阅读说明：本技术 低甲烷水稻 (Low methane rice ) 是由 孙传信 A·施奈尔 Y·金 A·摩阿萨米 M·贝滕堡 J·胡 于 2020-03-23 设计创作，主要内容包括：本发明涉及能够通过减少水稻植物根部的有机酸诸如延胡索酸的分泌来减少甲烷排放的水稻植物材料。有机酸诸如延胡索酸分泌的减少降低了与水稻植物的根部缔合的产甲烷菌的量,并且从而减少了此类产甲烷菌的甲烷排放。(The present invention relates to rice plant material capable of reducing methane emission by reducing the secretion of organic acids such as fumaric acid from the roots of rice plants. The reduction in the secretion of organic acids such as fumaric acid reduces the amount of methanogens associated with the roots of rice plants and thereby reduces the methane emissions of such methanogens.)

1. A method of producing a low methane rice plant, the method comprising modifying rice plant material to reduce organic acids secreted by the roots of the rice plant material or by the roots of a rice plant obtained from the rice plant material, wherein

The amount of organic acid secreted by the rice plant material or the roots of the rice plant is equal to or less than 90% of the amount of organic acid secreted by the roots of a corresponding wild-type rice plant lacking the modification; and

the reduction of organic acid secretion by the rice plant material or the roots of the rice plant results in a reduction of methane emission by the methanogens present in association with the rice plant material or the roots of the rice plant.

2. The method according to claim 1, wherein the amount of organic acid secreted by the rice plant material or the roots of the rice plant is equal to or less than 80%, preferably equal to or less than 70%, and more preferably equal to or less than 60% of the amount of organic acid secreted by the roots of the corresponding wild type rice plant lacking the modification.

3. The method of claim 1 or 2, wherein modifying the rice plant material comprises deleting the sucrose responsive region or a portion thereof in the SUSIBA1 promoter in the rice plant material.

4. The method according to any one of claims 1 to 3, wherein modifying the rice plant material comprises down-regulating an enzyme involved in the Krebs cycle in the rice plant material, wherein the enzyme is preferably selected from the group consisting of: citrate synthase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, fumarase and malate dehydrogenase.

5. The method of claim 4, wherein downregulating the enzyme comprises replacing a promoter of a gene encoding the enzyme with a promoter that is less active in the rice plant material than the promoter of the gene.

6. The method of claim 4 or 5, wherein down-regulating the enzyme comprises interfering with translation of a messenger ribonucleic acid (mRNA) molecule obtained after transcription of a gene encoding the enzyme using RNA interference (RNAi) and an RNA molecule complementary to and capable of base pairing with the mRNA molecule.

7. The method according to any one of claims 1 to 6, wherein modifying the rice plant material comprises modifying the rice plant material to reduce the secretion of fumaric and/or malic acid, preferably fumaric acid, at or in the roots of the rice plant material.

8. A method of reducing methane emissions from a rice field, the method comprising:

deleting the sucrose response region in the SUSIBA1 promoter from the rice plant material; and

cultivating the rice plant material or a rice plant obtained from the rice plant material in a paddy field.

9. A method of reducing methane emissions from a rice field, the method comprising:

redistributing carbon from the roots of a rice plant into the ears of the rice plant; and

cultivating the rice plant in a paddy field, wherein the redistribution of carbon results in a reduction of organic acid production and secretion at the roots and thereby in a reduction of methane emission by methanogens present in soil associated with the roots in the paddy field.

10. A method according to any one of claims 1 to 9, wherein the rice plant material is a rice plant material or a palea rice plant material.

11. The method of any one of claims 1 to 10, wherein the rice plant material is selected from the group consisting of: rice plants, rice cells, rice plant tissues or organs, and rice seeds.

Technical Field

The present invention relates generally to low methane rice and, more particularly, to rice plant material that can reduce methane emissions from rice fields.

Background

Rice is the main staple food in the world, and over half of the population has rice as a staple food. The annual yield of rice is about 7 hundred million tons. Rice agriculture is the largest man-made source of atmospheric methane. This situation is exacerbated by the expansion of rice cultivation to meet the growing grain demand for decades to come. In fact, the contribution rate of atmospheric methane to global warming has been 20% since the pre-industrial era.

Therefore, there is an urgent need to establish sustainable technologies that can both enhance rice production and reduce the methane flux in rice fields. The strategy of developing high-yield rice as a means for suppressing methane emission was proposed in 2002. However, such "high-yield low-methane" rice has not been reported so far.

