阅读说明：本技术 新型乳酸细菌 (Novel lactic acid bacterium ) 是由 A·科许-布拉谢尔 C·弗雷莫 T·德富热尔 A·叶德热乔夫斯基 于 2018-12-21 设计创作，主要内容包括：本发明涉及一种携带选自由以下组成的组的2个或3个基因中的突变的乳糖阳性半乳糖阴性的嗜热链球菌菌株：1)编码甘露糖-葡萄糖特异性PTS蛋白质的基因和glcK基因,2)编码甘露糖-葡萄糖特异性PTS蛋白质的基因和ccpA基因,以及3)编码甘露糖-葡萄糖特异性PTS蛋白质的基因、glcK基因和ccpA基因,其中当所述菌株用于发酵奶时,其提供低乳糖发酵奶和/或在发酵温度下储存时未经历酸化的发酵奶。(The present invention relates to a lactose positive galactose negative streptococcus thermophilus strain carrying mutations in 2 or 3 genes selected from the group consisting of: 1) a gene encoding a mannose-glucose specific PTS protein and a glcK gene, 2) a gene encoding a mannose-glucose specific PTS protein and a ccpA gene, and 3) a gene encoding a mannose-glucose specific PTS protein, a glcK gene and a ccpA gene, wherein the strain provides a lactose-reduced fermented milk and/or a fermented milk that has not undergone acidification when stored at a fermentation temperature when used to ferment milk.)

1. A lactose-positive galactose-negative Streptococcus thermophilus (Streptococcus thermophilus) strain carrying a mutation in a gene selected from the group consisting of: 1) at least one, in particular one, gene encoding a mannose-glucose specific PTS protein and a glcK gene; 2) at least one, in particular one, gene encoding a mannose-glucose specific PTS protein and a ccpA gene; and 3) at least one, in particular one, gene encoding a mannose-glucose specific PTS protein, a glcK gene and a ccpA gene;

wherein, when said strain is used in fermented milk as determined by test B, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 1.2, greater than 1.5, greater than 2, greater than 2.5 or greater than 3.

2. The lactose positive galactose negative streptococcus thermophilus strain according to claim 1, which carries at least one, in particular one, mutation in the gene encoding the mannose-glucose specific PTS protein and carries a mutation in the glcK gene, in particular a mutation in its coding sequence for the glcK gene, such that the glucokinase activity of the strain is reduced but not zero.

3. The lactose positive galactose negative streptococcus thermophilus strain according to claim 2, wherein the glucokinase activity in the strain is 300 to 1200U/g or 400 to 1000U/g total protein extract as determined by test a.

4. The lactose-positive galactose-negative streptococcus thermophilus strain according to claim 2, wherein the glucokinase activity in the strain is 10% to 50% of the glucokinase activity of the DGCC7710 strain deposited at DSMZ under accession number DSM28255 at 1 month 14, 2014, in particular 15% to 40% of the glucokinase activity of the DGCC7710 strain, wherein both the glucokinase activity of the strain and the glucokinase activity of the DGCC7710 strain are determined by test a.

5. The lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 2 to 4, wherein the maximum forward velocity (Vmax) of its glucokinase in said strain is significantly reduced but not zero and is defined by one or both of these parameters:

-the Vmax of glucokinase in said strain is 300U/g to 1200U/g or 400U/g to 1000U/g total protein extract as determined by test C;

-the Vmax of the glucokinase in said strain is 10% to 50% of the Vmax of the glucokinase of said DGCC7710 strain deposited at DSMZ at accession number DSM28255, in particular 15% to 40% of the Vmax of the glucokinase of said DGCC7710, all determined by test C.

6. The lactose positive galactose negative Streptococcus thermophilus strain of any one of claims 2 to 5, wherein

a) The amino acid at position 275 of the glucokinase is not glutamic acid, particularly not an acidic amino acid, particularly lysine;

b) the protein sequence of said glucokinase is as defined in SEQ ID NO. 25, wherein the amino acid at position 275 of said SEQ ID is not glutamic acid, particularly not an acidic amino acid, particularly lysine;

c) the protein sequence of said glucokinase is a GlcK variant sequence, in particular a sequence of 322 amino acids in length, having at least 90% similarity or identity to SEQ ID No. 25, wherein the amino acid corresponding to position 275 of SEQ ID No. 25 (or the amino acid at position 275 of said glucokinase) in said glucokinase is not glutamic acid, in particular not an acidic amino acid, in particular lysine.

7. The lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 2 to 5, wherein:

a) the amino acid at position 144 of the glucokinase is not glycine, particularly not an aliphatic amino acid, particularly serine;

b) the protein sequence of glucokinase is the sequence as defined in SEQ ID NO 46, wherein the amino acid at position 144 is not glycine, particularly not an aliphatic amino acid, particularly serine; or

c) The protein sequence of said glucokinase is a GlcK variant sequence having at least 90% similarity or identity to SEQ ID No. 46, wherein the amino acid in said glucokinase corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of said glucokinase) is not a glycine, in particular not an aliphatic amino acid, in particular a serine.

8. The lactose-positive galactose-negative Streptococcus thermophilus strain according to any one of claims 2 to 7, further carrying a mutation in the ccpA gene.

9. The lactose-positive galactose-negative streptococcus thermophilus strain according to claim 1, carrying at least one, in particular one, mutation in the gene encoding the mannose-glucose-specific PTS protein and carrying a mutation in the ccpA gene.

10. The lactose-positive galactose-negative streptococcus thermophilus strain according to claim 8 or 9, wherein the ccpA gene carries a mutation selected from the group consisting of: a nonsense mutation located between nucleotide 1 and nucleotide 270 of the coding sequence of the ccpA gene, and a mutation located in the first quarter of the coding sequence of the ccpA gene that causes an open reading frame of the ccpA gene.

11. The lactose-positive galactose-negative streptococcus thermophilus strain of claim 10, wherein the sequence of the mutated ccpA gene is selected from the group consisting of:

a) 71 as defined in SEQ ID NO; and

b) ccpA variant sequence having at least 90% identity to SEQ ID NO 71.

12. The lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 1 to 11, wherein the at least one, in particular one, gene encoding a mannose-glucose specific PTS protein is selected from the group consisting of: manL gene, manM gene and manN gene.

13. The lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 1 to 12, wherein the mutated mannose-glucose specific PTS protein encoding gene encodes a protein with reduced or eliminated glucose import activity, in particular a protein selected from the group consisting of:

a) streptococcus thermophilus IIAB truncated at position 305^ManProtein (IIAB)^Man ₃₀₅)；

b) Streptococcus thermophilus IIC truncated at position 208^ManProtein (IIC)^Man ₂₀₈) (ii) a And

c) streptococcus thermophilus IID truncated at position 28^ManProtein (IID)^Man ₂₈)。

14. The lactose positive galactose negative Streptococcus thermophilus strain of claim 13,

wherein the IIAB^Man ₃₀₅The protein sequence of the protein is selected from the group consisting of:

a) a sequence as defined in SEQ ID NO: 112; and

b) IIAB variant sequences having at least 90% similarity or identity to SEQ ID No. 112, particularly sequences 305 amino acids in length;

wherein the IIC^Man ₂₀₈The protein sequence of (a) is selected from the group consisting of:

a) a sequence as defined in SEQ ID NO: 158; and

b) IIC having at least 90% similarity or identity to SEQ ID NO 158^ManVariant sequences, in particular sequences of 208 amino acids in length;

wherein the IID^Man ₂₈The protein sequence of the protein is selected from the group consisting of:

a) 207 as defined in SEQ ID NO; and

b) IID having at least 90% similarity or identity to SEQ ID NO 207^ManVariant sequences, in particular sequences of 28 amino acids in length.

15. The lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 1 to 14, wherein when the strain is used for fermenting milk within 24 hours at a fermentation temperature as determined by test B:

a) the concentration of the residual lactose in the fermented milk is less than 60 mM; and/or

b) The pH of the milk is lowered to a pH at which the acidification speed becomes definitely less than 0.1mUpH/min (pH stop), wherein the pH stop is comprised between 4.6 and 5.3, and optionally the slope between pH 6 and pH 5.5 is at least-0.008 UpH/min.

16. A composition comprising at least one, in particular one, lactose-positive galactose-negative streptococcus thermophilus strain according to any one of claims 1 to 15, in particular in combination with another lactic acid bacterium, in particular in combination with one or more strains selected from the group consisting of: strains of Lactobacillus (Lactobacillus), such as Lactobacillus delbrueckii subsp bulgaricus (Lactobacillus delbrueckii) strains; a strain of Lactococcus (Lactococcus), such as a Lactococcus lactis (Lactococcus lactis) strain; or a strain of the genus Bifidobacterium (Bifidobacterium).

17. A method for the manufacture of a fermented milk product, in particular fermented milk, the method comprising inoculating a milk substrate with a lactose-positive galactose-negative streptococcus thermophilus strain according to any of claims 1 to 15 or a composition according to claim 16 and fermenting the inoculated milk to obtain a fermented milk product.

18. Use of a lactose positive galactose negative streptococcus thermophilus strain according to any one of claims 1 to 15 or a composition according to claim 16 for the manufacture of a fermented milk product.

19. A fermented milk product comprising at least one, in particular one, lactose-positive galactose-negative streptococcus thermophilus strain according to any one of claims 1-15 or obtained by the method according to claim 17.

20. A streptococcus thermophilus ccpA polynucleotide selected from the group consisting of:

a) a ccpA polynucleotide which, when inserted in place of said ccpA gene of said DGCC7710 strain, results in a polypeptide exhibiting a ratio of beta-galactosidase activity as determined by test D relative to glucokinase activity as determined by test E of at least 4.10^-6The DGCC7710 derivative of (1);

b) the ccpA polynucleotide, when replacing DGCC7710 strain (i.e., DGCC 7710-IIAB) that had previously replaced the manL gene with the manL gene as defined in SEQ ID NO:111^Man ₃₀₅Strain) generates DGCC7710-IIAB upon ccpA gene insertion^Man ₃₀₅A derivative which, when used in fermented milk as determined by test B, releases a ratio of the amount of half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2, more than 1.5, more than 2, more than 2.5 or more than 3;

c) ccpA polynucleotide, when substituted for DGCC7710 strain (i.e., DGCC 7710-IIC) that had previously replaced the manM gene with the manM gene as defined in SEQ ID NO:157^Man ₂₀₈Strain) generates DGCC7710-IIC upon ccpA gene insertion^Man ₂₀₈A derivative which, when used in fermented milk as determined by test B, releases a ratio of the amount of half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2, more than 1.5, more than 2, more than 2.5 or more than 3; and

d) ccpA polynucleotide, when substituted for DGCC7710 strain (i.e., DGCC 7710-IID) that had previously replaced the manN gene with the manN gene as defined in SEQ ID NO:206^Man ₂₈Strain) generates DGCC7710-IID when the ccpA gene is inserted^Man ₂₈Derivative which, when used in fermented milk as determined by test B, ferments the milkThe ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) is greater than 1.2, greater than 1.5, greater than 2, greater than 2.5 or greater than 3.

21. The streptococcus thermophilus ccpA polynucleotide of claim 20, said polynucleotide carrying a mutation selected from the group consisting of: a nonsense mutation located between the 1 st and 270 th nucleotides of the coding sequence of the ccpA gene, and a mutation causing an open reading frame of the ccpA gene located in the first quarter of the coding sequence of the ccpA gene, in particular a polynucleotide whose sequence is selected from the group consisting of: a) 71 as defined in SEQ ID NO; and b) a ccpA variant sequence having at least 90% identity to SEQ ID NO 71.

22. Separately encoding IIAB^ManProtein, IIC^ManProtein and IID^ManUse of a mutated streptococcus thermophilus manL gene, manM gene and/or manN gene of a protein for replacing the corresponding manL gene, manM gene and/or manN gene of a lactose-positive galactose-negative streptococcus thermophilus strain carrying a mutated glcK gene, or a mutated ccpA gene, or both a mutated glcK gene and a mutated ccpA gene, respectively, wherein the glucose import activity of said protein is reduced or eliminated.

23. Separately encoding IIAB^ManProtein, IIC^ManProtein or IID^ManUse of a mutated streptococcus thermophilus manL gene, manM gene and/or manN gene of a protein for replacing the corresponding manL gene, manM gene and/or manN gene, respectively, of a lactose positive galactose negative streptococcus thermophilus strain selected from the group consisting of: strains carrying a mutated glcK gene, strains carrying a ccpA gene whose sequence is as defined in claim 20 or 21 and a mutated glcK gene, wherein the glucose import activity of the protein is reduced or eliminated,

wherein the sequence of said mutated glcK gene encodes a streptococcus thermophilus glucokinase, the glucokinase activity of which is significantly reduced but not zero in DGCC7710 strain whose glcK gene has been replaced with said mutated glcK gene (to obtain a DGCC7710 derivative), as defined below:

a) the glucokinase activity of said Streptococcus thermophilus glucokinase in DGCC7710 derivatives is comprised between 300U/g and 1200U/g of total protein extract, as determined by test A, in particular comprised between 400U/g and 1000U/g of total protein extract, as determined by test A, or

b) The glucokinase activity of said Streptococcus thermophilus glucokinase in DGCC7710 derivative is between 10% and 50% of the glucokinase activity of said DGCC7710 strain deposited at DSMZ at accession number DSM28255, in particular between 15% and 40% of the glucokinase activity of said DGCC7710 strain when both are determined by test A, wherein the glucokinase activity in said DGCC7710 derivative and the glucokinase activity of said DGCC7710 strain are determined by test A.

24. The use according to claim 23, wherein said mutated glcK gene is further characterized as encoding a glucokinase having a "significantly reduced but not zero" maximum forward velocity (Vmax) in the DGCC7710 strain whose glcK gene has been replaced with said mutated glcK gene (to obtain DGCC7710 derivatives), as defined by one or both of these parameters:

a) the Vmax of said Streptococcus thermophilus glucokinase in DGCC7710 derivative is between 300U/g and 1200U/g total protein extract, in particular between 400U/g and 1000U/g total protein extract, as determined by test C;

b) the Vmax of said Streptococcus thermophilus glucokinase in DGCC7710 derivative, when both determined by test C, is 10% to 50% of the Vmax of the glucokinase of said DGCC7710 strain deposited at DSMZ under deposit number DSM28255 at 1 month 14 year 2014, in particular 15% to 40% of the Vmax of the glucokinase of DGCC 7710.

25. The use according to claim 23 or 24, wherein the mutated glcK gene encodes a glucokinase selected from the group consisting of:

a) glucokinase having an amino acid at position 275 which is not glutamic acid, in particular not an acidic amino acid, in particular lysine,

b) glucokinase having an amino acid at position 275 which is not glutamic acid, in particular not an acidic amino acid, in particular lysine, and an arginine at position 278 and/or a serine at position 279; and

c) glucokinase having an amino acid at position 144 which is not glycine, in particular not an aliphatic amino acid, in particular serine.

26. The use according to any one of claims 23 to 25, wherein the mutated glcK gene encodes glucokinase, the sequence of which is selected from the group consisting of:

a) 25, wherein the amino acid at position 275 is not glutamic acid, in particular is not an acidic amino acid, in particular is lysine; and

b) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID No. 25, wherein the amino acid corresponding to position 275 of SEQ ID No. 25 in said glucokinase (or the amino acid at position 275 of said glucokinase) is not glutamic acid, particularly not an acidic amino acid, particularly lysine;

c) 46, wherein the amino acid at position 144 is not glycine, in particular not an aliphatic amino acid, in particular serine; and

d) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 in said glucokinase (or the amino acid at position 144 of said glucokinase) is not a glycine, in particular is not an aliphatic amino acid, in particular is a serine.

27. Use according to any one of claims 22 to 26, wherein the mutated streptococcus thermophilus manL gene, manM gene or manN gene is characterized in that:

a) when the manL gene, manM gene or manN gene alone was inserted in place of the DSM32587 strain:

-when using the DSM32587 derivative for fermented milk as determined by test B, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in the fermented milk is greater than 1.2, greater than 1.5, greater than 2, greater than 2.5 or greater than 3; or

b) (ii) a strain DGCC7710 that has been substituted for the ccpA gene previously replaced with the ccpA gene as defined in SEQ ID NO:71 (i.e., DGCC 7710-ccpA)_Δ1A114-120Strain) the manL gene, manM gene or manN gene alone is inserted:

DGCC7710-ccpA when determined by test B_Δ1A114-120When the derivative is used in fermented milk, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 1.2, greater than 1.5, greater than 2, greater than 2.5 or greater than 3.

28. The use according to any one of claims 22 to 27, wherein the one or more mutated streptococcus thermophilus man genes are selected from the group consisting of:

a) encoding the Streptococcus thermophilus IIAB truncated at position 305^ManProtein (IIAB)^Man ₃₀₅) In particular truncated IIAB^Man ₃₀₅A mutated streptococcus thermophilus manM gene of a protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:112, and b) IIAB having at least 90% similarity or identity to SEQ ID NO:112^ManVariant sequences, in particular sequences of 305 amino acids in length;

b) encoding the Streptococcus thermophilus IIC truncated at position 208^ManProtein (IIC)^Man ₂₀₈) In particular truncated IIC^ManA mutated streptococcus thermophilus manM gene of a protein, the sequence of which is selected from the group consisting of: a) 158, and b) to SEQ ID NO158 IIC having at least 90% similarity or identity^ManVariant sequences, in particular sequences of 208 amino acids in length;

c) encoding the Streptococcus thermophilus IID truncated at position 28^ManProtein (IID)^Man ₂₈) In particular truncated IID^ManA mutated streptococcus thermophilus manN gene of a protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:207, and b) an IID having at least 90% similarity or identity to SEQ ID NO:207^ManVariant sequences, in particular sequences of 28 amino acids in length.

29. Use according to any one of claims 22 to 28, wherein the sequence of the mutated streptococcus thermophilus manL gene, manM gene or manN gene is as defined in SEQ ID NO 111, SEQ ID NO 157 and SEQ ID NO 206, respectively.

30. A lactose-positive galactose-negative streptococcus thermophilus strain selected from the group consisting of:

a strain corresponding to DSM32587 strain (deposited at DSMZ at 2017, 8/15), in which the coding sequence of the manL gene is represented by the sequence shown in SEQ ID NO:111 (encoding IIAB)^Man ₃₀₅) Replacement;

strains corresponding to the strain DSM32587, in which the coding sequence of the manM gene is as shown in SEQ ID NO:157 (coding for IIC)^Man ₂₀₈) Replacement;

strains corresponding to the strain DSM32587, in which the coding sequence of the manN gene is as shown in SEQ ID NO:206 (coding for IID)^Man ₂₈) Replacement;

-a strain corresponding to DSM32587 strain, wherein the coding sequence of the ccpA gene follows the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manL gene with the sequence shown in SEQ ID NO:111 (coding IIAB)^Man ₃₀₅) Replacement;

-a strain corresponding to strain DSM32587, wherein the ccpA geneThe coding sequence of (A) is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manM gene with the sequence shown in SEQ ID NO:157 (coding for IIC)^Man ₂₀₈) Replacement;

-a strain corresponding to strain DSM32587, wherein the coding sequence of the ccpA gene;

-a strain corresponding to DSM28255 strain, wherein the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manL gene with the sequence shown in SEQ ID NO:111 (coding IIAB)^Man ₃₀₅) Replacement;

-a strain corresponding to DSM28255 strain, wherein the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manM gene with the sequence shown in SEQ ID NO:157 (coding for IIC)^Man ₂₀₈) Replacement; and

-variants thereof, wherein the ratio of the amount of half lactose released (mM) relative to the amount of lactose remaining (mM) in the fermented milk is greater than 1.2, greater than 1.5, greater than 2, greater than 2.5 or greater than 3 when used in fermented milk as determined by test B.

Technical Field

The present invention relates to a lactose positive galactose negative streptococcus thermophilus strain carrying a mutation in a gene selected from the group consisting of: 1) a gene encoding a mannose-glucose specific PTS protein and a glcK gene, 2) a gene encoding a mannose-glucose specific PTS protein and a ccpA gene, and 3) a gene encoding a mannose-glucose specific PTS protein, a glcK gene and a ccpA gene, wherein the strain provides a lactose-reduced fermented milk and/or a fermented milk that has not undergone post-acidification when stored at a fermentation temperature, when used for fermenting milk. The invention also relates to a composition comprising at least one lactose-positive galactose-negative streptococcus thermophilus strain according to the invention, and to the use of this strain or composition for the manufacture of a fermented milk product.

Background

The food industry uses bacteria to improve the taste and texture of food or feed products. In the case of the dairy industry, lactic acid bacteria are often used, for example, to cause the acidification of milk (by lactose fermentation) and to modify the texture of the product into which they are incorporated. For example, lactic acid bacteria belonging to the species streptococcus thermophilus (s. thermophilus) are widely used, alone or in combination with other bacteria, for the manufacture of fresh fermented milk products, such as cheese or yoghurt.

One of the limitations of using lactic acid bacteria in milk technology is post-acidification, i.e. the production of lactic acid by the lactic acid bacteria after the target pH (pH required for the technology) is obtained [ fermentation is terminated ]. The post-acidification phenomenon is therefore not only a problem for milk product manufacturers (who wish to have a flexible manufacturing process, without the need for a rapid cooling step immediately after the target pH is obtained), but also for consumers (the production of lactic acid bacteria causes an increase in acidity and a reduction in shelf life of the fermented product).

Furthermore, there is a trend for milk consumers to use fermented products with reduced or lower lactose content (lactose intolerance).

WO 2015/193459 proposes several solutions to overcome these problems: controlling the concentration of lactose in milk prior to fermentation, e.g. by adding lactase, provides lactic acid bacteria (lactose-negative strains) that cannot hydrolyze lactose. However, these solutions are not satisfactory for milk product manufacturers, as they require the addition of exogenous enzymes (such as lactase) to the milk prior to fermentation, making the manufacturing process more complex and expensive, or the addition of carbohydrates (such as sucrose) to the milk, which is not in line with the increasing demand for healthier products without additives.

There is therefore a need for an improved method for producing fermented milk products which is both satisfactory for manufacturers and consumers, and which does not undergo post-acidification and has a reduced lactose content.

Drawings

FIG. 1: alignment of the GlcK protein sequences of DGCC7710(DSM28255), DSM32587 and ST1m-glcK0-gal + strains. Differences from the GlcK protein of DGCC7710 (SEQ ID NO:2) are boxed out.

FIGS. 2 to 10 are graphs showing the evolution (A) of the pH over time and the speed (B) as a function of the pH of milk fermented with strains DGCC7710 (FIG. 2), ST1m-glcK + manM (FIG. 3), ST1m-ccpA + manL (FIG. 4), ST1m-ccpA + manM (FIG. 5), ST1m-ccpA + manN (FIG. 6), ST1m-glcK + ccpA + manM (FIG. 7), ST1.1 (FIG. 8), ST1.1m-glcK + manM (FIG. 9) or ST1.1m-ccpA + manL (FIG. 10), respectively.

