阅读说明：本技术 香草醛从异丁香酚的生物合成 (Biosynthesis of vanillin from isoeugenol ) 是由 周睿 马俊莹 O·余 于 2020-04-29 设计创作，主要内容包括：本发明涉及通过异丁香酚的生物转化生产香草醛。所述生物转化可以在细胞系统(例如大肠杆菌)中介导,或在没有细胞系统的酶促反应混合物中介导。(The present invention relates to the production of vanillin by bioconversion of isoeugenol. The biotransformation can be mediated in a cell system, for example E.coli, or in an enzymatic reaction mixture without a cell system.)

1. A bioconversion method of producing vanillin comprising:

a. expressing a FfLSD gene in a mixture, wherein the expressed FfLSD gene in the mixture has an amino acid sequence that is at least 70% identical to SEQ ID No. 2;

b. adding isoeugenol to the mixture; and

c. the isoeugenol is converted into vanillin.

2. The method of claim 1, wherein the expressed FfLSD gene has an amino acid sequence that is at least 80% identical to SEQ ID No. 2.

3. The method of claim 1, wherein the expressed FfLSD gene has an amino acid sequence that is at least 90% identical to SEQ ID No. 2.

4. The method of claim 1, wherein the expressed FfLSD gene has an amino acid sequence that is at least 95% identical to SEQ ID No. 2.

5. The method of any one of claims 1-4, wherein the step of expressing the FfLSD gene is selected from the group consisting of: expressing the gene by in vitro translation; expressing the gene in a cell system; and expressing the gene in a bacterial or yeast cell.

6. The method of claim 5, further comprising purifying a product from the step of expressing the FfLSD gene as a recombinant protein.

7. The method of any one of claims 1 to 6, further comprising collecting said vanillin.

8. The method of claim 7, wherein the conversion from isoeugenol to vanillin is greater than 80%.

9. The method of claim 7, wherein the conversion from isoeugenol to vanillin is greater than 85%.

10. The method of claim 7, wherein the conversion from isoeugenol to vanillin is greater than 90%.

11. A method of producing vanillin using an isolated recombinant host cell, comprising: (i) growing the isolated recombinant host cell in a culture medium; (ii) (ii) adding isoeugenol to the medium of (i) to begin bioconverting isoeugenol to vanillin; and (iii) extracting vanillin from the culture medium, wherein the isolated recombinant host cell has been transformed with a nucleic acid construct comprising a polynucleotide sequence encoding a ligno-stilbene-alpha, beta-dioxygenase enzyme, wherein the ligno-stilbene-alpha, beta-dioxygenase has an amino acid sequence with at least 70% identity to SEQ ID No. 2.

12. The method of claim 11, wherein the ligno-stilbene-alpha, beta-dioxygenase has an amino acid sequence with at least 80% identity to SEQ ID No. 2.

13. The method of claim 11, wherein the ligno-stilbene-alpha, beta-dioxygenase has an amino acid sequence which is at least 90% identical to SEQ ID No. 2.

14. The method of claim 11, wherein the ligno-stilbene-alpha, beta-dioxygenase has an amino acid sequence that is at least 95% identical to SEQ ID No. 2.

15. A method of manufacturing a consumable, comprising the steps of: producing vanillin according to the method of claim 1 or claim 11; collecting said vanillin; and incorporating the vanillin into a consumable.

16. The method of claim 15, comprising the step of blending said vanillin with said consumable.

17. The method of claim 15 or 16, wherein said vanillin is incorporated into said consumable in an amount sufficient to impart a flavor characteristic.

18. The method of any one of claims 15 to 17, wherein the consumable is selected from the group consisting of: flavoring products, food precursor products, additives for the production of food products, pharmaceutical compositions, dietary supplements, nutraceuticals and cosmetics.

19. The method of claim 15 or 16, wherein said vanillin is incorporated in said consumable in an amount sufficient to impart a flavor characteristic.

20. The method of any one of claims 15, 16, 19 and 20, wherein the consumable is selected from the group consisting of: fragrance products, cosmetics, toiletry products and house cleaning products.

21. An isolated recombinant host cell transformed with a nucleic acid construct comprising a polynucleotide sequence encoding a stilbene- α, β -dioxygenase, wherein the stilbene- α, β -dioxygenase has an amino acid sequence which is at least 70% identical to SEQ ID No. 2.

22. The isolated recombinant host cell of claim 21, wherein the polynucleotide sequence comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID No. 1.

23. The isolated recombinant host cell of claim 21 or claim 22, further comprising a vector comprising the isolated nucleic acid sequence of SEQ ID No. 3.

24. The isolated recombinant host cell of any one of claims 21-23, wherein the host cell is selected from the group consisting of: bacteria, yeast, filamentous fungi other than anthrax, cyanobacteria, algae, and plant cells.

25. The isolated recombinant host cell of any one of claims 21-24, wherein the host cell is selected from the group of microorganisms consisting of: e.coli; salmonella; a bacillus; acinetobacter; a streptomycete; a coryneform bacterium; campylobacter methylotrophicus; methylomonas sp; rhodococcus sp; pseudomonas bacteria; rhodobacter; collecting the cytoalgae; a yeast; conjugative yeast; kluyveromyces; candida species; hansenula polymorpha; debaryomyces debarkii; mucor; pichia pastoris; torulopsis globisporus; aspergillus; arthrobotrys; b, Brevibacterium; a bacterium, a bacterium; arthrobacter; citrobacter bacteria; klebsiella sp; performing pantoea; and clostridium.

Technical Field

The present disclosure relates generally to methods and materials for catalyzing the bioconversion of isoeugenol to vanillin utilizing fungal ligno-stilbene alpha, beta-dioxygenase in bacteria, yeast, or other cellular systems, or in non-cellular systems.

Background

Vanilla flavour is one of the most common flavours in the world. It is used for the seasoning of various foods such as ice cream, dairy products, desserts, candies, baked products and spirits. It is also used in perfumes, pharmaceuticals and personal hygiene products.

Traditionally, natural vanilla flavour was obtained from the fermented pods of vanilla orchid flowers. It is formed mainly by hydrolysis of the vanillin glycosides present in beans within a few weeks of the bean drying and fermentation process after harvest. The main aromatic substance of vanilla flavour is vanillin (4-hydroxy 3-methoxybenzaldehyde).

Vanillin (4-hydroxy-3-methoxybenzaldehyde) is one of the most common flavor chemicals and is widely used in the food and beverage, perfume, pharmaceutical and medical industries. Approximately 12,000 tonnes of vanillin are consumed annually, of which only 20 to 50 tonnes are extracted from vanilla beans, the remainder being synthetically produced, mainly from petrochemicals such as guaiacol and lignin. In recent years, the demand for natural flavors has increased, leading the flavor industry to produce vanillin by bioconversion, as various regulatory and legislative bodies (e.g., european community legislation) consider such bioconverted products to be natural when produced from biological sources such as living cells or their enzymes, and can be sold as "natural products".

Natural isoeugenol can be extracted from essential oils and it is economically practical to produce vanillin by enzymatic or microbial bioconversion. The production of vanillin by the transformation of isoeugenol has been widely reported in many microorganisms including Aspergillus niger, Bacillus subtilis and Pseudomonas putida. However, the reported very low titres produced by these microorganisms (less than 2g/L) significantly limits the practical application of this method in industry. Furthermore, the reported biotransformation process is complicated, further increasing the cost of vanillin production.

