阅读说明：本技术 基因突变体及其应用 (gene mutant and application thereof ) 是由 江宠颐 方明艳 刘晓 伦纳特·哈马斯特罗姆 孙宇辉 陈玲燕 于 2018-06-11 设计创作，主要内容包括：本发明公开了核酸、基因突变及其应用。其中,该核酸,与野生型RAD50基因相比,所述核酸具有选自下列的至少一种突变类型：c.379G>A、c.137T>A/c.980G>A或c.494C>A/c.980G>A。通过检测这些突变在生物样品中是否存在,可以有效地检测生物样品是否患免疫缺陷病。(The invention discloses nucleic acid, gene mutation and application thereof. Wherein the nucleic acid has at least one mutation type selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. By detecting the presence of these mutations in a biological sample, it is possible to effectively detect whether the biological sample is afflicted with immunodeficiency.)

1. a nucleic acid, wherein the nucleic acid is a nucleic acid,

The nucleic acid has at least one type of mutation selected from the group consisting of:

c.379G > A, c.137T > A/c.980G > A, or c.494C > A/c.980G > A;

Optionally, the nucleic acid is DNA.

2. a genetic mutation, wherein said nucleic acid has at least one type of mutation selected from the group consisting of:

c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A.

3. A protein characterized in that it is capable of producing,

(ii) said protein has at least one of the following position mutations compared to the amino acid sequence of the protein expressed by said wild-type RAD50 gene:

(1) isoleucine at position 46 of the amino acid sequence is mutated into valine, arginine at position 327 is mutated into histidine, and the protein has amino acid sequence shown in SEQ ID NO: 1;

(2) Valine at the 127 th site of the amino acid sequence is mutated into isoleucine, the site is homozygous mutation, and the protein has the amino acid sequence shown as SEQ ID NO: 2;

(3) Proline at position 165 of the amino acid sequence is mutated into histidine, arginine at position 327 is mutated into histidine, and the protein has the amino acid sequence shown as SEQ ID NO: 3.

4. Use of a reagent for detecting the nucleic acid of claim 1 or the genetic mutation of claim 2 or the protein of claim 3 for the preparation of a kit for the diagnosis of immunodeficiency disorders.

5. the use of claim 4, the reagent comprising at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation, and the protein, a probe, a primer, and a mass spectrometry detection reagent;

Optionally, the immunodeficiency disorder is a primary immunodeficiency disorder;

preferably, the primary immunodeficiency disease comprises variant immunodeficiency disease and selective IgA deficiency.

6. Use of a biological model for screening for a drug, the biological model carrying at least one of:

(1) The nucleic acid of claim 1;

(2) a mutation of the gene of claim 2;

(3) Expressing the protein of claim 3.

7. Use according to claim 6, wherein the biological model is a cellular or animal model.

8. a medicament for treating immunodeficiency disorders, said medicament comprising:

an agent that specifically alters the nucleic acid of claim 1 or the gene of claim 2.

9. the medicament according to claim 8, wherein the agent is an agent based on a gene editing or nucleic acid synthesis method;

Optionally, the immunodeficiency disorder is a primary immunodeficiency disorder;

preferably, the primary immunodeficiency disease comprises variant immunodeficiency disease and selective IgA deficiency;

optionally, the nucleic acid or the gene is mutated to c.379G > A or c.137T > A/c.980G > A, and the primary immunodeficiency disease is variant immunodeficiency disease;

the nucleic acid or the gene mutation is c.494C > A/c.980G > A, and the primary immunodeficiency disease is selective IgA defect.

10. A system for screening a biological sample for immunodeficiency disease comprising:

A nucleic acid extraction device for extracting a nucleic acid sample from the biological sample;

A nucleic acid sequence determining device connected with the nucleic acid extracting device and used for analyzing the nucleic acid sample so as to determine the nucleic acid sequence of the nucleic acid sample;

A judging means connected to the nucleic acid sequence determining means so as to have at least one mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A mutation, judging that the biological sample is suffering from the immunodeficiency disease,

Optionally, the nucleic acid extraction device further comprises:

An RNA extraction unit for extracting an RNA sample from the biological sample; and

a reverse transcription unit connected to the RNA extraction unit for performing a reverse transcription reaction on the RNA sample to obtain a cDNA sample, the cDNA sample constituting the nucleic acid sample;

optionally, the nucleic acid extraction device further comprises:

A DNA extraction unit and/or a target nucleic acid capture enrichment unit, wherein the DNA extraction unit is used for extracting a DNA sample from the biological sample, the target nucleic acid enrichment capture unit is used for enriching and capturing target nucleic acid from the biological sample, and the DNA sample and/or the target nucleic acid form the nucleic acid sample;

optionally, the immunodeficiency disorder is a primary immunodeficiency disorder;

Preferably, the primary immunodeficiency disease comprises variant immunodeficiency disease and selective IgA deficiency;

Optionally, the mutation is c.379G > A or c.137T > A/c.980G > A, and the primary immunodeficiency disease is variant immunodeficiency disease;

optionally, the mutations are c.494C > A/c.980G > A, and the primary immunodeficiency disease is selective IgA deficiency.

11. The system of claim 10, wherein the nucleic acid sequence determination device further comprises:

A library construction unit for constructing a nucleic acid sequencing library for the nucleic acid sample; and

the sequencing unit is connected with the library construction unit and is used for sequencing the nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data;

Optionally, the library construction unit further comprises:

a PCR amplification module, wherein at least one primer selected from RAD50 gene exon-specific primers is arranged in the PCR amplification module, so that the nucleic acid sample is subjected to PCR amplification by using at least one primer selected from RAD50 gene exon-specific primers;

optionally, the step of (a) is carried out,

the RAD50 gene No. 2 exon specific primer has the sequence shown in SEQ ID NO: 4-5, wherein the nucleotide sequence is shown in the specification,

The RAD50 gene No. 4 exon specific primer has the sequence shown in SEQ ID NO: 6-7, wherein the nucleotide sequence is shown in the specification,

The RAD50 gene No. 7 exon specific primer has the sequence shown in SEQ ID NO: 8-9, and the nucleotide sequence shown in the sequence table,

aiming at c.379G > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 6-7, wherein the nucleotide sequence is shown in the specification,

the RAD50 gene exon-specific primers have the amino acid sequence shown in SEQ ID NO: 4-5, wherein the nucleotide sequence is shown in the specification,

Aiming at c.980G > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 8-9, and the nucleotide sequence shown in the sequence table,

Aiming at c.494C > A mutation, the RAD50 gene exon-specific primer has the sequence shown in SEQ ID NO: 6-7.

12. a kit for screening a biological sample for immunodeficiency disease, comprising:

Reagent suitable for detecting at least one of RAD50 gene mutants, wherein

the nucleic acid has at least one mutation selected from the group consisting of:

c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A;

optionally, the immunodeficiency disorder is a primary immunodeficiency disorder;

Optionally, the primary immunodeficiency disease comprises variant immunodeficiency disease and selective IgA deficiency;

optionally, the mutation is c.379G > A or c.137T > A/c.980G > A, and the primary immunodeficiency disease is variant immunodeficiency disease;

optionally, the mutations are c.494C > A/c.980G > A, and the primary immunodeficiency disease is selective IgA deficiency;

optionally, the reagents include at least one of antibodies, probes, primers, and mass spectrometry detection reagents specific for the RAD50 gene mutant or for expressing the RAD50 gene mutein.

13. A construct comprising the nucleic acid of claim 1 or the genetic mutation of claim 2.

14. A recombinant cell obtained by transforming a recipient cell with the construct of claim 13 or expressing the protein of claim 3.

Technical Field

The invention relates to a gene mutant and application thereof. In particular, the invention relates to nucleic acids, gene mutations, proteins, systems for screening biological samples for immunodeficiency disorders, drugs for screening for treatment of immunodeficiency disorders, kits for screening biological samples for immunodeficiency disorders, biological models, constructs and recombinant cells.