Detailed Description

The present inventors have demonstrated that mutations strictly deregulating sugar metabolism can be used to design strains of streptococcus thermophilus which can be used to obtain a low lactose fermented milk product and/or can be used to produce fermented milk that has not undergone post acidification even when stored at fermentation temperatures.

The inventors have well demonstrated that this Streptococcus thermophilus strain can be characterized by the ratio of the amount of galactose released relative to the amount of lactose remaining in the fermented milk. This ratio explains the ability of the strain to consume lactose (uptake and hydrolysis) and convert it to free galactose and glucose. Due to the galactose-negative phenotype of the streptococcus thermophilus strains of the present invention, the released galactose represents the stoichiometry of lactose consumed. It should be considered as an effectiveness of the strain against overuse of lactose. Thus, the inventors have demonstrated that in the galactose-negative strains of the invention the catabolism of carbohydrates from lactose hydrolysis is strictly unregulated, so that the consumption of lactose is increased, while the strains still remain acceptably increased for their use on an industrial level. The strains of the invention need not be galactose positive (a phenotype that has been shown to be unstable on lactose).

The present invention relates to a strain of streptococcus thermophilus being lactose positive and galactose negative, wherein the ratio of the amount of released half lactose (mM) relative to the amount of residual lactose (mM) in the fermented milk is more than 1.2, more than 1.5, more than 2 or more than 3 when the strain is used for fermented milk as determined by test B.

In one embodiment, the invention relates to a streptococcus thermophilus strain that is lactose positive and galactose negative carrying a mutation in a gene selected from the group consisting of: 1) at least one gene encoding a mannose-glucose specific PTS protein and a glcK gene, 2) at least one gene encoding a mannose-glucose specific PTS protein and a ccpA gene, and 3) a gene encoding a mannose-glucose specific PTS protein, a glcK gene and a ccpA gene;

wherein, when said strain is used in fermented milk as determined by test B, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 1.2, greater than 1.5, greater than 2 or greater than 3.

In one embodiment, the invention relates to a lactose-positive galactose-negative streptococcus thermophilus strain carrying a gene encoding a mannose-glucose specific PTS protein and a mutation in the glcK gene. In one embodiment, the gene encoding the mannose-glucose specific PTS protein is selected from the group consisting of: manL gene, manM gene, manN gene and manO gene. In one embodiment, the gene encoding the mannose-glucose specific PTS protein is selected from the group consisting of: manL gene, manM gene and manN gene. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain carries a mutation in a gene selected from the group consisting of the manL gene, the manM gene and the manN gene. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain carries mutations in 2 genes selected from the group consisting of the manL gene, the manM gene and the manN gene. In one example, the lactose-positive galactose-negative strain of streptococcus thermophilus carries mutations in the manL gene, the manM gene and the manN gene.

In one embodiment, the invention relates to a lactose-positive galactose-negative streptococcus thermophilus strain carrying mutations in 2 or 3 genes selected from the group consisting of: 1) a gene encoding a mannose-glucose-specific PTS protein and a glcK gene, 2) a gene encoding a mannose-glucose-specific PTS protein and a ccpA gene, and 3) a gene encoding a mannose-glucose-specific PTS protein, a glcK gene, and a ccpA gene;

wherein, when said strain is used in fermented milk as determined by test B, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 1.2, greater than 1.5, greater than 2 or greater than 3.

The lactose-positive galactose-negative Streptococcus thermophilus strains of the invention release galactose amounts during milk fermentation Ratio relative to the amount of lactose remaining.

In one embodiment, the lactose positive galactose negative strain of Streptococcus thermophilus of the invention exhibits a ratio of released amount of galactose (mM) relative to the remaining amount of lactose (mM) in said fermented milk of more than 1.2. In one embodiment, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is selected from the group consisting of: greater than 1.2, greater than 1.5, greater than 2, and greater than 3. In one embodiment, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 1.5. In one embodiment, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 2. In one embodiment, the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is greater than 3.

According to the present invention, the amount of half lactose (mM) and the amount of lactose remaining (mM) released during fermentation of milk can be determined by methods well known in the art. In one embodiment, the concentration of galactose and lactose in the fermented milk is characterized by test B defined as follows:

test B：

At 1% (v/v, about 10)⁷CFU/ml) UHT semi-skimmed milk "Le Petit vent meen" containing 3% (w/v) milk powder (BBA corporation, tracelis) previously pasteurized for 10min at 90 ℃ was inoculated with a culture of the streptococcus thermophilus strain to be assayed (carbohydrate-free M17 resuspension cells from an overnight culture grown in M17 supplemented with 3% sucrose). This milk was found to contain about 175mM lactose. And (3) standing and incubating the inoculated milk bottle in a water bath at the temperature of 43 ℃ for 24h to obtain fermented milk. Mixing the T0 sample and the fermented milk (T24h) sample (5g) at 25g 0.025N H₂SO₄Was diluted and then centrifuged at 4600rpm for 10 minutes at 4 ℃. The supernatant was filtered directly through a 0.2 μm nylon filter (Phenomenex, Germany, ascoffenburg) into a 2ml HPLC vial. The samples were stored at-20 ℃ until further analysis. At 35 deg.C, by high performance liquid chromatography (Agilent 1200HPLC) equipped with a refractive index detector, using an Aminex HPX-87H anion exchange column (Bio-Rad Laboratories Inc.) using 12.5mM H₂SO₄As eluent and 0.6ml min^-1The flow rate of (2) is controlled on carbohydrates [ especially galactose and lactose ]]Carry out quantification. The development of the results was performed with Chemstation reprocessing software (Agilent).

For the avoidance of doubt, a Streptococcus thermophilus species is understood to be a Streptococcus salivarius thermophilus strain.

The expression "lactose positive" means that the streptococcus thermophilus strain is capable of growing on lactose as sole source of carbohydrate source, in particular on M17 medium supplemented with 2% lactose.

In a specific example, the "lactose positive" phenotype is determined by: an overnight culture of the streptococcus thermophilus strain to be tested was inoculated at a rate of 1% in M17 broth containing 2% lactose and incubated at 37 ℃ for 20 hours, and wherein a pH of 5.5 or lower at the end of the incubation indicates a lactose positive phenotype.

The expression "galactose-negative" means that the streptococcus thermophilus strain cannot grow on lactose, which is the sole source of carbohydrate, in particular on M17 medium supplemented with 2% lactose. In a specific example, the "lactose negative" phenotype is determined by: an overnight culture of the streptococcus thermophilus strain to be tested was inoculated at 1% in M17 broth containing 2% lactose and incubated at 37 ℃ for 20 hours, and wherein a pH of 6 or higher at the end of the incubation indicates a lactose negative phenotype.

The expression "derivative" with respect to the original strain (for example, a DGCC7710 derivative) refers to a strain obtained from the original strain (for example from the DGCC7710 strain) by replacing one of its genes (such as glcK, ccpA … …) with another allele of the same gene, in particular a mutated allele. In one example, the derivative is obtained by replacing the complete gene (coding sequence and promoter) of the original strain with another allele (coding sequence and promoter) of the same gene. In one example, the derivative is obtained by replacing the coding sequence of the original strain gene with another allele (coding sequence) of the same gene.

Accordingly, the present invention relates to:

-a lactose-positive galactose-negative streptococcus thermophilus strain carrying at least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein and carrying a mutation in the glcK gene, wherein the ratio of the amount of released galactose (mM) relative to the amount of residual lactose (mM) in the fermented milk is more than 1.2, more than 1.5, more than 2 or more than 3 when the strain is used in fermented milk as determined by test B. In one embodiment, a mutation in the gene encoding the mannose-glucose specific PTS protein reduces or eliminates the import of glucose from the medium into the bacterium. In one embodiment, the mutated glcK gene encodes glucokinase, and the glucokinase activity of the glucokinase in the strain is significantly reduced but not zero. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain carries a mutation in the gene encoding the mannose-glucose specific PTS protein that reduces or eliminates glucose import from the culture medium into the bacterium and carries a mutation in the glcK gene encoding glucokinase such that glucokinase activity of glucokinase in the strain is significantly reduced but not zero. In any of these embodiments, the gene encoding the mannose-glucose specific PTS protein is selected from the group consisting of: the manL gene, the manM gene and the manN gene;

-a lactose-positive galactose-negative streptococcus thermophilus strain carrying at least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein and carrying a mutation in the ccpA gene, wherein the ratio of the amount of released galactose (mM) relative to the amount of residual lactose (mM) in the fermented milk is more than 1.2, more than 1.5, more than 2 or more than 3 when the strain is used in fermented milk as determined by test B. In one embodiment, a mutation in the gene encoding the mannose-glucose specific PTS protein reduces or eliminates the import of glucose from the medium into the bacterium. In one embodiment, the mutation in the ccpA gene produces a lactose positive galactose negative streptococcus thermophilus strain that exhibits a ratio of beta-galactosidase activity of the strain as determined by test D relative to glucokinase activity of the strain as determined by test E of at least 4.10^-6At least 5.10^-6At least 6.10^-6At least 7.10^-6Or at least 8.10^-6. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain carries a mutation in the gene encoding the mannose-glucose specific PTS protein that reduces or eliminates glucose import from the culture medium into the bacterium and carries a mutation in the ccpA gene such that the ratio of the beta-galactosidase activity of the strain as determined by test D relative to the glucokinase activity of the strain as determined by test E is at least 4.10^-6. In any of these embodiments, the gene encoding the mannose-glucose specific PTS protein is selected from the group consisting of: the manL gene, the manM gene and the manN gene;

-a lactose-positive galactose-negative streptococcus thermophilus strain carrying at least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein, carrying a mutation in the glcK gene and carrying a mutation in the ccpA gene, wherein the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in the fermented milk is more than 1.2, more than 1.5, more than 2 or more than 3 when the strain is used in fermented milk as determined by test B. In one embodiment, a mutation in the gene encoding the mannose-glucose specific PTS protein reduces or eliminates the import of glucose from the medium into the bacterium. In one embodiment, the mutated glcK gene encodes glucokinase, and the glucokinase activity in the strain is significantly reduced but not zero in the strain. In one embodiment, the mutation in the ccpA gene produces a lactose positive galactose negative streptococcus thermophilus strain that exhibits a ratio of beta-galactosidase activity of the strain as determined by test D relative to glucokinase activity of the strain as determined by test E of at least 4.10^-6At least 5.10^-6At least 6.10^-6At least 7.10^-6Or at least 8.10^-6. In one embodiment, the lactose positive galactose negative Streptococcus thermophilus strain carries a PTS protein encoding mannose-glucose specificity that reduces or eliminates glucose import into the bacterium from culture mediumCarrying a mutation in the glcK gene encoding glucokinase such that the glucokinase activity in said strain is significantly reduced but not zero, and carrying a mutation in the ccpA gene such that the ratio of the beta-galactosidase activity of said strain as determined by test D relative to the glucokinase activity of said strain as determined by test E is at least 4.10^-6. In any of the above embodiments, the gene encoding the mannose-glucose specific PTS protein is selected from the group consisting of a manL gene, a manM gene, and a manN gene.

The following sections I to III describe mutations of the glcK gene, mutations of the gene encoding the mannose-glucose specific PTS protein (such as mutations of the manL gene, manM gene and manN group), and mutations of the ccpA gene, respectively.

Although these mutations are disclosed herein separately (for the sake of clarity), any embodiment of one part may be combined with any embodiment of the other part or with any embodiment of the two other parts to design a lactose positive galactose negative streptococcus thermophilus strain as defined herein, which when used in fermented milk as determined by test B releases a ratio of the amount of galactose (mM) to the amount of lactose remaining (mM) which is greater than 1.2, greater than 1.5, greater than 2 or greater than 3.

For the avoidance of doubt, the present invention relates to a strain of streptococcus thermophilus which is lactose positive, galactose negative as defined herein, wherein, when said strain is used in fermented milk as determined by test B, the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk is greater than 1.2, greater than 1.5, greater than 2 or greater than 3, wherein said strain carries:

1) at least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein as defined in section II herein and a mutation in the glcK gene thereof as defined in section I herein; or

2) At least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein as defined in section II herein and a mutation in the ccpA gene thereof as defined in section III herein; or

3) At least one, in particular one, mutation in the gene encoding a mannose-glucose specific PTS protein as defined in section II herein, mutation in its glcK gene as defined in section I herein and mutation in its ccpA gene as defined in section III herein;

mutation of glcK Gene

This section describes mutations of the glcK gene, which in the context of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention can be used in combination with a mutation of the gene encoding the mannose-glucose specific PTS protein as defined herein or in combination with a mutation of the gene encoding the mannose-glucose specific PTS protein as defined herein and a mutation of the ccpA gene as defined herein.

In one embodiment, the mutant glcK gene of the strain of the invention encodes glucokinase, and the glucokinase activity of the glucokinase in the strain is significantly reduced but not zero. Indeed, the present inventors have demonstrated that some mutant alleles of the GlcK gene encoding glucokinase (GlcK) wherein the glucokinase has a significantly reduced but non-zero glucokinase activity when present in lactose-positive, galactose-negative strains of streptococcus thermophilus.

The expression "glcK gene encoding glucokinase" refers to any DNA sequence encoding glucokinase in the Streptococcus thermophilus strain which catalyzes the conversion of glucose and ATP to glucose-6-phosphate (G6P) and ADP. Non-limiting examples of S.thermophilus glucokinase sequences are disclosed in SEQ ID Nos. 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.

In the present invention, glucokinase activity in the streptococcus thermophilus strain is significantly reduced but not zero due to glcK gene mutation of the strain. In other words, the alleles of the glcK gene carried by the strain are such that the glucokinase activity in the strain is significantly reduced but not zero.

The expression "glucokinase activity in said strain is significantly reduced but not zero" means that the glucokinase activity of the strain corresponds to both:

-the glucokinase activity in said strain is significantly reduced, in particular compared to the glucokinase activity in strains carrying the non-mutated glcK gene; and

-not zero, i.e. the activity can be detected by test a as defined herein.

According to the invention, the characteristic "glucokinase activity in said strain is significantly reduced but not zero" can be determined by methods well known in the art. Thus, methods for measuring glucokinase activity in strains of streptococcus thermophilus are known and include enzymatic assays using commercially available reactants. Reference is made herein to paragraph 2.4 of Pool et al (2006.Metabolic Engineering [ Metabolic Engineering ]8 (5); 456-464) (incorporated herein by reference). In a specific example, the glucokinase activity in the Streptococcus thermophilus strains of the invention is determined by test A [ i.e.test A is performed using the Streptococcus thermophilus strains of the invention ].

Test A:

a fresh overnight culture of the Streptococcus thermophilus strain to be assayed in M17 containing 30g/L lactose was obtained and used to inoculate 1% (v/v) with 10ml of fresh M17 containing 30g/L lactose. Cells were harvested by centrifugation (6000g, 10min, 4 ℃) at an optical density of 600nm (OD600) of 0.8+/-0.2 in 5ml cold GLCK buffer (5mM MgCl2, 10mM K)₂HPO₄/KH₂PO₄[pH 7.2]) Washed and resuspended in 500. mu.l cold GLCK buffer. EDTA-free protease inhibitor "cOmplete" was used as described by the supplier^TM"(Roche, supplier reference 04693132001) was added to the GLCK buffer. Cells were disrupted by adding 100mg of glass beads (150-212 μm, Sigma G1145) to 200. mu.l of resuspended cells and shaking for 6min at a frequency of 30 cycles/sec in an MM200 shaking mill (Retsch, Haan, Germany). By centrifugation (14000g, 15min, 4 ℃ C.)Cell debris and glass beads were removed and the supernatant was transferred to a 1.5mL clean centrifuge tube stored on ice. Total Protein content was determined by using a Fluka Protein quantitation Kit (FLUKA Protein quantitation Kit-Rapid, reference number 51254). Glucokinase activity in cell extracts was determined spectrophotometrically by glucose-6-phosphate dehydrogenase (G-6PDH, EC 1.1.1.49): NADPH coupling assay (Porter et al, 1982), essentially as described by Pool et al (2006). Each sample (5, 10 and 20. mu.L) was added to assay buffer (10mM K) in a final volume of 250. mu.L₂HPO₄/KH₂PO₄[pH 7.2]5mM MgCl2, 1mM ATP, 20mM glucose, 1mM NADP, 1U G-6PDH) and the mixture was left at 30 ℃ for 5 min. The optical density at 340nm was measured for 5 minutes by using a Synergy HT multi-detection microplate reader (betem). One unit of glucokinase corresponds to the amount of enzyme catalyzing the phosphorylation of 1 micromole of D-glucose to D-glucose 6-phosphate per minute under the assay conditions. Glucokinase activity was calculated as follows:

glucokinase activity (U/g total protein extract) ═ dOD x V/[ dt x l x epsilon x Qprot ], where:

-dOD is the change in Optical Density (OD) at 340nm

V is the reaction volume (250. mu.L in this case)

dt ═ measurement time (in minutes)

light path length (0.73 cm in this document)

Epsilon is the molar decay coefficient of NADPH; h⁺(6220 cm 2/. mu. mol, herein)

Amount of protein in the Qprot ═ cuvette (in grams)

Three measurements were made for each sample and the specific glucokinase activity values given herein according to test a are the average of three independent experiments.

In a first particular example featuring "glucokinase activity in said strain is significantly reduced but not zero", the glucokinase activity in the streptococcus thermophilus strain of the invention is comprised between 200U/g and 1500U/g total protein extract, as determined by test a. In a specific embodiment, the activity of glucokinase in the Streptococcus thermophilus strains of the invention is between 300U/g and 1200U/g of total protein extract, as determined by test A. In a specific embodiment, the Streptococcus thermophilus strain of the invention has a glucokinase activity of 400U/g to 1000U/g total protein extract as determined by test A. In a specific embodiment, the glucokinase activity in the Streptococcus thermophilus strains of the invention is from a minimum value selected from the group consisting of 200U/g, 300U/g and 400U/g total protein extract to a maximum value selected from the group consisting of 1000U/g, 1200U/g and 1500U/g total protein extract, as determined by test A. Notably, as described in test a, the glucokinase activity values disclosed herein are the average of three independent experiments (in triplicate).

In a second particular embodiment characterized by the feature "glucokinase activity in said strain is significantly reduced but not zero", the glucokinase activity in the streptococcus thermophilus strain of the invention is an activity of 5% to 60% of the glucokinase activity of the DGCC7710 strain deposited at the DSMZ under accession number DSM28255 at 1 month 14 2014. "Glucokinase activity of DGCC7710 strain" means the activity of the DGCC7710 strain glucokinase (i.e., having SEQ ID NO:2) in DGCC7710 strain as determined by test A [ i.e., test A was performed using DGCC7710 strain ]. The percentage values were calculated based on the glucokinase activity in the strains of the invention and the glucokinase activity of the DGCC7710 strain, both determined by test A. In a specific embodiment, the glucokinase activity in the Streptococcus thermophilus strain of the invention is between 10% and 50% of the glucokinase activity of the DGCC7710 strain. In a particular embodiment, the glucokinase activity in the streptococcus thermophilus strain of the invention is 15% to 40% of the glucokinase activity of strain DGCC 7710. In a specific embodiment, the glucokinase activity in the streptococcus thermophilus strain of the invention is a minimum percentage selected from the group consisting of 5%, 10% and 15% of the glucokinase activity of the DGCC7710 strain to a maximum percentage selected from the group consisting of 40%, 50% and 60% of the glucokinase activity of the DGCC7710 strain. In a specific example, and regardless of the percentage range, glucokinase activity is determined by test a described herein. Notably, the percentage values disclosed herein are calculated from glucokinase activity values, which are the average of three independent experiments (in triplicate) determined by test a.

In the first and second specific examples, the following strains can be used as controls in test a:

as positive control (i.e. streptococcus thermophilus strain, which represents a strain carrying the non-mutated glcK gene): strain DGCC7710 deposited at DSMZ under accession number DSM28255 at 1-14/2014;

as a negative control (i.e. a streptococcus thermophilus strain with undetectable glucokinase activity): the S.thermophilus in which the glcK gene is knocked out or the glcK gene carries WO 2013/160413, WO 2017/103051 orStreptococcus thermophilus of one of the mutations disclosed in et al (2016) and summarized in Table 1 below:

TABLE 1: glcK mutations in strains producing undetectable glucokinase activity

During milk fermentation, the lactose contained in the milk (as the main carbohydrate source in the milk) is imported into the streptococcus thermophilus strain. Intracellular lactose is then cleaved by β -galactosidase to glucose and galactose (so that 1 mole of lactose produces 1 mole of glucose and 1 mole of galactose).

The feature "glucokinase activity in said strain is significantly reduced but not zero" can also be characterized by the maximum forward velocity of glucokinase (referred to herein as Vmax and defined as the rate of conversion of glucose + ATP to G6P + ADP) or by the reciprocal of the affinity of glucokinase for its substrates, i.e. one or both of glucose and ATP (referred to as Km). In one embodiment, the characteristic of the strain of the invention "the glucokinase activity in said strain is significantly reduced but not zero" is also characterized by its maximum positive velocity of glucokinase (Vmax) in said strain.

Thus, in combination with the first or second embodiment of the feature "glucokinase activity in said strain is significantly reduced but not zero" as defined herein, the maximum forward velocity (Vmax) of glucokinase in the lactose-positive galactose-negative Streptococcus thermophilus strain of the invention is significantly reduced but not zero. The feature "the glucokinase Vmax in said strain is significantly reduced but not zero" can be defined by one or both of these parameters:

-Vmax is 200 to 1500U/g total protein extract as determined by test C.

-Vmax is 5% to 60% of Vmax of glucokinase deposited at DGCC7710 strain of DSMZ under accession number DSM28255 at 1 month 14 days 2014, all determined by test C.

In a specific embodiment, the mutated glcK gene of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention encodes glucokinase, wherein the glucokinase activity in said strain is significantly reduced but not zero (as defined herein), and wherein the maximum forward velocity (Vmax) of its glucokinase in said strain is significantly reduced but not zero and is defined by one or both of these parameters:

-Vmax is 200 to 1500U/g total protein extract as determined by test C.

-Vmax is 5% to 60% of Vmax of glucokinase deposited at DGCC7710 strain of DSMZ under accession number DSM28255 at 1 month 14 days 2014, all determined by test C.

The maximum forward velocity (Vmax) of glucokinase in Streptococcus thermophilus of the invention is determined by test C [ test C is performed using the Streptococcus thermophilus strain of the invention ].