Thus, there is a need in the art for more cost-effective methods for producing vanillin with higher titers and conversions.

Disclosure of Invention

The present inventors solved the above problems by identifying fungal xylstilbene alpha, beta-dioxygenases that have very low sequence identity to the previously reported bacterial isoeugenol monooxygenase and to the xylstilbene alpha, beta-dioxygenases that have been used for the production of vanillin. The identified fungal xylylenesrylene α β -dioxygenase (FfLSD) shows surprisingly high activity in converting isoeugenol to vanillin. Expression plasmids with the FfLSD gene were constructed, and an engineered host strain was developed and utilized to produce vanillin from isoeugenol at high titers and conversion rates. The recombinant protein expressed from the FfLSD gene can also be isolated and purified and used to convert isoeugenol to vanillin in vitro.

Thus, in one aspect, the present disclosure relates to a bioconversion method of producing vanillin. The method may include expressing the FfLSD gene in a mixture, adding isoeugenol to the mixture, and converting isoeugenol to vanillin. In some embodiments, the expressed FfLSD gene may have an amino acid sequence that is at least 60% identical to SEQ ID No.2, at least 65% identical to SEQ ID No.2, at least 70% identical to SEQ ID No.2, at least 75% identical to SEQ ID No.2, at least 80% identical to SEQ ID No.2, at least 85% identical to SEQ ID No.2, at least 90% identical to SEQ ID No.2, at least 95% identical to SEQ ID No.2, or at least 99% identical to SEQ ID No. 2. In some embodiments, the expressed FfLSD gene may have the same amino acid sequence as SEQ ID No. 2.

In various embodiments, the biotransformation process may comprise expressing the FfLSD gene by in vitro translation. In an alternative embodiment, the biotransformation process may comprise expressing the FfLSD gene in a cell system. In certain embodiments, the bioconversion method may comprise expressing the FfLSD gene in a bacterial or yeast cell. The bioconversion process may comprise purifying the product from the step of expressing the fvlsd gene as a recombinant protein. In some embodiments, the purified recombinant protein may be added as a biocatalyst to a reaction mixture containing isoeugenol. In some embodiments, isoeugenol may be added directly to the mixture in which the FfLSD gene is expressed.

The bioconversion process described herein can comprise recovering vanillin from the mixture. The recovery of vanillin can be carried out according to any conventional isolation or purification method known in the art. The method may further comprise removing biomass (enzymes, cellular material, etc.) from the mixture prior to recovering vanillin.

In one aspect, the present disclosure relates to a method of producing vanillin using an isolated recombinant host cell, wherein the isolated recombinant host cell has been transformed with a nucleic acid construct comprising a polynucleotide sequence capable of encoding a ligno-stilbene alpha, beta-dioxygenase. For example, the lignorethene α, β -dioxygenase may have an amino acid sequence which is at least 60% identical to SEQ ID No.2, at least 65% identical to SEQ ID No.2, at least 70% identical to SEQ ID No.2, at least 75% identical to SEQ ID No.2, at least 80% identical to SEQ ID No.2, at least 85% identical to SEQ ID No.2, at least 90% identical to SEQ ID No.2, at least 95% identical to SEQ ID No.2 or at least 99% identical to SEQ ID No. 2. In some embodiments, the ligno-stilbene α, β -dioxygenase may have the same amino acid sequence as SEQ ID No. 2. In some embodiments, the method may comprise (i) growing the isolated recombinant host cell in a culture medium; (ii) adding isoeugenol to the culture medium to initiate the bioconversion of isoeugenol to vanillin; (iii) extracting vanillin from the culture medium. In other embodiments, the methods can comprise (i) culturing the isolated recombinant host cell in a culture medium to allow expression of a ligno-stilbene α, β -dioxygenase; (ii) separating the woody stilbene alpha, beta-dioxygenase; (iii) adding the isolated ligno-stilbene alpha, beta-dioxygenase to a reaction mixture comprising isoeugenol; and (iv) extracting vanillin from the reaction medium.

In one aspect, the present disclosure relates to an isolated recombinant host cell transformed with a nucleic acid construct comprising a polynucleotide sequence encoding a ligno-stilbene α, β -dioxygenase enzyme, wherein the ligno-stilbene α, β -dioxygenase enzyme has an amino acid sequence that is at least 60% identical to SEQ ID No.2, at least 65% identical to SEQ ID No.2, at least 70% identical to SEQ ID No.2, at least 75% identical to SEQ ID No.2, at least 80% identical to SEQ ID No.2, at least 85% identical to SEQ ID No.2, at least 90% identical to SEQ ID No.2, at least 95% identical to SEQ ID No.2, or at least 99% identical to SEQ ID No. 2. In some embodiments, the ligno-stilbene α, β -dioxygenase may have the same amino acid sequence as SEQ ID No. 2. In some embodiments, the nucleic acid construct may contain a polynucleotide sequence comprising an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID No.1, at least 75% identical to the amino acid sequence of SEQ ID No.1, at least 80% identical to the amino acid sequence of SEQ ID No.1, at least 85% identical to the amino acid sequence of SEQ ID No.1, at least 90% identical to the amino acid sequence of SEQ ID No.1, or at least 95% identical to the amino acid sequence of SEQ ID No. 1. In some embodiments, the nucleic acid construct may comprise the same polynucleotide sequence as SEQ ID No. 1. In some embodiments, the isolated recombinant host cell may comprise a vector comprising the isolated nucleic acid sequence of SEQ ID No. 5. In various embodiments, the host cell may be selected from the group consisting of: bacteria, yeast, filamentous fungi other than Colletotrichum (Colletotrichum), cyanobacteria (cyanobacteria), algae, and plant cells. For example, the host cell may be selected from the group of microorganisms consisting of: escherichia coli (Escherichia); salmonella (Salmonella); bacillus (Bacillus); acinetobacter (Acinetobacter); streptomyces (streptomyces); corynebacteria (Corynebacterium); campylobacter methylotrophus (Methylosinus); methylomonas (Methylomonas); rhodococcus (Rhodococcus); pseudomonas (Pseudomonas); rhodobacter (Rhodobacter); synechocystis (Synechocystis); yeasts (Saccharomyces); zygosaccharomyces; kluyveromyces (Kluyveromyces); candida (Candida); hansenula yeast (Hansenula); debaryomyces (Debaryomyces); mucor (Mucor); pichia pastoris (Pichia); torulopsis globulopsis (Torulopsis); aspergillus (Aspergillus); arthrobotrys (Arthrobotlys); brevibacterium (brevibacterium); bacillus (Microbacterium); arthrobacter (Arthrobacter); citrobacter (Citrobacter); klebsiella (Klebsiella); pantoea (Pantoea); and Clostridium (Clostridium).