Disclosure of Invention

It is a general object to obtain rice plant materials that can reduce methane emissions from rice fields.

This and other objects are met by embodiments as disclosed herein.

The present invention relates to rice plant material capable of reducing methane emission by reducing organic acid secretion, such as fumaric acid secretion and/or malic acid secretion, at the roots of rice plants. This reduction in organic acid secretion reduces the amount of methanogens associated with the roots of rice plants, thereby reducing the methane emissions of such methanogens.

The invention is defined in the independent claims. Further embodiments of the invention are defined in the dependent claims.

Aspects of the invention relate to methods of producing low methane rice plants. The method comprises modifying the rice plant material to reduce organic acid secretion in the roots of the rice plant material or rice plant roots obtained from the rice plant material. In this embodiment, the amount of organic acid secreted by the rice plant material or by the roots of the rice plant is equal to or less than 90% of the amount of organic acid secreted by the roots of a corresponding wild-type rice plant in the absence of said modification. The reduced organic acid secretion from the rice plant material or the roots of the rice plant results in a reduction in methane emissions from the methanogens present in association with the rice plant material or the roots of the rice plant.

Another aspect of the invention relates to a method for reducing methane emission in a rice field. The method comprises deleting the sucrose response region in the SUSIBA1 promoter in the rice plant material. The method further comprises growing rice plant material or a rice plant obtained from the rice plant material in a paddy field.

Another aspect of the invention relates to a method for reducing methane emission in a rice field. The method comprises redistributing carbon from the roots of the rice plant into the ears of the rice plant. The method further comprises growing rice plants in the paddy field, wherein the redistribution of carbon results in a reduction in the production and secretion of organic acids by the roots, thereby resulting in a reduction in methane emissions from methanogens present in the soil associated with the roots in the paddy field.

The present invention can be used to reduce methane emission in paddy fields, thereby facilitating the use of rice as food, but has less negative effect on global warming due to the increase of atmospheric methane.

Drawings

The embodiments, together with further objects and advantages thereof, may best be understood by reference to the following description taken in conjunction with the accompanying drawings in which:

FIG. 1 shows the growth conditions of rice. Time samples were taken at weeks 4, 6, 8, and 13, and maturation and spatial samples at different times were expressed as horizontal positions 1-3 (positions 1-3) and vertical positions 1-3 (positions 1-3).

FIG. 2 phenotypic analysis of Rice roots at weeks 4, 6 and 7. Photograph of rice root (FIG. 2A) and root length (FIG. 2B). P <0.05 indicates a significant difference between SUSIBA2 rice and Nipponbare (Nipponbare). The bar is 2 cm.

FIG. 3 shows the methane emission from SUSIBA2 rice and Nipponbare at different time periods. P <0.05 and P <0.01 indicate significant differences between SUSIBA2 rice and japan sunny.

FIG. 4. microbiological assay of the part of the rice root and rhizosphere area (FIG. 4A), and the total part of the horizontal position at week 13 (FIG. 4B). Mst (methanostaceae), MET (methanogenic bacteria), Msc (Methanosarcinaceae), MBT (methanobacterales), MMB (methanobactorales), Arc (archaea) and methanobactorales (Methanocella) -specific MET. P <0.05 and P <0.01 indicate a significant reduction in microbial levels of SUSIBA2 rice compared to nipponica.

FIG. 5. microbiological determination of the horizontal position of the soil (FIG. 5A) and rhizosphere (FIG. 5B) parts at week 13. P <0.05 and P <0.01 indicate a significant reduction in microbial levels of SUSIBA2 rice compared to nipponica.

FIG. 6. microbiological assay of the horizontal position of the root surface (FIG. 6A) and inner circle (FIG. 6B) portions at week 13. P <0.05 and P <0.01 indicate a significant reduction in microbial levels of SUSIBA2 rice compared to nipponica.

FIG. 7 microbiological assays of the total fraction of the vertical position at week 4 (FIG. 7A) and week 6 (FIG. 7B). P <0.05 and P <0.01 indicate that the levels of microorganisms in SUSIBA2 rice were significantly reduced compared to Nipponbare.

FIG. 8 NMR analysis of root secretions at week 4, week 6, week 8 and at maturity.

FIG. 9 RNAseq analysis of SUSIBA2 rice roots at week 6 compared to Nipponbare. Schematic representation of 600 up-and 889 down-regulated genes in SUSIBA2 rice roots (fig. 9A). Genes downregulated in the Krebs cycle for SUSIBA2 rice roots (fig. 9B).

