阅读说明：本技术 寡糖的生产 (Production of oligosaccharides ) 是由 斯特凡·延内魏因 于 2014-07-04 设计创作，主要内容包括：本发明涉及寡糖的生产。具体而言,本发明涉及一种或多种糖苷酶在用于所产生的期望的寡糖的生产和/或纯化的过程中的用途。所述过程优选是利用宿主微生物的微生物发酵过程,所述宿主微生物也可以包含表达适用于糖类的降解的糖分解代谢途径蛋白的核酸,否则阻碍期望的寡糖的纯化。(The present invention relates to the production of oligosaccharides. In particular, the present invention relates to the use of one or more glycosidases in a process for the production and/or purification of the desired oligosaccharides produced. The process is preferably a microbial fermentation process using a host microorganism which may also contain nucleic acids expressing carbohydrate catabolic pathway proteins suitable for the degradation of carbohydrates, otherwise hampering the purification of the desired oligosaccharides.)

1. A method for producing an oligosaccharide using a host microorganism, wherein the oligosaccharide does not naturally occur in the host cell, the method comprising the steps of:

a) culturing a host microorganism suitable for the production of the desired oligosaccharide under conditions and in a medium which allow the production of the oligosaccharide, thereby producing the oligosaccharide and, where applicable, biosynthetic sugar intermediates and/or by-products;

b) using a glycosidase enzyme in the culture medium in which the host microorganism is cultured to degrade biosynthetic sugar intermediates and/or sugar by-products and/or unused sugar substrates, wherein the glycosidase enzyme is produced by a second microorganism additionally added to the culture medium and expressing the glycosidase enzyme; and

c) recovering the desired oligosaccharide.

2. The process of claim 1, wherein the process is a batch or continuous process.

3. The method according to claim 1 or 2, characterized in that the oligosaccharides are recovered from the supernatant of the cultured host microorganism obtained by centrifuging the cultured host microorganism to obtain a supernatant and a host microorganism pellet.

4. The method according to any of the preceding claims, the desired oligosaccharide is selected from one of 2' -fucosyllactose, 3-fucosyllactose, 2' 3-difucosyllactose, 3' -sialyllactose, 6' -sialyllactose, 3-fucosyl-3 ' -sialyllactose, lacto-N-tetraose, lacto-N-neotetraose, lacto-N-fucopentaose I, lacto-N-fucopentaose II, lacto-N-fucopentaose III, lacto-N-fucopentaose V, lacto-N-difucohexaose I, lacto-N-difucohexaose II, lacto-N-sialylpentaose LSTa, LSTb, LSTc and especially from the oligosaccharides shown in table 1 of fig. 11 or their derivatives.

5. The method according to any one of the preceding claims, characterized in that the glycosidase is selected from one or more of the group consisting of: galactosidase, mannosidase, fucosidase, sialidase (neuraminidase), glucosidase, N-acetylglucosaminidase, and N-acetylhexosaminidase.

6. The method according to any one of the preceding claims, characterized in that the glycosidase is selected from one or more of the group consisting of: beta-galactosidase, alpha-galactosidase, beta-N-acetylglucosaminidase, beta-N-acetylhexosaminidase, beta-mannosidase alpha-mannosidase, alpha-fucosidase, beta-glucosidase, alpha-glucosidase, neuraminidase.

7. The method according to any one of the preceding claims, characterized in that the host microorganism is selected from bacteria and yeasts, and preferably is a strain of Escherichia coli, Lactobacillus or Corynebacterium glutamicum or a strain of Saccharomyces.

8. The method according to any one of the preceding claims, characterized in that the host microorganism employed expresses a protein for a sugar catabolic pathway which is absent from said microorganism, said protein being selected from at least one of the following: when a galactosidase is used, a galactose catabolic pathway protein; fucose catabolic pathway proteins when fucosidase is used; when beta-N-acetylhexosaminidase is used, N-acetylglucosamine catabolism pathway proteins.

9. A method according to any of the preceding claims, characterized in that in the host microorganism employed, a salvage pathway for monosaccharides released during degradation is overexpressed to convert the monosaccharides.

10. The method according to any one of the preceding claims, characterized in that the host microorganism employed is a wild-type expressing a protein for a carbohydrate catabolic pathway selected from at least one of the following: when a galactosidase is used, a galactose catabolic pathway protein; fucose catabolic pathway proteins when fucosidase is used; n-acetylglucosamine catabolic pathway proteins when beta-N-acetylhexosaminidase is used, wherein during said process overexpression of such proteins is induced in said host microorganism.

Technical Field

The present invention relates generally to methods for the production of oligosaccharides or polysaccharides, such as, for example, the production of oligosaccharides or polysaccharides via microbial fermentation, and in particular to the use of hydrolases in such methods.

Background

Commercial production of oligosaccharides, together with the development of novel biological manufacturing techniques, has become more and more interesting over the past years. Today, oligosaccharides are used, for example, as functional food components, nutritional additives or as nutraceuticals. Traditionally, oligosaccharides are defined as polymers of 2 or more (usually up to 10) monosaccharides, however, in addition polymers of up to 20 to 25 monosaccharides are often assimilated with them. In particular, prebiotic oligosaccharides (prebiotic oligosaccharides) are of high interest, since they represent non-cariogenic and non-digestible compounds that stimulate the growth and development of the human gastrointestinal microflora.

Currently, oligosaccharides are synthesized by chemical glycosylation and de novo synthesis using glycosyltransferases, or they may be derived from chemical, physical or biological degradation of polysaccharides.

Today, fructooligosaccharides (fructooligosaccharides, fructans, fructooligosaccharides) and galactooligosaccharides (galactooligosaccharides), synthesized or isolated from plant polysaccharides, represent the most abundantly produced oligosaccharides. However, interest in Human Milk Oligosaccharides (HMOs) as nutraceuticals has increased strongly over the past years due to superior health benefits. It is well recognized that HMOs contribute to the body's defense mechanisms against human pathogens, the establishment of specific intestinal flora, and the postnatal stimulation of the immune system. While HMOs are consumed by infants, it is accepted that the beneficial effects of these oligosaccharides observed during postnatal period can also be found later in life.

It has long been known that human breast milk, in addition to lactose, contains a complex mixture of oligosaccharides known as Human Milk Oligosaccharides (HMOs), which represents a unique complex mixture of oligosaccharides with respect to composition and quantity. Today, more than 80 HMO compounds have been structurally characterized and, with few exceptions, they are characterized by a lactose moiety at the reducing end and often contain fucose and/or sialic acid at the non-reducing end. Typically, the monosaccharides from which the HMO is derived are D-glucose, D-galactose, N-acetylglucosamine, L-fucose and sialic acid.

The most notable oligosaccharides are 2 '-fucosyllactose and 3' -fucosyllactose, which together can contribute up to 1/3 of the total HMO fraction. Additional well-known HMOs present in human milk are lacto-N-tetraose, lacto-N-neotetraose (neotamarose) and lacto-N-fucopentaose (fucopentaose). In addition to these neutral oligosaccharides, acidic HMOs may also be found in human milk, such as, for example, 3' -sialyllactose (sialyllactose), 6' -sialyllactose and 3-fucosyl-3 ' -sialyllactose, disialo-lacto-N-tetraose, and the like. These structures are closely related to epitopes of epithelial cell surface glycocomplexes, Lewis (Lewis) tissue blood group antigens, such as Lewis x (lex), and the structural homology of HMOs to epithelial epitopes results in protective properties against bacterial pathogens.