And (3) testing C:

the maximal forward velocity (Vmax) was determined by using various glucose concentrations (0mM, 5mM, 10mM, 15mM, 20mM) for the crude extract prepared as described in test a. Three measurements were made for each sample and the Vmax values given in test C were the average of three independent experiments. A linear regression that exhibits the inverse specific velocity as a function of the inverse glucose concentration gives the inverse of the maximum forward velocity at the intersection with the Y-axis of the graph.

In a specific example of the maximum forward velocity of glucokinase in the Streptococcus thermophilus strains of the invention, the Vmax is from 200U/g to 1500U/g of total protein extract as determined by test C. In a specific embodiment, Vmax is 300U/g to 1200U/g total protein extract as determined by test C. In a specific embodiment, Vmax is 400 to 1000U/g total protein extract. In a specific embodiment, the Vmax of the glucokinase in the streptococcus thermophilus strain of the invention is from a minimum value selected from the group consisting of 200, 300 and 400U/g total protein extract to a maximum value selected from the group consisting of 1000, 1200 and 1500U/g total protein extract, as determined by test C.

In one specific example of the maximum forward velocity of glucokinase in the Streptococcus thermophilus strain of the invention, the Vmax is 5% to 60% of the Vmax of the glucokinase of the DGCC7710 strain. "Vmax of glucokinase of DGCC7710 strain" means Vmax of glucokinase of DGCC7710 strain (i.e., having SEQ ID NO:2) as determined by test C in DGCC7710 strain [ i.e., test C was performed using DGCC7710 strain ]. The percentage values are calculated based on the Vmax of glucokinase in the strain of the invention and the Vmax of the DGCC7710 strain, both Vmax being determined by test C. In a specific embodiment, the Vmax of the glucokinase in the streptococcus thermophilus strain of the invention is 10% to 50% of the Vmax of the glucokinase of the DGCC7710 strain, both when determined by test C. In a specific embodiment, the Vmax of glucokinase in the Streptococcus thermophilus strain of the invention is 15% to 40% of the Vmax of glucokinase of the DGCC7710 strain. In a specific embodiment, the Vmax of glucokinase in the streptococcus thermophilus strain of the invention is the minimum percentage selected from the group consisting of 5%, 10% and 15% of the Vmax of glucokinase activity of the DGCC7710 strain to the maximum percentage selected from the group consisting of 40%, 50% and 60% of the Vmax of glucokinase activity of the DGCC7710 strain.

The lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in the glcK gene encoding glucokinase, in which strain the glucokinase activity of the glucokinase is significantly reduced but not zero as defined herein, and optionally wherein the maximum forward velocity of the glucokinase in said strain is significantly reduced but not zero as defined herein.

By "mutation in the glcK gene" is meant in the present invention any nucleotide change within the glcK gene, wherein the change at the nucleotide level is such that the glucokinase activity in a strain carrying this mutated glcK gene (as the only glcK gene) is significantly reduced but not zero as defined herein, and optionally the maximal forward velocity of glucokinase in said strain is significantly reduced but not zero as defined herein. In a specific embodiment, a "mutation in the glcK gene" in the present invention refers to any nucleotide change within the open reading frame of the glcK gene, wherein said change at the nucleotide level is such that glucokinase activity in a strain carrying this mutated glcK gene (as the only glcK gene) is significantly reduced but not zero as defined herein, and optionally such that the maximal forward velocity of glucokinase in said strain is significantly reduced but not zero as defined herein.

Thus, although two Streptococcus thermophilus strains may differ by the sequence of their respective glcK genes, this does not necessarily mean that one of the two glcK genes is mutated in the sense of the present invention. In fact, the following are not considered mutations in the present invention:

changes at the nucleotide level that do not cause any changes at the protein level (silent changes) and do not affect translation of glcK RNA; and

-a change at the nucleotide level that does cause an alteration at the protein level, but wherein this alteration does not affect the glucokinase activity of the resulting GlcK protein and optionally the maximum forward velocity of the resulting GlcK protein as defined herein. In fact, such changes can be observed at the level of the glcK gene of streptococcus thermophilus of the invention without affecting the scope of protection.

Non-limiting examples of glcK genes which are not to be considered as mutated in the sense of the present invention are:

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 2 (GlcK type ST1), in particular a polynucleotide as defined in SEQ ID No. 1; this GlcK type is one of the DGCC7710 strains deposited at DSMZ under accession number DSM28255 at 1 month 14, 2014;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 4 (GlcK type ST2), in particular a polynucleotide as defined in SEQ ID No. 3;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 6 (GlcK type ST3), in particular a polynucleotide as defined in SEQ ID No. 5;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 8 (GlcK type ST4), in particular a polynucleotide as defined in SEQ ID No. 7;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 10 (GlcK type ST5), in particular a polynucleotide as defined in SEQ ID No. 9;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 12 (GlcK type ST6), in particular a polynucleotide as defined in SEQ ID No. 11;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 14 (GlcK type ST7), in particular a polynucleotide as defined in SEQ ID No. 13;

-a polynucleotide encoding a glucokinase as defined in SEQ ID No. 16 (GlcK type ST8), in particular a polynucleotide as defined in SEQ ID No. 15;

-a polynucleotide encoding glucokinase as defined in SEQ ID No. 18 (GlcK type ST9), in particular a polynucleotide as defined in SEQ ID No. 17;

-a polynucleotide encoding a glucokinase (GlcK type ST10) as defined in SEQ ID NO:20, in particular a polynucleotide as defined in SEQ ID NO: 19.

The amino acid differences across the glucokinase layers and the percent identity of each GlcK type to SEQ ID NO:2 are summarized in table 3 (example 2). The glucokinase activity in strains of GlcK types ST2 to ST10 is summarized in table 4 (example 3).

Furthermore, some nucleotide mutations within the glcK gene are not considered suitable for the purpose of the present invention, as said mutations would result in a glucokinase with an activity as determined by test a of zero or below the minimum value defined herein. Non-limiting examples of unsuitable mutations are described in table 1. In one embodiment, the streptococcus thermophilus of the invention does not carry a mutation selected from the group consisting of a mutation causing a glcK gene knockout and a large deletion in the glcK gene.

In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in the open reading frame of the glcK gene such that an amino acid in the glcK protein is substituted, the glucokinase activity of the glcK protein in said strain carrying said mutated glcK gene is significantly reduced but not zero (as defined herein), and optionally wherein the maximum forward velocity of glucokinase in said strain is significantly reduced but not zero as defined herein. In a specific embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in the glcK gene such that an amino acid in the glcK protein is substituted, the glucokinase activity of the glcK protein in said strain carrying said mutated glcK gene is significantly reduced but not zero (as defined herein), and optionally wherein the maximum forward velocity of glucokinase in said strain is significantly reduced but not zero as defined herein. In a specific embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in the glcK gene such that the glcK protein is 322 amino acids in length and wherein the glucokinase activity in said strain is significantly reduced but not zero as defined herein and optionally wherein the maximum forward velocity of glucokinase in said strain is significantly reduced but not zero as defined herein.

As mentioned above, some DNA modifications can be observed at the level of the glcK gene of S.thermophilus of the invention, which do not affect the glucokinase activity of the strain. Based on test a as defined herein and the control strain as defined herein, the skilled person will know how to identify 1) a glcK gene encoding glucokinase, the glucokinase activity of which is significantly reduced but not zero (as defined herein) in the strain carrying this glcK gene, and optionally wherein the maximum forward velocity of glucokinase is significantly reduced but not zero (as defined herein) in the strain carrying this mutated glcK gene; 2) a glcK gene with a modification that has no effect on glucokinase activity in the strain carrying this modification, or 3) a glcK gene encoding glucokinase with zero glucokinase activity (as defined herein) in the strain carrying this glcK gene.

DGCC7710 strain can be used as a control by: the glcK gene to be assayed is substituted for its glcK gene to obtain a derivative of DGCC7710, and the derivative of DGCC7710 is assayed by test a (glucokinase activity) or test c (vmax).

The present inventors have identified two positions within glucokinase whose amino acid properties have been shown to affect the activity of glucokinase such that glucokinase activity is significantly reduced but not zero as defined herein, and to affect the Vmax of glucokinase such that Vmax is significantly reduced but not zero as defined herein: 144 th and 275 th of glucokinase (i.e., 144 th and 275 th codons of glcK gene). Notably, based on the test a and C and control strains defined herein, one skilled in the art would know how to identify other positions within glucokinase and appropriate amino acids to obtain a significantly reduced but non-zero (as defined herein) glucokinase activity and optionally a significantly reduced but non-zero maximum forward velocity, and thus the corresponding glcK gene.

In one embodiment, the amino acid at position 275 of glucokinase (encoded by the glcK gene of the streptococcus thermophilus strains of the present invention) is not glutamate (i.e., is any amino acid other than glutamate); thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is neither GAA nor GAG. In a particular embodiment, the amino acid at position 275 of glucokinase is not an acidic amino acid (i.e., is any amino acid other than an acidic amino acid); thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon encoding a non-acidic amino acid. In a specific embodiment, the amino acid 275 of glucokinase is selected from the group consisting of lysine and any conserved amino acids thereof; thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon encoding an amino acid selected from the group consisting of lysine and any conserved amino acids thereof. In a specific embodiment, the amino acid at position 275 of glucokinase is lysine; thus, in one embodiment, the 275 th codon of the glcK gene carried by the Streptococcus thermophilus strain of the invention is AAA or AAG. In a specific embodiment, nucleotide 823-.

In a specific embodiment, the sequence of the GlcK protein of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention is selected from the group consisting of:

a) 25, wherein the amino acid at position 275 is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine; and

b) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific embodiment, the GlcK variant sequence is 322 amino acids in length.

In another embodiment, the amino acid at position 144 of glucokinase (encoded by the glcK gene of the streptococcus thermophilus strain of the present invention) is not glycine (i.e., is any amino acid other than glycine); thus, in one embodiment, the 144 th codon of the glcK gene carried by the streptococcus thermophilus strains of the invention is not GGT, GGC, GGA or GGG. In a particular embodiment, the amino acid at position 144 of glucokinase is not an aliphatic amino acid (i.e., is any amino acid other than an aliphatic amino acid). In a specific embodiment, the amino acid at position 144 of glucokinase is selected from the group consisting of serine and any conserved amino acid thereof; thus, in one embodiment, codon 144 of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon encoding an amino acid selected from the group consisting of serine and any conserved amino acid thereof. In a specific embodiment, the amino acid at position 144 of glucokinase is serine; thus, in one embodiment, codon 144 of the glcK gene carried by the Streptococcus thermophilus strain of the invention is AGT, AGC, TCT, TCC, TCA or TCG. In a particular embodiment, nucleotides 430-432 of the glcK gene carried by the Streptococcus thermophilus strain of the invention are AGT, AGC, TCT, TCC, TCA or TCG.

In a specific embodiment, the sequence of the GlcK protein of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention is selected from the group consisting of:

a) 46, wherein the amino acid at position 144 is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine; and

b) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 in glucokinase (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence is 322 amino acids in length.

To define GlcK variants having at least 90% similarity to SEQ ID No. 25, similarity or identity [ i.e. the number of similar or identical amino acid residues in one or more aligned parts of the sequence ] is calculated herein over the entire length of 2 sequences after optimal alignment; position 275 as defined in SEQ ID NO:25 is not considered for calculation of similarity or identity. In a specific embodiment, the GlcK variant sequence has at least 91, 92, 93, 94, 95, 96, 97, 98 or 99% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In one embodiment, the GlcK variant sequence has at least 95% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In one embodiment, the GlcK variant sequence has at least 97% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine.

In a specific embodiment, the GlcK variant sequence differs from SEQ ID NO:25 by 1 to 30 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine (position 275 is not considered for the calculation of the number of one or more substitutions). In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1 to 20 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1 to 15 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1 to 10 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine.

To define GlcK variants having at least 90% similarity to SEQ ID NO 46, similarity or identity [ i.e. the number of similar or identical amino acid residues in one or more aligned parts of the sequence ] is calculated herein over the entire length of 2 sequences after optimal alignment; position 144 as defined in SEQ ID NO 46 is not considered for calculation of similarity or identity. In a specific embodiment, the GlcK variant sequence has at least 91, 92, 93, 94, 95, 96, 97, 98 or 99% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 (or amino acid position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than aliphatic amino acids, in particular serine. In one embodiment, the GlcK variant sequence has at least 95% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In one embodiment, the GlcK variant sequence has at least 97% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine.

In a specific embodiment, the GlcK variant sequence differs from SEQ ID NO:46 by 1 to 30 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine (position 144 is not considered for the calculation of the number of one or more substitutions). In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1 to 20 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1 to 15 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1 to 10 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine.

In one embodiment, the sequence of the GlcK protein of the lactose positive galactose negative streptococcus thermophilus strain of the invention is selected from the group consisting of SEQ ID NOs 25, 26, 27, 28, 29, 30, 31, 32, 33 and 34, wherein the amino acid at position 275 of the variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strain of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NOs: 25, 26, 27, 28, 29, 30, 31, 32, 33 and 34, wherein the amino acid at position 275 of the glucokinase is not glutamic acid, in particular not an acidic amino acid, in particular lysine, respectively.

In a particular embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is not glutamic acid; thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is neither GAA nor GAG; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strain of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:25 and any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), wherein the amino acid corresponding to position 275 of SEQ ID NO:25 in glucokinase (or the amino acid at position 275 of glucokinase) is not glutamic acid.

In a particular embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is not an acidic amino acid; thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon that does not encode an acidic amino acid; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:25 and any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase is not an acidic amino acid.

In a specific embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NOs 26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is selected from the group consisting of lysine and any conserved amino acids thereof; thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the present invention is a codon encoding an amino acid selected from the group consisting of lysine and any conserved amino acids thereof; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:25 and any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), wherein the amino acid corresponding to position 275 of SEQ ID NO:25 in glucokinase (or the amino acid at position 275 of glucokinase) is lysine and any conserved amino acid thereof.

In a particular embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NOs 26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is lysine; thus, in one embodiment, the 275 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon encoding lysine, in particular AAA or AAG, respectively; thus, in a specific embodiment, the sequence of the GlcK protein of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention is selected from the group consisting of SEQ ID NOs 22, 35, 36, 37, 38, 39, 40, 41, 42 and 43; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strain of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NOs 22, 35, 36, 37, 38, 39, 40, 41, 42 and 43; in a specific embodiment, the Streptococcus thermophilus strain of the invention carries the glcK gene as defined in SEQ ID NO 21.

In another embodiment, the sequence of the GlcK protein of the lactose positive galactose negative streptococcus thermophilus strain of the invention is selected from the group consisting of SEQ ID NOs 46, 47, 48, 49, 50, 51, 52, 53, 54 and 55, wherein the amino acid at position 144 of the variant is any amino acid other than glycine, in particular any amino acid other than aliphatic amino acids, in particular serine; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strain of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NOs 46, 47, 48, 49, 50, 51, 52, 53, 54 and 55, wherein the amino acid at position 144 of the glucokinase is not a glycine, in particular not an aliphatic amino acid, in particular a serine.

In a particular embodiment, as SEQ ID No. 46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID NOs 47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is not glycine; thus, in one embodiment, the 144 th codon of the glcK gene carried by the streptococcus thermophilus strains of the present invention is not GGT, GGC, GGA or GGG; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:46 and any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:46 (in particular SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54 or 55), wherein the amino acid corresponding to position 144 of SEQ ID NO:46 in glucokinase (or the amino acid at position 144 of glucokinase) is not glycine.

In a particular embodiment, as SEQ ID No. 46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID NOs 47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is not an aliphatic amino acid; thus, in one embodiment, the 144 th codon of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon which does not encode an aliphatic amino acid; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:46 and any GlcK variant sequence as defined herein having at least 90% similarity or identity with SEQ ID NO:46 (in particular SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54 or 55), wherein the amino acid corresponding to position 144 of SEQ ID NO:46 in glucokinase (or the amino acid at position 144 of glucokinase) is not an aliphatic amino acid.

In a specific embodiment, as SEQ ID NO:46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:46 (in particular SEQ ID NOs 47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID NO:46 (or the amino acid at position 144 of glucokinase) is selected from the group consisting of serine and any conserved amino acid thereof; thus, in one embodiment, codon 144 of the glcK gene carried by the streptococcus thermophilus strain of the present invention is a codon encoding an amino acid selected from the group consisting of serine and any conserved amino acids thereof; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NO:46 and any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:46 (in particular SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54 or 55), wherein the amino acid in glucokinase corresponding to position 144 of SEQ ID NO:46 (or the amino acid at position 144 of glucokinase) is serine and any conserved amino acid thereof.

In a particular embodiment, as SEQ ID No. 46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID NOs 47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is serine; thus, in one embodiment, codon 144 of the glcK gene carried by the streptococcus thermophilus strain of the invention is a codon encoding serine, in particular AAA or AAG; thus, in a specific embodiment, the sequence of the GlcK protein of the lactose-positive galactose-negative Streptococcus thermophilus strain of the invention is selected from the group consisting of SEQ ID NOs 45, 56, 57, 58, 59, 60, 61, 62, 63 and 64; thus, in one embodiment, the glcK gene carried by the Streptococcus thermophilus strains of the invention encodes a GlcK protein, the sequence of which is selected from the group consisting of SEQ ID NOs 45, 56, 57, 58, 59, 60, 61, 62, 63 and 64; in a specific embodiment, the strain of Streptococcus thermophilus of the invention carries the glcK gene as defined in SEQ ID NO. 44.

In defining the sequence of the GlcK protein of the lactose-positive galactose-negative streptococcus thermophilus strain of the invention, according to the teachings of the present application, the glucokinase activity in the strain expressing this GlcK protein is significantly reduced but not zero as defined herein, and optionally the Vmax of the glucokinase in this strain is significantly reduced but not zero as defined herein.

Mutations in the genes encoding the mannose-glucose-specific PTS proteins, in particular manL, manM and manN Mutation of the gene.

This section describes mutations of the genes encoding mannose-glucose specific PTS proteins, in particular mutations of the manL, manM and manN genes, which in the context of the lactose-positive galactose-negative streptococcus thermophilus strains of the present invention can be used in combination with a mutation of the glcK gene as defined herein, or in combination with a mutation of the ccpA gene as defined herein, or in combination with both a mutation of the glcK gene and a mutation of the ccpA gene as defined herein.

In a lactose-positive galactose-negative streptococcus thermophilus strain, any mutation in the gene encoding the mannose-glucose specific PTS protein is suitable, as long as the ratio of the amount of released galactose (mM) relative to the amount of residual lactose (mM) in the fermented milk, as defined herein, is more than 1.2, when combined with a mutated glcK gene, as defined herein, or with a mutation of the ccpA gene, as defined herein, or with both a mutated glcK gene and a mutated ccpA gene, as defined herein, when the strain is used in fermented milk (by test B).

The inventors have shown that the reduction or elimination of mutations in the genes encoding mannose-glucose specific PTS proteins, in particular in the mutated manL gene, the mutated manM gene, the mutated manN gene or the mutated manO gene, of glucose import from the culture medium in lactose-positive galactose-negative streptococcus thermophilus strains is particularly advantageous in the present invention. In one embodiment, a mutation in a gene encoding a mannose-glucose specific PTS protein results in a reduction or elimination of the glucose import activity of the protein encoded by the gene. In one embodiment, the mutated gene is the manL gene, and mutation of the manL gene results in reduction or elimination of IIAB^ManGlucose import activity of proteins. In one embodiment, the mutated gene is a manM gene, and mutation of the manM gene results in reduction or elimination of IIC^ManGlucose import activity of proteins. In one embodiment, the mutated gene is the manN gene, and mutation of the manN gene results in reduction or elimination of IID^ManGlucose import activity of proteins.

In one example, a mutation of a gene encoding a mannose-glucose specific PTS protein, particularly a mutation of a manL gene, a manM gene or a manN gene, is a mutation causing gene knockout (i.e., complete disruption).

In one embodiment, the mutation of the gene encoding the mannose-glucose specific PTS protein, particularly the mutation of the manL gene, manM gene or manN gene, is a mutation of the promoter of the gene, particularly a mutation of the promoter of the gene which reduces or inhibits transcription of the gene.

In one embodiment, the mutation of the gene encoding the mannose-glucose specific PTS protein, in particular the mutation of the manL, manM or manN gene, is a mutation introduced into the coding sequence of said gene, in particular the mutation resulting in glucose of the protein encoded by the mutated geneReduction or elimination of input activity, particularly causing IIAB^ManProtein, IIC^ManProtein or IID^ManA mutation that reduces or eliminates the glucose import activity of the protein.

In one embodiment, the mutation of the gene encoding the mannose-glucose specific PTS protein, in particular the mutation of the manL, manM or manN gene, is a mutation which, in the coding sequence of said gene, results in a truncated protein, in particular in a truncated IIAB^ManProtein, truncated IIC^ManProteins or truncated IIDs^ManProteins, particularly truncated proteins that produce glucose import activity with reduced or eliminated (such as truncated IIAB)^ManProtein, truncated IIC^ManProteins or truncated IIDs^ManProtein). Regardless of the position of the truncation, the mutation introduced into the gene is a nucleotide substitution that results in a stop codon, or a deletion, insertion or deletion/insertion that causes an open reading frame and results in a premature stop codon. In one embodiment, the mutation introduced into the gene is a nucleotide substitution that results in a stop codon. In one embodiment, the mutation introduced into the gene is a deletion, insertion, or deletion/insertion that causes an open reading frame and results in a premature stop codon.

Although the two strains of S.thermophilus may differ by the sequence of their respective manL, manM or manN genes, this does not necessarily mean that one of these genes is mutated in the sense of the present invention. In fact, the following are not considered mutations of the manL, manM or manN gene in the present invention:

changes at the nucleotide level that do not cause any changes at the protein level (silent changes) and do not affect the translation of manL, manM or manN RNA; and

-in a lactose-positive galactose-negative streptococcus thermophilus strain, a change at the nucleotide level that does result in a change at the protein level, but when combined with a mutated glcK gene as defined herein, or with a mutation of the ccpA gene as defined herein, or with both a mutated glcK gene and a mutated ccpA gene, when said strain is used for fermenting milk (by test B), wherein this change does not result in a ratio of the amount of released galactose (mM) relative to the amount of residual lactose (mM) in said fermented milk as defined herein of more than 1.2.