Vanillin produced using the methods and/or isolated recombinant host cells described herein can be collected and incorporated into a consumable. For example, vanillin can be mixed with the consumable. In some embodiments, vanillin may be incorporated into the consumable in an amount sufficient to impart, modify, enhance or enhance an intended taste, flavor, or sensation, or hide, modify or minimize an unintended taste, flavor, or sensation in the consumable. For example, the consumable may be selected from the group consisting of: food, food ingredient, food additive, beverage, medicine and tobacco. In some embodiments, vanillin may be incorporated into the consumable in an amount sufficient to impart, modify, enhance or enhance a desired flavor or odor, or hide, modify or minimize an undesired flavor or odor in the consumable. The consumable may be selected from the group consisting of: perfumes, cosmetics, toiletries, household and body care, detergents, insect repellents, fertilizers, air fresheners, and soaps.

Other features and advantages of the present invention will become apparent from the following detailed description, which proceeds with reference to the accompanying drawings.

Drawings

Figure 1 shows the biotransformation pathway of isoeugenol to vanillin.

Figure 2 provides a schematic representation of a pvuap plasmid according to the present disclosure.

Fig. 3 provides a schematic of the FfLSD-pET28 construct according to the present disclosure.

Figure 4 provides a schematic of the FfLSD-poudap construct according to the present disclosure.

FIG. 5 is a graph showing the results of measurement of the purified recombinant protein FfIEM/FfLSD by SDS-PAGE.

Figure 6 provides HPLC chromatograms showing bioconversion of isoeugenol to vanillin by FfLSD (upper panel) according to the present disclosure, as compared to denatured FfLSD (lower panel).

FIG. 7 compares vanillin production by E.coli strain FfLSD-W3110 according to the disclosure with E.coli strain FfLSD-W-control.

Figure 8 shows the production of vanillin by escherichia coli strain FfLSD-W3110 with isoeugenol as substrate in a 5 liter fermentor according to the present disclosure.

Detailed Description

As used herein, the singular forms "a", "an" and "the" include plural references unless the content clearly dictates otherwise.

To the extent that the terms "includes," "including," "has," "having," "has," "having," "contains," "containing," "involving," or the like are used in either the detailed description or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising" as "comprising" is interpreted when employed as a transitional word in a claim.

The word "exemplary" is used herein to mean serving as an example, instance, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.

A "cell system" is any cell that provides for the expression of ectopic proteins. It includes bacteria, yeast, plant cells and animal cells. It includes prokaryotic cells and eukaryotic cells. It also encompasses the in vitro expression of proteins based on cellular components (e.g., ribosomes).

"coding sequence" shall be given its ordinary and customary meaning to a person of ordinary skill in the art, and is not limited to being used to refer to a DNA sequence that encodes a particular amino acid sequence.

"growing" or "culturing" a cell system comprises providing an appropriate medium that allows the cells to multiply and divide. It also comprises providing resources such that the cell or cell component can translate and make the recombinant protein.

"Yeast" is a eukaryotic, unicellular microorganism classified as a member of the kingdom fungi. Yeast is a unicellular organism evolved from a multicellular ancestor, but some species useful for the present invention are yeasts capable of developing multicellular characteristics by forming a linked string of budding cells called pseudohyphae (pseudo-hyphae).

The term "complementary" shall be given its ordinary and customary meaning to a person of ordinary skill in the art and is used, but not limited to, describing the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present technology also encompasses isolated nucleic acid fragments that are complementary to the complete sequences reported in the accompanying sequence listing, as well as those substantially similar nucleic acid sequences.

The terms "nucleic acid" and "nucleotide" shall be given their respective ordinary and customary meaning to those of ordinary skill in the art and are used, without limitation, to refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified or degenerate variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.

The term "isolated" shall be given its ordinary and customary meaning to one of ordinary skill in the art, and when used in the context of an isolated nucleic acid or isolated polypeptide, is used to refer, but is not limited to, a nucleic acid or polypeptide that exists by hand free from its natural environment and is therefore not a natural product. An isolated nucleic acid or polypeptide may exist in a purified form or may exist in a non-natural environment, e.g., in a transgenic host cell.

The term "incubation" as used herein refers to a process of mixing two or more chemical or biological entities (e.g., compounds and enzymes) and allowing them to interact under conditions favorable for the production of vanillin.

The term "degenerate variant" refers to a nucleic acid sequence having a sequence of residues that differs from a reference nucleic acid sequence by one or more degenerate codon substitutions. Degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues. The nucleic acid sequence and all degenerate variants thereof will express the same amino acid or polypeptide.

The terms "polypeptide", "protein" and "peptide" shall be given their respective ordinary and customary meaning to those of ordinary skill in the art; these three terms are sometimes used interchangeably and are intended to refer, without limitation, to polymers of amino acids or amino acid analogs, regardless of their size or function. Although "protein" is generally used with reference to a relatively large polypeptide and "peptide" is generally used with reference to a smaller polypeptide, the use of these terms in the art is overlapping and varies. The term "polypeptide" as used herein refers to peptides, polypeptides and proteins, unless otherwise specified. The terms "protein," "polypeptide," and "peptide" are used interchangeably herein when referring to a polynucleotide product. Thus, exemplary polypeptides include polynucleotide products, naturally occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing.

The terms "polypeptide fragment" and "fragment", when used in reference to a polypeptide, shall be given their ordinary and customary meaning to those of ordinary skill in the art, and are used in, but are not limited to, referring to polypeptides in which amino acid residues are deleted as compared to the reference polypeptide itself, but the remaining amino acid sequence is generally identical to the corresponding position in the reference polypeptide. Such deletions may occur at the amino terminus or the carboxy terminus of the reference polypeptide, or both.

The term "functional fragment" of a polypeptide or protein refers to a peptide fragment that is a portion of a full-length polypeptide or protein and has substantially the same biological activity or performs the same function (e.g., performs the same enzymatic reaction) as the full-length polypeptide or protein.

The terms "variant polypeptide", "modified amino acid sequence" or "modified polypeptide" used interchangeably refer to a polypeptide that differs from a reference polypeptide by one or more amino acids, e.g., one or more amino acid substitutions, deletions and/or additions. In one aspect, a variant is a "functional variant" that retains some or all of the ability of a reference polypeptide.

The term "functional variant" further encompasses conservatively substituted variants. The term "conservatively substituted variant" refers to a peptide having an amino acid sequence that differs from a reference peptide by one or more conservative amino acid substitutions, and that maintains some or all of the activity of the reference peptide. A "conservative amino acid substitution" is a substitution of an amino acid residue with a functionally similar residue. Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue (e.g., isoleucine, valine, leucine or methionine) for another; substitution of one charged or polar (hydrophilic) residue for another, e.g., between arginine and lysine, glutamine and asparagine, threonine and serine; substitution of one basic residue (e.g., lysine or arginine) for another; or substitution of one acidic residue (e.g., aspartic acid or glutamic acid) for the other; or by substitution of one aromatic residue (e.g., phenylalanine, tyrosine, or tryptophan) for another. Such substitutions are expected to have little effect on the apparent molecular weight or isoelectric point of the protein or polypeptide. The phrase "conservatively substituted variant" also encompasses peptides in which a residue is replaced with a chemically derivatized residue, provided that the resulting peptide maintains some or all of the activity of the reference peptide as described herein.

The term "variant" in relation to polypeptides of the present technology also encompasses functionally active polypeptides having an amino acid sequence that is at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% and even 100% identical to the amino acid sequence of a reference polypeptide.

