阅读说明：本技术 寄生虫疫苗 (Parasite vaccine ) 是由 C·托恩金 A·优博尔蒂 M·麦肯维勒 M·布鲁梅 于 2019-05-10 设计创作，主要内容包括：本公开内容提供了突变的寄生虫,特别是包含刚地弓形虫(在本文中称为“弓形虫”)的海藻糖-6-磷酸合酶/6-磷酸磷酸酶(TPS/TPP)样基因或其同源物的突变的原生动物寄生虫,以及包含其的疫苗。(The present disclosure provides mutant parasites, in particular mutant protozoan parasites comprising a trehalose-6-phosphate synthase/6-phosphate phosphatase (TPS/TPP) -like gene of toxoplasma gondii (referred to herein as "toxoplasma"), or homologues thereof, and vaccines comprising the same.)

1. An isolated mutant protozoan parasite, wherein the mutant is attenuated when grown or cultured in a medium comprising glucose but not when grown or cultured in a medium without glucose.

2. The mutant according to claim 1, wherein the attenuation is due to uncontrolled accumulation of amyloid amylopectin depot when grown in a glucose-containing medium.

3. The parasite according to claim 1 or 2, wherein the mutant parasite comprises an inactivating mutation (Δ TPS/TPP) of a trehalose-6-phosphate synthase/6-phosphate phosphatase (TPS/TPP) like gene of toxoplasma or a homologue thereof.

4. A mutant parasite according to any one of claims 1 to 4 wherein the inactivating mutation is caused by a targeted or non-targeted disruption of the Toxoplasma gondii's native TPS/TPP-like gene.

5. A mutant parasite according to any one of claims 1 to 4 wherein the disruption occurs in coding and/or non-coding sequences of the TPS/TPP-like gene and/or regulatory sequences controlling gene transcription of the TPS/TPP-like gene.

6. A mutant parasite according to any one of claims 3 to 5 wherein the inactivating mutation is a frameshift mutation in the coding sequence of the TPS/TPP-like gene.

7. A mutant parasite according to claim 4 wherein the targeted disruption of the TPS/TPP-like gene comprises an insertion of one or more contiguous heterologous nucleotides or a deletion of one or more contiguous nucleotides in the native TPS/TPP-like gene sequence.

8. A mutant parasite according to any one of the preceding claims wherein the native TPS/TPP-like gene comprises the amino acid sequence of SEQ ID NO: 1 or consists thereof.

9. Mutant according to any of claims 1-8, wherein the parasite is Toxoplasma gondii.

10. Mutant according to any of the preceding claims, wherein the parasite comprises one or more additional gene activations, inactivations or disruptions in combination with an inactivated or disrupted TPS/TPP-like gene, wherein starch accumulation is increased relative to a wild type non-mutated parasite.

11. The mutant according to claim 10, further comprising inactivation of the CDPK2 gene of Toxoplasma gondii.

12. The mutant according to claim 10, further comprising a C-terminally modified hexokinase (HxK) gene.

13. A mutant according to any one of claims 1-9 or 12, wherein the mutant is selected from one of the following:

(i) toxoplasma gondii (Toxoplasma gondii) mutant deposited with ATCC and designated PTA-125166;

(ii) the Toxoplasma gondii mutant deposited by ATCC and designated PTA-125164; and

(iii) toxoplasma gondii mutants deposited by the ATCC and designated PTA-125-165.

14. A vaccine comprising an isolated mutant protozoan parasite, wherein the mutant is attenuated when grown or cultured in a medium comprising glucose but not when grown or cultured in a medium without glucose.

15. Vaccine comprising a Δ TPS/TPP mutant protozoan parasite.

16. A vaccine according to claim 14 or 15 comprising a mutant according to any one of claims 1-13.

17. The vaccine according to claim 14, wherein said attenuation is due to uncontrolled accumulation of amyloid amylopectin depot in the parasite when grown in glucose-containing medium.

18. Vaccine according to any one of claims 14-17, wherein said parasite comprises an inactivating mutation of a trehalose-6-phosphate synthase/6-phosphate phosphatase (TPS/TPP) -like gene of toxoplasma gondii or a homologue thereof.

19. A vaccine according to any one of claims 14 to 18, which comprises a pharmaceutically acceptable carrier or excipient.

20. Vaccine according to any one of claims 14-19, wherein oocyst shedding is substantially reduced or prevented in a human or non-human animal vaccinated with said vaccine.

21. A method of immunizing an animal against a parasite comprising administering to said animal a mutant parasite according to any one of claims 1-13 or a vaccine according to any one of claims 14-20.

22. A method for immunizing an animal against a parasitic infection or condition without concomitant oocyst shedding comprising administering to the animal a mutant parasite according to any one of claims 1 to 13 or a vaccine according to any one of claims 14 to 20.

23. A method for immunizing an animal against toxoplasmosis without concomitant oocyst shedding comprising administering to the animal a mutant toxoplasma parasite according to any one of claims 1 to 13 or a vaccine according to any one of claims 14 to 20.

24. The vaccine according to any one of claims 13 to 20 or the method according to any one of claims 21 to 23, wherein the vaccine comprises a mutant toxoplasma tachyzoite, bradyzoite or oocysts.

25. Use of a mutant parasite according to any one of claims 1-13 or a vaccine according to any one of claims 14-20 in the manufacture of a medicament for vaccinating an animal.

26. Use of a mutant toxoplasma parasite according to any one of claims 1 to 13 or a vaccine according to any one of claims 14 to 20 in the manufacture of a medicament for vaccinating an animal against toxoplasmosis.

27. A method of preventing toxoplasmosis in an animal, the method comprising administering to the animal a mutant toxoplasma parasite according to any one of claims 1 to 13 or a vaccine according to any one of claims 14 to 20.

Technical Field

The present disclosure provides mutant parasites, in particular protozoan parasites, comprising a mutation in the trehalose-6-phosphate synthase/6-phosphate phosphatase (TPS/TPP) -like gene of Toxoplasma gondii (referred to herein as "Toxoplasma gondii"), or a homologue thereof, and vaccines comprising the same.

Background

The phylum Apicomplexa (phyllum Apicomplexa) contains a group of obligate intracellular parasites that cause a range of diseases by active invasion and replication within the host cell. Like all intracellular pathogens, these parasites broadly modify their host cells to prevent immune clearance while allowing access to nutrients for growth.

Toxoplasma gondii (Toxoplasma gondii) is one of the most common human pathogens, infecting 10-80% of the population (Fischer HG et al (1997) Eur J Immunol.27: 1539-48;). In humans, the risk lies in unborn human infants and immunocompromised individuals. The pregnant woman may have infected and unknowingly infected the fetus. Even if diagnosed and treated, children may naturally suffer permanent brain and eye damage. Diagnosis during pregnancy is at best uncertain and treatment is uncertain and risky. Therefore, efforts to prevent infection during pregnancy are important.

Toxoplasma is the cause of toxoplasmosis, an obligate intracellular protozoan parasite. In addition to infecting humans, it can infect virtually all warm-blooded animals. It has been found worldwide that nearly one third of humans have been exposed to this parasite. Toxoplasma is transmitted by ingestion of sporulated oocysts present in soil, water or vegetables contaminated with cat manure, or by ingestion of raw or uncooked meat with tissue cysts.

In farm animals, species such as sheep and goats, congenital infections are common and can lead to abortion and neonatal death (Buxton (1998) Vet Res 29: 289-310). Animals raised to produce meat for human consumption may be constantly infected by Toxoplasma gondii, which is contained in the tissue cysts of muscles and internal organs and may be an important source of infection for humans.

Cats are animals of great importance in toxoplasma life cycle and disease epidemiology. Kittens are often infected with Toxoplasma gondii when first hunting and eating wild rodents and birds. After the initial infection, cats will shed millions of oocysts in their feces, which, depending on the climatic conditions, can survive in the environment for 12-18 months, an important source of infection for grazing animals (Tenter et al (2000) Int J Parasitol 30: 1217-.

It is known in the art that animals can be vaccinated against toxoplasmosis. However, vaccines have not been completely successful to date, or have drawbacks. For example, oocyst shedding often occurs after initial infection of cats (an important carrier for Toxoplasma) before immunity is established. This phenomenon greatly undermines the goal of immunization because infectious oocysts in cat feces are the primary vehicle for the disease. Furthermore, all known strains of organisms used for primary infection of mammals, although effective for establishing immunity, tend to persist in the mammal for a long period of time, possibly for a lifetime, with the result that the mammal is chronically infected. This in turn increases the likelihood that if such mammals are immunosuppressed later in life, the infection may reactivate, leading to debilitating or even fatal consequences, and furthermore, it is uncertain whether meat and internal organs intended for human consumption will be infected by the strain.

Currently, only one commercial vaccine "Toxovax" (Intervet) based on the live attenuated strain S48 of Toxoplasma gondii is licensed for use in preventing congenital infections in ewes (Buxton D (1993) Parasitol Today 9: 335-. However, such vaccines are expensive, cause adverse reactions, and have a short shelf life (as administration within 3 weeks after production is typically required). In addition, since attenuation of a vaccine is produced by repeated serial passages, its production is slow due to its slow growth. In addition, vaccines are genetically undefined and therefore the attenuation mechanism is unknown. Furthermore, studies have shown that the vaccine can revert to pathogenic strains and is therefore not suitable for human use (Zhang NZ et al (2013) Expert Rev. vaccines 12 (11): 1287-1299). The vaccine does not produce oocysts and therefore the immune system does not see the antigen at this stage of the life cycle. Another disadvantage of this vaccine is that it only partially protects the animal, which, although it leads to a reduction in cyst levels, does not disappear completely, since only about 60-70% of the ewes are protected against abortion (Zhang NZ et al (2013) Expert Rev. vaccines 12 (11): 1287-1299).

Thus, there is a need in the art for effective vaccines that provide adequate and consistent levels of immunity when vaccinated into animals, but do not persist and cause chronic infections in immunized animals by restoring virulence. Furthermore, there is a need in the art for vaccines that are genetically determined and can be safely used in non-human animals and humans.

Summary of The Invention

In the introduction to this disclosureIn the work of the disclosure, the inventors determined Ca²⁺The dependent protein kinase CDPK2 is a key regulator of amylopectin metabolism. Increased amylopectin synthesis and decreased degradation in CDPK 2-deficient parasites leads to excessive accumulation of this glycopolymer (Uboldi A et al (2015) Host Cell and Microbe 18: 670-.

The inventors have now identified a protein in Toxoplasma gondii which has homology to two enzymes of the trehalose biosynthetic pathway of bacteria, fungi and plants, namely trehalose-6-phosphate synthase (TPS) and trehalose/6-phosphate phosphatase (TPP). Notably, the TPS and TPP proteins and their functional trehalose biosynthetic pathways are not present in mammalian cells. The Toxoplasma gondii TPS/TPP-like gene comprises trehalose 6-phosphate synthase (TPS) -like and trehalose 6-phosphate phosphatase (TPP) -like domains arranged in tandem, and an N-terminal amylopectin-binding CBM20 domain, thereby enabling direct interaction with amylopectin. In particular, the inventors have found that this protein has a regulatory role in glucose/amylopectin metabolism in Toxoplasma gondii. However, in contrast to plant proteins, TPS/TPP-like proteins in parasites lack important substrate binding residues and neither T6P biosynthetic activity from the TPS domain nor trehalose production from the TPP domain was detected.

The present disclosure is based on the following findings: disruption of the TPS/TPP-like gene in a parasite containing the TPS/TPP-like gene or homologue thereof alters starch (e.g. amylopectin) metabolism in the parasite. More particularly, the inventors found that disruption of the TPS/TPP-like gene results in greater attenuation of the toxoplasma parasite compared to disruption of the CDPK2 gene. Furthermore, TPS/TPP-like gene mutants are unable to form cysts.

The vaccines of the present invention offer a number of advantages over prior art vaccines such as Toxovax. These advantages include:

(i) they are genetically determined;

(ii) they have a known attenuation mechanism; and

(iii) they produce cysts (bradyzoites) that do not persist in the host, thereby allowing an immune response to be initiated. However, since cysts do not persist in the host, the risk of transmission to humans is very low or even non-existent.

Attenuation of the mutant TPS/TPP parasites described herein can be achieved by altering the parasite's growth medium to contain glucose. In the glucose-free medium, the parasites grew normally. However, in the presence of glucose-containing medium, parasites comprising a TPS/TPP-like protein disruption will accumulate a lot of amylopectin in the cytoplasm, which proceeds uncontrollably. For the type II mutant Toxoplasma gondii parasite, the continued uncontrolled progression of amylopectin accumulation can lead to death. Such mutants comprising an inactivating mutation in the TPS/TPP-like gene are referred to as Δ TPS/TPP mutants in the description and in the examples. The inventors herein show that when Δ tps/tpp parasites are administered to mice, they become completely attenuated in vivo.

Thus, vaccines comprising the Δ tps/tpp parasite are particularly useful. Because parasites are attenuated and eventually die once introduced into a host, they cannot recover virulence in the immunized host and cannot form a durable tissue cyst in the immunized host. These properties make vaccines attractive for human and animal use.

In addition, vaccines comprising the Δ tps/tpp parasite are particularly useful for immunization of cats, as oocyst production is dependent on normal starch metabolism and thus it is possible to prevent shedding of oocysts.

In a first aspect, the present disclosure provides an isolated mutant parasite, wherein the mutant is attenuated when grown in a glucose-containing medium, but not in a glucose-free (i.e., glutamine-containing) medium. As used herein, the term "isolated mutant parasite" is also intended to refer to a population of such mutant parasites. In a particular example, the mutant is live. In one example, the mutant parasite uncontrollably accumulates amyloid amylopectin deposits when grown in a glucose-containing medium. In another example, the parasite is a protozoan parasite. In a particular example, the parasite is toxoplasma gondii (t.

In one example, the parasite comprises an inactivating mutation of a trehalose-6-phosphate synthase/6-phosphate phosphatase (TPS/TPP) -like gene of Toxoplasma gondii or a homolog thereof. In one example, the mutant parasite is a Δ tps/tpp parasite. In one example, the mutant parasite is not a Δ CDPK2 mutant as described in Uboldi A et al, (2015) Cell Host & Microbe 18, 670-.

In one example, the TPS/TPP-like gene is TGGT1 — 297720 or a homologue thereof in toxoplasma gondii genomics resources (named "toxodb. In one example, the TPS/TPP-like gene comprises a sequence according to SEQ ID NO: 1 (fig. 1) or consists thereof. In one example, the sequence is the genomic sequence of the TPS/TPP-like gene. In one example, the sequence is a cDNA sequence of a TPS/TPP-like gene, e.g. as shown in SEQ ID NO: 3, respectively. The TPS/TPP-like gene also extends to homologues of the TPS/TPP-like gene of Toxoplasma gondii, which homologues are present in parasites, in particular protozoan parasites, more in particular coccidia parasites. In some examples, the homolog is homologous to SEQ ID NO: 1 or its N-terminal 200 nucleotides (SEQ ID NO: 2) comprises at least 80% identity.

The skilled artisan will appreciate, in light of the present disclosure, that a gene may be inactivated or mutated by a variety of different methods. In one example, the mutation results in inactivation of the TPS/TPP-like gene by targeted or non-targeted (i.e., random) disruption of the gene. Disruption may occur in coding or non-coding sequences of the TPS/TPP-like gene. In another example, the inactivation of the function of the TPS/TPP-like gene is caused by disruption of one or more regulatory sequences upstream of the TPS/TPP gene, thereby preventing transcription of the gene. In another example, the disruption is a frameshift mutation in the coding sequence of the TPS/TPP-like gene. In one example, the TPS-like domain or TPP-like domain is disrupted or inactivated (partially or fully). In another example, both the TPS-like domain and the TPP-like domain are disrupted or inactivated (partially or fully). In another example, the inactivation of the TPS/TPP-like gene is caused by gene knock-down or gene knock-out.

In certain examples, the targeted disruption of the TPS/TPP-like gene comprises an insertion or deletion of one or more contiguous nucleotides in the TPS/TPP-like gene. In other examples, the insertion or deletion causes a frame shift in the TPS/TPP-like gene sequence. In another example, the insertion or deletion results in the formation of a stop codon, thereby truncating translation of the resulting protein. Furthermore, inactivation of TPS/TPP-like genes may occur by removal of all genes (i.e.nonsense mutations).

In one example, the TPS/TPP-like gene is inactivated or disrupted such that uncontrolled accumulation of amylopectin occurs in the parasite when grown in glucose-containing medium.

In one example, the mutant parasite is present in a TPS/TPP-like gene, e.g. according to SEQ ID NO: 1 or SEQ ID NO: 3 comprises an insertion of one or more consecutive or non-consecutive heterologous nucleotides within the TPS/TPP-like gene sequence. In another example, the mutant parasite comprises a TPS/TPP-like gene sequence e.g. according to SEQ ID NO: 1 or SEQ ID NO: 3, or 3, of one or more contiguous or non-contiguous natural nucleotides within the TPS/TPP-like gene sequence.

