阅读说明：本技术 高莱鲍迪苷m甜菊植物栽培品种及其产生方法 (High rebaudioside M stevia plant cultivars and methods of producing the same ) 是由 阿韦季克·马尔科斯雅恩 王雄祥 景润春 黄腾芳 斯蒂芬·埃兹拉·肖尔 法亚兹·卡齐 阿历 于 2018-03-07 设计创作，主要内容包括：公开了具有高RebM含量的甜菊品种。还提供了通过负调节选择所得植物的某些基因来产生具有高RebM含量的甜菊植物、以及用这样的植物进行育种以赋予植物后代这样的期望Reb M表型的方法。(Stevia species with high RebM content are disclosed. Also provided are methods of producing stevia plants with high RebM content by negative regulation of certain genes of the resulting plants, and breeding with such plants to confer such a desired Reb M phenotype to the progeny of the plants.)

1. A Stevia (Stevia rebaudiana) plant comprising at least one disrupted negative regulatory gene in the rebaudioside a to rebaudioside M turnover pathway.

2. A method for increasing rebaudioside M content in stevia plants by inducing a disruption of the function of at least one negative regulator gene in said plant, wherein said negative regulator gene is selected from the group consisting of genes that affect metabolism, signal transduction, and gene regulation, and novel unclassified genes.

3. The metabolic gene of the method of claim 2, wherein said gene comprises a gene that affects sugar metabolism, monooxygenase content, terpene metabolism, aminotransferase metabolism, multi-antimicrobial extrusion protein metabolism, and methionine metabolism.

4. The metabolic gene of claim 3, wherein said gene is selected from the group consisting of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10.

5. the stevia plant of claim 2, or a plant part thereof, consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, ovules, seeds, cells, roots, root tips, pistils, anthers, flowers and stems.

6. The signal transduction and gene regulation gene of claim 2, wherein the gene comprises an abiotic stress gene and an biotic stress gene.

7. The signal transduction and gene regulation gene of claim 6, wherein the gene is selected from the group consisting of SEQ ID NO: 11. SEQ ID NO: 12. SEQ ID NO: 13. SEQ ID NO: 14. SEQ ID NO: 15 and SEQ ID NO: 16.

8. the novel unclassified gene according to the method of claim 2 wherein said gene is selected from the group consisting of SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19 and SEQ ID NO: 20.

9. a method for producing a high rebaudioside M stevia plant comprising: (a) screening stevia plant populations for mutations in at least one of the following sequences: SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO: 11. SEQ ID NO: 12. SEQ ID NO: 13. SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19 and SEQ ID NO: 20; (b) selecting a first stevia plant having said at least one mutation; (c) crossing a first selected stevia plant having at least one mutation with a second stevia plant; (d) screening stevia progeny plants having high rebaudioside M; and (e) selecting a stevia plant with high rebaudioside M.

10. A stevia plant produced by the method of claim 9.

Brief Description of Drawings

The accompanying drawings, which are incorporated herein and constitute part of this specification, illustrate some, but not the only or exclusive example embodiments and/or features. The embodiments and figures disclosed herein are intended to be considered illustrative rather than restrictive.

FIG. 1 shows the expression pattern of cytochrome P450716B 1-like genes (STKS #3) in different stevia plant types.

Definition of

In the following description and tables, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided. All rebaudioside contents were expressed as a percentage of the dry weight of the leaves.

High rebaudioside A: rebaudioside a content greater than or equal to 9%, rebaudioside D content less than or equal to 0.3%, and rebaudioside D for plants described as having high rebaudioside a as used hereinThe content of M is less than or equal to 0.2 percent.

High rebaudioside D: as used herein, plants described as having high rebaudioside D have a rebaudioside D content of greater than or equal to 0.6% and rebaudioside D/total steviol glycosides (steviol glycosides) of greater than or equal to 8%.

High rebaudioside D and high rebaudioside M: as used herein, a plant described as having rebaudioside D and high rebaudioside M content has a rebaudioside D content greater than or equal to 0.6% and rebaudioside D/total steviol glycosides greater than or equal to 8%, and rebaudioside M content greater than or equal to 0.5%.

High rebaudioside M: rebaudioside M content of plants described as having high rebaudioside M as used herein is greater than or equal to 0.5%.

High stevioside: as used herein, a plant described as having a high stevioside has a stevioside content greater than or equal to 7%, a rebaudioside D content less than or equal to 0.3%, and a rebaudioside M content less than or equal to 0.2%.

High stevioside and high rebaudioside A: rebaudioside D/total steviol glycosides used herein, described as plants with high stevioside and high rebaudioside a, are less than or equal to 7.60% and rebaudioside M/total steviol glycosides are less than or equal to 1.9%.

Marking: as used herein, a "marker" is an indicator of the presence of at least one polymorphism, and thus a marker may be, for example, the nucleotide sequence itself or a probe.

Plant and method for producing the same: the term "plant" as used herein includes reference to an immature or mature whole plant, including plants that have been processed for steviol glycosides. Seeds or plant parts that produce plants are also considered plants.

Plant parts: the term "plant part" as used herein includes leaves, stems, roots, seeds, embryos, pollen, ovules, flowers, root tips, anthers, tissues, cells and the like.

Rebaudioside A (RebA)): "rebaudioside A" or "RebA" as used herein isSteviol glycosides which contain only glucose as their monosaccharide moiety (motif). It contains a total of four glucose molecules, with the central glucose of the triad being linked to the main steviol structure at its hydroxyl group, and the remaining glucose linked at its carboxyl group to form an ester linkage.

Rebaudioside D(RebD): "rebaudioside D" or "RebD" as used herein is an enantiomeric-kaurane diterpene glycoside isolated from stevia rebaudiana (stevia rebaudiana).

Rebaudioside M(RebM): "rebaudioside M" or "RebM" as used herein is an enantiomeric-kaurane-type diterpene glycoside isolated from stevia.

SNP: the term "SNP" as used herein shall refer to a single nucleotide polymorphism.

Stevioside content: stevioside, as used herein, is the percentage of glycosides derived from the stevia plant.

Detailed Description

Stevia (Stevia rebaudiana Bertoni) is a perennial herb of the family Asteraceae (Asteraceae) consisting of about 230 herbs, shrubs and subshrubular plants. Stevia is known to produce the diterpene Steviol Glycoside (SG) approximately 300 times sweeter than sucrose. Twenty-one diterpene glycosides have been identified in stevia leaf tissue (US 2011/0183056). Among the four major steviol glycosides synthesized in stevia rebaudiana leaves are Stevioside (STEV), RebA, rebaudioside C (RebC), and rebaudioside F (RebF). STEV accounts for 5% to 10% of the dry weight of the leaves, while RebA accounts for 2% to 4% (Pande and Priyanka 2013).

All stevia plants grown worldwide are genetically 97% to 99% identical to the estimated 2GB genome. The genetic differences comprise only 2% to 3% of the 2GB genome in different stevia plants and are key attributes for stevia adaptability, growth performance, leaf size, disease resistance, steviol glycoside composition variation, etc.

Deep short-read sequencing methods have been used to quantify gene expression levels in samples with different rebaudioside M accumulation. To identify potential negative regulators of rebaudioside M biosynthesis, candidate genes were selected based on lower expression levels in high rebaudioside M stevia plants compared to expression levels in high rebaudioside a or rebaudioside D stevia plants. Preferably, candidate genes are selected that have a single copy of the protein coding sequence. The expression pattern of the selected candidate genes was verified in a separate short read sequencing dataset.

Some embodiments described herein generally relate to stevia varieties in which at least one negative regulator gene in the rebaudioside a to rebaudioside M turnover pathway has been disrupted.

A list of candidate genes thought to be involved in the down-regulation of the rebaudioside a to rebaudioside M switch pathway is shown in table 1 below. It is believed that disruption of one or more of these negative regulatory genes in stevia will result in an increased conversion of rebaudioside a to rebaudioside M in stevia plants. All candidate genes are native to stevia plants.

Table 1: down-regulatory candidate genes for rebaudioside M overproduction

Some embodiments described herein also provide methods of disrupting at least one negative regulator gene in the rebaudioside a to rebaudioside M turnover pathway. Such methods may include, but are not limited to: ethyl Methane Sulfonate (EMS) mutagenesis, site-directed mutagenesis, direct gene targeting (knockout), RNA interference, and CRISPR (gene editing).

Embodiments described herein also provide methods of introducing a mutation into one or more negative regulator genes in the rebaudioside a to rebaudioside M turnover pathway, the method comprising applying a mutagen, wherein the mutagen is selected from the group comprising: ionizing radiation, chemical mutagens, targeted local lesions induced in the genome, zinc finger nuclease-mediated mutagenesis, and meganucleases, and methods of selecting plants having one or more negative regulatory gene mutations in the rebaudioside a to rebaudioside M turnover pathway are provided.

Another embodiment provided herein discloses a stevia plant produced by the above method, wherein the rebaudioside M content of the leaves is at least 0.5% of dry weight.

Some embodiments described herein also provide methods for screening for a disrupted stevia plant comprising at least one negative regulator of rebaudioside M. These methods may include, but are not limited to: gene sequencing, SNP analysis, RNA sequencing and gene expression analysis.

Some embodiments described herein also provide methods of introgressing rebaudioside M phenotype into other stevia varieties in a plant breeding program to produce new stevia cultivars with high rebaudioside M by selecting stevia plants with a disruption of at least one negative regulatory gene and applying plant breeding techniques such as recurrent selection, backcrossing, pedigree breeding, marker enhanced selection, or haploid/doubled haploid production.

Another embodiment discloses a stevia plant, wherein the leaves of the stevia plant have a rebaudioside M content of about 0.1% to 2.0%, or about 0.5% to 1.54% (e.g., about 1.15%) of dry weight. Higher rebaudioside M levels, such as 3.0%, 4.0%, or 5.0%, are contemplated by the present invention.

Another embodiment discloses a method for producing a high rebaudioside M stevia plant comprising: (a) screening stevia plant populations for mutations in at least one of the following sequences: SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO: 11. SEQ ID NO: 12. SEQ ID NO: 13. SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19 and SEQ ID NO: 20; (b) selecting a first stevia plant having said at least one mutation; (c) crossing a first selected stevia plant having at least one mutation with a second stevia plant; (d) screening stevia progeny plants having high rebaudioside M; and (e) selecting a stevia plant with high rebaudioside M.

Another embodiment provided herein discloses a stevia plant produced by the above breeding method, wherein the rebaudioside M content of the leaves is at least 0.5% of dry weight.

Examples

The following examples are provided to further illustrate the various applications and are not intended to limit the invention beyond that set forth in the appended claims.

To identify the apical negative regulator of rebaudioside M accumulation, transcriptomic analysis was performed using the PacBio Iso-seq and IlluminaHiSeq sequencing methods. PacBio Iso-seq sequencing was performed to determine full-length gene models and post-transcriptional modifications to facilitate genome annotation and gene prediction. Illumina HiSeq sequencing is to quantify the expression level of each transcript in a particular tissue under different conditions. The selection criteria for the top negative regulator were: 1) protein coding sequences with lower expression in high rebaudioside M stevia lines; 2) consistently lower expression in high rebaudioside M stevia lines under different conditions (health and stress); 3) is inversely related to the rebaudioside M property in the expression network. As an example, the expression pattern of the candidate gene cytochrome P450716B 1-like protein gene is shown in FIG. 1. The expression level of cytochrome P450716B 1-like protein gene in high rebaudioside M stevia lines is significantly lower than the expression level in high rebaudioside a, high rebaudioside a and high rebaudioside D stevia lines. This cytochrome P450 enzyme can modify SG or SG precursors to reduce metabolic flux (metabolic flow) towards SG biosynthesis. Mutations in this gene can reduce undesired branching reactions and can redirect metabolic flux to more Reb M biosynthesis.

Molecules for disrupting one or more negative regulatory genes in the rebaudioside a to rebaudioside M switch pathway Technique of

A number of techniques for gene silencing are well known to those skilled in The art, including, but not limited to, knockout (e.g., by insertion of transposable elements (e.g., Mu (Vicki Chandler, The Maize Handbook, Ch.118(Springer-Verlag 1994)) or other genetic elements (e.g., FRT, Lox or other site-specific integration sites)), antisense techniques (see, e.g., Sheehy et al, PNAS USA, 85: 8805-8809(1988) and U.S. Pat. Nos. 5,107,065, 5,453,566 and 5,759,829)), cosuppression (e.g., Taylor, Plant Cell, 9: 1245(1997), Jorgensen, TrendsBiotech, 8 (12): 340-344(1990)), Flavelll, PNAS USA, 91: 3490-96 (Finnegan et al, Bio/Technology, 12: 343 Technology (Neber 88241, Gene,888, 1994); RNA interference (Napoli et al, Plant Cell, 2: 279-289 (1990); U.S. Pat. No.5,034,323; Sharp, GenesDev., 13: 139-141 (1999)); zamore et al, Cell, 101: 25-33 (2000); montgomery et al, PNAS USA, 95: 15502-15507(1998)), virus-induced gene silencing (Burton et al, Plant Cell, 12: 691-705 (2000); baulcombe, curr, op.plant bio, 2: 109-113 (1999)); target RNA-specific ribozymes (Haseloff et al, Nature, 334: 585-591 (1988)); hairpin structures (Smith et al, Nature, 407: 319-320 (2000); U.S. Pat. Nos. 6,423,885, 7,138,565, 6,753,139 and 7,713,715); MicroRNA (Aukerman & Sakai, plant cell, 15: 2730-; ribozymes (Steinecke et al, EMBO J., 11: 1525 (1992); Perriman et al, Antisense Res. Dev., 3: 253 (1993)); oligonucleotide-mediated targeted modification (e.g., U.S. patent nos. 6,528,700 and 6,911,575); zn refers to targeting molecules (e.g., U.S. patent nos. 7,151,201, 6,453,242, 6,785,613, 7,177,766, and 7,788,044); and other methods known to those skilled in the art or combinations of the above.