FIG. 10 relative abundance of bacterial and archaeobacteria phyla (FIG. 10A). From soil a) during cultivation of the rice varieties nippon (nippp), SUSIBA2-77 and SUSIBA 2-80; soil B) nanning, root P) plant phytotron and soil P) relative abundance of archaeomycetes (Su et al, 2015) in samples taken from plant phytotron (fig. 10B). Each sample was analyzed in triplicate.

FIG. 11 CRISPR/Cas deletion of the barley-corresponding sugar-sensing sequence in the rice SUSIBA1 promoter results in increased ear length. Schematic representation of the corresponding sugar-sensing sequence and CRISPR/Cas deletion in rice SUSIBA1 promoter (fig. 11A). Nipp: wild type rice variety nipponica, which has been exposed to the same CRISPR tissue culture protocol without deletion. CRISPR: CRISPR/Cas deleted fine japanese rice with SUSIBA1 sequence (fig. 11B). Statistical differences between long and short ears were significant (P < 0.01). n is 12. CRISPR rice and japanese clear rice were grown under the same phytoclimatic conditions as described (Su et al (2015)).

Figure 12. responses of different groups of methanogen breeds to fumaric acid treatment for two weeks (from week 6 to week 8). Mst (Methanosomatidae), MET (methanogen), Msc (Methanosomatidae), MBT (Methanobactriales), MMB (Methanomicrobiales), Arc (archaebacteria), Methanomycoles-specific Met.

Figure 13. qPCR analysis of the three rate-limiting enzymes (citrate synthase (e.c.2.3.3.1), isocitrate dehydrogenase (EC 1.1.1.42 and EC 1.1.1.41) and α -ketoglutarate dehydrogenase (EC 1.2.4.2, EC 2.3.1.61 and EC 1.8.1.4) genes and key enzymes for fumarate accumulation (succinate dehydrogenase EC 1.3.5.1, fumarase EC 4.2.1.2 and malate dehydrogenase EC 1.1.1.37) RNA from week 6 was used for gene expression analysis P <0.05 and P <0.01 indicate a significant difference between SUSIBA2 rice and nipponica.

FIG. 14 copy number of Geobacter sulfluridus (Geobacter sulflurucens) in rhizosphere of rice root (copy g-DW-root)^-1)。

Detailed Description

The present invention relates generally to low methane rice and, more particularly, to rice plant material that can reduce methane emissions from rice fields.

The present invention is based on the following findings: the interaction between rice plants and methanogens is based on organic acids, in particular fumaric acid and other organic acids of the Krebs cycle, such as malic acid secreted by the roots of rice plants. The secreted organic acids (such as fumaric and/or malic acid) are in turn used by methanogens as substrates for their propagation. Thus, by reducing the secretion of, in particular, fumarate from the roots of rice plants, the amount of methanogens present in the soil associated with the roots of rice is significantly reduced, as is the methane emission of the methanogens. Therefore, reduction of fumaric acid secretion in rice roots is an effective means for obtaining low-methane rice that results in reduction of methane emission in rice fields.

Accordingly, aspects of the present invention relate to methods of producing low methane rice. The method comprises modifying the rice plant material to reduce organic acid secretion in the roots of the rice plant material or rice plant roots obtained from the rice plant material. In this embodiment, the amount of organic acid secreted by the rice plant material or by the roots of the rice plant is equal to or less than 90% of the amount of organic acid secreted by the roots of a corresponding wild-type rice plant in the absence of said modification. The reduced organic acid secretion from the rice plant material or the roots of the rice plant results in a reduction in methane emissions from the methanogens present in association with the rice plant material or the roots of the rice plant.

In one embodiment, modifying the rice plant material comprises modifying the rice plant material to reduce fumaric acid and/or malic acid (preferably fumaric acid) secretion at the roots of the rice plant material or at the roots of the rice plant.

Methanogens are microorganisms that produce methane as a metabolic byproduct under anaerobic conditions. They are prokaryotes and belong to the archaebacteria domain. Common rice-related methanogens belong to the families Methanosomatidae, Methanosarcina, Methanobactriales and Methanomicrobiales.

According to various embodiments, organic acid secretion, such as fumarate secretion and/or malate secretion reduction, can be achieved in rice plant roots.

In one embodiment, enzymes involved in the Krebs cycle, also known as the citrate cycle (CAC) or the tricarboxylic acid cycle (TCA), are down-regulated. In particular embodiments, the enzyme is selected from the group consisting of: citrate synthase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, fumarase and malate dehydrogenase.

