阅读说明：本技术 一种产beta-丙氨酸酵母菌及其构建方法 (Yeast capable of producing beta-alanine and construction method thereof ) 是由 范文超 高书良 丁鹏 于 2021-07-15 设计创作，主要内容包括：本发明公开了一种产beta-丙氨酸酵母菌,其为酿酒酵母BY4742衍生菌,在基因组上整合了外源的甲基丙二酰-CoA变构酶基因、甲基丙二酰-CoA脱羧酶基因、丙酸CoA-转移酶基因、乳酰基-CoA脱水酶alfa亚基基因、乳酰基-CoA脱水酶beta亚基基因、硫酯裂解酶基因和氨基裂合酶基因,可通过一步发酵法实现β-丙氨酸的从头合成。(The invention discloses a yeast for producing beta-alanine, which is a saccharomyces cerevisiae BY4742 derivative, integrates exogenous methylmalonyl-CoA allosteric enzyme gene, methylmalonyl-CoA decarboxylase gene, propionic acid CoA-transferase gene, lactyl-CoA dehydratase alfa subunit gene, lactyl-CoA dehydratase beta subunit gene, thioester lyase gene and amino lyase gene on a genome, and can realize the de novo synthesis of beta-alanine BY a one-step fermentation method.)

1. A beta-alanine producing Saccharomyces cerevisiae, which is a Saccharomyces cerevisiae BY4742 derivative, has integrated on its genome exogenous MMUT gene encoding methylmalonyl-CoA allosteric enzyme, YgfG gene encoding methylmalonyl-CoA decarboxylase, Pct gene encoding propionate CoA-transferase, lcdA gene encoding lactyl-CoA dehydratase alfa subunit, lcdB gene encoding lactyl-CoA dehydratase beta subunit, TesB thioester gene encoding lactyl lyase, and AspB gene encoding amino lyase.

2. The Saccharomyces cerevisiae of claim 1, wherein the Saccharomyces cerevisiae BY4742 has the genotype MAT α his3 Δ 1leu2 Δ 0lys2 Δ 0ura3 Δ 0 (MAT α his3 Δ 1leu2 Δ 0lys2 Δ 0ura3 Δ 0).

3. The Saccharomyces cerevisiae according to claim 1,

the methylmalonyl-CoA allosteric enzyme is derived from Human Homo sapiens (Human), and the amino acid sequence of the methylmalonyl-CoA allosteric enzyme is SEQ ID NO. 1;

the methylmalonyl-CoA decarboxylase is derived from Escherichia coli (strain K12), and the amino acid sequence of the methylmalonyl-CoA decarboxylase is SEQ ID NO. 3;

the propionate CoA-transferase is derived from Escherichia coli (strain K12), and the amino acid sequence of the propionate CoA-transferase is SEQ ID NO. 5;

the lactyl-CoA dehydratase alfa subunit is derived from anaerobe propionicacid Anaeroticum DSM 1682, and the amino acid sequence of the lactyl-CoA dehydratase alfa subunit is SEQ ID NO. 7;

the lactyl-CoA dehydratase beta subunit is derived from anaerobe proprionicum propionicum DSM 1682, and the amino acid sequence of the lactyl-CoA dehydratase beta subunit is SEQ ID NO. 9;

the thioester lyase is derived from Escherichia coli (strain K12), and the amino acid sequence of the thioester lyase is SEQ ID NO. 11; and/or

The amino lyase has an amino acid sequence of SEQ ID NO. 13.

4. The Saccharomyces cerevisiae according to claim 3,

the nucleotide sequence of the MMUT gene is SEQ ID NO. 2;

the nucleotide sequence of the YgfG gene is SEQ ID NO. 4;

the nucleotide sequence of the Pct gene is SEQ ID NO. 6;

the nucleotide sequence of the lcdA gene is SEQ ID NO. 8;

the nucleotide sequence of the lcdB gene is SEQ ID NO. 10;

the nucleotide sequence of the TesB gene is SEQ ID NO. 12; and/or

The nucleotide sequence of the AspB gene is SEQ ID NO. 14.

5. A method for constructing the Saccharomyces cerevisiae yeast as claimed in any of claims 1 to 4, comprising the steps of:

A. constructing an MMUT gene expression cassette which comprises a promoter pTEF1, an MMUT gene and a terminator ADH1t to form a pTEF1-MMUT-ADH1t expression cassette;

constructing a YgfG gene expression cassette which comprises a promoter pTPI1, a ygfG gene and a terminator PRM5t to form a pTPI1-ygfG-PRM5t expression cassette;

constructing a Pct gene expression cassette which comprises a promoter pTEF2, a Pct gene and a terminator IDP1t to form a pTEF2-Pct-IDP1t expression cassette;

constructing an lcdA gene expression cassette which comprises a promoter pENO2, an lcdA gene and a terminator CPS1t to form a pENO2-lcdA-CPS1t expression cassette;

constructing an lcdB gene expression cassette which comprises a promoter pGPM1, an lcdB gene and a terminator IDP1t to form a pGPM1-lcdB-IDP1t expression cassette;

constructing a TesB gene expression cassette which comprises a promoter pPGK3, a tesB gene and a terminator PRM9t to form a pPGK3-tesB-PRM9t expression cassette;

constructing an AspB gene expression cassette comprising a promoter pTDH3, an AspB-11-D4 gene and a terminator SPG5t to form an expression cassette of pTDH3-AspB-11-D4-SPG5 t;

B. loading the 7 gene expression cassettes constructed in the step A onto a plasmid vector suitable for expression in saccharomyces cerevisiae to form a gene cluster expression plasmid;

C. b, transforming the gene cluster expression plasmid obtained in the step B into Saccharomyces cerevisiae BY4742, and screening positive clones with the 7 genes integrated in the genome;

D. screening to obtain the saccharomyces cerevisiae for producing the beta-alanine.

6. The method of claim 5, wherein the plasmid vector suitable for expression in Saccharomyces cerevisiae is pUC57 and the resulting gene cluster expression plasmid is designated as pUC57-pathway plasmid.

7. Use of the Saccharomyces cerevisiae according to any of claims 1-4 for the production of beta-alanine.

8. Use according to claim 7, wherein β -alanine is produced by fermentation of the Saccharomyces cerevisiae.

9. Use according to claim 8, wherein ammonia or ammonium salts are added to the fermentation medium.

10. The use according to claim 9, wherein the fermentation medium is YPD-NH4 medium consisting of: 10g/L yeast extract, 20g/L tryptone, 20g/L glucose, during fermentation culture, 15% ammonia was added.

Technical Field

The invention belongs to the field of metabolic engineering and genetic engineering, and particularly relates to a saccharomyces cerevisiae engineering bacterium for producing beta-alanine and a construction method thereof.

Background

Beta-alanine (beta-alanine) is a natural beta-form of amino acid occurring in nature. Although not protein amino acid, it participates in the synthesis of various functional substances such as carnosine and vitamin B5, and is widely applied to industries such as medicine, food, chemical industry and the like. For example, it can be used for the synthesis of pantothenic acid, calcium pantothenate, carnosine, pamidronate, octasalazine, etc., and can also be used as a dietary supplement to provide energy to muscles. The beta-alanine and the derivative thereof are widely applied to the fields of medicine, beauty treatment, food, feed, chemical industry and the like, so that the market demand is gradually increased.

The preparation method of beta-alanine comprises three methods, namely a chemical method, an enzymatic method and a fermentation method. Among them, chemical methods and enzymatic methods are the main production methods at present. The chemical methods comprise an acrylonitrile method, an acrylic acid method, a beta-aminopropionitrile method, a succinimide degradation method and the like, but the methods are high-temperature and high-pressure reactions, the process conditions are harsh, byproducts are more in the reaction process, the extraction process is complex, the cost is high, the environment is not friendly, and the inevitable defects lead to increasingly weak market competitiveness of the chemical method for synthesizing the beta-alanine.

The enzymatic catalytic synthesis of beta-alanine mainly comprises decarboxylation of L-aspartic acid under the catalysis of L-aspartic acid Alpha Decarboxylase (ADC) to generate beta-alanine, the method has high catalytic efficiency, mild conditions and simple and environment-friendly extraction process, and is always a hot point of research, but the method has the defects that the enzyme catalysis substrate aspartic acid is expensive, so that the production cost is high, and the industrialization is greatly limited. Patent document CN201710659654.9 discloses a method for synthesizing beta-alanine by catalyzing acrylic acid with ammonia by a biological enzyme method, but the method cannot be applied industrially because the post-treatment step is complicated and the production cost is high. The inventor reports that acrylic acid or acrylonitrile is used as a substrate and the aspartic acid ammonia lyase mutant AspB-11-D4 is used for catalyzing and producing beta-alanine in the prior research CN201911182183.2, but the invention needs to be further improved in the aspect of industrial production.

The fermentation method adopts cheap and easily available glucose as a starting material, and gradually becomes a new research direction in recent years, and patent document CN201910474753.9 discloses that beta-alanine is produced by fermenting glucose as a raw material in escherichia coli engineering bacteria, the yield is as high as 50g/L, and the sugar-acid conversion rate is as high as 40%, but the method is only in a laboratory research stage. In addition, patent documents CN112662609A, CN112625985A, and CN103898033A also disclose the production of β -alanine by fermentation of escherichia coli engineering bacteria, but all are limited to laboratory research stages, and have not been able to be applied industrially.