Mutation breeding is another approach to disrupting one or more negative regulatory genes in the rebaudioside a to rebaudioside M switch pathway. Spontaneously occurring or artificially induced mutations may be a useful source of variation for plant breeders. The goal of artificial mutagenesis is to increase the mutation rate of the desired feature. The mutation rate can be increased by a number of different means including temperature, long term seed storage, tissue culture conditions, ionizing radiation (e.g. X-rays, gamma rays (e.g. cobalt 60 or caesium 137)), neutrons (nuclear fission products of uranium 235 in an atomic reactor), beta radiation (emitted from radioisotopes (e.g. phosphorus 32 or carbon 14)), or ultraviolet radiation (preferably 2500 to 2900 nanometers); chemical mutagens (e.g., base analogs (5-bromo-uracil)), related compounds (8-ethoxycaffeine), antibiotics (streptonigrin), alkylating agents (sulfur mustard, nitrogen mustard, epoxides, vinylamines, sulfates, sulfonates (e.g., ethyl methanesulfonate), sulfones, lactones), sodium azide, hydroxylamine, nitrous acid, methylnitrosourea (methylnitrilsourea), or acridine; TILLING (targeted induced local damage in genome), in which mutations are induced by chemical mutagens and mutagenesis is accompanied by isolation of chromosomal DNA from each mutated plant line or seed and screening of the seed or plant population at the DNA level using advanced molecular techniques; zinc finger nucleases. Once the desired trait is observed by mutagenesis, it can be incorporated into existing germplasm (germplasm) by traditional breeding techniques. Details of mutation breeding can be found in: sikora, Per et al, "Mutagenesis as a Tool in Plant Genetics, Functional Genomics, and Breeding" International Journal of Plant genomics.2011 (2011); 13 pages; petilino, Joseph F. "Genome editing In plants via designed zinc finger nuclei" In Vitro Cell DevBiol plant.51 (1): pages 1 to 8 (2015); and Daboussi, Fayza et al, "engineering Meganucleare for precision Plant Genome Modification" in Advances in New technology for Targeted Modification of Plant Genome Springer Science + Business, pages 21 to 38 (2015).

Additional methods include, but are not limited to, introducing the expression vector into plant tissue using direct gene transfer methods (e.g., microprojectile-mediated delivery, DNA injection, electroporation, etc.). More preferably, the expression vector is introduced into the plant tissue by using microprojectile-mediated delivery with a biolistic device or by using Agrobacterium-mediated transformation. It is intended that the transformant plants obtained with the protoplasts of the embodiments are within the scope of the embodiments.

Gene editing using CRISPR

Targeted gene editing can be performed using CRISPR/Cas9 technology (Saunders & Joung, Nature Biotechnology, 32, 347-. CRISPR is a class of genome editing systems that represents regularly Interspaced clustered Short Palindromic Repeats (ClusteredRegularly Interspaced Short Palindromic Repeats). The system and CRISPR-associated (Cas) genes enable organisms (e.g., selected bacteria and archaea) to respond to and eliminate invading genetic material. Ishino, Y, et al J.Bacteriol.169, 5429-5433 (1987). These repeats were known in e.coli as early as the 80's in the 20 th century, but Barrangou and colleagues showed that streptococcus thermophilus (s. thermophilus) could gain resistance to bacteriophages by integrating fragments of the infectious viral genome into its CRISPR locus. Barrangou, R. et al Science 315, 1709-. Many plants have been modified using the CRISPR system. See, e.g., Zhang, B et al, "expanding the CRISPR/Cas9 System for Targeted Genome mutagenesis in Petunia" Science Reports, Vol.6, 2016, 2 months.

Gene editing can also be performed using crRNA-guided monitoring systems for gene editing. Additional information on crRNA-guided monitoring complex systems for gene editing can be found in the following documents incorporated by reference in their entirety: U.S. application publication No.2010/0076057 (Sonthheimer et al, Target DNA Interference with crRNA); U.S. application publication No.2014/0179006(Feng, CRISPR-CAS Component Systems, Methods, and communications for Sequence management); U.S. application publication No.2014/0294773(Brouns et al, Modified Cascade Ribonucleus proteins and Uses Thereof); sorek et al, annu, rev, biochem.82: 273-266, 2013; and Wang, S et al, Plant Cell Rep (2015) 34: 1473-1476.

Molecular marker breeding

Molecular markers can also be used during the breeding process to select for qualitative traits. For example, markers closely related to an allele or markers comprising sequences within the actual allele of interest can be used to select plants comprising the allele of interest during a backcross breeding program. Markers can also be used to select for the genome of the recurrent parent and for the genome of the donor parent. The use of this procedure minimizes the amount of genome from the donor parent that remains in the selected plant. It can also be used to reduce the number of rounds of backcrossing the parent required in the backcrossing procedure. The use of molecular markers in the selection process is often referred to as genetic marker enhanced selection. Molecular markers can also be used to identify and exclude certain germplasm sources as ancestor or parental varieties of plants by providing a means to track genetic profiles through crossing. Molecular markers, including markers identified by using techniques such as: isozyme electrophoresis, Restriction Fragment Length Polymorphism (RFLP), Random Amplified Polymorphic DNA (RAPD), random Amplified polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence feature Amplified Region (Sequence Characterized Amplified Region, scarr), Amplified Fragment Length Polymorphism (Amplified Fragment Length Polymorphism, AFLP), Simple Repeat Sequence (SSR), and Single Nucleotide Polymorphism (SNP). See, Vainstein, "Breeding for organization: classical and molecular applications, "Kluwer Academic Publishers (2002).

One use of molecular markers is Quantitative Trait Locus (QTL) mapping. QTL mapping uses markers that are known to be closely related to alleles that have a measurable effect on quantitative traits. Selection during breeding is based on accumulation of markers associated with positive effect alleles and/or elimination of markers associated with negative effect alleles from the plant genome. See, e.g., Fletcher, Richard S et al, "QTL analysis root morphology, marketing time, and yield reviews trade-off in response to precipitation in Brassica napus" Journal of Experimental biology.66 (1): 245-256(2014). QTL markers can also be used during the breeding process to select for qualitative traits. For example, markers closely related to an allele or markers comprising sequences within the actual allele of interest can be used to select plants comprising the allele of interest during a backcross breeding program. Markers can also be used to select for the genome of the recurrent parent and for the genome of the donor parent. The use of this procedure minimizes the amount of genome from the donor parent that remains in the selected plant. It can also be used to reduce the number of rounds of backcrossing the parent required in the backcrossing procedure. The use of molecular markers in the selection process is often referred to as genetic marker enhanced selection. Molecular markers can also be used to identify and exclude certain germplasm sources that are ancestral or parental varieties of plants by providing a means to track genetic profiles through crossing.

Method for detecting SNPs for marker-assisted breeding

In addition to direct or indirect sequencing of sites, SNPs can be detected by a variety of effective methods known in the art, including those described in U.S. Pat. nos. 5,468,613 and 5,217,863; 5,210,015; 5,876,930; 6,030,787, respectively; 6,004,744, respectively; 6,013,431; 5,595,890; 5,762,876, respectively; 5,945,283; 5,468,613; 6,090,558, respectively; 5,800,944 and 5,616,464. In particular, polymorphisms in DNA sequences can be detected by hybridization to allele-specific oligonucleotide (ASO) probes as disclosed in U.S. Pat. nos. 5,468,613 and 5,217,863. The nucleotide sequence of the ASO probe is designed to form perfectly matched hybrids or to contain mismatched base pairs at the sites of variable nucleotide residues. The distinction between matched and mismatched hybrids is based on differences in the thermostability of the hybrids under the conditions used during hybridization or washing, the stability of the hybrids analyzed by denaturing gradient electrophoresis or chemical cleavage at the site of mismatch.

If a SNP creates or destroys a restriction endonuclease cleavage site, it will alter the size or characteristics of the DNA fragment produced by digestion with that restriction endonuclease. Thus, plants with variant sequences can be distinguished from those with the original sequence by restriction fragment analysis. SNPs that can be identified in this way are called "restriction fragment length polymorphisms" ("restriction fragment length polymorphism," RFLP "). RFLP has been widely used in human and plant genetic analysis (Glassberg, UK patent application 2135774; Skolnick et al, cytogen.cell Genet.32: 58-67 (1982); Botstein et al, Ann.J.Hum.Genet.32: 314-.

An alternative method for determining SNPs is based on Cleaved Amplified Polymorphic Sequences (CAPS) (Konieczny, A. and F.M.Ausubel, Plant J.4: 403-; lyamichev et al, Science 260: 778-783(1993) A modified form of CAP known as dCAP is a technique for detecting Single Nucleotide Polymorphisms (SNPs). dCAPS technique introduces or destroys restriction enzyme recognition sites by using primers containing one or more mismatches to the template DNA, and then restriction enzyme digestion of the PCR product modified in this manner, this technique can be used to genotype known mutations and genetic maps of isolated DNA (Neff MM, Neff JD, chord J, Pepper AE. dCAPS, a single technical analysis for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. plant J.1998May, 14 (3): 387-92).

SNPs can also be identified by Single Strand Conformation Polymorphism (SSCP) analysis. SSCP technology is a method that can recognize most sequence variations (usually 150 to 250 nucleotides long) in single-stranded DNA (Elles, Methods in Molecular Medicine: Molecular diagnostics of genetic Diseases, Humana Press (1996); Orita et al, Genomics 5: 874-.

SNPs can also be detected using a DNA fingerprinting technique called Amplified Fragment Length Polymorphism (AFLP), which is based on selective PCR amplification of restriction fragments from total digests of genomic DNA to delineate the DNA. Vos et al, Nucleic acids sRs.23: 4407-4414(1995). This method allows for the specific co-amplification of many restriction fragments, which can be analyzed without knowledge of the nucleic acid sequence. AFLP essentially takes three steps. Initially, a genomic DNA sample is cut with a restriction enzyme and oligonucleotide adaptors are ligated to restriction fragments of DNA. The restriction fragments are then amplified using PCR by using the adaptors and restriction sequences as target sites for primer annealing. Selective amplification is achieved by using primers that extend into the restriction fragments, only those fragments in which the primer extension matches the nucleotides flanking the restriction site are amplified. These amplified fragments are then visualized on denaturing polyacrylamide gels (Beismann et al, mol. Ecol. 6: 989-993 (1997); Janssen et al, int. J. Syst. Bacteriol 47: 1179-1187 (1997); Huys et al, int. J. Syst. Bacteriol. 47: 1165-1171 (1997); McCouch et al, Plant mol. biol. 35: 89-99 (1997); Nandi et al, mol. Gen. Genet. 255: 1-8 (1997); Cho et al, Genome 39: 378-373 (1996); Simons et al, Genomics 44: 61-70 (1997); Cnops et al, mol. Genet. 253: 32-41 (1996); Thomas et al, Plant J. 8: 785-794 (1995)).

SNPs can also be detected using Random Amplified Polymorphic DNA (RAPD) (Williams et al, Nucl. acids sRs.18: 6531-6535 (1990)).

SNPs can be identified by methods such as those described in U.S. patent nos. 5,210,015; 5,876,930 and 6,030,787, wherein an oligonucleotide probe having a reporter molecule and a quencher molecule is hybridized to the target polynucleotide. The probe is degraded by the 5 '→ 3' exonuclease activity of the nucleic acid polymerase.

SNPs can also be identified by methods such as U.S. patent No.6,004,744; 6,013,431; 5,595,890; 5,762,876, respectively; and labeled base extension as disclosed in U.S. Pat. No.5,945,283. These methods are based on primer extension and incorporation of detectable nucleoside triphosphates. The primers are designed to anneal to the sequence immediately adjacent to the variable nucleotide, which can be detected after incorporation of as few as one labeled nucleoside triphosphate. U.S. Pat. No.5,468,613 discloses allele-specific oligonucleotide hybridization in which single or multiple nucleotide variations in a nucleic acid sequence can be detected in a nucleic acid by: wherein a sequence comprising a nucleotide variation is amplified, spotted on a membrane and treated with a labeled sequence specific oligonucleotide probe.

In addition to those described above, other methods for identifying and detecting SNPs include the use of restriction enzymes (Botstein et al, am. J. hum. Genet.32: 314-331(1980), and Konieczny and Ausubel, Plant J.4: 403-410(1993)), enzymatic and chemical mismatch assays (Myers et al, Nature 313: 495-498(1985)), allele-specific PCR (Newton et al, Nucl. acids Res.17: 2503-2516 (1989)), and Wu et al, Proc. Natl. Acad. Sci.USA 86: 2757-2760(1989)), ligase chain reaction (Barany, Proc. Natl. Acad. Sci.USA 88: 189-193(1991)), polymorphic analysis (Labrune et al, Am. J.hum. Hum. 1115.48: 1991)), single-strand polymorphism primers (Sappwa. Sci. USA 88: 853, Biopsne et al, U.S.S.S.2784 (1989), and Single-DNA, Biopsne et al, Biopst. Sci.11, Biopsne et al, Biopst. Sci.32, Biopst. Sci.11, Biopst. 1989, and DNA, PCR (1989), and DNA, PCR, Biopst. SEQ ID. 1989), and DNA, PCR, SEQ ID No. 11, genomics 13: 441-: 357, 362(1995)), 5' -nuclease allele-specific hybridization TAQMAN assay (Livak et al, Nature genet.9: 341 (1995)), template-directed dye-terminator incorporation (TDI) assay (Chen and Kwok, nucleic acids res.25: 347-353(1997)), allele-specific molecular beacon assay (Tyagi et al, Nature biotech.16: 49-53(1998), PinPoint assay (Haff and Smimov, Genome Res.7: 378-388(1997)), dCAPS assay (neffetal, Plant j.14: 387-392(1998)), pyrosequencing (Ronaghi et al, Analytical Biochemistry 267: 65-71 (1999); ronaghi et al, PCT application WO 98/13523; and Nyren et al, PCT application WO 98/28440), using mass spectrometry such as MASSCODE systems (Howbert et al, WO 99/05319; howber et al WO 97/27331), mass spectrometry (U.S. Pat. No.5,965,363, invasive cleavage of oligonucleotide probes (Lyachev et al, Nature Biotechnology 17: 292-.