Thus, in one embodiment, modifying the rice plant material comprises down-regulating enzymes involved in the Krebs cycle in the rice plant material. In a specific embodiment, the enzyme is preferably selected from the group consisting of: citrate synthase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, fumarase and malate dehydrogenase.

Citrate synthase (e.c.2.3.3.1) catalyzes the condensation of a two-carbon acetate residue from acetyl-CoA (acetyl-CoA) with one molecule of four-carbon oxaloacetate to form six-carbon citrate: acetyl CoA + oxaloacetate + H₂O → citric acid + CoA-SH.

Isocitrate Dehydrogenase (IDH) (EC 1.1.1.42 and EC 1.1.1.41) is a catalyst for oxidative decarboxylation of isocitrate to produce alpha-ketoglutarate (alpha-ketoglutarate) and CO₂An enzyme of (4).

Alpha-ketoglutarate dehydrogenase (EC 1.2.4.2, EC 2.3.1.61 and EC 1.8.1.4), also known as ketoglutarate dehydrogenase complex (OGDC), is an enzyme complex that catalyzes the following reaction: alpha-ketoglutarate + NAD⁺+ CoA → succinyl-CoA + CO₂+ NADH. The compound consists of three components: ketoglutarate decarboxylase (OGDH) (EC 1.2.4.2), dihydrolipoyl succinyltransferase (DLST) (EC 2.3.1.61), and dihydrolipoyl dehydrogenase (DLD) (EC 1.8.1.4).

Succinate dehydrogenase (EC 1.3.5.1), also known as Succinate Dehydrogenase (SDH), succinate coenzyme Q reductase (SQR), or respiratory complex II, catalyzes the oxidation of succinic acid to fumaric acid, while reducing ubiquinone to ubiquinol.

Fumarase (EC 4.2.1.2), also known as fumarase hydratase, is an enzyme that catalyzes the reversible hydration/dehydration of fumaric acid to malic acid.

Malate Dehydrogenase (MDH) (EC 1.1.1.37) is prepared by using NAD⁺Reduction to NADH reversibly catalyzes the enzyme oxidation of malate to oxaloacetate.

In another specific embodiment, the enzyme is citrate synthase.

In another embodiment, a plurality, i.e. at least two enzymes (such as at least two of the above mentioned enzymes) involved in the Krebs cycle are down-regulated.

The down-regulation of the enzyme may be performed at the transcriptional level, the translational level, the post-processing level and/or at the enzymatic or protein level.

Down-regulation of the transcription level means that the transcription of the gene encoding the enzyme is down-regulated relative to the transcription level observed in wild-type rice material without any down-regulation. For example, down-regulation may be achieved by replacing the wild-type or native promoter of the gene encoding the enzyme with a weaker promoter that has lower activity in the rice material compared to the wild-type promoter or by an inducible promoter. Non-limiting but illustrative examples of such promoters include plant transcription promoters such as the SUSIBA2 promoter and the WRI1 promoter. An alternative or additional way of performing down-regulation of an enzyme at the level of transcription is to remove at least a portion of any enhancer element associated with the wild-type promoter of the gene encoding the enzyme, thereby reducing the activity of the wild-type promoter and the transcription of the gene encoding the enzyme.

Thus, in one embodiment, down-regulating the enzyme comprises replacing the promoter of the gene encoding the enzyme with a promoter that is less active in the rice plant material than the promoter of the gene.

Downregulation of the level of translation can be achieved by inhibiting or interfering with the translation of the mRNA molecule obtained after transcription of the gene encoding the enzyme. A typical example of such translational inhibition or interference is achieved by using RNA interference (RNAi). RNAi is based on the use of RNA molecules to inhibit translation by neutralizing target mRNA molecules. Such RNAi can be achieved using RNA molecules (such as micrornas) that are complementary to mRNA molecules obtained in the transcription of the gene encoding the enzyme, and thus capable of base pairing therewith.

Thus, in one embodiment, down-regulating an enzyme comprises using RNAi and complementary to a messenger ribonucleic acid (mRNA) molecule, thereby enabling RNA molecules base-pairing therewith to interfere with translation of the mRNA molecule obtained after transcription of the gene encoding the enzyme.

Down-regulation of post-processing levels implies any interference in the translation of mRNA molecules obtained after transcription from the gene encoding the enzyme, as described above, to obtain fully functional enzymes that are present in the rice cell in the correct location to catalyze their associated chemical reactions. For example, such down-regulation may involve interfering with the transport of the enzyme from the cytosol (where translation occurs) to organelles (such as mitochondria) in which the enzyme catalyzes its associated chemical reaction. Another example of down-regulation is any inhibition of post-translational processing of the amino acid sequence (to obtain a functional enzyme).