The fermentation method in the prior art basically adopts the engineering bacteria of escherichia coli for fermentation, which has a fatal defect. Since Escherichia coli is a pathogenic bacterium in the public view, especially in the view of the ordinary consumers of beta-alanine products, the fermentation products can have endotoxin, which makes the users of beta-alanine products unacceptable and seriously affects the market sales of the fermentation products.

Disclosure of Invention

To explore the feasibility of producing beta-alanine by fermentation using well-established biosafety patterns of microorganisms such as Corynebacterium glutamicum, Lactobacillus, Bacillus subtilis, Saccharomyces cerevisiae, etc., we have derived and experimented with possible metabolic pathways of beta-alanine in various species of microorganisms, and have succeeded in certain microorganisms. For example, a metabolic route for biologically synthesizing beta-alanine BY Saccharomyces cerevisiae BY4742(MAT alpha his3 delta 1leu2 delta 0lys2 delta 0ura3 delta 0) is developed, so that the engineered Saccharomyces cerevisiae constructed BY the invention can realize one-step fermentation production of beta-alanine.

Accordingly, a first object of the present invention is to provide a β -alanine producing s.cerevisiae, which is a s.cerevisiae BY4742 derivative, having integrated into its genome an exogenous MMUT gene encoding methylmalonyl-CoA allosteric enzyme, YgfG gene encoding methylmalonyl-CoA decarboxylase, Pct gene encoding propionate CoA-transferase, dAlc gene encoding lactyl-CoA dehydratase alfa subunit, lcdB gene encoding lactyl-CoA dehydratase beta subunit, TesB gene encoding thioesterase (tesB), and AspB gene encoding an amino lyase, such as aspartate ammonia lyase.

The genotype of Saccharomyces cerevisiae BY4742 may be MAT α his3 Δ 1leu2 Δ 0lys2 Δ 0ura3 Δ 0 or BY4742(MAT α his3 Δ 1leu2 Δ 0lys2 Δ 0ura3 Δ 0).

Preferably, the methylmalonyl-CoA allosteric enzyme is derived from Human Homo sapiens (Human) and has the amino acid sequence of SEQ ID NO: 1;

the methylmalonyl-CoA decarboxylase is derived from Escherichia coli (strain K12), and the amino acid sequence of the methylmalonyl-CoA decarboxylase is SEQ ID NO. 3;

the propionate CoA-transferase is derived from Escherichia coli (strain K12), and the amino acid sequence of the propionate CoA-transferase is SEQ ID NO. 5;

the lactyl-CoA dehydratase alfa subunit is derived from anaerobe propionicacid Anaeroticum DSM 1682, and the amino acid sequence of the lactyl-CoA dehydratase alfa subunit is SEQ ID NO. 7;

the beta subunit of the lactyl-CoA dehydratase is derived from anaerobe propionicacid Anaerococcus DSM 1682, and the amino acid sequence of the beta subunit is SEQ ID NO. 9;

the thioester lyase is derived from Escherichia coli (strain K12), and the amino acid sequence of the thioester lyase is SEQ ID NO. 11; and/or

The above-mentioned amino lyase may be a wild-type aspartate ammonia lyase derived from Bacillus sp.YM55-1 (the sequence reported in AspB, Ruifeng Li.et al, comparative release of enzymes for regio-and enantioselective hydrolysis. Nat.chem.biol.2018), or a mutant thereof (N142V, H188A), more preferably the mutant (N142V, H188A) having the amino acid sequence of SEQ ID NO:13, which has been disclosed in the inventor's prior patent CN201911182183.2, in which the amino acid sequence of SEQ ID NO:3 and the number of AspB-11-D4 (correspondingly, the wild-type enzyme number of AspB1) are used herein.

In one embodiment, the nucleotide sequence of the MMUT gene can be SEQ ID NO. 2;

the nucleotide sequence of the YgfG gene can be SEQ ID NO. 4;

the nucleotide sequence of the Pct gene is SEQ ID NO 6;

the nucleotide sequence of the lcdA gene can be SEQ ID NO. 8;

the nucleotide sequence of the lcdB gene can be SEQ ID NO. 10;

the nucleotide sequence of the TesB gene is SEQ ID NO. 12; and/or

The nucleotide sequence of the AspB gene is SEQ ID NO. 14.

The second purpose of the invention is to provide a method for constructing the saccharomyces cerevisiae, which comprises the following steps:

A. constructing an MMUT gene expression cassette which comprises a promoter pTEF1, an MMUT gene and a terminator ADH1t to form a pTEF1-MMUT-ADH1t expression cassette;

constructing a YgfG gene expression cassette which comprises a promoter pTPI1, a ygfG gene and a terminator PRM5t to form a pTPI1-ygfG-PRM5t expression cassette;

constructing a Pct gene expression cassette which comprises a promoter pTEF2, a Pct gene and a terminator IDP1t to form a pTEF2-Pct-IDP1t expression cassette;

constructing an lcdA gene expression cassette which comprises a promoter pENO2, an lcdA gene and a terminator CPS1t to form a pENO2-lcdA-CPS1t expression cassette;

constructing an lcdB gene expression cassette which comprises a promoter pGPM1, an lcdB gene and a terminator IDP1t to form a pGPM1-lcdB-IDP1t expression cassette;

constructing a TesB gene expression cassette which comprises a promoter pPGK3, a tesB gene and a terminator PRM9t to form a pPGK3-tesB-PRM9t expression cassette;

constructing an AspB gene expression cassette comprising a promoter pTDH3, an AspB-11-D4 gene and a terminator SPG5t to form an expression cassette of pTDH3-AspB-11-D4-SPG5 t;

B. loading the 7 gene expression cassettes constructed in the step A onto a plasmid vector suitable for expression in saccharomyces cerevisiae to form a gene cluster expression plasmid;

C. b, transforming the gene cluster expression plasmid obtained in the step B into Saccharomyces cerevisiae BY4742, and screening positive clones with the 7 genes integrated in the genome;

D. screening to obtain the saccharomyces cerevisiae for producing the beta-alanine.

Preferably, the above plasmid vector suitable for expression in Saccharomyces cerevisiae may be pUC57 or the like, but is not limited thereto, and the resulting gene cluster expression plasmid is designated as pUC57-pathway plasmid. The whole length of the pUC57-pathway plasmid was 16192 bp.

The method for transforming the plasmid in the above step C is selected from the group consisting of chemical transformation (such as calcium chloride transformation) and electrical transformation, preferably electrical transformation.

The third purpose of the invention is to provide the application of the saccharomyces cerevisiae in producing beta-alanine.

In particular, beta-alanine is produced by fermentation of the above-mentioned Saccharomyces cerevisiae, i.e.the de novo synthesis of beta-alanine is achieved by a "one-step fermentation process".

During fermentation, ammonia water or an ammonium salt selected from ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, ammonium nitrate and the like may be added to the fermentation medium.

In one embodiment, the seed culture medium for fermentation may be YPD medium, and the bacterial fermentation medium may be YPD-NH4 medium, and has the following composition: 10g/L yeast extract, 20g/L tryptone, 20g/L glucose, if necessary during fermentation, for example, fermentation for 45-48h, and about 15% ammonia water is added.

According to the growth habit of the saccharomyces cerevisiae, the fermentation temperature is about 30 ℃.

The saccharomyces cerevisiae engineering bacteria constructed by the invention is a well-known safe mode microorganism, can directly produce beta-alanine through fermentation, and the obtained fermentation product is easy to be accepted by wide users, thus having industrial development and utilization values.

Drawings

FIG. 1 is a metabolic scheme for biosynthesis of beta-alanine in Saccharomyces cerevisiae BY4742 (MAT. alpha. his 3. delta. 1leu 2. delta. 0lys 2. delta. 0ura 3. delta. 0) strain constructed according to the present invention.

FIG. 2 is a schematic structural diagram of a gene cluster expression plasmid pUC57-pathway constructed according to the present invention.

Detailed Description

The invention changes the intrinsic metabolic pathway of a saccharomyces cerevisiae BY4742(MAT alpha his3 delta 1leu2 delta 0lys2 delta 0ura3 delta 0) strain, and can realize the biosynthesis of beta-alanine BY enzyme system catalysis from glucose as shown in figure 1.

In the metabolic pathway, saccharomyces cerevisiae can take up glucose as a carbon source and metabolize to generate pyruvate and succinyl-CoA, wherein pyruvate can generate lactate under the catalysis of lactate dehydrogenase; catalyzing succinyl-CoA by methylmalonyl-CoA allosteric enzyme and methylmalonyl-CoA decarboxylase to generate propionyl-CoA; propionyl-CoA and lactic acid are catalyzed by propionate CoA transferase to generate transacylation reaction to generate lactyl-CoA; further generating acrylic acid by catalysis of lactyl-CoA dehydratase and thioester lyase; acrylic acid can be catalyzed by amino lyase to generate beta-alanine in the presence of inorganic ammonium.