The term "homologous" in all its grammatical forms and spelling changes refers to the relationship between polynucleotides or polypeptides having "common evolutionary origin", including polynucleotides or polypeptides from a superfamily and homologous polynucleotides or proteins from different species (Reeck et al, CELL 50:667,1987). Such polynucleotides or polypeptides have sequence homology, as reflected by their sequence similarity, whether in percent identity or in the presence of particular amino acids or motifs at conserved positions. For example, two homologous polypeptides may have an amino acid sequence that is at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 900, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identical.

"suitable regulatory sequences" shall be given their ordinary and customary meaning to those of ordinary skill in the art, and are used in, but are not limited to, reference to nucleotide sequences located upstream (5 'non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and that affect transcription, RNA processing or stability or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leaders, introns, and polyadenylation recognition sequences.

"promoter" shall be given its ordinary and customary meaning to a person of ordinary skill in the art and is used, without limitation, to refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Typically, the coding sequence is located 3' to the promoter sequence. Promoters may be derived entirely from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It will be appreciated by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types or at different stages of development or in response to different environmental conditions. Promoters that cause the expression of genes in most cell types are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

The term "operably linked" refers to the association of nucleic acid sequences on individual nucleic acid fragments such that the function of one nucleic acid fragment is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). The coding sequence may be operably linked to regulatory sequences in sense or antisense orientation.

The term "expression" as used herein shall be given its ordinary and customary meaning to a person of ordinary skill in the art and is used in, but not limited to, referring to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragments of the present technology. "overexpression" refers to the production of a gene product in a transgenic or recombinant organism above the level of production in a normal or non-transformed organism.

"transformation" shall be given its ordinary and customary meaning to a person of ordinary skill in the art, and is used in, but not limited to, referring to the transfer of a polynucleotide into a target cell. The transferred polynucleotide may be incorporated into the genomic or chromosomal DNA of the target cell, resulting in genetically stable inheritance, or may replicate independently of the host chromosome. Host organisms containing transformed nucleic acid fragments are referred to as "transgenic" or "transformed" or "recombinant".

The terms "transformed", "transgenic" and "recombinant" when used herein in connection with a host cell shall confer their respective ordinary and customary meaning to a person of ordinary skill in the art and are used in, but not limited to, referring to a cell of a host organism, such as a plant or microbial cell, into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule may be stably integrated into the genome of the host cell, or the nucleic acid molecule may exist as an extrachromosomal molecule. Such extrachromosomal molecules can replicate autonomously. Transformed cells, tissues or subjects are understood to comprise not only the end product of the transformation process, but also transgenic progeny thereof.

The terms "recombinant," "heterologous," and "exogenous" when used herein in connection with a polynucleotide shall confer their ordinary and customary meaning to those of ordinary skill in the art, and are used to refer, without limitation, to an exogenous source in which the polynucleotide (e.g., DNA sequence or gene) is derived from a particular host cell, or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell comprises a gene that is endogenous to the particular host cell, but has been modified, for example, by using site-directed mutagenesis or other recombinant techniques. The term also encompasses non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the term refers to a segment of DNA that is foreign or heterologous to the cell, or homologous to the cell, but which is not normally present in the host cell at the location or form of the element.

Similarly, the terms "recombinant," "heterologous," and "exogenous" when used herein in connection with a polypeptide or amino acid sequence, refer to the polypeptide or amino acid sequence being derived from a source foreign to the particular host cell, or if from the same source, modified from its original form. Thus, the recombinant DNA segment can be expressed in a host cell to produce a recombinant polypeptide.

"protein expression" refers to the protein produced upon gene expression. It consists of the stage after transcription of DNA into messenger rna (mrna). The mRNA is then translated into polypeptide chains, which ultimately fold into proteins. DNA is present in cells by transfection, a process by which nucleic acids are deliberately introduced into cells. The term is generally used for non-viral methods in eukaryotic cells. It may refer to other methods and cell types, although other terms are preferred: "transformation" is more commonly used to describe non-viral DNA transfer in bacterial, non-animal eukaryotic cells, including plant cells. In animal cells, transfection is the preferred term, as transformation is also used to refer to progression to a cancerous state in these cells (carcinogenesis). Transduction is commonly used to describe virus-mediated DNA transfer. For the purposes of this application, transformation, transduction, and viral infection are included under the definition of transfection.

The terms "plasmid", "vector" and "gene cassette" shall confer their respective ordinary and customary meaning to those skilled in the art and are used in, but not limited to, referring to extra chromosomal elements that normally carry genes that are not part of the central metabolism of the cell, usually in the form of circular double stranded DNA molecules. These elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, derived from single-or double-stranded DNA or RNA of any origin, linear or circular, in which a number of nucleotide sequences have been joined or recombined into a unique structure capable of introducing into a cell a promoter fragment and DNA sequence of a selected gene product and appropriate 3' untranslated sequence. "transformation gene cassette" refers to a specific vector containing an exogenous gene and having, in addition to the exogenous gene, elements that facilitate transformation of a specific host cell. "expression gene cassette" refers to a specific vector that contains an exogenous gene and has elements in addition to the exogenous gene that allow for enhanced expression of the gene in an exogenous host.

As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or peptide sequences do not vary over the alignment window of components (e.g., nucleotides or amino acids). The "identity portion" of an aligned fragment of a test sequence and a reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence fragment, i.e., the entire reference sequence or a smaller defined portion of the reference sequence.

As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) as compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (the appropriate nucleotide insertions, deletions, or gaps add up to less than 20% of the reference sequence over the comparison window). Optimal alignment of sequences for alignment over a comparison window is well known to those skilled in the art and can be achieved by local homology algorithms such as Smith and Waterman, NeedleThe man and Wunsch homology alignment algorithm, the Pearson and Lipman similarity search method, and preferably by computerized implementation of these algorithms (e.g., GAP, BESTFIT, FASTA and TFASTA, as examplesWisconsin(obtained as part of Accelrys Inc., Burlington, MA). The "identity portion" of an aligned segment of a test sequence and a reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the segment of the reference sequence, i.e., the entire reference sequence or a smaller defined portion of the reference sequence. Percent sequence identity is expressed as the identity score multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof or to a longer polynucleotide sequence. For purposes of the present invention, "percent identity" can also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.

Preferably using a sequence analysis software package^TM(10 th edition; Genetics Computer Group, Inc., Madison, Wis.) the "Best Fit" or "Gap" program to determine the percent sequence identity. "Gap" utilizes the algorithms OF Needleman and Wunsch (Needleman and Wunsch, J. mol. biol. 48: 443-. "BestFit" uses the local homology algorithm of Smith and Waterman (Smith and Waterman, applied mathematical development (ADVANCES IN APPLIED MATHEMATICS),2: 482. sup. 489,1981, Smith et al, NUCLEIC acids research (NUCLEIC ACIDS RESEARCH)11: 2205. sup. 2220,1983) to perform optimal alignment of the optimal similarity segments between two sequences and to insert gaps to maximize the number of matches. The percent identity is most preferably determined using the "BestFit" program.

Useful methods of determining sequence identity are also disclosed in the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from National Center for Biotechnology Information (NCBI)20894 of national institutes of health and medicine (national medical library), bessel da, maryland; see BLAST handbook, Altschul et al, NCBI, NLM, NIH; altschul et al, J.M.Biol.BIOL 215: 403-; the 2.0 or higher version of the BLAST program allows for the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; (ii) a Also, for polynucleotide sequences, BLASTN can be used to determine sequence identity.