For example, the mutant parasite may comprise an insertion of 1 to 1500 heterologous nucleotides within the TPS/TPP-like gene of toxoplasma or a homologue thereof. In another example, the mutant parasite comprises an insertion of 1 to 1000 heterologous nucleotides, 1 to 800 heterologous nucleotides, 1 to 750 heterologous nucleotides, 1 to 500 heterologous nucleotides, 1 to 250 heterologous nucleotides, 1 to 100 heterologous nucleotides, 1 to 50 heterologous nucleotides, 1 to 25 heterologous nucleotides, 1 to 20 heterologous nucleotides, 1 to 15 heterologous nucleotides, 1 to 10 heterologous nucleotides, or 1 to 5 heterologous nucleotides. The mutant parasite can comprise insertions of at least three, at least five, at least ten, at least twenty, at least forty, at least fifty, at least eighty, at least one hundred, and/or up to five hundred heterologous nucleotides. The inserted nucleotides may be contiguous or non-contiguous.

In certain examples, the mutant parasite comprises a deletion of a native nucleotide within the TPS/TPP-like gene sequence. In a further example, the mutant parasite comprises a deletion of 1 to 1000 consecutive nucleotides, 1 to 800 consecutive nucleotides, 1 to 750 consecutive nucleotides, 1 to 500 consecutive nucleotides, 1 to 250 consecutive nucleotides, 1 to 100 consecutive nucleotides, 1 to 50 consecutive nucleotides, 1 to 25 consecutive nucleotides, 1 to 20 consecutive nucleotides, 1 to 15 consecutive nucleotides, 1 to 10 consecutive nucleotides or 1 to 5 consecutive nucleotides within the native TPS/TPP-like gene sequence of toxoplasma or a homologue thereof. The mutant parasite can comprise deletions of at least three, at least five, at least ten, at least twenty, at least forty, at least fifty, at least eighty, at least one hundred, and/or up to five hundred natural nucleotides.

In another example, the deleted nucleotides are discontinuous.

In another example, TPS/TPP mutant parasites (Δ TPS/TPP parasites) accumulate amylopectin stores at a much faster rate than corresponding parasites containing wild type TPS/TPP.

The TPS/TPP-like gene may be disrupted at any position within the gene (e.g.at any nucleotide position within the TPS/TPP-like gene sequence). More specifically, the disruption may occur in SEQ ID NO: 1, SEQ ID NO: 2 (corresponding to the first 200 nucleotides from the N-terminus of SEQ ID NO: 1) or SEQ ID NO: 3 at any nucleotide position within the TPS/TPP-like gene sequence shown. In one example, disruption of the TPS/TPP-like gene can occur within a TPS-like domain. In one example, disruption of the TPS/TPP-like gene can occur within a TPP-like domain. In one example, disruption of the TPS/TPP-like gene may occur within the amylopectin binding domain, also known as carbohydrate-binding domain 20 (i.e., CBM 20).

In certain examples, the TPS/TPP-like gene or homologue thereof is encoded by SEQ ID NO: 1 or SEQ ID NO: 2 at positions 1 to 99 of the sequence is disrupted at a site within the first exon sequence defined by the nucleotide residues. In other examples, the TPS/TPP-like gene is in a sequence according to SEQ ID NO: 1 or a homologue thereof, within a second exon sequence, within a third exon sequence, within a fourth exon sequence, within a fifth exon sequence, within a sixth exon sequence, within a seventh exon sequence, within an eighth exon sequence, within a ninth exon sequence, within a tenth exon sequence, within an eleventh exon sequence, within a twelfth exon sequence, within a thirteenth exon sequence, within a fourteenth exon sequence, within a fifteenth exon sequence, within a sixteenth exon sequence, within a seventeenth exon sequence or within an eighteenth exon sequence.

It will be appreciated that any parasite, in particular a protozoan parasite, comprising the TPS/TPP-like gene of the present disclosure or homologue thereof may be mutated in accordance with the present disclosure. In one example, the parasite is a coccidia parasite. In another example, the parasite belongs to the phylum Apicomplexa. In other examples, the parasite is selected from the group consisting of Toxoplasma (Toxoplasma), Neospora (Neospora), Cryptosporidium (Cryptosporidium), or Eimeria (Eimeria) parasites. In another example, the parasite is Neospora caninum (Neospora caninum), toxoplasma gondii or Eimeria tenella (Eimeria tenella).

In one example, the TPS/TPP-like gene is encoded by a nucleotide sequence located in SEQ ID NO: 3, positions 1 and 500, positions 501 and 1000, positions 1001 and 1500, positions 1501 and 3000 or positions 3001 and 3666 and/or any nucleotide insertion or deletion of any nucleotide residue between and including these positions.

In another example, the TPS/TPP-like gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, residues 50 and 150, residues 50 and 140, residues 55 and 125, residues 60 and 120 or residues 78 and 100, and/or any nucleotide residue including these residues.

In another example, the TPS/TPP-like gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2 and/or any nucleotide insertion or deletion at any nucleotide position including these residues.

In another example, disruption of the TPS/TSS-like gene results in loss of the proto-spacer (proto-spacer) sequence (CCCGTCTCTGGGGAATTGGC; SEQ ID NO: 22) and/or proto-spacer adjacent motif (PAM) sequence (AGG).

In certain examples, the mutant parasite is a toxoplasma mutant. The toxoplasma mutants according to the present disclosure may be derived from any strain. For example, the Toxoplasma mutant can be an RH (type I), Pru (type II) or CTG (type III) strain of Toxoplasma gondii. In a particular example, the toxoplasma is a type II mutant.

In a specific example, the TPS/TPP-like gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 1. SEQ ID NO: 2 or SEQ ID NO: 3 as shown in CCCGTCTCTGGGGAATTGGCAGGTGAGGCTGCGTCGCCGTCG CC (SEQ ID NO: 4) or a nucleotide insertion or deletion within the sequence.

In a specific example, the mutant is in a nucleic acid sequence according to SEQ ID NO: 2 or SEQ ID NO: 3, or the TPS/TPP-like gene of SEQ ID NO: 4 comprises a single C nucleotide insertion. In another embodiment, the mutant comprises sequence CCCGTCTCTGGGGAATTCGGCAGGTGAGGCTGCGTCGCCGTCGC (SEQ ID NO: 5).

In another specific example, the mutant comprises a TPS/TPP-like gene sequence with a heterologous nucleotide insertion, such as the sequence used to produce the mutant derived from the CRISPR/cas9 plasmid.

In another embodiment, the mutant is a mutant according to SEQ ID NO: 2 or SEQ ID NO: 3, or the TPS/TPP-like gene of SEQ ID NO: 4 comprises a 183bp insertion of a heterologous nucleotide. In another embodiment, the mutant comprises the sequence CCCGTCTCTGGGGAAA (+182) GGCAGGCAGGTGAGGCTGCGTCGCCG (SEQ ID NO: 6), wherein the mutant comprises an insertion of an A nucleotide plus an adjacent additional insertion of 182 consecutive heterologous nucleotides.

In another specific example, the mutant comprises the sequence CCCGTCTCTGGGGAATTTGA (>1000) TTAGGCAGGTGAGGCTG (SEQ ID NO: 8), wherein >1000 means the insertion of more than 1000 consecutive heterologous nucleotides.

In another specific example, the mutant comprises a single T nucleotide deletion within the sequence of a TPS/TPP-like gene comprising the nucleotide sequence of SEQ ID NO: 2. SEQ ID NO: 3 or SEQ ID NO: 4, or a sequence shown in the figure. In another embodiment, the mutant comprises sequence CCCGTCTCTGGGGAATGGCAGGTGAGGCTGCGTCGCCGTCGCC (SEQ ID NO: 7).

In another embodiment, the mutant comprises SEQ ID NO: 1, of nucleotide residues from position 48 to 115. In another embodiment, the mutant comprises sequence GACAGACTTCGGTGAACGAGTCGCCTGCGCCGCTTCGTG (SEQ ID NO: 9).

The present disclosure also provides Toxoplasma gondii mutants (also referred to herein as Pru: tdTomato: TPS/TPP) deposited by the American type culture Collection and having the name PTA-125166.

The disclosure also provides Toxoplasma gondii mutants deposited by the American type culture Collection and having the name PTA-125165 (also referred to herein as RH: Dhxgprt: Dtps/tpp cl-23(SEQ ID NO: 7)).

The present disclosure also contemplates a mutant parasite comprising one or more additional gene activations, inactivations or disruptions in combination with the inactivated or disrupted TPS/TPP-like genes described herein, wherein starch accumulation is increased relative to a wild-type parasite. In one example, the additional gene is a CDPK2 gene. The production of parasites comprising inactivation of the CDPK2 gene (. DELTA.cdpk 2) is described in Uboldi A et al (2015) Cell Host & Microbe 18, 670-. Thus, in one example, the present disclosure provides a mutant parasite comprising or consisting of a mutation in the TPS/TPP-like gene and a mutation in the CDPK2 gene. In particular, the mutation results in an impairment of normal starch metabolism in the mutant parasite. In one example, the combination of mutations results in one or more of: i) an increase in the size of the amylopectin granules, ii) an increase in the number of amylopectin granules, or iii) a faster accumulation of amylopectin granules.

In another example, the mutant parasite comprises or consists of a mutation in the TPS/TPP-like gene and the modified hexokinase (HxK) gene. In one example, the hexokinase is C-terminally modified as described herein. In one example, the mutant parasite comprises a modified C-terminus having the following sequence ADVNAGAGYPYDVPDYAAGAGPRAGAGYPYDVPDYAAGAGPGDVDIEL (SEQ ID NO: 20).

In one example, the mutant parasite comprises or consists of a mutated TPS/TPP-like gene and an HA-tagged HxK gene (referred to as Δ TPS/TPP: HxK-HA).

The disclosure also provides Toxoplasma gondii mutants (also referred to herein as RH: Δ hxgprt: Ku80: Δ tps/tpp: HxK-HA cl-1SEQ ID NO: 9) deposited by the American type culture Collection and designated PTA-125164.

The person skilled in the art will be familiar with methods which may be used to introduce targeted or non-targeted (i.e. random) insertions or deletions of nucleotide residues within the TPS/TPP-like gene sequence. For example, targeted disruption of TPS/TPP-like genes can be performed using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). If a CRISPR is to be used, a proto-spacer sequence corresponding to a region of about 20bp of the target gene and a proto-spacer adjacent motif of about 2-6bp comprising a GG dinucleotide and immediately following the DNA sequence to be targeted can be designed. CRISPR methodology is known in the art and is described, for example, in Shen B et al (2014) MBio 13; 5(3) are described. In another example, disruption of the TPS/TPP-like gene is caused by homologous recombination. In yet another example, disruption of the TPS/TPP-like gene is caused by mutagenesis. In yet another example, disruption of the TPS/TPP-like gene is caused by gene knock-out. In yet another example, disruption of TPS/TPP-like genes is caused by the use of a "gene targeting" strategy as described, for example, in Michel Cohen-Tannoudji and Charles Babinet (1998) Molecular Human Reproduction vol 4 (10): 929-. Other methods known in the art for disrupting or inactivating a gene are considered to be within the scope of the present disclosure.

In a second aspect, the present disclosure provides a vaccine comprising a mutant parasite according to the first aspect of the present disclosure. In one example, the vaccine comprises an isolated mutant intracellular parasite, wherein the parasite uncontrollably accumulates amyloid amylopectin deposit when grown in a glucose-containing medium. In another example, the parasite is a protozoan parasite. In another example, the vaccine comprises a parasite having an inactivating mutation of a trehalose-6 phosphate synthase/6 phosphate phosphatase (TPS/TPP) -like gene.

In one example, the parasite is a toxoplasma or other parasite described herein.

In one example, the vaccine further comprises a pharmaceutically acceptable carrier or excipient.

In another example, the mutant parasite is not persistent in the animal immunized with the vaccine. For example, the mutant parasite cannot remain viable in the immunized animal for more than 2-3 days.

In one example, oocyst shedding is prevented or substantially reduced in an animal vaccinated with the vaccine.

In one example, the mutant parasite is attenuated in vitro by growth in a medium comprising glucose prior to administration to the animal. Such attenuation can be achieved by culturing the mutant parasite in a glucose-containing medium for a suitable period of time to allow starch granules to form in the parasite. In one example, the incubation period is about 1-7 days, preferably about 1-2 days. In another example, the incubation period is about 24 hours.

In a third aspect, the present disclosure provides a method of immunizing an animal against a parasite comprising administering to the animal a mutant parasite according to the first aspect or a vaccine comprising a mutant parasite according to the second aspect. In one example, the parasite is a protozoan parasite. In one example, the method is a method of immunizing an animal against toxoplasmosis. In another example, a method of immunizing an animal against toxoplasmosis comprises administering to the animal a mutant toxoplasma parasite according to the first aspect or a vaccine comprising a mutant toxoplasma parasite according to the second aspect.

In one example, the vaccine is administered to an animal in an effective amount.

According to this aspect, the animal to be vaccinated can be any warm-blooded animal, and preferably an animal susceptible to toxoplasmosis. Warm-blooded animals may also include members of the family felidae (the natural host of toxoplasma).

In another example, the animal is selected from the group consisting of a human, a cow, a sheep, a goat, a bird, a cat, a pig, a new continental monkey, an australian indigenous marsupial animal, a bear, a deer or a raccoon. Examples of australian indigenous marsupials include koala, kangaroo, gerbil, brachypomus, koala, marshallets, badger, nasty possums, nasty kangaroos and bag shrews.

In another example, the human is a female who is not pregnant.

In a fourth aspect, the present disclosure provides a method of vaccinating an animal against a parasitic infection or condition not accompanied by oocyst shedding comprising administering to the animal a mutant parasite according to the first aspect or a vaccine according to the second aspect. For example, the parasitic infection may include toxoplasmosis caused by toxoplasma, and the parasitic condition may include spontaneous abortion.

In one example, the present disclosure provides a method of immunizing an animal against toxoplasmosis that is not accompanied by oocyst shedding comprising administering to the animal a mutant toxoplasma parasite according to the first aspect or a vaccine comprising a mutant toxoplasma parasite according to the second aspect.

In one example, the animal is a cat, such as a domestic cat.

In certain examples, the vaccines of the present disclosure are capable of providing protection against subsequent toxoplasma attack.

The vaccine can be administered to the animal in any suitable form, including intramuscular, subcutaneous, and oral. In a particular example, the vaccine is administered orally.

In one example, the vaccine is administered with a pharmaceutically acceptable carrier or excipient. In another example, the pharmaceutically acceptable carrier is saline.

The form in which the parasite is administered to the animal (i.e., the sexual stage) can vary. For example, the vaccine may comprise mutant parasites in the form of tachyzoites and/or bradyzoites. In another example, the vaccine may comprise a mutant parasite in the form of an oocyst.

The dose of vaccine administered to an animal will depend on the size and weight of the animal, and will be determined by the clinician or veterinarian. In certain examples, the vaccine dose comprises at least about 1,000-2,000 parasites (e.g., tachyzoites). In other examples, depending on the animal, the vaccine dose may comprise at least about 1,500, 1,800, 2,200, 2,500, 5,000, 8,000, or 10,000 or more parasites (e.g., tachyzoites).

It will be appreciated that vaccines provided in oocyst form will not require storage under refrigerated conditions (e.g. at temperatures between 2-8 ℃). This therefore facilitates the transportation of the vaccine to remote communities in a convenient and cost-effective manner, and allows the vaccine to be transported without compromising the quality (i.e. efficacy) of the vaccine. In certain examples, a vaccine dose may comprise at least about 20 oocysts. In other examples, the vaccine comprises at least about 30, 40, 50, 60, 70, 80, 90, 100 oocysts. In yet another example, the vaccine comprises 100 to 200 oocysts. In certain examples, the oocysts are provided with a pharmaceutically acceptable diluent or excipient.

The vaccine can be administered to the animal in a single dose or in multiple doses.

In one example, the vaccine is administered to the animal prior to mating or mating. In another example, the vaccine is administered to the animal at least four weeks prior to mating or mating.

In some examples, the vaccine may further comprise an adjuvant.

In certain examples, the vaccine is provided with instructions for use. The instructions for use may require reconstitution of the vaccine prior to administration to an animal for immunization. For example, if the vaccine is provided in the form of oocysts, the vaccine may be provided with a suitable pharmaceutically acceptable diluent or excipient, wherein the latter is added to the oocysts prior to direct administration to the animal.

In certain examples, oocysts may be cultured in glutamine-rich medium for a period of time sufficient to convert the oocysts to tachyzoites. In one example, the incubation period is about 3-4 days. The tachyzoites can be used to immunize animals after they have been added to a suitable pharmaceutically acceptable diluent or excipient. Tachyzoites naturally become attenuated after immunization of an animal because the parasite will obtain its source of glucose from the immunized host animal.

In an alternative example, cultured tachyzoites can be attenuated in culture prior to administration to an animal by transferring the culture medium to a medium comprising glucose or glucose and glutamine. The tachyzoites may then be cultured for a period of time to allow starch granules to accumulate with the parasites. In one example, the incubation period is about 1-2 days, as described above. Accumulation of starch granules in the parasites can be clearly determined by microscopic examination or periodic acid-schiff (Pas) staining in culture samples.

