Nicotiana genus), the Capsicum genus (Capsicum genus), and the like, and more specifically, tomato, eggplant, tobacco, Capsicum, potato, and the like. In one aspect, preferably the CMV-resistant plant of the present embodiment is a solanum plant, more preferably tomato, eggplant, potato, particularly preferably tomato.

In one aspect, the present embodiment may be a part of the CMV-resistant plant, and more specifically, may include organs such as fruits, buds, stems, roots, shoots, and anthers, tissues of plants, pollen, seeds, and the like. In one aspect, this embodiment also relates to methods of making such plants or parts thereof, and uses of the mutant eIF4E gene of this embodiment in making such plants or parts thereof.

In one aspect, the CMV-resistant plant of the present embodiment can also be produced as a processed product, such as food. That is, the present embodiment relates to a processed product of a CMV-resistant solanaceous plant having a mutant eIF4E gene encoding an eIF4E protein that is not functional for CMV. The present embodiment also relates to a method for producing a processed product of a CMV-resistant plant, which comprises a step of mutating an eIF4E gene of a solanaceous plant, wherein the mutation is a mutation of a mutant eIF4E gene encoding an eIF4E protein that is not functional for CMV.

The processed product is not particularly limited, and can be processed into edible, medical, or other processed products depending on the plant species. For example, when the CMV-resistant plant is a tomato, examples of the processed food product of a tomato include canned tomatoes, tomato puree, tomato sauce, tomato paste, tomato soup, dried tomatoes, tomato juice, tomato powder, tomato concentrate, and nutritional supplements (supplements) using tomatoes as raw materials. The production of the processed product can be carried out using CMV-resistant plants as a starting material by means known to those skilled in the art.

The CMV-resistant plant in the present embodiment may be a scion, a rootstock, or the like used for grafting, as long as it is a plant showing CMV resistance. In one aspect, the present embodiment also relates to a plant cell (including callus) or the like capable of regenerating the above-described CMV-resistant plant, which plant cell has a mutant eIF4E gene encoding an eIF4E protein that is non-functional for CMV, as in the CMV-resistant plant of the present embodiment. CMV-resistant plants in this embodiment include plants obtained from such plant cells. In one aspect, this embodiment also relates to methods of making such plant cells, and uses of the mutant eIF4E gene of this embodiment in making such plant cells.

The CMV-resistant plant in this embodiment has a mutant eIF4E gene (hereinafter also referred to as "CMV-resistant gene") that encodes an eIF4E protein that is non-functional with CMV. In one aspect, the present embodiments also relate to such a mutant eIF4E gene, a vector, promoter or kit comprising such a mutant eIF4E gene, and the use of such a vector, promoter or kit in the preparation of a CMV-resistant solanaceous plant, plant cell thereof, part (seed, etc.) thereof, or progeny thereof.

eIF4E is one of the translation initiation factors in eukaryotes, which plays an important role in the initiation of protein synthesis. eIF4E forms the eIF4E family with eIF (iso)4E, and solanaceae are believed to have multiple eIF4E isozymes. For example, 2 isozymes of eIF4E located on chromosome 2 and chromosome 3 in tomato are known. It is also known that 1 eIF (iso)4E is present in tomato, which is located on chromosome 9. In pepper, the presence of pvr1 and pvr2 located on chromosome 4 is known as a gene homologous to eIF4E of tomato (pvr1 and pvr2 are allelic relationships), and pvr6 located on chromosome 3 is known as a gene homologous to eIF (iso)4E of tomato. Of these genes, the gene encoding eIF4E or a protein homologous thereto is preferably non-functional for CMV.

In this embodiment, the eIF4E protein that is non-functional for CMV is an eIF4E protein that is not available for infection and proliferation of CMV in plants or that reduces infection and proliferation of CMV, and in one aspect, the CMV-resistant gene may be a gene that is mutated and does not encode a protein. Without being bound by theory, it is believed that: when CMV infects a plant, using a specific eIF4E among a plurality of isozymes present in solanaceae, if a gene encoding the specific isozyme (eIF4E functional to CMV) is mutated to encode an eIF4E protein that is not functional to CMV, at this time, translation of a protein necessary for propagation of infection encoded on the viral genome will not proceed, or a CMV protein necessary for interaction with eIF4E will not function, whereby more than one of CMV infection, CMV propagation, and expression of CMV infection symptoms will be inhibited, and a CMV-resistant plant will be obtained. On the other hand, among the various eIF4E homologs present in solanaceae plants, even if 1 species is mutated, other homologs may be utilized by the plant itself, or the eIF4E protein that is not functional for CMV may be utilized by the plant itself, and therefore, it is considered that CMV resistance can be imparted without affecting the growth of the solanaceae plant as a host.