In addition to the mentioned local effects in the intestinal tract, HMOs have also been shown to induce systemic effects in infants by entering the systemic circulation. Furthermore, the effect of HMOs on protein-carbohydrate interactions, e.g., selectin-leukocyte binding, can modulate immune responses and reduce inflammatory responses.

Due to the well-studied beneficial properties of prebiotic oligosaccharides, especially HMOs, together with their limited availability, efficient commercial production, i.e. large-scale production, is highly desirable.

However, the major drawback today is the lack of efficient oligosaccharide production in most cases. As described above, oligosaccharides may be produced from oligomer engineering by means of synthesis using enzymatic or chemical engineering, or polysaccharide depolymerization (using physical, chemical or enzymatic methods).

Chemical synthesis of oligosaccharides has proven to be challenging due to the presence of several hydroxyl groups with similar chemical reactivity. Thus, in the chemical synthesis of oligosaccharides, the saccharide building blocks must first be selectively protected to control the reactivity of chemically similar groups, then coupled, and finally deprotected (de-protected) to obtain the desired oligosaccharide. Even if small scale synthesis of the desired oligosaccharides is possible, the development of synthetic routes is often time consuming, technically challenging and often extremely expensive. Enzymatic synthesis or a combination of chemical and enzymatic synthesis offers significant advantages over purely chemical synthetic routes. Several human milk oligosaccharides have been obtained by enzymatic synthesis, such as 2 '-fucosyllactose, lacto-N-tetraose, lacto-N-neotetraose or 3' -sialyllactose. In addition to enzymatic synthesis, fermentative routes to oligosaccharides have also proven successful and have made it possible to provide oligosaccharides (including HMOs) in comparable yields by fermentative means.

In addition, as mentioned previously, by virtue of chemical or biochemical synthesis of oligosaccharide structures, which is more difficult than for example the synthesis of other biopolymers such as peptides and nucleic acids, oligosaccharide mixtures are often produced which contain undesired oligosaccharides which need to be separated or removed from the desired oligosaccharides. The same applies to oligosaccharides produced via microbial fermentation, since in those processes high amounts of by-products, intermediates or even starting substrates will be found in the reaction mixture/cell culture medium (containing the microorganism to be fermented).

Against this background, there is a great need for efficient methods and processes for producing desired oligosaccharides, in particular HMOs, wherein the efficient production has a high medical relevance as well as commercial impact.

Disclosure of Invention

This and other objects have been solved by the present invention by the use of one or more exoglycosidases for degrading undesired oligosaccharides or metabolites or unused substrates in the purification of the produced desired oligosaccharides from a mixture containing the produced desired oligosaccharides and, where applicable, undesired oligosaccharides or metabolic carbohydrate products (produced in the production of said desired oligosaccharides) and/or unused sugar substrates used in the production of said oligosaccharides.

The above object is further solved by a method for producing an oligosaccharide by means of a host microorganism, wherein the oligosaccharide does not naturally occur in said host cell, comprising the steps of: a) culturing a host microorganism suitable for the production of the desired oligosaccharide under conditions and in a culture medium which allow the production of the oligosaccharide, whereby the oligosaccharide and, where applicable, biosynthetic intermediates and/or by-products are produced; b) using a glycosidase in a medium in which the host microorganism is cultured to degrade biosynthetic sugar intermediates and/or sugar by-products and/or unused sugar substrates; and c) recovering the desired oligosaccharide.

According to the present invention, glycosidases are used in processes for the production of oligosaccharides, wherein the glycosidases serve to degrade and/or hinder undesired by-products, unused starting substrates and intermediate products produced in the production of desired oligosaccharides; thus, according to the present invention, glycosidases are used to purify desired oligosaccharides from mixtures containing the desired oligosaccharides and other undesired carbohydrate moieties.

According to the present invention, glycosidases may be used in fermentation processes for the production of desired oligosaccharides as well as for the purification or isolation of oligosaccharide mixtures obtained by in vitro oligosaccharide synthesis reactions or by chemical synthesis or combinations thereof.

By means of glycosidases it is achieved that, for example, other (oligo) sugars than the desired oligosaccharide, which are produced in the microorganism during the synthesis of the desired oligosaccharide, and which interfere with the purification step of the desired oligosaccharide, can be metabolized.

The use of glycosidases in processes for producing desired oligosaccharides has not been described so far. In contrast, in the currently applied process (i.e. for fermentation of HMOs), lactose is added as substrate for the synthesis. To prevent degradation of the added lactose, the reaction of β -galactosidase as well as other glycosidases is strongly avoided in the fermentation strain. Thus, β -galactosidase deficient strains (see, e.g., Dumon et al, (2004) Biotechnol. prog.20,412-419) or strains whose β -galactosidase genes have been specifically inactivated (Dumon et al, (2006) ChemBiochem.7,359-365) have been used in fermentations. In general, the presence of any glycosidase activity is considered to be a reaction (back production) on the fermentation of oligosaccharides.

According to the invention, "oligosaccharides" are to be understood as short polymers of monosaccharides, comprising at least 2 sugar subunits, as already mentioned at the outset. Oligosaccharides may be branched or form a linear chain of subunits. In addition, the sugar subunits of oligosaccharides may have many chemical modifications. Thus, the oligosaccharides according to the invention may comprise one or more non-sugar moieties.

Furthermore, currently and generally, in the relevant art, "glycosidases," also known as "glycoside hydrolases" or "glycosyl hydrolases," catalyze the hydrolysis of glycosidic bonds to release smaller sugars. They can be classified as enzymes that catalyze the hydrolysis of O-glycosides or S-glycosides, and they are often named after the substrate on which they act. Thus, glucosidases catalyze the hydrolysis of glycosides as well as xylanases to catalyze the cleavage of xylans. Thus, the glycosidases according to the invention catalyze the hydrolysis of glycosidic bonds to release mono-and oligosaccharides with lower molecular weights than natural simple carbohydrate substrates as well as complex carbohydrate substrates.

According to the present invention, in the applications and methods disclosed herein, glycosidases are used to degrade and/or hinder undesired by-products, unused starting substrates and intermediates produced in the production of desired oligosaccharides, which typically have a higher molecular weight than mono-and oligo-or disaccharides released by the action of glycosidases during the degradation of undesired by-products, unused starting substrates and intermediates.

Thus, at present, "liberated monosaccharides" are understood to be monosaccharides that have been produced in glycosidase-mediated hydrolysis of the glycosidic bond of a carbohydrate substrate, wherein monosaccharides and oligosaccharides with lower molecular weights than the hydrolyzed carbohydrate substrate are formed.

According to the present invention, at least one glycosidase, or a combination of two or more thereof, may be used for the uses and methods according to the present invention.

According to one aspect of the invention, the glycosidase is used in a microbial fermentation process for the production of a desired oligosaccharide and using a host microorganism, wherein said oligosaccharide and/or said glycosidase does not naturally occur in the microorganism with respect to said host cell.

As currently and generally understood in the relevant art, "microbial fermentation" is understood to be a (generally large-scale) industrial metabolic process in which enzymatic breakdown and utilization of nutrients, particularly carbohydrates, and conversion of compounds into other compounds occurs during the cultivation of microorganisms, such as bacteria, fungi, and molds. Accordingly, industrial or large-scale microbial fermentation is a process of controlling microorganisms, i.e., bacteria, yeasts and molds, to improve food products to produce desired products.