In this context, for the sake of simplicity of description, an enzyme such as the thioesterase tesB is sometimes used in combination with the name of the gene (DNA) encoding it, and it will be understood by those skilled in the art that they represent different substances in different description situations. Their meaning will be readily understood by those skilled in the art based on the context and context. For example, for TesB, when used to describe the function or class of thioester cleaving enzymes, refers to proteins; when described as a gene, refers to the gene encoding the enzyme.

It is understood that the MMUT gene, YgfG gene, Pct gene, lcdA gene, lcdB gene, TesB gene and AspB gene integrated into the Saccharomyces cerevisiae genome in the present invention can also be cloned separately on one plasmid and then transferred into the same Saccharomyces cerevisiae competent cell separately or simultaneously; more than two genes can also be cloned on one plasmid in combination; as shown in FIG. 2, the 7 genes can also be cloned on a plasmid to form gene clusters, and then transferred into the same saccharomyces cerevisiae competent cell separately or simultaneously, and the beta-alanine gene engineering bacteria can be obtained by screening positive clones. The plasmid vector may be any plasmid vector suitable for expression in Saccharomyces cerevisiae BY4742, such as pUC57 or the like.

In this context, for the purposes of the present invention, the terms "engineered β -alanine bacterium", "engineered β -alanine bacterium" and "alanine producing bacterium" all mean the constructed engineered Saccharomyces cerevisiae BY4742, especially Saccharomyces cerevisiae BY4742 (MAT. alpha. his 3. delta.1 leu 2. delta.0 lys 2. delta.0 ura 3. delta.0).

In order to optimally express methylmalonyl-CoA allosteric enzyme SEQ ID NO 1, methylmalonyl-CoA decarboxylase SEQ ID NO 3, propionate CoA-transferase SEQ ID NO 5, lactyl-CoA dehydratase alfa subunit SEQ ID NO 7, lactyl-CoA dehydratase beta subunit SEQ ID NO 9, thioesterase SEQ ID NO 11 and amino lyase SEQ ID NO 13 in the expression in Saccharomyces cerevisiae BY4742, the present invention codon optimizes their expression genes.

Codon optimization is one technique that can be used to maximize protein expression in an organism by increasing the translation efficiency of a gene of interest. Different organisms often show a special preference for one of several codons encoding the same amino acid due to mutation tendencies and natural selection. For example, in rapidly growing microorganisms such as E.coli, the optimized codons reflect the composition of their respective pools of genomic tRNA's. Thus, in a fast growing microorganism, the low frequency codons of an amino acid can be replaced with codons for the same amino acid but with a high frequency. Thus, expression of optimized DNA sequences is improved in fast growing microorganisms.

After codon optimization aiming at saccharomyces cerevisiae, the coding genes of the 7 enzymes SEQ ID NO 1, 3, 5, 7, 9, 11 and 13 can be SEQ ID NO2, 4, 6, 8, 10, 12 and 14 respectively.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing in the examples were performed by Jinzhi Biotechnology, Inc., Suzhou.

The molecular biological experiments herein include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., which are mainly performed with reference to molecular cloning, a guide to experiments (third edition), J. SammBruk, D.W. Lassel (America), Huangpetang, et al, scientific Press, Beijing, 2002). For example, the competent cell transformation method and the competent cell preparation method are carried out with reference to chapter 1, page 96. The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.

Culture medium:

LB culture medium: 5g/L yeast extract, 10g/L tryptone, 10g/L sodium chloride. (20 g/L agar powder was additionally added to LB solid medium.)

YPD medium: 10g/L yeast extract, 20g/L tryptone, 20g/L glucose. (20 g/L agar powder was additionally added to the solid medium.)

YPD-NH4 Medium: 10g/L yeast extract, 20g/L tryptone, 20g/L glucose, according to need in fermentation culture to 48h, adding 15% ammonia water.

In the following examples, when a kanamycin-containing medium was used, the final concentration of kanamycin in the medium was 50. mu.g/ml.

20X electrotransfer mother liquor: 80g/L glycine, 2% Tween 80.

Acrylic acid HPLC detection method:

a detection instrument: agilent 1260 high performance liquid chromatograph, chromatographic column: shanghai yue OAA column chromatography, mobile phase a (100%): 10mM potassium dihydrogen phosphate (0.68g to 500mL water) phosphoric acid to pH2.5, flow rate 1mL/min, column incubator 20 ℃, detection time 20min, collection wavelength 210nm, sample volume 5 ul.

The HPLC detection method of the beta-alanine comprises the following steps:

a detection instrument: agilent 1260 high performance liquid chromatograph, chromatographic column: an Agilent SB-C18 chromatographic column or an Elite BDS-C18 column, a mobile phase A: 2.871g anhydrous sodium acetate +700ml water, mobile phase B: the methanol and gradient program is shown in the table below, the flow rate is 1.0mL/min, the column incubator is 40 ℃, the detection wavelength is 334nm, the sample injection amount is 5ul, and the detection time is 20 min.

Time min	A％	B％
			0	70	30
6	70	30
			7	55	45
15	55	45
			15.5	70	30
20	70	30

Preparation of a derivative: 0.1372g of o-phthalaldehyde and 0.0589g N-acetyl-L-cysteine are weighed, 2ml of absolute ethyl alcohol is added, ultrasonic oscillation is carried out for 1min until dissolution is finished, and boric acid buffer solution is added until 10ml (the volume is determined by a volumetric flask) (P1F3 position).

Preparing a boric acid buffer solution: 6.183g of boric acid powder are weighed, 250ml of distilled water is added for ultrasonic oscillation until the boric acid powder is dissolved, then 6mol of NaOH solution is used for adjusting the pH value to 9.5, and the mixture is filtered for standby (P1F2 position). The P1F1 position is a squirt. The derivation method comprises the following steps: 1. using the default offset, 5.00. mu.l were withdrawn from position P1F2 at maximum speed, and the needle was cleaned at the flush port for 3 s. 2. 2.00. mu.l was withdrawn from the sample at maximum speed using the default offset. 3. Mixing: mix 2 times from the default volume in air at maximum speed. 4. Wait for 0.1min, clean the needle at the flush port for 3 s. 5. The default offset value is used to draw 1.00 μ l from position P1F3 at maximum speed. 6. Mixing: mix 6 times from the default volume in air at maximum speed. 7. Wait for 0.3 min. 8. The needle 3s is cleaned at the flushing port. 9. At maximum speed, 32.00. mu.l was withdrawn from the needle mount. 10. The default volume from the needle mount was mixed 2 times at maximum speed. 11. Wait for 0.5 min. 12. And (6) sample injection.

The starting strain used in the examples was Saccharomyces cerevisiae BY4742 (MAT. alpha. his 3. delta. 1leu 2. delta. 0lys 2. delta. 0ura 3. delta. 0), which was a premium from the Biotechnology research center of Shanghai industry.

The plasmid pUC57-pathway used in the examples was synthesized by Suzhou Jinzhi Biotechnology, Inc., and was available to any entity or individual for verification of the present invention, but was not approved for other uses, including development and utilization, scientific research, and teaching.

Example 1: construction of beta-alanine metabolism engineering bacteria

1.1 according to the design of FIG. 2, 7 genes were matched with functional promoters and terminators adapted to Saccharomyces cerevisiae BY4742 (MAT. alpha. his 3. delta. 1leu 2. delta. 0lys 2. delta. 0ura 3. delta. 0) to form 7 gene expression cassettes, in which: the lcdA gene, using promoter pENO2, terminator CPS1t, to form pENO2-lcdA-CPS1 t; the pct gene, using promoter pTEF2, terminator IDP1t, forms pTEF2-pct-IDP1 t; the lcdB gene uses promoter pGPM1 and terminator IDP1t to form pGPM1-lcdB-IDP1 t; the ygfG gene, pTPI1-ygfG-PRM5t using promoter pTPI1 and terminator PRM5 t; the tesB gene, which forms pPGK3-tesB-PRM9t using promoter pPGK3, terminator PRM9 t; the MMUT gene forms pTEF1-MMUT-ADH1t by using a promoter pTEF1 and a terminator ADH1 t; the AspB-11-D4 gene was used to form pTDH3-AspB-11-D4-SPG5t using promoter pTDH3 and terminator SPG5 t.

The gene cluster was designed, synthesized by Jinwei Zhi Suzhou, and loaded into a plasmid vector pUC57 to form a pUC57-pathway plasmid with a full-length sequence of 16192bp, as shown in FIG. 2.

1.2 Saccharomyces cerevisiae BY4742 (MAT. alpha. his 3. delta.1 leu 2. delta. 0lys 2. delta. 0ura 3. delta. 0) strain was streaked on YPD solid medium, cultured at 30 ℃ for 2 days, and a single colony was picked and transferred to a test tube containing 4ml of YPD liquid medium. And (3) overnight culture at 30 ℃ and 220rpm, transferring the mixture into a 250ml shake flask filled with 25ml YPD liquid culture medium, culturing at 30 ℃ and 220rpm for 4-6 h until OD600 is 0.8-1.0, and using the bacterial liquid for preparing saccharomyces cerevisiae conversion competence. The preparation and Transformation of competence were carried out using the Frozen-EZ Yeast Transformation II Kit, to which strict reference was made.