The manL, manM and manN genes (each coding for IIAB) which are not considered to be mutated in the sense of the present invention^ManProtein, IIC^ManProtein and IID^ManProteins) are:

encoding IIAB as defined in SEQ ID NO:78^ManProtein (IIAB)^ManType ST1), in particular as defined in SEQ ID No. 77; the IIAB^ManType is one of DGCC7710 strains;

encoding the IIAB as defined in SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108 and 110^ManProtein (IIAB)^ManTypes ST2 to ST17), in particular as defined in SEQ ID NOs 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107 and 109. IIAB as defined in SEQ ID NOs: 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108 and 110^ManThe sequence of the protein has 98.4% to 99.6% identity with SEQ ID NO: 78;

encoding IIC as defined in SEQ ID NO 130^ManProtein (IIC)^ManType ST1), in particular as defined in SEQ ID NO: 129; the IIC^ManType is one of DGCC 7710;

encoding the IIC as defined in SEQ ID NO 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154 and 156^ManProtein (IIC)^ManTypes ST2 to ST14), in particular as defined in SEQ ID NOs 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153 and 155. IIC as defined in SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154 and 156^ManThe sequence of the protein has 98.5% to 99.6% identity with SEQ ID NO. 130;

encoding the IID as defined in SEQ ID NO:167^ManProtein (IID)^ManType ST1), in particular as defined in SEQ ID NO: 166; the IID^ManType is one of DGCC7710 strains;

169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203 and 205 encoding the IID as defined in SEQ ID NO^ManProtein (IID)^ManTypes ST2 to ST20), in particular as defined in SEQ ID NOs 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202 and 204. IID as defined in SEQ ID NO 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203 and 205^ManThe sequence of the protein has 97.3% to 99.6% identity with SEQ ID NO: 167.

The inventors have identified at least one mutation in the manL gene which, when inserted into the manL gene of a starting lactose-positive galactose-negative streptococcus thermophilus strain [ mutated in the glcK gene, the ccpA gene or both the glcK and ccpA genes as described herein ], when said strain is used in fermented milk, results in reaching a ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk as defined herein of more than 1.2 (as determined by test B).

In one embodiment, the mutation in the manL gene results in IIAB^ManThe protein is truncated at position 305. In one example, the mutation in the manL gene is a substitution of nucleotide G at position 916 with nucleotide T (resulting in a stop codon at position 306). Streptococcus thermophilus IIAB truncated at position 305^ManThe protein is referred to herein as IIAB^Man ₃₀₅。

In one embodiment, the IIAB truncated at position 305^ManThe sequence of the protein is selected from the group consisting of:

a) a sequence as defined in SEQ ID NO: 112; and

b) has at least 90% phase with SEQ ID NO. 112IIAB of similarity or identity^ManVariant sequences, in particular sequences of 305 amino acids in length.

To define an IIAB having at least 90% similarity to SEQ ID NO:112^ManVariants, herein similarity or identity is calculated over the entire length of 2 sequences after optimal alignment [ i.e., the number of similar or identical amino acid residues in one or more aligned portions of the sequences]. In a specific embodiment, IIAB^ManThe variant sequence has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% similarity or identity to SEQ ID No. 112.

In a specific embodiment, IIAB^ManThe variant sequence differs from SEQ ID NO 112 by 1 to 30 amino acid substitutions. In a specific embodiment, IIAB^ManThe variant sequence differs from SEQ ID NO 112 by 1 to 20 amino acid substitutions. In a specific embodiment, IIAB^ManThe variant sequence differs from SEQ ID NO 112 by 1 to 15 amino acid substitutions. In a specific embodiment, IIAB^ManThe variant sequence differs from SEQ ID NO 112 by 1 to 10 amino acid substitutions. In a specific embodiment, IIAB^ManThe variant sequence differs from SEQ ID NO. 112 by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the IIAB of a lactose-positive galactose-negative Streptococcus thermophilus strain of the invention^ManThe sequence of the protein is selected from the group consisting of SEQ ID NO:112 to 128.

In one embodiment, the manL gene carried by the Streptococcus thermophilus strains of the invention encodes IIAB^ManA protein having a sequence selected from the group consisting of SEQ ID NO:112 and any IIAB having at least 90% similarity or identity to SEQ ID NO:112 as defined herein^ManVariant sequences (in particular SEQ ID NO:113 to 128). In one embodiment, the manL gene carried by the Streptococcus thermophilus strain of the invention is as defined in SEQ ID NO 111.

The inventors have identified at least one mutation in the manM gene which, when inserted into the manL gene of a starting lactose-positive galactose-negative streptococcus thermophilus strain [ mutated in the glcK gene, the ccpA gene or both the glcK and ccpA genes as described herein ], when said strain is used in fermented milk, results in reaching a ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk as defined herein of more than 1.2 (as determined by test B).

In one embodiment, the mutation in the manM gene is such that IIC^ManThe protein is truncated at position 208. In one example, the mutation in the manM gene is a substitution of nucleotide G at nucleotide 625 with nucleotide T (resulting in a stop codon at position 209). Streptococcus thermophilus IIC truncated at position 208^ManThe protein is referred to herein as IIC^Man ₂₀₈。

In one embodiment, the IIC truncated at position 208^ManThe sequence of the protein is selected from the group consisting of:

a) a sequence as defined in SEQ ID NO: 158; and

b) IIC having at least 90% similarity or identity to SEQ ID NO 158^ManVariant sequences, in particular sequences of 208 amino acids in length.

To define an IIC having at least 90% similarity to SEQ ID NO:158^ManVariants, herein similarity or identity is calculated over the entire length of 2 sequences after optimal alignment [ i.e., the number of similar or identical amino acid residues in one or more aligned portions of the sequences]. In a specific embodiment, IIC^ManThe variant sequence has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% similarity or identity to SEQ ID NO. 158.

In a specific embodiment, IIC^ManThe variant sequence differs from SEQ ID NO:158 by 1 to 30 amino acid substitutions. In a specific embodiment, IIC^ManThe variant sequence differs from SEQ ID NO:158 by 1 to 20 amino acid substitutions. In a specific embodiment, IIC^ManThe variant sequence differs from SEQ ID NO:158 by 1 to 15 amino acid substitutions. In a specific embodiment, IIC^ManDifferences in variant sequences from SEQ ID NO:158Consisting of 1 to 10 amino acid substitutions. In a specific embodiment, IIC^ManThe variant sequence differs from SEQ ID NO. 158 by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the IIC of the lactose-positive galactose-negative Streptococcus thermophilus strain of the invention^ManThe sequence of the protein is selected from the group consisting of SEQ ID NO:158 to 165.

In one embodiment, the manM gene carried by the Streptococcus thermophilus strains of the invention encodes IIC^ManA protein, the sequence of which is selected from the group consisting of SEQ ID NO:158 and any IIC having at least 90% similarity or identity to SEQ ID NO:158 as defined herein^ManVariant sequences (in particular SEQ ID NO:159 to 165). In one embodiment, the manM gene carried by the Streptococcus thermophilus strain of the invention is as defined in SEQ ID NO: 157.

The inventors have identified at least one mutation in the manN gene which, when inserted into the manN gene of a starting lactose-positive galactose-negative streptococcus thermophilus strain [ mutated in the glcK gene, the ccpA gene or both the glcK and ccpA genes as described herein ], when said strain is used in fermented milk, results in reaching a ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk as defined herein of more than 1.2 (as determined by test B).

In one embodiment, the mutation in the manN gene results in IID^ManThe protein is truncated at position 28. In one example, the mutation in the manN gene is an insertion of nucleotide A in the stretch with 5 nucleotides A from positions 37 to 41 (generating a fragment with 6 nucleotides A, resulting in IID)^ManOpen reading frame and truncation of the protein at position 28). Such Streptococcus thermophilus IID truncated at position 28^ManThe protein is referred to herein as IID^Man ₂₈。

In one embodiment, the IID truncated at position 28^ManThe sequence of the protein is selected from the group consisting of:

a) 207 as defined in SEQ ID NO; and

b) has at least 90 percent of SEQ ID NO 207IID of similarity or identity^ManVariant sequences, in particular sequences of 28 amino acids in length.

To define an IID having at least 90% similarity to SEQ ID NO 207^ManVariants, herein similarity or identity is calculated over the entire length of 2 sequences after optimal alignment [ i.e., the number of similar or identical amino acid residues in one or more aligned portions of the sequences]. In a specific embodiment, IIC^ManThe variant sequence has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% similarity or identity to SEQ ID No. 207.

In a specific embodiment, IID^ManThe variant sequence differs from SEQ ID NO 207 by 1 to 10 amino acid substitutions. In a specific embodiment, IID^ManThe variant sequence differs from SEQ ID NO 207 by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the IID of the lactose-positive galactose-negative Streptococcus thermophilus strain of the invention^ManThe sequence of the protein is selected from the group consisting of SEQ ID NO 207 to 211.

In one embodiment, the manN gene carried by the Streptococcus thermophilus strains of the invention encodes IID^ManA protein, the sequence of which is selected from the group consisting of SEQ ID NO:207 and any IID having at least 90% similarity or identity to SEQ ID NO:207 as defined herein^ManVariant sequences (in particular SEQ ID NO:208 to 211). In one embodiment, the manN gene carried by the Streptococcus thermophilus strain of the invention is defined in SEQ ID NO. 206.

Regardless of the mutation of the glcK gene as defined herein and the mutation of the ccpA gene as defined herein (alone or in combination in the lactose positive galactose negative streptococcus thermophilus strains of the invention), at least one gene encoding a mannose-glucose specific PTS protein is mutated as defined herein. Regardless of which embodiment, the present invention comprises a lactose-positive galactose-negative streptococcus thermophilus strain carrying mutations in one, two or three genes selected from the group consisting of the manL gene, the manM gene and the manN gene. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manL. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manM. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manN. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manL and a mutation in manM. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manL and a mutation in manN. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manM and a mutation in manN. In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention carries a mutation in manL, a mutation in manM and a mutation in manN.

Any method can be used to identify mutations in the genes encoding the mannose-glucose specific PTS protein, in particular in the manL gene, manM gene or manN gene, in the lactose-positive galactose-negative streptococcus thermophilus strains suitable for the present invention.

For example, in order to identify suitable mutations in the manL, manM or manN gene, the person skilled in the art can operate by:

a) DSM32587 strain (mutant glcK gene thereof)

b) Mutagenesis of the manL, manM or manN gene of the strain in a), for example by random or directed mutagenesis, to obtain a manL, manM or manN gene with a sequence different from the sequence of the manL, manM or manN gene of DSM32587, thereby obtaining a man mutated DSM32587 strain;

c) the ratio of the amount of galactose released (mM) relative to the amount of lactose remaining (mM) of the milk fermented by the man-mutated DSM32587 strain of step B) was determined by test B, wherein a ratio of more than 1.2 means that the mutated manL, manM or manN gene is according to the invention. In a specific embodiment, a mutated manL, manM or manN gene is considered according to the invention when the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

Alternatively, the person skilled in the art can operate by:

a) providing a DGCC7710 strain, wherein the ccpA gene of said strain has been mutated ccpA gene (ccpA) as defined in SEQ ID NO:71_Δ1A114-120) Replacement, referred to herein as DGCC7710-ccpA_Δ1A114-120A strain;

b) mutagenesis of the manL, manM or manN gene of the strain in a), for example by random or directed mutagenesis, to obtain the sequence corresponding to DGCC7710-ccpA_Δ1A114-120The manL, manM or manN genes of the strain have different sequences, thereby obtaining the DGCC7710-ccpA of the man mutation_Δ1A114-120A strain;

c) determination of the human mutation DGCC7710-ccpA by test B)_Δ1A114-120A ratio of the amount of released galactose (mM) to the amount of lactose remaining (mM) of the milk fermented by the strain, wherein a ratio higher than 1.2 means that the mutated manL, manM or manN gene is according to the invention. In a specific embodiment, a mutated manL, manM or manN gene is considered according to the invention when the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

After identification, a mutated manL, manM or manN gene according to the invention can be introduced in place of the manL, manM or manN of a lactose-positive galactose-negative Streptococcus thermophilus strain to obtain a lactose-positive galactose-negative Streptococcus thermophilus strain according to the invention.

Mutations in the ccpA Gene

This section describes mutations of the ccpA gene, which may be used in combination with mutations of the gene encoding the mannose-glucose specific PTS protein as defined herein or in combination with mutations of the gene encoding the mannose-glucose specific PTS protein as defined herein and mutations of the glcK gene as defined herein in the context of the lactose positive galactose negative streptococcus thermophilus strain of the invention.

In a lactose-positive galactose-negative streptococcus thermophilus strain, any mutation in the ccpA gene is suitable as long as the ratio of the amount of released galactose (mM) relative to the amount of residual lactose (mM) is more than 1.2 when combined with the mutated glcK gene as defined herein, or with the mutated gene encoding a mannose-glucose specific PTS protein as defined herein, or with both the mutated glcK gene as defined herein and the mutated gene encoding a mannose-glucose specific PTS protein, when said strain is used in fermented milk, as defined herein.

The inventors have demonstrated that the mutation of the ccpA gene leading to the streptococcus thermophilus strain of the invention can be characterized by the ratio of the β -galactosidase activity determined by test D relative to the glucokinase activity determined by test E in the strain of ccpA carrying this mutation. Thus, a ccpA mutation as defined herein is a mutation of the ccpA gene which results in a lactose positive galactose negative Streptococcus thermophilus strain exhibiting a ratio of beta-galactosidase activity as determined by test D relative to glucokinase activity as determined by test E of at least 4.10^-6. In one embodiment, the ratio of β -galactosidase activity determined by test D relative to glucokinase activity determined by test E is selected from the group consisting of at least 4.10^-6At least 5.10^-6At least 6.10^-6At least 7.10^-6Or at least 8.10^-6Group (d) of (a). In one embodiment, the ratio of beta-galactosidase activity determined by test D to glucokinase determined by test E is at least 5.10^-6. In one embodiment, the ratio of beta-galactosidase activity determined by test D to glucokinase determined by test E is at least 6.10^-6. In one embodiment, the ratio of beta-galactosidase activity determined by test D to glucokinase determined by test E is at least 7.10^-6. In one embodiment, the channelThe ratio of beta-galactosidase activity as determined by test D relative to glucokinase as determined by test E is at least 8.10^-6. Whatever the minimum value of the ratios defined herein, the ratio of beta-galactosidase activity determined by test D relative to glucokinase activity determined by test E is not less than 8.10^-3。

To determine the ratio of β -galactosidase activity relative to glucokinase activity in the strains of the invention, test D and test E as described herein were used:

and (4) testing D:

beta-galactosidase activity in the Streptococcus thermophilus strains of the invention was determined by test D [ i.e.test D was performed using the Streptococcus thermophilus strains of the invention ].

A fresh overnight culture of the Streptococcus thermophilus strain to be assayed in M17 containing 30g/L lactose was obtained and used to inoculate 1% (v/v) with 10ml of fresh M17 containing 30g/L lactose. After 3 hours of growth on M17+30g/l lactose at 42 ℃, the cells were collected by centrifugation (6000g, 10min, 4 ℃), washed in 1.5ml cold lysis buffer (KPO40.1M) and resuspended in 300. mu.l cold lysis buffer. EDTA-free protease inhibitor "cOmplete" was used as described by the supplier^TM"(Roche, supplier reference 04693132001) was added to the lysis buffer. Cells were disrupted by adding 100mg of glass beads (150-212 μm, Sigma G1145) to 250 μ l of resuspended cells and shaking for 6min at a frequency of 30 cycles/sec in an MM200 shaking mill (Retsch, Haan, Germany). Cell debris and glass beads were removed by centrifugation (14000g, 15min, 4 ℃) and the supernatant was transferred to a 1.5mL clean centrifuge tube stored on ice. Total Protein content was determined by using a Fluka Protein quantitation Kit (FLUKA Protein quantitation Kit-Rapid, reference number 51254). Beta-galactosidase activity in cell extracts was determined by spectrophotometric monitoring of the hydrolysis of O-nitro-phenol-beta-galactoside (ONPG) to galactose and O-nitro-phenol (ONP). mu.L of bacterial extract was mixed with 135. mu.L of reaction buffer (NaPO)₄ 0.1M+KCl 0.01M+MgSO₄0.001M + ONPG 3mM + β mercaptoethanol 60mM, pH 6). The production of ONP gives a yellow color in the tube. When this color appeared, the color was stopped by adding 250. mu.L of stop buffer (Na)₂CO₃1M) to block the reaction. The optical density at 420nm was measured using a Synergy HT multi-detection microplate reader (biotm corporation (BIO-TEK)). One unit of galactosidase corresponds to the amount of enzyme that catalyzes the production of 1 micromole of ONP per minute under the assay conditions. The activity of β -galactosidase was calculated as follows:

β -galactosidase activity (U/g total protein extract) ═ dOD x V/[ dt x l x epsilon x Qprot ], wherein:

dOD is the change in Optical Density (OD) at 420nm between blank and test samples

V is the volume of the reaction whose optical density is measured (250. mu.L in this context)

-dt ═ represents the number of minutes duration of addition of 20 μ L of bacterial extract to addition of 250 μ L of stop buffer

-l ═ optical path length (0.73 cm in this text)

Molar attenuation coefficient of-epsilon-ONP (4500 cm in this context)²/μmol)

-amount of protein in Qprot ═ cuvette (in grams)

At least three measurements were made for each sample, and the specific β -galactosidase activity values given herein according to test D were the average of three independent experiments.

Test E

To determine the ratio, glucokinase activity in the Streptococcus thermophilus strains of the invention was determined by test E [ i.e., test E was performed using the Streptococcus thermophilus strains of the invention ].

A fresh overnight culture of the Streptococcus thermophilus strain to be assayed in M17 containing 30g/L lactose was obtained and used to inoculate 1% (v/v) with 10ml of fresh M17 containing 30g/L lactose. After 3 hours growth on M17+30g/L lactose at 42 ℃, cells were harvested by centrifugation (6000g, 10min, 4 ℃) in 1.5ml cold GLCK buffer (5mM MgCl2, 10mM K)₂HPO₄/KH₂PO₄[pH 7.2]) Washed and resuspended in 300. mu.l cold GLCK buffer. EDTA-free protease inhibitor "cOmplete" was used as described by the supplier^TM"(Roche, supplier reference 04693132001) was added to the GLCK buffer. Cells were disrupted by adding 100mg of glass beads (150-212 μm, Sigma G1145) to 250 μ l of resuspended cells and shaking for 6min at a frequency of 30 cycles/sec in an MM200 shaking mill (Retsch, Haan, Germany). Cell debris and glass beads were removed by centrifugation (14000g, 15min, 4 ℃) and the supernatant was transferred to a 1.5mL clean centrifuge tube stored on ice. Total Protein content was determined by using a Fluka Protein quantitation Kit (FLUKA Protein quantitation Kit-Rapid, reference number 51254). Glucokinase activity in cell extracts was determined spectrophotometrically by glucose-6-phosphate dehydrogenase (G-6PDH, EC 1.1.1.49): NADPH coupling assay (Porter et al, 1982), essentially as described by Pool et al (2006). Each sample (5, 10 and 20. mu.L) was added to assay buffer (10mM K) in a final volume of 250. mu.L₂HPO₄/KH₂PO₄[pH 7.2]5mM MgCl2, 1mM ATP, 20mM glucose, 1mM NADP, 1U G-6PDH) and the mixture was left at 30 ℃ for 5 min. The optical density at 340nm was measured for 5 minutes by using a Synergy HT multi-detection microplate reader (betem). One unit of glucokinase corresponds to the amount of enzyme catalyzing the phosphorylation of 1 micromole of D-glucose to D-glucose 6-phosphate per minute under the assay conditions. Glucokinase activity was calculated as follows:

glucokinase activity (U/g total protein extract) ═ dOD x V/[ dt x l x epsilon x Qprot ], where:

-dOD is the change in Optical Density (OD) at 340nm

V is the reaction volume (250. mu.L in this case)

dt ═ measurement time (in minutes)

light path length (0.73 cm in this document)

Epsilon is the molar decay coefficient of NADPH; h⁺(6220 cm 2/. mu. mol, herein)

Amount of protein in the Qprot ═ cuvette (in grams)

Three measurements were made for each sample, and the specific glucokinase activity values given herein according to test E are the average of three independent experiments.

In one embodiment, the ccpA gene mutation is not a mutation that knocks out (i.e., completely disrupts) the gene.

In one embodiment, the ccpA gene mutation is a mutation in the coding sequence of the ccpA gene, particularly in the first 270 nucleotides of the coding sequence of the ccpA gene. In one embodiment, the mutation is a mutation selected from the group consisting of:

a) a nonsense mutation (i.e., generating a stop codon) between nucleotide 1 and nucleotide 270 of the ccpA gene coding sequence; and

b) mutations that cause the open reading frame of the ccpA gene located in the first quarter of the coding sequence of the ccpA gene (i.e., between nucleotides 1 and 250).

In one embodiment, the mutation that causes the open reading frame of the ccpA gene is located between the 50 th and 200 th nucleotides of the ccpA gene coding sequence. In one embodiment, the mutation that causes the open reading frame of the ccpA gene is located between the 100 th and 150 th nucleotides of the ccpA gene coding sequence. Regardless of the position of the mutation causing the frameshift, the mutation is selected from the group consisting of a deletion, an insertion or a deletion/insertion (neither being a multiple of 3).

Although the two strains of streptococcus thermophilus may differ due to the sequence of their respective ccpA genes, this does not necessarily mean that one of the two ccpA genes is mutated in the sense of the present invention. Indeed, the following are not considered mutations of the ccpA gene in the present invention:

changes at the nucleotide level which do cause changes at the protein level, but in which this change does not yield at least 4.10^-6The ratio of beta-galactosidase activity determined by test D relative to glucokinase activity determined by test E of the lactose-positive galactose-negative Streptococcus thermophilus strain encoding this modified protein

Non-limiting examples of ccpA genes that are not considered to be mutated in the sense of the present invention are:

-a polynucleotide as defined in SEQ ID No. 65 (ccpA type ST 1); this ccpA type is one of DGCC7710 strains;

-a polynucleotide as defined in SEQ ID No. 66 (ccpA type ST2) having 99.8% identity with SEQ ID No. 65;

-a polynucleotide as defined in SEQ ID No. 67 (ccpA type ST3) having 99.8% identity with SEQ ID No. 65;

-a polynucleotide as defined in SEQ ID NO:68 (ccpA type ST4) having 99.7% identity with SEQ ID NO: 65;

-a polynucleotide as defined in SEQ ID No. 69 (ccpA type ST5) having 99.8% identity with SEQ ID No. 65; and

-a polynucleotide as defined in SEQ ID NO:70 (ccpA type ST6) having 99.7% identity with SEQ ID NO: 65.