Although certain methods for detecting SNPs are described herein, other detection methods may be used. For example, further methods are known and set forth in the following documents: birren et al, Genome Analysis, 4: 135-; malaga et al, Methods in Plant Molecular biology, Laboratory Corse Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1995); paterson, Biotechnology Intelligence Unit: genome Mapping in plants, R.G.Landes Co., Georgetown, Tex., and Academic Press, San Diego, Calif. (1996); the Maize Handbook, Freeling and Walbot eds., Springer-Verlag, New York, N.Y. (1994); methods in Molecular Medicine: molecular diagnostics of genetic diseases, Ellesed., Humana Press, Totowa, N.J. (1996); clark ed., Plant Molecular Biology: ALabortory Manual, Clark ed., Springer-Verlag, Berlin, Germany (1997).

Methods for detecting and measuring steviol glycosides

Steviol glycosides can be detected and measured using HPLC. The following scheme is one example.

For HPLC analysis, stevia leaf samples were air dried/oven dried and then ground to a fine powder using a pestle and mortar. For each sample, leaf powder (100mg) was extracted with 15ml of distilled water at 60 ℃ for 18 hours. The mixture was centrifuged and the supernatant was filtered and collected for analysis of steviol glycoside composition by HPLC (Agilent, USA). Analysis of steviol glycosides was performed using Agilent Technologies 1200 series (USA) HPLC equipped with Agilent Poroshell 120 SB-C182.7 μm, 4.6X 150 mm. An array of diodes set at 210nm was used as the detector. Reference standards for all glycosides, including rebaudioside E, RebD, RebM, rebaudioside N, and rebaudioside O, were purchased from ChromaDex Inc (USA). The following methods were used to analyze rebaudioside e (rebe), RebD, RebM, rebaudioside n (rebn), and rebaudioside o (rebo): column temperature: 40 ℃, mobile phase: solvent a10mM sodium dihydrogen phosphate pH 2.6: acetonitrile, 75%: 25% (v/v), solvent B water acetonitrile, 50%: 50% (v/v), gradient program% v/v: 100% a and 0% B at 0.0 and 14.0 minutes, 100% B and 0% a at 14.5 and 25.0 minutes, flow: 0.5 mL/min, injection: 5 μ L, autosampler temperature: the ambient temperature. Except that the mobile phase was made up of an isocratic 10mM sodium dihydrogen phosphate pH 2.6: rebaudioside a (reba), stevioside (Stev), rebaudioside f (rebf), rebaudioside c (rebc), Dulcoside a (Dulcoside a, DulA), Rubusoside (Rub), rebaudioside b (rebb), and steviolbioside (Stev) were analyzed using the same method as above, except that acetonitrile, 68%: 32% (v/v), the flow rate was 1.0 mL/min, and the run time was 20 minutes.

In addition to HPLC, steviol glycosides can be detected and measured by a number of methods well known in the art.

Alternative methods of breeding

There are many steps in the development of any desired plant germplasm. Plant breeding begins with the analysis and definition of current germplasm problems and disadvantages, the formulation of planning goals, and the definition of specific breeding goals. The next step is to select germplasm with traits that meet the planned goals. The goal is to combine improved combinations of desired traits from parent germplasm in a single cultivar. In stevia, important traits are leaf yield, precocity, improved leaf quality, rebaudioside content, stevioside content, resistance to disease and insect pests, resistance to drought and heat, and improved agronomic traits. The choice of breeding or selection method depends on the mode of plant propagation, the heritability of the trait being improved, and the type of cultivar used commercially (e.g., F1 hybrid cultivars, inbred cultivars, etc.). For highly heritable traits, selection to evaluate good quality individual plants at a single location would be effective, whereas for traits with low heritability, selection should be based on averages obtained from repeated evaluations of related plant families. Popular selection methods typically include pedigree selection, improved pedigree selection, weight selection (mass selection), and recurrent selection.

The complexity of inheritance affects the choice of breeding methods. Backcross breeding is used to transfer one or some favorable genes of a highly heritable trait into a desired cultivar. The method has been widely used for breeding disease-resistant cultivars. A variety of recurrent selection techniques are used to improve quantitative genetic traits controlled by a number of genes. The use of recurrent selection in self-pollinated crops depends on the ease of pollination, the frequency of successful crosses per pollination, and the number of progeny of each successful cross.

Each breeding program should include a regular, objective assessment of the efficiency of the breeding operation. Evaluation criteria vary according to goals and purposes, but should include annual revenue from selection based on comparisons with appropriate criteria, the overall value of advanced breeding lines, and the number of successful cultivars produced per unit investment (e.g., annually, dollars per consumption, etc.).

Promising advanced breeding lines were fully tested and compared for three or more years with popular cultivars in an environment representing a commercial target area. Lines that are superior to popular cultivars are candidates for new commercial cultivars. Those lines that still lack some traits are discarded or used as parents to create new populations for further selection.

These processes, which result in the final step of marketing and distribution, typically take 7 to 12 years from the start of the first cross. Therefore, developing new cultivars is a time consuming process requiring accurate prospective planning, efficient use of resources, and minimal changes in direction.

The most difficult task is to identify genetically superior individuals, since for most traits the true genotype values are masked by other confounding plant traits or environmental factors. One way to identify elite plants is to observe their performance relative to other experimental lines and widely cultivated standard cultivars. For many traits, a single observation is uncertain and requires repeated observations in time and space to provide a good estimate of the genetic value of the line.

The goal of commercial stevia breeding programs is to develop new, unique and superior stevia cultivars. Breeders initially select and cross two or more parental lines, followed by generational evolution and selection, resulting in many new genetic combinations. By doing so, breeders can theoretically produce billions of different genetic combinations. Breeders have no direct control over which genetic combinations will occur in the limited population size they cultivate. Thus, two breeders will never develop the same line with the same trait.

Each year, plant breeders select germplasm to advance to the next generation. The germplasm is grown under unique and different geographical, climatic and soil conditions and is then further selected during and at the end of the growing season. The developed lines are unpredictable. This unpredictability is because the breeder's selection occurs in a unique environment, there is no control at the DNA level (using conventional breeding operations), and millions of different possible genetic combinations are generated. The breeding person of ordinary skill in the art cannot predict the final resultant line he developed, except perhaps in a very rough and general manner. By using exactly the same original parent and the same selection technique, the same breeder cannot produce the same cultivar twice with any reasonable probability. This unpredictability leads to a large expenditure of research capital for the development of superior new stevia cultivars.

Pure cultivars of stevia rebaudiana are typically propagated by crossing two or more parents and then selecting for selection. Genetic complexity, breeding goals, and available resources all affect breeding methods. Pedigree breeding, recurrent selective breeding and backcross breeding are breeding methods commonly used for self-pollinating crops (e.g., stevia). These methods involve ways in which breeding pools or populations are prepared to combine desired traits from two or more cultivars or a wide variety of sources. The procedures commonly used to select a desired individual or population of individuals are known as weight selection, plant-to-row selection (plant-to-row selection), and single seed descent (single seed determination) or modified single seed descent. One or a combination of these selection methods may be used to develop cultivars from breeding populations.

Pedigree breeding is primarily used to synthesize advantageous genomes into completely new cultivars that differ in many traits from either parent used in the original cross. It is commonly used to improve self-pollinated crops. Crossing two parents having favorable complementary traits to produce F₁(next generation). By making F₂Plant selfing to produce F₂And (4) a group. It is expected that selection of individual plants may occur as early as possible thereinF of maximum Gene isolation₂The generation starts. Individual plant selection may occur for one or more generations. Next, seeds from each selected plant can be planted in a separate, identified row or mountain, called a progeny row (progeny row) or progeny mountain (progeny hill), to evaluate the line and increase seed number, or to further select individual plants. Once a progeny row or mountain with the desired trait is selected, it becomes a so-called breeding line, which can be specifically identified from other breeding lines derived from the same original population. In advanced generation (i.e., F)₅Or higher), individual lines are evaluated for seed in duplicate tests. At an advanced stage, a mixture of best lines or phenotypically similar lines from the same original cross is tested as potential release for a new cultivar.

Single seed-borne operations in the strict sense refer to planting segregating populations, harvesting one seed from each column of plants, and combining these seeds in batches (bulk), which are planted as the next generation. When the population has progressed to the desired level of inbreeding, the plants of the line from which they were derived will track to different F's, respectively₂(ii) an individual. The main advantage of single seed breeding operations is to delay selection until a high level of homozygosity (e.g., lack of gene segregation) is achieved in a single plant and to quickly pass through these early generations, typically by using a winter nursery.

Improved single seed-borne procedures involve harvesting multiple seeds (i.e., single locks or simple bells) from each plant in a population and combining them to form a batch. One part of the batch is used for planting the next generation and one part is used for stocking. This operation has been used to save labor and maintain adequate population seed numbers at harvest.

The selection of the desired trait may be in any isolated generation (F)₂And higher) occurs. Selection pressure is applied to a population by growing the population in an environment that maximally expresses a desired trait and individuals or lines having that trait can be identified. For example, when a plant or line is grown in a naturally or artificially induced disease environment, selection for disease resistance can be performed, and the breeder simply selects little or no diseaseThose individuals who are diseased and therefore considered to be resistant.

Method for determining stevia rebaudiana genotype

In addition to phenotypic observations, the genotype of a plant can also be detected. There are many laboratory-based techniques available for the analysis, comparison and characterization of plant genotypes. These include isozyme electrophoresis, Restriction Fragment Length Polymorphism (RFLP), random amplified polymorphic DNA (rapd), arbitrary primer polymerase chain reaction (AP-PCR), DNA amplification fingerprinting technology (DAF), sequence feature amplified region (scarr), Amplified Fragment Length Polymorphism (AFLP), simple repeat sequences (SSR-also known as microsatellites), and Single Nucleotide Polymorphism (SNP).

Isoenzyme electrophoresis and RFLP have been widely used to determine genetic composition. Molecular linkage Maps consisting of 25 linkage groups of about 365 RFLPs, 11 RAPDs, 3 classical markers and 4 isozyme loci were developed by Shoemaker and Olsen, (molecular linkage Map of Soybean (Glycine max L. Merr.), pages 6.131 to 6.138, SJ O' Brien (eds.) Genetic Maps: Locus Maps of Complex Genomes, Cold Spring Harbor laboratory Press, Cold Spring Harbor, N.Y. (1993)). See also, Shoemaker, R.C., RFLP Map of Soybean, pages 299 to 309, in Phillips, R.L., and Vasil, I.K (Eds.), DNA-Based Markers in Plants, Kluwer Academic Press, Dordrecht, the Netherlands (1994).

The SSR technology is the most efficient and practical marking technology at present; more marker loci can be routinely used compared to RFLP, and SSR can be used to find more alleles per marker locus. For example, Diwan and Cregan describe highly polymorphic microsatellite loci with up to 26 alleles in soybean. Diwan, n. and Cregan, p.b., the door.appl.genet., 95: 22-225(1997). Additional SNPs to those described herein can also be used to identify the unique genetic composition of the present invention and progeny varieties that retain the unique genetic composition. Multiple molecular labeling techniques can be used in combination to enhance overall resolution.

Molecular markers including markers identified by using techniques such as isozyme electrophoresis, RFLP, RAPD, AP-PCR, DAF, SCAR, AFLP, SSR, and SNP are useful for plant breeding. One use of molecular markers is Quantitative Trait Locus (QTL) mapping. QTL mapping is the use of markers that are known to be closely related to alleles that have a measurable effect on quantitative traits. Selection during breeding is based on accumulation of markers associated with positive effect alleles and/or elimination of markers associated with negative effect alleles from the plant genome.

Molecular markers can also be used during the breeding process to select for qualitative traits. For example, markers that are closely related to alleles or markers comprising sequences within the actual allele of interest can be used to select plants comprising the allele of interest during a backcross breeding program. For example, molecular markers are used in soybean breeding to select for traits that are resistant to soybean cyst nematode (soybean cyst nematode), see U.S. Pat. No.6,162,967. Markers can also be used to select for the genome of the recurrent parent and for the marker of the donor parent. The use of this procedure minimizes the amount of genome from the donor parent that remains in the selected plant. It can also be used to reduce the number of rounds of backcrossing the parent required in the backcrossing procedure. The use of molecular markers in the selection process is often referred to as genetic marker enhanced selection. Molecular markers can also be used to identify and exclude certain germplasm sources as ancestor parent varieties of plants by providing a means to track genetic profiles by crossing, as discussed more fully below.

Further embodiments

With the advent of molecular biology techniques that allow the isolation and characterization of genes encoding specific protein products, scientists in the field of plant biology have generated a great deal of interest in designing plant genomes to contain and express exogenous genes or, in addition or modified form, native or endogenous genes (possibly driven by different promoters) in order to alter the traits of plants in a specific way. Such exogenous additional and/or modified genes are collectively referred to herein as "transgenes". In the last fifteen to twenty years, several methods for producing transgenic plants have been developed, in some specific embodiments, also involving transformed forms of the claimed cultivars.

Plant transformation involves the construction of expression vectors that will function in plant cells. Such vectors comprise DNA comprising a gene under the control of, or operably linked to, a regulatory element (e.g., a promoter). An expression vector may comprise one or more such operably linked gene/regulatory element combinations. The vector may be in the form of a plasmid and may be used alone or in combination with other plasmids to provide transformed stevia plants, the transgene being incorporated into the genetic material of the stevia plant using the transformation method described below.

Expression vector for stevia transformation: marker gene

The expression vector includes at least one genetic marker operably linked to a regulatory element (e.g., a promoter) that allows recovery of transformed cells containing the marker by negative selection (i.e., inhibition of growth of cells that do not contain the selectable marker gene) or by positive selection (i.e., screening for the product encoded by the genetic marker). Many common selectable marker genes for plant transformation are known in the transformation art and include, for example, genes encoding enzymes that metabolically detoxify selective chemical agents, which may be antibiotics or herbicides, or genes encoding altered targets that are not sensitive to inhibitors. Some positive selection methods are also known in the art.