The plasmid pUC57-pathway was transferred into competent cells using the electrotransformation method. The transformation product was spread on SC-his plates (glucose 20g/l, YNB basic nitrogen source 1.7g/l, lysine, leucine, uracil each 50mg/l), and cultured at 30 ℃ for 4 days. Positive transformants can be grown on histidine-deficient selection plates using HIS3 as a selection marker for subsequent transformation of the Saccharomyces cerevisiae host.

1.3 screening plates, selecting positive transformants, extracting genomes, taking the genomes as templates, respectively using the following two pairs of verification primers Yz-1-F/Yz-1-R and Yz-2-F/Yz-2-R to carry out PCR verification on the transformants, wherein the PCR reaction system is strictly referred to High efficiency and High fidelity PCR enzyme KOD FX (purchased from Toyobo Co.). And carrying out DNA gel electrophoresis detection on the PCR products, wherein the two PCR products respectively correspond to the sizes of 7935bp and 6928 bp.

Verifying the primers:

Yz-1-F：ATGAATACTGATGTTAGAAT，

Yz-1-R：ATGTCTTATCAATATGTCAA。

Yz-2-F：TTAATGACCAACAAAATTTG，

Yz-2-R：TTATTCAGCTGCAGCCATAT。

example 2: fermentation verification of beta-alanine engineering bacteria

Shake flask fermentation validation was performed on genotype positive transformants identified in example 1. The transformants were inoculated into YPD-NH4 medium, respectively, and fermented at 30 ℃ and 220rpm for 3 days. The highest yield of beta-alanine of the positive transformant was 3 g/L. In contrast, host bacteria that do not integrate into the β -alanine metabolic pathway do not produce acrylic acid and β -alanine.

The above examples show that the inventors have successfully designed the β -alanine metabolic pathway for Saccharomyces cerevisiae BY4742(MAT α his3 Δ 1leu2 Δ 0lys2 Δ 0ura3 Δ 0). The strain integrating the metabolic pathway can realize the accumulation of beta-alanine in fermentation liquor and has industrial development potential.

It should be understood that the above-described embodiments are for illustrative purposes only and are not limiting to the present invention. Various changes and modifications of the invention which may occur to those skilled in the art after reading the teachings herein are deemed to be within the scope and equivalents thereof which fall within the scope and spirit of the invention as defined by the appended claims.

Sequence listing

<110> Luoyang Huarong Biotechnology Co., Ltd

<120> saccharomycete for producing beta-alanine and construction method thereof

<130> SHPI2110208

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 750

<212> PRT

<213> Homo sapiens

<400> 1

Met Leu Arg Ala Lys Asn Gln Leu Phe Leu Leu Ser Pro His Tyr Leu

1 5 10 15

Arg Gln Val Lys Glu Ser Ser Gly Ser Arg Leu Ile Gln Gln Arg Leu

20 25 30

Leu His Gln Gln Gln Pro Leu His Pro Glu Trp Ala Ala Leu Ala Lys

35 40 45

Lys Gln Leu Lys Gly Lys Asn Pro Glu Asp Leu Ile Trp His Thr Pro

50 55 60

Glu Gly Ile Ser Ile Lys Pro Leu Tyr Ser Lys Arg Asp Thr Met Asp

65 70 75 80

Leu Pro Glu Glu Leu Pro Gly Val Lys Pro Phe Thr Arg Gly Pro Tyr

85 90 95

Pro Thr Met Tyr Thr Phe Arg Pro Trp Thr Ile Arg Gln Tyr Ala Gly

100 105 110

Phe Ser Thr Val Glu Glu Ser Asn Lys Phe Tyr Lys Asp Asn Ile Lys

115 120 125

Ala Gly Gln Gln Gly Leu Ser Val Ala Phe Asp Leu Ala Thr His Arg

130 135 140

Gly Tyr Asp Ser Asp Asn Pro Arg Val Arg Gly Asp Val Gly Met Ala

145 150 155 160

Gly Val Ala Ile Asp Thr Val Glu Asp Thr Lys Ile Leu Phe Asp Gly

165 170 175

Ile Pro Leu Glu Lys Met Ser Val Ser Met Thr Met Asn Gly Ala Val

180 185 190

Ile Pro Val Leu Ala Asn Phe Ile Val Thr Gly Glu Glu Gln Gly Val

195 200 205

Pro Lys Glu Lys Leu Thr Gly Thr Ile Gln Asn Asp Ile Leu Lys Glu

210 215 220

Phe Met Val Arg Asn Thr Tyr Ile Phe Pro Pro Glu Pro Ser Met Lys

225 230 235 240

Ile Ile Ala Asp Ile Phe Glu Tyr Thr Ala Lys His Met Pro Lys Phe

245 250 255

Asn Ser Ile Ser Ile Ser Gly Tyr His Met Gln Glu Ala Gly Ala Asp

260 265 270

Ala Ile Leu Glu Leu Ala Tyr Thr Leu Ala Asp Gly Leu Glu Tyr Ser

275 280 285

Arg Thr Gly Leu Gln Ala Gly Leu Thr Ile Asp Glu Phe Ala Pro Arg

290 295 300

Leu Ser Phe Phe Trp Gly Ile Gly Met Asn Phe Tyr Met Glu Ile Ala

305 310 315 320

Lys Met Arg Ala Gly Arg Arg Leu Trp Ala His Leu Ile Glu Lys Met

325 330 335

Phe Gln Pro Lys Asn Ser Lys Ser Leu Leu Leu Arg Ala His Cys Gln

340 345 350

Thr Ser Gly Trp Ser Leu Thr Glu Gln Asp Pro Tyr Asn Asn Ile Val

355 360 365

Arg Thr Ala Ile Glu Ala Met Ala Ala Val Phe Gly Gly Thr Gln Ser

370 375 380

Leu His Thr Asn Ser Phe Asp Glu Ala Leu Gly Leu Pro Thr Val Lys

385 390 395 400

Ser Ala Arg Ile Ala Arg Asn Thr Gln Ile Ile Ile Gln Glu Glu Ser

405 410 415

Gly Ile Pro Lys Val Ala Asp Pro Trp Gly Gly Ser Tyr Met Met Glu

420 425 430

Cys Leu Thr Asn Asp Val Tyr Asp Ala Ala Leu Lys Leu Ile Asn Glu

435 440 445

Ile Glu Glu Met Gly Gly Met Ala Lys Ala Val Ala Glu Gly Ile Pro

450 455 460

Lys Leu Arg Ile Glu Glu Cys Ala Ala Arg Arg Gln Ala Arg Ile Asp

465 470 475 480

Ser Gly Ser Glu Val Ile Val Gly Val Asn Lys Tyr Gln Leu Glu Lys

485 490 495

Glu Asp Ala Val Glu Val Leu Ala Ile Asp Asn Thr Ser Val Arg Asn

500 505 510

Arg Gln Ile Glu Lys Leu Lys Lys Ile Lys Ser Ser Arg Asp Gln Ala

515 520 525

Leu Ala Glu Arg Cys Leu Ala Ala Leu Thr Glu Cys Ala Ala Ser Gly

530 535 540

Asp Gly Asn Ile Leu Ala Leu Ala Val Asp Ala Ser Arg Ala Arg Cys

545 550 555 560

Thr Val Gly Glu Ile Thr Asp Ala Leu Lys Lys Val Phe Gly Glu His

565 570 575

Lys Ala Asn Asp Arg Met Val Ser Gly Ala Tyr Arg Gln Glu Phe Gly

580 585 590

Glu Ser Lys Glu Ile Thr Ser Ala Ile Lys Arg Val His Lys Phe Met

595 600 605

Glu Arg Glu Gly Arg Arg Pro Arg Leu Leu Val Ala Lys Met Gly Gln

610 615 620

Asp Gly His Asp Arg Gly Ala Lys Val Ile Ala Thr Gly Phe Ala Asp

625 630 635 640

Leu Gly Phe Asp Val Asp Ile Gly Pro Leu Phe Gln Thr Pro Arg Glu

645 650 655

Val Ala Gln Gln Ala Val Asp Ala Asp Val His Ala Val Gly Ile Ser

660 665 670

Thr Leu Ala Ala Gly His Lys Thr Leu Val Pro Glu Leu Ile Lys Glu

675 680 685

Leu Asn Ser Leu Gly Arg Pro Asp Ile Leu Val Met Cys Gly Gly Val

690 695 700

Ile Pro Pro Gln Asp Tyr Glu Phe Leu Phe Glu Val Gly Val Ser Asn

705 710 715 720

Val Phe Gly Pro Gly Thr Arg Ile Pro Lys Ala Ala Val Gln Val Leu

725 730 735

Asp Asp Ile Glu Lys Cys Leu Glu Lys Lys Gln Gln Ser Val

740 745 750

<210> 2

<211> 2253

<212> DNA

<213> Artificial sequence ()