Background

Common Variant Immunodeficiency Disease (CVID) and selective IgA deficiency (SIgAD) are the most common Primary Immunodeficiency Diseases (PID). The proportion of these two diseases accounts for one fourth of the worldwide PID. CVID is mainly characterized by a reduction in serum immunoglobulins, in particular IgA, IgE and IgG, with an incidence of about 1/50000. CVID has high heterogeneity in clinical presentation, and patients may have recurrent mucosal infections, and 20% to 30% of them are associated with autoimmune diseases, splenomegaly and malignancies. CVID is inherited in an indefinite manner, and is found to be both frequently stained invisible inheritance and autosomal dominant inheritance. SIgAD has a genetic pattern similar to CVID, and can be either autosomal recessive inheritance or autosomal dominant inheritance, or sporadic pathogenesis. The incidence rate of the SIgAD has ethnic specificity, the incidence rate of caucasians is about 1/223-1/1000, and the incidence rate of the caucasian adults is 1/18500 in Japan; the prevalence rate of SIGAD in China is 1/4100. SIgAD patients may be asymptomatic for a long period of time, with many patients presenting only upper respiratory tract infections; some patients have various concomitant diseases, especially autoimmune diseases (about 50%) and allergic diseases; some patients are accompanied by mental retardation and sensory nerve abnormality and are closely related to primary epilepsy; some patients also have concomitant asthma, and about 10% of european and american asthmatics are diagnosed with SIgAD. Studies have found that some patients with SIgAD develop CVID, and CVID patients have been found in other SIgAD families, evidence that CVID and SIgAD may be caused by the same genetic mutation.

meanwhile, exome refers to the collection of all exome regions of the human genome, including flanking sequences of the protein coding region and the untranslated region, which encompass most of the functional variations associated with an individual's phenotype. The exome sequencing technology is a method for performing high-throughput sequencing and bioinformatics analysis by using a second generation sequencing technology after capturing and enriching exome sequences of a human genome by using a special probe. The human genome-wide has 180,000 exons, accounting for 1% of the genome-wide sequence, and 85% of the pathogenic mutations (especially those of rare diseases) are located in this region. Therefore, exome sequencing analysis is more economical and efficient than whole genome sequencing analysis for rare diseases such as CVID and SIgAD. In addition, under the condition of the same budget, the sequencing depth of the exon is higher, and the discovery of a new pathogenic gene is facilitated. The new pathogenic gene discovered by exome sequencing technology can be verified by adopting target gene association analysis in patients with large sample amount and normal control, and more pathogenic sites can be discovered at lower sequencing cost.

disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. To this end, it is an object of the present invention to propose a method which enables efficient screening of biological samples suffering from immunodeficiency diseases.

The current human mendelian genetic database (OMIM) includes 13 CVID subtypes, 13 virulence genes (CR2, IRF2BP2, ICOS, NFKB1, IL21, LRBA, IKZF1, NFKB2, CD81, MS4a1, CD19, TNFRSF13B and TNFRSF 13C). OMIM only records one pathogenic gene TNFRSF13B of SIgAD. However, despite the discovery of several CVID and one SIgAD causative gene, the cause of morbidity in many patients remains unexplained. Therefore, it is important to find more new CVID and SIgAD virulence genes as soon as possible to improve the early diagnosis and treatment effects of CVID and SIgAD.

based on the above facts and findings, the inventors cloned RAD50, a new causative gene of CVID and SIGAD, and found, by high-throughput exome sequencing, that CVID would be produced if RAD50 of a biological sample were homozygous c.379G > A or compound heterozygous c.137T > A/c.980G > A; SIGAD will develop if RAD50 from a biological specimen undergoes complex shuffling c.494C > A/c.980G > A.

it should be noted that c.379G > A referred to in this application means that the 379 th base of the coding region of RAD50 gene is homozygously changed by G- > A; c.137T > A/c.980G > A refers to heterozygous T- > A change at the 137 th base of a coding region of the RAD50 gene and heterozygous G- > A change at the 980 th base of the coding region; c.494C > A/c.980G > A refers to hybrid C- > A change at the 494 th base of a coding region of the RAD50 gene and hybrid G- > A change at the 980 th base of the coding region.

according to a first aspect of the invention, a nucleic acid is presented. According to embodiments of the invention, the nucleic acid has at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. According to the embodiment of the invention, the inventor clones a new CVID and SIGAD virulence gene RAD50 gene, and determines that the mutation of RAD50 gene to at least one of the genes is closely related to the onset of primary immunodeficiency diseases (CVID and SIGAD), so that whether a biological sample is suffering from immunodeficiency diseases, especially CVID and SIGAD, can be effectively detected by detecting whether the mutants exist in the biological sample.

according to a second aspect of the invention, the invention proposes a genetic mutation. According to embodiments of the invention, the nucleic acid has at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. According to the embodiment of the invention, the inventor discovers a novel CVID and SIGAD virulence gene RAD50 gene, and determines that the mutation of RAD50 gene according to the embodiment of the invention is closely related to the onset of immunodeficiency diseases, especially primary immunodeficiency diseases such as CVID and SIGAD, so that whether a biological sample is suffering from immunodeficiency diseases, especially whether the biological sample is suffering from primary immunodeficiency diseases such as CVID and SIGAD can be effectively detected by detecting whether the RAD50 gene is mutated at the position in the biological sample.

According to a third aspect of the invention, the invention proposes a protein. According to embodiments of the invention, the protein has at least one type of mutation, as compared to the amino acid sequence of the protein expressed by the wild-type RAD50 gene, of: (1) isoleucine at position 46 of the amino acid sequence is mutated into valine, arginine at position 327 is mutated into histidine ammonia, and the protein has amino acid sequence shown in SEQ ID NO: 1; (2) and the amino acid sequence is 127 th, and valine mutation is homozygous mutation to isoleucine mutation, and the protein has the amino acid sequence shown as SEQ ID NO: 2; (3) proline at position 165 of the amino acid sequence is mutated into histidine, arginine at position 327 is mutated into histidine, and the protein has the amino acid sequence shown as SEQ ID NO: 3. The inventors cloned a new CVID and SIgAD virulence genes, RAD50 gene, and determined that mutations in RAD50 gene according to the examples of the invention were closely associated with the onset of primary immunodeficiency disease, particularly CVID and SIgAD, and therefore by detecting the presence of proteins expressing these mutated RAD50 genes in biological samples, it was possible to effectively detect whether biological samples are afflicted with primary immunodeficiency disease, particularly CVID and SIgAD.

According to a fourth aspect of the invention, the invention provides the use of a reagent for detecting a nucleic acid as defined above or a mutation in a gene as defined above or a protein as defined above for the preparation of a kit. According to an embodiment of the invention, the agent is for diagnosing primary immunodeficiency disease. According to the embodiment of the invention, the reagent can effectively screen biological samples with immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD, and can be further used for preparing a kit for screening the biological samples with the primary immunodeficiency diseases, particularly the primary immunodeficiency diseases such as CVID and SIgAD.

according to a fifth aspect of the invention, the invention proposes the use of a biological model for screening a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the protein as described above. It is to be noted that "the biological model carries the aforementioned nucleic acid" means that the biological model of the present invention carries at least one type of mutation selected from the following mutations compared with the wild-type RAD50 gene: the nucleic acid sequence of the RAD50 gene mutant of c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or the nucleic acid sequences of the various gene mutants are contained at the same time; by "biological model carries the aforementioned gene mutations," it is meant that the biological model of the invention carries a RAD50 gene having at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A, or simultaneously contains the mutations of the RAD50 genes. "biological model carries the aforementioned protein" means that the biological model of the invention carries at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: the protein expressed by RAD50 gene mutant of c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or the protein expressed by gene containing the above-mentioned various gene mutations. The biological model according to the embodiment of the present invention can be effectively used as a model for the study related to immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD.

according to a sixth aspect of the invention, there is provided a medicament for use in the treatment of immunodeficiency disorders. According to an embodiment of the invention, the medicament comprises: an agent which specifically alters the aforementioned nucleic acid or the aforementioned gene mutation or the aforementioned protein. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene or the mutated protein is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. The medicament according to the embodiment of the invention can specifically prevent or treat immunodeficiency diseases, in particular primary immunodeficiency diseases such as CVID and SIgAD.

according to a seventh aspect of the invention, there is provided a method of screening a biological sample for immunodeficiency disease. According to an embodiment of the invention, the method comprises the steps of: extracting a nucleic acid sample from a biological sample; determining the nucleic acid sequence of the nucleic acid sample; the nucleic acid sequence of the nucleic acid sample, or a complement thereof, having at least one type of mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A are indications that the biological sample is suffering from immunodeficiency. By the method for screening biological samples with immunodeficiency diseases according to the embodiment of the invention, biological samples with immunodeficiency diseases, especially primary immunodeficiency diseases such as CVID and SIgAD can be effectively screened.