According to another aspect of the invention, glycosidases are used to break down oligosaccharide mixtures obtained by in vitro oligosaccharide synthesis reactions or by chemical synthesis or by a combination thereof.

Currently and generally in the relevant art, "microorganisms" are currently specified and include any microscopic organism, including single, groups, or multicellular relatively complex organisms, and in particular, including bacteria and yeasts, that is suitable for use in the method according to the present invention. Microorganisms as employed according to the present invention can be cultured in liquid media and generally require a carbon source in the media for growth and replication.

Currently, and throughout the present invention, "recombinant" refers to genetically engineered DNA prepared by transplanting or splicing genes from one species into cells of a host microorganism of a different species. Such DNA becomes a part of the genetic constitution of the host and is replicated.

Thus, a "host microorganism" is used to refer to any microorganism which contains a nucleic acid sequence or expressed protein which is foreign to/not naturally present in a host microorganism so recombined, and wherein the above-mentioned nucleic acid sequence which is foreign/not naturally present in said microorganism is integrated into the genome of the host microorganism cell. Thus, "non-naturally occurring" means that the nucleic acid sequence/protein (e.g., such as, for example, an enzyme) is foreign to the host microbial cell, i.e., the nucleic acid sequence/protein is heterologous with respect to the microbial host cell. Heterologous sequences can be stably introduced into the genome of a host microbial cell, for example by transfection, transformation or transduction, wherein techniques can be applied, depending on the host cell into which the sequence is to be introduced. Various techniques are known to those skilled in the art and are disclosed, for example, in Sambrook et al, Molecular Cloning: A Laboratory Manual,2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Thus, a host microorganism into which a heterologous sequence has been introduced will produce a heterologous protein encoded by a nucleic acid sequence according to the invention.

For recombinant production, host cells may be genetically engineered to incorporate expression systems or portions thereof as well as the nucleic acid sequences of the invention. Nucleic acid sequences can be introduced into host microbial cells by Methods described in many standard laboratory manuals, such as Davis et al, Basic Methods in Molecular Biology, (1986), and Sambrook et al,1989, supra.

Thus, the nucleic acid sequence according to the invention may, for example, be comprised in a vector, which is to be stably transformed/transfected or otherwise introduced into a host microbial cell.

A wide variety of expression systems may be used to produce the polypeptides of the invention. Such vectors include, among others, chromosomal vectors, episomal vectors, and virus-derived vectors, e.g., vectors derived from bacterial plasmids, phage-derived vectors, transposon-derived vectors, yeast episome-derived vectors, insertion element-derived vectors, yeast chromosomal element-derived vectors, virus-derived vectors, and vectors derived from combinations thereof, such as those derived from plasmid and phage genetic elements, e.g., cosmids and phagemids. The expression system construct may contain regulatory regions that regulate and cause expression. Generally, any system or vector suitable for maintaining, propagating or expressing a polynucleotide and for synthesizing a polypeptide in a host may be used for expression (in this regard). Appropriate DNA sequences may be inserted into the expression system by any of a variety of well-known and conventional techniques, such as, for example, those set forth in Sambrook et al, supra.

Currently, "desired oligosaccharides" refer to oligosaccharides that are to be produced specifically and purposefully by means of applied methods. Thus, "undesired oligosaccharides" means oligosaccharides that are not intended to be produced or produced in the production of desired oligosaccharides or oligosaccharides formed by the use of organisms unrelated to the desired oligosaccharides. "metabolite" or "metabolic sugar product" or "sugar intermediate" are sugars, i.e. carbohydrate products produced in the production of the desired oligosaccharide, and "unused sugar substrate" refers to the starting molecule or moiety used in/for the production of the desired oligosaccharide.

As mentioned at the outset, the invention also relates to a method for producing oligosaccharides using a host microorganism, wherein the oligosaccharides do not naturally occur in the host cell, comprising the following steps: a) culturing a host microorganism suitable for the production of the desired oligosaccharide under conditions and in a culture medium which allow the production of the oligosaccharide, whereby the oligosaccharide and, where applicable, biosynthetic sugar intermediates and/or sugar by-products are produced; b) using glycosidases in a medium in which the host microorganism is cultured to degrade biosynthetic intermediates and/or by-products and/or unused substrates; and c) recovering the desired oligosaccharide.

By means of the method according to the invention, an efficient production method has been provided, by which the desired oligosaccharides can be produced in a form in which undesired oligosaccharides or otherwise hindering intermediates or unused substrates are substantially absent.

As used herein, the term "culturing" refers to growing a microorganism in a culture medium and under conditions permissive and suitable for the production of the desired oligosaccharide. A variety of suitable host microorganisms, as well as media and conditions for their culture, will be readily available to those skilled in the art after reading the present disclosure, along with the skill and expertise of the skilled artisan.

As used herein, the term "recovering" refers to isolating, harvesting, purifying, collecting, or otherwise isolating oligosaccharides produced by a host microorganism according to the present invention from a culture of the host microorganism.

According to one aspect of the invention, the glycosidase is added to a medium in which the microorganism is cultured. Accordingly, "adding" means adding the enzyme directly to the medium, i.e., as opposed to providing the glycosidase enzyme by endogenous production by the microorganism used for production. Thus, enzymes (in their active form) are readily available and commercially available on the market and can be added in the amounts necessary to degrade the undesired oligosaccharides/unused substrates/intermediates. The amount will depend on the amount of microorganism cultured and also on the amount of desired oligosaccharides produced, the substrate and possibly the intermediates that may be expected.

According to this embodiment, at the end of the production process according to the invention, glycosidase enzymes are added externally to the culture medium/supernatant, which is particularly preferred when the endogenous genes of the host microorganism encoding the glycosidase enzymes have been inactivated or deleted. In doing so, unwanted oligosaccharides and/or monosaccharides cannot accumulate and do not interfere with the recovery of the desired oligosaccharides.

For example, where beta-galactosidase is added to a solution containing both desired and undesired oligosaccharides, such as fermentation-derived lacto-N-tetraose and lactose, the amount of beta-galactosidase to be employed will depend on the (actual or expected) amount of oligosaccharides. For example, with lacto-N-tetraose and lactose, both at a concentration of 10mM, an amount of 50 units/ml (final concentration) of beta-galactosidase (e.g.from Sigma-Aldrich Chemie GmbH, Munich Germany, Cat. No. G6008)) can achieve good results for cleavage of lactose in glucose and galactose for better chromatographic separation of sugars (e.g.by size-dependent gel filtration chromatography). In respective experiments performed by the present inventors, it could be shown that lactose is cleaved into its monosaccharides, galactose and glucose, while lacto-N-tetraose is still the same within a few seconds (see also fig. 1 and the respective description below). These experiments demonstrated the highly selective action of purified E.coli β -galactosidase to selectively hydrolyze only the Gal (. beta.1-4) Glc glycosidic linkages and not the Gal (. beta.1-3) GlcNAc glycosidic linkages present at the non-reducing end of the lacto-N-tetraose. It will be apparent in light of this disclosure how many of the corresponding glycosidases may need to be used.

For example, in fermentation procedures, suitable microorganisms for producing, for example, fucosylated oligosaccharides are known from EP 2479263 a1 or from EP 2439264 or from WO2010/142305, the contents of which are hereby explicitly mentioned and the subject of the present invention is made.