<400> 2

atgttgagag ctaaaaatca attgtttttg ttgtctccac attatttgag acaagttaaa 60

gaatcttctg gttctagatt gattcaacaa agattgttgc atcaacagca accattgcat 120

cctgaatggg ctgctttggc taaaaaacaa ttgaaaggta aaaatcctga agatttgatt 180

tggcatactc ctgaaggtat ttctattaaa ccattgtatt ctaaaagaga tactatggat 240

ttgcctgaag aattgcctgg tgttaaacca tttactagag gtccatatcc aactatgtat 300

acttttagac catggactat tagacaatat gctggatttt ctacagtcga ggaatctaac 360

aagttttata aagataatat taaagctggt caacaaggtt tgtctgttgc ttttgatttg 420

gctactcata gaggttatga ttctgataat ccaagagtta gaggtgatgt tggtatggct 480

ggtgttgcta ttgacactgt tgaagatact aaaattttgt ttgatggtat tccattggaa 540

aaaatgtctg tttctatgac tatgaatggt gctgttattc ctgttttggc taattttatt 600

gttactggtg aagaacaagg tgttccaaag gaaaaattga ctggaacaat tcaaaatgat 660

attttgaagg aattcatggt tagaaatact tatatttttc cacctgaacc ttctatgaaa 720

attattgctg atattttcga gtacactgct aaacacatgc caaagtttaa ttctatttct 780

atttctggtt atcatatgca agaagctggt gctgatgcta ttttggaatt ggcttatact 840

ttggctgatg gtttggaata ttctagaact ggtttgcaag ctggtttgac tattgatgaa 900

tttgctccaa gattgtcttt tttttggggt attggtatga atttttatat ggaaattgct 960

aaaatgagag ctggtagaag attgtgggct catttgattg aaaaaatgtt tcaaccaaaa 1020

aattctaaat ctttgttatt gagagctcat tgtcaaactt ctggttggtc tttgactgaa 1080

caagatccat ataataatat tgttagaact gctattgaag ctatggctgc tgtttttggt 1140

ggtactcaat ctttgcatac taattctttt gatgaagctt tgggtttgcc aacagtcaag 1200

tctgctagaa ttgctagaaa tactcaaatt atcattcaag aagaatctgg tattccaaaa 1260

gttgctgatc catggggtgg ttcttatatg atggaatgtt tgactaatga tgtttatgat 1320

gctgctttga aattgattaa tgaaattgaa gaaatgggtg gtatggctaa agctgttgct 1380

gaaggtatcc caaaattgag aattgaagag tgtgctgcta gaaggcaagc tagaattgat 1440

tctggttcag aagttattgt tggtgttaat aaataccaat tggaaaaaga agatgctgtt 1500

gaagttttgg ctatcgataa tacatctgtt agaaataggc aaattgagaa gttgaaaaaa 1560

atcaaatctt ctagagatca agctttggct gaaagatgtt tggctgcttt gactgaatgc 1620

gctgcttctg gtgatggtaa tattttggct ttggctgttg atgcttctag agctagatgt 1680

actgttggtg aaattactga tgctttgaaa aaagtttttg gtgaacataa agctaatgat 1740

agaatggttt ctggtgctta tagacaagaa tttggtgaat ctaaggaaat tacttctgct 1800

attaagagag ttcataaatt tatggaaaga gaaggtagaa gaccaagatt gttggttgct 1860

aaaatgggtc aagatggtca tgatagaggt gctaaagtta ttgctactgg ttttgctgat 1920

ttgggttttg atgttgatat tggtccattg tttcaaactc caagagaagt tgctcaacaa 1980

gctgtcgatg ctgatgttca tgctgttggt atttctactt tggctgctgg tcataaaact 2040

ttggttcctg aattgattaa agaattgaat tctttgggta gacctgatat tttggttatg 2100

tgtggtggtg ttattccacc acaagattat gaatttttgt ttgaagttgg tgtttctaat 2160

gtttttggtc ctggtactag aattccaaaa gctgctgttc aagttttgga tgatattgaa 2220

aaatgtttgg aaaaaaaaca acaatctgtt taa 2253

<210> 3

<211> 261

<212> PRT

<213> Escherichia coli (strain K12)

<400> 3

Met Ser Tyr Gln Tyr Val Asn Val Val Thr Ile Asn Lys Val Ala Val

1 5 10 15

Ile Glu Phe Asn Tyr Gly Arg Lys Leu Asn Ala Leu Ser Lys Val Phe

20 25 30

Ile Asp Asp Leu Met Gln Ala Leu Ser Asp Leu Asn Arg Pro Glu Ile

35 40 45

Arg Cys Ile Ile Leu Arg Ala Pro Ser Gly Ser Lys Val Phe Ser Ala

50 55 60

Gly His Asp Ile His Glu Leu Pro Ser Gly Gly Arg Asp Pro Leu Ser

65 70 75 80

Tyr Asp Asp Pro Leu Arg Gln Ile Thr Arg Met Ile Gln Lys Phe Pro

85 90 95

Lys Pro Ile Ile Ser Met Val Glu Gly Ser Val Trp Gly Gly Ala Phe

100 105 110

Glu Met Ile Met Ser Ser Asp Leu Ile Ile Ala Ala Ser Thr Ser Thr

115 120 125

Phe Ser Met Thr Pro Val Asn Leu Gly Val Pro Tyr Asn Leu Val Gly

130 135 140

Ile His Asn Leu Thr Arg Asp Ala Gly Phe His Ile Val Lys Glu Leu

145 150 155 160

Ile Phe Thr Ala Ser Pro Ile Thr Ala Gln Arg Ala Leu Ala Val Gly

165 170 175

Ile Leu Asn His Val Val Glu Val Glu Glu Leu Glu Asp Phe Thr Leu

180 185 190

Gln Met Ala His His Ile Ser Glu Lys Ala Pro Leu Ala Ile Ala Val

195 200 205

Ile Lys Glu Glu Leu Arg Val Leu Gly Glu Ala His Thr Met Asn Ser

210 215 220

Asp Glu Phe Glu Arg Ile Gln Gly Met Arg Arg Ala Val Tyr Asp Ser

225 230 235 240

Glu Asp Tyr Gln Glu Gly Met Asn Ala Phe Leu Glu Lys Arg Lys Pro

245 250 255

Asn Phe Val Gly His

260

<210> 4

<211> 786

<212> DNA

<213> Artificial sequence ()

<400> 4

atgtcttatc aatatgtcaa tgtcgtcact attaataaag ttgctgttat tgaattcaat 60

tacggaagga aattgaatgc tttgtctaag gttttcattg atgatttgat gcaagctttg 120

tctgatttga atagacctga aattagatgt attattttga gagctccatc tggttctaaa 180

gttttttctg ctggtcatga tattcatgaa ttgccatctg gtggtagaga tccattgtct 240

tatgatgacc cattgagaca aattacaaga atgattcaaa agtttccaaa accaattatt 300

tctatggttg aaggttctgt ttggggtggt gcttttgaaa tgattatgtc ttctgatttg 360

attattgctg cttctacttc tactttttct atgactcctg ttaatttggg tgttccatat 420

aatttggttg gtattcataa tttgactaga gatgctggtt ttcatattgt taaagaattg 480

atttttactg cttctccaat tactgctcaa agagctttgg ctgttggtat tttgaatcat 540

gttgttgaag ttgaagaatt ggaagatttt actttgcaaa tggctcatca tatttctgaa 600

aaagctccat tggctattgc tgttattaaa gaagaattga gagttttggg tgaagctcat 660

actatgaatt ctgatgaatt tgaaagaatt caaggtatga gaagagctgt ttatgattct 720

gaagattatc aagaaggtat gaatgctttt ttggaaaaaa gaaaaccaaa ttttgttggt 780

cattaa 786

<210> 5

<211> 524

<212> PRT

<213> Escherichia coli (strain K12)