The inventors have identified at least one mutation, which, when present in the ccpA gene of a lactose-positive galactose-negative Streptococcus thermophilus strain, enables this strain to exhibit a ratio of beta-galactosidase activity in said strain as determined by test D to glucokinase activity in said strain as determined by test E of at least 4.10 as defined herein^-6. Accordingly, the present invention relates to a streptococcus thermophilus strain carrying a mutation in the ccpA gene selected from the group consisting of: a nonsense mutation located between the 1 st and 270 th nucleotides of the coding sequence of the ccpA gene, and a mutation located in the first quarter of the coding sequence of the ccpA gene causing an open reading frame of the ccpA gene, wherein the ratio of beta-galactosidase activity in said strain as determined by test D to glucokinase activity in said strain as determined by test E as defined herein is at least 4.10^-6。

In one embodiment, the mutation of the ccpA gene is inDeletion of nucleotide A in the segment with 7 nucleotides A at positions 114-120 (resulting in the open reading frame of the ccpA gene). This mutated ccpA gene of Streptococcus thermophilus is referred to herein as ccpA_Δ1A114-120。

In one embodiment, the sequence of the ccpA gene with a stop codon at codon 66 is selected from the group consisting of:

a) 71 as defined in SEQ ID NO; and

b) ccpA variant sequence having at least 90% identity to SEQ ID NO 71. The ccpA variant as defined herein carries a mutation as defined above, i.e. is selected from the group consisting of: a nonsense mutation located between nucleotide 1 and nucleotide 270 of the coding sequence of the ccpA gene, and a mutation located in the first quarter of the coding sequence of ccpA causing an open reading frame of the ccpA gene.

To define a ccpA variant with at least 90% identity to SEQ ID NO 71, identity [ i.e. the number of identical nucleotides in one or more aligned parts of the sequence ] is calculated herein over the entire length of 2 sequences after optimal alignment. In a particular embodiment, the ccpA variant sequence is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 71. In a specific embodiment, the ccpA variant sequence differs from SEQ ID NO 71 by 1 to 30 nucleotide substitutions. In a specific embodiment, the ccpA variant sequence differs from SEQ ID NO 71 by 1 to 20 nucleotide substitutions. In a specific embodiment, the ccpA variant sequence differs from SEQ ID NO 71 by 1 to 15 nucleotide substitutions. In a specific embodiment, the ccpA variant sequence differs from SEQ ID NO 71 by 1 to 10 nucleotide substitutions. In a specific embodiment, the ccpA variant sequence differs from SEQ ID NO 71 by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide substitutions. In one embodiment, the sequence of the ccpA gene of the lactose positive galactose negative Streptococcus thermophilus strain of the invention is selected from the group consisting of SEQ ID NO 71, 72, 73, 74, 75 and 76.

In this section of the application, the skilled person obtains guidance on how to identify mutations of the ccpA gene other than the specifically disclosed mutations. Based on the ratio defined above [ the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in fermented milk as defined herein ] and the reference strain defined herein, the skilled person will know how to identify the mutated ccpA gene according to the invention and obtain the streptococcus thermophilus strain of the invention.

Thus, the person skilled in the art can operate by:

a) DGCC7710 strain is provided in which the manL gene has been mutated as defined in SEQ ID NO:111 (encoding IIAB)^Man ₃₀₅manL gene for protein), referred to herein as DGCC7710-IIAB^Man ₃₀₅A strain;

b) mutagenesis of the ccpA gene of the strain in a), for example by random or directed mutagenesis, to obtain the sequence corresponding to DGCC7710-IIAB^Man ₃₀₅The ccpA genes of the strains have different sequences, so that ccpA mutant DGCC7710-IIAB is obtained^Man ₃₀₅A strain;

c) determination of ccpA-mutated DGCC7710-IIAB by step B) by test B^Man ₃₀₅A ratio of the amount of released galactose (mM) to the amount of lactose remaining (mM) of the fermented milk of the strain, wherein a ratio greater than 1.2 means that the mutated ccpA is according to the invention. In a specific embodiment, a mutated ccpA gene is considered according to the present invention when the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

Alternatively, the person skilled in the art can operate by:

a) DGCC7710 strain is provided in which the manM gene has been mutated as defined in SEQ ID NO:157 with the manM gene (encoding IIC)^Man ₂₀₈manM Gene of protein), referred to herein as DGCC7710-IIC^Man ₂₀₈A strain;

b) mutagenesis of the ccpA gene of the strain in a), for example by random or targeted mutagenesisTo obtain the sequence and DGCC7710-IIC^Man ₂₀₈The ccpA genes of the strains have different sequences, so that ccpA mutant DGCC7710-IIC is obtained^Man ₂₀₈A strain;

c) determination of ccpA-mutated DGCC7710-IIC by step B) by test B^Man ₂₀₈A ratio of the amount of released galactose (mM) to the amount of lactose remaining (mM) of the fermented milk of the strain, wherein a ratio greater than 1.2 means that the mutated ccpA is according to the invention. In a specific embodiment, a mutated ccpA gene is considered according to the present invention when the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

The person skilled in the art can also operate by:

a) DGCC7710 strain is provided in which the manN gene has been mutated as defined in SEQ ID NO:206 (encoding IID)^Man ₂₈manN gene for protein), referred to herein as DGCC7710-IID^Man ₂₈A strain;

b) mutagenesis of the ccpA gene of the strain in a), for example by random or directed mutagenesis, to obtain the sequence corresponding to DGCC7710-IID^Man ₂₈The ccpA genes of the strains have different sequences, so that ccpA mutant DGCC7710-IID is obtained^Man ₂₈A strain;

c) determination of ccpA-mutated DGCC7710-IID by step B) by test B^Man ₂₈A ratio of the amount of released galactose (mM) to the amount of lactose remaining (mM) of the fermented milk of the strain, wherein a ratio greater than 1.2 means that the mutated ccpA is according to the invention. In a specific embodiment, a mutated ccpA gene is considered according to the present invention when the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

After identification, the mutated ccpA gene identified herein can be introduced in place of the ccpA gene of the lactose-positive galactose-negative streptococcus thermophilus strain to obtain the lactose-positive galactose-negative streptococcus thermophilus strain of the invention.

Further characterization of the strains of the invention

Part of the present invention is that the lactose positive galactose negative streptococcus thermophilus strain as defined herein shows a ratio of released amount of half lactose (mM) relative to the remaining amount of lactose (mM) of more than 1.2, more than 1.5, more than 2 or more than 3 when used for fermenting milk by test B. This feature can be used to design and identify the strains of the invention as described herein. The inventors have demonstrated that strains exhibiting this ratio (due to mutations in the gene encoding the mannose-glucose specific PTS protein and mutations in the glcK gene and/or the ccpA gene) are capable of:

1) obtaining low-lactose fermented milk; and/or

2) Fermented milk that has not undergone post-acidification can be obtained even when stored at fermentation temperatures.

Thus, if desired, these 2 advantages can be used to further characterize the strains of the invention, in addition to the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) as determined by test B, and the mutations defined herein for the gene encoding the mannose-glucose specific PTS protein, the glcK gene and the ccpA gene.

In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention is further characterized in that it produces a low lactose fermented milk when used for fermenting milk by test B, in addition to showing a ratio of the amount of released half lactose (mM) to the amount of remaining lactose (mM) of more than 1.2, more than 1.5, more than 2 or more than 3.

In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention is characterized in that it produces fermented milk that has not undergone post acidification when stored at fermentation temperature, in addition to showing a ratio of the amount of released half lactose (mM) relative to the amount of residual lactose (mM) that is greater than 1.2, greater than 1.5, greater than 2 or greater than 3, when used for fermented milk by test B.

In one embodiment, the lactose positive galactose negative streptococcus thermophilus strain of the invention is characterized in that it produces a low lactose fermented milk that does not undergo post acidification when stored at fermentation temperature (when used for fermenting milk by test B), in addition to showing a ratio of the amount of released half lactose (mM) to the amount of residual lactose (mM) that is greater than 1.2, greater than 1.5, greater than 2 or greater than 3.

The expression "lactose-reduced fermented milk" means a fermented milk which contains an amount of residual lactose in the fermented milk at the end of the fermentation by test B which is less than 60mM, less than 50mM, less than 45mM, less than 40mM, less than 35mM or less than 30 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 60 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 50 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 45 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 40 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 35 mM. In one embodiment, the concentration of lactose remaining in fermented milk obtained by test B using the strain of the invention is less than 30 mM. In one embodiment, the concentration of lactose remaining in the fermented milk obtained by test B using the strain of the invention is selected from the group consisting of: less than 60mM, less than 50mM, less than 45mM, less than 40mM, less than 35mM and less than 30 mM. Notably, the amount of lactose in the milk provided in test B was about 300mM (60g/L) prior to fermentation.

The expression "not subjected to post-acidification" means that when inoculated with a strain of the invention and fermented by test B, the pH of the milk product decreases until the acidification speed becomes definitely less than 0.1mUpH/min (defined herein as pH)_Terminate) The pH of (A), wherein the pH_TerminateIncluded between 4.6 and 5.3, and optionally, the slope between pH 6 and pH 5.5 is at least-0.008 UpH/min.

Thus, the absence of post-acidification is characterized by a pH-cut of the fermented milk when test B is usedEnding between 4.6 and 5.3. The pH was considered to be terminated (pH/time) when the acidification speed (. DELTA.pH/. DELTA.time) became definitely less than 0.1mUpH/min (less than 0.0001UpH/min)_Terminate). By "specifically becoming" is meant once the pH is obtained_TerminateThe acidification rate was maintained at 0.1mUpH/min for the remainder of test B (i.e.up to 24h at fermentation temperature).

In one example, the pH obtained by test B using the strains of the invention_TerminateComprised between 4.7 and 5.2. In one example, the pH obtained by test B using the strains of the invention_TerminateIncluded between 4.8 and 5.1. In one example, the pH obtained by test B using the strains of the invention_TerminateIncluded between a minimum value selected from the group consisting of 4.6, 4.7 and 4.8 and a maximum value selected from the group consisting of 5.1, 5.2 and 5.3.

In one embodiment, the fermented milk that has not undergone post-acidification is characterized by a slope between pH 6 and pH 5.5. The slope represents the inverse of the velocity (the velocity of acidification). In one embodiment, the slope is at least-0.009 UpH/min. In one embodiment, the slope is at least-0.01 UpH/min.

Examples of some strains of the invention

The invention also relates to the following lactose-positive galactose-negative streptococcus thermophilus strains:

strains corresponding to the DSM32587 strain (deposited at DSMZ at 2017, 8, 15) in which the coding sequence of the manL gene is as shown in SEQ ID NO:111 (encoding IIAB)^Man ₃₀₅) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain which carries the same mutated manL gene and in which the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) is more than 1.2 when the strain is used in fermented milk as determined by test B;

strains corresponding to the strain DSM32587, in which the coding sequence of the manM gene is as shown in SEQ ID NO:157 (coding for IIC)^Man ₂₀₈) Substitutions, and variants thereof; variants are defined herein as lactose positive halvesA lactose-negative strain of streptococcus thermophilus which carries the same mutated manM gene and in which the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) is greater than 1.2 when the strain is used in fermented milk as determined by test B;

strains corresponding to the strain DSM32587, in which the coding sequence of the manN gene is as shown in SEQ ID NO:206 (coding for IID)^Man ₂₈) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain which carries the same mutated manN gene and in which the ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) is more than 1.2 when the strain is used in fermented milk as determined by test B;

strains corresponding to the DSM32587 strain, in which the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manL gene with the sequence shown in SEQ ID NO:111 (coding for IIAB)^Man ₃₀₅) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manL gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when the strain is used in fermented milk as determined by test B;

-a strain corresponding to the DSM32587 strain, wherein the coding sequence of the ccpA gene follows the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manM gene with the sequence shown in SEQ ID NO:157 (encoding IIC)^Man ₂₀₈) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manM gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when the strain is used in fermented milk as determined by test B;

-a strain corresponding to strain DSM32587, wherein ccpAThe coding sequence of the gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manN gene with the sequence shown in SEQ ID NO:206 (coding for IID)^Man ₂₈) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manN gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when the strain is used in fermented milk as determined by test B;

strains corresponding to the DSM28255 strain, in which the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manL gene with the sequence shown in SEQ ID NO:111 (coding for IIAB)^Man ₃₀₅) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manL gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when said strain is used in fermented milk as determined by test B.

Strains corresponding to the DSM28255 strain, in which the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manM gene with the sequence shown in SEQ ID NO:157 (encoding IIC)^Man ₂₀₈) Substitutions, and variants thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manM gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when the strain is used in fermented milk as determined by test B;

strains corresponding to the DSM28255 strain, in which the coding sequence of the ccpA gene is represented by the sequence shown in SEQ ID NO:71 (ccpA)_Δ1A114-120) Replacement and the coding sequence of the manN gene with the sequence shown in SEQ ID NO:206 (coding for IID)^Man ₂₈) Replacement, anda variant thereof; a variant is defined herein as a lactose-positive galactose-negative streptococcus thermophilus strain carrying the same mutated ccpA gene and the same mutated manN gene and releasing a ratio of the amount of half lactose (mM) relative to the amount of residual lactose (mM) in fermented milk of more than 1.2 when said strain is used in fermented milk as determined by test B.

In a specific embodiment, the genomic sequence of a variant of a strain as defined herein has at least 90% identity to the genomic sequence of the strain from which the variant is obtained, in particular at least 90%, at least 91%, at least 95%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.92%, at least 99.94%, at least 99.96%, at least 99.98% or at least 99.99% identity to the genomic sequence of the strain from which the variant is obtained. Identity is described in terms of comparing two genomic sequences over their full length (global alignment) and can be calculated using any program based on the Needleman-Wunsch algorithm.

Compositions, methods and uses of lactose-positive galactose-negative Streptococcus thermophilus strains of the invention

The invention also relates to a bacterial composition comprising or consisting of: at least one, in particular one, lactose-positive galactose-negative strain of Streptococcus thermophilus according to the invention. In a particular embodiment, the bacterial composition is a pure culture, i.e. comprises or consists of a single bacterial strain. In another embodiment, the bacterial composition is a mixed culture, i.e. comprises or consists of: one or more lactose positive galactose negative streptococcus thermophilus strains according to the invention and at least one further bacterial strain. By "at least" (with respect to strains or bacteria) is meant 1 or more, and in particular 1, 2, 3, 4 or 5 strains.

Thus, in one embodiment, the bacterial composition of the invention comprises or consists of: one or more lactose positive galactose negative streptococcus thermophilus strains of the invention and at least one lactic acid bacterium of a species selected from the group consisting of: lactococcus (Lactococcus) species, Streptococcus (Streptococcus) species, Lactobacillus (Lactobacillus) species including Lactobacillus acidophilus (Lactobacillus acidophilus), Enterococcus (Enterococcus) species, Pediococcus (Pediococcus) species, Leuconostoc (Leuconostoc) species, Bifidobacterium (Bifidobacterium) species and Oenococcus (Oenococcus) species or any combination thereof. Lactococcus species include lactobacillus acidophilus and Lactococcus lactis, including Lactococcus lactis subsp. The Bifidobacterium species include Bifidobacterium animalis (Bifidobacterium animalis), in particular Bifidobacterium animalis subsp. Other species of lactic acid bacteria include species of Leuconostoc, Streptococcus thermophilus, Lactobacillus delbrueckii subsp.

In one embodiment, the bacterial composition comprises or consists of: one or more lactose positive galactose negative streptococcus thermophilus strains according to the invention and at least one different streptococcus thermophilus strain than the one or more streptococcus thermophilus strains according to the invention and/or at least one strain of lactobacillus species and/or any combination thereof. In a particular embodiment, the bacterial composition comprises or consists of: one or more streptococcus thermophilus strains of the invention, one or more lactobacillus delbrueckii subsp. In a particular embodiment, the bacterial composition comprises or consists of: one or more strains of Streptococcus thermophilus of the invention, at least one strain of Streptococcus thermophilus different from the one or more strains of Streptococcus thermophilus of the invention and a strain of Lactobacillus delbrueckii subsp. In another specific embodiment, the bacterial composition comprises or consists of: one or more strains of Streptococcus thermophilus and Lactobacillus delbrueckii subsp.

In a particular embodiment, the bacterial composition comprises or consists of: one or more strains of Streptococcus thermophilus, lactococcus lactis subsp.

In a particular embodiment of any of the bacterial compositions defined herein in the form of a pure culture or a mixed culture, the bacterial composition further comprises at least one probiotic bacterial strain, such as Bifidobacterium animalis subsp.

In particular embodiments, the bacterial composition in the form of a pure culture or a mixed culture as defined above is in frozen, dried, freeze-dried, liquid or solid form, in the form of pellets or frozen pellets, or in the form of a powder or dry powder. In particular embodiments, the bacterial composition of the invention is in frozen form or in the form of pellets or frozen pellets, in particular contained in one or more boxes or sachets. In another embodiment, the bacterial composition as defined herein is in powder form, such as a dried or freeze-dried powder, in particular contained in one or more boxes or sachets.

In a particular embodiment, the bacterial composition according to the invention, in the form of a pure culture or mixed culture and whatever form (frozen, dried, freeze-dried, liquid or solid form, in the form of granules or frozen granules, or in the form of a powder or dry powder), as defined above, comprises one or more lactose-positive galactose-negative streptococcus thermophilus strains according to the invention, at a concentration comprised between 10⁵To 10¹²cfu (colony forming units)/gram of bacterial composition. In a specific embodiment, the present inventionThe concentration of one or more lactose-positive galactose-negative strains of Streptococcus thermophilus in the bacterial composition of the invention is 10⁷To 10¹²cfu/gram of bacterial composition, and in particular at least 10⁷At least 10⁸At least 10⁹At least 10¹⁰Or at least 10¹¹CFU/g bacterial composition. In a specific embodiment, the concentration of the one or more lactose-positive galactose-negative strains of Streptococcus thermophilus in pure culture or in mixed culture within the bacterial composition is 10 when in the form of a frozen or dried concentrate⁸To 10¹²cfu/g frozen or dried concentrate, and more preferably at least 10⁸At least 10⁹At least 10¹⁰At least 10¹¹Or at least 10¹²cfu/g frozen concentrate or dried concentrate.

The invention also relates to a method for manufacturing a fermentation product, the method comprising: a) inoculating a substrate with one or more lactose positive galactose negative streptococcus thermophilus strains according to the invention, and b) fermenting the inoculated substrate to obtain a fermentation product. In a specific embodiment, one or more lactose-positive galactose-negative streptococcus thermophilus strains of the invention are inoculated in the form of a bacterial composition as defined herein, such as a pure culture or a mixed culture. In one embodiment, the substrate added by the one or more strains or compositions of streptococcus thermophilus of the invention is a milk substrate. By 'milk substrate' is meant milk derived from animals and/or plants. In a particular embodiment, the milk substrate is derived from an animal such as a cow, goat, sheep, buffalo, zebra, horse, donkey or camel, and the like. The milk may be in a natural state, reconstituted milk, skim milk or milk supplemented with compounds necessary for bacterial growth or subsequent treatment of fermented milk. Thus, in a particular embodiment, the present invention also provides a method for manufacturing a fermented milk product, the method comprising: a) inoculating a milk substrate with one or more lactose positive galactose negative streptococcus thermophilus strain or bacterial composition of the invention, and b) fermenting the inoculated milk substrate to obtain a fermented milk product.

The invention also relates to the use of one or more lactose-positive galactose-negative streptococcus thermophilus strains according to the invention or a composition according to the invention for the manufacture of a fermented milk product.

The present invention also relates to a fermented dairy product obtained using one or more lactose-positive galactose-negative streptococcus thermophilus strains according to the invention or a bacterial composition according to the invention, in particular by or obtainable by the method according to the invention. Accordingly, the present invention relates to a fermented dairy product comprising one or more lactose-positive galactose-negative streptococcus thermophilus strains of the present invention. In a particular embodiment, the fermented dairy food product of the invention is freshly fermented milk. In a specific embodiment, the fermented dairy product of the invention, in particular the freshly fermented milk as defined herein, contains the DSM32587 strain deposited at the DSMZ at 8, 15, 2017, as defined herein, or any variant thereof.

Proteins, nucleic acids, vectors, constructs and uses thereof

The present invention relates to a polynucleotide encoding a streptococcus thermophilus glucokinase having a significantly reduced but non-zero glucokinase activity. In one example, reduced, but non-zero, glucokinase activity was determined in DGCC7710 derivatives (i.e., DGCC7710 strain whose glcK gene had been replaced with the glcK polynucleotide to be assayed). To test a polynucleotide encoding glucokinase satisfying the glucokinase activity characteristic "significantly reduced but not zero" in the DGCC7710 derivative, the glcK gene of the DGCC7710 strain was replaced with the glcK gene encoding the Streptococcus thermophilus glucokinase to be assayed to obtain a derivative of DGCC7710, and the DGCC7710 derivative was assayed by test A (see example 4).

Streptococcus thermophilus glucokinase (encoded by the polynucleotide of the invention) satisfies the glucokinase activity characteristic "significantly reduced but not zero" in the DGCC7710 derivative when the following occurs:

a) the glucokinase activity of said Streptococcus thermophilus glucokinase in DGCC7710 derivatives is comprised between 200U/g and 1500U/g of total protein extract, as determined by test A, in particular between 300U/g and 1200U/g or between 400U/g and 1000U/g of total protein extract, as determined by test A, or

b) The glucokinase activity of said Streptococcus thermophilus glucokinase in DGCC7710 derivative is between 5% and 60% of the glucokinase activity of the DGCC7710 strain deposited at DSMZ at 2014 1, 14, in particular between 10% and 50% or between 15% and 40% of the glucokinase activity of the DGCC7710 strain at DSMZ under accession number DSM28255, when both determined by test A, wherein the glucokinase activity in said DG7710 derivative and the glucokinase activity of the DGCC7710 strain are determined by test A.

In a specific example, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivatives is from 200U/g to 1500U/g total protein extract as determined by test A. In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivatives is from 300U/g to 1200U/g of total protein extract as determined by test A. In a specific example, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivatives is 400U/g to 1000U/g total protein extract as determined by test A. In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in the DGCC7710 derivative is from a minimum selected from the group consisting of 200U/g, 300U/g and 400U/g total protein extract to a maximum selected from the group consisting of 1000U/g, 1200U/g and 1500U/g total protein extract as determined by test A. Notably, as described in test a, the glucokinase activity values disclosed herein are the average of three independent experiments (in triplicate).

In a specific example, the glucokinase activity of streptococcus thermophilus glucokinase (encoded by the polynucleotide of the invention) in the DGCC7710 derivative is 5% to 60% of the glucokinase activity of the DGCC7710 strain deposited at the DSMZ at 1, 14, 2014 under accession number DSM 28255. "Glucokinase activity of DGCC7710 strain" means the activity of the DGCC7710 strain glucokinase (i.e., having SEQ ID NO:2) in DGCC7710 strain as determined by test A [ i.e., test A was performed using DGCC7710 strain ]. The percentage values are calculated based on the glucokinase activity of Streptococcus thermophilus glucokinase in the DGCC7710 derivative and the glucokinase activity of the DGCC7710 strain, both glucokinase activities being determined by test A.