In a fifth aspect, the present disclosure provides the use of a mutant parasite according to the first aspect or a vaccine comprising a mutant parasite according to the second aspect in the manufacture of a medicament for immunizing an animal. In one example, the medicament is for immunizing an animal against toxoplasmosis.

In a specific example, the present disclosure provides the use of a mutant toxoplasma parasite according to the first aspect or a vaccine comprising a mutant toxoplasma parasite according to the second aspect in the manufacture of a medicament for immunizing an animal against toxoplasmosis.

In a sixth aspect, the present disclosure provides a mutant parasite according to the first aspect or a vaccine comprising a mutant parasite according to the second aspect, for use in or when immunizing an animal. In one example, the use is for immunizing an animal against toxoplasmosis.

In a seventh aspect, the present disclosure provides a method of preventing toxoplasmosis in an animal, the method comprising administering to the animal a mutant toxoplasma parasite according to the first aspect or a vaccine comprising a mutant toxoplasma parasite according to the second aspect.

In an eighth aspect, the present disclosure provides a polypeptide comprising SEQ ID NO: 10 and SEQ ID NO: 11 or oligonucleotide primers consisting thereof for use in a method of disrupting a TPS/TPP-like gene of toxoplasma gondii. In one particular example, the method is CRISPR/Cas 9.

In a ninth aspect, the present disclosure provides a CRISPR/Cas9 method of disrupting a TPS/TPP-like gene of toxoplasma gondii, wherein the method comprises an oligonucleotide primer comprising SEQ ID NO: 10 and SEQ ID NO: 11 or consists thereof.

In a tenth aspect, the present disclosure provides an oligonucleotide primer pair comprising or consisting of:

(i) SEQ ID NO: 12 and SEQ ID NO: 13;

(ii) SEQ ID NO: 14 and SEQ ID NO: 15; or

(iii) SEQ ID NO: 16 and SEQ ID NO: 17.

in an eleventh aspect, the present disclosure provides a kit comprising: a first container comprising a mutant oocyst lacking a functional TPS/TPP-like gene; a second container comprising a pharmaceutically acceptable excipient or diluent; a delivery device and instructions for combining the contents of the containers and immunizing an animal. In one example, the container is an ampoule or vial. In certain examples, the ampoule or vial includes a seal that can be pierced with a syringe. In another example, the delivery device is a syringe for administering the vaccine to the animal. In another example, the mutant oocysts are toxoplasma oocysts.

Drawings

FIG. 1 shows the genomic sequence of TPS/TPP-like genes from Toxoplasma gondii. Intron highlighting. The proto-spacer sequence is underlined, followed by the AGG PAM sequence targeted by the CRISPR.

FIG. 2 shows the N-terminal sequence (first 200 nucleotides) of the TPS/TPP-like gene. The proto-spacer and PAM sequences are indicated.

FIG. 3 shows A) the sequence of the Wild Type (WT) TPS/TPP-like gene of Toxoplasma gondii, indicating the positions of the prototype-spacer sequence (bold and underlined text) and the PAM motif (highlighted). B) Sequence of clone-1 with a single "C" nucleotide insertion of RH Δ hxgprt Δ tps/tpp. C) Sequence of clone-2 with 183bp insertion (A +182bp) derived from CRISPR/Cas9, RH: Δ hxgprt: Δ tps/tpp. D) Sequence of clone-23 with a single "T" base deletion, RH: Δ hxgprt: Δ tps/tpp. E) Sequences with an inserted Pru: tdTomato: Δ tps/tpp cl-2 of greater than 1000 bp. F) Sequence of RH: Δ hxgprt: Δ tps/tpp: hexokinase-HA cl-1 with a 58bp deletion, including the complete prototype spacer sequence and PAM motif.

FIG. 4 shows the genomic sequence of Toxoplasma gondii hexokinase (HxK). Intron highlighting.

FIG. 5 shows that the Δ tps/tpp parasite grown in glucose-containing medium accumulates amylopectin and exhibits reduced virulence in vivo. A) RH. DELTA. tps/tpp the parasite accumulated a significant amount of amylopectin. Amylopectin was detected by periodic acid-schiff fluorescence. Scale bar 5 μm. B) Plaque assays indicate that the RH. DELTA. tps/tpp parasite is unable to grow on glucose. Pas fluorescence shows the accumulation of amylopectin in glucose-containing medium compared to the absence or low amylopectin level when grown in glucose-free, glutamine-containing medium. C) The parasite of type II Pru: tdTomato: Δ tps/tpp excessively accumulates amylopectin in glucose-containing medium, resulting in morphological aberrations. The parasite was produced in medium lacking glucose by Pru: tdTomato: Δ tps/tpp and then switched to medium containing glucose. Gap45 staining detected by IFA with anti-Gap 45 antibody indicates parasite periphery. The scale bar represents 10 μm. D) C57BL/6 mice infected with the wild-type Pru: tdTomato parasite lost significant body weight over time and reached a peak loss 10 days post infection. In contrast, mice infected with the Pru: tdTomato: Δ tps/tpp parasite did not lose body weight. E) Approximately 10 days post-infection, C57BL/6 mice infected with the wild-type Pru parasite succumbed to infection rapidly. In contrast, mice infected with the Pru: tdTomato: Δ tps/tpp parasite remained healthy during the course of the experiment. 10000 Pru: tdtomato: Δ tps/tpp or WT parasites were used to inoculate C57BL/6 mice and their changes in body weight and survival were monitored over time.

FIG. 6 shows A) intracellular RH. DELTA. tps/tpp tachyzoites hyper-accumulating amylopectin, B) detection by PAS staining when cultured in a medium containing glucose.

FIG. 7 shows A) the assemblyAmylopectin pool and B) measurement of isolated parent RH and RH after extraction, amylase digestion and GC/MS Δ tps/tpp tachyzoites¹³C-glucose level.

FIG. 8 shows the levels of polar metabolites in parent RH and RH. DELTA. tps/tpp tachyzoites as determined by LC/MS.

FIG. 9 shows A) glucose uptake by parental RH and RH. DELTA.tgtps/tpp tachyzoites, use¹⁴C-glucose. B) By using¹³C-glucose labeling of parasites and tracking by GC/MS¹³C incorporation of glucose-6-phosphate to evaluate the turnover kinetics of the intracellular pool of glucose-6-phosphate.

FIG. 10 shows the massive accumulation of amylopectin granules in the Δ tps/tpp: HxK-HA parasite, resulting in the absence of viable parasites. The HA epitope tagged form of TgHxK was expressed in standard glucose-containing media in 1, 4 and 7 days of culture of RD:. DELTA.tgtps/tpp parasite and infected fibroblasts. Immunofluorescence images of infected host cells were taken at different time points and stained with anti-ha (tghxk) and Gap45 (inner membrane complex).

FIG. 11PAS fluorescence shows that when switching from glucose-free medium to glucose-containing medium, the Δ tps/tpp: HxK-HA parasite accumulated a significant amount of amylopectin over time and eventually died.

FIG. 12 shows that the levels of amylopectin of the Δ cdpk2 Hxk-HA parasite are comparable to the Δ cdpk2 parasite and can be maintained in glucose-containing medium without loss of viability. White arrows indicate amylopectin granules, green staining indicates HxK-HA protein expression as detected by IFA probed with anti-HA antibody and AlexaFluor-488 secondary antibody. The scale bar represents 5 μm.

FIG. 13 results in an increase in catalytic activity by double HA-tagged C-terminal modification of hexokinase (Δ tps/tpp: HxK-HA) parasites. HxK activity was determined using coupled G6PDH spectrometry.

FIG. 14 shows the localization of myc-tagged TgTPS/TPP in wild-type RH parasites (upper panel) and in Toxoplasma gondii Δ cdpk2 mutants (lower panel). The upper panel shows the expression of TPS/TPP in wild type parasites, while the lower panel shows that, if present, TPS/TPP is localized on the amylopectin granules, as is the case with the CDPK2 KO parasite, so the CBM20 domain is functional. Infected host cells were labeled with anti-myc (TgTPS/TPP) and anti-TOM (mitochondrial) antibodies and residual antibodies were visualized by DIC.

FIG. 15 shows lysis of RH parasites expressing TgTPS/TPP-3Myc and fractionation of cytoplasmic extracts on amylose columns. Myc-tagged proteins were largely associated with the bound fractions.

FIG. 16. DELTA.tps/tpp Chronic cystogenesis in the parasite. Host cells were infected with tachyzoites and allowed to differentiate in the presence of bradyzoites induction medium for 2 and 7 days prior to IFA. The bradyzoite surface protein, SRS9, was detected with anti-SRS 9 antibody, whereas amylopectin was detected by PAS staining. The scale bar represents 5 μm.

FIG. 17 immunization with a.DELTA.TPS/TPP Toxoplasma provides protection against subsequent challenge. With 1x10⁴Wild type (Pru Δ hx) toxoplasma tachyzoite i.p. challenge animals used for the first time in the experiment (naive) and immunized with Δ TPS/TPP. A) Body weight was monitored daily and B) Kaplan-Meier survival curves were generated. Animals were eliminated when they lost 10% weight for more than three consecutive days or 15% weight for more than one day.

Description of the sequence listing

SEQ ID NO: 1: the genomic sequence of the TPS/TPP-like gene from Toxoplasma gondii is shown.

SEQ ID NO: 2: the N-terminal sequence (first 200 nucleotides) of the TPS/TPP-like gene is shown.

SEQ ID NO: 3: the cDNA sequence of the TPS/TPP-like gene from Toxoplasma gondii is shown.

SEQ ID NO: 4: sequences targeting the N-terminal portion of CRISPR from wild type TPS/TPP-like genes of toxoplasma gondii, including the 20bp WT protospacer sequence and PAM motif.

SEQ ID NO: 5: the sequence of part of a mutated TPS/TPP-like gene from Toxoplasma gondii, comprising a single C insertion at residue 18, is shown (FIG. 3B).

SEQ ID NO: 6: the sequence of the part of the mutated TPS/TPP-like gene from Toxoplasma gondii is shown, which comprises the insertion of a heterologous nucleotide after residue 15 (FIG. 3C).

SEQ ID NO: 7: the sequence of the part of the mutated TPS/TPP-like gene from Toxoplasma gondii showing deletion of a single T nucleotide (3D).

SEQ ID NO: 8: the sequence of the part of the mutated TPS/TPP-like gene from Toxoplasma gondii is shown, which comprises an insertion of more than 1000 nucleotides after residue 20 (FIG. 3E).

SEQ ID NO: 9: the sequence of part of a mutated TPS/TPP-like gene from Toxoplasma gondii is shown with a deletion of 58bp, including the complete protospacer sequence and PAM motif (FIG. 3F).

SEQ ID NO: 10: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 11: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 12: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 13: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 14: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 15: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 16: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 17: the sequences of the oligonucleotide primers are shown.

SEQ ID NO: 18: shown in SEQ ID NO: 4, the sequence of the mutant comprising a 183bp insertion.

SEQ ID NO: 19: showing the sequence of the mutant comprising a sequence that disrupts the sequence of SEQ ID NO: the >1kb insert sequence (partial sequence obtained) of the TPS/TPP locus in 8.

SEQ ID NO: 20: the sequence of the HA-tagged hexokinase modified C-terminus is shown.

SEQ ID NO: 21: shows the sequence from SEQ ID NO:9, and a 58bp deletion sequence.

SEQ ID NO: 22: the sequence of the prototype spacer of 20bp is shown.

SEQ ID NO: 23: the genomic sequence of the hexokinase gene from toxoplasma gondii is shown.

SEQ ID NO: 24: sequence of gBlock No. 1.

SEQ ID NO: 25: sequence of gBlock No. 2.

SEQ ID NO: 26: sequence of gBlock No. 3.

SEQ ID NO: 27: sequence of gBlock No. 4.

SEQ ID NO: 28: sequence of gBlock No. 5.

SEQ ID NO: 29: sequence of gBlock No. 6.

SEQ ID NO: 30: sequence of gBlock No. 7.

SEQ ID NO: 31: sequence of gBlock No. 8.

SEQ ID NO: 32: sequence of gBlock No. 9.

SEQ ID NO: 33: sequence of gBlock No. 10.

SEQ ID NO: 34: sequence of the forward primer.

SEQ ID NO: 35: sequence of the reverse primer.

SEQ ID NO: 36: sequence of the forward primer.

SEQ ID NO: 37: sequence of the reverse primer.

SEQ ID NO: 38: sequence of the forward primer.

SEQ ID NO: 39: sequence of the reverse primer.

SEQ ID NO: 40: sequence of the forward primer.

SEQ ID NO: 41: sequence of the reverse primer.

SEQ ID NO: 42: sequence of the forward primer.

SEQ ID NO: 43: sequence of the reverse primer.

SEQ ID NO: 44: sequence of the reverse primer.

SEQ ID NO: 45: sequence of the forward primer.

SEQ ID NO: 46: sequence of the forward primer.

SEQ ID NO: 47: sequences of short linkers.

SEQ ID NO: 48: the sequence of the long linker.

SEQ ID NO: 49: sequence of the forward primer.

SEQ ID NO: 50: sequence of the forward primer.

SEQ ID NO: 51: sequence of the reverse primer.

SEQ ID NO: 52: sequence of the forward primer.

SEQ ID NO: 53: sequence of the reverse primer.

SEQ ID NO: 54: sequence of the reverse primer.

SEQ ID NO: 55: sequence of the forward primer.

SEQ ID NO: 56: an oligonucleotide sequence.

SEQ ID NO: 57: an oligonucleotide sequence.

SEQ ID NO: 58: an oligonucleotide sequence.

SEQ ID NO: 59: an oligonucleotide sequence.

SEQ ID NO: 60: an oligonucleotide sequence.

SEQ ID NO: 61: an oligonucleotide sequence.

SEQ ID NO: 62: an oligonucleotide sequence.

SEQ ID NO: 63: an oligonucleotide sequence.

Detailed Description

Summary of the invention

Throughout this specification, unless explicitly stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of matter shall be taken to include one or more (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of matter.

Those skilled in the art will recognize that variations and modifications of the present disclosure may be made in addition to those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The present disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

The present disclosure is not to be limited in scope by the specific examples described herein, which are intended as illustrations only. Functionally equivalent products, compositions and methods are clearly within the scope of the present disclosure.

Unless expressly stated otherwise, any example of the disclosure herein should be applied mutatis mutandis to any other example of the disclosure.

Unless otherwise specifically defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

Unless otherwise indicated, recombinant proteins, cell culture and immunological techniques used in the present disclosure are standard procedures well known to those skilled in the art. These techniques are described and explained throughout the literature, such as Perbal (1984), Sambrook et al (1989), Brown (1991), Glover and Hames (1995 and 1996) and Ausubel et al (1988, including all updates to date), Harlow and Lane (1988), Coligan et al (including all updates to date) and Zola (1987).

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

As used herein, the term "derived from" should be taken to indicate that the specified integer may be obtained from a particular source, although not necessarily directly from that source.

The present invention employs conventional molecular biology, microbiology and recombinant DNA techniques within the skill of the art. See, e.g., Sambrook et al, "Molecular Cloning" A Laboratory Manual (1989).

Definition of selection

The term "and/or", for example "X and/or Y", is to be understood as meaning "X and Y" or "X or Y" and as providing explicit support for either or both of these meanings.

Unless the context indicates otherwise, reference to the singular forms "a", "an" and "the" should also be understood to imply the inclusion of a plural number of such forms.

Further, as used herein, "and/or" should be taken as specifically disclosing each of the two specified features or components, with or without the other. Thus, the term "and/or" as used herein in phrases such as "a and/or B" is intended to include "a and B," "a or B," "a" (alone) and "B" (alone). Likewise, the term "and/or" as used in phrases such as "A, B and/or C" is intended to encompass each of the following embodiments: A. b and C; A. b or C; a or C; a or B; b or C; a and C; a and B; b and C; a (alone); b (alone); and C (alone).

The term "about" is used herein to mean about, approximately, about, or in range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. Generally, the term "about" is used herein to refer to a modification of a numerical value with a variance (higher or lower) in the range of 10% above or below the stated value.

By "isolated" is meant a parasite removed from its natural environment. In a particular example, it refers to a mutant parasite, the genotype of which is altered relative to the native parasite.

The term "disrupted" as used herein refers to a gene whose native sequence has been modified by insertion or deletion of nucleotides within the sequence (e.g., a TPS/TPP-like gene). Insertions or deletions may encompass a single nucleotide or up to thousands of nucleotides within the target sequence. The inserted or deleted nucleotides may be continuous, partially continuous or discontinuous. The term "disruption" is understood to encompass mutations introduced at specific nucleotide positions within a sequence or mutations that lead to occur within specific regions of the nucleotide targeted for mutation. The term "disruption" also includes non-targeted disruptions understood to mean the introduction of randomly introduced mutations into a sequence, meaning that mutations are introduced at random positions (not predetermined) within a given sequence. CRISPR-derived mutations described herein are generally understood in the art to refer to targeted mutations. Although it cannot be predicted whether the CRISPR repair mechanism results in insertion or deletion of nucleotides, the proto-spacer and PAM motif are used to direct the mutation to a specific position within the sequence (e.g., the TPS/TPP-like genes described herein).