One commonly used selectable marker gene for plant transformation is neomycin phosphotransferase ii (nptii), which confers resistance to kanamycin under the control of plant regulatory signals. Fraley et al, PNAS, 80: 4803(1983). Another commonly used selectable marker gene is the hygromycin phosphotransferase gene, which confers resistance to the antibiotic hygromycin. VandenElzen et al, Plant mol. biol., 5: 299(1985).

Additional selectable marker genes of bacterial origin that confer resistance to antibiotics include gentamycin acetyltransferase, streptomycin phosphotransferase and aminoglycoside-3' -adenyltransferase, i.e., the bleomycin resistance determinant. Hayford et al, Plant Physiol., 86: 1216 (1988); jones et al, mol.gen.genet, 210: 86 (1987); svab et al, plantamol. biol., 14: 197 (1990); hille et al, Plant mol biol., 7: 171(1986). Other selectable marker genes confer resistance to herbicides (e.g., glyphosate, glufosinate, or bromoxynil). Comai et al, Nature, 317: 741-744 (1985); Gordon-Kamm et al, Plant Cell, 2: 603-618 (1990); and Stalker et al, Science, 242: 419-423(1988).

Other selectable marker genes for plant transformation of non-bacterial origin include, for example, mouse dihydrofolate reductase, plant 5-enolpyruvyl-shikimate-3-phosphate synthase and plant acetolactate synthase. Eichholtz et al, SomaticCell mol. gene, 13: 67 (1987); shah et al, Science, 233: 478 (1986); charest et al, Plant cellrep, 8: 643(1990).

Another class of marker genes used for plant transformation requires selection of putatively transformed plant cells rather than direct genetic selection of transformed cells for resistance to toxic substances (e.g., antibiotics). These genes are particularly useful for quantifying or visualizing the spatial pattern of gene expression in a particular tissue, and are often referred to as reporter genes, as they can be fused to genes or gene regulatory sequences to study gene expression. Common genes used to screen for putatively transformed cells include β -Glucuronidase (GUS), β -galactosidase, luciferase and chloramphenicol acetyltransferase. Jefferson, r.a., Plant mol.biol.rep., 5: 387 (1987); teeri et al, EMBO j., 8: 343 (1989); koncz et al, PNAS, 84: 131 (1987); DeBlock et al, EMBO J.3: 1681(1984).

In vivo methods are available for visualizing GUS activity without the need to destroy plant tissues. Molecular probes Publication 2908, IMAGENE GREEN, pages 1 to 4(1993) and Naleway et al, j.cell biol., 115: 151a (1991). However, these in vivo methods for visualizing GUS activity have not proven useful for recovering transformed cells due to low sensitivity, high fluorescence background, and limitations associated with using luciferase genes as selectable markers. Genes encoding Green Fluorescent Protein (GFP) have been used as markers for gene expression in prokaryotic and eukaryotic cells. Chalfie et al, Science, 263: 802(1994). GFP and GFP mutants can be used as screenable markers.

Expression vector for stevia transformation: promoters

The gene contained in the expression vector must be driven by a nucleotide sequence containing a regulatory element (e.g., a promoter). Several types of promoters are currently known in the transformation art, as are other regulatory elements that may be used alone or in combination with a promoter.

As used herein, "promoter" includes reference to a region of DNA upstream from the initiation of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in a plant cell. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids (tracheids), or sclerenchyma. Such promoters are referred to as "tissue-preferred". Promoters that initiate transcription only in certain tissues are referred to as "tissue-specific". A "cell-type" specific promoter primarily drives the expression of certain cell types in one or more organs, e.g., vascular cells in roots or leaves. An "inducible" promoter is a promoter that is under environmental control. Examples of environmental conditions that may affect transcription through inducible promoters include anaerobic conditions or the presence of light. Tissue-specific, tissue-preferred, cell-type specific and inducible promoters constitute a class of "non-constitutive" promoters. A "constitutive" promoter is a promoter that is active under most environmental conditions.

A.Inducible promoters：

The inducible promoter is operably linked to a gene for expression in stevia. Optionally, the inducible promoter is operably linked to a nucleotide sequence encoding a signal sequence operably linked to a gene for expression in stevia. For inducible promoters, the rate of transcription increases in response to an inducing agent.

Any inducible promoter can be used in the present invention. See Ward et al, Plant mol. biol., 22: 361-366(1993). Exemplary inducible promoters include, but are not limited to, promoters from the ACEI system that respond to copper (Mett et al, PNAS, 90: 4567-4571 (1993)); in2 gene from maize In response to a benzenesulfonamide herbicide safener (Hershey et al, mol.Gen.Genet., 227: 229-237(1991) and Gatz et al, mol.Gen.Genet., 243: 32-38 (1994)); or the Tet repressor from Tn10 (Gatz et al, mol.Gen.Genet., 227: 229-237 (1991)). An example of an inducible promoter is a promoter that responds to an inducer to which a plant does not normally respond. An exemplary inducible promoter is an inducible promoter from the steroid hormone gene, whose transcriptional activity is induced by glucocorticoids (Schena et al, PNAS, 88: 0421 (1991)).

B.Constitutive promoter:

the constitutive promoter is operably linked to a gene for expression in stevia or the constitutive promoter is operably linked to a nucleotide sequence encoding a signal sequence operably linked to a gene for expression in stevia.

Many different constitutive promoters are useful in the present invention. Exemplary constitutive promoters include, but are not limited to, promoters from plant viruses, such as the 35S promoter from CaMV (Odell et al, Nature, 313: 810-812(1985)) and promoters from genes such as rice actin (rice actin). (McElroy et al, Plant Cell, 2: 163-171 (1990)); ubiquitin (Christensen et al, Plant mol. biol., 12: 619-632(1989) and Christensen et al, Plant mol. biol., 18: 675-689 (1992)); pEMU (Last et al, the or. appl. Gene. 81: 581-588 (1991)); MAS (Velten et al, EMBO J., 3: 2723-2730 (1984)); and maize H3 histone (Lepetit et al, mol. Gen. Genet., 231: 276-.

The ALS promoter, the XbaI/NcoI fragment 5' of the Brassica napus (Brassica napus) ALS3 structural gene (or a nucleotide sequence similar to the XbaI/NcoI fragment) represents a particularly useful constitutive promoter. See PCT application No. wo 96/30530.

C.Tissue-specific or tissue-preferred promoters：

The tissue-specific promoter is operably linked to a gene for expression in stevia. Optionally, the tissue-specific promoter is operably linked to a nucleotide sequence encoding a signal sequence operably linked to a gene for expression in stevia. Plants transformed with a gene of interest operably linked to a tissue-specific promoter produce the transgenic protein product only in, or preferentially in, a particular tissue.

Any tissue-specific or tissue-preferred promoter may be used in the present invention. Exemplary tissue-specific or tissue-preferred promoters include, but are not limited to: root-preferred promoters, for example from the phaseolin (phaseolin) gene (Murai et al, Science, 23: 476-482(1983) and Sengutta-Gopalan et al, PNAS, 82: 3320-3324 (1985)); leaf-specific and light-inducible promoters, for example from cab or rubisco (Simpson et al, EMBOJ., 4 (11): 2723-2729(1985) and Timko et al, Nature, 318: 579-582 (1985)); an anther-specific promoter, such as the promoter from LAT52 (Twell et al, mol.Gen.Genet., 217: 240-245 (1989)); pollen-specific promoters, such as the promoter from Zm13 (Guerrero et al, mol.Gen.Genet., 244: 161-168 (1993)); or microspore-preferred promoters, such as those from apg (Twell et al, Sex. plant repeat., 6: 217-224 (1993)).

Signal sequences for targeting proteins to subcellular compartments

Transport of the transgenically produced protein into a subcellular compartment, such as a chloroplast, vacuole, peroxisome, glyoxylate cycle (glyoxysome), cell wall or mitochondria, or for secretion into the apoplast (apoplast), is achieved by operably linking a nucleotide sequence encoding a signal sequence to the 5 'and/or 3' region of the gene encoding the protein of interest. During protein synthesis and processing, targeting sequences at the 5 'and/or 3' end of the structural gene can determine where the encoded protein is ultimately compartmentalized.

The presence of the signal sequence directs the polypeptide to an intracellular organelle or subcellular compartment or for secretion to the apoplast. Many signal sequences are known in the art. See, e.g., Becker et al, Plant mol. biol, 20: 49 (1992); close, P.S., Master's Thesis, Iowa State University (1993); knox, c, et al, Plant mol. biol, 9: 3-17 (1987); lerner et al, Plant physiol, 91: 124-129 (1989); fontes et al, Plant Cell, 3: 483-496 (1991); matsuoka et al, PNAS, 88: 834 (1991); gould et al, j.cell.biol., 108: 1657 (1989); creissen et al, Plant J., 2: 129 (1991); kalderon et al, Cell, 39: 499-509 (1984); steifel et al, Plant Cell, 2: 785-793(1990).

Process for stevia conversion

A number of methods for plant transformation have been developed, including biological and physical plant transformation protocols. See, e.g., Mild et al, "Procedures for Introducing Foreign DNA into Plants" in Methods in plant Molecular Biology and Biotechnology, Glick and Thompson (Eds.), CRC Press, Inc., Boca Raton, pages 67 to 88 (1993). In addition, expression vectors and in vitro culture methods for plant cell or tissue transformation and plant regeneration are available. See, e.g., Gruber et al, "Vectors for Plant Transformation" in Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson (Eds.), CRC Press, Inc., Boca Raton, pages 89-119 (1993).

A.Agrobacterium-mediated transformation:

one method for introducing expression vectors into plants is based on natural Agrobacterium transformation systems. See, e.g., Horsch et al, Science, 227: 1229(1985). Agrobacterium tumefaciens (a. tumefaciens) and agrobacterium rhizogenes (a. rhizogenes) are phytopathogenic soil bacteria that genetically transform plant cells. The Ti and Ri plasmids of Agrobacterium tumefaciens and Agrobacterium rhizogenes carry genes responsible for genetic transformation of plants, respectively. See, e.g., Kado, c.i., crit.rev.plantansci, 10: 1(1991). Description of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are described by Gruber et al, supra, Miki et al, supra, and Moloney et al, Plant Cell Rep, 8: 238 (1989). See also U.S. Pat. No.5,563,055(Townsend and Thomas) issued 10, 8, 1996.

B.Direct gene transfer:

several methods of plant transformation, collectively referred to as direct gene transfer, have been developed as alternatives to agrobacterium-mediated transformation. A commonly applicable plant transformation method is microprojectile-mediated transformation, in which DNA is carried on the surface of 1 μm to 4 μm microprojectiles. The expression vector is introduced into plant tissue using a biolistic device that accelerates microparticles to a velocity of 300m/s to 600m/s, which is sufficient to penetrate plant cell walls and membranes. Sanford et al, part.sci.technol., 5: 27 (1987); sanford, j.c., Trends biotech, 6: 299 (1988); klein et al, Bio/technology, 6: 559-563 (1988); sanford, j.c., Physiol Plant, 7: 206 (1990); klein et al, Bio/technology, 10: 268(1992). See also U.S. Pat. No.5,015,580 issued 5/14 1991 (Christou et al); U.S. Pat. No.5,322,783 issued on 21/6/1994 (Tomes et al).

Another method for the physical delivery of DNA to plants is sonication of target cells. Zhang et al, Bio/technology, 9: 996(1991). Alternatively, liposome and spheroplast fusions have been used to introduce expression vectors into plants. Deshayes et al, EMBO j., 4: 2731 (1985); christou et al, PNAS, 84: 3962(1987). The use of CaCl is also reported₂Precipitation, polyvinyl alcohol or poly-L-ornithine directly uptake DNA into protoplasts. Hain et al, mol.gen.genet., 199: 161(1985) and Draper et al, Plant Cell physiol.23: 451(1982). Electroporation of protoplasts and whole cells and tissues is also described. Donn et al, In Abstracts of VIIth International consistency on Plant Cell and Tissue Culture IAPTC, A2-38, p.53 (1990); d' Halluin et al, Plant Cell, 4: 1495-; and Spencer et al, Plant mol. biol., 24: 51-61(1994).

Following transformation of stevia target tissues, expression of the above selectable marker genes allows for preferential selection of transformed cells, tissues and/or plants using regeneration and selection methods currently known in the art.

The foregoing methods for transformation will generally be used to produce transgenic varieties. The transgenic variety can then be crossed with another (untransformed or transformed) variety to produce a new transgenic variety. Alternatively, a genetic trait that has been engineered into a particular stevia cultivar using the aforementioned transformation techniques can be transferred into another cultivar using traditional backcrossing techniques that are well known in the plant breeding art. For example, backcrossing methods can be used to transform engineered traits from public, non-elite varieties to elite varieties, or from varieties that contain foreign genes in their genomes to varieties that do not contain the genes. "hybridization" as used herein may refer to a simple X Y hybridization, or the process of backcrossing, depending on the context.

C.Single gene conversion

When the term "stevia plant" is used herein, this also includes any single gene conversion of the variety. The term "single gene transformed plant" as used herein refers to those stevia plants developed by a plant breeding technique known as backcrossing, wherein substantially all of the desired morphological and physiological characteristics of the variety are restored except for the single gene that is transferred into the variety by the backcrossing technique. Backcrossing methods may be used herein to improve or introduce characteristics into the variety. The term "backcross" as used herein refers to the repeated crossing of the progeny of a cross back to the recurrent parent, i.e., backcrossing 1,2, 3,4, 5,6, 7,8, 9, or more times to the recurrent parent. Parent stevia plants that contribute genes to a desired trait are referred to as "non-recurrent" or "donor parents". The term refers to the fact that the non-recurrent parent is used once in the backcrossing scheme and thus no longer appears. Parent stevia plants that have transferred genes from non-recurrent parents are called recurrent parents because they are used in several rounds of backcrossing protocols (Poehlman & Sleper (1994); Fehr (1987)). In a typical backcrossing scheme, the original variety of interest (recurrent parent) is crossed with a second variety (non-recurrent parent) carrying the single gene of interest to be transferred. The resulting progeny from this cross are then re-crossed to the recurrent parent and the process is repeated until a stevia plant is obtained in which essentially all of the desired morphological and physiological characteristics of the recurrent parent are restored in the transformed plant, except for a single transgene from the non-recurrent parent, as determined at a 5% significance level when cultured under the same environmental conditions.