As used herein, the term "percent base sequence identity" refers to the following percentage of sequence identity: at least about 70% sequence identity, at least about 80% sequence identity, at least about 85% identity, at least about 90% sequence identity, or even greater sequence identity, such as about 98% or about 99% sequence identity. Thus, one embodiment of the invention is a polynucleotide molecule having at least about 70% sequence identity, at least about 80% sequence identity, at least about 85% identity, at least about 90% sequence identity, or even greater sequence identity (e.g., about 98% or about 99% sequence identity) to a polynucleotide sequence described herein. Polynucleotide molecules having an active gene of the invention are capable of directing the production of vanillin and have a substantial percentage of sequence identity to the polynucleotide sequences provided herein and are included within the scope of the invention.

Identity refers to the portion of amino acids that are identical between a pair of sequences after alignment of the sequences (which can be done using only sequence information or structural information or some other information, but is usually based only on sequence information), and similarity is the score assigned based on the alignment using some similarity matrix. The similarity index may be any of BLOSUM62, PAM250, or gon net, or any matrix used by those skilled in the art for protein sequence alignment.

Identity is the degree of correspondence between two subsequences (no gaps between sequences). Identity of 25% or higher means similarity of function, and 18 to 25% means similarity of structure or function. Please remember that two completely unrelated or random sequences (more than 100 residues) can have more than 20% identity. Similarity is the degree of similarity when two sequences are compared. Depending on the identity of the sequences.

Coding nucleic acid sequence

The present invention relates to nucleic acid sequences encoding a ligno-stilbene-alpha, beta-dioxygenase enzyme as described herein, which may be used to carry out the desired genetic engineering operations. The invention also relates to nucleic acids having a degree of "identity" to the sequences specifically disclosed herein. For example, aspects of the invention encompass nucleic acid sequences that are at least 60% identical to SEQ ID No.1, at least 65% identical to SEQ ID No.1, at least 70% identical to SEQ ID No.1, at least 75% identical to SEQ ID No.1, at least 80% identical to SEQ ID No.1, at least 85% identical to SEQ ID No.1, at least 90% identical to SEQ ID No.1, at least 95% identical to SEQ ID No.1, or at least 99% identical to SEQ ID No. 1. In some embodiments, the nucleic acid sequence encoding a lignstilbene-alpha, beta-dioxygenase enzyme suitable for use in the present invention may have the same nucleic acid sequence as SEQ ID No. 1.

The invention also relates to a nucleic acid sequence encoding a ligno-stilbene-alpha, beta-dioxygenase having an amino acid sequence which has at least 60% identity with SEQ ID No.2, at least 65% identity with SEQ ID No.2, at least 70% identity with SEQ ID No.2, at least 75% identity with SEQ ID No.2, at least 80% identity with SEQ ID No.2, at least 85% identity with SEQ ID No.2, at least 90% identity with SEQ ID No.2, at least 95% identity with SEQ ID No.2 or at least 99% identity with SEQ ID No. 2. In some embodiments, the ligno-stilbene- α, β -dioxygenase may have the same amino acid sequence as SEQ ID No. 2. In some embodiments, the invention may relate to nucleic acid sequences encoding functional equivalents of any of the aforementioned enzymes.

Constructs according to the invention

In some aspects, the invention relates to constructs, such as expression vectors, for expression of a ligno-stilbene-alpha, beta-dioxygenase.

In one embodiment, the expression vector comprises those genetic elements for expressing a recombinant polypeptide described herein (i.e., FfLSD) in various host cells. The elements used for transcription and translation in the host cell may comprise a promoter, a coding region for a protein complex, and a transcription terminator.

One of ordinary skill in the art will appreciate the molecular biology techniques that can be used to prepare expression vectors. As noted above, polynucleotides for incorporation into expression vectors of the present technology can be prepared by conventional techniques such as Polymerase Chain Reaction (PCR). In molecular cloning, a vector is a DNA molecule that serves as a vehicle (vehicle) for the artificial carrying of foreign genetic material into another cell, which can be replicated and/or expressed (e.g., plasmid, cosmid, lambda phage). Vectors containing foreign DNA are considered recombinant DNA. The four major types of vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. Among the most commonly used vectors are plasmids. Common to all engineered vectors are an origin of replication, a multiple cloning site, and a selectable marker.

Many molecular biology techniques have been developed to operably link DNA to vectors via complementary cohesive termini. In one embodiment, complementary homopolymer tracts may be added to the nucleic acid molecule for insertion into the vector DNA. The vector and nucleic acid molecule are then bound by hydrogen bonding between the complementary homopolymer tails to form a recombinant DNA molecule.

In alternative embodiments, synthetic linkers containing one or more restriction sites are used to operably link the polynucleotides of the present technology to an expression vector. In embodiments, the polynucleotide is produced by restriction endonuclease digestion. In embodiments, the nucleic acid molecule is treated with bacteriophage T4 DNA polymerase or escherichia coli DNA polymerase I, which removes the protruding 3 '-single stranded ends with 3' -5 '-exonucleolytic activity and fills the recessed 3' -ends with polymerization activity, thereby generating blunt-ended DNA segments. The blunt-ended segment is then incubated with a large molar excess of linker molecules in the presence of an enzyme capable of catalyzing ligation of blunt-ended DNA molecules, such as bacteriophage T4 DNA ligase. Thus, the reaction product is a polynucleotide with a polymer linker sequence at its end. These polynucleotides are then cleaved with appropriate restriction enzymes and ligated into an expression vector that has been cleaved with an enzyme that produces ends compatible with the ends of the polynucleotides.

Alternatively, a vector having a Ligation Independent Cloning (LIC) site can be used. The desired PCR amplified polynucleotide can then be cloned into the LIC vector without the need for restriction digestion or ligation (Aslanidis and de Jong, nucleic acids Res. 186069-74, (1990), Haun et al, Biotechnology (BIOTECHNIQUES)13,515-18(1992), each of which is incorporated herein by reference).

In one embodiment, in order to isolate and/or modify the polynucleotide of interest for insertion into the selected plasmid, PCR is suitably used. Appropriate primers for PCR preparation of the sequences can be designed to isolate the desired coding region of the nucleic acid molecule, add restriction endonuclease or LIC sites, and place the coding region in the desired reading frame.

In embodiments, polynucleotides for expression vectors incorporating the present technology are prepared using PCR-appropriate oligonucleotide primers. The coding region is amplified, and the primer itself is incorporated into the amplified sequence product. In embodiments, the amplification primers contain restriction endonuclease recognition sites that allow for cloning of the amplified sequence product into an appropriate vector.

The expression vector may be introduced into a plant or microbial host cell by conventional transformation or transfection techniques. Transformation of appropriate cells with the expression vectors of the present technology is accomplished by methods known in the art and generally depends on the type of vector and cell. Suitable techniques include calcium phosphate or calcium chloride co-precipitation, DEAE-dextran mediated transfection, lipofection, chemical perforation or electroporation.

Successfully transformed cells, i.e., those containing an expression vector, can be identified by techniques well known in the art. For example, cells transfected with an expression vector of the present technology can be cultured to produce a polypeptide described herein. Cells can be examined for the presence of expression vector DNA by techniques well known in the art.