The term "knock-out" as used herein refers to a process in which a part or all of a gene is replaced or disrupted by an artificial DNA fragment, e.g., a DNA fragment from toxoplasma or another organism, or from a Cas 9-and RNA-guided plasmid-containing plasmid used for transfection.

As used herein, the term "native TPS/TPP-like gene" refers to a gene having the trehalose-6-phosphate synthase (TPS) and trehalose 6-phosphate phosphatase (TPP) domains in tandem arrangement with the N-terminal amylopectin-binding CBM20 domain. The gene is in a form that is naturally present in a given parasite. For example, the native TPS/TPP-like gene sequence in toxoplasma may be derived from the ToxoDB gene ID TGGT1_297720 in the toxoplasma genomic resource (www.Toxodb.org) (as shown in figure 1).

The term "inactivating mutation" as used herein refers to a mutation that negatively affects the transcription of a given gene and thereby does not produce the resulting protein. Inactivating mutations may be generated in different ways, such as deletion of native nucleotides or insertion of heterologous nucleotides within the gene sequence. Inactivating mutations may also result from insertions or deletions that result in a frame shift of the gene sequence compared to the native sequence.

The term "homologue" of a TPS/TPP-like gene refers to a gene sequence genetically related to the TPS/TPP-like gene called ToxoDB gene ID TGGT1_297720 (shown in FIG. 1). In the context of the present disclosure, it refers to other TPS/TPP-like genes present in other parasites than toxoplasma, where such parasites also store energy as amylopectin. Such homologues may comprise a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% identical to the TPS/TPP-like gene of toxoplasma gondii.

The term "coccus" as used herein refers to an obligate intracellular parasite belonging to the class apicomplexan. Such parasites must live and multiply within animal cells.

As used herein, the term "composition" refers to any composition comprising at least one therapeutic or bioactive agent and suitable for administration to a subject. Any of these formulations may be prepared by methods well known and recognized in the art. See, e.g., Gennaro, A.R., ed., Remington: The Science and Practice of Pharmacy,20th Edition, Mack Publishing Co., Easton, Pa. (2000).

The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, and/or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The term "animal" as used herein refers to any warm-blooded animal, including non-human animals (e.g., cats, sheep) or primates (e.g., humans or monkeys).

The term "vaccination" as used herein refers to the process of inducing immunity to infectious organisms in an animal by immunization. Typically, immunization of an animal is designed to provide protection against further challenge by the same infectious organism (i.e., immunogen) by stimulating the immune system of the animal.

The term "proto-spacer adjacent motif (PAM)" sequence refers to a 2-6 base pair DNA sequence following the DNA sequence targeted by the Cas9 nuclease in the CRISPR system. If there is no PAM sequence behind, Cas9 will not bind or cleave the target DNA sequence successfully. The classical PAM sequence is 5'-NGG-3', where N is any nucleobase, followed by two guanine (G) nucleobases.

The term "uncontrolled" has its ordinary meaning. It is understood to mean growth that occurs in an unlimited manner.

The term "toxoplasma" as used herein is understood to mean toxoplasma gondii as of the beginning, and these terms may be used interchangeably.

Toxoplasma gondii (T. gondii) life cycle

Toxoplasma exists mainly in three forms with infectivity for humans and animals: oocysts (containing sporozoites), tachyzoites and bradyzoites. These three stages are infectious to both intermediate and final hosts, which may acquire Toxoplasma gondii infection primarily through one of the following pathways: (A) horizontally by oral ingestion of infectious oocysts from the environment; (B) horizontally by oral ingestion of tissue cysts contained in the primary offal (viscera) of raw or uncooked meat or intermediate hosts, or (C) vertically by trans-placental transmission of tachyzoites. In addition, in several hosts, tachyzoites can also be transmitted in milk from mother to offspring.

Oocysts are thought to be produced only in a defined host, i.e., a member of the feline family. Oocysts, when transmitted in feces, can infect humans and other intermediate hosts (essentially any warm-blooded animal). They then develop into tachyzoites and multiply rapidly by repeated endophytic processes. They divide rapidly in cells, leading to tissue destruction and transmission of infection. Eventually, tachyzoites localize in muscle tissue and in the CNS, where they transform into tissue cysts or bradyzoites. This is considered to be a response to the host immune response.

Tissue cysts (including bradyzoites) have a high affinity for nerve and muscle tissue. They are located primarily in the Central Nervous System (CNS), the eye, and bones and cardiac muscle. However, to a lesser extent, they may also be found in internal organs, such as the lungs, liver and kidneys. Tissue cysts are the final life cycle stage in the intermediate host and are immediately infectious. In certain intermediate host species, they may persist throughout the life of the host. The mechanism of this persistence is not clear. However, many researchers believe that tissue cysts are periodically disrupted and that bradyzoites convert to tachyzoites that re-invade the host cell and to bradyzoites within new tissue cysts again (Dubey JP et al (1998) Clin Microbiol. Rev 11: 267-99).

Ingestion of cysts in contaminated meat results in the bradyzoite being transformed back to tachyzoites upon entry into a new host.

Toxoplasma organisms were described in the New Zealand report in aborted sheep placental tissue and in aborted sheep fetuses, it was first recognized that Toxoplasma is an important pathogen in livestock species (Hartley et al (1954) Aust Vet J30: 216-. In the late 1960 s, cats were found to excrete a new form of the parasite in their faeces, which was very stable in the environment, which led to the recognition that cats were the ultimate host for the parasite.

Virtually all edible parts of an animal can carry live toxoplasma. In one study, live toxoplasma was isolated from 17% of 1,000 adult pigs (sows) at a slaughterhouse in Iowa. Toxoplasma infections are also common in hunting animals. In wild hunting, toxoplasma infection is most prevalent in black bears and white-tailed deer. In the united states, about 80% of black bears are infected, while about 60% of raccoons have antibodies to toxoplasma. Since raccoons and black bears will eat their food, infection in these animals is a good indicator of toxoplasma epidemic in the environment.

The number of toxoplasma tissue cysts in the meat of food animals is very low. It is estimated that there may be only 1 tissue cyst per 100 grams of meat.

Toxoplasma parasites suitable for use in the present disclosure may be obtained from a deposit such as the American Type Culture Collection (ATCC). The ATCC includes multiple deposits of Toxoplasma gondii, such as ATCC Nos. PRA-340, PRA-426, PRA-344, 50950, 50174, 40050, 50839, 50940, 50611, 40615, 50943, 50942, 50856, 50851 and 50947.

Energy utilization of Toxoplasma gondii (T.gondii)

Toxoplasma tachyzoites must acquire a carbon source and other essential nutrients from their host cells. Toxoplasma gondii is located in a distinct parasite vacuole in infected host cells, surrounded by a membrane that is thought to freely penetrate many host metabolites.

In order to obtain its energy, tachyzoites utilize glucose and glutamine obtained from Host cells (MacRae JI et al (2012) Host Cell Microbe 12: 682-692), and accumulate γ -aminobutyric acid after Host Cell efflux, which may provide extracellular tachyzoites with short-term energy reserves to supply motility and invasion (MacRae JI et al (2012) Host Cell Microbe 12: 682-692). Toxoplasma tachyzoites also produce the storage polysaccharide amylopectin, which contains a backbone of α (1-4) -linked glucose residues modified by α (1-6) -linked branch points. Tachyzoites typically express very low levels of amylopectin unless stressed, in contrast bradyzoites and oocysts accumulate high levels of amylopectin granules in the cytoplasm (Coppin a et al (2003) Biochimie 85: 353-. It is speculated that amylopectin granules may be a long term energy store during transmission to maintain parasite viability in low nutrient niches and/or to promote rapid differentiation when favorable conditions are encountered. However, little is known about how to regulate amylopectin accumulation and utilization at different stages of the Toxoplasma gondii's living cells.

Amylopectin characterization

Structural and gas chromatography/mass spectrometry analysis has determined that particles in Toxoplasma are true amylopectin, consisting of alpha (1-4) -linked glucan linear chains with a low proportion of alpha (1-6) branches. The chain has an average length of 19 glucose molecules (Guerardel Y et al (2005) Microbes Infect 7 (1): 41-8).

Amylopectin is found in all stages of toxoplasma. However, experiments have shown that the conversion of bradyzoites from quiescent cysts to newly transformed tachyzoites is associated with the disappearance of amylopectin granules (Coppin A et al (2003) Biochimie 85: 353-361). In Toxoplasma gondii, during tissue cyst formation, a number (average: 21.8, range: 7-38) of amylopectin granules are synthesized in bradyzoites with an average size of 358nm (range: 192-. When developed in a glucose-rich environment (e.g., brain or muscle cells), the bradyzoite form produces abnormally large amounts of amylopectin (glucose polymer) because of the reduced nutrient requirements during this inactive phase.

It has been found that amylopectin granules exist in a rather large size range. Large amylopectin granules exhibit a rigid densely entangled wire-sphere structure to store a large number of glucose molecules, with a size of the order of 0.4 μm. The regular entanglement and smooth "globuloid" structure of the larger amylopectin is in sharp contrast to the more irregular shape and rod-like particle composition of the smaller particles (Harris JR et al, (2004) Parasitology 128(Pt 3): 269-82). Amylopectin granules can be identified using techniques such as iodine staining, periodic acid schiff's staining or electron microscopy.

Trehalose-6 phosphate synthase/6-phosphate phosphatase (TPS/TPP) -like genes

Many fungi and plants synthesize the disaccharide trehalose by the synergistic action of two enzymes Trehalose Phosphate Synthase (TPS) and Trehalose Phosphate Phosphatase (TPP) (Thamhong A et al, (2017) Microbiol Biol Rev 15; 81 (2)). Trehalose synthesis is often increased under conditions of cellular stress, reflecting the potential role of this sugar as a short-term energy reserve and as a compatible solute-stabilizing protein in vivo. Furthermore, the constitutive synthesis and degradation of trehalose (through inefficient cycles of ATP consumption) may play a key role in balancing the flux of glycolysis through higher (ATP consumption) and lower (ATP production) in certain fungi. Interestingly, the genomes of all toxoplasma wires encode proteins containing both TPS and TPP domains (toxodb accession TGME49 — 297720).

Both TPS and TPP proteins, and the trehalose biosynthetic pathway by which they function, are absent in mammalian cells. Toxoplasma gondii homologues, referred to herein as TPS/TPP-like genes, comprise trehalose 6-phosphate synthase (TPS) -like and trehalose 6-phosphate phosphatase (TPP) -like domains arranged in tandem, and an N-terminal amylopectin-binding CBM20 domain, enabling direct interaction with amylopectin.

Preliminary sequence analysis indicated that the TPS domain of toxoplasma gondii, TgTPS/TPP, has strong homology to the TPS proteins of escherichia coli (e.coli), saccharomyces cerevisiae (s.cerevisiae) and arabidopsis thaliana (a.thaliana), including residues important for binding to the UDP-glucose donor. However, the toxoplasma TPS domain lacks several important TPS-catalytic residues, including Gly22, Val366 and Lys267 (important for UDP-glucose binding) and Arg9, Arg300 and Tyr76 (important for glucose-6-phosphate binding), increasing the likelihood that this domain may not have T6P synthase activity. Similarly, although the C-terminal TgTPP-like domain appears to have all of the conserved motifs required for phosphatase activity, the TgTPP sequence contains other insertions that can interfere with activity. Consistent with the possibility that TgTPS/TPP lacks trehalose phosphate synthase or trehalose phosphate phosphatase activity, no trehalose or trehalose phosphate was detected in whole cell extracts of tachyzoites using either GC/MS or LC/MS.

Tandem arrangements of TPS-like and TPP-like domains are also present in The 11 paralogs found in Arabidopsis (Vandesteene L et al, (2012) Plant physiology 160: 884-896), although only three of them are shown to have T6P synthase activity (Vandesteene et al, (2012) and delarge I et al, (2015) The Biochemical Journal 466: 283-290) and none of them shows T6P phosphatase activity.

In addition to The dual domain proteins, Arabidopsis thaliana contains 10 proteins comprising an enzymatically active T6P phosphatase domain, but completely lacking The TPS-like domain (Vogel G et al, (1998) The Plant Journal: for Cell and Molecular Biology 13: 673-683). In yeast, The TPS and TPP proteins are separated but form complexes with two other accessory proteins (Bell W et al, (1992) European Journal of Biochemistry 209: 951-959; Bell W et al, (1998) The Journal of Biological Chemistry 273: 33311-33319; Vuorio O.E et al, (1993) European Journal of Biochemistry 216: 849-861). Importantly, the Saccharomyces cerevisiae homolog TPS1 is essential for growth on glucose, and disruption of this gene leads to accumulation of G6P (Eastmond P.J. and Graham I.A. et al, (2003) Current opinion in plant Biology 6: 231-. At least some Arabidopsis paralogues are also involved in sugar signaling and Plant development (Eastmond P.J. et al, (2002) The Plant Journal: for cell and molecular biology 29: 225. sub.235; Gomez L.D. et al, (2006) The Plant Journal: for cell and molecular biology 46: 69-84; Gomez L.D. et al, (2010) The Plant Journal: for cell and molecular biology 64: 1-13; van Dijken A.J. et al, (2004) Plant physiology 135: 969. sub.977).

The sequence of the TPS/TPP-like gene in ToxoDB gene ID TGGT 1-297720 was identified in ToxoDB, the sequence of which is shown in FIG. 1 (SEQ ID NO: 1). ToxoDB Gene resources in Gajria B et al, (2008) Nuc Acids Res 36(database issue): D553-D556.

Disruption of TPS/TPP-like genes

As described herein, the present disclosure relates to mutant parasites having TPS/TPP-like genes disrupted resulting in gene inactivation. Inactivation of TPS/TPP-like genes in parasites can be achieved by many different methods known in the art. The present disclosure is based on the following findings: inactivation of the TPS/TPP-like gene in Toxoplasma gondii leads to accumulation of amylopectin in the mutant parasite when grown in a medium containing glucose instead of no glucose.

Any suitable method conventionally used to generate knockout mutants can be used to generate mutants of the present disclosure. For example, mutants can be obtained by single crossover integration (e.g., as described in Fox and Bzik (2002) Nature 451 (6874): 926-9) or by using double crossover gene replacement (Kim K et al, (1993) Science Nov 5; 262 (5135): 911-4).

Typically, production of a mutant toxoplasma comprises isolating a nucleic acid molecule of interest from the toxoplasma (e.g., as described herein); replacing, mutating, substituting or deleting all or part (e.g., one or more bp) of the gene to disrupt the coding or regulatory region of the gene; and integrating the disrupted molecule into the genome of the Toxoplasma gondii. Mutants bearing mutated sequences may be selected using suitable drug selectable markers, such as hxgprt, chloramphenicol acetyltransferase, DHFR-ts or phleomycin.

In particular embodiments, the selectable marker is selected by positive and negative selection (e.g., hxggrt).

Disruption of all or part of the TPS/TPP-like gene may be achieved, for example, by replacing the coding sequence with a nucleic acid molecule encoding a selectable marker, by replacing the coding sequence with a nucleic acid molecule encoding a foreign protein, and the like. Subsequent restriction endonuclease digestions and Southern blot analysis or sequencing of the mutant toxoplasma genomic DNA can be used to confirm the disruption, as known to those skilled in the art.

Although the mutants of the invention may be produced from toxic type I strains such as RH (as exemplified herein), type II strains (as exemplified herein) as well as type III strains as well as any other strains belonging to clade A, B, C, D, E or F may also be used. The mutants of the invention can be generated using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) as described (Shen Z et al, (2014) Dev Cell Sep 8; 30(5) 625-36; Sidik S.M. et al PLoS One2014Jun 27; 9(6) e100450 PMID: 24971596). Briefly, the technique consists of a guide rna (grna) and a DNA endonuclease Cas9 (typically from Streptococcus pyogenes). The gRNA (or protospacer sequence) determines where insertions or deletions (indels) occur. Once the gRNA and Cas9 are expressed in the cell, the gRNA will direct Cas9 to bind to the target sequence and introduce a double strand break. The cell can then repair the break by non-homologous end joining (NHEJ) or Homologous Directed Repair (HDR). NHEJ is the most active repair mechanism in toxoplasma, often resulting in indels near the target sequence. If the insertion or deletion occurs within an open reading frame, this may introduce a frame shift, leading to a premature stop codon, thereby eliminating gene function. HDR recombination can occur if a homologous template is provided, and also results in disruption or modification of the gene. In the current technology (Shen et al 2014 and Sidik et al 2014), the guide sequence/protospacer is selected based on the sequence adjacent to the PAM 'NGG' motif and consisting of 20 bp. A "G" may be added at the 5' end to better initiate transcription. The protospacer sequence and its adjacent PAM motif can be selected on either DNA strand, throughout the gene, including promoters, terminators, coding sequences or introns, or any other portion of the gene that may affect the level or fidelity of the gene product.