<400> 5

Met Arg Lys Val Pro Ile Ile Thr Ala Asp Glu Ala Ala Lys Leu Ile

1 5 10 15

Lys Asp Gly Asp Thr Val Thr Thr Ser Gly Phe Val Gly Asn Ala Ile

20 25 30

Pro Glu Ala Leu Asp Arg Ala Val Glu Lys Arg Phe Leu Glu Thr Gly

35 40 45

Glu Pro Lys Asn Ile Thr Tyr Val Tyr Cys Gly Ser Gln Gly Asn Arg

50 55 60

Asp Gly Arg Gly Ala Glu His Phe Ala His Glu Gly Leu Leu Lys Arg

65 70 75 80

Tyr Ile Ala Gly His Trp Ala Thr Val Pro Ala Leu Gly Lys Met Ala

85 90 95

Met Glu Asn Lys Met Glu Ala Tyr Asn Val Ser Gln Gly Ala Leu Cys

100 105 110

His Leu Phe Arg Asp Ile Ala Ser His Lys Pro Gly Val Phe Thr Lys

115 120 125

Val Gly Ile Gly Thr Phe Ile Asp Pro Arg Asn Gly Gly Gly Lys Val

130 135 140

Asn Asp Ile Thr Lys Glu Asp Ile Val Glu Leu Val Glu Ile Lys Gly

145 150 155 160

Gln Glu Tyr Leu Phe Tyr Pro Ala Phe Pro Ile His Val Ala Leu Ile

165 170 175

Arg Gly Thr Tyr Ala Asp Glu Ser Gly Asn Ile Thr Phe Glu Lys Glu

180 185 190

Val Ala Pro Leu Glu Gly Thr Ser Val Cys Gln Ala Val Lys Asn Ser

195 200 205

Gly Gly Ile Val Val Val Gln Val Glu Arg Val Val Lys Ala Gly Thr

210 215 220

Leu Asp Pro Arg His Val Lys Val Pro Gly Ile Tyr Val Asp Tyr Val

225 230 235 240

Val Val Ala Asp Pro Glu Asp His Gln Gln Ser Leu Asp Cys Glu Tyr

245 250 255

Asp Pro Ala Leu Ser Gly Glu His Arg Arg Pro Glu Val Val Gly Glu

260 265 270

Pro Leu Pro Leu Ser Ala Lys Lys Val Ile Gly Arg Arg Gly Ala Ile

275 280 285

Glu Leu Glu Lys Asp Val Ala Val Asn Leu Gly Val Gly Ala Pro Glu

290 295 300

Tyr Val Ala Ser Val Ala Asp Glu Glu Gly Ile Val Asp Phe Met Thr

305 310 315 320

Leu Thr Ala Glu Ser Gly Ala Ile Gly Gly Val Pro Ala Gly Gly Val

325 330 335

Arg Phe Gly Ala Ser Tyr Asn Ala Asp Ala Leu Ile Asp Gln Gly Tyr

340 345 350

Gln Phe Asp Tyr Tyr Asp Gly Gly Gly Leu Asp Leu Cys Tyr Leu Gly

355 360 365

Leu Ala Glu Cys Asp Glu Lys Gly Asn Ile Asn Val Ser Arg Phe Gly

370 375 380

Pro Arg Ile Ala Gly Cys Gly Gly Phe Ile Asn Ile Thr Gln Asn Thr

385 390 395 400

Pro Lys Val Phe Phe Cys Gly Thr Phe Thr Ala Gly Gly Leu Lys Val

405 410 415

Lys Ile Glu Asp Gly Lys Val Ile Ile Val Gln Glu Gly Lys Gln Lys

420 425 430

Lys Phe Leu Lys Ala Val Glu Gln Ile Thr Phe Asn Gly Asp Val Ala

435 440 445

Leu Ala Asn Lys Gln Gln Val Thr Tyr Ile Thr Glu Arg Cys Val Phe

450 455 460

Leu Leu Lys Glu Asp Gly Leu His Leu Ser Glu Ile Ala Pro Gly Ile

465 470 475 480

Asp Leu Gln Thr Gln Ile Leu Asp Val Met Asp Phe Ala Pro Ile Ile

485 490 495

Asp Arg Asp Ala Asn Gly Gln Ile Lys Leu Met Asp Ala Ala Leu Phe

500 505 510

Ala Glu Gly Leu Met Gly Leu Lys Glu Met Lys Ser

515 520

<210> 6

<211> 1575

<212> DNA

<213> Artificial sequence ()

<400> 6

atgagaaaag ttccaattat tactgctgat gaagctgcta aattgattaa agatggtgat 60

actgttacta cttctggttt tgttggtaat gctattcctg aagctttgga tagagctgtt 120

gaaaaaagat ttttggaaac tggtgaacca aagaatatta catatgttta ttgtggttct 180

caaggtaata gagatggtag aggtgctgaa cattttgctc atgaaggttt gttgaaaaga 240

tatattgctg gtcattgggc tactgttcct gctttgggta aaatggctat ggaaaataaa 300

atggaagctt ataatgtttc tcaaggtgct ttgtgtcatt tgtttagaga tattgcttct 360

cataaacctg gtgtttttac taaagttggt attggtactt ttattgatcc aaggaatggt 420

ggaggtaaag ttaatgatat tactaaggag gatattgttg aattagttga aattaagggt 480

caagaatatt tgttttatcc tgcttttcca attcatgttg ctttgattag aggtacttat 540

gctgatgaat ctggtaatat tacttttgaa aaagaagttg ctccattgga aggtacttct 600

gtttgtcaag ctgttaaaaa ttctggtggt attgttgtcg ttcaagttga aagagttgtt 660

aaagctggta ctttggatcc aagacatgtt aaagttcctg gtatttatgt tgattatgtt 720

gtcgttgctg atcctgaaga tcatcaacaa tctttggatt gtgaatatga tcctgctttg 780

tctggtgaac atagaagacc tgaagttgtt ggtgaaccat tgccattgtc tgctaaaaaa 840

gttattggta gaagaggtgc tattgaattg gaaaaagatg ttgctgttaa tttgggtgtt 900

ggtgctcctg aatatgttgc ttctgttgct gatgaagaag gtattgttga ttttatgact 960

ttgactgctg aatctggtgc tattggtggt gttcctgctg gtggtgttag atttggtgct 1020

tcttataatg ctgatgcttt gattgatcaa ggttatcaat ttgattatta tgatggtgga 1080

ggtttggatt tgtgttattt gggtttggct gaatgtgatg aaaaaggtaa tattaatgtt 1140

tctagatttg gtccaagaat tgctggttgt ggtggtttta ttaatattac tcaaaatact 1200

ccaaaagttt ttttttgtgg tacttttact gctggtggat tgaaggttaa aatcgaagat 1260

ggaaaggtca ttatcgttca agaaggtaag cagaaaaaat tcttgaaagc tgttgaacaa 1320

attactttta atggtgatgt tgctttggct aataaacaac aagtcactta tattactgaa 1380

agatgtgttt ttttgttgaa agaagatggt ttgcatttgt ctgaaattgc tcctggtatt 1440

gatttgcaaa ctcaaatttt ggatgttatg gattttgctc caattattga tagagatgct 1500

aatggtcaaa ttaaattgat ggatgctgct ttgtttgctg aaggtttgat gggtttgaaa 1560

gaaatgaaat cttaa 1575

<210> 7

<211> 422

<212> PRT

<213> Anaerotignum propionicum DSM 1682

<400> 7

Met Ser Leu Thr Gln Gly Met Lys Ala Lys Gln Leu Leu Ala Tyr Phe

1 5 10 15

Gln Gly Lys Ala Asp Gln Asp Ala Arg Glu Ala Lys Ala Arg Gly Glu

20 25 30

Leu Val Cys Trp Ser Ala Ser Val Ala Pro Pro Glu Phe Cys Val Thr

35 40 45

Met Gly Ile Ala Met Ile Tyr Pro Glu Thr His Ala Ala Gly Ile Gly

50 55 60

Ala Arg Lys Gly Ala Met Asp Met Leu Glu Val Ala Asp Arg Lys Gly

65 70 75 80

Tyr Asn Val Asp Cys Cys Ser Tyr Gly Arg Val Asn Met Gly Tyr Met

85 90 95

Glu Cys Leu Lys Glu Ala Ala Ile Thr Gly Val Lys Pro Glu Val Leu

100 105 110

Val Asn Ser Pro Ala Ala Asp Val Pro Leu Pro Asp Leu Val Ile Thr

115 120 125

Cys Asn Asn Ile Cys Asn Thr Leu Leu Lys Trp Tyr Glu Asn Leu Ala

130 135 140

Ala Glu Leu Asp Ile Pro Cys Ile Val Ile Asp Val Pro Phe Asn His

145 150 155 160

Thr Met Pro Ile Pro Glu Tyr Ala Lys Ala Tyr Ile Ala Asp Gln Phe

165 170 175

Arg Asn Ala Ile Ser Gln Leu Glu Val Ile Cys Gly Arg Pro Phe Asp

180 185 190

Trp Lys Lys Phe Lys Glu Val Lys Asp Gln Thr Gln Arg Ser Val Tyr

195 200 205

His Trp Asn Arg Ile Ala Glu Met Ala Lys Tyr Lys Pro Ser Pro Leu

210 215 220

Asn Gly Phe Asp Leu Phe Asn Tyr Met Ala Leu Ile Val Ala Cys Arg

225 230 235 240

Ser Leu Asp Tyr Ala Glu Ile Thr Phe Lys Ala Phe Ala Asp Glu Leu

245 250 255

Glu Glu Asn Leu Lys Ala Gly Ile Tyr Ala Phe Lys Gly Ala Glu Lys

260 265 270

Thr Arg Phe Gln Trp Glu Gly Ile Ala Val Trp Pro His Leu Gly His

275 280 285

Thr Phe Lys Ser Met Lys Asn Leu Asn Ser Ile Met Thr Gly Thr Ala

290 295 300

Tyr Pro Ala Leu Trp Asp Leu His Tyr Asp Ala Asn Asp Glu Ser Met

305 310 315 320

His Ser Met Ala Glu Ala Tyr Thr Arg Ile Tyr Ile Asn Thr Cys Leu

325 330 335

Gln Asn Lys Val Glu Val Leu Leu Gly Ile Met Glu Lys Gly Gln Val

340 345 350

Asp Gly Thr Val Tyr His Leu Asn Arg Ser Cys Lys Leu Met Ser Phe

355 360 365

Leu Asn Val Glu Thr Ala Glu Ile Ile Lys Glu Lys Asn Gly Leu Pro

370 375 380

Tyr Val Ser Ile Asp Gly Asp Gln Thr Asp Pro Arg Val Phe Ser Pro

385 390 395 400

Ala Gln Phe Asp Thr Arg Val Gln Ala Leu Val Glu Met Met Glu Ala

405 410 415

Asn Met Ala Ala Ala Glu

420

<210> 8

<211> 1269

<212> DNA

<213> Artificial sequence ()