The host cell may contain a single copy of the expression vector described previously, or may contain multiple copies of the expression vector.

In some embodiments, the transformed cell is a plant cell, an algal cell, a fungal cell other than anthrax, or a yeast cell. In some embodiments, the cell is selected from the group consisting of: a canola plant cell, a rapeseed plant cell, a palm plant cell, a sunflower plant cell, a cotton plant cell, a maize plant cell, a peanut plant cell, a flax plant cell, a sesame plant cell, a soybean plant cell, and a petunia plant cell.

Microbial host cell expression systems and expression vectors containing regulatory sequences that direct high levels of expression of foreign proteins are well known to those skilled in the art. Any of these can be used to construct vectors for expressing recombinant polypeptides of the present technology in microbial host cells. These vectors can then be introduced into appropriate microorganisms by transformation to allow for high level expression of the recombinant polypeptides of the present technology.

Vectors or gene cassettes that can be used to transform suitable microbial host cells are well known in the art. Typically, the vector or gene cassette contains sequences that direct transcription and translation of the relevant polynucleotide, a selectable marker, and sequences that allow for autonomous replication or chromosomal integration. Suitable vectors comprise a 5 'region of the polynucleotide having transcriptional initiation control and a 3' region of the DNA fragment which controls transcriptional termination. Preferably, both control regions are derived from genes homologous to the transformed host cell, although it will be understood that such control regions need not be derived from the native gene of the particular species chosen as the host.

Termination control regions may also be derived from various genes native to the microbial host. For the microbial hosts described herein, a termination site may optionally be included.

Preferred host cells include those known to have the ability to produce vanillin from isoeugenol. For example, preferred host cells may comprise bacteria of the genera Escherichia and Pseudomonas.

Fermentative production of vanillin

Isoeugenol is metabolized to vanillin via the epoxide-diol pathway involving the oxidation of the propenylbenzene side chain (fig. 1). The inventors have surprisingly found that a putative lignstilbene-alpha, beta-dioxygenase from the fungus Fusarium fujikuroi (FfLSD) shows surprisingly high activity in the bioconversion of isoeugenol to vanillin compared to the previously reported bacteria IEM and LSD. More specifically, the inventors were able to achieve vanillin production at titers above 14g/L with conversion rates above 90% by engineering a host strain with the FfLSD gene and growing the engineered host strain in a mixture comprising isoeugenol. High titers and high conversion rates were obtained without the use of other crude enzymes and/or subfactors.

The cultivation of the host cells can be carried out in aqueous medium in the presence of common nutrients. For example, a suitable medium may contain a carbon source, an organic or inorganic nitrogen source, inorganic salts and growth factors. For the culture medium, glucose may be a preferred carbon source. Yeast extract can be a useful nitrogen source. Phosphates, growth factors and trace elements may be added.

The culture broth may be prepared and sterilized in a bioreactor. The engineered host strain according to the invention can then be inoculated into a culture broth to start the growth phase. A suitable duration of the growth phase may be about 5 to 40 hours, preferably about 10 to 35 hours, and most preferably about 10 to 20 hours.

After the growth phase is completed, the pH of the fermentation broth may be shifted to a pH of 8.0 or higher, and the substrate isoeugenol may be added to the culture. Suitable substrate additions are from 0.1 to 40g/L fermentation broth, preferably from about 0.3 to 30 g/L. The substrate may be added as a solid material or in the form of an aqueous solution or suspension. The total amount of substrate can be added in one step, in two or more addition steps or in a continuous manner.

The bioconversion period begins with substrate addition and lasts about 5 to 50 hours, preferably 10 to 40 hours, most preferably 15 to 30 hours, i.e., until all substrate is converted to product and by-product.

After the end of the bioconversion period, the biomass can be separated from the fermentation broth by any well-known method (e.g., centrifugation or membrane filtration, etc.) to obtain a cell-free fermentation broth.

The extractant phase may be added to the fermentation broth using, for example, a water immiscible organic solvent, vegetable oil or any solid extractant, such as a resin, preferably a neutral resin. The fermentation broth may be further sterilized or pasteurized. In some embodiments, the fermentation broth may be concentrated. Vanillin can be selectively extracted from the fermentation broth using, for example, a continuous liquid-liquid extraction process or a batch extraction process.

The advantages of the present invention include, inter alia, the ability to carry out the growth phase and the subsequent biotransformation phase in the same medium. This highly simplifies the production process, making the process efficient and economical, so that it is possible to scale up to industrial production levels.

One skilled in the art will recognize that the vanillin composition produced by the methods described herein can be further purified and mixed with aroma and/or flavoring consumables as well as dietary supplements, pharmaceutical compositions, cosmeceuticals, as described above, for use in nutritional as well as pharmaceutical products.

The present disclosure will be more fully understood in view of the following non-limiting examples. It should be understood that these examples, while indicating preferred embodiments of the present technology, are given by way of illustration only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of this technology, and without departing from the spirit and scope thereof, can make various changes and modifications of the technology to adapt it to various usages and conditions.

Examples

Bacterial strains, plasmids and culture conditions。

Coli strains of DH5a and BL21(DE3) were purchased from Invitrogen. Escherichia coli strain W3110 was obtained from the E.coli genetic resource center of Yale university (http:// cgsc2.biology. yale. edu /). Plasmid pET28a was purchased from EMD Millipore (Billerica, Mass.). Plasmid pUVAP was constructed by the inventors using SEQ ID No.3 and based on the map shown in FIG. 2, for gene cloning and gene expression purposes.

And (3) DNA operation.

All DNA manipulations were performed according to standard procedures. Restriction enzymes, T4 DNA ligase, were purchased from New England Biolabs (New England Biolabs). All PCR reactions were performed according to the manufacturer's instructions using the Phusion PCR system of the new england biological laboratory.

Example 1: identification of target genes

Putative genes with a complete ORF (open reading frame) of 1569bp and NCBI reference sequence of XM _023575505.1 were identified from the genome of fusarium lutescens. The deduced protein, FFUJ-11801, is annotated as woody stilbene alpha, beta-dioxygenase (veemann (Wiemann) et al 2013). The ORF encodes a protein of 522 amino acids (SEQ ID NO:2), has a theoretical molecular weight of 59kDa and a calculated isoelectric point (pI) of 6.26. The corresponding nucleotides were synthesized by GeneUniversal Inc. (New Wake, N.J.) after codon optimization for expression in E.coli (SEQ ID NO: 1).

Bioinformatic analysis showed that the FfLSD showed lower identity to previously reported LSD from pseudomonas. In particular, bioinformatic analysis showed that the FfLSD had only 35% identity with the LSD from Pseudomonas paucimohilis (TMYI 009). With respect to isoeugenol monooxygenase (IEM), FfLSD showed only 36% identity with PnIEM, an IEM from Pseudomonas nitroreducens.