As described herein, by way of non-limiting example, mutant parasites can be generated by mutating the UPRT proto-spacer sequence of plasmid pSAG1-Cas9-U6-sgUPRT with the target TPS/TPP proto-spacer sequence (SEQ ID NO: 22) and transfecting the construct into the parasite to initiate the CRISPR/Cas9 protocol. For example, screening for mutants can be accomplished using Fluorescence Activated Cell Sorting (FACS) to sort the parasites into the wells of a 96-well microplate and then incubating for a sufficient time to identify clones that produce visible starch granules (amylopectin) when grown in glucose-containing medium. Once a mutant clone is identified, it can be maintained in glucose-free, glutamine-containing medium to multiply the parasite until such time as immunization is required. Mutants can also be isolated by first culturing the transfected cells in glutamine media, cloning them out by limiting dilution, and then identifying the clones as mutants by looking for the production of amylopectin when transferred to glucose-containing media.

Preferably, the mutant parasite of the invention is attenuated when grown in a medium containing glucose. The term "attenuated" refers to an attenuated and/or weaker form of a native strain, as is conventional in the art. Desirably, the attenuated mutants of the present invention are capable of stimulating an immune response and generating immunity, but do not cause disease. Attenuation can be determined using the methods shown in the examples herein. In some examples, the degree of attenuation is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or greater than 95% relative to a corresponding wild-type parasite grown on the same medium.

Determination of TPS/TPP-like Gene inactivation

Inactivation of the TPS/TPP-like gene can be assessed by examining the mutant parasite for amylopectin production in glucose-containing and glutamine-containing medium. For example, the growth of mutant parasites can be assessed by plaque assays known in the art and as described herein. Plaque assays can be performed by assessing the ability of human foreskin fibroblasts to grow by lytic cycling on confluent layers in media containing glucose or glutamine as a carbon source. Inactivation of the TPS/TPP-like gene will be evident by accumulation of amylopectin granules in the tachyzoites themselves, which can be observed by Pas staining. The growth of the same mutant parasite on glutamine-containing medium should be comparable to the wild-type parasite and if such a mutant parasite is transferred to glutamine-containing medium, it should result in the disappearance or reduction of amylopectin granules in the parasite.

Virulence assays in mice can be performed as described herein. Survival and body weight of mice transfected with the mutant parasite can be measured over time. Mutants in which the TPS/TPP-like gene is inactivated do not significantly affect the body weight of the mice over time, compared to wild-type parasites which would lead to loss of body weight and susceptibility to infection in mice.

Vaccine

The present disclosure encompasses vaccines comprising the mutant parasites described herein. Preferably, the vaccine further comprises a pharmaceutically acceptable excipient or diluent. The skilled person will know which suitable excipient or diluent to use, depending on whether the vaccine is for human or veterinary use.

Administration of the mutant parasites disclosed herein can be carried out by any suitable means, including parenteral injection (e.g., intraperitoneal, subcutaneous, or intramuscular injection), orally, or by topical application (typically in a pharmaceutical formulation) to the airway surface. Topical application to the airway surface may be by intranasal administration (e.g., by use of a dropper, swab or inhaler for intranasal deposition of the pharmaceutical formulation). Oral administration may be in the form of an ingestible liquid or solid formulation.

In one example, the pharmaceutically acceptable excipient or diluent is an aqueous carrier. A variety of aqueous carriers can be used, such as buffered saline and the like. Exemplary carriers include water, saline, ringer's solution, dextrose solution, and 5% human serum albumin. The compositions may contain pharmaceutically acceptable carriers required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. Non-aqueous vehicles such as mixed oils and ethyl oleate may also be used. The vehicle may contain minor amounts of additives that enhance isotonicity and chemical stability, such as buffers and preservatives.

The vaccines of the present invention may comprise one or more veterinarily acceptable carriers. As used herein, "veterinarily acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Diluents may include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents may include sodium chloride, dextrose, mannitol, sorbitol, lactose and the like. The stabilizer includes albumin and the like. Adjuvants include, but are not limited to, RIBI adjuvant system (Ribi Inc.), alum, aluminum hydroxide gel, cholesterol, oil-in-water emulsions, water-in-oil emulsions such as Freund's complete and incomplete adjuvant, block copolymers (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), and,Adjuvants, saponins, Quil a, QS-21(Cambridge Biotech inc., Cambridge Mass.), GPI-0100 (galenicals, inc., Birmingham, Ala.) or other saponin fractions, monophosphoryl lipid a, an avridine lipid-amine adjuvant, heat labile enterotoxin (recombinant or other form) from e.

Administration may be carried out in a single dose regimen or in a multiple dose regimen, wherein the main course of treatment may employ 1-10 divided doses, followed by other doses given at subsequent intervals to maintain and/or enhance the response, e.g. a second dose given over 1-4 months, followed by subsequent doses after several months if desired.

Vaccine efficacy can be affected by many factors, including the health status, genetic makeup, concurrent infections, age, nutritional status, current drug therapy, and stress of the animal. Thus, in some instances, it may be necessary to administer a further booster vaccine as described above.

The exact dose administered can be determined by the skilled practitioner based on factors associated with the animal in need of prevention or treatment. The dosage and administration are adjusted to provide sufficient levels of the mutant parasite or vaccine containing the same or to maintain the desired effect of preventing or reducing signs or symptoms of toxoplasmosis. Factors that may be considered include the severity of the disease state, the general health of the subject, age, weight and sex of the animal, diet, time and frequency of administration, drug combination, response sensitivity and tolerance/response to therapy.

In certain examples, the vaccine dose comprises at least about 1,000-2,000 parasites (e.g., tachyzoites). In other examples, depending on the animal, the vaccine dose may comprise at least about 1,500, 1,800, 2,200, 2,500, 5,000, 8,000, or 10,000 or more parasites (e.g., tachyzoites).

In certain examples, a vaccine dose may comprise at least about 20 oocysts. In other examples, the vaccine comprises at least about 30, 40, 50, 60, 70, 80, 90, 100 oocysts. In another example, the vaccine comprises 100 to 200 oocysts.

2

Use of mutant toxoplasma gondii (t.gondii)

In certain examples, the mutant toxoplasma of the present disclosure can be used as a vehicle for delivery of exogenous antigens from non-toxoplasma disease factors (i.e., antigens that are not naturally expressed by the toxoplasma). For example, the CRISPR technique can be used to replace TPS/TPP-like genes with foreign genes encoding antigens that require immunization.

Specific examples of exogenous antigens include tetanus toxoid (tetC), malaria antigens such as circumsporozoite protein (CSP) and merozoite surface protein-1 (MSP-1), Bacillus anthracis (Bacillus antrhritis) protective antigen, Yersinia pestis (Yersinia pestis) antigen, antigens from bacterial pathogens such as Francisella tularensis, mycobacterium (mycobacter), Legionella (legioninella), Burkholderia (Burkholderia), Brucella (Brucella) and Coxiella (coxella); antigens from viruses, in particular intracellular invaders such as HIV; other toxoids, such as botulinum toxoid or Epsilon toxin; a tumor antigen; multi-agent biodefense antigens; an antigen from a non-biological threat infectious agent; pestis antigens (platue antigens); and combinations of all of these.

In other examples, mutants of toxoplasma can be used to express any other gene that is desired to be expressed in a mammalian host cell. This may include genes encoding therapeutic peptides or proteins, such as therapeutic antibodies (e.g., trastuzumab) for treating a disease or condition, proteins (e.g., interferons, blood factors, insulin, erythropoietin, and clotting factors) or enzymes (e.g., asparaginase, catalase, lipase, and tissue plasminogen activator); and proteins, enzymes or peptides for use in screening assays to identify inhibitors or activators (i.e., effectors) thereof.

Other non-toxoplasma vaccine antigens that may be included are Leptospira (Leptospira) antigens, clostridium (closteridial) antigens, rabies antigens, Campylobacter (Campylobacter) antigens and corynebacterium (corynebacterium) antigens.

The mutant toxoplasma or vaccines comprising the same may be used in various methods of inducing an immune response and protecting a subject from infection by toxoplasma and/or non-toxoplasma disease. Such methods generally involve administering to an animal in need of treatment (e.g., an animal at risk of exposure to an infectious disease or at risk of developing cancer) an effective amount of an attenuated mutant toxoplasma or vaccine of the invention, thereby generating an immune response and protecting the animal from infection by toxoplasma and/or non-toxoplasma disease.

An effective amount, as used in the context of the present disclosure, is an amount that produces a detectable immune response (e.g., a Th-1 response, a natural granulocyte, a neutrophil, a macrophage, GR1+ macrophage, a B cell or T cell immune response) or antibody production. According to some examples, the toxoplasma mutant expresses an exogenous antigen, thereby generating protective immunity against the pathogen or disease from which the antigen is derived or associated. However, in other examples, only the toxoplasma mutants of the present disclosure are sufficient to generate an immune response against toxoplasma. An effective amount of a toxoplasma mutant of the present disclosure prevents or treats a sign or symptom of toxoplasma. The response to administration can be measured by monitoring T cell or antibody responses according to any suitable method known in the art.

In other examples, the mutant toxoplasma parasites described herein may be used to provide an industrial source of starch as an alternative to plant-derived sources of starch.

The following specific examples are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. Without further elaboration, it is believed that one skilled in the art can, using the description herein, utilize the present invention to its fullest extent. All publications cited herein are incorporated by reference in their entirety. Where a URL or other such identifier or address is mentioned, it is to be understood that such identifier may vary and that the particular information on the internet may vary, but equivalent information may be found by searching the internet. Reference thereto demonstrates the availability and public dissemination of such information.

Those skilled in the art will recognize that numerous variations and/or modifications may be made to the above-described embodiments without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Examples

Materials and methods

Parasite culture

Toxoplasma gondii tachyzoites were maintained in D1 medium (Dulbecco's modified Eagle Medium [ DMEM)]Supplemented with 1% fetal bovine serum [ Invitrogen]And 2mM Glutamax [ Gibco]) In Human Foreskin Fibroblasts (HFFs), at 10% CO₂At 37 ℃ in a humid atmosphere. For growth in the absence of glucose, the parasites were maintained in glucose-free DMEM supplemented with 4mM glutamine and 6mM Glutamax (Gibco). HFF was grown and maintained in D10 medium (supplemented with 10% calf serum [ Thermo Scientific ] prior to inoculation with parasites]DME).

DNA cloning and transfection

DNA amplification was performed using PrimeSTAR HS or PrimeSTAR MAX DNA polymerase (Takara) according to the manufacturer's instructions. Restriction enzymes were from New England Biolabs (NEB). Oligonucleotide primers are provided in table 1 below.

TABLE 1 oligonucleotide primers

Q5 mutagenesis (NEB) was performed according to the manufacturer's instructions. Some plasmids are constructed internally and detailed information on these plasmids can be provided as required.

For electroporation using the 4D Nucleofector system (Lonza), 2X10 was used⁶The parasites were suspended in 20. mu.l of supplemented P3 solution containing variable amounts of DNA depending on the experiment. Transfection was performed in 20. mu.l Nucleocuvette strips (Lonza) using the F1-115 program (T cells, human unstimulated, HE).

After electroporation, parasites were immediately transferred to HFF in complete medium or in medium without glucose. For drug selection, recombinant parasites were selected by addition of chloramphenicol (20 μ M), or mycophenolic acid (20 μ g/mL) and xanthine (50 μ g/mL), or with 5 μ M5 '-fluoro-2' -deoxyuridine (FUDR) (for negative selection in the absence of uracil phosphoribosyltransferase [ UPRT ]).

Disruption of the genomic sequence of the trehalose synthase/phosphatase (TPS/TPP) gene (ToxoDB gene ID TGGT 1-297720; FIG. 1) was performed using CRISPR/Cas9 technology (Shen Z et al, (2014) Dev Cell Sep 8; 30 (5): 625-36; Sidik S.M. et al, PLoS One2014Jun 27; 9(6): e100450 PMID: 24971596). The UPRT prototype-spacer of plasmid pSAG1-Cas9-U6-sgUPRT was replaced by the target TPS/TPP gene prototype spacer (CCCGTCTCTGGGGAATTGGC) by Q5 mutagenesis using primers 1 and 2 in Table 1 (Shen et al, 2014). Primer 2 also adds a "G" at the 5' end of the protospacer to better initiate transcription. This construct (10. mu.g) was transfected into RH:hxgrptparasite (Donald RG and Roos DS (1998) Mol Biochem Parisitol 15; 91 (2): 295-. After 48 hours of incubation, parasites were FACS sorted (based on high GFP expression) into wells of a 96-well microplate (Corning) at 3 parasites/well. Two parasite clones producing visible starch granules were sequenced using the selection oligonucleotides 3 and 4 in table 1. One clone contained a single point mutation (FIG. 3B; RH: Δ hxgprt: Δ tps/tpp cl-1) while the other contained a 183 base pair insertion from the transfected plasmid, both resulting in a frameshift mutation (FIG. 3C; named RH: Δ hxgprt: Δ tps/tpp cl-2).

This mutant comprises the following sequence:

the proto-spacer is underlined and the PAM motif is shown in bold. The insert sequence is highlighted.

To address the fact that the Δ tps/tpp phenotype reverts to the wild-type phenotype over time in culture, the Δ tps/tpp parasite was also produced in glucose-free medium. By omitting glucose as a carbon source, there is no severe amylopectin phenotype, but it can be induced by the subsequent addition of glucose to the medium. To this end, the RH Δ hxgprt parasite, which had been maintained in glucose-free DMEM supplemented with 4mM glutamine and 6mM Glutamax (Gibco), was transfected with 20 μ g of pSAG1-Cas 9-U6-sgTPS/TPP. Parasites were cloned by limiting dilution in glucose-free medium supplemented with Glutamax/glutamine. After 7 days, clones that produced starch granules RH,. DELTA.hxgprt,. DELTA.ttps/tpp, when transferred to D1 medium containing glucose were sequenced and found to contain a single base pair deletion that caused gene disruption (FIG. 3; designated as RH,. DELTA.hxgprt,. DELTA.tps/tpp cl-23).

To destroy TPS/TPP in type II Pru: tdTomato parasites, 20. mu.g of pSAG1-Cas9-U6-sgTPS/TPP were transfected into the parasites and immediately cloned at 5 parasites/well in 96-well plates containing HFF in D1 medium (lacking glucose, but containing 6mM glutamine and 4mM glutamine). After 14 days, single clonal lines with visible starch accumulation were further expanded and sequenced, indicating the presence of a large >1kb insertion, disrupting the TPS/TPP locus (FIG. 3E; Pru: tdTomato: Δ TPS/TPP cl-2).

This mutant comprises the following sequence:

the proto-spacer is underlined and the PAM motif is shown in bold. The insert sequence is highlighted. N indicates a nucleotide base that cannot be determined from sequence reads.

Generation of Δ tps/tpp mutants with HA-tagged hexokinase

To generate a Δ tps/tpp parasite with a double HA-tagged hexokinase at its C-terminus, the 3 'region of the Toxoplasma hexokinase (HxK) gene (Toxo DB gene # TGGT1_ 265450; FIG. 4) was amplified using oligonucleotides 5 and 6 having the sequences 5' -CTCAGATCTACTTTCCCGAGAGGAAGAGTG-3(SEQ ID NO: 14) and 5'-ttcctaggtcctgctccagcagcgtagtccgggacatcgtacgggtatcctgcaccagcGTTCACATCTGCGATCAGAGC-3' (SEQ ID NO: 15), respectively, and inserted into pgCM3 (gift from Giel van Dooren) via Bgl II and Avr II restriction sites. pgCH-HxK (20. mu.g) was linearized with Kas I and the DNA was then precipitated and transfected into the RH/. DELTA.hxgprt/. DELTA.Ku 80 parasite. After 48 hours of incubation, the transfected parasites were selected with 20. mu.M chloramphenicol. DNA sequencing of HA-tagged hexokinase revealed the following modified C-termini:ADVNAGAGYPYDVPDYAAGAGPRAGAGYPYDVPDYAAGAGPGDVDIEL (SEQ ID NO: 20) (where the original WT hexokinase C-terminus is highlighted by underlining and the two HA tags are highlighted by shading).

To disrupt TPS/TPP in the RH: Δ hxgprt: Δ ku80: HxK-HA background, 10 μ g of pSAG1-Cas9-U6-sgTPS/TPP was combined with 100 μ g of annealed oligonucleotides 7 and 8 having the sequences 5'-GGTCTTCCCCGTCTCTGGGGAATTGACTAGCTGAGCAGGTGAGGCTGCGTCGCCGTCGC-3' (SEQ ID NO: 16) and 5'-GCGACGGCGACGCAGCCTCACCTGCTCAGCTAGTCAATTCCCCAGAGACGGGGAAGACC-3' (SEQ ID NO: 17) in Table 1 (designed to insert a stop codon in the TPS/TPP reading frame) and electroporated into RH: Δ hxgprt: Δ ku80: HxK-HA parasite.