According to an eighth aspect of the invention, a system for screening a biological sample for immunodeficiency disease is provided. According to an embodiment of the invention, the system comprises: a nucleic acid extraction device for extracting a nucleic acid sample from the biological sample; a nucleic acid sequence determining device connected with the nucleic acid extracting device and used for analyzing the nucleic acid sample so as to determine the nucleic acid sequence of the nucleic acid sample; a judging means connected to the nucleic acid sequence determining means so that the nucleic acid has at least one type of mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A, and judging whether the biological sample has the immunodeficiency disease. By using this system, the aforementioned method for screening a biological sample for immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD can be effectively carried out, and a biological sample for immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD can be effectively screened.

According to a ninth aspect of the invention, a kit for screening a biological sample for immunodeficiency disease is provided. According to an embodiment of the invention, the kit comprises: a reagent suitable for detecting at least one of RAD50 gene mutants, wherein the nucleic acid has at least one type of mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. By using the kit provided by the embodiment of the invention, biological samples suffering from immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD can be effectively screened.

according to a tenth aspect of the invention, a construct is presented. According to an embodiment of the invention, the construct comprises the nucleic acid or the genetic mutation as described above. It is noted that by "the construct comprises the nucleic acid as described above" it is meant that the construct of the invention comprises at least one type of mutation in the nucleic acid compared to the wild-type RAD50 gene, selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or simultaneously contains the nucleic acid sequences of the various gene mutants. By "the construct comprises a mutation in a gene as described above" is meant that the construct of the invention comprises a RAD50 gene having at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or simultaneously contains the various gene mutations. Thus, the recombinant cells obtained by transforming the receptor cells with the construct of the present invention can be effectively used as a model for studies related to immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIGAD.

according to an eleventh aspect of the invention, the invention also provides a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct or the protein. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for studies related to immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIGAD.

additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

drawings

the above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a schematic diagram of a system for screening a biological sample for immunodeficiency disease according to an embodiment of the invention,

FIG. 2 is a schematic view of a system for screening a biological sample for immunodeficiency disease further comprising a nucleic acid extraction device according to an embodiment of the present invention,

FIG. 3 is a schematic diagram of a system for screening a biological sample for immunodeficiency disease (further including a nucleic acid sequence determination device) according to an embodiment of the invention;

FIG. 4: shows 3 CVID and SIgAD family maps for the detection of new disease-causing sites according to one embodiment of the present invention, where families 1 and 2 are CVID families whose disease-causing sites are determined by exon sequencing techniques; family 3 is a SIGAD family, pathogenic sites of the RAD50 gene are determined by scanning the RAD50 gene, a square represents a male, a circle represents a female, a diamond represents that the gender is unknown, colors are not filled in the graph to represent a normal person, a black color in the graph represents a patient, an arrow indicates that the patient is a proband, and a slash represents that the detected person is died;

FIG. 5: shows the results of Sanger sequencing of the RAD50 gene according to CVID families 1 and 2, according to one embodiment of the invention;

FIG. 6: protein products from two transcripts of the RAD50 gene (ENST00000265335 and ENST00000453394) are shown to be involved in a wide variety of physiological and biochemical pathways, according to one embodiment of the present invention;

FIG. 7: showing comparative analysis of RAD50 gene homology (BLAST results), according to one embodiment of the present invention;

FIG. 8: a cartoon representation of the RAD50 protein is shown, according to one embodiment of the present invention, wherein,

a is the position of the identified mutation on the exon according to the embodiments of the present invention,

b is the position of the mutation according to the embodiment of the present invention in the protein domain,

c is the position of the mutation according to the embodiment of the present invention in the spatial structure of the protein,

D is the position of a mutation according to an embodiment of the invention at the nuclease complex MRN;

FIG. 9: showing that the RAD50 mutation affects DNA repair as demonstrated by cellular experiments, according to one embodiment of the present invention,

A is the chromosome fragmentation and fusion of patient P1 (indicated by the arrow) according to the present invention,

B is the comparison of the analysis of chromatin abnormality at G0 and G2 between the patient P1 and the control group (30 normal controls and 6A-T patients) according to the example of the present invention,

C is MN length usage analysis of RAD50 patients versus control groups (normal control, MRE11 patients, NBS patients, and DNA ligase 4 deficiency patients) according to an embodiment of the invention.

Reference numerals: the system 1000 for screening biological samples with immunodeficiency diseases, a nucleic acid extracting device 100, a nucleic acid sequence determining device 200, a judging device 300, an RNA extracting unit 101, a reverse transcription unit 102, a DNA extracting unit 103, a target nucleic acid capturing and enriching unit 104, a library constructing unit 201 and a sequencing unit 202.

Detailed Description

the following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention.

it is understood by those skilled in the art that the position of the wild-type RAD50 gene sequence used herein is based on the sequence of the wild-type RAD50 gene in the human genome, but that when the wild-type RAD50 gene is present in other species, the sequence will differ, and the corresponding position in the wild-type RAD50 gene of that species can be obtained by aligning the wild-type RAD50 gene of that species with the human wild-type RAD50 gene.

nucleic acids

according to a first aspect of the invention, a nucleic acid is presented. According to embodiments of the invention, the nucleic acid has at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. It is to be noted that the nucleic acid of the present invention encoding the RAD50 mutant, which may also be referred to as "nucleic acid encoding the RAD50 mutant", i.e., the nucleic acid may be understood as the nucleic acid substance corresponding to the gene encoding the RAD50 mutant, i.e., the type of nucleic acid is not particularly limited, and may be any polymer comprising deoxyribonucleotides and/or ribonucleotides corresponding to the gene encoding RAD50, including but not limited to DNA, RNA or cDNA. According to a specific example of the present invention, the nucleic acid encoding the RAD50 mutant described above is DNA. According to the embodiment of the invention, the inventor clones a new CVID and SIgAD virulence gene, namely RAD50 gene, and determines that the RAD50 gene mutant is closely related to the onset of primary immunodeficiency diseases such as CVID and SIgAD, so that whether a biological sample suffers from the primary immunodeficiency diseases, particularly CVID and SIgAD can be effectively detected by detecting whether the mutant exists in the biological sample.

for the purposes of the present description and claims, reference to nucleic acids will be understood by those skilled in the art to include virtually either or both of the complementary strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to SEQ ID NO 10 to SEQ ID NO 15 actually includes the complementary sequences thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.

The inventors found that mutants of RAD50 gene, compared to the wild-type RAD50 gene, have at least one type of mutation selected from the group consisting of: homozygous G- > A alteration at base 379 of the coding region of RAD50 gene (c.379G > A); heterozygous T- > A change at base 137 of the coding region and heterozygous G- > A change at base 980 of the coding region of the RAD50 gene (c.137T > A/c.980G > A); the 494 th base of the coding region of the RAD50 gene was heterozygous for a C- > A change and the 980 th base of the coding region was heterozygous for a G- > A change (c.494C > A/c.980G > A).

the inventor firstly proposes the RAD50 gene as a virulence gene of CVID and SIGAD, and firstly discovers that c.379G > A or c.137T > A/c.980G > A mutation of the RAD50 gene can cause a patient to suffer from CVID; the c.494C > A/c.980G > A of the RAD50 gene can cause patients to suffer from SIGAD.

it is to be noted that the cDNA and/or genomic DNA sequence of the above wild-type gene can be obtained from the following website:

the acquisition site of the RAD50 genomic DNA sequence is shown below:

http://grch37.ensembl.org/Homo_sapiens/Transcript/Summary？db＝core；g＝ENSG00000113522；r＝5:131892630-131979752；t＝ENST00000378823。

According to a specific embodiment of the present invention, the wild-type RAD50 gene exon region No. 2 has the amino acid sequence as shown in SEQ ID NO:10, wherein the underlined base sites are sites susceptible to mutation.