In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in the DGCC7710 derivative is 5% to 60% of the glucokinase activity of DGCC7710 strain. In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivative is 10% to 50% of the glucokinase activity of DGCC7710 strain. In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivative is 15% to 40% of the glucokinase activity of strain DGCC 7710. In a specific embodiment, the glucokinase activity of Streptococcus thermophilus glucokinase in DGCC7710 derivative is a minimum percentage selected from the group consisting of 5%, 10% and 15% of the glucokinase activity of DGCC7710 strain to a maximum percentage selected from the group consisting of 40%, 50% and 60% of the glucokinase activity of DGCC7710 strain. In a specific example, and regardless of the percentage range, the glucokinase activity of S.thermophilus glucokinase is determined in DGCC7710 derivative by test A described herein. Notably, the percentage values disclosed herein are calculated from glucokinase activity values, which are the average of three independent experiments (in triplicate) determined by test a.

The feature "glucokinase activity in the DGCC7710 derivative is significantly reduced but not zero" can also be characterized by the maximum forward velocity (Vmax) of glucokinase or the affinity of glucokinase for one or both of its substrates, i.e., glucose and ATP, called Km, in the DGCC7710 derivative. In one embodiment, the characteristic "significantly reduced but non-zero glucokinase activity in DGCC7710 derivatives" of Streptococcus thermophilus glucokinase of the invention (encoded by the polynucleotide of the invention) can also be characterized by the maximum forward velocity of this glucokinase in DGCC7710 derivatives.

Thus, in combination with the example defined herein as being characterized by a significant reduction but not zero in glucokinase activity in derivatives of DGCC7710, the maximum forward velocity (Vmax) of S.thermophilus glucokinase in derivatives of DGCC7710 is significantly reduced but not zero. In order to test that glucokinase satisfies the Vmax characteristic of "significantly reduced but not zero" in the DGCC7710 derivative, the open reading frame of the glcK gene of the DGCC7710 strain is replaced with the open reading frame of the glcK gene encoding Streptococcus thermophilus glucokinase to be tested (i.e., the polynucleotide of the present invention) to obtain a derivative of DGCC7710, and the DGCC7710 derivative is tested by test C (see example 4). The expression "DGCC 7710 derivative" is as defined above.

The "significantly reduced but non-zero" characteristic of Vmax of glucokinase in DGCC7710 derivatives can be defined by one or both of these parameters:

-Vmax of streptococcus thermophilus glucokinase in DGCC7710 derivatives is 200 to 1500U/g total protein extract as determined by test C;

-the Vmax of streptococcus thermophilus glucokinase in the DGCC7710 derivative is 5% to 60% of the Vmax of the glucokinase deposited at DGCC7710 strain of DSMZ under accession number DSM28255 when both determined by test C.

In a particular embodiment, the invention relates to a polynucleotide encoding streptococcus thermophilus glucokinase, in which the glucokinase activity of the glucokinase in the DGCC7710 derivative is significantly reduced but not zero (as defined herein), and in which the maximum forward velocity (Vmax) of said glucokinase in the DGCC7710 derivative is significantly reduced but not zero and is defined by one or both of these parameters:

-Vmax of streptococcus thermophilus glucokinase in DGCC7710 derivatives is 200 to 1500U/g total protein extract as determined by test C;

-the Vmax of streptococcus thermophilus glucokinase in the DGCC7710 derivative is 5% to 60% of the Vmax of the glucokinase deposited at DGCC7710 strain of DSMZ under accession number DSM28255 when both determined by test C.

In a specific embodiment, the Vmax of Streptococcus thermophilus glucokinase in the DGCC7710 derivative is from 200U/g to 1500U/g total protein extract as determined by test C. In a specific embodiment, the Vmax of Streptococcus thermophilus glucokinase in the DGCC7710 derivative is between 300U/g and 1200U/g of total protein extract as determined by test C. In a specific embodiment, the Vmax of S.thermophilus glucokinase in DGCC7710 derivatives is 400U/g to 1000U/g total protein extract. In a specific embodiment, the Vmax of Streptococcus thermophilus glucokinase in the DGCC7710 derivative is from a minimum value selected from the group consisting of 200U/g, 300U/g and 400U/g total protein extract to a maximum value selected from the group consisting of 1000U/g, 1200U/g and 1500U/g total protein extract as determined by test C.

In a specific embodiment, the Vmax of streptococcus thermophilus glucokinase in the DGCC7710 derivative is 10% to 50% of the Vmax of glucokinase of the DGCC7710 strain, both when determined by test C. "Vmax of glucokinase of DGCC7710 strain" means Vmax of glucokinase of DGCC7710 strain (i.e., having SEQ ID NO:2) as determined by test C in DGCC7710 strain [ i.e., test C was performed using DGCC7710 strain ]. The percentage values are calculated based on the Vmax of the Streptococcus thermophilus glucokinase in the DGCC7710 derivative and the Vmax of the glucokinase of the DGCC7710 strain, both Vmax being determined by test C. In a specific embodiment, the Vmax of the Streptococcus thermophilus glucokinase in the DGCC7710 derivative is 15% to 40% of the Vmax of the glucokinase of the DGCC7710 strain. In a specific embodiment, the Vmax of streptococcus thermophilus glucokinase in the DGCC7710 derivative is the smallest percentage selected from the group consisting of 5%, 10% and 15% of the Vmax of the glucokinase activity of the DGCC7710 strain to the largest percentage selected from the group consisting of 40%, 50% and 60% of the Vmax of the glucokinase activity of the DGCC7710 strain.

In one embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero Vmax in DGCC7710 derivative, the sequence of which has an amino acid other than glutamic acid (i.e. is any amino acid other than glutamic acid) at position 275 thereof (based on the sequence numbering as defined in SEQ ID NO: 25). In one embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero glucokinase in DGCC7710 derivative, the sequence of which has an amino acid other than an acidic amino acid (i.e. is any amino acid other than an acidic amino acid) at position 275 (based on the sequence numbering as defined in SEQ ID NO: 25). In one embodiment, the polynucleotide of the invention encodes a streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero Vmax in DGCC7710 derivative, the sequence of which has at its position 275 (based on the sequence numbering as defined in SEQ ID NO: 25) an amino acid selected from the group consisting of lysine and any conserved amino acids thereof. In one embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero glucokinase in DGCC7710 derivative, the sequence of which has an amino acid which is a lysine at position 275 (based on the sequence numbering as defined in SEQ ID NO: 25). In a specific embodiment, the polynucleotide of the invention encodes a streptococcus thermophilus of 322 amino acids in length.

In another embodiment, a polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but non-zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but non-zero Vmax in DGCC7710 derivative, the sequence of which has an amino acid other than glycine (i.e. is any amino acid other than glycine) at position 144 (based on the sequence numbering as defined in SEQ ID NO: 25). In one embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero glucokinase in DGCC7710 derivative, the sequence of which has an amino acid other than an aliphatic amino acid (i.e. is any amino acid other than an aliphatic amino acid) at position 144 (based on the sequence numbering as defined in SEQ ID NO: 25). In one embodiment, the polynucleotide of the invention encodes a streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero Vmax in DGCC7710 derivative, the sequence of which has at its position 144 (based on the sequence numbering as defined in SEQ ID NO: 25) an amino acid selected from the group consisting of serine and any conserved amino acids thereof. In one embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero glucokinase in DGCC7710 derivative, the sequence of which has an amino acid at position 144 (based on the sequence numbering as defined in SEQ ID NO: 25) that is serine. In a specific embodiment, the polynucleotide of the invention encodes a Streptococcus thermophilus glucokinase 322 amino acids in length.

In a specific embodiment, the polynucleotide of the invention encoding a streptococcus thermophilus glucokinase having a significantly reduced but not zero glucokinase activity in DGCC7710 derivative and optionally a significantly reduced but not zero glucokinase in DGCC7710 derivative is selected from the group consisting of:

a) 25, wherein the amino acid at position 275 is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine; and

b) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific embodiment, the GlcK variant sequence is 322 amino acids in length. In one embodiment, the GlcK variant has an arginine at position 278 thereof and/or a serine at position 279 thereof.

c) 46, wherein the amino acid at position 144 is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine; and

d) a GlcK variant sequence having at least 90% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 in glucokinase (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence is 322 amino acids in length.

To define GlcK variants having at least 90% similarity to SEQ ID No. 25, similarity or identity [ i.e. the number of similar or identical amino acid residues in one or more aligned parts of the sequence ] is calculated herein over the entire length of 2 sequences after optimal alignment; position 275 as defined in SEQ ID NO:25 is not considered for calculation of similarity or identity. In a specific embodiment, the GlcK variant sequence has at least 91, 92, 93, 94, 95, 96, 97, 98 or 99% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase is any amino acid other than glutamic acid, particularly any amino acid other than an acidic amino acid, particularly lysine. In one embodiment, the GlcK variant sequence has at least 95% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In one embodiment, the GlcK variant sequence has at least 97% similarity or identity to SEQ ID NO:25, wherein the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine.

In a specific embodiment, the GlcK variant sequence differs from SEQ ID NO:25 by 1 to 30 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine (position 275 is not considered for the calculation of the number of one or more substitutions). In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1 to 20 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific example, the GlcK variant sequence differs from SEQ ID No. 25 by 1 to 15 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific embodiment, the GlcK sequence differs from SEQ ID No. 25 by 1 to 10 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a specific example, the GlcK sequence differs from SEQ ID No. 25 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions, wherein the amino acid at position 275 of the GlcK variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine.

In a specific embodiment, the sequence of Streptococcus thermophilus glucokinase (encoded by a polynucleotide of the invention) is selected from the group consisting of SEQ ID NOs: 25, 26, 27, 28, 29, 30, 31, 32, 33 and 34, wherein the amino acid at position 275 of the variant is any amino acid other than glutamic acid, in particular any amino acid other than an acidic amino acid, in particular lysine. In a particular embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is not glutamic acid.

In a particular embodiment, the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase (encoded by a polynucleotide of the invention) as SEQ ID NO:25 or any GlcK variant sequence having at least 90% similarity or identity to SEQ ID NO:25 as defined herein (in particular SEQ ID NO:26, 27, 28, 29, 30, 31, 32, 33 or 34). In a specific embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NOs 26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) in glucokinase is selected from the group consisting of lysine and any conserved amino acids thereof. In a particular embodiment, as SEQ ID NO:25 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:25 (in particular SEQ ID NOs 26, 27, 28, 29, 30, 31, 32, 33 or 34), the amino acid in glucokinase corresponding to position 275 of SEQ ID NO:25 (or the amino acid at position 275 of glucokinase) is lysine; thus, in a specific embodiment, the sequence of Streptococcus thermophilus glucokinase (encoded by a polynucleotide of the invention) is selected from the group consisting of SEQ ID NOs 22, 35, 36, 37, 38, 39, 40, 41, 42 and 43.

To define GlcK variants having at least 90% similarity to SEQ ID NO 46, similarity or identity [ i.e. the number of similar or identical amino acid residues in one or more aligned parts of the sequence ] is calculated herein over the entire length of 2 sequences after optimal alignment; position 144 as defined in SEQ ID NO 46 is not considered for calculation of similarity or identity. In a particular embodiment, the GlcK variant sequence has at least 91, 92, 93, 94, 95, 96, 97, 98 or 99% similarity or identity to SEQ ID NO:46, wherein the amino acid corresponding to position 144 of SEQ ID NO:46 (or the amino acid at position 144 of glucokinase) in glucokinase is any amino acid other than glycine, particularly any amino acid other than an aliphatic amino acid, particularly serine. In one embodiment, the GlcK variant sequence has at least 95% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In one embodiment, the GlcK variant sequence has at least 97% similarity or identity to SEQ ID No. 46, wherein the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine.

In a specific embodiment, the GlcK variant sequence differs from SEQ ID NO:46 by 1 to 30 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine (position 144 is not considered for the calculation of the number of one or more substitutions). In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1 to 20 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK variant sequence differs from SEQ ID No. 46 by 1 to 15 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK sequence differs from SEQ ID No. 46 by 1 to 10 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine. In a specific embodiment, the GlcK sequence differs from SEQ ID No. 46 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions, wherein the amino acid at position 144 of the GlcK variant is any amino acid other than glycine, in particular any amino acid other than an aliphatic amino acid, in particular serine.

In a specific embodiment, the sequence of Streptococcus thermophilus glucokinase (encoded by a polynucleotide of the invention) is selected from the group consisting of SEQ ID NOs 46, 47, 48, 49, 50, 51, 52, 53, 54 and 55, wherein the amino acid at position 144 of the variant is any amino acid other than glycine, in particular any amino acid other than aliphatic amino acids, in particular serine. In a particular embodiment, as SEQ ID NO:46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID NO:46 (in particular SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID NO:46 (or the amino acid at position 144 of glucokinase) is not glycine.

In a particular embodiment, the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) in glucokinase (encoded by the polynucleotide of the invention) as SEQ ID No. 46 or any GlcK variant sequence defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID No. 47, 48, 49, 50, 51, 52, 53, 54 or 55) is not an aliphatic amino acid. In a specific embodiment, the amino acid corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) in glucokinase as SEQ ID No. 46 or any GlcK variant sequence defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID No. 47, 48, 49, 50, 51, 52, 53, 54 or 55) is selected from the group consisting of serine and any conserved amino acid thereof. In a particular embodiment, as SEQ ID No. 46 or any GlcK variant sequence as defined herein having at least 90% similarity or identity to SEQ ID No. 46 (in particular SEQ ID NOs 47, 48, 49, 50, 51, 52, 53, 54 or 55), the amino acid in glucokinase corresponding to position 144 of SEQ ID No. 46 (or the amino acid at position 144 of glucokinase) is serine; thus, in a specific embodiment, the sequence of Streptococcus thermophilus glucokinase (encoded by a polynucleotide of the invention) is selected from the group consisting of SEQ ID NOs 45, 56, 57, 58, 59, 60, 61, 62, 63 and 64.

In defining the sequence of streptococcus thermophilus glucokinase (encoded by a polynucleotide of the invention), the glucokinase activity in DGCC7710 derivatives expressing this glucokinase is significantly reduced but not zero as defined herein, and optionally the Vmax of this glucokinase in DGCC7710 derivatives is significantly reduced but not zero as defined herein, according to the teachings of the present application.

The present invention also relates to a polynucleotide for coding 322 amino acids glucokinase. In a specific embodiment, the polynucleotide is from a streptococcus thermophilus strain. Based on the genetic code, one skilled in the art knows whether a polynucleotide encodes S.thermophilus glucokinase as defined herein. In a specific embodiment, when the encoded glucokinase is 322 amino acids in length, the polynucleotide of the invention is 969 nucleotides in length.

A non-limiting example of a polynucleotide of the invention is disclosed in SEQ ID NO 21. Another non-limiting example of a polynucleotide of the invention is disclosed in SEQ ID NO. 44. Further non-limiting examples of polynucleotides of the invention are the sequences as defined in SEQ ID Nos 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, but wherein codon 144 or codon 275, respectively, encodes any amino acid other than glycine or glutamic acid, in particular other than an aliphatic or acidic amino acid, in particular serine or lysine, respectively. In particular, non-limiting examples of polynucleotides of the invention are the sequences as defined in SEQ ID Nos 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, but wherein the 275 th codon is AAA or AAG. In particular, non-limiting examples of polynucleotides of the invention are the sequences as defined in SEQ ID Nos 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, but wherein the 144 th codon is AGT, AGC, TCT, TCC, TCA or TCG.

The invention also relates to the use of a polynucleotide (or construct, plasmid or vector) of the invention for the design of bacterial cells, in particular gram-positive bacterial cells, in particular streptococcus thermophilus cells. In a particular embodiment, the polynucleotide (or construct, plasmid or vector) of the invention is used to replace the glcK gene of a streptococcus thermophilus strain such that the streptococcus thermophilus strain expresses glucokinase as defined herein. In a particular embodiment, the only glucokinase expressed by said obtained streptococcus thermophilus is the glucokinase as defined herein. In a specific embodiment, the glcK gene of the lactose positive streptococcus thermophilus strain is replaced with a polynucleotide (or construct, plasmid or vector) of the invention. In one embodiment, the glcK gene of a lactose-positive galactose-negative streptococcus thermophilus strain is replaced with a polynucleotide (or construct, plasmid or vector) of the invention.

The present invention also relates to a (mutated) streptococcus thermophilus ccpA polynucleotide as defined or identified above. In one embodiment, the invention also relates to a (mutated) streptococcus thermophilus ccpA polynucleotide selected from the group consisting of:

a) a ccpA polynucleotide which, when inserted in place of the ccpA gene of DGCC7710 strain, results in a polypeptide exhibiting a ratio of beta-galactosidase activity as determined by test D relative to glucokinase activity as determined by test E of at least 4.10 as defined herein^-6The DGCC7710 derivative of (1).

b) The ccpA polynucleotide, when replacing DGCC7710 strain (i.e., DGCC 7710-IIAB) that had previously replaced the manL gene with the manL gene as defined in SEQ ID NO:111^Man ₃₀₅Strain) generates DGCC7710-IIAB upon ccpA gene insertion^Man ₃₀₅Derivative which, when used in fermented milk, releases a ratio of the amount of half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2, more than 1.5, more than 2, more than 2.5 or more than 3, as determined by test B

c) ccpA polynucleotide, when substituted has been previously replaced with the manM gene as defined in SEQ ID NO:157DGCC7710 Strain (i.e., DGCC 7710-IIC) having manM Gene^Man ₂₀₈Strain) generates DGCC7710-IIC upon ccpA gene insertion^Man ₂₀₈A derivative which, when used in fermented milk as determined by test B, releases a ratio of the amount of half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2, more than 1.5, more than 2, more than 2.5 or more than 3;

d) ccpA polynucleotide, when substituted for DGCC7710 strain (i.e., DGCC 7710-IID) that had previously replaced the manN gene with the manN gene as defined in SEQ ID NO:206^Man ₂₈Strain) generates DGCC7710-IID when the ccpA gene is inserted^Man ₂₈Derivative, which when used in fermented milk releases a ratio of the amount of half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2, more than 1.5, more than 2, more than 2.5 or more than 3, as determined by test B.

For any of b) to d), DGCC7710-IIAB^Man ₃₀₅Derivative, DGCC7710-IIC^Man ₂₀₈Derivatives or DGCC7710-IID^Man ₂₈The derivative may be further characterized in that it exhibits a ratio of beta-galactosidase activity determined by test D relative to glucokinase activity determined by test E, as defined herein, of at least 4.10^-6。

In this context, as applicable to DGCC7710-IIAB^Man ₃₀₅Strain, DGCC7710-IIC^Man ₂₀₈Strain and DGCC7710-IID^Man ₂₈The term "derivative" when used in connection with a strain means DGCC7710-IIAB^Man ₃₀₅Strain, DGCC7710-IIC^Man ₂₀₈Strain and DGCC7710-IID^Man ₂₈Strain in which the original ccpA gene (one of the DGCC7710 strains) has been replaced with the mutated ccpA gene to be determined.

In this context, DGCC7710-IIAB^Man ₃₀₅Strain means DGCC7710 strain with the manL gene replaced by its manL gene as defined in SEQ ID NO: 111. Similarly, DGCC7710-IIC^Man ₂₀₈Strain means a strain with m as defined in SEQ ID NO:157anM DGCC7710 strain with manM gene replaced. Similarly, DGCC7710-IID^Man ₂₈Strain means DGCC7710 strain with the manN gene replaced by its manN gene as defined in SEQ ID NO. 206.

In one embodiment, the mutant ccpA polynucleotide is not a knock-out allele (i.e., a disrupted allele) of the ccpA gene.

In one embodiment, the ccpA gene mutation is a mutation in the coding sequence of the ccpA gene, particularly in the first 270 nucleotides of the coding sequence of the ccpA gene. In one embodiment, the mutation is a mutation selected from the group consisting of:

a) a nonsense mutation (i.e., generating a stop codon) between nucleotide 1 and nucleotide 270 of the ccpA gene coding sequence; and

b) mutations that cause the open reading frame of the ccpA gene located in the first quarter of the coding sequence of the ccpA gene (i.e., between nucleotides 1 and 250).

In one embodiment, the mutation that causes the open reading frame of the ccpA gene is located between the 50 th and 200 th nucleotides of the ccpA gene coding sequence. In one embodiment, the mutation that causes the open reading frame of the ccpA gene is located between the 100 th and 150 th nucleotides of the ccpA gene coding sequence. Regardless of the position of the mutation causing the frameshift, the mutation is selected from the group consisting of a deletion, an insertion or a deletion/insertion (neither being a multiple of 3).

In one embodiment, the sequence of the mutated ccpA polynucleotide is selected from the group consisting of: a) 71 as defined in SEQ ID NO; and b) a ccpA variant sequence having at least 90% identity to SEQ ID NO 71. The definition of ccpA variants with at least 90% identity is detailed in paragraph III. Mutation of the above ccpA gene.

The (mutated) glcK polynucleotide [ encoding a mutated streptococcus thermophilus glucokinase as defined herein ] and the (mutated) ccpA polynucleotide as defined herein can be used to design streptococcus thermophilus strains, in particular lactose positive galactose negative streptococcus thermophilus strains. The use consists in replacing the glcK gene and/or the ccpA gene of the original streptococcus thermophilus strain with a mutated glcK polynucleotide and/or a mutated ccpA polynucleotide as defined herein, in order to design a streptococcus thermophilus strain in which one or more of the original genes are replaced with one or more (mutated) genes as defined herein. The present invention also relates to a method of designing a streptococcus thermophilus strain, comprising: 1) replacing the glcK gene and/or the ccpA gene of the original streptococcus thermophilus strain with the mutated glcK polynucleotide and/or the mutated ccpA polynucleotide as defined herein, and 2) obtaining a streptococcus thermophilus strain with one or more of the original genes replaced with one or more (mutated) genes as defined herein.

In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in at least one, in particular one, gene encoding a mannose-glucose specific PTS protein, in particular in its manL gene, its manM gene and/or its manN gene as defined herein; thus, replacement of the glcK gene and/or the ccpA gene of this original streptococcus thermophilus strain by a mutated glcK polynucleotide and/or a mutated ccpA polynucleotide as defined herein will result in a lactose positive galactose negative streptococcus thermophilus strain of the invention. In another embodiment of said use or said method, the original S.thermophilus strain does not carry a mutation in the gene encoding the mannose-glucose specific PTS protein; thus, replacement of the glcK gene and/or the ccpA gene of this original streptococcus thermophilus strain by a mutated glcK polynucleotide and/or a mutated ccpA polynucleotide as defined herein will yield a middle lactose positive galactose negative streptococcus thermophilus strain which can be used as a starting strain to mutate at least one, in particular one, gene encoding a mannose-glucose specific PTS protein, in particular the manL gene, the manM gene and/or the manN gene, in order to design the lactose positive galactose negative streptococcus thermophilus strain of the invention.