According to another aspect of the invention, the glycosidase is endogenously produced by said host microorganism, wherein the nucleic acid sequence encoding the endogenously produced glycosidase does not naturally occur in the host cell, and wherein the host cell has been stably transformed to express the glycosidase which does not naturally occur, and wherein the expression of the glycosidase in the host microorganism is inducible.

According to this embodiment, the oligosaccharide-producing microorganism endogenously (i.e. comprised in its genome) expresses a glycosidase, e.g. β -galactosidase, under external induction, e.g. via temperature or substrate-induced expression (which is otherwise deregulated). This means that during the synthesis of the desired oligosaccharide the glycosidase is deregulated and can be induced, for example, by temperature or addition of a sensor, such as tetracycline (at the end of the fermentation process). After a sufficient and/or substantially maximum amount of oligosaccharides has been produced in the culture of the host microorganism, the expression of the glycosidase will be induced. Thereafter, the expressed glycosidase will degrade the undesired sugar intermediates, substrates, etc., thereby leaving the medium substantially free of sugar intermediates or substrates, which would otherwise hinder or complicate the purification of the desired oligosaccharide. In the prior art, a variety of suitable inducible expression tools are known (see, e.g., Sambrook et al,1989, supra), and the skilled person will be able to apply the respectively suitable one for the desired oligosaccharide.

In the context of this document, "regulated" with respect to a gene is generally understood to mean a gene whose expression can be regulated in a controlled manner, for example down-regulated or up-regulated, i.e. the amount of synthetic protein encoded by the regulated gene (for example down-regulated/down-regulated or up-regulated) differs from the unregulated gene.

According to another aspect of the present invention, the glycosidase is produced by a second microorganism additionally added to the culture medium and expressing the glycosidase.

In this embodiment, the glycosidase expressed by the microorganism is a naturally occurring glycosidase or a glycosidase encoded by a nucleic acid sequence that has been stably integrated into the genome of the second microorganism. This embodiment is particularly suitable for a continuous fermentation process for the production of oligosaccharides, wherein, for example, two separate fermentation vessels are provided, while one vessel is used for the oligosaccharide synthesis reaction and the second vessel is substantially used for the degradation of the undesired sugars.

Thus, and according to certain aspects of the invention, the process according to the invention is a batch or continuous process.

Thus, according to one aspect of the invention, i.e. in a continuous process, glycosidase is continuously added to the culture medium during the culturing step of the host microorganism, e.g. by providing a strain expressing glycosidase, however the glycosidic reaction and the catabolic reaction can be spatially separated.

According to another aspect, i.e. in a batch process or a batch feed process, the hydrolytic decomposition reaction is limited to a specific period of time.

According to another aspect of the invention, the oligosaccharides are recovered from a supernatant of the cultured host microorganism, which supernatant is obtained by centrifuging the cultured host microorganism to obtain a supernatant and a pellet of the host microorganism.

By means of the newly provided method, the produced oligosaccharides can be recovered from the medium in which the host microorganism is cultured, since the oligosaccharides produced in the microbial cells are preferentially transported to the medium, thus enabling the oligosaccharides to be recovered from the supernatant without difficulty after the cells of the microorganism have been separated from the medium.

Furthermore, according to another aspect of the present invention, the separation of the host microorganism from the preferred liquid medium in which the host microorganism is cultured may produce a supernatant, wherein the produced oligosaccharides are contained in the supernatant, prior to addition of the glycosidase. To this supernatant, glycosidase may be added.

According to another aspect, the desired oligosaccharide is selected from the group consisting of 2' -fucosyllactose (2' -FL), 3-fucosyllactose (3-FL), difucosyllactose (difucosyllactose) (DF-L), 3' -sialyllactose (3' -SL), 6' -sialyllactose (6' -SL), 3-fucosyl-3 ' -sialyllactose (F-SL), lacto-N-tetraose ((LNT), lacto-N-neotetraose (LNneoT), lacto-N-fucopentaose (fucopentaose) (LNFP-I, II, III, V), lacto-N-difucohexaose (LNDH-I and II), lacto-N-sialylpentaose (sialylpentaose) (LSTa, b and c), fucosyl-lacto-N-sialylhexaose (F-LSTa), b and c), disialo-lacto-N-hexaose (DS-LNT) and in particular those selected from those shown in Table 1 or derivatives thereof. In this respect, for the production of oligosaccharides, EP 2479263 a1 or from EP 2439264 or from WO2010/142305 is explicitly mentioned, the content of which is hereby explicitly mentioned and is the subject of the present invention.

Table 1: list of oligosaccharides that can be produced according to the invention (FIG. 11)

According to a further aspect of the invention, in the method according to the invention or in the use according to the invention, the glycosidase is selected from one or more of the group comprising: galactosidases, glucosidases, galactosidases, N-acetyl-glucosaminidase (glucosaminidase), N-acetyl-hexosaminidase (hexosaminidase), mannosidases, fucosidases and sialidases, which are sometimes also referred to as neuraminidases.

In this respect, it is preferred that the glycosidase is selected from one or more of the group comprising: beta-galactosidase, beta-glucosidase, beta-N-acetylhexosaminidase, alpha-fucosidase, beta-fucosidase, alpha-glucosidase, alpha-galactosidase, beta-mannosidase, alpha-mannosidase, ceramidase (neuramidinase), and it is particularly preferred that the glycosidase is beta-galactosidase, preferably E.coli beta-galactosidase.

As used herein and as generally understood in the art of the present invention, "beta-galactosidase" is a hydrolase that catalyzes the hydrolysis of beta-galactoside to monosaccharides.

Beta-galactosidases are frequently used in genetic, molecular biological and biotechnological engineering techniques and are known per se to the person skilled in the art.

According to a preferred embodiment, the microorganism used in the process according to the invention and as claimed therein is selected from bacteria or yeasts, and more preferably the host microorganism is a strain of escherichia coli, a strain of Corynebacterium, in particular of Corynebacterium glutamicum (Corynebacterium glutamicum), a strain of Lactobacillus (Lactobacillus species) or a strain of Saccharomyces species (Saccharomyces sp.

The bacteria escherichia coli, lactobacillus species, corynebacterium glutamicum and saccharomyces species have the following advantages: these microorganisms can grow easily and inexpensively in a laboratory environment, and the above-mentioned bacteria and yeasts have been studied intensively for more than 60 years.

Thus, in a preferred embodiment, the host microorganism used in the method according to the invention and additionally claimed therein is selected from bacteria and yeasts, and is preferably an escherichia coli strain.

According to a further aspect of the invention, in the method or use according to the invention, the host microorganism employed and preferably expressing the glycosidase further expresses a protein for the glycolytic metabolic pathway which is otherwise not present in the microorganism, said protein being selected from at least one of the following: when a galactosidase is used, galactose catabolic pathway proteins, as encoded by the galactose operon; a fucose catabolic pathway when fucosidase is used; the N-acetylglucosamine catabolic pathway using β -N-acetylhexosaminidase. By using β -N-acetylhexosaminidase for the degradation of oligosaccharides containing terminal N-acetylglucosamines, it has proved advantageous to overexpress enzymes involved in the catabolism of the monosaccharide N-acetylglucosamine. Also, if the monosaccharide released is L-fucose, it is advantageous to express the L-fucose catabolic pathway. The same is true for sialic acids and the like.