<400> 8

atgtctttga ctcaaggtat gaaagctaaa caattgttgg cttattttca aggtaaagct 60

gatcaagatg ctagagaagc taaagctaga ggtgaattgg tttgttggtc tgcttctgtt 120

gctccacctg aattttgtgt tactatgggt attgctatga tttatcctga aactcatgct 180

gctggtattg gtgctagaaa aggtgctatg gatatgttgg aagttgctga tagaaaaggt 240

tataatgttg attgttgttc ttatggtaga gttaatatgg gttatatgga atgtttgaaa 300

gaagctgcta ttactggtgt taaacctgaa gttttggtta attctcctgc tgctgatgtt 360

cctttgcctg atttagtcat tacttgcaat aatatctgta atactttgtt gaaatggtat 420

gaaaatttgg ctgctgaatt ggatattcca tgtattgtta ttgatgttcc attcaatcat 480

actatgccaa tccctgaata tgctaaggct tatattgctg atcagtttag aaatgctatt 540

tctcagttgg aagttatttg tggtagacca ttcgattgga aaaaatttaa agaggtcaaa 600

gaccaaactc aaagatctgt ttatcattgg aatagaattg ctgaaatggc aaaatataaa 660

ccttctccat tgaatggttt tgatttgttt aattacatgg ctttgattgt tgcttgtaga 720

tctttggatt atgctgaaat tacttttaaa gcttttgctg atgaattgga agaaaatttg 780

aaagctggta tttatgcttt taaaggtgct gaaaaaacta gatttcaatg ggaaggtatt 840

gctgtttggc cacatttggg tcatactttt aaatctatga aaaatttgaa ttctattatg 900

actggtactg cttatcctgc tttgtgggat ttgcattatg atgctaatga tgaatcaatg 960

cactctatgg ctgaagctta cactaggatt tatattaata catgtttgca aaataaagtt 1020

gaagttttgt tgggtattat ggaaaaaggt caagttgacg gaactgttta tcacttgaac 1080

agatcttgca aattaatgtc tttcttaaat gttgaaactg cagaaattat taaggagaaa 1140

aatggtttgc catatgtttc tattgatggt gatcaaactg atccaagagt tttttctcct 1200

gctcaatttg atactagagt tcaagctttg gttgaaatga tggaagctaa tatggctgca 1260

gctgaataa 1269

<210> 9

<211> 374

<212> PRT

<213> Anaerotignum propionicum DSM 1682

<400> 9

Met Ser Arg Val Glu Ala Ile Leu Ser Gln Leu Lys Asp Val Ala Ala

1 5 10 15

Asn Pro Lys Lys Ala Met Asp Asp Tyr Lys Ala Glu Thr Gly Lys Gly

20 25 30

Ala Val Gly Ile Met Pro Ile Tyr Ser Pro Glu Glu Met Val His Ala

35 40 45

Ala Gly Tyr Leu Pro Met Gly Ile Trp Gly Ala Gln Gly Lys Thr Ile

50 55 60

Ser Lys Ala Arg Thr Tyr Leu Pro Ala Phe Ala Cys Ser Val Met Gln

65 70 75 80

Gln Val Met Glu Leu Gln Cys Glu Gly Ala Tyr Asp Asp Leu Ser Ala

85 90 95

Val Ile Phe Ser Val Pro Cys Asp Thr Leu Lys Cys Leu Ser Gln Lys

100 105 110

Trp Lys Gly Thr Ser Pro Val Ile Val Phe Thr His Pro Gln Asn Arg

115 120 125

Gly Leu Glu Ala Ala Asn Gln Phe Leu Val Thr Glu Tyr Glu Leu Val

130 135 140

Lys Ala Gln Leu Glu Ser Val Leu Gly Val Lys Ile Ser Asn Ala Ala

145 150 155 160

Leu Glu Asn Ser Ile Ala Ile Tyr Asn Glu Asn Arg Ala Val Met Arg

165 170 175

Glu Phe Val Lys Val Ala Ala Asp Tyr Pro Gln Val Ile Asp Ala Val

180 185 190

Ser Arg His Ala Val Phe Lys Ala Arg Gln Phe Met Leu Lys Glu Lys

195 200 205

His Thr Ala Leu Val Lys Glu Leu Ile Ala Glu Ile Lys Ala Thr Pro

210 215 220

Val Gln Pro Trp Asp Gly Lys Lys Val Val Val Thr Gly Ile Leu Leu

225 230 235 240

Glu Pro Asn Glu Leu Leu Asp Ile Phe Asn Glu Phe Lys Ile Ala Ile

245 250 255

Val Asp Asp Asp Leu Ala Gln Glu Ser Arg Gln Ile Arg Val Asp Val

260 265 270

Leu Asp Gly Glu Gly Gly Pro Leu Tyr Arg Met Ala Lys Ala Trp Gln

275 280 285

Gln Met Tyr Gly Cys Ser Leu Ala Thr Asp Thr Lys Lys Gly Arg Gly

290 295 300

Arg Met Leu Ile Asn Lys Thr Ile Gln Thr Gly Ala Asp Ala Ile Val

305 310 315 320

Val Ala Met Met Lys Phe Cys Asp Pro Glu Glu Trp Asp Tyr Pro Val

325 330 335

Met Tyr Arg Glu Phe Glu Glu Lys Gly Val Lys Ser Leu Met Ile Glu

340 345 350

Val Asp Gln Glu Val Ser Ser Phe Glu Gln Ile Lys Thr Arg Leu Gln

355 360 365

Ser Phe Val Glu Met Leu

370

<210> 10

<211> 1125

<212> DNA

<213> Artificial sequence ()

<400> 10

atgtctagag ttgaagctat tttgtctcaa ttgaaagatg ttgctgctaa tccaaaaaaa 60

gctatggatg attataaagc tgaaactggt aaaggtgctg ttggtattat gccaatttat 120

tctcctgaag aaatggttca tgctgctggt tatttgccaa tgggtatttg gggtgctcaa 180

ggtaaaacta tttctaaagc tagaacttat ttgcctgctt ttgcttgttc tgttatgcaa 240

caagttatgg aattgcaatg tgaaggtgct tatgatgatt tgtctgctgt tattttttct 300

gttccatgtg atactttgaa atgtttgtct caaaaatgga aaggtacttc tcctgttatt 360

gtttttactc atccacaaaa tagaggtttg gaagctgcta atcaattttt ggttactgaa 420

tatgaattgg ttaaagctca attggaatct gtcttgggag ttaaaatctc taatgctgct 480

ttggagaatt caattgctat ctataatgaa aatagagctg ttatgagaga atttgttaaa 540

gttgctgctg attatccaca agttattgat gctgtttcta gacatgctgt ttttaaagct 600

agacaattta tgttgaaaga aaaacatact gctttggtta aagaattgat tgctgaaatt 660

aaagctactc ctgttcaacc atgggatggt aaaaaagttg ttgtcactgg tattttgtta 720

gaaccaaacg agttgttaga tatctttaat gaattcaaaa ttgctattgt tgatgacgat 780

ttggctcaag aatctagaca aattagagtt gatgttttgg atggtgaagg tggtccattg 840

tatagaatgg ctaaagcttg gcaacaaatg tatggttgtt ctttggctac tgatactaaa 900

aaaggtagag gtagaatgtt gattaataaa actattcaaa ctggtgctga tgctattgtt 960

gttgctatga tgaaattttg tgatcctgaa gaatgggatt atcctgttat gtatagagaa 1020

ttcgaagaga aaggagttaa atctttaatg attgaagttg accaagaagt ttcatctttt 1080

gagcagatta aaactagatt gcaatctttt gttgaaatgt tgtaa 1125

<210> 11

<211> 286

<212> PRT

<213> Escherichia coli (strain K12)

<400> 11

Met Ser Gln Ala Leu Lys Asn Leu Leu Thr Leu Leu Asn Leu Glu Lys

1 5 10 15

Ile Glu Glu Gly Leu Phe Arg Gly Gln Ser Glu Asp Leu Gly Leu Arg

20 25 30

Gln Val Phe Gly Gly Gln Val Val Gly Gln Ala Leu Tyr Ala Ala Lys

35 40 45

Glu Thr Val Pro Glu Glu Arg Leu Val His Ser Phe His Ser Tyr Phe

50 55 60

Leu Arg Pro Gly Asp Ser Lys Lys Pro Ile Ile Tyr Asp Val Glu Thr

65 70 75 80

Leu Arg Asp Gly Asn Ser Phe Ser Ala Arg Arg Val Ala Ala Ile Gln

85 90 95

Asn Gly Lys Pro Ile Phe Tyr Met Thr Ala Ser Phe Gln Ala Pro Glu

100 105 110

Ala Gly Phe Glu His Gln Lys Thr Met Pro Ser Ala Pro Ala Pro Asp

115 120 125

Gly Leu Pro Ser Glu Thr Gln Ile Ala Gln Ser Leu Ala His Leu Leu

130 135 140

Pro Pro Val Leu Lys Asp Lys Phe Ile Cys Asp Arg Pro Leu Glu Val

145 150 155 160

Arg Pro Val Glu Phe His Asn Pro Leu Lys Gly His Val Ala Glu Pro

165 170 175

His Arg Gln Val Trp Ile Arg Ala Asn Gly Ser Val Pro Asp Asp Leu

180 185 190

Arg Val His Gln Tyr Leu Leu Gly Tyr Ala Ser Asp Leu Asn Phe Leu

195 200 205

Pro Val Ala Leu Gln Pro His Gly Ile Gly Phe Leu Glu Pro Gly Ile

210 215 220

Gln Ile Ala Thr Ile Asp His Ser Met Trp Phe His Arg Pro Phe Asn

225 230 235 240

Leu Asn Glu Trp Leu Leu Tyr Ser Val Glu Ser Thr Ser Ala Ser Ser

245 250 255

Ala Arg Gly Phe Val Arg Gly Glu Phe Tyr Thr Gln Asp Gly Val Leu

260 265 270

Val Ala Ser Thr Val Gln Glu Gly Val Met Arg Asn His Asn

275 280 285

<210> 12

<211> 861

<212> DNA

<213> Artificial sequence ()