Selection of the appropriate recurrent parent is an important step in the successful backcrossing operation. The goal of the backcrossing scheme is to alter or replace individual traits or characteristics in the original variety. To accomplish this, individual genes of recurrent varieties are modified or replaced with desired genes from non-recurrent parents, while retaining substantially all of the remaining desired genetic genes, and thus the desired physiological and morphological constitution of the original variety. The choice of a particular non-recurrent parent will depend on the purpose of the backcross. One of the main objectives is to add some commercially desirable, agronomically important traits to plants. The exact backcrossing protocol will depend on the characteristics or traits that are altered to determine the appropriate test protocol. Although the backcrossing process is simplified when the characteristic being transferred is a dominant allele, recessive alleles can also be transferred. In such a case, it may be necessary to introduce a progeny test to determine if the desired feature has been successfully transferred.

Many monogenic traits have been identified which have not been regularly selected in the development of new varieties but which can be improved by backcrossing techniques. A monogenic trait may or may not be transgenic. Examples of such traits include, but are not limited to, male sterility, waxy starch, herbicide resistance, resistance to bacterial, fungal or viral diseases, insect resistance, male fertility, enhanced nutritional quality, industrial use, yield stability and yield improvement. These genes are usually inherited through the nucleus. Some of these monogenic traits are described in U.S. patent No.5,959,185; 5,973,234, respectively; and 5,977,445, the disclosures of which are specifically incorporated herein by reference.

The variety can be further propagated by tissue culture and regeneration. Tissue culture of various tissues of stevia and regeneration of plants therefrom are well known and widely published. For example, reference may be made to Komatsuda, t. et al, Crop sci, 31: 333-337 (1991); stephens, p.a., et al, the or.appl.genet, 82: 633-635 (1991); komatsuda, T.et al, Plant Cell, Tissue and organic Culture, 28: 103-113 (1992); dhir, s. et al Plant Cell rep, 11: 285-289 (1992); pandey, P et al, Japan j. breed, 42: 1-5 (1992); and Shetty, k, et al, plant science, 81: 245-; and U.S. patent No.5,024,944 to Collins et al, 6/18 in 1991 and U.S. patent No.5,008,200 to Ranch et al, 4/16 in 1991. Thus, another aspect of the present invention is to provide cells that, when grown and differentiated, produce stevia plants with high RebD and RebM, as well as the marker SNPs disclosed herein.

The term "tissue culture" as used herein means a composition comprising isolated cells of the same or different types or a collection of such cells organized into a plant part. Exemplary types of tissue cultures are protoplasts, callus tissue, plant clumps (plant cells), and plant cells, which can produce whole tissue cultures in plants or plant parts (e.g., embryos, pollen, flowers, seeds, leaves, stems, roots, root tips, anthers, pistils, etc.). Methods for preparing and maintaining plant tissue cultures are well known in the art. For example, tissue cultures comprising organs have been used to produce regenerated plants. U.S. patent nos. 5,959,185; 5,973,234, respectively; and 5,977,445 describe certain techniques.

Method for extracting and purifying glycosides

Methods for extracting and purifying sweet glycosides from stevia plants using water or organic solvents are described, for example, in U.S. patent nos. 4,361,697; 4,082,858, respectively; 4,892,938, respectively; 5,972,120, respectively; 5,962,678; 7,838,044 and 7,862,845. Methods of extracting RebD are described in U.S. patent No.9,029,426, and extraction of RebM is provided in U.S. application No.14/254,653.

The composition is useful as a sweetness enhancer, flavor enhancer, and sweetener in a variety of food and beverage products. Examples of food and beverage products include, but are not limited to: carbonated soft drinks, ready-to-drink beverages, energy drinks, isotonic drinks, low-calorie drinks, zero-calorie drinks, sports drinks, tea, fruit and vegetable juices, fruit and vegetable juice drinks, dairy drinks, yogurt drinks, alcoholic drinks (alcohol juice), powdered drinks, baked products, cookies (cookies), biscuits (biscuit), baking mixes, cereals, pastries (confectioneries), candies (candy), toffees, chewing gums, dairy products, flavored milks, yoghurts, flavored yoghurts, fermented milks (fermented milks), soy sauce (soy sauce) and other soy based products (soy based products), salad dressings (salad dressing), mayonnaise, vinegar, frozen confections (frozen-desserts), meat products, fish products, bottled and canned foods, table tops, fruits and vegetables. In addition, the composition can be used in pharmaceutical or pharmaceutical formulations and cosmetics, including but not limited to toothpaste, mouthwash, cough syrup, chewable tablets, lozenges (lozenge), vitamin formulations, and the like. The composition can be used "as is" or in combination with other sweeteners, flavoring agents and food ingredients.

While various exemplary aspects and embodiments have been discussed above, those of ordinary skill in the art will recognize certain modifications, permutations (permation), additions and sub-combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.

One or more aspects may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the embodiments is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.

The foregoing discussion of the embodiments has been presented for purposes of illustration and description. The foregoing is not intended to limit the embodiments to the form disclosed herein. In the detailed description of the foregoing examples, various features of the embodiments are grouped together in one or more embodiments for the purpose of streamlining the disclosure. This method of disclosure is not to be interpreted as reflecting an intention that the claimed embodiments require more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus the following claims are hereby incorporated into the detailed description, with each claim standing on its own as a separate preferred embodiment.

Moreover, although the description of an embodiment has included description of one or more embodiments and certain variations and modifications, other variations and modifications are within the scope of the embodiments (e.g., as may be within the skill and knowledge of those in the art, after understanding the present disclosure). It is intended to obtain rights which include alternative embodiments to the extent permitted, including alternate, interchangeable and/or equivalent structures, functions, ranges or acts to those claimed, whether or not such alternate, interchangeable and/or equivalent structures, functions, ranges or acts are disclosed herein, and without intending to publicly dedicate any patentable subject matter.

The terms "a" and "an" and "the" and similar referents in the context of describing the embodiments (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10 to 15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the embodiments and does not pose a limitation on the scope of the embodiments unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of one or more embodiments.

While various exemplary aspects and embodiments have been discussed above, those of ordinary skill in the art will recognize certain modifications, permutations, additions and sub-combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.

Sequence listing

<110> Parsaikoku U.S. Sourcations Co., Ltd. Key Gene

<120> high rebaudioside M stevia plant cultivars and methods for producing the same