Example 2: construction of plasmids

The Open Reading Frame (ORF) of FfLSD was cloned into Nde I/Xho I restriction sites of pET28a to make the recombinant protein have a 6XHis tag at the N-terminus for ease of extraction and purification. The ORF of FfLSD was amplified with a pair of primers in Table 1, F FfLSD-NdeI-F and FfLSD-Xho I-R1, by introducing an Nde I restriction site at the 5 'end and an Xho I site at the 3' end. After digestion with Nde I and Xho I, the PCR fragment was ligated to Nde I and Xho I restriction sites of expression vector pET28a and transformed into DH5 α competent cells to generate the FfLSD-pET28 plasmid (fig. 3). After confirmation of the sequencing, the plasmid was ready for transformation into E.coli strain BL21(DE 3).

To produce the e.coli strain for bioconversion of isoeugenol to vanillin in a fermentor, the open reading frame of FfLSD was cloned into the Nde I/Not I site of the pvuap vector (fig. 2) to generate the FfLSD-pvuap expression vector (fig. 4) using the same procedure described above, except that the primers used were FfLSD-Nde-F and FfLSD-NotI-R2. The expressed FfLSD with this construct had no His tag.

TABLE 1 primers for construction of FfLSD expression vectors

Example 3: coli cells were transformed with the constructs developed.

The construct of FfLSD-pET28a was introduced into E.coli BL21(DE3) cells using standard chemical transformation protocols to produce strain FfLSD-BL 21. Strain FfLSD-BL21 was used to express recombinant proteins for functional characterization.

The FfLSD-pUVAP plasmid was introduced into E.coli W3110 competent cells using standard chemical transformation protocols to generate the FfLSD-W3110 strain, and similarly, the control FfLSD-W-control strain was developed using the pUVAP plasmid. Strains FfLSD-W3110 and FfLSD-W-control were used for whole-cell bioconversion of isoeugenol to vanillin.

Example 4: heterologous expression of FfLSD in E.coli and purification of recombinant proteins

A single colony of E.coli strain FfLSD-BL21 was grown overnight at 37 ℃ in 5mL of LB medium with 100mg/L kanamycin (kanamycin). This strain culture was transferred to 200mL LB medium with 100mg/L ampicillin (ampicillin). Cells were grown at 37 ℃ at 250rpm to an OD600 of 0.6 to 0.8, then isopropyl beta-D-1-thiogalactoside (IPTG) was added to a final concentration of 0.5mM and the growth temperature was changed to 16 ℃. After 16 hours of IPTG induction, E.coli cells were harvested by centrifugation at 4000g for 15min at 4 ℃. The resulting pellet was resuspended in 5mL of 100mM Tris-HCl, pH 7.4, 100mM NaOH, 10% glycerol (v/v) and sonicated on ice for 2 min. The mixture was centrifuged at 4000g for 20min at 4 ℃. The recombinant protein in the supernatant was purified using His60 Ni Superflow resin from Clonetech inc. The purification of the recombinant protein was checked by SDS-PAGE (FIG. 5).

Example 5: in vitro enzyme assay

The activity of FfLSD was determined by two substrates, 4 '-dihydroxy-3, 3' -dimethoxystilbene and isoeugenol, respectively. To measure the activity on 4,4 '-dihydroxy-3, 3' -dimethoxystilbene, the activity was determined in 2.5ml of 50mM Tris-HCI buffer (pH 8.5) containing the appropriate amount of enzyme solution at 30 ℃. The enzymatic reaction was started by adding substrate dissolved in 10. mu. L N, N-Dimethylformamide (DMF) to a final concentration of 200. mu.M. The reaction product vanillin was detected by HPLC analysis.

The purified protein showed no activity on 4,4 '-dihydroxy-3, 3' -dimethoxystilbene. When incubated with 4,4 '-dihydroxy-3, 3' -dimethoxystilbene, no vanillin production was observed by HPLC analysis.

The activity was also measured with isoeugenol by measuring the formation of vanillin. The reaction mixture contained 10mM isoeugenol, 100mM potassium phosphate buffer (pH 7.0), 10% (v/v) ethanol and an appropriate amount of enzyme, in a total volume of 1 ml. The reaction was started by adding isoeugenol as an ethanol solution, oscillating (160 times per minute) at 30 ℃ for 10min and stopping with 1ml of methanol. After 21,500 centrifugation, the supernatant was analyzed by HPLC to determine isoeugenol, vanillin, vanillyl alcohol. The FfLSD enzyme treated in boiling water for 5 minutes was used as a negative control.

Figure 6 shows HPLC chromatograms obtained from the supernatant of the experiment using purified FfLSD (upper panel) and a negative control (lower panel). As shown, purified FfLSD showed high activity on isoeugenol. Almost all of the isoeugenol added to the reaction mixture was converted to vanillin (upper panel). As expected, the negative control (lower panel) produced no vanillin.

Example 6: in vivo bioconversion of Isoeugenol to Vanillin Using Shake flasks

FfLSD-W3110 and FfLSD-W-control E.coli W3110 strain was grown as a seed culture overnight at 37 ℃ in LB medium with 3ml of LB containing 50. mu.g/L ampicillin, respectively. 0.2mL of the seed culture was inoculated into 20mL M9 medium containing 5g/L yeast extract and 50. mu.g/L ampicillin in 125mL shake flasks. Cells were grown for 6 hours at 30 ℃ in a shaker at 250rpm, and 400. mu.l of 20% isoeugenol (v/v in dimethyl sulfoxide (DMSO)) was added to the flask. After the first addition for 12 hours and 24 hours, 200. mu.l of 20% isoeugenol (v/v in DMSO) were added twice more to the culture. 100. mu.l of the culture mixture were taken out of the flask at the indicated time intervals, respectively, and mixed well with 900. mu.l of methanol by vortexing, followed by centrifugation at 20,000g for 15 min. The resulting 50 μ L supernatant was placed in an HPLC sample vial for HPLC analysis. Experiments were performed in triplicate.

FIG. 7 compares the vanillin production of E.coli strain FfLSD-W3110 with the E.coli strain FfLSD-W-control. As shown in fig. 7, the strain with FfLSD converted isoeugenol to vanillin in the culture medium, whereas the control strain produced no vanillin.

Example 7: bioconversion of Isoeugenol to Vanillin in a fermenter

A fermentation process was developed to produce natural vanillin using the strain FfLSD-W3110 in a fermentor with natural isoeugenol as substrate. Specifically, 1mL of FfLSD-W3110 glycerol stock was inoculated into 100mL of seed culture medium (Luria-Bertani medium containing 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl and 50mg/L ampicillin) in a 500mL flask. The strain was incubated for 8 hours at 37 ℃ in a shaker at 200rpm and then transferred to 3 liters of fermentation medium in a 5 liter fermentor with Luria-Bertani medium plus 10g/L initial glucose, 50mg/L ampicillin.

The 5L vanillin fermentation tank process has two stages: a cell growth phase and a biotransformation phase. The cell growth phase is from 0 hours through fermentation time (EFT) to about EFT 16.5 hours. The fermentation parameters were set as follows: air flow rate: 0.6 vvm; the pH was controlled to not less than 7.1 by using 4N NaOH. The growth temperature was set to 30 ℃ and the stirring speed was set to 300 to 500 rpm. Dissolved Oxygen (DO) was stirred in cascade to maintain above 30%. The growth time is about 16 to 17 hours.