In one aspect, the CMV-resistant plant of the present embodiment, the genes encoding the eIF4E protein functional in CMV are all mutated. For example, in the case of polyploid plants such as diploid, it is preferable that all of the existing genes encoding eIF4E protein functional for CMV be mutated into CMV resistance genes. Such CMV-resistant plants may have other normal eIF4E genes, as long as the gene encoding the eIF4E protein functional in CMV is mutated. Alternatively, it may be obtained by introducing a foreign CMV-resistant gene and deleting or disrupting all endogenous genes encoding eIF4E protein that is functional in CMV.

In one aspect, the CMV-resistant gene in the present embodiment is a gene having a mutation in the base sequence of the eIF4E gene that is a functional gene for CMV of a solanaceae plant, and preferably a gene having a mutation in the base sequence of exon 2 of the eIF4E gene. More specifically, when the plant of the family solanaceae is tomato, it has a mutation in the eIF4E gene on chromosome 3 of tomato, preferably a mutation in the base sequence of exon 2 thereof (seq id No. 2), and more preferably a mutation in the base sequence AGGGTAAATCTGATACCAGC of exon 2 thereof (seq id No. 3).

In one aspect, the CMV resistance gene in this embodiment has any one or more of the following mutations in the base sequence of exon 2 of the eIF4E gene:

(a) frame shift mutation

(b) Nonsense mutations

(c) Deletion of 3n contiguous or non-contiguous bases (n-1 to 7)

(d)1 or more base substitutions, deletions, additions and/or insertions.

(a) Frame shift mutations are mutations that result in codon reading frame shifts due to the deletion or insertion of bases, resulting in encoding different amino acid sequences, thereby becoming CMV resistance genes.

(b) The nonsense mutation is a mutation in which a codon encoding an amino acid is changed to a stop codon, and thus the CMV-resistant gene is obtained.

(c) Deletion of 3n contiguous or non-contiguous bases (n ═ 1 to 7, preferably n ═ 1 to 3, for example, 3, 6, or 9 bases, more preferably n ═ 3, for example, 9 bases) causes a slight change in the amino acid encoded by the base downstream of the deleted region, and thus the CMV-resistant gene is obtained.

(d) Substitution, deletion, addition and/or insertion of 1 or more bases results in a change in the reading frame of the amino acid encoded by the base downstream of the mutated region. This causes disruption of the eIF4E protein, a structural change, and the like, and the resulting gene becomes a CMV-resistant gene. In one aspect, preferably, the mutation is a mutation of a base other than position 3 in the codon. In the present embodiment, the number of bases to be substituted, deleted, added, and/or inserted is not particularly limited as long as the CMV-resistant gene can be obtained, and may be, for example, 1 to 5, 1 to 3, 1 to 2, or 1.

The mutations (a) to (d) are not optional, and, for example, the mutation (a) or (b) may be generated as a result of the mutation (c) or (d).

In one aspect, the CMV-resistant gene of the present embodiment preferably has at least one of a continuous or discontinuous deletion of 9 bases, a continuous or discontinuous deletion of 3 bases, and a frame shift mutation by insertion of 1 base.

In one aspect, the mutant eIF4E gene has a mutation selected from the group consisting of an insertion of 1 base, a deletion of 3 bases, and a deletion of 9 bases in the base sequence AGGGTAAATCTGATACCAGC (seq id No. 3) in exon 2 of the eIF4E gene on chromosome 3 of tomato, preferably in the base sequence (seq id No. 2) and may also have a mutation other than the mutation (for example, a substitution of 1 or more bases in the base sequence of seq id No. 2 and/or 3, and the like). In one aspect, the mutant eIF4E gene has a mutation selected from the group consisting of an insertion of 1 base between the 15 th and 16 th bases (in one aspect, an insertion of C (cytosine)), a deletion of 3 bases at 16 th to 18 th, and a deletion of any 9 bases at 8 th to 18 th (preferably, a deletion of 9 bases other than 10 th and 13 th) in the base sequence AGGGTAAATCTGATACCAGC (seq id No. 3) in exon 2 of eIF4E gene on chromosome 3 of tomato, and may have a mutation other than the mutation. The base sequence of SEQ ID NO. 3 corresponds to the 135 th to 154 th bases of the base sequence of tomato exon 2 (SEQ ID NO. 2).