This embodiment has the advantage that monosaccharides released by the action of glycosidases can be efficiently and effectively removed from the fermentation medium by means of deregulation of the sugar catabolic pathway. Alternatively, in this way, the monosaccharide added as precursor can likewise be removed from the fermentation medium. Thus, in addition to glycosidases, the host microorganism also expresses proteins for carbohydrate catabolic pathways, such as galactose catabolic pathways, to prevent accumulation of the degradation product galactose. However, the glycosidase and the carbohydrate catabolic pathway need not be expressed by separate organisms, they may also be expressed by two different co-cultured strains, or the glycosidase may be added to a suitable strain capable of the desired monosaccharide catabolism.

According to another embodiment, and alternatively expressing the sugar catabolic pathway of the monosaccharide released, the monosaccharide released during degradation of undesired by-products, unused starting substrates and intermediates, may be imparted to its nucleotide activated form by expressing its salvage pathway and reused for oligosaccharide synthesis. Thus, for example, fucose may be imparted to GDP-fucose, or sialic acid may be imparted to CMP-Neu5 Ac.

For example, if fucose is produced as a released monosaccharide, its salvage pathway (i.e., over-expressed (highly regulated) fucose has been produced in the host microorganism) may be used to confer fucose to GDP-fucose.

In the so-called "fucose salvage pathway", fucose is first phosphorylated to fucose-1-phosphate by the enzyme fucose kinase. Fucose-1-phosphate is then converted to GDP-fucose by the action of the enzyme fucose-1-P-guanylyltransferase. Thus, according to one aspect, a microorganism may be employed which is genetically modified to express a fucose kinase and a guanylyl transferase. According to one embodiment, bacterial enzyme Fkp was used, which represents the first identified bifunctional enzyme with fucose kinase and L-fucose-1-P-guanylyltransferase. A detailed description of the production of the above-described genetically modified microorganisms can be found in WO2010/070104 a1, the disclosure of which is explicitly mentioned and the content of which is explicitly incorporated by reference.

For the fermentation of more complex oligosaccharides, a combination of glycosidases, i.e.expressed in the host microorganism, such as beta-galactosidase and beta-N-acetylhexosaminidase, which specifically degrades lacto-N-trisaccharide II (LNT-2) into N-acetylglucosamine and lactose, is used. The released N-acetylglucosamine and galactosamine can then be removed equally efficiently from the fermentation medium by deregulating or introducing specific monosaccharide transport proteins (import proteins) and monosaccharide-specific catabolic pathways.

According to another embodiment of the method and use of the present invention, the host microorganism to be employed is wild-type, expressing a protein for a carbohydrate catabolic pathway selected from at least one of the following: when a galactosidase is used, a galactose catabolic pathway protein; a fucose catabolic pathway when fucosidase is used; (ii) the N-acetylglucosamine catabolic pathway using β -N-acetylhexosaminidase; sialic acid, wherein overexpression of the protein is induced in the host microorganism during the method or the use.

This embodiment has the advantage that a host microorganism can be employed which already contains and expresses the desired protein for the carbohydrate catabolic pathway, wherein overexpression of the above-mentioned protein is induced. Overexpression can be achieved, for example, by placing the nucleic acid sequences encoding these proteins under the control of an inducible promoter, so that the expression of the genes/polynucleotides can be specifically targeted and overexpressed in this way.

Thus, the expression system construct contains regulatory regions that regulate and initiate expression. Generally, in this aspect, any system or vector suitable for maintaining, propagating or expressing a protein in a host and/or suitable for expressing a protein may be used for expression. The appropriate DNA sequence may be inserted into the expression system by any of a variety of well-known and conventional techniques, such as, for example, those set forth in Sambrook et al, supra.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization described above and below are those well known and commonly employed in the art.

Further advantages result from the description of the embodiments and the figures.

It is obvious that the features mentioned above and those yet to be explained below can be used not only in the respectively specified combination but also in other combinations or on their own without departing from the scope of the present invention.

Drawings

Several embodiments of the invention are illustrated in the drawings and are explained in more detail in the following description. In the figure:

FIG. 1, which shows the breakdown of lacto-N-tetraose and lactose by β -galactosidase. A. Shows a superimposed HPLC chromatogram of 10mM lactose and 10mM lacto-N-tetraose (true standard). B. Shows the HPLC chromatogram of a beta-galactosidase reaction containing 10mM lactose and 10mM lacto-N-tetraose taken immediately after enzyme addition. C. HPLC chromatogram showing the β -galactosidase reaction containing 10mM lactose and 10mM lacto-N-tetraose taken 3 hours after enzyme addition;

figure 2 shows a diagram showing a continuous fermentation apparatus with a first fermenter and a second fermenter suitable for producing oligosaccharides such as 2 '-fucosyllactose, 3-fucosyllactose, 2' 3-difucosyllactose, 3 '-sialyllactose, 6' -sialyllactose, according to one embodiment of the present invention;

FIG. 3 shows HPLC analysis of a cell-free medium sample before addition of a beta-galactosidase expressing E.coli strain to the fermentation. The above strains also express galactose catabolic pathway to prevent accumulation of galactose;

FIG. 4 shows HPLC analysis of a cell-free medium sample after addition of a second beta-galactosidase expressing E.coli strain to the fermentation;

figure 5 shows a diagram illustrating a continuous fermentation apparatus that may be used to produce 2' -fucosyllactose according to one embodiment of the present invention. The first fermenter vessel is used for the continuous synthesis of 2 '-fucosyl-lactose, while the second fermenter vessel, in addition to the synthesis of 2' fucosyl-lactose, is also used for removing excess substrate (lactose) and other sugar by-products;

figure 6 shows HPLC analysis of the product stream obtained from the fermenter 1. Analysis of the cell-free fermentation broth indicated the presence of lactose and 2' -fucosyllactose;

figure 7 shows an HPLC analysis of the product stream obtained from the fermenter 2. HPLC analysis showed a lack of the substrate lactose, which is metabolized by the strain by expression of the e.coli lacZ gene encoding β -galactosidase and the galactose operon, which is responsible for the metabolism of released galactose;

FIG. 8 shows HPLC analysis of cell-free media samples before addition of E.coli strains expressing β -galactosidase and β -N-acetyl-hexosaminidase to the fermentation. The above strains also express galactose catabolic pathway to prevent accumulation of galactose;

FIG. 9 shows samples taken after glycosidase and β -N-acetylhexosaminidase treatment. Comparison of the HPLC chromatograms clearly shows the disappearance of lactose and lacto-N-trisaccharide II present in the sample before the treatment with β -galactosidase and β -N-acetylhexosaminidase;

FIG. 10 shows the sequence of the galactose operon used in the construction of recombinant E.coli strains; and

FIG. 11 shows a list of oligosaccharides that can be produced according to the invention.