ACCATCATTGAATGTCTAAAATATATTTGTACTGGAGATTTCCCTCCTGGAACCAAAGGAAATACATTTGTACACGATCCCAAG(SEQ ID NO：10)。

The wild type RAD50 gene No. 4 exon region has the sequence shown in SEQ ID NO: 11, wherein the underlined base sites are sites susceptible to mutation.

GCATGGTGAAAAGGTCAGTCTGAGCTCTAAGTGTGCAGAAATTGACCGAGAAATGATCAGTTCTCTTGGGGTTTCCAAGGCTGTGCTAAATAATGTCATTTTCTGTCATCAAGAAGATTCTAATTGGCCTTTAAGTGAAGGAAAGGCTTTGAAGCAAAAGTTTGATGAGATTTTTTCAGCAACAAG(SEQ ID NO：11)。

The wild type RAD50 gene No. 7 exon region has the sequence shown in SEQ ID NO: 12, wherein the underlined base positions are positions susceptible to mutation.

GTTTTTCAAGGGACTGATGAGCAACTAAATGACTTATATCACAATCACCAGAGAACAGTAAGGGAGAAAGAAAGGAAATTGGTAGACTGTCATCGTGAACTGGAAAAACTAAATAAAGAATCTAGGCTTCTCAATCAGGAAAAATCAGAACTGCTTGTTGAACAGG(SEQ ID NO：12)。

Gene mutation

according to a second aspect of the invention, the invention proposes a genetic mutation. According to embodiments of the invention, the nucleic acid has at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. In other words, the genetic mutation is located in at least one of the following positions of the nucleotide sequence of the RAD50 gene, i.e., compared to the wild-type RAD50 gene: the gene mutation is positioned at 8 th position of the No. 2 exon of the RAD50 gene and is changed from T mutation to A mutation, and the No. 2 exon of the RAD50 gene after the gene mutation has the nucleotide sequence shown as SEQ ID NO: 13; the gene mutation is located at 14 th and 129 th of the RAD50 gene No. 4 exon, G mutation is A, and C mutation is A, and the RAD50 gene No. 4 exon after the gene mutation has the nucleotide sequence shown in SEQ ID NO: 14; the gene mutation is positioned at 95 of the 7 th exon of the RAD50 gene and is from G mutation to A mutation, and the 7 th exon of the RAD50 gene after the gene mutation has the nucleotide sequence shown as SEQ ID NO:15, or a nucleotide sequence as set forth in seq id no. According to the embodiments of the present invention, the inventors discovered a new causative gene of CVID and SIGAD, RAD50 gene, and determined that the occurrence of mutation of RAD50 gene according to the embodiments of the present invention is closely related to the onset of primary immunodeficiency diseases (CVID and SIGAD), so that whether a biological sample suffers from primary immunodeficiency diseases, particularly CVID and SIGAD, can be effectively examined by examining whether the above mutation of RAD50 gene occurs at the above-mentioned site in the biological sample. Wherein, SEQ ID NO: 13-15 As shown below, the underlined base sites are the sites where the mutation occurs.

ACCATCAATGAATGTCTAAAATATATTTGTACTGGAGATTTCCCTCCTGGAACCAAAGGAAATACATTTGTACACGATCCCAAG(SEQ ID NO：13)。

GCATGGTGAAAAGATCAGTCTGAGCTCTAAGTGTGCAGAAATTGACCGAGAAATGATCAGTTCTCTTGGGGTTTCCAAGGCTGTGCTAAATAATGTCATTTTCTGTCATCAAGAAGATTCTAATTGGCATTTAAGTGAAGGAAAGGCTTTGAAGCAAAAGTTTGATGAGATTTTTTCAGCAACAAG(SEQ ID NO：14)。

GTTTTTCAAGGGACTGATGAGCAACTAAATGACTTATATCACAATCACCAGAGAACAGTAAGGGAGAAAGAAAGGAAATTGGTAGACTGTCATCATGAACTGGAAAAACTAAATAAAGAATCTAGGCTTCTCAATCAGGAAAAATCAGAACTGCTTGTTGAACAGG(SEQ ID NO：15)。

Protein

according to a third aspect of the invention, the invention proposes a protein. According to embodiments of the invention, the protein has at least one type of mutation, as compared to the amino acid sequence of the protein expressed by the wild-type RAD50 gene, of: (1) isoleucine at position 46 of the amino acid sequence is mutated into valine, arginine at position 327 is mutated into histidine, and the protein has amino acid sequence shown in SEQ ID NO: 1; (2) valine at the 127 th site of the amino acid sequence is mutated into isoleucine, the site is homozygous mutation, and the protein has the amino acid sequence shown as SEQ ID NO: 2; (3) the proline at position 165 of the amino acid sequence is mutated to histidine, and the arginine at position 327 is mutated to histidine, and the protein has the amino acid sequence shown as SEQ ID NO: 3. The inventor finds a new CVID and SIgAD virulence gene, namely RAD50 gene, and determines that the mutation of RAD50 gene according to the embodiment of the invention is closely related to the onset of immunodeficiency diseases, especially primary immunodeficiency diseases such as CVID and SIgAD, so that whether a biological sample suffers from immunodeficiency diseases, especially primary immunodeficiency diseases such as CVID and SIgAD, can be effectively detected by detecting whether protein expressing the mutated RAD50 gene exists in the biological sample.

according to an embodiment of the invention, the protein expressed by the wild-type RAD50 gene has the amino acid sequence as shown in SEQ ID NO: 16, wherein the underlined amino acid positions are positions at which mutations are easy to occur.

MSRIEKMSILGVRSFGIEDKDKQIITFFSPLTILVGPNGAGKTTIIECLKYICTGDFPPGTKGNTFVHDPKVAQETDVRAQIRLQFRDVNGELIAVQRSMVCTQKSKKTEFKTLEGVITRTKHGEKVSLSSKCAEIDREMISSLGVSKAVLNNVIFCHQEDSNWPLSEGKALKQKFDEIFSATRYIKALETLRQVRQTQGQKVKEYQMELKYLKQYKEKACEIRDQITSKEAQLTSSKEIVKSYENELDPLKNRLKEIEHNLSKIMKLDNEIKALDSRKKQMEKDNSELEEKMEKVFQGTDEQLNDLYHNHQRTVREKERKLVDCHRELEKLNKESRLLNQEKSELLVEQGRLQLQADRHQEHIRARDSLIQSLATQLELDGFERGPFSERQIKNFHKLVRERQEGEAKTANQLMNDFAEKETLKQKQIDEIRDKKTGLGRIIELKSEILSKKQNELKNVKYELQQLEGSSDRILELDQELIKAERELSKAEKNSNVETLKMEVISLQNEKADLDRTLRKLDQEMEQLNHHTTTRTQMEMLTKDKADKDEQIRKIKSRHSDELTSLLGYFPNKKQLEDWLHSKSKEINQTRDRLAKLNKELASSEQNKNHINNELKRKEEQLSSYEDKLFDVCGSQDFESDLDRLKEEIEKSSKQRAMLAGATAVYSQFITQLTDENQSCCPVCQRVFQTEAELQEVISDLQSKLRLAPDKLKSTESELKKKEKRRDEMLGLVPMRQSIIDLKEKEIPELRNKLQNVNRDIQRLKNDIEEQETLLGTIMPEEESAKVCLTDVTIMERFQMELKDVERKIAQQAAKLQGIDLDRTVQQVNQEKQEKQHKLDTVSSKIELNRKLIQDQQEQIQHLKSTTNELKSEKLQISTNLQRRQQLEEQTVELSTEVQSLYREIKDAKEQVSPLETTLEKFQQEKEELINKKNTSNKIAQDKLNDIKEKVKNIHGYMKDIENYIQDGKDDYKKQKETELNKVIAQLSECEKHKEKINEDMRLMRQDIDTQKIQERWLQDNLTLRKRNEELKEVEEERKQHLKEMGQMQVLQMKSEHQKLEENIDNIKRNHNLALGrQKGYEEEIIHFKKELREPQFRDAEEKYREMMIVMRTTELVNKDLDIYYKTLDQAIMKFHSMKMEEINKIIRDLWRSTYRGQDIEYIEIRSDADENVSASDKRRNYNYRVVMLKGDTALDMRGRCSAGQKVLASLIIRLALAETFCLNCGIIALDEPTTNLDRENIESLAHALVEIIKSRSQQRNFQLLVITHDEDFVELLGRSEYVEKFYRIKKNIDQCSEIVKCSVSSLGFNVH(SEQ ID NO：16)。