The invention also relates to the use of a mutated gene (or polynucleotide) encoding a mannose-glucose specific PTS protein, in particular a mutated manL gene, a mutated manM gene or a mutated manN gene, for designing streptococcus thermophilus strains, in particular lactose positive galactose negative streptococcus thermophilus strains. In one embodiment, the use consists in substituting [ or replacing ] the manL gene, manM gene or manN gene of the original streptococcus thermophilus strain with a mutated manL, manM or manN polynucleotide, respectively, as defined herein, in order to design a streptococcus thermophilus strain in which the original gene is replaced with a (mutated) gene as defined herein. "separately" means replacing original manL with mutated manL, replacing original manM with mutated manM and/or replacing original manN with mutated manN. The present invention also relates to a method of designing a streptococcus thermophilus strain, comprising: 1) replacing [ or replacing ] the manL gene, manM gene or manN gene of the original S.thermophilus strain with a mutated manL, manM or manN polynucleotide, respectively, as defined herein, and 2) obtaining a S.thermophilus strain with the original gene replaced with the (mutated) gene as defined herein.

In one embodiment of said use or said method, said original S.thermophilus strain carries a mutation in its glcK gene. In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in its ccpA gene. In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in its glcK gene and a mutation in its ccpA gene. It is an object of the present invention that the replacement of the manL, manM or manN gene in the original S.thermophilus strain [ carrying a mutation in its glcK gene and/or a mutation in its ccpA gene ] with a manL, manM or manN polynucleotide, respectively, mutated as defined herein, will result in a lactose-positive galactose-negative S.thermophilus strain as defined herein, i.e. a lactose-positive galactose-negative S.thermophilus strain showing a ratio of released amount of galactose (mM) relative to the remaining amount of lactose (mM) of more than 1.2, more than 1.5, more than 2 or more than 3.

In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in its glcK gene as defined in section I above. In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in its ccpA gene as defined in section III above. In one embodiment of said use or said method, said original streptococcus thermophilus strain carries a mutation in its glcK gene as defined in part I above and a mutation in its ccpA gene as defined in part III above.

In one embodiment, the mutated streptococcus thermophilus manL gene, manM gene or manN gene codes for IIAB, respectively^ManProtein, IIC^ManProtein or IID^ManA protein, the glucose import activity of which is reduced or eliminated.

In one embodiment, the mutated streptococcus thermophilus manL gene, manM gene or manN gene is characterized in that, when the manL gene, manM gene or manN gene is inserted alone in place of the DSM32587 strain:

-when the DSM32587 derivative is used in fermented milk as determined by test B, it shows a ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in the fermented milk of more than 1.2. In a specific embodiment, a mutated manL, manM or manN gene is considered according to the invention when the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

In this context, the term "derivative" when applied to the strain DSM32587 means the strain DSM32587 in which the original manL, manM or manN gene has been replaced with the mutated manL, manM or manN gene to be determined.

In one embodiment, the mutant Streptococcus thermophilus manL, manM or manN gene is characterized by replacing the DGCC7710 strain (i.e., DGCC 7710-ccpA) which has previously replaced the ccpA gene with the ccpA gene as defined in SEQ ID NO:71_Δ1A114-120Strain) the manL gene, manM gene or manN gene alone is inserted:

DGCC7710-ccpA when determined by test B_Δ1A114-120When the derivative is used in fermented milk, it shows a ratio of the amount of released half lactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2. In a toolIn embodiments of the invention, a mutated manL, manM or manN gene is considered according to the invention when the ratio of the amount of released half lactose (mM) relative to the amount of remaining lactose (mM) in said fermented milk is more than 1.5, more than 2 or more than 3.

In this context, when applied to DGCC7710-ccpA_Δ1A114-120When the strain is used, the expression is' DGCC7710-ccpA_Δ1A114-120Derivative "means DGCC7710-ccpA_Δ1A114-120Strain in which the original manL, manM or manN gene has been replaced with a mutated manL, manM or manN gene to be determined. In this context, DGCC7710-ccpA_Δ1A114-120The strain is DGCC7710 strain with the ccpA gene previously replaced with the ccpA gene as defined in SEQ ID NO: 71.

"insertion alone" means that the DSM32587 strain or DGCC7710-ccpA is used for characterization of the mutated man gene_Δ1A114-120Only one man gene of the strain is replaced (or substituted) with the respective mutant man gene to be characterized.

In one embodiment, the mutated gene encoding the mannose-glucose specific PTS protein is a mutated manL gene. In one embodiment, the mutated Streptococcus thermophilus manL encodes Streptococcus thermophilus IIAB^ManProteins with reduced or eliminated glucose import activity, in particular S.thermophilus IIAB truncated at position 305^ManProtein (IIAB)^Man ₃₀₅). In one embodiment, the mutated Streptococcus thermophilus manL encodes a truncated Streptococcus thermophilus IIAB^ManA protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:112, and b) a variant IIAB sequence having at least 90% similarity or identity to SEQ ID NO:112, in particular a sequence 305 amino acids in length. In one embodiment, the mutated manL gene encodes IIAB^ManA protein, the sequence of which is selected from the group consisting of SEQ ID NOs 112 to 128. In one embodiment, the mutated Streptococcus thermophilus manL gene is as defined in SEQ ID NO 111. The expression "IIAB having at least 90% similarity or identity^ManVariants "are as defined in II. Mutations of the Gene encoding mannose-glucose-specific PTS protein, in particular the above manL, manM and manMutation of the N gene.

In one embodiment, the mutated gene encoding the mannose-glucose specific PTS protein is a mutated manM gene. In one embodiment, the mutated Streptococcus thermophilus manM codes for Streptococcus thermophilus IIC^ManProteins with reduced or eliminated glucose import activity, in particular Streptococcus thermophilus IIC truncated at position 208^ManProtein (IIC)^Man ₂₀₈). In one embodiment, the mutated Streptococcus thermophilus manM codes for a truncated Streptococcus thermophilus IIC^ManA protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:158, and b) an IIC having at least 90% similarity or identity to SEQ ID NO:158^ManVariant sequences, in particular sequences of 208 amino acids in length. In one embodiment, the mutated manM gene encodes IIC^ManA protein having a sequence selected from the group consisting of SEQ ID NOs 158 to 165. In one embodiment, the mutated Streptococcus thermophilus manM gene is as defined in SEQ ID NO: 157. The expression "IIC having at least 90% similarity or identity^ManVariants "are as defined in II. Mutations of the gene encoding the mannose-glucose specific PTS protein, in particular of the above manL, manM and manN genes.

In one embodiment, the mutated gene encoding the mannose-glucose specific PTS protein is a mutated manN gene. In one embodiment, the mutated Streptococcus thermophilus manN encodes Streptococcus thermophilus IID^ManProteins with reduced or eliminated glucose import activity, in particular Streptococcus thermophilus IID truncated at position 28^ManProtein (IID)^Man ₂₈). In one embodiment, the mutated Streptococcus thermophilus manN encodes a truncated Streptococcus thermophilus IID^ManA protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:207, and b) an IID having at least 90% similarity or identity to SEQ ID NO:207^ManVariant sequences, in particular sequences of 28 amino acids in length. In one embodiment, the mutated manN gene encodes IID^ManA protein having a sequence selected from the group consisting of SEQ ID NOS 207 to 211. In one embodiment, the mutated Streptococcus thermophilus manN gene is as defined in SEQ ID NO: 206. The expression "IID having at least 90% similarity or identity^ManVariants "are as defined in II. Mutations of the gene encoding the mannose-glucose specific PTS protein, in particular of the above manL, manM and manN genes.

In one embodiment, a polynucleotide as defined herein is provided in isolated form. An "isolated" polynucleotide is substantially or essentially free of components with which it normally accompanies or interacts as found in the environment in which the gene naturally occurs. Thus, an isolated polynucleotide is substantially free of other cellular material, or substantially free of culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

The invention also relates to constructs comprising a polynucleotide as defined herein. In one embodiment, the invention encompasses a construct comprising a polynucleotide of the invention operably linked to a regulatory sequence. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence is "operably linked" to a coding sequence in a manner such that expression of the coding sequence is achieved under conditions compatible with the control sequences. The term "regulatory sequence" includes promoters and/or enhancers and other expression control signals. The term "promoter" is used in the standard sense of the art, e.g., an RNA polymerase binding site. In one embodiment, the construct contains or expresses another gene, such as a marker that allows selection of the construct, either independently or in combination with the "regulatory sequence" embodiments. There are various markers that can be used, for example those that provide antibiotic resistance, for example resistance to bacterial antibiotics such as Erythromycin (Erythromycin), Ampicillin (ampicilin), Streptomycin (Streptomycin) and Tetracycline (Tetracycline).

Thus, in another aspect, there is provided a vector comprising a polynucleotide or construct as defined herein. As used herein, the term "vector" refers to any nucleic acid molecule into which another nucleic acid (e.g., a polynucleotide of the invention) can be inserted and which can be introduced into and replicated in a bacterial strain, such as a streptococcus thermophilus strain. Thus, the term refers to any nucleic acid construct (and any associated delivery system, if desired) that can be used to introduce genetic material into a bacterial strain, particularly a streptococcus thermophilus strain. The choice of an appropriate carrier is within the knowledge of the person skilled in the art. In one embodiment, the vector is a plasmid. The term "plasmid" as used herein refers to a circular double stranded (ds) DNA construct that can be used as a vector for introducing DNA into bacterial strains, particularly streptococcus thermophilus strains. The construct or vector can be introduced into a bacterial strain described herein, such as the DGCC7710 strain.

The polynucleotides, constructs, vectors or plasmids of the invention disclosed herein can be introduced into strains of S.thermophilus using any available method.

"introduced" (and "introduced") is intended to mean that a polynucleotide, construct, vector or plasmid of the invention as defined herein is presented to a streptococcus thermophilus strain in a manner such that one or more components can enter the interior of the streptococcus thermophilus strain. The methods and compositions do not depend on the particular method of introducing the sequence into the S.thermophilus strain, so long as the polynucleotide, construct, vector or plasmid of the invention is capable of entering the interior of the S.thermophilus strain. Introduction includes incorporation of the polynucleotide, construct, vector or plasmid of the invention into the S.thermophilus strain, wherein the polynucleotide or construct of the invention can be incorporated into the genome of the S.thermophilus strain, and includes transient (direct) provision of the polynucleotide or construct of the S.thermophilus strain.

Introduction of the polynucleotide, construct, vector or plasmid of the present invention into the streptococcus thermophilus strain can be carried out by several methods, including transformation, conjugation, transduction or protoplast fusion. Methods for introducing a polynucleotide, construct, vector or plasmid of the invention into a Streptococcus thermophilus strain by transformation include, but are not limited to, microinjection, electroporation, stable transformationChemometric, transient transformation methods [ such as using chemistry (e.g., divalent cations such as CaCl)₂) Or mechanical (electroporation) means for inducing competence]Ballistic particle acceleration (particle bombardment), direct gene transfer, virus-mediated introduction, cell penetrating peptide or Mesoporous Silica Nanoparticle (MSN) -mediated direct protein delivery. The polynucleotides, constructs, vectors or plasmids of the invention can be introduced into strains of S.thermophilus by conjugation, a particular method which requires the exchange of native DNA for physical cell-to-cell contact. The polynucleotides, constructs, vectors or plasmids of the invention can be introduced into strains of S.thermophilus by transduction by introducing DNA by viral (e.g., phage) infection, which is also a natural method of DNA exchange. Typically, such methods involve the incorporation of a polynucleotide into a viral DNA or RNA molecule.

The invention also relates to the following mutated man genes themselves and their corresponding encoded proteins:

mutant Streptococcus thermophilus manL, which codes for a truncated IIAB of Streptococcus thermophilus^ManA protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:112, and b) a variant IIAB sequence having at least 90% similarity or identity to SEQ ID NO:112, in particular a sequence 305 amino acids in length. In one embodiment, the mutated Streptococcus thermophilus manL gene encodes IIAB^ManA protein having a sequence selected from the group consisting of SEQ ID NOS: 112 to 128. In one embodiment, the mutated Streptococcus thermophilus manL gene is as defined in SEQ ID NO 111.

Mutant Streptococcus thermophilus manN, which codes for a truncated IID of Streptococcus thermophilus^ManA protein, the sequence of which is selected from the group consisting of: a) a sequence as defined in SEQ ID NO:207, and b) an IID having at least 90% similarity or identity to SEQ ID NO:207^ManVariant sequences, in particular sequences of 28 amino acids in length. In one embodiment, the mutated Streptococcus thermophilus manN gene encodes IID^ManA protein, the sequence of which is selected from the group consisting of SEQ ID NOs 207 to 211. In one example, the mutated Streptococcus thermophilus manN gene is as set forth in SEQ ID NO:206As defined.

The expression "IIAB having at least 90% similarity or identity^ManVariants and IID^ManVariants "are as defined in II. Mutations of the gene encoding the mannose-glucose specific PTS protein, in particular of the above manL and manN genes.

The invention also relates to a method for designing the streptococcus thermophilus strain with positive lactose and negative galactose, which comprises the following steps:

a) providing a lactose-positive galactose-negative streptococcus thermophilus strain carrying a glcK gene encoding glucokinase, the activity of said enzyme being reduced but not zero as defined herein, and optionally carrying a mutated ccpA gene;

b) mutating at least one, in particular one, gene encoding a mannose-glucose specific PTS protein, in particular the manL gene, the manM gene and/or the manN gene; and

c) a lactose-positive galactose-negative strain of streptococcus thermophilus is selected which, when used in fermented milk as determined by test B, shows a ratio of the amount of released galactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2.

In one embodiment, the strain selected in step c) exhibits a ratio of the amount of released galactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.5, more than 2, more than 2.5 or more than 3, as determined by test B.

In one embodiment, at least one gene encoding a mannose-glucose specific PTS protein, in particular the manL, manM or manN gene, is mutated, such as to encode a protein, in particular a truncated protein, whose glucose import activity is reduced or eliminated.

The invention also relates to a method for designing the streptococcus thermophilus strain with positive lactose and negative galactose, which comprises the following steps:

a) streptococcus thermophilus strains which are lactose positive and galactose negative are provided, which carry at least one, in particular one, coding for at least one mutated mannose-glucose specific PTS protein (in particular one protein), in particular mutated IIAB^ManProtein, protein,In particular mutated IIC^ManProtein and/or mutated IID^ManA gene for a protein whose glucose import activity is reduced or eliminated;

b) mutating a glcK gene encoding glucokinase, the activity of said enzyme being reduced but not zero as defined herein, and/or mutating a ccpA gene;

c) a lactose-positive galactose-negative strain of streptococcus thermophilus is selected which, when used in fermented milk as determined by test B, shows a ratio of the amount of released galactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.2.

In one embodiment, the strain selected in step c) exhibits a ratio of the amount of released galactose (mM) relative to the amount of lactose remaining (mM) in said fermented milk of more than 1.5, more than 2, more than 2.5 or more than 3, as determined by test B.

In one embodiment, the gene encoding a mutated mannose-glucose specific PTS protein (whose glucose import activity is reduced or eliminated) encodes a truncated protein, in particular a truncated IIAB^ManProtein, truncated IIC^ManProteins or truncated IIDs^ManA protein.

In one embodiment of the 2 methods defined above, the method further comprises:

d) selecting a strain which, when used for fermenting milk by test B, provides a low lactose fermented milk, in particular a fermented milk having a residual lactose amount of less than 60mM, less than 50mM, less than 45mM, less than 40mM, less than 35mM or less than 30mM,

in one embodiment of the 2 methods defined above, the method further comprises

d) Selecting a strain, the pH of which, when inoculated into milk fermented by test B, decreases to a pH at which the rate of acidification becomes definitely less than 0.1mUpH/min, wherein said pH is_TerminateIncluded between 4.6 and 5.3, and optionally, the slope between pH 6 and pH 5.5 is at least-0.008 UpH/min. In one embodiment, the pH is measured as_TerminateIncluding at a minimum selected from the group consisting of 4.6, 4.7 and 4.8 and at a minimum selected from the group consisting of 5.1, 5.2 and5.3 between the maxima of the group, strains were selected. In one embodiment, the strain is selected when the slope between pH 6 and pH 5.5 is at least 0.009 or at least 0.01 UpH/min.

---------------

Various preferred features and embodiments of the invention will now be described by way of non-limiting example.

Materials and methods

Strains and growth conditions

The Streptococcus thermophilus Strains (ST) disclosed in the present application were bouillon M17 at 37 ℃Company, supplier reference CM0817), with the addition of 30g/L of suitable carbohydrates and, if necessary, 15g/L of bacterial agar type a (boercar (Biokar), supplier reference a1010HA), or in milk (UHT semi-skimmed milk "Le pet food meen" + 3% milk powder (BBA, landtius). 0.2 μ M filtered lactose, sucrose, galactose or glucose was added to the autoclaved M17 broth. Frozen stocks of ST strains were obtained by half-diluting overnight cultures in M17 supplemented with 5g/L lactose and 10% glycerol and stored at-20 ℃.

Quantification of carbohydrate catabolism during milk fermentation [ test B ]

At 1% (v/v, about 10)⁷CFU/ml) UHT semi-skimmed milk "Le Petit vent meen" containing 3% (w/v) milk powder (BBA corporation, tracelis) previously pasteurized for 10min at 90 ℃ was inoculated with a culture of the streptococcus thermophilus strain to be assayed (carbohydrate-free M17 resuspension cells from an overnight culture grown in M17 supplemented with 3% sucrose). This milk was found to contain about 175mM lactose. And (3) standing and incubating the inoculated milk bottle in a water bath at the temperature of 43 ℃ for 24h to obtain fermented milk.

Mixing the T0 sample and the fermented milk (T24h) sample (5g) at 25g 0.025N H₂SO₄Was diluted and then centrifuged at 4600rpm for 10 minutes at 4 ℃. The supernatant was passed through a 0.2 μm nylon filter (Ashifen, Germany)Phillips company, burgh) was directly filtered into 2ml HPLC vials. The samples were stored at-20 ℃ until further analysis. At 35 deg.C, by high performance liquid chromatography (Agilent 1200HPLC) equipped with a refractive index detector, using an Aminex HPX-87H anion exchange column (Bio-Rad Laboratories Inc.) using 12.5mM H₂SO₄As eluent and 0.6ml min^-1The flow rate of (c) was used to quantify the carbohydrates. Development of the results was performed with Chemstation reprocessing software (agilent).

glcK sequencing

PCR amplification of the glucokinase gene was performed using primers GlcK-F4 (5'-CAGGTATGAGTTTAGCAACGG-3') and GlcK-R12 (5'-ATTCACCACGGCCTGAGAC-3') [ incubation step at 98 ℃ for 5min, followed by 33 cycles of 98 ℃ for 45 s; at 58 ℃ for 30 s; a cycle of 68 ℃ for 3min, a final extension step at 72 ℃ for 7min]. Illustra was then used according to the manufacturer's instructions (GE Healthcare)^TMExoProStar^TMThe 2788bp PCR product was processed. By usingTerminator v3.1 cycle sequencing kit (Life Technologies), AB3500(Applied Biosystems) was used according to the manufacturer's instructions^TM) And the primers listed in table 2.

Primer and method for producing the same	Sequence of
		GlcK-F4	CAGGTATGAGTTTAGCAACGG
GlcK-R8	AGTTCAATCTTCATCATCTCG
		GlcK-F5	GTAGCCACATTGTTCCTGAC
GlcK-R6	TTGCTGAAGCTACAGTTTCC
		GlcK-R4	TAAGCAAGACTAGCAGCTCC
GlcK-F7	TTGCGTAGTCGTGTTGAAGG
		GlcK-R10	ATTGTCCCTTCATAAGCATCG
GlcK-F11	CGAACTGGGTGCAGATGATG
		GlcK-R12	ATTCACCACGGCCTGAGAC

TABLE 2: list of primers used for glcK sequencing.

Glucokinase Activity [ test A ]

A fresh overnight culture of S.thermophilus strain in M17 containing 30g/L lactose was obtained and used to inoculate 1% (v/v) with 10ml of fresh M17 containing 30g/L lactose. At an optical density of 0.8 at 600nm (OD600), cells were harvested by centrifugation (6000g, 10min, 4 ℃) in 5ml cold GLCK buffer (5mM MgCl2, 10mM K)₂HPO₄/KH₂PO₄[pH 7.2]) Washed and resuspended in 500. mu.l cold GLCK buffer. EDTA-free protease inhibitor "cOmplete" was used as described by the supplier^TM"(Roche, supplier reference 04693132001) was added to the GLCK buffer. Cells were disrupted by adding 100mg of glass beads (150-212 μm, Sigma G1145) to 200. mu.l of resuspended cells and shaking for 6min at a frequency of 30 cycles/sec in an MM200 shaking mill (Retsch, Haan, Germany). Cell debris and glass beads were removed by centrifugation (14000g, 15min, 4 ℃) and the supernatant was transferred to a 1.5mL clean centrifuge tube stored on ice. Total Protein content was determined by using a Fluka Protein quantitation Kit (FLUKA Protein quantitation Kit-Rapid, reference number 51254). Glucokinase activity in cell extracts was determined spectrophotometrically by glucose-6-phosphate dehydrogenase (G-6PDH, EC 1.1.1.49): NADPH coupling assay (Porter et al, 1982), essentially as described by Pool et al (2006). Each sample (5, 10 and 20. mu.L) was added to assay buffer (10mM K) in a final volume of 250. mu.L₂HPO₄/KH₂PO₄[pH 7.2]5mM MgCl2, 1mM ATP, 20mM glucose, 1mM NADP, 1U G-6PDH) and the mixture was left at 30 ℃ for 5 min. The optical density at 340nm was measured for 5 minutes by using a Synergy HT multi-detection microplate reader (betem). One unit of glucokinase corresponds to the amount of enzyme catalyzing the phosphorylation of 1 micromole of D-glucose to D-glucose 6-phosphate per minute under the assay conditions. Glucokinase activity was calculated as follows:

glucokinase activity (U/g total protein extract) ═ dOD x V/[ dt x l x epsilon x Qprot ], where:

-dOD is the change in Optical Density (OD) at 340nm

V is the reaction volume (250. mu.L in this case)

dt ═ measurement time (in minutes)

light path length (0.73 cm in this document)

Epsilon is the molar decay coefficient of NADPH; h⁺(6220 cm 2/. mu. mol, herein)

Amount of protein in the Qprot ═ cuvette (in grams)

Three measurements were made for each sample and the specific glucokinase activity values given herein according to test a are the average of three independent experiments.