<130>PURC.08WOU1

<140>62/468,937

<141>08-03-2017

<160>20

<170>PatentIn version 3.5

<210>1

<211>717

<212>DNA

<213> stevia

<400>1

atgttaggtc cccagtgctg caaaaatcca ccggcaatca gctccggtag ccaacaaaag 60

gatcacatag aagtaatcgg aggcttaaca tcatacacta ccggcaccct tgattctaag 120

cttgctgtca ttttgattgc tgacatattt ggctatgaat ccccaaaact aagacaaatt 180

gctgacaaag ttgcagcagc tggattttat gtagttgtgc ctgatttctt ttatggagat 240

ccttatttac ctcacatgac aataccttca tggtatccta atcatcaacc ggaaaaaggg 300

tgtgaagatg ccagaaaggt agttgctgat ttgaaaagaa aaggagcaac tgcaattgga 360

gttgccggtt tctgttgggg aggtatgttt ttgtcaaaac tgtcgagtta tggtgagatt 420

gatgttgctg ttgtactaca ccctggtcgg ctaacagaag atgatattca agaaacaaaa 480

gtcccaacag caatcttagg tgctgaattt gatgagcatg ctccacctga acaaatgaaa 540

aaattggggg aaattttaac agaaaaatca atagataatt ttgtgaagat ataccctgga 600

gttgatcatg gttggacaac aagatacaaa gatgatgatg aacatgatgt taaaaccgca 660

atggaagcac atgaggacat gttaaattgg cttaaaaaat atcttaaaca aaaatga 717

<210>2

<211>1512

<212>DNA

<213> stevia

<400>2

atgagtggac ctgcatcgga tgatcttcaa ccggaaaccg gttgtctttc agttattgtt 60

ctcggggctt ccggtgatct agccaagaaa aagacgtttc ctgcactctt tcatcttcat 120

cgtcaaggat tcattgcatc acatgatgtc cgtattttcg gttatgcaag aagtaaactg 180

tcggatcaag atttgcgaca ccaacttcgt agatatttga caccatgcaa aggttgtgaa 240

gaaacacacg aggaagatgt atcaaagttt cttcaattga tcaaatatat aagcggcgcg 300

tatgatgctg aggagggatt ccggtcacta aatgatgaaa tatccgcaca cgaaaggtca 360

aaaggcgaca aaggaggacc atacaaaaga ctcttctact ttgcacttcc tccgtccata 420

tatccacccg tttgtaaaat gataaaatgt tgttgcatga gcaaatccga aggtggttgg 480

acacgcgttg ttgttgagaa accttttggc aaagatctga gttcatctga agcattgagt 540

aagcagatag gagaattgtt tgatgaatca caaatctacc gtatcgatca ttacttgggg 600

aaagagttgg tgcagaatct gttggtgtta cgttttgcta atcgattttt cttgccattg 660

tggaaccatg ataatatttc aactgtacag attgtattta aagaggattt tggaactgaa 720

ggtcgtggcg gatattttaa tgaatatgga attattaggg acatacttca aaatcattta 780

ctacaggtgc tttgtttggt tgcaatggag aaacctgttt ctttaaaacc tgaacatatt 840

cgagatgaga aagtgaaggt tctacaatct gttctacaga tcaaagatga tgaagttgtg 900

attggacaat atgaaggcta tacgaatgat cccactgttc ctaaagaatc aaacactccc 960

acttttgcaa caatggtttt aagaattcac aatgaaagat gggaaggtgt tccgtttata 1020

ttgaaagctg gaaaatcaat gaattcaaaa aaagctgaga ttagaatcca atttaaagat 1080

gttcctggtg atatattcac ttcaaagggc aaagggagaa atgagtttgt cattcgattg 1140

caaccttcag aagccattta catgaagcta actgtcaagg agcctgggct ggagatgaaa 1200

actgctcaaa gtgaactaga cttatcatat cgccaaagat atcaagaagt cgttatccca 1260

gaagcatacg aacgtctgat acttgacact attcggggtg atcaacaaca ttttgttcgt 1320

agagatgaac taaaggccgc ttgggagatc tttaccccat tgttgcacaa aatagataac 1380

aacgaaatgc gatcacttcc atataagcca ggaagccggg gcccagagga tgcagataag 1440

ttggctaaaa aggtaggata cgttcaaacc cacggatacg tatggatccc accaacatta 1500

agcgcggttt ag 1512

<210>3

<211>1521

<212>DNA

<213> stevia

<400>3

atgaatctgt atatatccag gggattaatc tcttcaatct ttcatcaaac tatcttatgt 60

tttctagcca tggtttttct aattttattg ttattactga ttttggttcc aatctttttc 120

cttttccatc ataataacaa gcataatcgc caactaccac ctggttcttt aggacttccg 180

gtaattgggc aaagcatcgg ccttttgaag gccttgaagg ccgacagggt cgagaaatgg 240

tttcacgaaa gaataacaaa gcacggtccg gtttggaaag cgagtctttt tggatacccg 300

acggttgtct tgcatggtcc aaccgcgaat aagttcatat acacttgtga cgggaataca 360

cttaccccca cacaaccatc gtcagtcagt aggatcttgg gttccaaaaa tttattagag 420

ttgtcgggca atgatcacaa acgagtcaga tcggctctag tttcgtttct taagcttgaa 480

gtgttgaaac aatatgttgc aaaagtagat gaagaggtcc aacatcacct tctaacccat 540

tggcatggta aacatgaggt ccaggtacaa ccccttatca agatcttaac cttcaacgtc 600

atttgttcgc ttttgtttgg gattgaaaga ggacccaaac gagataattt gctaccactt 660

ttccaagata taattgaagg ggtgttgtca attccaatca atttgccttt cactcaattt 720

aggcgtggta ttatagcaag gaagaaactt gtaccaatga tttcacatat catacgtgag 780

aaaagagagg ctcttaagga acaaaatcaa caaattgact cacataaaga tctaatcaca 840

tcattactta acatttgtga tgatgatggc tcaaaaatta tgtccgaaga tgagatcatt 900

gacaacatca tcattgtgat ggttgcagga tatgacacca cctctgttct tcttaccttc 960

ttggtcaggc ttttggctaa caataaatct atctactctg ctatagttca agaacaacaa 1020

gaaattgcca ataataaagt gtctgaagaa gctttaacat gggaagacct tgcaaagatg 1080

aagtacacat ggagagtagc aactgagatg ttgcggatta tcccacctgt gactttgagc 1140

ttccgacgtg ctaagcaaga tatcacgtat gaaggatttg taattccaaa aggatggcaa 1200

gtgatgttat cggcatccat gacacatagg gatgatagca ttttcaaaaa tccaaccata 1260

tttgatccaa ctcgttttga gaaacatgca ccatcgccac caccatttag ttttgtggca 1320

tttggaggcg ggccaaggat gtgtcctggt attgagcttg caaaaatgga aactttaatc 1380

atgatgcatc gtctcgtgac aagattctct tgggagctac ttgagaaaga tgaatccttc 1440

aagagggttc cattgccaga atttgatcaa gggttgttag ttcaggtgaa gcctttaaaa 1500

ggaagccatg aaggtatgtg a 1521

<210>4

<211>1599

<212>DNA

<213> stevia

<400>4

tccgatctat cagattttag agataagatc tatctcacta tcatcaacaa ctggtcatgg 60

tggtgtaaag tagacaatga aaaagacaag ctttctcgca ccatcctcac catcttagtt 120

ccggttctag tccttgtatg gttcaagtgg acccaatcgt ttatccgaaa tggaaaaaac 180

ccgttaccac caggccccta tggcttaccg gtcgtcggtt accttccgtt tttgagccca 240

aacttacacg aaagattcac cgagatggct caccgatacg gtcctatctt tagcctaagg 300

ctcggaagta agttacatgt tgtggtgaac aacatggagc tagcaaaggt tgtggctcgt 360

gatcttgacc agacctttgc taaccgtagt ccaccgatga cagcactaac catcagttat 420

ggcgcgcttg atatcgcgtg gtccaacaac aacgcgcact ggcgtaacat gcgtaagctt 480

ttagtgagcc aagtgttgag caatgcgaat cttgatgctt gtcaaggttt tagaataaat 540

gaagtcagaa aaaccgttaa taacgtttat gcaaaaatgg ggacaccagt tgatatcaat 600

caaattgcat tcgacacgga acttaacgtt gtaatgaaca tgttatgggg ttgtagtaat 660

gattctggtg attattttca ggggtttcga gaagttgagt tcaagattat agatttattg 720

ggtgtaccaa atatctctga ttttatcccg atgttatcat ggtttgattt gcagggaaga 780

aagaaagata tgcagaagca aaaggaacat cttgatcgga ttttggacca cgtaattgaa 840

gaaagaattg aaagaaactc gagaaaaatg gagggtgagg atgatcgtaa caaggatttt 900

ttgcagatca tgttagagct taaagatcag aaagatggtt catcatcatt tgacatagtt 960

catataaaag ccatgttatt tgacatcttg acagcaacaa cagacacagc atcaacaatg 1020

gtagaatggg tgatggcaga gattttgcat aatccagatg taaaaacaaa gattcaagaa 1080

gaattaaccg aggttatcgg tatggatatt gttcaagaat ctcatctacc caaattaata 1140

tatttggatg cagtagtcaa agagacattc agactacatc ctccacttcc actcttaatc 1200

caaagatgcc cggatgaaac ttgcattgtg gacggatacg cgattccaaa gggtagtatc 1260

gtctatataa atgttcgggc tatacaacac gatccaaaga actggcccga tccattggag 1320

tttaggcccg agagattctt gaaaggaaaa tgggattaca atggaaataa tttgaagttt 1380

ttaccgtttg gatcaggaag aagaatttgt cctggaatcc ctttagggga gaagatgttg 1440

atgtatatat tagcatcact tttgcattct tttgagtgga tcttgcataa agatgaagag 1500

tttgagcttt cagatgagtt tggatttgta accaagaaac ggaaaccact ggttgcaatt 1560

ccttttcaaa gattatcaga tgaaaccctc tacaaatga 1599

<210>5

<211>1431

<212>DNA

<213> stevia

<400>5

atgattcaag ttctaacacc gatccttctc ttcctcattt tcttcgtttt ctggaaggtt 60

tacaagcacc acaaaaccaa aatcaatctt ccaccgggaa gcttcggatg gccatttctg 120

ggcgaaactc tggcactcct acgtgcaggt tgggattcag agccggagag atttgttcgt 180

gaacggatca agaaacacgg aagtcctcta gtgtttaaga cgtcgttgtt tggcgaccgt 240

tttgcggtgt tgtgtggacc tgccggaaac aagttcctgt tctgcaacga gaacaagctg 300

gtggcgtcgt ggtggccggt tccggtgagg aagcttttcg gcaagtctct gctcacgatt 360

cgtggtgatg aagctaagtg gatgaggaag atgttgttat cgtatcttgg tcctgatgct 420

ttcgcaactc attatgccgt cacaatggac gtcgtcaccc gtcggcatat cgacgttcat 480

tggcgaggga aggaagaggt gaacgtattc caaaccgtta agttatatgc ctttgaactt 540

gcatgtcgtt tattcatgaa cctagacgac ccaaaccaca ttgcaaaact cggttccttg 600

ttcaaaattt tcttgaaagg catcattgag cttccaatcg acgtcccagg gacacgattt 660

tatagcgcca aaaaagcagg agcagctatc aggattgaac taaaaaaatt gattaaagca 720

agaaaactgg aactgaaaga agggaaggca tcatcttcac aagacctctt atcacatttg 780

cttacatctt cagatgaaaa tggtatgttt ctaaccgaag aagagattgt agacaacatc 840

ttgttactac tctttgcggg tcatgatacc tcggctcttt caatcacttt gctcatgaag 900

actcttggcg aacattctga tgtttatgac aaggtgttaa aagagcaact agagatctct 960

aagacgaaag aagcatggga atcactgaaa tgggaggaca tacaaaagat gaaatactcc 1020

tggagtgttg tatgtgaagt catgagacta aatccacccg ttataggaac ctatagagag 1080

gcccttgtgg atatcgagta tgctggttat accatcccca aaggatggaa gctacactgg 1140

agtgctgtat cgacacaaag ggacgaggct aattttgaag gcgtaacacg ttttgaccca 1200

tcacggtttg aaggcgcagg accgactcca ttcacctttg ttccgtttgg aggggggcct 1260

aggatgtgtt tagggaaaga atttgctcga ttggaagtgc ttgcgtttct tcacaatatt 1320

gtcaccaatt tcaaatggga cctgttgata cctgatgaga aaatagaata tgatcccatg 1380

gctaccccag caaaggggct tccaattcgt cttcatcccc atcaagtttg a 1431

<210>6

<211>1638

<212>DNA

<213> stevia

<400>6

atggcatcca accaagagga ggttattcga cccgtggcaa attttcatcc cagcctttgg 60

ggagataaat ttcttatcta tcaagagctg gaagaacagg atgtgataga acgaacaatc 120

aacggtctga aaaatgaatt gaggatagaa ctatcgtctg ctttgaacga tccagcacaa 180

catagaaatt tgttgaaact tattgataat attcaacgcc taggcatagc ttactacttc 240

gaaaacaata ttgatgaagc attgcaacat atttataata tatatggtga cgactggaaa 300

ggtcataaca cgcctctttg gttccgactc ctccgacaac aaggctttta tgtttccacc 360

gatggtctta acaagtataa gcccggtaaa aaagtggaat tcttaaccga tgatgttcaa 420

gggttgcttg acttgtacga ggccatgtat atgagggtgc caggcgaaga attactagat 480

gatgctctta tttgtattaa aactcgtctt ggtagcatag caaatgatcc acgatgcaac 540

agtggtctct ctaaacaaat aaatgaggca ctcgagaggc caatacgtaa gcgtttaccc 600

cgattagatg cattacgcta catacctatc tatgaagaag atgcttgcca taacaagtct 660

ttactaagac ttgcaaagtt gggattcaac cacctacaat ccttacataa gaaggagctt 720

agcctacttt ccaagtggtg gaaagctttt gatgttccaa ataatctaca tttcacgaga 780

aatcgattgg ttgaaaacta tttctgggta cttggtgtct actttgagcc tcaatattct 840

cgtgctagag ttttcatgac aaaagtgatt gcggtttcca cgattttaga tgatacttat 900

gatgcatatg ctacttatga tgaacttgtt atctttacgg aagccgttca aaggtggtca 960

gttactatca tggatgaattaccagattac atgaaactga tatacaaaat cctcttagat 1020

gtttacgaag aaatggagga aacgatggca aaggaaggaa aaggccatca tgttaacttt 1080

gccaaagagg cgatgaaaga gatgattaaa aatttcatga tcgaagcaaa atggagaaat 1140

gaggggtata taccaacagt ggaagaacat aaatcggttt ctttcatgag ctgtggatac 1200

aaaatgctta caatagcaag ttttgttggc atgggtgaca taatcacaga tgagtccttt 1260

gaatgggttc tcggtaatcc tccacttatt aaaggttcaa gtgaaatttg caggcttatg 1320

gatgatatcg taggtcacaa ggaggagcaa aagagaaacc atgttgcatc tgtcgttgaa 1380

gcttacatga aacaaaatga tgttaatgag gagtttgtgt ataacgtatt caataaacaa 1440

gtcgaacaag catggaaagc tatgaatcaa gaatccctta aatgtaaaga tgtcgttcct 1500

ctacctctta taatgcgtgt gattaatctc gcacgtgtta tggataccct gtataaatat 1560

gatgatactt ttacgcgtgt tggagaagaa ctcattggtc acatcgaatc actatttgtt 1620

catgctatga gtctttag 1638

<210>7

<211>339

<212>DNA

<213> stevia

<400>7

atggagatgg agaaaggaag aatttgtgta actggaggaa cagggtattt agcatcatgg 60

atcatcaaaa ggctgcttga agaagggtat tccgtaaata ctaccgttag atctcaatca 120

ggctcaaaga aagatgtgag ctacatcaca aacttacccc tagcttcaga gagactcgaa 180

atattcgatg cagatttaag caaaccggag actttgaggc acccgatcaa aggttgcatt 240

ggtgtctttc atcttgcaca cccaatggat tttgaaggca acaataccgt agaagttata 300

actaaagaaa caattaagtg tagtttgggt attttataa 339