Down-regulation at the protein or enzyme level may be achieved by adding an inhibitor of the enzyme, which is capable of binding to the enzyme, thereby competing with, i.e. preventing or at least inhibiting, the binding of a target molecule to the enzyme. Another example of an enzyme inhibitor is an inhibitor that is capable of inducing a change in the conformational state of an enzyme molecule upon binding to the enzyme molecule, and wherein such change results in a decrease in the enzymatic activity of the enzyme.

Another method for reducing organic acid secretion in rice plants is to screen rice plants with low organic acid secretion (such as fumaric acid secretion and/or malic acid secretion) in the roots of the plants. Such screening can be performed among available rice plants. In another embodiment, a population of rice mutants with low organic acid secretion can be generated by, for example, Ethyl Methanesulfonate (EMS) induced mutagenesis. In this case, seeds of rice plants can be treated with EMS, then planted and selected to establish a stable rice population. Root organic acid secretion, such as fumarate secretion and/or malate secretion, of the stable rice population can then be monitored, and rice populations exhibiting reduced root organic acid secretion relative to wild-type rice can be selected and optionally subjected to crossing.

Another method for reducing organic acid secretion (such as fumaric acid secretion and/or malic acid secretion) in rice plant roots is to inhibit organic acid (such as fumaric acid and/or malic acid) secretion from the roots (i.e., transport of fumaric acid and/or malic acid from cells in rice plant roots). This inhibition can be performed in a similar manner to the enzymatic down-regulation discussed previously. For example, one or more proteins involved in the transport of fumaric and/or malic acid from the mitochondria into the cytosol and vacuole, and then from rice root cells into the environment surrounding the cells, can be down-regulated.

Any of the above disclosed alternatives for reducing organic acid secretion may be combined. Furthermore, any of the above disclosed alternatives to reduce organic acid secretion (including any combination thereof) may also be combined with the deletion of the negative transcription factor (sucrose response region) or part thereof in the rice SUSIBA1 promoter as shown in fig. 11A and further disclosed herein. This deletion of the negative transcription factor results in the redistribution of carbon from the root into the ear. Thus, there are fewer carbons available in the root for the production of organic acids, especially fumaric acid, resulting in reduced fumaric acid secretion.

In one embodiment, the modified rice plant material comprises a deletion of the sucrose responsive region or a portion thereof in the SUSIBA1 promoter in the rice plant material.

The rice SUSIBA1 promoter is present in the intron of the wild-type version of the genomic nucleotide sequence encoding the SUSIBA2 transcription factor. The absence of at least a portion of the sucrose responsive region means that none of the transactivators or complexes bind efficiently to the sucrose responsive region and, thus, do not efficiently activate the SUSIBA1 promoter. Thus, no SUSIBA1 transcription factor or only a small amount of SUSIBA1 transcription factor is produced in rice plant material, regardless of the level of sugar in the rice plant material. The absence or low content of the SUSIBA1 transcription factor in the rice plant material in turn means that the SUSIBA2 transcription factor will outperform the SUSIBA1 transcription factor in binding to the SUSIBA2 promoter (in more detail to at least one W-box of the SUSIBA2 promoter). This in turn will result in activation of the SUSIBA2 promoter and further production of the SUSIBA2 transcription factor in rice plant material. High levels of the SUSIBA2 transcription factor and low levels of the SUSIBA1 transcription factor in rice plant material induce the above-mentioned carbon redistribution in rice plant material. For more information on the rice SUSIBA1 and SUSIBA2 genes, promoters and transcription factors thereof, reference is made to WO 2018/182493, the teachings of which are hereby incorporated by reference.

Another aspect of the invention relates to a method for reducing methane emission in a rice field. The method comprises deleting the sucrose response region in the SUSIBA1 promoter in the rice plant material. The method further comprises growing rice plant material or a rice plant obtained from the rice plant material in a paddy field.

Another aspect of the invention relates to a method for reducing methane emission in a rice field. The method comprises redistributing carbon from the roots of the rice plant into the ears of the rice plant. The method further comprises growing the rice plant in the paddy field. In this embodiment, the redistribution of carbon results in a reduction in the production and secretion of organic acids by the roots, thereby resulting in a reduction in methane emissions by methanogens present in the soil associated with the roots in the rice field.