According to an embodiment of the invention, the protein has at least one of the following position mutations compared to the amino acid sequence of the protein expressed by the wild-type RAD50 gene:

(1) Isoleucine at position 46 of the amino acid sequence is mutated into valine, arginine at position 327 is mutated into histidine, and the protein has amino acid sequence shown in SEQ ID NO:1, wherein underlined amino acid positions are positions where mutation occurs, and the mutation of the amino acid according to the embodiment of the present invention enables a patient to suffer from variant immunodeficiency;

MSRIEKMSILGVRSFGIEDKDKQIITFFSPLTILVGPNGAGKTTIVECLKYICTGDFPPGTKGNTFVHDPKVAQETDVRAQIRLQFRDVNGELIAVQRSMVCTQKSKKTEFKTLEGVITRTKHGEKVSLSSKCAEIDREMISSLGVSKAVLNNVIFCHQEDSNWPLSEGKALKQKFDEIFSATRYIKALETLRQVRQTQGQKVKEYQMELKYLKQYKEKACEIRDQITSKEAQLTSSKEIVKSYENELDPLKNRLKEIEHNLSKIMKLDNEIKALDSRKKQMEKDNSELEEKMEKVFQGTDEQLNDLYHNHQRTVREKERKLVDCHHELEKLNKESRLLNQEKSELLVEQGRLQLQADRHQEHIRARDSLIQSLATQLELDGFERGPFSERQIKNFHKLVRERQEGEAKTANQLMNDFAEKETLKQKQIDEIRDKKTGLGRIIELKSEILSKKQNELKNVKYELQQLEGSSDRILELDQELIKAERELSKAEKNSNVETLKMEVISLQNEKADLDRTLRKLDQEMEQLNHHTTTRTQMEMLTKDKADKDEQIRKIKSRHSDELTSLLGYFPNKKQLEDWLHSKSKEINQTRDRLAKLNKELASSEQNKNHINNELKRKEEQLSSYEDKLFDVCGSQDFESDLDRLKEEIEKSSKQRAMLAGATAVYSQFITQLTDENQSCCPVCQRVFQTEAELQEVISDLQSKLRLAPDKLKSTESELKKKEKRRDEMLGLVPMRQSIIDLKEKEIPELRNKLQNVNRDIQRLKNDIEEQETLLGTIMPEEESAKVCLTDVTIMERFQMELKDVERKIAQQAAKLQGIDLDRTVQQVNQEKQEKQHKLDTVSSKIELNRKLIQDQQEQIQHLKSTTNELKSEKLQISTNLQRRQQLEEQTVELSTEVQSLYREIKDAKEQVSPLETTLEKFQQEKEELINKKNTSNKIAQDKLNDIKEKVKNIHGYMKDIENYIQDGKDDYKKQKETELNKVIAQLSECEKHKEKINEDMRLMRQDIDTQKIQERWLQDNLTLRKRNEELKEVEEERKQHLKEMGQMQVLQMKSEHQKLEENIDNIKRNHNLALGRQKGYEEEIIHFKKELREPQFRDAEEKYREMMIVMRTTELVNKDLDIYYKTLDQAIMKFHSMKMEEINKIIRDLWRSTYRGQDIEYIEIRSDADENVSASDKRRNYNYRVVMLKGDTALDMRGRCSAGQKVLASLIIRLALAETFCLNCGIIALDEPTTNLDRENIESLAHALVEIIKSRSQQRNFQLLVITHDEDFVELLGRSEYVEKFYRIKKNIDQCSEIVKCSVSSLGFNVH(SEQ ID NO：1)。

(2) Valine at the 127 th site of the amino acid sequence is mutated into isoleucine, the site is homozygous mutation, and the protein has the amino acid sequence shown as SEQ ID NO: 2, wherein the underlined amino acid positions are positions where mutation occurs, and the mutation of the amino acid according to the embodiment of the present invention can cause a patient to suffer from the variant immunodeficiency disease;

MSRIEKMSILGVRSFGIEDKDKQIITFFSPLTILVGPNGAGKTTIIECLKYICTGDFPPGTKGNTFVHDPKVAQETDVRAQIRLQFRDVNGELIAVQRSMVCTQKSKKTEFKTLEGVITRTKHGEKISLSSKCAEIDREMISSLGVSKAVLNNVIFCHQEDSNWPLSEGKALKQKFDEIFSATRYIKALETLRQVRQTQGQKVKEYQMELKYLKQYKEKACEIRDQITSKEAQLTSSKEIVKSYENELDPLKNRLKEIEHNLSKIMKLDNEIKALDSRKKQMEKDNSELEEKMEKVFQGTDEQLNDLYHNHQRTVREKERKLVDCHRELEKLNKESRLLNQEKSELLVEQGRLQLQADRHQEHIRARDSLIQSLATQLELDGFERGPFSERQIKNFHKLVRERQEGEAKTANQLMNDFAEKETLKQKQIDEIRDKKTGLGRIIELKSEILSKKQNELKNVKYELQQLEGSSDRILELDQELIKAERELSKAEKNSNVETLKMEVISLQNEKADLDRTLRKLDQEMEQLNHHTTTRTQMEMLTKDKADKDEQIRKIKSRHSDELTSLLGYFPNKKQLEDWLHSKSKEINQTRDRLAKLNKELASSEQNKNHINNELKRKEEQLSSYEDKLFDVCGSQDFESDLDRLKEEIEKSSKQRAMLAGATAVYSQFITQLTDENQSCCPVCQRVFQTEAELQEVISDLQSKLRLAPDKLKSTESELKKKEKRRDEMLGLVPMRQSIIDLKEKEIPELRNKLQNVNRDIQRLKNDIEEQETLLGTIMPEEESAKVCLTDVTIMERFQMELKDVERKIAQQAAKLQGIDLDRTVQQVNQEKQEKQHKLDTVSSKIELNRKLIQDQQEQIQHLKSTTNELKSEKLQISTNLQRRQQLEEQTVELSTEVQSLYREIKDAKEQVSPLETTLEKFQQEKEELINKKNTSNKIAQDKLNDIKEKVKNIHGYMKDIENYIQDGKDDYKKQKETELNKVIAQLSECEKHKEKINEDMRLMRQDIDTQKIQERWLQDNLTLRKRNEELKEVEEERKQHLKEMGQMQVLQMKSEHQKLEENIDNIKRNHNLALGRQKGYEEEIIHFKKELREPQFRDAEEKYREMMIVMRTTELVNKDLDIYYKTLDQAIMKFHSMKMEEINKIIRDLWRSTYRGQDIEYIEIRSDADENVSASDKRRNYNYRVVMLKGDTALDMRGRCSAGQKVLASLIIRLALAETFCLNCGIIALDEPTTNLDRENIESLAHALVEIIKSRSQQRNFQLLVITHDEDFVELLGRSEYVEKFYRIKKNIDQCSEIVKCSVSSLGFNVH(SEQ ID NO：2)。