In one aspect, preferably, the mutant eIF4E gene is a gene obtained by mutating a base sequence AGGGTAAATCTGATACCAGC (SEQ ID NO: 3) in exon 2 of an eIF4E gene on chromosome 3 of tomato to any one of SEQ ID NO. 4-9.

As described above, the CMV-resistant gene of the present embodiment may have a mutation other than the above described mutation as long as it exhibits the desired CMV resistance, and in one aspect, for example, it may have any mutation as described above in a nucleotide sequence having a sequence identity of 85% or more, preferably 90% or more, more preferably 95% or more, further preferably 98% or more, particularly preferably 99% or more with the nucleotide sequence of eIF4E gene.

The present embodiment also relates to the use of the mutant eIF4E gene for conferring CMV resistance to solanaceae plants, and the mutant eIF4E gene itself as a CMV resistance gene.

The CMV-resistant plant having the above CMV-resistant gene can be obtained by approximately 2 methods exemplified below, but is not limited thereto.

(1) Direct genome editing: plants having a CMV-resistant gene were prepared by direct genome editing of plants having CMV-functional eIF4E to introduce mutations precisely at the target site.

(2) Introduction of mutant genes: the method is a method in which the following (A) and (B) are combined. (A) The method comprises the following steps The CMV resistance gene is prepared and introduced into the plant using a suitable promoter. (B) The method comprises the following steps The plant has endogenous eIF4E with eIF4E that is CMV-functional to eIF4E that is CMV-non-functional.

Next, various methods will be explained.

The method of (1) above can be carried out using a known genome editing technique using a site-specific nuclease, such as CRISPR or TALEN. The double-stranded nicks were introduced using restriction enzymes capable of cleaving at specific sites in the genome, and when they were repaired, various mutations were introduced due to repair errors, whereby the gene encoding eIF4E functional for CMV was mutated into a CMV-resistant gene.

For introduction with particularly high specificity and high efficiency, the CRISPR system can preferably be used, particularly preferably the CRISPR/Cas9 system can be used. In this system, when a guide RNA (sgRNA) recognition target having a sequence of about 20 bases in length complementary to a target gene is targeted and the Cas9 protein cleaves a double strand and is repaired by a non-homologous end recombination (NHEJ) repair pathway, a mutation is introduced into the target site by a repair error.

Delivery of Cas protein and sgRNA to plants can be performed using methods known to those skilled in the art (e.g., agrobacterium method, standard transfection method, electroporation method, microparticle bombardment method, etc.) via vectors encoding the same.

Briefly, as shown in The examples below, a binary vector integrating a Cas gene and sgRNA was constructed, and after agrobacterium was transformed using The same, plants were transformed using The agrobacterium, thereby enabling delivery of Cas protein and sgRNA to plants (see Friedrich house et al, The Plant Journal (2014)79, 348-.

The form of the plant transformed with Agrobacterium is not particularly limited as long as the plant can be regenerated, and examples thereof include suspension culture cells, protoplasts, leaf sections, and callus. After removing the Agrobacterium, the cells are cultured in a reagent corresponding to the vector used, and selective culture of the whole target gene can be achieved using reagent tolerance as an index.

To be able to efficiently introduce mutations into target sites, guide rna (guideerna) may be designed.