Maximum Forward speed of GlcK [ test C ]

The maximal forward velocity (Vmax) of GlcK was determined by using various glucose concentrations (0, 5, 10, 15, 20mM) on crude extracts prepared as described in "glucokinase activity" (test a). Three measurements were made for each sample, and the Vmax values given herein according to test C were the average of three independent experiments. A linear regression that exhibits the inverse specific velocity as a function of the inverse glucose concentration gives the inverse of the maximum forward velocity at the intersection with the Y-axis of the graph.

Acidifying power of milk

During milk fermentation as described in test B, the acidification properties of the streptococcus thermophilus strains were evaluated by recording the pH as a function of time. The pH was monitored for 24 hours as described previously using the CINAC system (Alliance Instruments, France; pH electrode Mettler 405DPAS SC, Toledo, Spain). The pH was measured and recorded every 5 minutes. The slope between pH 6.0 and pH 5.5 (UpH/min) [ slope pH 6-5.5] was calculated using CINAC v2.07 software.

The glcK allele of the ST0 strain was transferred into the genomes of the other 3 S.thermophilus strains

Primers GlcK-F1 (5'-GAAGCAGTTTGGGGTAGTAG-3') and GlcK-R2 (5'-GAGTTATCTACAGGAGCTGG-3') were used to obtain a 1889bp PCR product with the glcK gene of ST0 strain. The PCR product was then purified using the QIAquick PCR purification kit (Qiagen) and eluted in rnase-free water. The concentration of the PCR product was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, MA). By gel-based capillary electrophoresisThe system (Qiagen, Hilden, Germany) verifies the size and purity of the PCR products. Strains DGCC7710 ST1.1 and ST1.2 were transformed with the 1889bp PCR product and mutants were selected in which the glcK gene was replaced by the glcK allele of the ST0 strain (examination of the glcK of the ST0 strain by sequencing)Whether an allele is present).

Results

Example 1: screening of glucose secreting strains in the pool of Streptococcus thermophilus

The inventors of the present application used another method for selecting a strain secreting glucose. The pool of Streptococcus thermophilus was screened by test B for strains capable of secreting glucose in fermented milk. Glucose was used in an amount of 10mM as the minimum threshold of choice. One strain was selected ST0, which released 30mM glucose in fermented milk using test B.

Example 2 identification of mutations in the glcK Gene

Several genes of the ST0 strain known to be involved in the catabolism of carbohydrates in streptococcus thermophilus were sequenced and aligned with the corresponding gene sequences of other streptococcus thermophilus in our collection.

A non-conservative amino acid difference E275K was identified in the GlcK sequence of ST0 strain, which difference was not found in any GlcK sequence of other streptococcus thermophilus strains in the collection; this amino acid difference is the result of a substitution of G for A at position 823 of the glcK gene. Other comparisons of the glucokinase encoded by the glcK gene of other strains of streptococcus thermophilus confirmed that lysine at position 275 (instead of glutamic acid) is unique to ST0 and was not found in any of the 107 other strains.

Other amino acid differences identified in glucokinase elicited from these 108 strains are presented in table 3. Thus, 10 different glucokinase types can be distinguished (e.g., GlcK 1-GlcK 10 as set forth in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, respectively). For subsequent experiments, 10 strains ST1 to ST10 were selected, each of which expressed a unique glucokinase. SEQ ID NO 2 was used as a reference sequence since this GlcK type was found in about 70% of 108 analyzed strains. In particular, DGCC7710 strain deposited at DSMZ under accession number DSM28255 on 1/14 of 2014 encodes glucokinase as defined in SEQ ID NO. 2. Notably, the only amino acid difference between the glucokinase sequence encoded by the ST0 strain and SEQ ID NO. 2 was the amino acid difference at position 275.

TABLE 3: the GlcK protein identified by comparing the GlcK protein sequence encoded by 108 streptococcus thermophilus with the GlcK protein sequence encoded by ST 0. The amino acid positions listed indicate all amino acid differences between the GlcK proteins. The GlcK protein sequence from ST1 (SEQ ID NO:2) was selected as the reference sequence. Amino acid positions not listed in this table are identical for all glucokinases in this study. The "aa diff" column gives the number of amino acid differences compared to SEQ ID NO 2. The "% ID" column gives the percent identity to SEQ ID NO 2

Example 3 measurement and comparison of the glucokinase Activity of the ST0 Strain with other strains (ST1 to ST10)

The glucokinase activity of the ST0 strain was compared with that of the ST1 to ST10 strains selected as reported in example 2 using test a. The results are summarized in table 4 below.

TABLE 4: glucokinase specific activity of 11 strains: 10 strains, ST1 to ST10, each representing a different GlcK protein variant, and ST0 identified in example 1; ND: undetermined

These data show that the glucokinase activity of strains ST1 to ST10 is 2014U/g to 2791U/g total protein extract as determined by test a. Glucokinase activity higher than 1800U/g total protein extract is considered to indicate normal glucokinase activity. The glucokinase activity of DGCC7710 strain was considered as the reference glucokinase activity (because of the expression of the most common GlcK type, said type being defined as SEQ ID NO: 2).

In contrast, the ST0 strain expressing the GlcK protein with lysine at position 275 had a glucokinase activity of about 977U/g total protein extract, i.e., about 3-fold (35%) lower than that of DGCC7710 strain, as determined by test A.

These data show that the method retained by the present inventors is capable of selecting for the first time a galactose-negative streptococcus thermophilus strain expressing glucokinase whose activity is significantly reduced but not zero.

Example 4: comparison of the Glucokinase Activity, Vmax and Km of DGCC7710 Strain, DGCC7710 derivatives with E275K Difference and galactose-Positive variants of DGCC7710 with zero Glucokinase amino acid Change

Derivatives of DGCC7710 strain were designed in which the glcK gene encodes glucokinase with the glutamic acid (E) at position 275 replaced by the amino acid lysine (K). This derivative (DGCC12534) was deposited at DSMZ at 2017 on month 8 and 15 under accession number DSM 32587. The sequence of the GlcK protein is defined in SEQ ID NO. 22.

Meanwhile, a mutant of DGCC7710 in which serine (S) at position 72 was replaced with proline (P) was generated to give GlcK protein having the sequence as defined in SEQ ID NO:23 [ amino acid substitution S72P; reported in the application WO 2013/160413, strain DSM25851 ]. Since the S72P amino acid substitution produced zero glucokinase activity (i.e., a strain that was unable to use glucose via glucokinase), the mutant was previously rendered galactose-positive (so that galactose could be used, since a galactose-negative streptococcus thermophilus strain exhibiting zero glucokinase activity was not expected to be viable on lactose). Thus, the gal operon promoter of DGCC7710 strain was mutated in advance according to application WO 2011/026863 to obtain a gal operon promoter having the sequence as defined in SEQ NO. 24. A galactose-positive mutant with an amino acid substitution of S72P in the GlcK protein was obtained and designated ST1m-glcK0-gal +.

An alignment of the glucokinase protein sequences of DGCC7710, DSM32587 and ST1m-glcK0-gal + strains is disclosed in FIG. 1.

The glucokinase activity, Vmax and Km of glucokinase were determined for DGCC7710, DSM32587 and ST1m-glcK0-gal + strains as described in materials and methods.

The results obtained are disclosed in tables 5 and 6.

TABLE 5: specific Glucokinase Activity in DGCC7710 Strain and DSM32587 and ST1m-glcK0-gal + Strain and Activity compared to Glucokinase Activity of DGCC7710 Strain%

TABLE 6: vmax of glucokinase of DGCC7710 strain and DSM32587 and ST1m0gal + strain, Vmax% of glucokinase as compared with Vmax of glucokinase of DGCC7710 strain, and Km activity of glucokinase of DGCC7710, DSM32587 and ST1m-glcK0-gal + strain; ND: it is not determined.

The data in Table 5 show well that in DGCC7710 derivative (DSM32587), substitution of glutamic acid (E) at position 275 of the GlcK protein with lysine (K) alone is sufficient to significantly reduce glucokinase activity from 2756U/g to 907U/g (i.e., 33% of DGCC7710 activity). The data obtained for the ST1m-glcK0-gal + mutant confirmed that the S72P amino acid change was sufficient to completely eliminate glucokinase activity. Together with the glucokinase activity, the inventors also investigated whether the decrease in glucokinase activity observed in the DSM32587 strain is due to a decrease in the affinity (Km) of glucokinase for its substrate (glucose) and/or a decrease in the maximum forward velocity (Vmax) of glucokinase. The data in Table 6 demonstrate that, in the derivative of DGCC7710(DSM 32587), the substitution of glutamic acid (E) at position 275 of the GlcK protein with lysine (K) alone is sufficient to significantly reduce the Vmax of glucokinase from 2855U/g to 914U/g (i.e., 32% of the Vmax of DGCC 7710). Vmax could not be determined in the absence of functional glucokinase in the ST1m-glcK0-gal + mutant.

Example 5: identification of other GlcK muteins

A strain of Streptococcus thermophilus was identified (ST20) whose glcK gene contained the non-conservative amino acid difference G144S. This amino acid change was not found in any of the GlcK sequences of the other Streptococcus thermophilus strains of the collection (GlcK types ST1 to ST 10). Notably, the only amino acid difference between the glucokinase sequence encoded by the ST20 strain and SEQ ID NO. 2 was the amino acid difference at position 144 (Table 3).

Example 6: comparison of the dynamics of glycolysis and acidification during milk fermentation of strain DGCC7710, strain DSM32587, strain ST20, strain ST1m-glcK0-gal +, strain ST1.1 and strain ST1.1 with glcK mutation

Considering, on the one hand, the effect of the mutations E275K and G144S on the glucokinase activity (reduced but not zero) and, on the other hand, the role of glucokinase in glucose metabolism, DGCC7710 strain, DSM32587 strain, ST20 strain, ST1m-glcK0-gal + strain (all of the above) as well as the second parent strain (ST1.1 strain encoding glucokinase as defined in SEQ ID NO: 22) and its glcK mutated ST1.1 strain (with E275K substitution; ST1.1m-glcK strain) were used to ferment milk by test B and the concentration of glucose, galactose and lactose in the fermented milk was determined (see materials and methods). The results are summarized in table 7 below.

Table 7:carbohydrate content in milk fermented (24h) with DGCC7710, DSM32587, ST20 and ST1m-glcK0-gal + strainsCatabolism

The data in table 7 show:

the DSM32587 strain and the ST20 strain released 32mM and 49mM glucose, respectively, after fermentation of milk, whereas the DGCC7710 strain with high glucokinase activity did not release detectable amounts of glucose. This difference was also seen between the ST1.1 strain and its glcK mutant (ST1.1m-glcK). For the ST1m-glcK0-gal + mutant, this galactose-positive mutant secreted 109mM glucose;

DSM32587 strain and ST20 strain released 73mM and 62mM glucose, respectively, after milk fermentation, while DGCC7710 strain released 53 mM. This subtle difference can also be seen between the ST1.1 strain and its glcK mutant (ST1.1m-glcK);

with respect to the lactose remaining in the fermented milk, the ST1m-glcK0-gal + mutant consumed almost all of the lactose present in the milk (158 mM out of about 175 mM), so that the concentration of lactose remaining in the fermented milk was 17 mM. In contrast, the concentration of residual lactose was in the same range as that of DGCC7710 strain [95 and 101 vs 116] for DSM32587 strain or ST20 strain. This is also seen between the ST1.1m-glcK strain and the ST1.1 strain [96 vs 119 ].

These data show that when DGCC7710, DSM32587, ST20, ST1.1 and ST1.1m-glcK strains were used (59mM, 80mM, 66mM, 56mM and 79mM lactose consumed 53mM, 73mM, 62mM, 44mM and 65mM released galactose), almost all of the galactose fraction (from lactose hydrolysis) was released in the fermented milk. It should be reminded that 1 mole of lactose hydrolyzed to yield 1 mole of glucose and 1 mole of galactose. The glucose fraction was partially consumed by the strain, and therefore, in milk containing 175mM lactose (test B), this means that more lactose remained in the milk than was consumed by the strain.

This behaviour can also be explained by determining the ratio of galactose released (mM) in fermented milk relative to the lactose remaining (mM) in fermented milk, as determined by test B. This ratio was 0.452 in DGCC7710, 0.775 in DSM32587, 0.544 in ST20 strain, 0.373 in ST1.1 and 0.672 in ST1.1m-glcK, i.e.less than 1 in the glcK mutated strain described above and its parent strain. This ratio represents the efficiency of lactose uptake and hydrolysis in galactose-negative strains.

Example 7: determination of carbohydrate catabolism and acidification kinetics in lactose-positive galactose-negative ccpA-mutated and man-mutated strains of Streptococcus thermophilus

Based on the observations made in example 6, the inventors have determined the dynamics of sugar catabolism and acidification of streptococcus thermophilus strains that are mutated in the ccpA gene or in the gene encoding the mannose-glucose specific PTS protein (manL, manM or manN gene). The following mutants were designed in the context of DGCC7710(ST1) and ST1.1 and used for fermentation by test B:

DGCC7710 derivative wherein the ccpA gene is replaced by a ccpA gene (SEQ ID NO:71) with deletion of nucleotide A in the stretch with 7 nucleotides A at position 114-120, resulting in an open reading frame for the ccpA gene (ST1 m-ccpA);

DGCC7710 derivatives with a knock-out ccpA gene (ST1 m-KOccpA);

DGCC7710 derivative wherein the manL gene is replaced by the manL gene with nucleotide G substituted by nucleotide T at position 916 (SEQ ID NO:111) to yield IIAB^ManThe stop codon at position 306 of the protein (ST1 m-manL);

DGCC7710 derivative wherein the manM gene is replaced by the manM gene replacing nucleotide G with nucleotide T at position 625 (SEQ ID NO:157) yielding IIC^ManA stop codon at position 209 of the protein (ST1 m-manM);

DGCC7710 derivative in which the manN gene is replaced by a manN gene (SEQ ID NO:206) with an insertion of nucleotide A in a stretch with 5 nucleotides A at positions 37 to 41, resulting in IID^ManOpen reading frame and truncation of the protein at position 28 (ST1 m-manN);

ST1.1 derivative wherein the ccpA gene is replaced by a ccpA gene (SEQ ID NO:71) with deletion of nucleotide A in the segment with 7 nucleotides A at position 114-120 (ST1.1m-ccpA); and

ST1.1 derivatives in which the manL gene is replaced by the manL gene (SEQ ID NO:111) in which nucleotide G is replaced by nucleotide T at position 916 (ST1.1m-manL).

The results are summarized in table 8 below.

TABLE 8: carbohydrate catabolism in fermented milk (24h) with ccpA-mutated and man-mutated strains and their parent strains

These data show that neither ccpA mutated nor man mutated strains are suitable for lactose removal during milk fermentation (lactose concentration 96mM to 113 mM).

These data confirm that the values of the ratio of released galactose to residual lactose in fermented milk obtained using the strain mutated in the ccpA gene or in the gene encoding the mannose-glucose specific PTS protein and its parent strain are consistent with the values reported in example 6 above (i.e., a ratio of less than 1).

Example 8: determination of the carbohydrate catabolism and acidification kinetics of lactose-positive galactose-negative Streptococcus thermophilus strains mutated in the gene encoding the mannose-glucose-specific PTS protein and in the glcK gene and/or the ccpA gene

Then, the present inventors designed strains mutated in the gene encoding mannose-glucose specific PTS protein (manL, manM or manN) and mutated in the glcK gene and/or ccpA gene. Thus, double and triple mutant strains were designed in the context of DGCC7710(ST1) or in the context of ST1.1, based on the mutated genes below.

ST1m-glcK + manM: DSM32587 derivatives (carrying the glcK gene encoding glucokinase with the substitution E275K; example 2) in which the manM gene is replaced by the mutated manM gene as defined in SEQ ID NO: 157;

-ST1m-ccpA + manL: ST1m-ccpA derivative (DGCC7710, which carries the mutated ccpA gene as defined in SEQ ID NO:71), wherein the manL gene is replaced with the mutated manM gene as defined in SEQ ID NO: 111;

-ST1m-ccpA + manM: ST1m-ccpA derivative (DGCC7710, which carries the mutated ccpA gene as defined in SEQ ID NO:71), wherein the manM gene is replaced with a mutated manM gene as defined in SEQ ID NO: 157;

-ST1m-ccpA + manN: ST1m-ccpA derivative, wherein the manN gene is replaced with a mutated manN gene as defined in SEQ ID NO: 206;

-ST1m-glcK + ccpA + manM: DSM32587 derivatives in which the ccpA gene is replaced with a mutated ccpA gene as defined in SEQ ID NO:71 and the manM gene is replaced with a mutated manM gene as defined in SEQ ID NO: 157;

ST1.1m-glcK + manM: ST1.1m-glcK derivatives (ST1.1 strain carrying the glcK gene encoding for glucokinase with the substitution E275K) wherein the manM gene is replaced by the mutated manM gene as defined in SEQ ID NO: 157; and

ST1.1m-ccpA + manL: ST1.1m-ccpA derivative (ST1.1, which carries a mutated ccpA gene as defined in SEQ ID NO:71), wherein the manL gene is replaced with a mutated manL gene as defined in SEQ ID NO: 111.

The results are summarized in table 9 below.

TABLE 9: carbohydrate catabolism in fermented milk (24h) with double and triple mutant strains and their parents

Surprisingly, by test B, all galactose-negative single mutant strains (mutated in one of the glcK gene, ccpA gene, manL gene, manM gene and manN gene) showed lactose concentrations around or above 100mM (95 to 113) [ see tables 7 and 8], strains in which 2 or 3 mutant genes (mutated gene encoding mannose-glucose specific PTS protein, and mutated glcK gene and/or mutated ccpA gene) were introduced to produce a strain that, when used to ferment milk by test B, removed 68% to 85% of the lactose originally contained in the milk (i.e., lactose concentration of 25mM to 55 mM).

Interestingly, the ratio of released galactose over remaining lactose in fermented milk as defined above was significantly increased, whether compared to the non-mutated strain or the single mutated strain. Therefore, this ratio is comprised between 1.780 and 5.252. This indicates that the ratio of lactose released in the fermented milk to the remaining lactose, in addition to the concentration of the remaining lactose in the fermented milk, is a good parameter for distinguishing galactose-negative strains suitable for lactose removal from strains not suitable for lactose removal during milk fermentation. This shows the interest of dual or triple mutant strains in manufacturers wishing to obtain low lactose fermented milk products (less than 60 mM).

Example 9: pH in milk fermented with double or triple mutants of the invention_Terminate。

Milk was fermented by test B using DGCC7710, ST1m-glcK + manM, ST1m-ccpA + manL, ST1m-ccpA + manM, ST1m-ccpA + manN, ST1m-glcK + ccpA + manM, ST1.1, ST1.1m-glcK + manM and ST1.1m-ccpA + manL (all above) at fermentation temperature [ 24h ].

The pH was recorded using a CINAC apparatus. The evolution of pH over time is presented in fig. 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A and 10A. The speed between pH 6 and pH 5.5 was calculated as the slope of a linear model derived from the evolution of pH as a function of time for pH values of 6 to 5.5. The slope values are opposite to the speed (table 10). The change in velocity as a function of pH is also presented (fig. 2B, 3B, 4B, 5B, 6B, 7B, 8B, 9B and 10B). The velocity is determined as the instantaneous derivative of the evolution of the pH as a function of time. pH value_TerminateIs characterized by a pH value at which no speed drop is detectable (below 0.1 mupH/min) (Table 10). Also determines the pH_Terminate(TpH_Terminate) Corresponding time (table 10).

Watch 10: acidification kinetics obtained with double and triple mutant strains and their parent strains

The data in Table 10 show that milk fermented with the double or triple mutant strains (invention) is more than milk fermented with the parent strains (4.21 and 4.31)Has a higher pH_Terminate(between 4.66 and 4.98). In other words, this means that the pH obtained at the end of test B (24h at fermentation temperature) using the double or triple mutant strain (of the invention) is higher than the parent strain. The table also shows that the pH is obtained within 298 to 512 minutes after inoculation_TerminateAnd held for up to 24 hours (i.e., over 15 hours). FIGS. 3A, 4A, 5A, 6A, 7A, 9A and 10A show the regular decrease in pH at harvest (FIGS. 2A and 8A) compared to the use of the parental strain_TerminateStability of the pH of the fermented milk over time (using double or triple mutant strains). Fig. 3B, 4B, 5B, 6B, 7B, 9B and 10B show that acidification (rate) is stopped at high pH between 4.6 and 5 using the double or triple mutant strains, whereas acidification rate is stopped at low pH (4.21 and 4.31) using the parent strain (fig. 2B and 8B). In summary, these results show that there is no post-acidification of milk fermented with the double or triple mutant strains of the invention.

These data also show that the acidification kinetics (slope between pH 6 and 5.5) are acceptable at the industrial level for the production of fermented milk products.

In summary, these results show that the producer's interest in double or triple mutant strains is not only in the desire to obtain fermentation products ending in a higher range of pH values (4.6-5.3), but also in the desire to keep their process at fermentation temperatures that do not affect the pH of the fermented milk product.

Sequence of

Bacterial strains

DGCC number is the internal reference of DuPont danisck collection (DuPont Danisco collection); DSM numbers are numbers assigned by the Lai Bunitz institute DSMZ-German Collection of microorganisms and cell cultures GmbH (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH) (Bulunelix Neufen 7B, D-38124 (Inhoffentr. 7B, D-38124Braunschweig))) according to the Budapest treaty.

In the case of the Streptococcus thermophilus strain DGCC7710 deposited under the Budapest treaty on 14.1.2014 under the number DSM28255 at the institute of Labrinitz DSMZ-German microorganisms and cell culture Collection, GmbH, we have here demonstrated that the deposit Danisco Deutschland GmbH (Nippon Germany D-25899 Buxi-Johnson street No. 1 (Busch-Johannsen-Strass 1, D-25899 Niebull, Germany)) has granted the applicant (DuPont Nutrition Biosciences ApS) the biological material deposited in this application. The expressions "DGCC 7710 strain" and "DGCC 7710 derivative" are used interchangeably with the expressions "DSM 28255 strain" and "DSM 28255 derivative".

The Streptococcus thermophilus strain deposited under the Budapest treaty on 15.8.2017 under the number DSM32587 at the institute of Lai Bunez DSMZ-German micro-organisms and cell culture Collection, Inc., was deposited by DuPont Nutrition biosciences.

The applicant claims that samples of the deposited microorganisms described herein can only be provided to experts before the date of patent.

For those designations seeking protection from european patents, samples of these deposited microorganisms are available prior to the mention of a publication granted to european patent or prior to the date the application was refused or withdrawn, or deemed withdrawn, and the issuance of such samples is limited to an expert designated by the applicant requesting access to the sample, and solicited, as appropriate, i) applicant and/or ii) european patent office consent.

PCT/RO/134 Table