Detailed Description

Adding beta-galactosidase to a solution containing fermentation-derived lacto-N-tetraose and lactose (both at a concentration of 10 mM); beta-galactosidase (Sigma-Aldrich Chemie GmbH, Munich Germany, Cat. No. G6008) was added at 50 units/ml (final concentration) to break down lactose in glucose and galactose for better chromatographic separation of sugars (e.g. by size-dependent gel filtration chromatography). It can be shown that lactose is broken down into its monosaccharides galactose and glucose within a few seconds, while lacto-N-tetraose remains (see also fig. 1). These experiments demonstrated the highly selective action of purified E.coli β -galactosidase to selectively hydrolyze only the Gal (. beta.1-4) Glc glycosidic linkages and not the Gal (. beta.1-3) GlcNAc glycosidic linkages present at the non-reducing end of the lacto-N-tetraose. Thus, FIG. 1-A shows a superimposed HPLC chromatogram of 10mM lactose and 10mM lacto-N-tetraose (true standard), and FIG. 1-B shows a HPLC chromatogram of a beta-galactosidase reaction containing 10mM lactose and 10mM lacto-N-tetraose taken immediately after the addition of the enzyme. FIG. 1-C shows an HPLC chromatogram of a beta-galactosidase reaction containing 10mM lactose and 10mM lacto-N-tetraose taken 3 hours after the addition of the enzyme.

FIG. 2 shows a continuous fermentation apparatus that can be used to produce oligosaccharides such as 2 '-fucosyllactose, 3-fucosyllactose, 2', 3-difucosyllactose, 3 '-sialyllactose or 6' -sialyllactose and derivatives thereof, according to one embodiment of the present invention.

The first fermentor vessel ("fermentor 1") is used for the continuous synthesis of the desired oligosaccharides, while the second fermentor vessel ("fermentor 2") containing a microbial strain expressing a suitable glycosidase enzyme (e.g., β -galactosidase) is used for the degradation of excess monosaccharides, such as lactose and other sugars present in the culture medium, which interfere with the subsequent purification of the desired oligosaccharide product. The fermenter 1 and the fermenter 2 are connected to each other by means of a suitable conduit, and the fermentation slurry is transferred from the fermenter 1 to the fermenter 2 by a pump. Another pump removes the stream containing the desired oligosaccharide product from fermentor 2.

Decomposition of sugar mixtures by glycosidase treatment in the production of 2' -fucosyllactose

2' -fucosyllactose feed-batch fermentation, using recombinant 2' -fucosyllactose to synthesize an E.coli strain (E.coli BL21(DE3) DeltalacZ, which contains the genome-integrated 2' -fucosyltransferase encoded by the wbgL gene (EP 111151571.4) and has additional copies of E.coli lacY, manB, manC, gmd and fcl, all under the control of a strong constitutive tetracycline promoter, which contains a functional galactose operon (gal opero)n) comprising the genes galM, galK, galT and galE; see FIG. 10; forward primer P-TTACTCAGCAATAAACTGATATTCCGTCAGGCTGG (SEQ ID No. 2); reverse primer P-TTGATAATCTCGCGCTCTTCAGCAGTCAGACTTTCCATATAGAGCGTAATTTCCGTTAACGTCGGTAGTGCTGACCTTGCCGGAGG (SEQ ID No.3)), grown in defined salt medium (7g L)^-1NH₄H₃P0₄、7g L^-1K₂HP0₄、2gL^-1KOH、0.37g L^-1Citric acid, 1ml L^-1Antifoam (Struktol J673, Schill + Seilacher), 1mM CaCl₂、4mM MgS0₄0.101g L, a trace element consisting of^-1Nitrilotriacetic acid pH 6.5, 0.056g L^-1Ammonium ferric citrate, 0.01g L^-1MnCl₂x 4H₂O、0.002g L^-1CoCl₂x 6H₂O、0.001g L^{- 1}CuCl₂x 2H₂O、0.002g L^-1Boric acid, 0.009g L^-1ZnS0₄x 7H₂O、0.001g L^-1Na₂MoO₄x 2H₂O、0.002g L^-1Na₂SeO₃、0.002g L^-1NiS0₄x 6H₂O, with 2% glycerol as carbon source); the glycerol feed was made from glycerol 800g L^-1、MgS0₄2,64g L^-1And 4ml of trace element solution^-1And (4) forming. For 2' -fucosyllactose formation 216g L was used^-1Is fed with lactose. The pH was controlled by using ammonia solution (25% v/v), which also served as a nitrogen source. Lactose is supplied as a precursor for the production of 2' -fucosyllactose. The feed batch was incubated at 30 ℃ and under constant aeration and stirring for 90 hours. At 90 hours after the start of the fermentation, most of the added lactose was converted to 2' -fucosyllactose.

To remove most or all of the lactose still present in the fermentation supernatant, a second bacterial strain was added to the fermentation vessel 90 hours after the start of the fermentation (see apparatus in fig. 2). The second bacterial strain added was genetically identical to the first employed bacterial strain, however, differed only in the expression of the genomically integrated β -galactosidase and in the expression of the functional galactose operon (see fig. 10) (for D-galactose degradation). Incubation with the added helper bacterial strain resulted in the disappearance of residual lactose within 5 hours. Approximately 25ml of the initial culture of the second β -galactosidase expressing bacterial strain was added per 1L of fermentation broth.

For HPLC analysis, a cell-free sterile filtered medium sample was used and desalted by passing 350 μ Ι _ of the sample through a desalting column (Strata ABW (55 μm,70A) phenomenex, ascoffenburg, Germany). For HPLC analysis, a ReproSil Carbohydrate 5 μm,250x 4.6mm column (dr. maisch GmbH, Ammerbuch-Entringen, Germany) was used with the following conditions: eluent acetonitrile/ddH₂O (68:32), isocratic conditions (no gradient conditions) and with a flow rate of 1.4ml/min (column oven set at 35 ℃); sucrose was used as an internal standard for quantification; true standards were used for the identification of lactose and 2' -fucosyllactose. For detection, a Refractive Index Detector (RID) is employed. At the end of the fermentation process, the introduction of a glycosidase decomposition step results in a significant reduction in the complexity of the fermentation filtrate produced. FIG. 3 shows an analysis of a cell-free fermentation medium taken before glycosidase treatment and FIG. 4 shows a sample taken after glycosidase treatment. Comparison of the HPLC chromatograms clearly showed the disappearance of lactose present in the sample before the β -galactosidase treatment. The strain also expresses a galactose catabolic pathway to prevent accumulation of D-galactose.

Decomposition of sugar mixtures by glycosidase treatment in the continuous production of 2' -fucosyllactose

Continuous synthesis of 2' -fucosyllactose was achieved by using two fermentation vessels, fermentor 1 comprising a 2' -fucosyllactose fermentation strain lacking lactose degradation (escherichia coli BL21(DE3) AlacZ, which contains a genomically integrated 2' -fucosyltransferase encoded by the wbgL gene (EP 111151571.4) and has additional copies of escherichia coli lacY, manB, manC, gmd and fcl, all under the control of a strong constitutive tetracycline promoter, containing a functional galactose operon (see fig. 10) comprising genes galM, galK, gaIT and galE). Fermentor 2 contains an initial culture that is genetically similar to the 2' -fucosyllactose fermenting strain used in fermentor 1, except thatIn that this strain additionally expresses the E.coli lacZ gene encoding beta-galactosidase (see the apparatus shown in FIG. 5). For both fermenters, a defined salt medium was used, which contained 7g L^-1NH₄H₃PO₄、7g L^-1K₂HPO₄、2g L^-1KOH、0.37g L^-1Citric acid, 1ml L^-1Antifoam (Struktol J673, Schill + Seilacher), 1mM CaCl₂、4mM MgSO₄0.101g L, a trace element consisting of^-1Nitrilotriacetic acid pH 6.5, 0.056g L^-1Ammonium ferric citrate, 0.01g L^-1MnCl₂x 4H₂O、0.002g L^-1CoCl₂x 6H₂O、0.001g L^-1CuCl₂x 2H₂O、0.002g L^-1Boric acid, 0.009g L^-1ZnSO₄x 7H₂O、0.001g L^-1Na₂MoO₄x 2H₂O、0.002g L^-1Na₂SeO₃、0.002g L^-1NiSO₄x 6H₂O, and has 10mM lactose as substrate and 2% glycerol as carbon source.