(3) proline at position 165 of the amino acid sequence is mutated into histidine, arginine at position 327 is mutated into histidine, and the protein has the amino acid sequence shown as SEQ ID NO: 3, wherein the underlined amino acid positions are positions at which mutations occur, the mutations of amino acids according to embodiments of the invention are capable of causing a patient to suffer from selective IgA deficiency:

MSRIEKMSILGVRSFGIEDKDKQIITFFSPLTILVGPNGAGKTTIIECLKYICTGDFPPGTKGNTFVHDPKVAQETDVRAQIRLQFRDVNGELIAVQRSMVCTQKSKKTEFKTLEGVITRTKHGEKVSLSSKCAEIDREMISSLGVSKAVLNNVIFCHQEDSNWHLSEGKALKQKFDEIFSATRYIKALETLRQVRQTQGQKVKEYQMELKYLKQYKEKACEIRDQITSKEAQLTSSKEIVKSYENELDPLKNRLKEIEHNLSKIMKLDNEIKALDSRKKQMEKDNSELEEKMEKVFQGTDEQLNDLYHNHQRTVREKERKLVDCHHELEKLNKESRLLNQEKSELLVEQGRLQLQADRHQEHIRARDSLIQSLATQLELDGFERGPFSERQIKNFHKLVRERQEGEAKTANQLMNDFAEKETLKQKQIDEIRDKKTGLGRIIELKSEILSKKQNELKNVKYELQQLEGSSDRILELDQELIKAERELSKAEKNSNVETLKMEVISLQNEKADLDRTLRKLDQEMEQLNHHTTTRTQMEMLTKDKADKDEQIRKIKSRHSDELTSLLGYFPNKKQLEDWLHSKSKEINQTRDRLAKLNKELASSEQNKNHINNELKRKEEQLSSYEDKLFDVCGSQDFESDLDRLKEEIEKSSKQRAMLAGATAVYSQFITQLTDENQSCCPVCQRVFQTEAELQEVISDLQSKLRLAPDKLKSTESELKKKEKRRDEMLGLVPMRQSIIDLKEKEIPELRNKLQNVNRDIQRLKNDIEEQETLLGTIMPEEESAKVCLTDVTIMERFQMELKDVERKIAQQAAKLQGIDLDRTVQQVNQEKQEKQHKLDTVSSKIELNRKLIQDQQEQIQHLKSTTNELKSEKLQISTNLQRRQQLEEQTVELSTEVQSLYREIKDAKEQVSPLETTLEKFQQEKEELINKKNTSNKIAQDKLNDIKEKVKNIHGYMKDIENYIQDGKDDYKKQKETELNKVIAQLSECEKHKEKINEDMRLMRQDIDTQKIQERWLQDNLTLRKRNEELKEVEEERKQHLKEMGQMQVLQMKSEHQKLEENIDNIKRNHNLALGRQKGYEEEIIHFKKELREPQFRDAEEKYREMMIVMRTTELVNKDLDIYYKTLDQAIMKFHSMKMEEINKIIRDLWRSTYRGQDIEYIEIRSDADENVSASDKRRNYNYRVVMLKGDTALDMRGRCSAGQKVLASLIIRLALAETFCLNCGIIALDEPTTNLDRENIESLAHALVEIIKSRSQQRNFQLLVITHDEDFVELLGRSEYVEKFYRIKKNIDQCSEIVKCSVSSLGFNVH(SEQ ID NO：3)。

Organisms carrying proteins according to embodiments of the invention suffer from immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SigAD.

Use of reagent in preparation of kit

According to a fourth aspect of the invention, the invention provides the use of a reagent for detecting a nucleic acid as defined above or a mutation in a gene as defined above or a protein as defined above for the preparation of a kit. According to an embodiment of the invention, the agent is for diagnosing primary immunodeficiency disease. According to the embodiment of the invention, the reagent can effectively screen biological samples suffering from immunodeficiency diseases, in particular primary immunodeficiency diseases such as CVID and SIgAD, and can be further used for preparing a kit for screening the biological samples suffering from the primary immunodeficiency diseases, in particular primary immunodeficiency diseases such as CVID and SIgAD.

according to an embodiment of the invention, the reagent comprises at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation and the protein, a probe, a primer and a mass spectrometric detection reagent. The reagent according to the embodiment of the present invention can specifically and highly sensitively screen the above-mentioned nucleic acid, the above-mentioned gene mutation or the above-mentioned protein, and further specifically and highly sensitively screen a biological sample suffering from immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD, and further can be effectively used for preparing a kit for screening a biological sample suffering from immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIgAD.

according to a particular embodiment of the invention, the immunodeficiency disorder is a primary immunodeficiency disorder.

According to a particular embodiment of the invention, the primary immunodeficiency disease is a variant immunodeficiency disease or a selective IgA deficiency.

According to a specific embodiment of the invention, the RAD50 gene mutant has a mutation selected from the group consisting of: c.379G > A or c.137T > A/c.980G > A, and the primary immunodeficiency disease is variant immunodeficiency disease (CVID). The inventors have found that CVID can be confirmed in an organism by mutating at least one of the coding regions of RAD50 gene.

According to a specific example of the present invention, the RAD50 gene mutant has the mutation c.494c > a/c.980g > a, compared to the wild-type RAD50 gene, and the primary immunodeficiency disease is selective IgA deficiency (SIgAD). The inventors have found that the above mutation in the coding region of RAD50 gene can confirm that the organism suffers from SIGAD.

according to a specific embodiment of the invention, the gene encoding the protein has at least one type of mutation, as compared to the amino acid sequence of the protein expressed by the wild-type RAD50 gene, of: isoleucine at position 46 of the amino acid sequence is mutated into valine, and arginine at position 327 is mutated into histidine; or valine at the 127 th site of the amino acid sequence is mutated into isoleucine, the site is homozygous mutation, and the primary immunodeficiency disease is variant immunodeficiency disease. The inventors have found that CVID can be confirmed in an organism by mutating at least one of the proteins expressed by RAD50 gene.

according to a specific embodiment of the invention, the coding gene of the protein has the following mutation amino acid sequence that proline at position 165 is mutated into histidine and arginine at position 327 is mutated into histidine compared with the amino acid sequence of the protein expressed by the wild-type RAD50 gene, and the primary immunodeficiency disease is selective IgA deficiency. The inventors found that the protein expressed by RAD50 gene was mutated as described above, and confirmed that the organism had SIgAD.

Use of biological model in screening drugs

According to a fifth aspect of the invention, the invention proposes the use of a biological model for screening a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the protein as described above. It is to be noted that "the biological model carries the aforementioned nucleic acid" means that the biological model of the present invention carries at least one type of mutation selected from the following mutations compared with the wild-type RAD50 gene: the nucleic acid sequence of RAD50 gene mutant of c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A; by "biological model carries the aforementioned gene mutations," it is meant that the biological model of the invention carries a RAD50 gene having at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: mutations in the RAD50 gene at c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. By "biological model carries the aforementioned protein" it is meant that the biological model of the invention carries at least one mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. The biological model according to embodiments of the invention can be effectively used as a model for primary immunodeficiency diseases, in particular CVID and SIgAD related studies.

According to a particular embodiment of the invention, the biological model is a cellular or animal model.

Medicine for treating immunodeficiency disease

according to a sixth aspect of the invention, there is provided a medicament for use in the treatment of immunodeficiency disorders. According to an embodiment of the invention, the medicament comprises: an agent which specifically alters the aforementioned nucleic acid or the aforementioned gene mutation. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. The medicament according to the embodiment of the invention can specifically prevent or treat immunodeficiency diseases, in particular primary immunodeficiency diseases such as CVID and SIgAD.

According to an embodiment of the invention, the reagent is a reagent based on a gene editing or nucleic acid synthesis method.