In the CRISPR system, cleavage is essentially 3 bases preceded by a 3 base sequence called a PAM sequence (NGG in the case of using Cas9 of most common streptococcus pyogenes (s.pyogenes) origin). Since the PAM sequence needs to be present immediately after the target sequence, the guide RNA can be designed using the upstream of the PAM sequence as the target sequence. For example, in fig. 1 (which shows a sequence (seq id No. 1) corresponding to mRNA of eIF4E gene present on chromosome 3 of tomato), guide RNA can be designed with the position indicated by the box present in exon 2 (wavy line portion in fig. 1, seq id No. 2) as a PAM sequence and the normal 20 bases (seq id No. 3) upstream from the 3 bases as a target. When other plants of the solanaceae family are subjected to direct genome editing, as in the case of tomato, a plant having a CMV-resistant gene can be prepared by selecting a PAM sequence design guide RNA in exon 2 of the gene encoding eIF4E functional for CMV and introducing a mutation into the target site.

Since the cleavage efficiency increases as the GC content in the base sequence of the guide RNA increases, the guide RNA can be designed in consideration of the GC content. Also, it can be designed so that non-specific cleavage due to off-target effects is minimized. In one aspect, in the case where the plant is tomato, the guide RNA may be designed to have a base sequence that targets a specific sequence (sequence number 3) in exon 2 of chromosome 3.

When double-stranded cleavage is introduced at 1 position by the CRISPR system, about 20 bases will be repaired, and it is considered that a mutation will be introduced by repairing an error. In one aspect, the mutation of the CMV-resistant gene of the present embodiment is a continuous or discontinuous mutation of 3n bases (n ═ 1 to 7, preferably 1 to 3).

The method (2) will be explained below. This method is a method comprising a combination of the following steps (A) and (B). As for the order of carrying out (A) and (B), as long as it does not cause death of the plant, (B) may be carried out first. The method of carrying out only (B) at a specific site is the method of (1) above.

(A) The method comprises the following steps Preparing a mutant gene encoding an eIF4E protein that is not functional for CMV, and introducing it into a plant using an appropriate promoter.

(A) The preparation of the medium mutant gene can be carried out by a method known to those skilled in the art, for example, synthesizing a base sequence having a desired mutation and amplifying it by PCR or the like. The introduction of the prepared mutant gene into a plant can also be carried out by a method known to those skilled in the art. Briefly, a vector carrying a mutant gene can be used, and the vector can be used, for example, by the polyethylene glycol method, electroporation method, Agrobacterium method, particle gun method, or the like. The CMV-resistant gene of another plant may be introduced as long as it is a CMV-resistant gene obtained by mutating the eIF4E gene derived from a solanaceous plant.

(B) The method comprises the following steps A step of making CMV-functional eIF4E in endogenous eIF4E possessed by the plant into CMV-non-functional eIF 4E.

In the practice of (B), a known method can be used for introducing a mutation into a plant, and for example, a treatment with a mutagen such as ion beam or EMS can be used. The above-described CRISPR and TALEN can also be implemented by the genomic editing technique. Ideally, all CMV-functional eIF4E in endogenous eIF4E is made CMV-non-functional eIF 4E.

Regeneration of plant bodies from plant cells having the CMV resistance gene can be carried out by methods known to those skilled in the art depending on the plant species. For example, tomato can be referred to SunHJ et al, Plant Cell physiol.47:426,2006, and tobacco can be referred to Jefferson RA et al, EMBO J.6:3901,1987, and the like.

The confirmation that the plant has the CMV-resistant gene can be confirmed by inoculating CMV by a conventional method, confirming accumulation of CMV in the plant by ELISA, PCR, or the like, or observing CMV infection symptoms of the plant, as described above.

Once a CMV-resistant plant with a CMV-resistance gene is obtained, progeny, clones of said plant can be obtained by known methods. Thus, CMV-resistant plants of the present embodiments also include progeny and clones thereof.

This embodiment also relates to a method of making a CMV-resistant plant comprising the step of mutating the eIF4E gene of a solanaceous plant. The method may be carried out with reference to the above description relating to CMV-resistant plants. In one aspect, the above preparation method further comprises the step of self-pollinating or cross-pollinating the CMV-resistant plant of the present embodiment to obtain progeny. Self-pollination or cross-pollination of plants can be carried out by known means.

This embodiment also relates to guide RNAs and vectors comprising guide RNAs for use in the preparation of the above CMV-resistant plants. The guide RNA has the sequence described above. The present embodiment also relates to a kit comprising the guide RNA. The kit may comprise site-specific nucleases, etc., necessary for performing genome editing using CRISPR systems, which can be used to make CMV-resistant plants.