As illustrated, a constant feed of medium (7g L) was supplied to fermentor 1^-1NH₄H₃PO₄、7g L^-1K₂HPO₄、2g L^-1KOH、0.37g L^-1Citric acid, 1ml L^-1Antifoam, 1mM CaCl₂、4mM MgS0₄Trace elements, consisting of 0.101g L^-1Nitrilotriacetic acid pH 6.5, 0.056g L^-1Ammonium ferric citrate, 0.01g L^-1MnCl₂x 4H₂O、0.002g L^-1CoCl₂x 6H₂O、0.001g L^-1CuCl₂x 2H₂O、0.002g L^-1Boric acid, 0.009g L^-1ZnSO₄x 7H₂O、0.001g L^-1Na₂MoO₄x 2H₂O、0.002g L^-1Na₂SeO₃、0.002g L^-1NiSO₄x 6H₂O) containing 40mM lactose and 5% glycerol. Use of New Brunswick parallel with a working volume of 1LA fermentation system (Bio-Flow/CellLGen 115) applied a continuous Flow of 20ml/h feed solution. The action of the three pumps working simultaneously then resulted in a similar production of a product stream of 20 ml/hour, containing almost only 2' -fucosyllactose as the sole sugar product.

Figure 6 shows HPLC analysis of the product stream taken from fermentor 1. Analysis of the cell-free fermentation broth indicated the presence of lactose and 2' -fucosyllactose. In contrast, fig. 7 shows HPLC analysis of the product stream obtained from the fermentor 2. HPLC analysis indicated the lack of the substrate lactose, which was metabolized by the strain through expression of the e.coli lacZ gene encoding β -galactosidase and the galactose operon, for metabolizing the released galactose.

Separation of sugar mixtures by glycosidase treatment in the production of lacto-N-tetraose

In the fermentation of lacto-N-tetraose from lactose, lacto-N-trisaccharide II (LNT-2) can accumulate in addition to the added substrate. Specific degradation of lactose and LNT-2 proved to be desirable in order to obtain a more economical fermentation filtrate for the purification of lacto-N-tetraose.

For this purpose, strains were constructed which, in addition to β -galactosidase, also express β -N-acetylhexosaminidase (encoded by the bifidobacterium bifidum JCM1254bbhl gene) for the specific degradation of LNT-2 into N-acetylglucosamine and lactose. The lactose obtained is further broken down into glucose and galactose. In view of the efficient metabolism of the obtained glucose by the organism, the E.coli BL21(DE3) strain employed was unable to catabolize galactose due to the integration of the DE3 prophage into the galactose operon. For efficient degradation of galactose, the galactose operon from E.coli K strain JM 109 was amplified and transformed into E.coli BL21(DE3) by simultaneous expression of Lamba Red recombinant protein (from episomal vector system). Coli BL21 transformants capable of galactose degradation were isolated by screening them on galactose-containing basal medium agar plates and galactose-containing McConkey agar plates.

After completion of the lacto-N-tetraose fermentation (it should be noted that alternatively the oligosaccharide mixture may be obtained via an enzymatic or chemical synthesis reaction), the engineered glycosidase strain is added to the batch fermentation. Similar to the 2' -fucosyllactose fermentation described above, degradation of the undesired oligosaccharides is complete within minutes to hours, depending on the amount of culture used for the separation step.

At the end of the fermentation process, the introduced glycosidase decomposition step results in a significant reduction in the complexity of the fermentation filtrate produced. FIG. 8 shows an analysis of a cell-free fermentation medium taken before glycosidase and β -N-acetylhexosaminidase treatment and FIG. 9 shows a sample taken after glycosidase and β -N-acetylhexosaminidase treatment. Comparison of the HPLC chromatograms clearly shows the disappearance of lactose and lacto-N-trisaccharide II present in the sample before the treatment with β -galactosidase and β -N-acetylhexosaminidase.

As indicated above, the use and method according to the present invention are particularly useful for the purification of Human Milk Oligosaccharides (HMOs) from microbial fermentation reactions. Almost all human milk oligosaccharides contain a Gal- β -1,4-Glc disaccharide subunit at the reducing end. Lactose moieties (Gal-beta-1, 4-Glc) subunits can be obtained by complete fermentation or lactose can be added as substrate to the microbial fermentation. It is often advantageous to add an excess of lactose to the fermentation in order to achieve maximum volumetric yield.

According to the present invention, and in order to remove lactose or its undesired by-products, glycosidases, such as β -galactosidase, are added to the fermentation at specific points in time of the fermentation, resulting in a specific degradation of lactose and by-products.

As described above, alternatively, a transcription-regulated (or otherwise activity-regulated) glycosidase may be induced in the production strain, or an additional strain expressing the desired activity may be added to the fermentation at a particular point in time.

As also mentioned and demonstrated above, the process of the present invention further involves the deregulation of the sugar catabolic pathway to efficiently and effectively remove monosaccharides released by the action of glycosidases from the fermentation medium. Alternatively, it is also possible in this way to likewise remove the monosaccharides added as precursors from the fermentation medium.