In one embodiment, the "rice plant material" is a rice plant. In another embodiment, the rice plant material is a rice cell, including a plurality of such rice cells. In further embodiments, the rice plant material is a rice plant tissue or organ, including but not limited to, the epidermis; ground tissue; vascular tissue, such as xylem or phloem; meristems such as apical meristem, lateral meristem or intermediate meristem; permanent tissues, such as simple permanent tissue (simple permanent tissue), include, for example, parenchyma, canthus, sclerenchyma, or epidermis, complex permanent tissues, including, for example, xylem, phloem, or specialized or secretory tissues. In yet another embodiment, the rice plant material is rice seed.

In one embodiment, the rice plant material is not wild rice plant material. Thus, the rice plant material is preferably a plant material of cultivated rice. In one embodiment, the rice plant material is rice (Oryza sativa) plant material or palea (Oryza glaberrima) plant material.

As used herein, "reduced organic acid secretion," such as reduced fumaric acid secretion, means a significant reduction in organic acid (such as fumaric acid) secretion from the roots of a rice plant according to the embodiments as compared to a corresponding control or wild type rice plant. In various embodiments, the amount of organic acid, such as fumaric acid, secreted by the roots of a rice plant according to embodiments may be equal to or less than 90%, preferably equal to or less than 85%, equal to or less than 80%, equal to or less than 75%, equal to or less than 70%, equal to or less than 65%, equal to or less than 60%, equal to or less than 55%, equal to or less than 50%, equal to or less than 45%, equal to or less than 40%, equal to or less than 35%, equal to or less than 30%, equal to or less than 25%, equal to or less than 20%, equal to or less than 15%, equal to or less than 10%, or even equal to or less than 5% of the amount of organic acid, such as fumaric acid, secreted by the roots of a control or wild-type rice plant.

In a particular embodiment, the amount of fumarate secreted by the roots of a rice plant according to the embodiment is 2.5 to 5.0 times less than the amount of fumarate secreted by the roots of the rice variety nipponica.

Examples

Example 1

SUSIBA2 rice (Su et al (2015)) is a low methane rice that produces a number of filled kernels of over 50% with the starch content in the kernels rising from 77% to 86%. Importantly, SUSIBA2 rice significantly reduced methane emissions in the rice field, which was associated with a significant reduction in methanogen growth. However, the mechanism behind the reduction of methane in rice is not clear. In these examples, ribonucleic acid (RNA) sequencing (RNAseq), microbial deoxyribonucleic acid (DNA) sequencing (DNAseq), Nuclear Magnetic Resonance (NMR), quantitative polymerase chain reaction (qPCR), and Gas Chromatography (GC) were used to monitor the interaction between SUSIBA2 rice and methanogens. The results showed that the interaction between SUSIBA2 rice and methanogens was an organic acid, mainly fumaric acid secreted by SUIBA2 rice. During rice cultivation, SUSIBA2 rice provides less physical habitat for methanogens by reducing root growth from around week 6 and reduces methane emissions by secreting less fumaric acid, which can be converted into a substrate for methanogen growth.

Materials and methods

Plant material and growth conditions

Rice plants of the japanese sunny (Oryza sativa l. ssp. japonica) (abbreviated herein as nippp) variety and SUSIBA2 rice were cultivated in accordance with Su et al (2015).

RNAseq

Total RNA isolation was performed as described by Su et al (2015). Root samples for RNA isolation were from horizontal position 1(h.position 1) or vertical position 1(v.position 1) at week 6 as indicated in fig. 1. RNAseq and bioinformatics were performed at SciLifeLab, BMC, Uppsala University.

Microbial DNAseq

Isolation of microbial DNA from plant phytotron rice soil and paddy soil was performed according to Su et al (2015). DNAseq was performed at BMC, Uppsala University.

NMR

Samples for NMR analysis were from vertical positions 1-3 (FIG. 1) at different time points during rice cultivation. Sample preparation and NMR analysis were performed according to Coulomb et al (2015) and Rohnisch et al (2018).

qPCR

Quantitative PCR was performed for methanogen assays and rice gene expression in the same manner as described in Su et al (2015).

GC analysis

Gas chromatographic analysis to determine methane concentration was performed as per Su et al (2015).

Results

SUSIBA2 rice and control rice were cultivated under phytoclimatic chamber conditions in Nipp and tracked during cultivation at weeks 4, 6, 8, 13 and maturity (FIG. 1). Various experiments were conducted on samples from different spatial sites (i.e., horizontal positions 1-3 and vertical positions 1-3) in the rhizosphere region of rice to analyze the interaction between SUSIBA2 rice and methanogens.