According to an embodiment of the invention, the immunodeficiency disease is a primary immunodeficiency disease.

according to an embodiment of the invention, the primary immunodeficiency disease comprises variant immunodeficiency disease and selective IgA deficiency

according to an embodiment of the invention, said nucleic acid or said gene is mutated to c.379G > A or c.137T > A/c.980G > A and said primary immunodeficiency disease is a variant immunodeficiency disease. The inventors have found that mutations in a drug which specifically alter at least one of the above may prevent or treat CVID.

According to a specific embodiment of the invention, said nucleic acid or said gene mutation is c.494C > A/c.980G > A and said primary immunodeficiency disease is selective IgA deficiency. The inventors have found that the use of drugs to specifically alter the above mutations can prevent or treat SIgAD.

Method for screening biological samples for immunodeficiency diseases

According to a seventh aspect of the invention, there is provided a method of screening a biological sample for primary immunodeficiency disease. According to an embodiment of the present invention, the method of screening a biological sample for primary immunodeficiency disease may comprise the steps of: according to an embodiment of the invention, the method comprises the steps of: extracting a nucleic acid sample from a biological sample; determining the nucleic acid sequence of the nucleic acid sample; the nucleic acid sequence of the nucleic acid sample, or a complement thereof, having at least one type of mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A are indications that the biological sample is suffering from immunodeficiency. By the method for screening biological samples with immunodeficiency diseases according to the embodiment of the invention, biological samples with immunodeficiency diseases, especially primary immunodeficiency diseases such as CVID and SIgAD can be effectively screened.

First, a nucleic acid sample is extracted from a biological sample. According to the embodiment of the present invention, the type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting the presence or absence of a mutation in the RAD50 gene of the biological sample can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and detection can be conveniently carried out, and the efficiency of screening the biological sample with the primary immunodeficiency disease can be further improved. The term "nucleic acid sample" as used herein is to be understood broadly according to embodiments of the present invention and can be any sample that reflects the presence or absence of mutations in the RAD50 gene in a biological sample, such as whole genomic DNA extracted directly from the biological sample, a portion of the whole genome that includes the coding sequence of the RAD50 gene, total RNA extracted from the biological sample, or mRNA extracted from the biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and a plurality of information of the biological sample can be determined simultaneously, so that the efficiency of screening the biological sample with the primary immunodeficiency disease can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. Thus, the efficiency of screening a biological sample for primary immunodeficiency disease using RNA as a nucleic acid sample can be further improved.

Next, after obtaining the nucleic acid sample, the nucleic acid sample may be analyzed, thereby enabling determination of the nucleic acid sequence of the obtained nucleic acid sample. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. Methods and apparatuses that may be used to perform sequencing according to embodiments of the present invention are not particularly limited. According to embodiments of the present invention, second generation sequencing techniques may be employed, as well as third generation and fourth generation or more advanced sequencing techniques. According to a specific example of the present invention, the nucleic acid sequence may be sequenced using at least one selected from the group consisting of BGIseq500, Hiseq2000, SOLiD, 454, and single molecule sequencing devices. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from the group consisting of BGIseq500, Hiseq2000, SOLiD, 454, and single molecule sequencing devices. In addition, according to embodiments of the invention, a nucleic acid sample can be screened to enrich for the RAD50 gene exon, and the screening enrichment can be performed before, during, or after the construction of a sequencing library. Exon-targeted sequence enrichment systems such as: the capture chip of Huada autonomous exon, the capture platform of other exons or target regions such as AglientSureSelect, Nimblegen and the like, and the enrichment of target fragments is carried out. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: performing PCR amplification on the nucleic acid sample by using at least one primer selected from RAD50 gene exon specific primers; and constructing a nucleic acid sequencing library aiming at the obtained amplification products. Therefore, the RAD50 gene exon can be enriched by PCR amplification, so that the efficiency of screening biological samples with primary immunodeficiency diseases can be further improved. According to the embodiment of the present invention, the sequence of the Primer specific to the exon of the RAD50 gene is not particularly limited, and can be obtained by, for example, on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, such as UCSC (http:// genome. UCSC. edu /), Primer3(version 0.4.0, http:// Primer3.ut. ee) is used to design and synthesize the Primer of the candidate gene (synthetic by Biotech), and the Primer specificity is verified using Primer-BLAST (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /). According to a preferred embodiment of the invention, the RAD50 gene exon 2 specific primer has the sequence as set forth in seq id NO: 4-5, and the RAD50 gene exon 4 specific primer has the nucleotide sequence shown in SEQ ID NO: 6-7, and the RAD50 gene exon 7 specific primer has the nucleotide sequence shown in SEQ ID NO: 8-9. According to some embodiments of the invention, the RAD50 gene exon-specific primer has the sequence as set forth in SEQ ID NO: 6-7, and the RAD50 gene exon-specific primer has the nucleotide sequence shown in SEQ ID NO: 4-5, and aiming at c.980G > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 8-9, and aiming at c.494C > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 6-7. The inventors have surprisingly found that by using SEQ ID NO: 4-9, can obviously and effectively complete the amplification of the exon sequence of the RAD50 gene mutation in a PCR reaction system. It is noted that these SEQ ID NOs: 4-9 was surprisingly obtained by the present inventors after a hard work.

With regard to the methods and procedures for constructing sequencing libraries for nucleic acid samples, those skilled in the art may make appropriate selections based on different sequencing techniques, and with regard to the details of the procedures, see the manufacturers of sequencing instruments such as the protocols provided by Illumina, see, for example, the Multiplexing Sample Preparation Guide (Part # 1005361; Feb 2010) or Paired-End Sample Preparation Guide (Part # 1005063; Feb 2010), incorporated herein by reference. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

It should be noted that the term "nucleic acid sequence" used herein is to be understood in a broad sense, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be nucleic acid sequences directly obtained by using sequencing data (reads) obtained by sequencing a nucleic acid sample, as long as the nucleic acid sequences contain the coding sequence corresponding to the RAD50 gene.

finally, after determining the nucleic acid sequence of the nucleic acid sample, the reference sequences corresponding to the nucleic acid sequence of the obtained nucleic acid sample are aligned, and when the obtained nucleic acid sequence has at least one of the mutations, the biological sample is indicated to be immunodeficiency. Thus, by the method of screening a biological sample having immunodeficiency diseases according to the embodiment of the present invention, a biological sample having immunodeficiency diseases can be effectively screened. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

It is to be noted that the use of the "method for screening a biological sample having immunodeficiency disease" according to the embodiment of the present invention is not particularly limited, and for example, it can be used as a screening method for non-diagnostic purposes.

system for screening biological samples for immunodeficiency diseases

According to an eighth aspect of the present invention, there is provided a system capable of efficiently carrying out the above method for screening a biological sample for immunodeficiency.

referring to fig. 1, the system 1000 for screening a biological sample for immunodeficiency disease, according to an embodiment of the present invention, includes: a nucleic acid extraction apparatus 100, a nucleic acid sequence determination apparatus 200, and a determination apparatus 300.

according to an embodiment of the present invention, the nucleic acid extraction apparatus 100 is used to extract a nucleic acid sample from a biological sample. As described above, referring to fig. 2A, according to an embodiment of the present invention, the type of the nucleic acid sample is not particularly limited, and in case RNA is used as the nucleic acid sample, the nucleic acid extraction apparatus 100 further includes an RNA extraction unit 101 and a reverse transcription unit 102, wherein the extraction unit 101 is used for extracting the RNA sample from the biological sample, and the reverse transcription unit 102 is connected to the RNA extraction unit 101 for performing a reverse transcription reaction on the RNA sample to obtain a cDNA sample, and the obtained cDNA sample constitutes the nucleic acid sample. According to another embodiment of the present invention, the nucleic acid extracting apparatus 100 described with reference to FIG. 2B further includes: a DNA extraction unit 103 for extracting a DNA sample from the biological sample, and a target nucleic acid capture enrichment unit 104 for enriching and capturing target nucleic acid from the biological sample, wherein the DNA sample and the target nucleic acid constitute the nucleic acid sample. According to another embodiment of the present invention, the nucleic acid extracting apparatus 100 described with reference to FIG. 2C further includes: a DNA extraction unit 103 for extracting a DNA sample from the biological sample, the DNA sample constituting the nucleic acid sample. According to another embodiment of the present invention, the nucleic acid extracting apparatus 100 described with reference to FIG. 2D further includes: a target nucleic acid capture enrichment unit 104 for enriching capture target nucleic acids from the biological sample, the target nucleic acids constituting the nucleic acid sample.