Sequence listing

<110> Zhannice Biotechnology, Limited liability company

<120> production of oligosaccharide

<130> 2827P108wo

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 4579

<212> DNA

<213> Escherichia coli

<400> 1

ttactcagca ataaactgat attccgtcag gctggaatac tcttcgccag gacgcaggaa 60

gcagtccggt tgcggccatt cagggtggtt cgggctgtcc ggtagaaact cgctttccag 120

agccagccct tgccagtcgg cgtaaggttc ggttccccgc gacggtgtgc cgccgaggaa 180

gttgccggag tagaattgca gagccggagc ggtggtgtag accttcagct gcaatttttc 240

atctgctgac cagacatgcg ccgccacttt cttgccatcg cctttggcct gtaacaagaa 300

tgcgtgatcg taacctttca ctttgcgctg atcgtcgtcg gcaagaaact cactggcgat 360

gattttggcg ctgcggaaat caaaagacgt tccggcgaca gatttcaggc cgtcgtgcgg 420

aatgccgcct tcatcaaccg gcagatattc gtccgccaga atctgcaact tgtgattgcg 480

cacgtcagac tgctcgccgt caagattgaa atagacgtga ttagtcatat tcaccgggca 540

aggtttatca actgtggcgc gataagtaat ggagatacgg ttatcgtcgg tcagacgata 600

ttgcaccgtc gcgccgagat tacccgggaa gccctgatca ccatcatctg aactcagggc 660

aaacagcacc tgacgatcgt tctggttcac aatctgccag cgacgtttgt cgaacccttc 720

cggcccgccg tgcagctggt taacgccctg acttggcgaa agcgtcacgg tttcaccgtc 780

aaaggtataa cggctattgg cgatacggtt ggcataacga ccaatagagg cccccagaaa 840

cgcggcctga tcctgatagc attccgggct ggcacagccg agcagcgcct cgcggacgct 900

gccatcggaa agcggaatac gggcggaaag taaagtcgca ccccagtcca tcagcgtgac 960

taccatccct gcgttgttac gcaaagttaa cagtcggtac ggctgaccat cgggtgccag 1020

tgcgggagtt tcgttcagca ctgtcctgct ccttgtgatg gtttacaaac gtaaaaagtc 1080

tctttaatac ctgtttttgc ttcatattgt tcagcgacag cttgctgtac ggcaggcacc 1140

agctcttccg ggatcagcgc gacgatacag ccgccaaatc cgccgccggt catgcgtacg 1200

ccacctttgt cgccaatcac agctttgacg atttctacca gagtgtcaat ttgcggcacg 1260

gtgatttcga aatcatcgcg catagaggca tgagactccg ccatcaactc gcccatacgt 1320

ttcaggtcgc cttgctccag cgcgctggca gcttcaacgg tgcgggcgtt ttcagtcagt 1380

atatgacgca cgcgttttgc cacgatcggg tccagttcat gcgcaacagc gttgaactct 1440

tcaatggtga catcacgcag ggctggctgc tggaagaaac gcgcaccggt ttcgcactgt 1500

tcacgacggg tgttgtattc gctgccaacc agggtacgtt tgaagttact gttgatgatg 1560

acgacagcca cacctttggg catggaaact gctttggtcc ccagtgagcg gcaatcgatc 1620

agcaaggcat gatctttctt gccgagcgcg gaaattagct gatccatgat cccgcagtta 1680

cagcctacaa actggttttc tgcttcctga ccgttaagcg cgatttgtgc gccgtccagc 1740

ggcagatgat aaagctgctg caatacggtt ccgaccgcga cttccagtga agcggaagaa 1800

cttaacccgg caccctgcgg cacattgccg ctgatcacca tgtccacgcc gccgaagctg 1860

ttgttacgca gttgcagatg tttcaccacg ccacgaacgt agttagccca ttgatagttt 1920

tcatgtgcga caatgggcgc atcgagggaa aactcgtcga gctgattttc ataatcggct 1980

gccatcacgc gaactttacg gtcatcgcgt ggtgcacaac tgatcacggt ttgataatca 2040

atcgcgcagg gcagaacgaa accgtcgttg tagtcggtgt gttcaccaat caaattcacg 2100

cggccaggcg cctgaatggt gtgagtggca gggtagccaa atgcgttggc aaacagagat 2160

tgtgtttttt ctttcagact catttcttac actccggatt cgcgaaaatg gatatcgctg 2220

actgcgcgca aacgctctgc tgcctgttct gcggtcaggt ctcgctgggt ctctgccagc 2280

atttcataac caaccataaa tttacgtacg gtggcggagc gcagcagagg cggataaaag 2340

tgcgcgtgca gctgccagtg ttgattctct tcgccattaa atggcgcgcc gtgccagccc 2400

atagagtagg ggaaggagca ctggaagagg ttgtcataac gactggtcag ctttttcaac 2460

gccagcgcca gatcgctgcg ctgggcgtcg gtcaaatcgg tgatccgtaa aacgtgggct 2520

ttgggcagca gtagcgtttc gaacggccag gcagcccagt aaggcacgac ggctaaccag 2580

tgttcggttt cgacaacggt acggctaccg tctgccagct cgcgctgaac ataatccacc 2640

agcattggtg atttctgttc ggcaaaatat tctttttgca ggcggtcttc gcgctcagct 2700

tcgttaggca ggaagctatt tgcccaaatc tgaccgtgcg gatgcgggtt agagcagccc 2760

atcgccgcgc ctttgttttc aaaaacctgc acccatgggt acgttttccc cagttctgcg 2820

gtttgctcct gccaggtttt gacgatttcc gtcaatgctg caacgctgag ctctggcagc 2880

gttttactgt gatccggtga aaagcagatc acccggctgg tgccgcgcgc gctctggcaa 2940

cgcatcagcg gatcgtgact ttctggcgca tctggcgtgt cagacatcaa agccgcaaag 3000

tcattagtga aaacgtaagt cccggtgtaa tcggggtttt tatcgcctgt cacccgcaca 3060

ttacctgcgc agaggaagca atctggatcg tgcgcaggta acacctgttt ggctggcgtt 3120

tcctgcgccc cctgccaggg gcgcttagcg cggtgcggtg aaaccagaat ccattgcccg 3180

gtgagcgggt tgtagcggcg atgtggatga tcaacgggat taaattgcgt catggtcgtt 3240

ccttaatcgg gatatccctg tggatggcgt gactgccagt gccaggtgtc ctgcgccatt 3300

tcatcgagtg tgcgcgttac gcgccagttc agttcacggt cggctttgct ggcgtccgcc 3360

cagtaggccg gaaggtcgcc ctcgcgacgc ggtgcaaaat gataattaac cggtttgccg 3420

caggctttgc tgaaggcatt aaccacgtcc agcacgctgt tgcctacgcc agcgccgagg 3480

ttgtagatgt gtacgcctgg cttgttcgcc agtttttcca tcgccacgac gtgaccgtcc 3540

gccagatcca ttacgtggat gtaatcgcgt acgccagtac catcttcggt cggataatcg 3600

ttaccaaaaa tcgccagcga gtcgcgacgg cctacagcaa cctgggcgat gtatggcatc 3660

aggttattcg gaatgccttg cggatcttcg cccatatcgc ccgacggatg cgcgccaacc 3720

gggttgaagt agcgcagcag ggcaatgctc cagtccggct gggctttttg cagatcggtg 3780

aggatctgtt ccaccatcag cttgcttttg ccgtaagggc tttgcggtgt gccggtcggg 3840

aagctttcaa cgtatggaat tttgggctga tcgccataaa cggtggcgga ggagctaaaa 3900

ataaagtttt tgacgttagc ggcgcgcatg gcgctaatca ggcgcagagt gccgttgaca 3960

ttgttgtcgt aatattccag cggtttttgt accgattcgc ccacggcttt cagcccggcg 4020

aagtggatca cggtgtcgat agcgtgatcg tgcaggatct cggtcatcaa cgcttcgtta 4080

cgaatatcgc cttcaacaaa cgttggatgt ttgccgccta aacgctcgat aacaggcagt 4140

acgctgcgct tactgttaca gaggttatca agaatgatga catcatgacc gttttgcagt 4200

aattgcacac aggtatgact tccaatgtaa ccgctaccac cggtaaccag aactctcata 4260

attcgctcca ttaggcttat ggtatgaaat aaccatagca taacaaagat gcgaaaagtg 4320

tgacatggaa taaattagtg gaatcgttta cacaagaatt tagccgtttt ttatgcgcga 4380

ttaagtgatt ataaaacaga gggtttatga atgattgcgc tttttatctg aaaaaagacg 4440

cggtttcatg cctgcatgcg tcgaaccgtt ggccggagag ggtgctaagg ccgcctccgg 4500

caaggtcagc actaccgacg ttaacggaaa ttacgctcta tatggaaagt ctgactgctg 4560

aagagcgcga gattatcaa 4579

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer

<400> 2

ttactcagca ataaactgat attccgtcag gctgg 35

<210> 3

<211> 86

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 3

ttgataatct cgcgctcttc agcagtcaga ctttccatat agagcgtaat ttccgttaac 60

gtcggtagtg ctgaccttgc cggagg 86