Root phenotype typing

Morphological changes of rice roots were followed during rice cultivation. At 4 weeks after planting, SUSIBA2 rice had the same or slightly larger root size than the wild-type control Nipponbare (FIG. 2). Interestingly, the roots of SUSIBA2 rice grew more slowly than Nipponbare after week 6 and became significantly smaller than Nipponbare at week 7 (FIG. 2B). After week 7, it was difficult to follow the development of root size due to the large root size, but SUSIBA2 rice had a smaller root size than Nipponbare.

Methane emission

Methane emissions were measured during the rice cultivation. After week 6, the SUSIBA2 rice showed significantly reduced methane emissions compared to the wild-type control rice Nipponbare (FIG. 3).

Methanogen assay

According to the protocol of Edwards et al (2015), the rice roots and the soil of the rhizosphere area are divided into four parts: soil, rhizosphere, root surface and inner ring (fig. 4A). Methanogenic assays showed that in all four fractions, methanogenic bacteria in seven groups of SUSIBA2 rice were less than methanogenic bacteria in Nipponbare (FIG. 4B, FIG. 5, and FIG. 6). Interestingly, the microorganisms other than MET and MET, which are the most important or major methanogens for methane emission in rice fields, could not be detected in the rhizosphere and inner circle parts. Examination of the vertical position during rice cultivation revealed that methanogens in 7 populations of SUSIBA2 rice were less than methanogens in Nipponbare at all depths starting at week 4 after planting (FIG. 7).

NMR analysis of root exudates

Root exudates from SUSIBA2 rice and Nipponbare were analyzed by NMR analysis. There was a significant difference in the amount of fumaric acid between rice root secretions (figure 8). From week 6 onwards, Nipponbare rice secreted more fumaric acid than SUSIBA2 rice. The secreted fumaric acid can be converted into a substrate for propagation of methanogens around the rhizosphere.

RNAseq analysis of rice root transcriptome

RNAseq analysis was used to detect 600 significantly (P <0.05) up-regulated genes and 889 down-regulated genes (9A) in SUSIBA2 rice roots. Among the down-regulated genes, all the fumaric acid synthesis-related genes were examined. One of the genes that was significantly down-regulated was the gene encoding citrate synthase (e.c.2.3.3.1), a rate-limiting enzyme of the Krebs cycle (fig. 9B).

DNAseq of microorganisms around rice rhizosphere

The DNAseq results showed little effect on the overall colony composition between different rice varieties, indicating that SUSIBA2 rice did not cause any significant change in the soil microflora. The main differences between the phytotron samples and the field samples have actually been shown. The results also show that the total relative abundance of methanogens relative to the bacterial community is very low, below 1%, which is normal for this type of community. Methanogens still account for 60% of the archaea community. Furthermore, consistent with the qPCR analysis, the relative abundance of methanogens was significantly lower for SUSIBA2 rice compared to japanese fine rice (fig. 10).

Conclusion

Experiments show that the interaction between SUSIBA2 rice and methanogens is organic acid and mainly fumaric acid. The reduction in methane emissions as observed in SUSIBA2 rice was due to this reduction in fumaric acid secretion around week 6 after planting. The secreted fumaric acid can be converted into a substrate for the propagation of methanogens. Thus, the reduction in fumaric acid secretion reduces the amount of methanogen substrate. In addition, SUSIBA2 rice began to reduce root growth around week 6 after planting, thereby providing less physical habitat for methanogen growth.

Example 2

Carbon partitioning from underground biomass to above-ground biomass can be used to reduce fumaric acid secretion at underground roots, which limits the growth of methanogenic communities in rice rhizosphere.

Materials and methods

Deletion of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein (Cas) was performed at a Biogle Genome Editing Center, China, to delete the negative transcription factor (sucrose response region) in the rice SUSIBA1 promoter of Nipponbare rice (Lu et al (2017); Jin et al (2017)). qPCR analysis of the relevant gene expression was performed according to Jin et al (2017).

Results

Negative transcription factors (sucrose responsive regions) in the yin-yang system in rice were successfully deleted using CRISPR/Cas technology (Jin et al (2017)) to obtain larger ears (fig. 11). The increased ear size means that more carbon is redistributed to the ear, which in turn results in less carbon from the underground root to the fumaric acid fraction. When SUSIBA2 rice and Nipponbare rice were treated with fumaric acid, all methanogenic populations were propagated (FIG. 12), indicating that fumaric acid can be converted into a substrate for methanogenic bacterial growth.