The bioconversion stage is from 16.5 hours to 46.5 hours EFT. The fermentation parameters were set as follows: air flow rate: 0.4 vvm. The pH was controlled to not less than 8.0 with 4N NaOH and the temperature was 30 ℃. The stirring speed was set to 250 to 500rpm and the DO was maintained above 30% by cascade stirring. Isoeugenol was added at a feed rate of 0.6g/L at EFT 16.5 hours, then the rate was reduced to 0.4g/L at EFT 27.5 hours until EFT 44 hours and the fermentation stage was completed at EFT 46-47 hours.

The culture mixture was removed from the fermentor at the indicated time intervals. HPLC analysis of isoeugenol, vanillin and vanillyl alcohol was performed using the Vanqish Ultimate 3000 system. The intermediate was separated by reverse phase chromatography on a Dionex Acclaim 120C 18 column (particle size 3 μm; 150X 2.1mm) with a gradient of 0.2% (v/v) trifluoroacetic acid (eluent A) and acetonitrile, containing 0.2% (v/v) of eluent B in the range of 10 to 40% (v/v) (eluent B) at a flow rate of 0.6 ml/min. For quantification, all intermediates were calibrated using external standards. The compounds are identified by their retention times and the corresponding spectra, which are identified using a diode array detector in the system.

Fig. 8 shows the amount of vanillin produced relative to the remaining amount of isoeugenol and the amount of vanillyl alcohol produced during the bioconversion stage from EFT 16.5 hours to 46.5 hours. As shown in FIG. 8, the vanillin production titer reaches above 14g/L, and the conversion rate of isoeugenol is above 90%.

It will be apparent from the foregoing description that certain aspects of the present disclosure are not limited by the specific details of the examples provided herein, and it is therefore contemplated that other modifications and applications, or equivalents thereof, will occur to those skilled in the art. It is therefore intended that the claims shall cover all such modifications and applications that do not depart from the spirit and scope of the present disclosure.

Furthermore, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described above.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced. Accordingly, the specification and examples should not be construed as limiting the scope of the invention, which is defined by the appended claims.

Sequence of interest

SEQ ID NO. 1: FfLSD nucleic acid sequence

ATGAGCGCACCGGAAGAACATCATGGTCTGAAAAGCAAATGGCCTCAGGCATTTGATCTGGCAGGTAGCAATAGCCCGTGTCGTATTGAAGGTGAAATTGGTGATCTGGTTGTTCTGGGTGAAATTCCGCCTGCAATTGATGGCACCTTTTATCGTGTTATGTGTGATCCGTTTGTTCCGCCTCATCCGGATAATGTTCCGCTGGATGGTGATGGTCATGTTAGCGCATTTCGTATCTATAATGGTCGCGTGGACATGAAAATCAAATATGTTGAAACCGAGCGCTACAAACTGGAACGTAAAGCAGGTAAAGCACTGTTTGGTCTGTATCGTAATCCGTTTACACATCATCCGTGTGTTCGTGCAGCAGTTGATAGCACCGCAAATACCAATATGGTTTATTGGGCAGATCGTCTGCTGGCACTGAAAGAAAGCGCACTGCCGTATGAAATGCATCCTGATACACTGGAAACCCTGTGTTATGATCCTTTTGGTGGTCAGGTTAAAGCAAAAGCATTTACCGCACATCCGAAAATCGATCCGTTTAGTGATGAACTGGTTGTGTATGGTTATGAAGCAAAAGGTCTGGCAACCCGTGATATTGTGATTTATAGCCTGGATAAAAACGGCATCAAACACGATGAACAGTGGATTGAAAGCCCGTGGTGTGCACCGATTCATGATTGTGTTATTACCCCGAACTTTATCGTTCTGATTCTGTGGCCGTTTGAAGCAAGCGTTGAACGTATGAAAGCCGGTAAACAGCATTGGGCATGGGATTATAGTCTGCCTGCAACCTTTATTGTTGTTCCGCGTCGTAAAACCAGCAAAATTCCGGCAAGCTGGAAACAGGGTGAACATCGTGTGTATCATTGGAAAAACTGCATGAACATTCATGCCGGTAGCGCATGGGAAGAAGATAACGGTAAACTGTATCTGGAAACCAGCCGTGTTCATGATAATGCCTTTCCGTTTTTTCCTCCGGTTGATGGTCGTATGCCTGCACCGGATGCAAAAGCAGATTTTGTTCGTTGGGAAATTGATCTGAATGCACCGAGCGGCACCCAGATGGCAGATCCGGAAGTTATTCTGGATGTTCCGAGCGAATTTCCGCGTATTGATGAACGTTTTATGACCAAACGTAACGAGTACCTGTTTCTGAATGTGTTTATTCCGGAAACCAGTCAAGGTGGCACCAACATTTTTCATGGCCTGAATGGTCTGGCCATGCATAATCATAGCACCGGTGAAACCAAATGGTTTTTTGCCGGTAAAGATAGCCTGGTTCAAGAACCGATCTTTATTCCGCGTACCGCAGATGCTCCGGAAGGTGATGGTTGGGTTATTGCAATGCTGGAACGTCGTGTTGCAAATCGTAGCGAACTGGTGGTTCTGGATACCCGTGAATTTGAAAAACCGGTTGCATTTATTCAGCTGCCGATGCATCTGAAAGCACAGGTTCATGGTAATTGGATTGATAGTCGTACCCGTGCAAGCACCGAAGCAATTGTTCGTCAGATTGGTGAAGTTAAAGTTAGCGCACGTGGTGCACTGGAACCGCTGGCATAA

Amino acid sequence of SEQ ID NO.2FfLSD

MSAPEEHHGLKSKWPQAFDLAGSNSPCRIEGEIGDLVVLGEIPPAIDGTFYRVMCDPFVPPHPDNVPLDGDGHVSAFRIYNGRVDMKIKYVETERYKLERKAGKALFGLYRNPFTHHPCVRAAVDSTANTNMVYWADRLLALKESALPYEMHPDTLETLCYDPFGGQVKAKAFTAHPKIDPFSDELVVYGYEAKGLATRDIVIYSLDKNGIKHDEQWIESPWCAPIHDCVITPNFIVLILWPFEASVERMKAGKQHWAWDYSLPATFIVVPRRKTSKIPASWKQGEHRVYHWKNCMNIHAGSAWEEDNGKLYLETSRVHDNAFPFFPPVDGRMPAPDAKADFVRWEIDLNAPSGTQMADPEVILDVPSEFPRIDERFMTKRNEYLFLNVFIPETSQGGTNIFHGLNGLAMHNHSTGETKWFFAGKDSLVQEPIFIPRTADAPEGDGWVIAMLERRVANRSELVVLDTREFEKPVAFIQLPMHLKAQVHGNWIDSRTRASTEAIVRQIGEVKVSARGALEPLA

Nucleic acid sequence of plasmid pUVAP of SEQ ID NO.3

GGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCATCGTTTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCAACTATAAGAAGGAGATATACATATGGCGGATCCGAATTCGGCGCGCCAGATCTCAATTGGATATCGGCCGGCCGACGTCGGTACCGCGGCCGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGGTAACGAATTCAAGCTTGATATCATTCAGGACGAGCCTCAGACTCCAGCGTAACTGGACTGCAATCAACTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCATTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGCTATGGAGGTCAGGTATGATTTAAATGGTCAGTATTGAGCGATATCTAGAGAATTCGTC