<210>8

<211>1281

<212>DNA

<213> stevia

<400>8

atggaggttg aaaacgggtc aacattgatg atgaagaaga agagatgggg attccggtcg 60

aacccggagc tgaacatgtc gtcagataac accgtcagag gctttctcta tatgctcctc 120

tccaaactca acccatccga cacccgaccc gtcatccctc tcggtaacgg cgacccgtct 180

gctttcccat gcttccgtac ggcccaaatc gcagaagacg ccattgttga ttccattcgt 240

tctgcaaact tcaacggtta tggtcctact gtaggtattc ttcaagctag aagggctgtt 300

gcagagtacc tttctcatga tcttccatat aacttatcac cggatgatgt gttcttgaca 360

ctcggttgta cgcaagcgat tcaaaccata ataaccgttc ttactaatcc aaaagcaaac 420

attttactcc cgaaaccggg ttttccatat tatgaagcga ttgctaaatc atgccatttg 480

gaagttcgtc actttgacct tcttccagac aaagattggg aggttgacct tgactcggtc 540

aacgctcttg cagatgagaa tacggttgca attgttataa tcaaccctgg aaacccttgt 600

ggaaatgttt tcacacacca acatctgcaa aaggttgctg aaacttcaaa gaagcttgga 660

atattagtga tttctgatga agtttatgat catcttgctt ttggaaaaaa cccttttgtt 720

ccgatggcga aatttgcatc aattacacct gtgatcacac ttggttccat ttcaaaaagg 780

tggatcgtac ccggttggcg gtttggttgg cttgttatca acgatcataa tggcatcctt 840

aaagaacacg ggatcattga ttgcattaca gcatatctca gtatatcctc agacgctccg 900

acgtttgttc agggtgcagt tcctgatatc ctttcaaaaa ccaaagacga tttctttttt 960

aagatcgtaa gtataataaa agaagctgca aatatctgtt acgaggggat tcaagacatc 1020

cccggtataa tttgccccag taagcccgaa ggatccatgt ttgttatggt aaaactagat 1080

atgtcagtgt ttgaggatat taaggatgat gtggactttt gtgtgaagct tgctgaagag 1140

gaatcagtta taatccttcc aggtaaaagt gtaggattga acaactggtt acgagtaaca 1200

tttgctattg agccttcagc acttaaagaa ggaatcaaga gacttaaagc tttttgtgta 1260

aaacacacca agaaaccatg a 1281

<210>9

<211>1443

<212>DNA

<213> stevia

<400>9

atggaggaag gacttcaaac gccacttgtg ggtcaagaat caggaaagtg ggtcaggtct 60

tacagcaaag atgagatttt ttgtgagttt aagaaacaat tgtatttagc aggaccttta 120

atgacagtta atctgttaat ttgtgggtta tcgatgattt cggtgatgtt tgtgggtcat 180

ttgggcgagc ttgctttatc tggtgcttca atggctactt cttttgcttc tgtaactggt 240

accagtttaa tggttggaat gggtagtgct ttagacacat tttgtggaca atcttttggc 300

gccaaacaat atcatatgtt aggaatccat aaacaaagag ccatgattgt tcttttatca 360

accagcatcc cactcgcttt catttgggca aatgccggaa aattgctcgt ttttcttggc 420

caagatcctg aaatttcagc cgaagcgggc ctctatgcaa gattcatgat accaagtttg 480

tttgcaaacg ctttacttca atgtcacgtt cggtttcttc aatcgcaaaa caatgtgttt 540

ccaatgatgt taagcaccgg gtttacaacg ctacttcata tcttaatttg ttggattatg 600

gtgtttaaat ccggttttgg gagtagaggt gcagctttgg ctaatgcgat atctctttgg 660

attaatgtgt tgttgttagc gatttatgtt cgcgtttcac cttcatgtaa aaaaacttgg 720

actggtttct caaaagaggc ttttcataat attccaacat ttttgaaact tgcagttcct 780

tctgcagtta tggtctgttt ggagatatgg tcgtttgaaa tgatggtgtt gctatctggt 840

gttcttccta atccacaact agaaacctca gttctttcta ttagcctgaa tacatgctca 900

atgatttaca tgattcctct tggtctaagt gctgccacaa gtgtaagggt ttcaaatgaa 960

ttaggagctg ggcgtgcacg cgctgcacgt ttagcaatac gcgtttcaat ggcttctgta 1020

gttacagaag gcattttggg tgcattaatc atgattttgg gccgaaaact atgggggtat 1080

tgttatagta acgaagaaga agttgtgagt tacattgcgc aaatgatgtt gcttcttgca 1140

ggatctcatg ttgttgatgg cattcaatct gtactttcag gggccgttag agggagtgga 1200

cgacaaaaaa taggcgcgat tgtgaactta ggtgcttatt atttgatcgg gattccttta 1260

gcgatcgtgt ttgcttttgt gcttcatttg ggagggaagg gattatggtt cggtatcatt 1320

gcagcattgg tagctcaagc attatttctt ttcatattaa ctttgtgtac gaattgggaa 1380

aacgaagcaa aaaaggctaatcaaagagtg tatgactcta tcacccgaga tgaagtatcg 1440

tag 1443

<210>10

<211>939

<212>DNA

<213> stevia

<400>10

aagaagagat tattagtaat cggaggcagt ggttacctgg gtcagcatct gctacattcc 60

tttgcagaat ctcctctgga tctatcaatg gcgttcacac atcattcctc ttctcccctg 120

cttcctaatg ctactgcctt tcaagtcgac ttgcaaacgg gtcaaggttt tgactcaatc 180

tcccacaaat ttggccagcc tgatgtagtg gtaaattgtg ctgcactttc tgtgcctcgt 240

gcttgcgaga caaacccaac agttgccatg tcagttaatg ttccttgtac actcgtaaac 300

tggttatctg gttttactca aaccaatacc aatactaata ctcttcttat tcatctatca 360

actgatcaag tttatgaagg aacaaagtcc ttttataaag aagaggatga aacccttgct 420

gtaaacgtat acggaaactc aaaagtggca tcagaaaaat acattttgga aaactggtca 480

aactttgtga ttttaagaag cagcattatc ttcgggccac aaactgtttc acctgtctca 540

aaatcacttc ctattcagtg gatggatagt gttcttgcta aaggacaaga agcagagttt 600

ttccatgatg aatttcgctg cccggtttat gtcaaggatg ttgtaaatat catacaaatg 660

ttaacccaca gatggatttc agatggcaag aaaagtcagt tgcttctaaa tatgggtgga 720

ccaagtaggg tatctcgtgc tcaaatggct gagacagtgg ctcgtgttag aggttacaac 780

acatcattga tcaaaccagt atcagcctca tcggttgatc gtggggtgaa gtcaccggct 840

gacatatcca tggatataag taagttgatt caaacactcg attttacacc tacttcattt 900

gaagatggtg tgaagttgac tattgagacc attaattaa 939

<210>11

<211>1191

<212>DNA

<213> stevia

<400>11

atggcttcct ctgtaactgc actcgctcga cttgttcacc taactccttc tacaaaatca 60

aaccctaaac ccctcttcac tttcttcaca ctcaaatcat catattcccc aatcgtatca 120

tcatcatcat cattactatc aatgtcgtat gataaacaac tcgctgctgc caagaaagct 180

gcatcccttg ctgctcgtct ctgccagaat gtccaaaaag gactgttgca atctgatgtc 240

cagtcaaaat ctgataaaag tccagtcaca gtggctgatt atgggtctca agttcttgtg 300

agctttgtac ttcaaaaaga acttcctgat caaacattct cactagttgc agaggaagac 360

tcgggagatc ttagaaaaga agaatctcaa gaaacccttg aacgtatcac gaaattagta 420

aatgatacga tcgctaatga tggaagttac aaagtgtctc ctttatctga tgcagatata 480

ctcactatca ttgatagtgg tatgtctgaa ggaggctcta ttggacaaca ctgggttttg 540

gatcctattg acggtaccaa aggtttttta aggggtgatc aatacgcgat agcgttaggt 600

ctgttagacg aagggaaagt ggtattaggt gtcctcgcgt gtccaaatct cccattggaa 660

tcaattacaa atcaaaatgt tgttactaag acagctgcag gttgtttgtt ttctgcacaa 720

ttgtcatgtg gaacattcat ggagtctcta gatggatcgc cacctgtcaa ggtgcatgtt 780

agcaacacgg agaatcccga agaagctgca ttctttgaat catatgaagc tgctcattct 840

tctcacagtt tatctggctc tatagcaaag aaattggggg ttaaagcacc accagttaga 900

atagacagcc aagcaaaata cggtgcattg tcacgaggag atggcgcgat atatttaagg 960

tttccaaata aaggatatcg cgagaagata tgggatcatg ctgcaggata cattgttgtt 1020

gcagaagccg ggggtgttgc ctcggatgct tctggaaagc cattagactt ttcaaaagga 1080

agatatctgg atctggatac gggtattatc gttaccaacc agaaactgat gcccgcggtt 1140

ttaaaggcgg ttcaagattc actcaaagag gaagctttac catcacttta a 1191

<210>12

<211>1614

<212>DNA

<213> stevia

<400>12

atgatggtat gcatagacag ttcacccgat tcacacgcaa ggttcctaac gaacgcaaac 60

aaaatgattt tgataaaaat ccatgatgtt ctaaaaatgg tatgtgacaa acaccggtta 120

cttcttgctc aaacatgggc tctgtcccaa cacacaagtt tcgtatccca tgaaaaagtc 180

attaaaaata gttgtggcag ttttgacatc agatgtgtcg ggaaagtctg catgtcaaga 240

tccggtctac cttttcatgt tcaagaaatg cgtatgtggc ctttctttaa agcatctaaa 300

gaacgacacc ttgacaagtc ccgtggactt gttggcaagg cgttgttaac ccacggttca 360

tgtttttgtg aagatgtcac caaactcagt gaagaagagt accctttggt ccactacgca 420

cgcatgaaca ggttgaccgg ctgctttgca attttcttgc atagtattga agccaatgat 480

gactacgtgt tggagttttt tctaccgaca gacatcaaac acagttggca ggtatgccac 540

ttggtccaaa ctttgaagca aaatattcca acaggttcgg gatttgaact tggtgacagt 600

tccattatac acatcgttga accgtctaca gaagaagtag atatatcttt aagtatagac 660

ccttgtacaa tccaaatagc ctcgggtata acaacaaata acaaccaact tgaaatggct 720

acatcagatt cagagttaat ggttgtacat atggctaaaa ctgactccgc aagtgtatca 780

aacccatggc catataaaga aacttacgat gataaactca ctaatattat cactaacact 840

gaaaatgtga cgggagatga tatcagtgag tttatcatcg taagagaaaa tgaaaaaagc 900

atgagcaata aaattagtga tgccagagaa aaaagcaacg gttcaaaaaa aggcagaaag 960

cgtaaaatag actctcttac aatggaggaa gttgtgaaac attttggaaa aacaatggat 1020

caagctgcta atagccttaa tgttggtcga tcgacactga agcgtttttg ccgagaacat 1080

gatatgccaa gttggccatt gacaaagaac ataaacaaaa acatccataa taccgactta 1140

gagccatcag aaaaagcaca acaaaaacaa aacttgctac caaattttat atacgtgaca 1200

acattgctga tcgtgtggtt gagacggtgg agaaataaga tttcaaaaag gaatgcaaaa 1260

cccgtatata caatgaataa tatgaacaac gcgtattcac gtgtcacaga atcgagtctt 1320

gttcatgcat tcccaaaaaa gaccgtagcg aggatctcag atataaagat ggtgacagtg 1380

aaggcaactt acaaagatga tatgattaag tttcaattcc ctacttcatc ggaccttttg 1440

aaattaaaaa atgaggtggc acaaaggatt aagttagaaa agagaagggt ttgtttaaag 1500

tacaaggatg aagataatga catgatttcc cttgcttctg acgacgactt gaagtttctt 1560

ctagatctta cagctaataa cagtactatc agattactcg ttgattactt ttaa 1614

<210>13

<211>654

<212>DNA

<213> stevia

<400>13

atggctcaac ctaacgatgc acctgcattc cctccaattt cggtcatcgg tgatcagttc 60

gtttcactaa aaccacttca aattatagtc gaaaggtatc cttgtagata cattctgatc 120

accaacatta accatgaaat cttgctaaaa gtaaaaccat acgacaagac cttccatcac 180

cagcgtgtgc tacttgatcc taacgacaaa cccatagcgt tgctccgtga taagaatttg 240

agtatgcata gtagatggaa tgtatttagg ggtgaaagta aagacgattc ggacatgata 300

ctaagcgcaa aaaacgaaca catgatccag tttaagacca atgttagtgt gacgttggga 360

aagagcagca atgatgattg tgatttgagg attaaaggga gctggaagaa aggaaactgc 420

actatttata tcggagattc gtcaacagta gtggcacaga tgcaaaaacc ggaaactttg 480

aagcacgcga cggaaaaata catagtgaca attcagccta acatggacta tgcaggtgtg 540

gttgcacttc tcgcaattat tgatgccatg gaaaacccta aggaaaataa atctggtggg 600

cttgaaactg cagcaggtgt ggttaatctt actagtgcag ttttgtcgat ttag 654

<210>14

<211>2286

<212>DNA

<213> stevia

<400>14

tttctatgga ccagaatcgc acctaacatg gttgtgattc caaaattgtc gaaactgaaa 60

gttcatggtt tgaagaagtt gaagcaaata tgggctagta gtagtgaggc agataatgtt 120

tcaatgttga aggagattga aatatatgat tgtaatagtc ttgtgaatct ttttccaagc 180

aatccaatgc gattacttac tcatttggaa gatcttaaag ttttatggtg ttgctccatt 240

gaagtgttat tcaacataga cttgggtaaa attgagcaac atataagcta caacagcaac 300

ttaagaagga ttatagtgtt tgacctaaag gagctaaaag agctgtggag gatacatgat 360

gaaaataact atgatcacct tattgttggc tttcaagctg ttgaaactat ccgagggtgt 420

aagaagttta gaaatgtatt cacacctacg aaagccaatt ttgatatgag aggacttacg 480

gacatcgtga ttcagagtga taaagatgca gagattactg gtatatcaaa agaggatgat 540

gatacgtcta ctatagttgg attcccatca tatcacctca cacgcgcttt taatcaaatt 600

cataggattg gttttattgg attagaaaaa gcagaagtgg tgtttgagat tgagaggcca 660

agtactaata cagaaattca acaaccacca ttacttccct gtcttgaatc tttatttttg 720

tggaaaatgg agaagatgag tcatgtgtgg aaatgcagca attggaatat tcttcacaaa 780

catcacccac aatcctcatt ccaaaacctc acagagatat acttggagga atgcaaacgc 840

attaagtact tgttttcacc tctcatgtcc aaacttcttt ccagcctaaa gagactcgaa 900

ataaaaaact gtgaaggtat tgaagaagtt gtttcaaata gagatgacga tgatgatgat 960

gatgatgaag cattgactac atctacgaca accttgttcc cgtgtcttga ttatctacaa 1020

cttaggtacc taagaaatct gaaacatatt agtggtggtg ttgttaaggg gaaaactaat 1080

gtggttcatg ataaatttaa gttttctcaa gcggatgtat ggtcttgtcc ttctttatca 1140

attctgattc catctgatgc agcactgcaa atgcaaaagc ttcaaaagct gaccatatgg 1200

aattgcccat ccatggtgga ggtatttgaa agtaaaaata tcaacaataa tattgtttat 1260

agtagtaaca ctgaccaaac aagcgtctca ttggcaacac caacaactac tactatgcat 1320

catgaactaa ccaacctaag gatattgagc atctctaaat gtgacctatt ggaatatata 1380

ttcacatttt cgacacttga acgccttaag aaacttgaac agttgagcat ttatcattgc 1440

aaagctatga aagtgattgt gaaggaagaa cacaaagagg aattatcaaa ggtggtcatg 1500

cctcgtttaa aatcaattca actgtatgat ctaccaaacc ttgaaggttt ctttgtaggg 1560

acgaatatcg actttgagtg gccatcatta gataatgcta tgatcaatga ttgcccccaa 1620

atgatggtgt tcacatctgg taagtcaacc gctccgaagc tcaagtttat acacacatcg 1680