In the RNAseq experiment (fig. 9), only the gene encoding citrate synthase was found to be down-regulated due to the lack of annotation in the nipponica genome sequence database, while no genes for other enzymes in the Krebs cycle were found. When the genes of two other rate-limiting enzymes (isocitrate dehydrogenase and α -ketoglutarate dehydrogenase) and the genes of key enzymes in fumarate accumulation were analyzed using qPCR, all the analyzed genes were down-regulated in SUSIBA2 rice roots, indicating that these genes can be used as probes for screening low-root fumarate rice.

Example 3

Geobacter (Geobacter) species are important to the environment, in part because they are capable of anaerobically oxidizing acetic acid by reducing extracellular electron acceptors such as Fe (III) and Mn (IV) oxides, humus, U (VI), and graphite electrodes. Some geobacillus species, including thioredoxin, can also use the tricarboxylic acid (TCA) cycle intermediate fumarate as an electron acceptor and acetic acid as a donor. It has been demonstrated that the strain S.thioreducens has only one enzyme FrdCAB, which acts in vivo as fumarate reductase.

Materials and methods

Samples of the rhizosphere part of the root at the proximal region 5cm from the upper phase (vertical position 1 in fig. 1) from four independent plants of nippon and SUSIBA2 were collected from the plant phytotron at 3 pm, and then the samples were used for the isolation of soil DNA using a DNA isolation kit for soil organisms (FastDNA SPIN kit for soil; MP Biomedicals, LLC). The DNA was then quantified and adjusted to the same concentration. Using a standard of cloned 16S rRNA gene fragment of Acinetobacter thioredoxin, using a primer G.Sulf923F: TGACATCCACGGAACCCTCC (SEQ ID NO: 1); Sulf1399R: GACGCTGCCTCCATTGCTG (SEQ ID NO:2) was subjected to qPCR quantification. The abundance of thioredoxin was calculated and converted to DNA copy number per gram of dry soil sample. The qPCR program for thioredoxin was as follows: 7 min at 95 ℃ then 40 cycles: 95 ℃ for 10 seconds, 60 ℃ for 40 seconds and 72 ℃ for 40 seconds. All melting curves were from 55 ℃ to 95 ℃ with a 0.05 ℃ rise per second.

Results

qPCR analysis showed that the group of geobacter associated with rhizosphere parts (see fig. 4A), i.e., geobacter thioreducens, was significantly more in nipponia than in SUSIBA2 rice (fig. 14). This means that Nipponbare rice secretes more fumaric acid than SUSIBA2 rice, which results in more Acetobacter thioredoxin producing acetic acid for methanogens. Thus, the control Nipponbare rice secreted more fumaric acid than SUSIBA2 rice, which stimulated production of more acetic acid by C.thioredoxinus. More acetic acid (as methanogenic substrate) enriches methanogens to release more methane.

The embodiments described above are to be understood as a few illustrative examples of the invention. Those skilled in the art will appreciate that various modifications, combinations, and alterations to the embodiments can be made without departing from the scope of the invention. In particular, different partial solutions in different embodiments may be combined in other configurations, where technically feasible.

Reference to the literature

Coulomb et al.(2015)Metabolomics study of cereal grains reveals the discriminative metabolic markers associated with anatomical compartments，Italian Joumal of Food Science 27：1-9

Edwards et al.(2015)Structure,variation,and assembly of the root-associated microbiomes of rice,The Proceedings of the Nationa/ Academy of Sciences of the United States of America 112：E911-E920

Lu et al.(2017)Genome-wide Targeted Mutagenesis in Rice Using the CRISPR/Cas9 System,Molecular Plant 10：1242-1245

Jin et al.(2017)A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley，Molecular Plant 10：1556-1570

Rohnisch et al.(2018)A QuA：An Automated Quantification Algorithm for High-Throughput NMR-Based Metabolomics and lts Application in Human Plasma，Analytical Chemistry 90：2095-2102

Su et al.(2015)Expression of barley SUSIBA2 transcription factor yields high-starch low-methane rice，Nature 523：602-606

Sequence listing

<110> Sun Signaling (SUN, Chuanxin)

<120> Low methane Rice

<130> HSJ102768P.WOP

<150> US 62/825,626

<151> 2019-03-28

<160> 2

<170> PatentIn 3.5 edition

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward qPCR primer

<400> 1

tgacatccac ggaaccctcc 20

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse qPCR primer

<400> 2

gacgctgcct ccattgctg 19