To obtain viable parasites, the transfection and cloning procedures must be performed in D1 medium without glucose supplemented with glutamine/Glutamax. The transfected parasites were cloned into 96-well plates at 3 parasites/well and clones producing starch particles when transferred to D1 medium containing glucose were sequenced and found to contain a deletion of 58bp leading to disruption of the TPS/TPP gene (FIG. 3; RH: Δ hxgprt: Δ TPS/TPP: HxK-HA cl-1). The deleted sequences are shown below:

GTCGCCGTCGTCGGGTCTTCCCCGTCTCTGGGGAATTGGCAGgtgaggctgcgtcgcc (SEQ ID NO: 21). To obtain a peptide having a molecular weight of Δ hxgprt: Δ ku80: HxK-HA background was generated as a Δ CDPK2 parasite, and 20ug of the previously used CDPK2 gene knockout construct (Uboldi A et al (2015) Host Cell and Microbe 18: 670-681) was digested with Nhe I/ClaI for transfection. Parasites were cloned by limiting dilution.

Plaque assay to determine growth of the Δ tps/tpp parasite under glucose-free and glutamine-free conditions

The parasites were scraped and passed through a 27 gauge needle to release the intracellular parasites. Debris and intact cells were pelleted by low speed centrifugation (3 minutes at 450rpm in a Beckman GS-6KR centrifuge). Followed by centrifugation at 2000rpm for 5 minutes to pellet the parasites. The parasites were resuspended in 10ml DMEM medium lacking glucose and glutamine and centrifuged as before to pellet the parasites. Parasites were counted and added at 200 parasites/well to wells of a 6-well plate containing a confluent HFF monolayer in media containing 5.55mM glucose and 4mM glutamine or lacking glucose or glutamine. After 7 days, plaque assays were performed by removing the medium, fixing with 80% ethanol for 20 minutes and staining the monolayer with crystal violet stain (2% crystal violet (w/v) and 0.16% ammonium oxalate in 20% ethanol) for 20 minutes. The single layer was then washed with water to reveal plaques.

Periodic Acid Schiff (PAS) dyeing

Parasites were added to wells of fused HFF monolayers contained in media containing 5.55mM glucose and 4mM glutamine or lacking glucose or glutamine. Infected monolayers at 37 ℃ and 10% CO₂After 4 days of incubation, PAS staining was performed as follows: the medium was removed and the infected monolayers were washed once with PBS and then fixed with PBS/4% formaldehyde (Sigma) for 20 min. The formaldehyde fixative was removed and the fixed monolayer was washed twice with PBS, then the coverslip was placed in 80% ethanol and PAS staining was performed using standard protocols. PAS stained coverslips were mounted onto slides and PAS fluorescence was measured through a594 channel on an AP Deltavision Elite microscope (GE Healthcare) equipped with a Coolsnap2 CCD detector and captured with SoftwoRx software (GE Healthcare). The color images of PAS staining were captured using a Nikon 90i Upper/Widefield microscope (Nikon).

Immunofluorescence assay

HFF grown on coverslips were infected with parasites and fixed with 4% Paraformaldehyde (PFA) (Sigma-Aldrich) in PBS for 25 minutes. The fixed samples were infiltrated with 0.1% Triton X-100 in PBS for 10 minutes (BioRad), blocked with 3% (w/v) BSA in PBS (Sigma-Aldrich) for 1 hour, and probed with primary antibody overnight at 4 ℃ before being placed in a fluorescent secondary antibody (Invitrogen) coupled to Alexa Fluor for 1 hour at room temperature. When DAPI staining of nuclei was required, 0.2. mu.g/ml (final concentration) of DAPI was used. Images were taken by an AP DeltaVision Elite microscope (GE Healthcare) equipped with a CoolSnap2 CCD detector and captured by SoftWoRx software (GE Healthcare). Images were viewed using Image J software and assembled using Image J, Adobe Photoshop and Illustrator software.

Antibodies used for immunofluorescence assays were rat anti-HA (clone 3F 10; Roche), rabbit anti-GAP 45 (gift from Con Beckers, Univ. North Carolina), and mouse anti-SAG 1(DG52) (gift from John Boothroyd, Stanford University).

In vivo infection of mice with Pru: tdTomato: Δ tps/tpp parasite

Pru: tdTomato (WT) and Pru: tdTomato: Δ tps/tpp parasites were scraped and passed through a 27 gauge needle to release intracellular parasites. Low speed centrifugation (450rpm, 3 minutes) was used to pellet debris and intact cells. Followed by centrifugation at 2000rpm for 5 minutes to pellet the parasites. The parasites were resuspended in 10ml PBS and washed by centrifugation as described above. The parasite pellet was resuspended in PBS at a concentration of 10000 parasites/100. mu.l. 10000 parasites were used to inoculate C57BL/6 mice and their weight and survival were monitored over several weeks.

Hexokinase activity assay

Freshly shed RH: WT and RH: Hxk-HA parasites from T25 cultures were spun at low speed (5 minutes at 350rpm in a Beckman GS-6KR centrifuge) to pellet cell debris. The supernatant was centrifuged at 2000rpm for 5 minutes to pellet the parasites. The parasite pellet was used immediately for the hexokinase activity assay or stored at-80 ℃ for later stages. The hexokinase assay was performed according to the manufacturer's instructions (Abcam) with minor modifications as follows: the parasites were washed twice with ice-cold PBS and then resuspended in 200-400. mu.l ice-cold assay buffer and pipetted 5-10 times up and down to lyse the cells. The lysate was centrifuged at 130000 rpm for 5 minutes at 4 ℃ to precipitate insoluble material. The supernatant was collected and used for the hexokinase assay. For each reaction, 50 μ l of lysate was combined with an equal volume of reaction mixture prepared according to the kit instructions. The absorbance at 450nm was then measured over time and the hexokinase activity was determined by comparison to a standard curve of NADH absorbance and normalized to the protein concentration in the lysate as determined by the BCA method (Pierce).

Complementary assay

To complement the Δ TPS/TPP parasite with wild-type TPS/TPP or modified heterologous protein, WT TgTPS/TPP and mutant cDNA were ligated to vector pHTU-3xHA (created internally). The vector places the complemented wild-type TgTPS/TPP and mutant variants under the control of 2760bp of the upstream region of tubulin and introduces a triple HA tag at the C-terminus of the protein. This plasmid allows selection with mycophenolic acid and contains regions of genomic DNA from the UPRT locus to stably integrate the construct into the locus following selection with 5 '-fluoro-2' -deoxyuridine. To generate constructs for complementing the Δ tps/TPP parasite with full-length TgTPS/TPP, gBlock 1 was amplified with oligonucleotides 9 and 10 (table 2) and gBlock2 with oligonucleotides 11 and 12 (see table 3).

TABLE 2 gBlock sequences

The amplified gBlock was digested with Bgl II/Sac I (gBlock 1) or Sac I/Nhe I (gBlock2) and ligated to pHTU-3HA via these sites. To generate a complementary construct containing PfHAD1 protein, codon optimized gBlock 3 was amplified using oligonucleotides 13 and 14, digested with Bgl II and Nhe I, and ligated to pHTU-3 HA. Likewise, to create constructs complemented with SpTPP1, codon optimized gBlocks 4 and 5 were amplified with oligonucleotides 15 and 16, and 17 and 18, respectively, digested with Bgl II/Psi I (gBlock 4) and Psi I/Nhe I (gBlock 5) and ligated to pHTU-3 HA. To generate a complementary construct comprising only the TgTPS domain but lacking the TgTPP domain, the TPS domain was amplified using oligonucleotides 9 and 19 using the pHTU-TgTPS/TPP-3HA complementary construct as DNA template. The TgTPS domain was inserted into pHTU-3HA via Bgl II and Nhe I sites. Constructs comprising a TgTPS domain fused to either PfHAD1 or SpTPP1 domain were also created. For the TgTPS-PfHAD1 construct, PfHAD1 domain was amplified from gBlock 3 using oligonucleotides 14 and 20 and digested with Nhe I, while TgTPS domain was amplified using oligonucleotide 21 and oligonucleotide 22 or 23 (to create a different linker sequence) and digested with Bgl II. SpTPP1 was amplified from pHTU-SpTPP1-3HA template DNA using oligonucleotides 18 and 24 as described above and digested with Nhe I to fuse with the TgTPS domain. To generate constructs to compensate with ScTPS1, codon optimized gBlock 6 was amplified with oligonucleotides 25 and 26, digested with Bgl II and Nhe I and ligated to pHTU-3HA through these sites. To generate a construct for complementation with the TgCBM20 domain fused to the ScTPS1 domain, the TgCBM20 domain was amplified with oligonucleotide 27 and oligonucleotide 28 or 29 (to create a rigid or flexible linker between the domains) and digested with Bgl II. ScTPS1 gBlock 6 was amplified using oligonucleotides 26 and 30 and digested with Nhe I. These two products were linked to pHTU-3HA via these sites. To create a complementation construct (complementation construct) of TgTPS/TPP, the missing substrate binding residues in this construct were reintroduced (thus presumably giving rise to the reaction product T6P), gBlock 7 was amplified using oligonucleotides 9 and 31 and gBlock 8 was amplified using oligonucleotides 12 and 32. gBlock was digested with Bgl II/Mlu I (gBlock 7) and Mlu I/Nhe I (gBlock 8) and ligated to pHTU-3HA via Bgl II and Nhe I sites. To create a complementing construct that lost the ability to bind amylopectin, gBlock 9 (containing mutations in 3 important starch binding residues) was amplified using oligonucleotides 9 and 10, digested with Bgl II/Sac I and ligated to Sac I/NheI-digested gBlock2 and Bgl II/Nhe I-digested pHTU-3 HA. To create constructs to compensate for the RH: Δ ku80: Δ hxgprt: Hxk-HA: Δ tps/tpp parasite, Bgl II/Sac I-digested gBlock 1 and SacI/Nhe I-digested gBlock2 were ligated to Bgl II/Avr II-digested pHTU-3MYC (created internally).

To tag the C-terminus of TgTPS/TPP with a triple Myc epitope tag, the 3' region of the gene was amplified using oligonucleotides 33 and 34 and inserted into pgCM3 through Bgl II and Avr II restriction sites. The construct was linearized with Sfo I for transfection into the parasites RH: Δ ku80: DHFR, RH: Δ ku80: Δ hxgprt: Hxk-HA and RH: Δ ku80: DHFR: Δ cdpk2 and drug selection was performed with chloramphenicol. To prepare Myc-tagged constructs that can be selected for mycophenolic acid/xanthine, the TPS/TPP fragment was cleaved with Spe I from the above-described pgCM3-TPS/TPP-3MYC construct and ligated to the pHTU-3HA vector backbone digested with Spe I and Nhe I. The resulting pHTU-TgTPS/TPP-3xMyc construct was digested with Aar II and 10. mu.g was transfected into a plasmid containing RH,. DELTA.ku 80,. DELTA.hxgprt: in the Hxk-HA parasite, lines of RH,. DELTA.ku 80,. DELTA.hxgprt,. DELTA.hxk-HA, TPS/TPP-3Myc were produced.

TABLE 3 oligonucleotides

Cyst assay

Pru: tdTomato: Wt and Pru: TdTimato: Δ tps/tpp parasites, which had been maintained in D1 medium without glucose, were added to monolayers of Human Foreskin Fibroblasts (HFFs) on coverslips in 6-well plates (Corning) at an M.O.I. of 1 parasite per 5 host cells. The parasites were spun onto HFF by centrifugation at 1400rpm for 3 minutes and in 10% CO₂Was incubated at 37 ℃ for 4 hours in a humid atmosphere to allow adhesion and invasion. The D1 medium without glucose was removed and replaced with bradyzoite induction medium (RPMI-Hepes, pH 8.1; 5% FBS) once every other day. Modified IFA combination antibody staining and PAS staining was performed as described in Sugi T et al, (2017) mBio 8, e 01289-17.

Delta TPS/TPP immunization

Delta TPS/TPP tachyzoites prepared from tissue culture and resuspended at 1X10⁴200ul in PBS. With 1x10⁴Individual tachyzoites were infected intraperitoneally (i.p) with 6x wild type C57BL/6 and monitored actively over 3 weeks.

Attack by wild-type parasites

Pru: tdTomato: delta hx strain (type II) Toxoplasma strain from 1x10⁴Harvest in tissue cultures resuspended in PBS/200 ul PBS. Six first experimental and 6 delta tps/tpp immunized animals were then i.p. injected with 1x10⁴The Pru: tdTomato: Δ hx strain was monitored daily for body weight and signs of infection.

Example 1 disruption of Toxoplasma gondii (Tg) TPS/TPP-like genes results in amylopectin within Toxoplasma gondii tachyzoites A large accumulation of.

To investigate the function of TPS/TPP-like proteins, the inventors created gene disruptions in highly toxic type I (RH) tachyzoites and less toxic cyst-forming Prugniaud (type II) strains. The genetic ablation of TgTPS/TPP in RH and tdTomato expressing P lines was confirmed by PCR and sequencing.

After gene disruption, large numbers of amylopectin granules were visible in the remnant and in the tachyzoite itself, as detected by Periodic Acid Schiff (PAS) staining (fig. 5A and C).

The inventors then evaluated the ability to grow through the lytic cycle by performing a plaque assay on confluent human foreskin fibroblasts. Surprisingly, the growth of tachyzoites RH. DELTA. tgtps/tpp was severely reduced in fibroblasts when the host cells were cultured in standard high glucose medium (FIG. 5B). In contrast, when the host cells were cultured in a glucose-free medium containing glutamine as an alternative carbon source, the growth of the mutant was partially restored (FIG. 5B). Interestingly, the addition of glutamine to the glucose-containing medium did not rescue growth, indicating that glucose itself, but not an excess of carbon source, is toxic in the absence of the TPS/TPP-like gene.

Example 2 disruption of TPS/TPP results in a reduction in virulence in vivo.

To investigate whether acute infection in animal models requires TPS/TPP-like genes, C57BL/6 mice were infected with the parent Pru: tdTomato and Pru: Δ TPS/TPP parasites (see mutant FIG. 3E) and their survival and weight changes were followed over time. Mice infected with the parental parasite lost 10% of their body weight after 10 days and had to be killed (fig. 5D). In contrast, mice infected with the Pru. DELTA. tps/tpp parasite lost little weight, and subsequently returned to pre-infection levels (FIG. 5D). Mice infected with wild-type Pru parasite lost body weight significantly over time and reached a peak loss 10 days post infection (fig. 5D). At about this time, the mice rapidly succumbed to infection (fig. 5E).

Microscopic examination of brain tissue showed no cysts in these mice. Therefore, TgTPS/TPP is essential for the growth of both acute and chronic tachyzoites in the affected tissue. The results also indicate that both stages are typically exposed to high glucose concentrations in vivo.

Example 3: loss of TgTPS/TPP is associated with a defect in central carbon metabolism

Toxoplasma gondii tachyzoites metabolize glucose through a variety of pathways, including glycolysis and pentose phosphate pathways, and also direct excess glucose into the synthesis of the major storage carbohydrate, amylopectin (Uboldi AD et al, (2015) Cell Host Microbe 18, 670-. Wild-type RH tachyzoites usually have very low levels of amylopectin, as shown by schiff periodate staining at the intracellular parasite stage, indicating that most of the glucose taken up by these parasites is used for glycolysis. In contrast, RH: the Δ tgtps/tpp tachyzoites accumulated large amounts of periodate-schiff positive granules in both the cytoplasm and the residuum (a membrane network continuous with the head of the developing tachyzoite and usually containing foreign metabolites) (fig. 6A). Excessive accumulation of amylopectin granules occurred when the infected fibroblasts were cultured in a medium containing glucose, but not in a medium containing glutamine as a main carbon source without glucose (fig. 6B). Biochemical analysis confirmed that the RH. DELTA. tgtps/tpp tachyzoites accumulated 100-fold higher levels of amylopectin compared to wild-type parasites (FIG. 7A). When in use¹³When C-glucose labeled intracellular RH tachyzoites, glucose associated with amylopectin was effectively labeled, indicating that the polysaccharide was constitutively synthesized and turnover under glucose-rich conditions (fig. 7B). RH. DELTA. tgtps/tpp parasite¹³Measurement of C-glucose incorporation into amylopectin indicated a 5-fold increase in glucose flux into amylopectin synthesis in the mutant lines (fig. 7B). Thus, TgTPS/TPP appears to regulate glucose uptake and/or downstream flux into different pathways of carbohydrate metabolism.

Metabolite profiles of the RH parental and RH Δ TgTPS/TPP tachyzoites indicate that loss of TgTPS/TPP is associated with global changes in parasite central carbon metabolism. Specifically, LC/MS analysis of polar metabolites (leading to detection of 2657m/z signature) revealed elevated levels of intermediates in the mutant in the upstream glycolysis and pentose phosphate pathways (figure 8). Intermediates in the glycolysis-fed pathway, including the deoxy-xylulose phosphate pathway (DOXP), were also elevated in knockout parasites (fig. 8). In contrast, the levels of most amino acids and intermediates in the TCA cycle were largely unaffected by the loss of TgTPS/TPP (FIG. 8). Thus, loss of TgTPS/TPP appears to result in an overall increase in glucose utilization and flux to pathways associated with upstream glycolysis.