ctaggcaaac ataatcttga atgtggcctt aactttcgtc agatgccacc cccaacttca 1740

aacagtatgt cagcttggtc ctttcataat ttggtcgaat tacatttgga atataaagat 1800

gaagttaaaa agattgttcc atacaatgag ttgctacaac tgcatgttct tgaaaagata 1860

agtgtagagg tgtgtgagag tgtagaggaa gtatttgaag tcacaaacaa tgagtcacaa 1920

actgttgtga aaattccaaa gctaagagaa atgaatttag aatatctaga caatctcaag 1980

tatatatgga agagcaatca gtggagtaaa ttggagtttc caaacctaac aagattgtct 2040

attgtcagat gtgacagttt agaacatgtt ctaacagctt ccatggttgg tagtctcatg 2100

caactccaag agctacatat aggtgagtgc gaaaatctta aggtaatcgt gaagaaaaaa 2160

gaagaagaat gtgatggcaa agtaggtgag attaagtttc cttacttgaa gttcttaaaa 2220

cttgatactc tttcaagtct caacggattt tgcttagagg aggaagatat ttcatttcca 2280

tcaatg 2286

<210>15

<211>2883

<212>DNA

<213> stevia

<400>15

atggattcaa agcaaccatt aatctcgtta ttttcttctt ctcctgttca tttcctcttt 60

tatgctcttg tcataattct aaattccacc accatcgcag ctggaaatga gaccgatcat 120

gaggctttga tacatatcaa gttgatgatc actcatgatc catatggata tctaacctca 180

tggaaccatt caattcattt ctgtgattgg agtggtgtta tatgtgggaa gcgacataga 240

agagtgactt atttagattt agactcacaa ggtctacaag gctctttgtc tcctcacgtc 300

ggaaacctca gtttccttcg tggaatttat ctctataaca acagctttga aggatgcatt 360

cctcatgaag tcggtcgcct tttcaggcta cgtatccttt acttgtatca aaacaaattc 420

gacacggtta ttccagctaa catatccggt tgttctagcc ttgaaattct tgatctttcc 480

accaacgagc tagttggaag catacccaag gagatcagtt tcctctccaa actcacttat 540

ctttcactcg atgataataa gttatctggt ggaatcccac ctttcttggg gaatattaca 600

caaatggaaa agttcggtgt tgtccgaaat ccgatgggtg ggagtattcc ggacacctta 660

ggtcgttgggagtttttaga agaaatttat tgtggggttt gtaatctatc tggaaccatc 720

cctcgttcga tttataacct ttcgctacta acatatttta gctttcctga taacaaactc 780

accgatactc ttccagcggc catgggtgaa ttgctccctc aacttgttgt ggttgagtta 840

tggaataacc aactaactgg accgcttcca ccgtctcttt ctaactgttc gagattagag 900

aaacttgaaa cgagtgtgaa caagtttagt gggaagttga gaatcgactt tgcacaatta 960

agagatattg agattatatc cttaagtacc aatacctttg gaagcaatga agttgatgag 1020

atgaagttca ttgattcttt aataaactgc accaaattaa aatggttgga tcttggtact 1080

tgtaagtttc aaggagtgct ccctcgatca ataggtaatc tttcaaatca acttcatcgt 1140

ctatatttag atgaaaatca tatacatgga aacctcccta tatcaatagg taatctagtt 1200

ggtttagaaa tgttatcact agaagaaaac caattcacag gaaacatccc ctcaaccgtt 1260

ggtaaccttc gaaagctaca agctatttat ttatataaaa atcaactttc aggagaaatt 1320

cctaaagcca taggaaactt aacatcattg aacacacttg atttatcttc aaatatgttg 1380

gtaggggtga ttccttcaag cttggggaat tgtcatagtc ttttagagtt gtaccttggt 1440

ggcaataaac ttcacgggaa aatccctaaa caactttttc aactctcatc tctatcgaaa 1500

acattagatc tctctcaaaa caacctgtat ggttcgtttc caactgaggt cggaaatctc 1560

aagatgttgg gtaatttgga tatatcttat aatagtttat caggtagcat tcctagtagc 1620

attgatggtt gtgctagcct ttcaagattg tccctcaaag gaaacttatt tcaaggtaag 1680

ataccaccat cgttaaattc cttgaaagga ttgttggaac tcgatgtttc tcataatcat 1740

ttatcaggtc aaattcctcg attcttggaa cgactagatt ttttgaacct ttcatataat 1800

gattttgagg gtgaagttcc aatcctagga gtgtttacca atctaagtgc attctctatt 1860

ttaggaaaca gtaggctttg tggtggtttg gttgaacttc atttacccaa atgcaaggat 1920

acaaagaaac atacaaaaaa atttcacctc tttgtaatag tcattttggt tgcattcaca 1980

ctttgcttca ttttatgttt agcatatgct tggcataaga agaaaagaaa gagtcattct 2040

tccgaatcat caatgagcaa acgtttcatg aaagtttcat atagtcaact tcttaaggct 2100

accgatggat tctctgaaac caatttgatt ggaaatggtg ggtttagctc cgtttataaa 2160

gggatacttg atgaagaaga tggaagattt gttgcaatca aagttctaca tcttcaaaat 2220

agaggagctc aaagaagttt tatgagggaa tgtgaagtat ggcggagcat tcgacaccga 2280

aacttgttaa agataataac ttcatgttca agtattgact tccaaggaaa tgatttcaaa 2340

gctttggtgt acgagttcat gcctaatgga agtttacatg attggttgca tccaacttcg 2400

agattaaacc ttcttcaaat aataaatatt cttatggatg tcgcaaatgc acttgattat 2460

attcacaatc gatgcgtgcc aagcattgtt cacggtgact tgaagcctag caatattctg 2520

ctcgatcatg atatggtagc tcatgttggt gactttggtt tagctcgatt tattgaaacg 2580

acgtcatacc aaaacagctc aaccgggatt agaggaacaa ttggttattc ccctccagag 2640

tatggtcttg ggggtgagat gacaagtagt ggagacatct acagctttgg aatattacta 2700

ttagaggtga tgaccggtaa gaatccaacc gatgacatct ttaatgaagg tcttagcctt 2760

cataaatttg cttccatggc cttgctagac cacgtaaccg acattattga tgtgaacatt 2820

ctgaaccttt ttcaaaacga tgaaaatatc atacaaaata atgaagtaga tgcaatggaa 2880

taa 2883

<210>16

<211>2247

<212>DNA

<213> stevia

<400>16

atgcatttaa acatacttct agcaatagca gctattgcag ctttcatggc ggcaattaat 60

cctcaaaact ccctaaattg tgaaagttca tgtggcaacg tgactatcac atacccattt 120

ggttcaggtc caggatgcta ctacagtcca gatttcttgg ttacttgtaa ccgatcaacc 180

gatgtacccg taccatatta cggactaagt acaagcaata ttgttatttc aaatatgtcg 240

acaaacaaga gtgaggtgga gatcatgatg tttgtagccc atgattgcta caatacttct 300

ggcccgactg gacgtaacag tccatatttg cggtcgagta atttccggat ctcgtccaag 360

aacaaattcg tcgccatcgg gtgtgatacg gaagcagatt ttttaggaag tagagggaat 420

tattctgata ttagtagcat atgctcttct agatgtgata taaatagcga tattactaac 480

ggatcatgtt caggaattgg gtgttgcgaa ttagacgttc cagaaggaat ggattatgtt 540

caaatgtcgg taagtagctt taataaccat acgaatataa ccgactttaa cccttgtggc 600

tatgggttct ttgttgaaga aggaaagttt agcttttcta ccacgaacct gcttgatttt 660

gaaacaaaga tgccgatgtt acttgattgg gcaattggaa acttgacttg tgaagaagca 720

aagaacacag ataatgagtt cttatgtacg ggaaatagta catgtgatca agattataaa 780

ggtgttggat atcgttgcgt ttgcaaagaa ggttatagag gcaatccgta tgatcaagta 840

aatggctgca aaaatattaa cgagtgtata gaacgaactc atacatgcca tgatgatgct 900

tggtgtcatg atacggatgg aaactacacg tgtgaatgtc gaaaaggtta ctctggagat 960

ggtacgaaga ttggaacagg ttgcactgct aatcaatcct cctcaataaa gatagttgta 1020

ggtatctcag cttctgctat atttcttctt atatttgtca cgtggttgta cttgatacta 1080

aagaagcgaa aggagatgat gctgagagag aagttcttta aacaaaatgg cgggataatg 1140

ttggagcaaa aatatttgtc tggagaaggg agttctcata atcaagcaaa agtcttcact 1200

ttagaggagc taaagggggc gaccaacaac tacgatgaga gcaggattat tggtaaaggt 1260

ggacatggca ccgtttataa aggagttctt tctgataaca gaatagttgc cataaaaaag 1320

tctaaaatac cagatcaaaa tgaaaacgag attgaacaat ttatcaatga agttgttatc 1380

ctgtcccaga taaatcatag gaatgtagtg aagttgattg ggtgttgttt ggaaacagaa 1440

ttcccattgt tggtttatga gttcattcca aatggcacac tttctgatca catccacacc 1500

aaaggcaagc tgtcacctat tacatggaac atccgactta gaatagcaac ggagacagct 1560

gaagcacttt catacttgca ttctgctgca tcagttccaa tcatacatcg tgatgtgaag 1620

ccatcgaata tacttttgga tgacaactat gtagcaaaag tggccgattt tggagcatct 1680

aagctaattc ctattgatca gatcgagttg gctactattg tgcaaggaac actaggctac 1740

ttagatcccg aatatatgca aacaaatcaa cttacagata aaagcgatgt ttatagtttt 1800

ggggtcgtac tggcggaact tttaacggga aaaacagctc ttagctttga taggccagag 1860

aaagagagga atctagctat ttattttcta tattccttaa aagaagggag actcttccaa 1920

attcttgatg aacaattaca actaaatgat gttcctagcg acatcattca agtttcaaga 1980

ctggcagaaa gatgcttacg tgttaaaggt gacgaaaggc caaccatgaa agaagtagcg 2040

attgagctcc aaggaatact ggcatcaatg atacaaaagc atccatgggt acaaaatatt 2100

acaaatgaag aagaagatga gtatttgctc aaagaattaa acaatgacta tgattctaca 2160

aatgttggca atgtaagcgt tgtcaactca agcacctttg atagcatgag caatcattct 2220

attttaccca ttgctagtgg tagatga 2247

<210>17

<211>498

<212>DNA

<213> stevia

<400>17

atggcgacca cggtttacgc ggcggcaact tcaacctcta tggcggctac cgccggtatg 60

ctgccacgtc ttccgacgag aatcaccacc gctggtttct ccgccgtacc taccctcccg 120

gctcgttcgt tttctacctc cgtcaaacag gtttcagggt caaaaaggtc aaatcttttc 180

cagataaagg tctcagaaga cgcatcatcc gcccccgatg caaatgagtt gttcaatgac 240

ctaaaagaaa agtgggatgc agttgagaac aagtcaactg tcataatcta tggtggagga 300

ggaattgttg caatttggtt atcctcaatt gttattggtg caattaattc tgtgccgttg 360

cttccaaaga tcatggagtt ggtcggactt ggatataccg gatggtttgt ctaccgatat 420

ttgctcttca agtcgagcag aaaagagcta gcgacagaca ttgagtccat aaagaagaag 480

attgcgggga ccgaataa 498

<210>18

<211>1308

<212>DNA

<213> stevia

<400>18

atggaaaaga gggatttgga gcttggagac atacgcattt tacaagacgc cgtccaaatt 60

cttgttgatg gggtgaaaag agggcataat cgtacaaatc aatcttcacc gttgatttcc 120

aaagactata cttgttcaga aatgcaggaa gtctttattg gacttgcgca cagttgctac 180

cttttaggta gacacagttt aggtgcagag ctgaaagaaa gttatttgat taatctaatg 240

agtcgcatcc cttccccaga agaggaaacg ttaaaatcat gtgcgcataa ggtctacacg 300

tcactcaaac aaatcaagtc atgttatcct gttcatataa ttaaggatca agagcacgag 360

ttaggtgatg ctgaaattgt caatgttatt gttacagatg cttgtttcat acttgaattc 420

gtcaacacga tttcgaaata tgataaatca tttcgcgggt acatgatcct gacccaaaat 480

ataatttctg acttggtgtt ggtacaaaac caaatccctt tctttattct tgatgaaata 540

ttccggtgca ctatattaaa attcaagcca aacatctccc ttgttgaatt tctccttcca 600

cttctaaatc tcctcaatat ttttaaatcc gatataaaaa tcgacaatat ttccgttagt 660

accactagtc atatacttgg ccttctacac gaatgctaca agcctcatta tcccgttgca 720

tcaactttcg taacatcaac aatccaatcg actaaagatc tagatagggc agggatcaac 780

atagaacaca accgaaatcc aaaatggttg ttggggatgg atgtgaagtt acataggttc 840

ccgtgttttt catggtgtca gggtaagcct actttcagaa tgccagcatt atatgttcat 900

gaattcacta agttggtttt aatgaacctt attaaatacg agcatcactt tgatcaagat 960

cacaagtatg ttacatcata tgcttatacc atagatatgc tagtgaatac tgaagaagat 1020

gttgctacgt tggtagagtc aggagtcctt gtcaacaata tgggttcaaa taaagaagct 1080

actaatatga tcaactccat atgtaataaa gtcacactgg aacatttctt ttacggtgaa 1140

gagtggcaaa aattgaataa ttactgcaat agttactggc caaaaaatat agcacggttg 1200

aagaggactt acttcagtag tccatggact atcattgctc tgttcgctgg aatcatccta 1260

tttgctttaa cagtggttca gaccgtttat accattgaaa gtgcctga 1308

<210>19

<211>813

<212>DNA

<213> stevia

<400>19

atggaggcgc tctattccaa gctgtatgat aagtacacta agctcaaggc aaaaaagact 60

tctgaaacag agcgactaag tctggatcaa gaagaaaaat tcaaaactta tgtgtctgct 120

gcagatgaac taattggcta tttaacaagc gaaaaggaca agttatctgc acagattagt 180

gatttgagac acgaaattgc ctcaatcaga tctaccaagg acgaagagga acaaatgcat 240

gaaatgatgt tgatggaaga aaagcagaaa aacaaacaac tttcagaaga aatagagagg 300

ctgcagagaa acaaatctga ttccagcgat aaacaatctt caggttctcc actttcattc 360

cacaattcaa caaagagaaa acgactcatg ctgcatgaaa aagaagttgt tgatgaagat 420

aacatcttct ctggagtttt tactaatgat gataatacac agcctaaatg ctgtcgtcga 480

aggcttagtg gtacagtaaa tgctgcctct gattcttcta gcaattgctg tatgtttcaa 540

gagcttgttg agtgcttaat cgacctcaag ttttcagttg gaaccccaat tgatgataat 600

atacaaataa ccgcggttca cgaatcaagt ggatactcat ttactttggg atgggtgagt 660

aagggagagg acgcgatgat gatgtaccgc gtgtcatcat tgggaacata tgagcgagtt 720

gcaccagaat ggatgcgcga tttgatgtta tttagtaaga gcatgttaag tgtctttttt 780

aaaagacttt cggtcctttt taaatcttca tga 813

<210>20

<211>507

<212>DNA

<213> stevia

<400>20

atgcctccgc cacatcccgc cggcccacca cccttcacgc cgccgtcatc ctccgctctc 60

tacaaacaaa attcatggtc accggacctt caccgggacg aggaatggat ccgccggaaa 120

gggaaaaatc tccaccgacg tcgccggaaa agcaaaagcg tcaccgatga agacatcgat 180

gaactcaaag cttgtttcga tcttggattc gggttcgatc attcttcacc ggaagtggac 240

gaccggcttt caactacttt tccggcgttg ggcttctatt acgccgtcaa caagcagtat 300

ctcgatacag tctccaaatc ttcatccatg tcgccatcgt cttcctcgtc gatttcatct 360

gcatctgctc tttcggaacc cgatttatct tctccatcaa gcagctctca caacataatc 420

aatcatgggg ataatccaca gacggtgaag actagattga gacaatgggc gcaagttgtt 480

gcttgttcgg tgagactacc atcatga 507