According to an embodiment of the present invention, the nucleic acid sequence determining apparatus 200 is connected to the nucleic acid extracting apparatus 100, and is configured to analyze the nucleic acid sample to determine the nucleic acid sequence of the nucleic acid sample. As indicated above, sequencing methods can be used to determine the nucleic acid sequence of a nucleic acid sample. Thus, with reference to fig. 3, according to one embodiment of the present invention, the nucleic acid sequence determination apparatus 200 may further include: a library construction unit 201 and a sequencing unit 202. The library construction unit 201 is used for constructing a nucleic acid sequencing library aiming at a nucleic acid sample; the sequencing unit 202 is connected to the library construction unit 201 and is configured to sequence the nucleic acid sequencing library to obtain a sequencing result consisting of a plurality of sequencing data. As described above, the RAD50 gene exon can be enriched by PCR amplification, further improving the efficiency of screening biological samples for immunodeficiency diseases. Thus, the library constructing unit 201 may further comprise a PCR amplification module (not shown) in which at least one primer selected from the group consisting of RAD50 gene exon-specific primers is disposed, so as to perform PCR amplification on the nucleic acid sample using at least one primer selected from the group consisting of RAD50 gene exon-specific primers. According to the embodiment of the present invention, the sequence of the RAD50 gene Exon-specific primer is not particularly limited, and for example, the target fragment can be enriched by using the primer3.0 online design with reference to the Human genome sequence database grch37.1/hg19, or by using the active SureSelect Exon targeting sequence enrichment system (SureSelect _ Human _ All _ Exon _ V4 and SureSelect _ Human _ All _ Exon _ V6). According to a preferred embodiment of the invention, the RAD50 gene exon 2 specific primer has the sequence as shown in SEQ ID NO: 4-5, and the RAD50 gene exon 4 specific primer has the nucleotide sequence shown in SEQ ID NO: 6-7, and the RAD50 gene exon 7 specific primer has the nucleotide sequence shown in SEQ ID NO: 8-9. According to some embodiments of the invention, the RAD50 gene exon-specific primer has the amino acid sequence as set forth in SEQ ID NO: 6-7, the RAD50 gene exon-specific primer has the nucleotide sequence set forth in seq id NO: 4-5, and aiming at c.980G > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 8-9, and aiming at c.494C > A mutation, the RAD50 gene exon-specific primer has the nucleotide sequence shown as SEQ ID NO: 6-7. According to an embodiment of the invention, the sequencing unit 202 may comprise at least one selected from the group consisting of BGISEQ500, HISEQ2000, SOLiD, 454, and single molecule sequencing devices. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data are improved.

According to an embodiment of the present invention, referring to fig. 1, the determining means 300 is connected to the nucleic acid sequence determining means 200 and is adapted to compare the nucleic acid sequences of the nucleic acid samples so as to determine whether the biological sample is immunodeficiency based on the difference between the nucleic acid sequences of the nucleic acid samples and the corresponding wild-type gene sequences. Specifically, the nucleic acid sample has at least one type of mutation compared to the wild-type RAD50 gene based on the nucleic acid sequence of the nucleic acid sample or a complement thereof, selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A mutation, and judging whether the biological sample has the immunodeficiency disease. As described above, the apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention is not particularly limited, and may be operated using any conventional software, for example, the alignment may be performed using SOAPALIGNER/SOAP2 according to embodiments of the present invention.

Thus, the method for screening a biological sample having an immunodeficiency disease can be effectively performed by using the system, and a biological sample having an immunodeficiency disease can be effectively screened.

Kit for screening biological samples for immunodeficiency diseases

according to a ninth aspect of the invention, a kit for screening a biological sample for immunodeficiency disease is provided. According to an embodiment of the present invention, the kit for screening a biological sample for immunodeficiency disease comprises: a reagent suitable for detecting at least one of RAD50 gene mutants, wherein the nucleic acid has at least one mutation selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A. With the kit according to an embodiment of the present invention, a biological sample suffering from immunodeficiency diseases can be effectively screened. As used herein, the term "reagent suitable for detecting at least one mutant of the RAD50 gene" is to be understood in a broad sense, i.e., reagents for detecting at least one of the genes encoding the RAD50 mutant, and reagents for detecting at least one of the mutants of the RAD50 protein, such as antibodies that recognize specific sites, can be used.

According to a particular embodiment of the invention, the immunodeficiency disorder is a primary immunodeficiency disorder.

According to a particular embodiment of the invention, the primary immunodeficiency disease is a variant immunodeficiency disease or a selective IgA deficiency.

According to a specific embodiment of the invention, the RAD50 gene mutant has one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A or c.137T > A/c.980G > A, and the primary immunodeficiency disease is variant immunodeficiency disease (CVID). The inventors have found that CVID can be confirmed in an organism by mutating at least one of the coding regions of RAD50 gene.

According to a specific embodiment of the invention, the RAD50 gene mutant has a mutation selected from the group consisting of: c.494C > A/c.980G > A, and the primary immunodeficiency disease is selective IgA deficiency (SIGAD). The inventors have found that the above mutation in the coding region of RAD50 gene can confirm that the organism suffers from SIGAD.

according to one embodiment of the invention, the reagents include at least one of antibodies, probes, primers, and mass spectrometry detection reagents specific for the RAD50 gene mutant or for expressing the RAD50 gene mutein. Thus, a biological sample having immunodeficiency can be efficiently screened.

construct and recombinant cell

According to a tenth aspect of the invention, the invention also proposes a construct. According to an embodiment of the invention, the construct comprises a nucleic acid as described above. It is noted that by "the construct comprises the nucleic acid as described above" it is meant that the construct of the invention comprises at least one type of mutation in the nucleic acid compared to the wild-type RAD50 gene, selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or simultaneously contains the nucleic acid sequences of the various gene mutants. By "the construct comprises a mutation in a gene as described above" is meant that the construct of the invention comprises a RAD50 gene having at least one type of mutation compared to the wild-type RAD50 gene selected from the group consisting of: c.379G > A, c.137T > A/c.980G > A or c.494C > A/c.980G > A or simultaneously contains the various gene mutations. Thus, the recombinant cells obtained by transforming the receptor cells with the construct of the present invention can be effectively used as a model for studies related to immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIGAD. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to an embodiment of the present invention, the form of the construct is not particularly limited. According to an embodiment of the present invention, it may be at least one of a plasmid, a phage, an artificial chromosome, a Cosmid (Cosmid), and a virus, and is preferably a plasmid. The plasmid is used as a genetic carrier, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. The skilled person can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

According to an eleventh aspect of the invention, the invention also provides a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct or expressing the protein. Thus, the recombinant cells of the invention are capable of efficiently expressing at least one of the mutant RAD50 gene or the protein expressed by the mutation of the RAD50 gene carried by the construct. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for studies related to immunodeficiency diseases, particularly primary immunodeficiency diseases such as CVID and SIGAD. According to the embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

It is to be noted that the features and advantages described in the method section for screening biological samples for immunodeficiency diseases herein before apply equally to the system or kit for screening biological samples for immunodeficiency diseases, which will not be described in detail herein.

In addition, it should be noted that the method, system and kit for screening a biological sample with immunodeficiency disease according to the embodiment of the present invention are completed by the inventors of the present application after hard creative work and optimization work.

the present invention is described below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. Unless otherwise indicated, the techniques used in the examples are conventional and well known to those skilled in the art, and may be performed according to the third edition of the molecular cloning, laboratory Manual, or related products, and the reagents and products used are also commercially available. Various procedures and methods not described in detail are conventional methods well known in the art, and the sources, trade names, and components of the reagents used are indicated at the time of first appearance, and the same reagents used thereafter are the same as those indicated at the first appearance, unless otherwise specified.