Next, the inventors measured the rate of glucose uptake in the extracellular RH parent and the RH. DELTA. TgTPS/TPP mutant tachyzoites to investigate whether TgTPS/TPP could modulate the activity of plasma membrane glucose transporters. Surprisingly, the TgTPS/TPP deficient tachyzoite parasite showed similar or slightly lower levels compared to the parental line¹⁴C-glucose uptake rate (FIG. 9A). To determine whether the downstream steps of glucose catabolism were enhanced without TgTPS/TPP, parental RH and RH. DELTA. TgTPS/TPP tachyzoites¹³C-glucose was metabolically labelled and determined by GC/MS¹³Kinetics of C incorporation of hexose phosphate and other glycolytic intermediates. Surprisingly, the synthesis rates of glucose-6-phosphate (FIG. 9B) and metabolically linked hexose-phosphate were greatly increased in the RH Δ TgTPS/TPP mutant, indicating that TgTPS/TPP might negatively regulate phosphorylation of glucose.

LC-MS/MS proteomic analysis of parasite extracts indicated that there was no alteration in the expression of hexokinase in TPS/TPP knockout parasites compared to WT parasites and no post-translational modification was detected. In addition, in glucose-rich media¹³The complementary metabolic labeling of extracellular parasites with C-glutamine revealed very little labeling of hexose phosphate in both parental RH and RH Δ tgtps/tpp tachyzoites, indicating that elevated levels of sugar phosphate in mutant tachyzoites were not due to increased gluconeogenic flux.

Example 4 disruption of TgTPS/TPP in combination with disruption of hexokinase leads to a greater reduction of mutant parasites Poisoning by toxic substances

To further assess whether the increased expression of hexokinase activity directly resulted in a severe amylopectin phenotype and loss of viability of the RH. DELTA. tgtps/tpp mutant in which an HA epitope-tagged form of Toxoplasma gondii hexokinase (TgHexK) was overexpressed. Overexpression of hexokinase in the mutant was associated with a dramatic decrease in parasite proliferation, the formation of a very large residuum full of amylopectin granules within one day of infection and further expansion of this residuum and a general loss of parasite integrity at day 7 (FIG. 10).

The accumulation of a large number of amylopectin granules was not reduced and morphological aberrations formed until the parasite died (FIG. 11). This defect was more severe than seen with the Δ tps/tpp parasite with untagged wild-type hexokinase (fig. 11), indicating that the newly modified C-terminus (comprising two HA tags) is responsible for the increased severity of the Δ tps/tpp phenotype.

Moreover, this severe phenotype was specific for the Δ tps/tpp: HxK-HA parasite, in contrast to the Δ cdpk2: HxK-HA parasite which only exhibited starch accumulation levels typical for the Δ cdpk2 parasite (FIG. 12).

The catalytic activity of hexokinase was increased by HA-tagging the C-terminus (fig. 13), indicating that the enhancement of the Δ tps tpp phenotype by HA-tagged hexokinase was due to its increased catalytic activity.

These findings indicate that TgTPS/TPP generally down-regulates hexokinase activity and that in the absence of TgTPS/TPP, excess glucose-6-phosphate synthesized by highly active hexokinase is transferred into amylopectin synthesis, leading to pathological accumulation of amylopectin granules.

Example 5 CBM20 and TPP domains of TgTPS/TPP are important for Activity

TgTPS/TPP contains an N-terminal carbohydrate binding module (CBM20) which is expected to bind to amylopectin and remain on the amylose column after cell lysis and passage of the cytosolic extract through the amylose column (fig. 15), indicating that it may be recruited to amylopectin granules in vivo. Indeed, when the myc tagged form of TgTPS/TPP was expressed in the wild-type RH parasite, this epitope was associated with a small spot distributed throughout the cytoplasm (fig. 14). Surprisingly, the TgTPS/TPP-myc protein was to a large extent transferred to the residual body when expressed in the RH. DELTA. cdpk2 parasite, which hyper-accumulated amylopectin granules in the residual body (FIG. 14), supporting co-localization of TgTPS/TPP with the granules. Interestingly, expression of TgTPS/TPP-myc in the Δ cdpk2 knock-out line revealed a second population of tagged proteins associated with the periplasmic network conforming to mitochondrial localization (FIG. 14). This localization was confirmed by co-labeling the parasite with the antibody TOM40 against the mitochondrial marker (fig. 14). These data indicate that TgTPS/TPP targets both the amylopectin granule in the cytosol and the outer mitochondrial membrane.

Finally, to determine which domains of TgTPS/TPP are involved in regulating hexokinase activity and amylopectin accumulation, the RH: Δ TgTPS/TPP mutant was complemented with a mutant or truncated TgTPS/TPP protein fused to an HA epitope (not shown). The genes encoding each construct were randomly integrated into the chromosomal locus and the population examined by immunofluorescence microscopy (localization of proteins and presence of amylopectin precipitates in enlarged residues), Western blot and GC/MS analysis of trehalose metabolites. The knockout line fully restored the normal morphology of the residuum after complementation with a construct expressing full length TgTPS/TPP (not shown). Complementation with full-Length TgTPS/TPP protein (where the key residue in the CBM20 binding domain required for amylopectin binding is mutated) (TgTPS/TPP-CBM^mut) The residuum phenotype can also be restored, but only in cells where high levels of expression are observed. Loss of CBM function in this construct was confirmed by amylose chromatography. Thus, targeting TgTPS/TPP to amylopectin granules is likely to facilitate function but is not essential. Importantly, expression of the truncated TgTPS/TPP protein lacking the C-terminal phosphatase domain failed to complement the mutant and prevent amylopectin accumulation and residual body swelling, suggesting that this domain is critical for function. To investigate whether other closely related phosphatase domains could replace the TPP domain of TgTPS/TPP, the knockout line was further complemented with a fusion protein in which the TPP domain of TgTPS/TPP was replaced by Schizosaccharomyces pombe trehalose-specific phosphatase TPP1 or promiscuous Plasmodium falciparum (Plasmodium falciparum) sugar phosphatase HAD 1. These chimeric proteinsNone of them could compensate for the amylopectin phenotype of the Δ tps/tpp parasite. Similarly, complementation of the RH Δ tgtps/tpp mutant with s.cerevisiae TPS1(ScTPS1) by itself and as a CBM20 fusion failed to complement the mutant phenotype. Interestingly, the RH. DELTA. TgTPS/TPP mutant lines expressing trehalose 6-phosphate synthesized by ScTPS1 demonstrated that these heterologous proteins were active as determined by GC/MS analysis of whole cell lysates, whereas trehalose 6-phosphate synthesis alone was insufficient to satisfy the regulatory activity of TgTPS/TPP. Finally, expression of a mutant form of TgTPS/TPP with restored putative substrate binding residues showed a TgTPS/TPP-like localization pattern, but failed to complement the Δ tps/TPP phenotype.

Example 6 bradyzoite cystodysplasia in the Δ tps/tpp parasite

Two days after induction of bradyzoite differentiation, large amylopectin granules were visible in the Δ tps/tpp parasite, but absent from the Wild Type (WT) parasite. Furthermore, the bradyzoite surface marker SRS9 was less intense for the Δ tps/tpp parasite compared to the WT parasite. Excessive accumulation of amylopectin clearly destroyed the Δ tps/tpp cyst morphology 7 days after bradyzoite induction. Individual parasites could not be distinguished by staining with SRS9, SRS9 appeared in a circular pattern around the periphery of the cyst-like structure. In contrast, the WT parasite expressed high levels of SRS9 around the periphery of the individual bradyzoites within the cysts. After 7 days, small amylopectin granules, characteristic of bradyzoite differentiation, were also visible in the WT cysts. Toxoplasma cyst loading in mouse brain was monitored using quantitative PCR. The complete absence of TPS/TPP knockdown (Δ TPS/TPP) or below detectable levels indicates that the mutant fails to survive as a bradyzoite.

Example 7 immune challenge with TPS

The inventors wanted to determine whether infection with the Δ tps/tpp strain (patent deposit number ATCC PTA-125166, corresponding to Pru: tdTomato: Dtps/tpp cl-2(SEQ ID NO: 8)) could prevent subsequent wild-type parasite challenge, thereby demonstrating the utility of this strain as a live surveillance vaccine. To do this, the inventors first looked at 1x10⁴The first C57BL/6 mice used in the experiment were infected with Δ tps/tpp and waited for 5 weeks. Then, the user can use the device to perform the operation,they used 1x10⁴Both wild type (Pru: tdTomato: Δ hx) tachyzoites i.p. infection-immunized and first-time experimental animals were monitored daily for body weight and signs of disease. As expected, the first experimental animals experienced a typical course of infection, starting with weight loss approximately at day 5 and dying from infection on days 9 to 12 (fig. 17A).

However, animals immunized with Δ tps/tpp did not lose any body weight, and 100% of the animals survived the challenge (fig. 17B). This indicates that Δ tps/tpp immunization can completely protect animals from challenge by wild strains of Toxoplasma gondii.

Remarks for note

The inventors herein show that the multidomain protein TgTPS/TPP has developed new regulatory functions in regulating carbon metabolism in the center of toxoplasma gondii, which functions are essential for the intracellular growth and survival of these parasites in both the acute and chronic stages. Although both the TPS and TPP domains of this protein appear to lack detectable catalytic activity, they retain many of the residues required for hexose phosphate/sugar nucleotide binding and may serve as intracellular sugar phosphate sensors. In the presence of high concentrations of glucose (as in cultured host cells and in infected tissues), TgTPS/TPP may experience high intracellular glucose-6-phosphate levels and exert negative regulatory effects on hexokinase activity and on the key pathway of glucose-6-phosphate entry into central carbon metabolism. Although we could not detect the direct interaction between TgTPS/TPP and hexokinase using pull-down or in vivo cross-linking assays, these proteins might be correlated on the amylopectin particle or on the outer mitochondrial membrane. Whether the TgTPS protein domain is able to sense other metabolites as has been speculated in certain fungi and plants remains to be investigated. These findings add increasing evidence that toxoplasma gondii is highly dependent on post-transcriptional/translational mechanisms to regulate central carbon metabolism. This strategy can rapidly respond to the availability of carbon sources in different cell types or tissue niches and/or modulate their growth rates to a major immune response.

Deposit description

Toxoplasma gondii mutant Pru: tdTomato: TPS/TPP (25 vials) was received by American Type Culture Collection (ATCC)10801University Boulevard, Manassas, Va.2018, at 9, 14, and assigned patent deposit number PTA-125166.

Toxoplasma gondii mutant RH HXGPRT: Ku80: TPS/TPP: HK2HA (25 vials) was received by American type culture Collection 10801University Boulevard, Manassas, VA at 9/14.2018 and assigned patent deposit number PTA-125164.

Toxoplasma gondii mutant RH HXGPRT TPS/TPP (25 vials) was received by American type culture Collection 10801University Boulevard, Manassas, Va.2018, 9, 14 and assigned patent deposit number PTA-125165.

These deposits will be provided according to the requirements of the budapest treaty. However, it should be understood that the provision of a deposit does not constitute a license to practice the invention in the detriment of a patent granted by the government. Furthermore, the relevant culture deposits will be stored and made public according to the provisions of the budapest treaty on the deposit of microorganisms, i.e. they will be stored, maintained as necessary to remain viable and not contaminated until at least five years after the last request to provide a sample of the deposit, and in any case at least 30 (thirty) years from the date of deposit, or the expiration date of any patent disclosing the possible grant of the culture plus five years after the last request to obtain a sample of the deposit. If the depositor cannot provide the sample on demand due to the conditions of the deposit, the depositor acknowledges the obligation to change the deposit.

Sequence listing

<110> The Walter and Eliza Hall Institute for Medical Research

<120> parasite vaccine

<130> 518905PCT

<160> 63

<170> PatentIn version 3.5

<210> 1

<211> 12471

<212> DNA

<213> Toxoplasma gondii (Toxoplasma gondii)