<400> 12

atgtctcaag ctttgaaaaa tttgttgact ttgttgaatt tggaaaaaat tgaagaaggt 60

ttgtttagag gtcaatctga agatttgggt ttgagacaag tttttggtgg tcaagttgtt 120

ggtcaagctt tgtatgctgc taaagaaact gttcctgaag aaagattggt tcattctttt 180

cactcttatt ttttgagacc tggtgattct aaaaaaccaa ttatttatga cgttgaaact 240

ttgagagatg gtaattcttt ttctgctaga agagttgctg ctattcaaaa tggtaaacca 300

attttttata tgactgcttc ttttcaagct cctgaagctg gttttgaaca tcaaaaaact 360

atgccatctg ctcctgctcc tgatggtttg ccatctgaaa ctcaaattgc tcaatctttg 420

gctcatttgt tgccacctgt tttgaaagat aaatttattt gtgatagacc attggaagtt 480

agacctgttg aatttcataa tccattgaaa ggtcatgttg ctgaaccaca tagacaagtt 540

tggattagag ctaatggttc tgttcctgat gatttgagag ttcatcaata tttgttgggt 600

tatgcttctg atttgaattt tttgcctgtt gctttgcaac cacatggtat tggttttttg 660

gaacctggta ttcaaattgc tactattgat cattctatgt ggtttcatag accatttaat 720

ttgaatgaat ggttgttgta ttctgttgaa tctacttctg cttcttctgc tagaggtttt 780

gttagaggtg aattttatac tcaagatggt gttttggttg cttctactgt tcaagaaggt 840

gttatgagaa atcataatta a 861

<210> 13

<211> 468

<212> PRT

<213> Artificial sequence ()

<400> 13

Met Asn Thr Asp Val Arg Ile Glu Lys Asp Phe Leu Gly Glu Lys Glu

1 5 10 15

Ile Pro Lys Asp Ala Tyr Tyr Gly Val Gln Thr Ile Arg Ala Thr Glu

20 25 30

Asn Phe Pro Ile Thr Gly Tyr Arg Ile His Pro Glu Leu Ile Lys Ser

35 40 45

Leu Gly Ile Val Lys Lys Ser Ala Ala Leu Ala Asn Met Glu Val Gly

50 55 60

Leu Leu Asp Lys Glu Val Gly Gln Tyr Ile Val Lys Ala Ala Asp Glu

65 70 75 80

Val Ile Glu Gly Lys Trp Asn Asp Gln Phe Ile Val Asp Pro Ile Gln

85 90 95

Gly Gly Ala Gly Thr Ser Ile Asn Met Asn Ala Asn Glu Val Ile Ala

100 105 110

Asn Arg Ala Leu Glu Leu Met Gly Glu Glu Lys Gly Asn Tyr Ser Lys

115 120 125

Ile Ser Pro Asn Ser His Val Asn Met Ser Gln Ser Thr Val Asp Ala

130 135 140

Phe Pro Thr Ala Thr His Ile Ala Val Leu Ser Leu Leu Asn Gln Leu

145 150 155 160

Ile Glu Thr Thr Lys Tyr Met Gln Gln Glu Phe Met Lys Lys Ala Asp

165 170 175

Glu Phe Ala Gly Val Ile Lys Met Gly Arg Cys Ala Leu Gln Asp Ala

180 185 190

Val Pro Ile Leu Leu Gly Gln Glu Phe Glu Ala Tyr Ala Arg Val Ile

195 200 205

Ala Arg Asp Ile Glu Arg Ile Ala Asn Thr Arg Asn Asn Leu Tyr Asp

210 215 220

Ile Asn Met Gly Ala Thr Ala Val Gly Thr Gly Leu Asn Ala Asp Pro

225 230 235 240

Glu Tyr Ile Ser Ile Val Thr Glu His Leu Ala Lys Phe Ser Gly His

245 250 255

Pro Leu Arg Ser Ala Gln His Leu Val Asp Ala Thr Gln Asn Thr Asp

260 265 270

Cys Tyr Thr Glu Val Ser Ser Ala Leu Lys Val Cys Met Ile Asn Met

275 280 285

Ser Lys Ile Ala Asn Asp Leu Arg Leu Met Ala Ser Gly Pro Arg Ala

290 295 300

Gly Leu Ser Glu Ile Val Leu Pro Ala Arg Gln Pro Gly Ser Ser Ile

305 310 315 320

Ile Pro Gly Leu Val Ala Pro Val Met Pro Glu Val Met Asn Gln Val

325 330 335

Ala Phe Gln Val Phe Gly Asn Asp Leu Thr Ile Thr Ser Ala Ser Glu

340 345 350

Ala Gly Gln Phe Glu Leu Asn Val Met Glu Pro Val Leu Phe Phe Asn

355 360 365

Leu Ile Gln Ser Ile Ser Ile Met Thr Asn Val Phe Lys Ser Phe Thr

370 375 380

Glu Asn Cys Leu Lys Gly Ile Lys Ala Asn Glu Glu Arg Met Lys Glu

385 390 395 400

Tyr Val Glu Lys Ser Ile Gly Ile Ile Thr Ala Ile Asn Pro His Val

405 410 415

Gly Tyr Glu Thr Ala Ala Lys Leu Ala Arg Glu Ala Tyr Leu Thr Gly

420 425 430

Glu Ser Ile Arg Glu Leu Cys Ile Lys Tyr Gly Val Leu Thr Glu Glu

435 440 445

Gln Leu Asn Glu Ile Leu Asn Pro Tyr Glu Met Thr His Pro Gly Ile

450 455 460

Ala Gly Arg Lys

465

<210> 14

<211> 1407

<212> DNA

<213> Artificial sequence ()

<400> 14

atgaatactg atgttagaat tgaaaaagat tttttgggtg aaaaagaaat tccaaaagat 60

gcttattacg gtgttcaaac tattagagct actgagaatt ttccaattac tggttataga 120

attcatcctg aattgattaa atctttgggt attgttaaaa aatctgctgc tttggctaat 180

atggaagttg gtttgttgga taaagaagtt ggtcaatata ttgttaaagc tgctgatgag 240

gtcattgaag gtaaatggaa tgatcaattt attgttgatc caattcaagg tggtgctggt 300

acttctatta atatgaatgc taatgaagtt attgctaata gagctttgga attgatggga 360

gaagaaaaag gtaactattc taaaatctct ccaaattctc atgttaatat gtctcaatct 420

actgttgatg cttttccaac tgctactcat attgcagttt tatctttgtt aaatcaattg 480

attgaaacaa ctaaatatat gcagcaagaa tttatgaaaa aagctgatga atttgctggt 540

gttattaaaa tgggtagatg tgctttgcaa gatgctgttc caattttgtt gggtcaagaa 600

tttgaagctt atgctagggt tatcgctagg gatattgaaa gaattgcaaa tacaaggaat 660

aatttgtatg atattaatat gggtgctact gctgttggta ctggtttgaa tgctgatcct 720

gaatatattt ctattgttac tgaacatttg gctaaatttt ctggtcatcc attgagatct 780

gctcaacatt tggttgatgc tactcaaaat actgattgtt atactgaggt ctcttctgct 840

ttgaaagttt gtatgattaa catgtctaaa attgctaatg atttgagatt gatggcttct 900

ggtccaagag ctggtttgtc tgaaattgtt ttgcctgcta gacaacctgg ttcttctatt 960

attcctggtt tggttgctcc tgttatgcct gaagttatga atcaagttgc ttttcaagtt 1020

tttggtaatg atttgactat tacttctgct tctgaagctg gtcagttcga attgaacgtc 1080

atggagcctg ttttattttt caatttgatt cagtctatct caattatgac taacgttttc 1140

aagtctttta ctgaaaattg tttgaaggga attaaagcta atgaggaaag aatgaaggaa 1200

tatgtcgaaa agtctattgg tattatcact gctattaatc cacatgttgg ttatgaaact 1260

gctgctaaat tggctagaga agcttatttg actggtgaat ctattagaga attgtgtatt 1320

aagtatggtg tcttgactga agaacaattg aatgaaattt tgaatccata tgaaatgact 1380

catcctggta ttgctggtag aaaataa 1407