<400> 1

atgctgtaca ccagggtttt cttccgtgca gtggttcgga cagacttcgg tgaacgagtc 60

gccgtcgtcg ggtcttcccc gtctctgggg aattggcagg tgaggctgcg tcgccgtcgc 120

ctgcgccgct tcgtgacacg gcgaacggtc gaaatgacaa gggaaaaccg ttcgttagga 180

aaaaccgttc gttctgaggc cacagctctt ctcgcaactc gcgcgctgca tgtgcctgtc 240

tcgtagagtc tgcatcacct tctggaggtc gggcgtttgc gggggaacgc gacgtcgact 300

gtgcgggaca aagggagaga ggggctctcg cgtcgcgcgg ctcagaagtc aaacagttgc 360

atttcgagtt ttgcgaaacg gagaacgaaa catgcatgcg cctttttgaa gaccgtctgt 420

gctgaacaca actccacgaa tcggacgagc tcaaaccgtg tgtatgtgtg tgtgacggac 480

tcgaactggc gcgacgtcca aacacaccgt cttcactttg actaaaaaag gagctgtttc 540

tcgaggacgc ttgcaggaag ttcacccttc cttcttcttt ttcgcattcg aaagaacgaa 600

ggaaaaatcc atagagaccg cagcggccgg tccccgggtc cgcttccaag tggggtgtgt 660

gtagacccca cggcgggaac tcggaggtcg agctgtgcgt ctgaagaagc gaccgcccgt 720

attgtttttt cttccccgac gagtttgccg agtttgtctc gcgcgcgaat ctgaggaaac 780

gcgcctctgt gtgccgacgg agttatgtgt ctgtcacaat ccatgaagct ctccttgcgg 840

ccatcagagc tacggactgg tcgtggaggc cagccgcgcc gcgagacgct ttgatgagca 900

acttgttttt cgtgggcaaa gcggagacaa aaacggggaa gcagtctgag agagacgaag 960

ctgctcaccc gttgccctgg acggcgcaca ccactgtggt tttgcatgtc catctccgtg 1020

tcgggcaaat atcgttgcat gcgccagttt agcttttgcg cttctgtggg agacacagtc 1080

tgtttgccgt gtctcgttcg acgttctctg gagttcttta cacggacgtg cagttcaact 1140

caaggcacca cggaagccgc ctgcatgtcg cggttgggcg cgcgcgcaaa aaacgttctc 1200

ttgtttgcgg tccgtttccc ttttcaggct gaacacggcc atgagctgac cacaaacgag 1260

gatgtcttcc cttcgtggtt ctccaaggag cctgtctact tgccgctaaa gaaacccata 1320

tcttacaaat atgttgttct cgacgaacgc ggcgacatcg tgaggtaggc gacagaggac 1380

atagacagaa acatctattt tactgtccat gtgtatcaat agttacatct atctacaggg 1440

atctatctac ttgaatatat ctacagggat ctatctactt gaatatatct acagggatct 1500

atctacttga atatatctac agggatctat ctacgtttat gtgtctatct tctatctaat 1560

tattcatata cgcgtctaca tctgtacatg tgtataaaag gatatgcagt gtctgtatgc 1620

gaaggcggag cggagtgggt tgtgtacgag ggtccaaggg ggcgttgcat gcgaagagca 1680

tttttctcgg tttttggaca ggtgggaaga atgcgaggga aatcgcgagt tggtgcccac 1740

gggcttggag atgacggtgg aggatgacga tggccttttt agggagcaga tgacgaatcg 1800

cggcgaccac ggagtcgaag gcgatgacga cgtaagttcc cttctctgag tttggagttt 1860

ctctccctct atgcttctta ggaggctctt cttctcttcg ttcttgtgag gttctcttct 1920

tctcttcgtt cttgtgaggt tctcttcttc tcttcgttct tgtgaggttc tcttcttctc 1980

ttcgttcttg tgaggttctc ttcttctctt cgttcttgtg aggttctctt cttctcttcg 2040

ttcttgtgag gttctcttct tctcttcgtt cttttgaggt tctcttcttc tcttcgttct 2100

tttgaggttc tcttcttctc ttcgttcttt tgaggttctc ttcttctctt cgttcttttg 2160

aggttctctt cttctcttcg ttcttttgag gttctcttct tctcttcgtt cttttgaggt 2220

tctcttcttc tcttcgttct tgtgaggttc tcttcttctc ttcgttcttg tgaggttctc 2280

ttcttcgctt cgttcttgtg aggttctctc gcgttgcatg cctctctcgt agcttgctcc 2340

gccggcgcgt tctgatcccg acgccggcct cgttcccgtt ccccaggggt cttggccctc 2400

ggcggttgtc gccacgtttt cttccgctgt gctgcggaac tcgaacgcgt ttgtcgcgtc 2460

tgggcgcttc tctgcggttt ttcggctcag gtgtctgtgg cggctctgga caaggaggag 2520

gtggacgcgc gcaaccggat gctggcgatt caagaagaag agcctgagtt cgacgagaac 2580

gacagcgtaa ttgtgtgtgc tcttgacttg cctctgcgcg tggtgcgtgt ctcgccgtct 2640

cgtgaggctt ctccgctgcc ctcctctctg cccgcgtcgt cgaccgactc ttccggccaa 2700

acagaaaagc gcgcggtttc attcccggaa gacgcgggcg cgagtgcccg gcgctcgagt 2760

tcgaccgtcg cggcgactcg ggaggaggaa acgactcgca ctgcgagttc ctttccaaaa 2820

gtcgaggaga cggcggagag aggacgcgac agctctctcg ctctttggcc tggcgcagcg 2880

cgcgacgctg ccggcgactt cggggaggcg cttcagccgc gcgcgacgcg cagccgacga 2940

ggcacctttg aagtgaggcc gagcaagagc gcgttgttgc cttcgctgtt tcacctgagg 3000

aagaagacgc ggctgcctgt gcgtttcgtc gggtggccgg gcatccacgt cgagaacgaa 3060

gaggagcagg cggagattgc ggagctgctg cgagcctacg actgttcgcc gatcttccca 3120

gacaaagacg agttcgactg ccatctcacc ttctgccatc aggtcctgtg gccgctgttt 3180

cacaacgtcg tcgtccttga ctccaatacc caggtcccgt tcgactccga cctctgggcc 3240

aagtaccagg ctgtgaacaa actgtgggcg gacgcggtgc tccgccaggc gcacgaaacc 3300

gacatggtct gggtccacga ctaccacctg ctcctcgcgc ccatgcacat tacgcggaaa 3360

gtccgacgcg ccaacgtcgg cttctttctt cacatcccct tcccctcttc cgaaatcttc 3420

aggtgtctcc cttgccgaga agacgtgagt cgaaaagaaa aaaacgcgac gcgcgtcaac 3480

acctgcggct gtggcggagc ggtctctgct cgggggtgta tgtacacccg aggggcttcc 3540

cggaggtgtg agcaggccag gccgcgaggg cggcctctcc tccgacggcg ttgccatttt 3600

tttgcatgca agcttcagga aacacgcttt cttgccgcgg ctctcggtgc gtctgtctcg 3660

ttcgttcttt gcgttccccg tatcgatcca accaacatgg acagacgccg gttgtgggtc 3720

tgtgtctgtg tgcatgtatg cgcatctagg gacatgcgta tgagacgcaa atgtcttcaa 3780

cttgtattct gagtgcgtcc tgacgccgat gtgtatactg ggcgttgctt cgctgttgcg 3840

ctgtgcaagt cctttgaccg gttcggcggc ttttcctcct tctcttgttc agattttgcg 3900

agggatgctg tgcgcggact tgattgggtt tcacctcttc gagtacgcgc gccactttct 3960

ggtcgcatgc aagcggctgc tcggcctcga gcaccatttt tgtcgagggg gcattctgaa 4020

catcgagtac ggcggccgca acgtctcggt ccgcatcggc catgtccaca ttcagtacgc 4080

cgacattcgc tcgaaaatcg aggcaaaccc ggtggttctg cagatggcgc gagacatcag 4140

gtaaaacaca cggacatcca gagacaggaa agaaagggga aatgggggaa atatgaaaga 4200

cagggctacc ccgctggacg gggctcgatt tcgagaagct ccaggtgtct agacaccgcg 4260

ctttaccgca agtagttgtg ggtgcagaga ccaagttgtg tttcctcttc ccctttggtg 4320

gaaagtgttc gatcctttcc agattccatg cacttctgta tggccgttct gtcgttttcc 4380

aacgacgcct cggcttctct gcggtgtccg tacggcacct gtttcccgag tgctgcgacg 4440

cgttttctct gaacattccg gattttctgg atctccgttt cgcaaaagga atgtggaatt 4500

tttagcctcc ggtgtccgtc gtctctctgc atgcctgttc agacaaaaac acgtcggaaa 4560

attcatcttc gtctccgtgg accgctgcga gaaattggcc ggtctcctcc tcaaagttcg 4620

cgccttccag gcgtttctcg tgacctactc ttatgccagg gtatgttcct tcaaaagcgt 4680

tgtgcgcgca ttgtcctctg ttgttctcaa ccttcttcct ccgtcgcgcc tggacggagg 4740

ctctcccttc gcttcccttt ttctctctct gcttctttac ttccgtcgac gcttgtgtgg 4800

gtgcttggct gtggctttta gacgcgtcgc gcgtgtgaat ggagccgcag agtgtatccg 4860

cgagaaacgc gcatcaatgc gtagcgcgaa ctcgacttcc ttcgaggtcc agcttgagta 4920

gcctccccag caaaagggag tttatgtgga cctagacatc ccttgaacat tgcggtcgac 4980

actttcctct cgactccgct gcgttttcag ggaaatgtcg tcctcattca gtacgcgtat 5040

cctaccatca aatacgcaga agacacagaa accatggcga cggaactcaa agagctcgtg 5100

gagaaagtca atgcccagtt cgccttgcca gatcgcccag gtgaggagaa atcgcaggtt 5160

ctttttcagt ctgccgaggt ctctgcagcg tgttctttct ttggggagca agggcgtctt 5220

ttttcggcaa aaccttctac cgcagtcttg ggtcactggt gcatcttgcc gctgtcgctc 5280

tgcacttgcc gctgtcgctc tgcacttgcc gctgtcgctc tgcacttgcc gttgtcgctc 5340

tgcacttgcc gctgtcgctc tgcacttgtc gttgtcgctc tgcacttgcc gttgtcgagc 5400

tctcccgagt tccgccgaat ttccttctct ctcgcgggtc ggctttcctc ttcgcgacag 5460

caaagacaac ggcgctgctc tgctgcctgg gtcgctgtct gtcgaggcgc catgtgaaaa 5520

actcgtcaag aatcattcag tcggtgtctg tgtgtctctc tggggagggg agaggggggt 5580

ctcctcatcg gctggccttg tcttctctgc ttgcgcggtc aaagaatcgt ttctctgggg 5640

tcgccagtgc actttgcggg tctcttcgtc tctctggaac ggcctctttt ttcagatttc 5700

caacatatcg aactccacat ccagccggtc ggctgggagg agaagtgggc gttgtttacc 5760

gcgggcgact gcttccttga cacatcgatc cgagatggcc tgaatctcaa tccgttcgaa 5820

tttatctgtt gccacaaaga caacgtcacc ggtgtgattt tatcagagtt cacggggtgc 5880

agcagagccc tcgcctcggc cattcgcgtc aatccttgga aggtcagttg aaaaagcaag 5940

tcagttgaaa aaacaagaca cacgcgaagc gcgctgagag acaaagggag ttcttctctc 6000

tcgtgccgtc tcctctcttt cgtctcgctc tttcgtcttt ctcctccctt tcttctctgg 6060

ctcgtcttcc gctgtagccg ccactctgcg ttcgtccgct gcgcctctgc aggtggaggc 6120

ggtggcagat gcgatggaca gaatcatcaa catgcctgtg gaggagcagc gcgaccggtt 6180

cacccgcgac cgcgactact tgagtcacaa cagtacgcag aagtgggcag acgaaaacat 6240

tctggatctg cgacgagccc ggaaaccaga cgacttcgtc tacgtctctt ggggtctcgg 6300

caacaccttc cgcgtcctag gcatggactc caacttccgg taagaagagt tgttaggacc 6360

gggggaacgg tcgacggcca aggcaggtcc acgcgacagt gcaacagaga gcggggaagc 6420

tgtcaagggg cgaacgcgtc agctctgctc agccaaagac gcggtcgggg ggccttcggg 6480

ggaagagaaa cgcacatgtg gtattccagc tctttcaaag ccggctgaac aaggtgctct 6540

gatgtgccaa ggacttcgct gtcggcgcgc ggatctgcgt agcgtcttct gccctagatc 6600

gcagcagcag gagtgtcaga gcgccgctgc aggagaacat cggcgaggaa ggaagggcgc 6660

ctggagtcga gtccaagaag gagaagccgc ggcagatccc ggaggaaacg acgaagagca 6720

ggaagggtgc cggcgcgcag agaggaagac agcgagaagg ggcggccgag gccggggaca 6780

gtgtggagaa aatgcgacag agcagtggag aacgggagga gaccagggga tggacaagtc 6840

gagaaggaag tcgaggaaaa ggacagcgag gaatcgacga agaagagagg gggaagggaa 6900

ccaatgcagc gcttttcaag gtttacggca acgaccagtt ctgcggagcg cctgcgattc 6960

gacccttcga actcgagttc tccagaagcg ttttcggact ttgttgctgc tcctgttttc 7020

caggtttctg gacacaaatc aagtggtgcg aggctaccga acttctcgac atcgcgtctt 7080

cttcttcgac tgcgaaggca cactcgcgcc ggacagacgc cgaatcactt ttgtacctgg 7140

cggcgaaaat ctttttgcgc aaggtcgccc gccttcgccg caagtcaagg actgtctcca 7200

ggcgcttgtc gacgaccaaa gaaacactgt tgtcattctc tcgggacgcg acagacacct 7260

cctagaggaa tggttctctt ccatcagagg cattggactt tgtgccgaac acggtaaggc 7320

gacagtgtag gtgcttcgac aaatctcgac gtcttccccc ccccctttcc cccccccccc 7380

ccccccacac acacacacac acacacatct acagatacat atgtatatgt atacatatat 7440

atacagttgt gtgcattata cgtacgcata tatatatacg tatgtatgca tatgcatata 7500

aaagcgtaca ctgatgtgcc gtatgcagaa acatagacgt agggatgcat tctgtggttc 7560

acggacatgt gagttgggag acagcgagag gaatcggttt cgttgagggt tcctggaatc 7620

gtcgagagtg agagtttgcg aaggatcggg tggctggatc tgaaaataaa gttttttcga 7680

gttctgcgga agcgaagagc cgtagggtgt cggaaacagg agagattctg caggggaaag 7740

acacacgaga tgcgcggttt ccgaggacac acacctggtc ccttcactca catgcagcat 7800

ctgctagctc ccacaatcca tggtcaatga gactccgttg ataaaagatc ccttccttct 7860

accacttcca cgttaatata tatatattta tatatatata tatatatagg tctatgtgta 7920

gatccgtaga aaggcgtata tgcatgtatc tgcacttttg tgtcggcgtg tatgtaaatg 7980

tatttacaca tacagatcca tgaatctcca tccatacgtt tttgtattta tgtagacata 8040

tatatatata tatatatatg tgtatgtata ggggggagat tgtgtgtttt tttgtcgttt 8100

gcttgagagg tttgttttca gtgcgttgtg gtgataagag cttttggagt gacctgcggt 8160

tggttttcag gtttttacta ccgggttccg ggcatcacgg gggaccagtg gcactgcatg 8220

tctcgtcaaa cagacttcac atggaagcaa gtggcgatcg agctgatgct gcagtatgtg 8280

aagcgaactc agggctcatt catcgaaaac aaagtaggtg aacggtggtt tttcttttct 8340

ggaacgtctc ccttgcgtgg acctcacgct ctctcctcga aacgtcgccg cccccgccac 8400

acagagctgc cggcgccttc tctctcctcg actagagaac tcgcaggtcg cggtcgagag 8460

cggagtcgaa gacgagtctc tttttcgctt cagttgcgaa gcgcgtcgtt tctgacttgg 8520

cgtccacgaa gaactggaaa aaaacctgtg ctggaacggt tctcaagagt cgaaaaccga 8580

cagttgtgac gcttgggacc cgcaagctga cttccaagtg cgacgcgaag ttcgctgcgt 8640

ttgaacactt gccagttgcg agaggatctc tgtagttcct tgcagacatt tcatgtccgc 8700

cgattccttc tctgcgcttg tgcgcagtct tcttgtcggc agttccttgc ggctggcggt 8760

agaaccgtac caaacacact ggcgtttaca cagagccccg ctgcgtctga ttcaccttgt 8820

gaaggaggag tgcgagggtg gctgttctgg acaagctttt gttcaccgtg acgtccgcct 8880

caaaactccg gaatgcacat cgcagagtcg gattcctgcg tctacagacg ctggcttttc 8940

tcttgtgcat gtgcctccag tcctgctcgg actcgaagct gaatgtgaca acagtgaatt 9000

cttctctcgt tctgctgcag ggaagtgctc tcgtcttcca gtaccgcgac gcagatccgg 9060

atttcggcag catgcaagcc aaggatctct cgaactacct cgggtgagaa actcgcattc 9120

tgcgcgaaca ccctcagcgc ttctcaggct ttgttcgccg catttcttca gacaaggaaa 9180

atgggtcggt gaagggcact gcgtcaggcg ccttcgcctc tcgccttcgg gtgcgcaacg 9240

tgtatcgaaa aggaatctga tttcttttca gggaactgct cttcggctat cctgtctcgg 9300

tcatgagcgg gaaaggctac gtggaagtga aactgcgagg tgtcaacaaa gggcatgcag 9360

tcgagaaagt tctgcggaaa ctcagcaacc tccacggaga cgtcgacttc gttctctgcg 9420

tcggagatga caggtaaaca gaccaatgaa agctgacgaa cgagacgcaa gaaaactcgc 9480

acgtgagcca tctacttcta ctcacgtgaa tacacataca tgcacatgca cacatactac 9540

ctacatatgt atatgcatat atatatatat atatatatat atatgtgcat atatatatat 9600

atatatatgt atatgcgtag agaagtactt gtgcagttct gtgtttgtga gtggatattc 9660

ctgtgcacag aggcgtagcg tttttcatgt gagttttaga agtgaatgta tgctgtttag 9720

tctggagaag gcgtcggctc ttttcagggc gcatactttt gaggaaaggt gagtttcgca 9780

gttgagggaa cgggaagcga gggtgttggc aggacgcgat tgagaagact gcattccaga 9840

ggccttcctt tcttctgaat tttcttcaga agcgacgaag acatgttcgc ggtcatcaac 9900

gccatgacgg aagacgggga ccagctgtgc ctgccagagg gcagcggcgc cgggagcagc 9960

ggcctctatc gccacacaca gtcgaaggat cgaattccta gacgcaactc tgtctctgta 10020

cgcggcgggt cgatgacgca acgcgtcaaa attggggaag cgagctgtcc tcagagatct 10080

gcgtacttct tccacactta cagacgtata catggctttc tgcgcagttg ctgctgtatc 10140

tgtaaatgtt tatgccgctc tttgtccaac atacatatac atatacatat atatatatat 10200

ttatttattt aatatattta atatattgat atttataagt gtatatatgt acagaaacgt 10260

tgcagaagtg cgtaggttga tagatgtgtg ccgtgagagg aagaaagccc tgacgtaccg 10320

tgagatgtgt gtcgcgagag tttgaaaaga catacacata tacatatata catatatata 10380

catatatata tatgtatata tatgtatata tatgtatctc gaactgttga gatacacgtc 10440

tgcataggtg taagtaacta gatgccaata cacagacaac agactttatt tgaatgtgcg 10500

tacatctttt ctctcgcttt cagtcggatg agaaccgagc agaagctgtc gttggaaacg 10560

tggagggact catgaagcgt gacgggtcga tgcagcatgc gggggcgctc ggcagcggct 10620

tgacctctgc gtcttccagc acaagtctca gtgggcacac aaaggtaaag gaaacaactg 10680

cgggggaagg cgtagaaagg cgagcaggaa ggcgaggagg aagagaagac aaagcgagga 10740

gcgagggaga gaccgaacgc agaaacaagg aggtgacgca aaggaggaga gccggaggag 10800

gaaggaggga cgaacacagg caaaaagaag agcagcagaa gggagggaga cgaacagcga 10860

gggagagaag agagcagaca aggagacgat acaacagagg aaagaaagca ggggaagacg 10920

cgcggggcgt accagagaaa gaagaaagga gacaggtacg aagcgaacgg tagggcggag 10980

ggagggagcg agagaagaga aacggagagg agagactcaa ccttgcgttc gaacaaggat 11040

gcagagcacg gagaagaatc gaaaggggct gcggagcccg acgatacaaa gaggagaaaa 11100

cagaaacaaa agacagagaa aaagaaacaa gacacaggag cgcagacaca gcatgaggaa 11160

acgaggacgg aagtgatgca agtgtgtatc tctttgttgt gttggaatgt gcagaaaacg 11220

agtcctcact ttttcacatg cacagtcggc aagaagccgt ccaacgctcg gtatgttttt 11280

tttaaaaaac aaagtttctt agagcacttt tccccgcgtt ttcgtctcgt gccgtctcat 11340

ctgcgtcttt ccttctcagc gcattacttc actttcttct ttttttcttt cgttgttcta 11400

atccagtctt cttgcgtgtg tgaatgctgt ctcgtccttc gtctctctcc atgcgtattt 11460

ctgttcctct cttggcccgc agtcgcctcc gtcaaggggg aacgcaaacg acgcggcgac 11520

gtggaacgcg aaatgtgcag aaggtgctcc acggtctcca gagttttctg aagtgtgtct 11580

tcaagtttcg ccgaacaacg attcgtgtcg actgttcgga taacttcaaa agacgacgcg 11640

ccatccttgt ttccctcctc tcgtttctgg ctttggcttt ttcgaaatgc ggagtttctc 11700

tgtttcattc gtctttttgg cccgttctcg atctcttcac aggtattacc tcaacgacac 11760

tgaggatgtc tccgatctcc tcgactctct gcagcagtgc actgagaagg taaacttctt 11820

gcccccagac acactctgtt cgcaggtgga ggcgtccgcc gtgtttttca gtttaatccg 11880

gttcttgcct tgggcctctc cccccccttt gttctacgcc atcggctctc ttcatgcgcg 11940

tcccgtcatg tgccgtcgcg ttctctttgc ggtgtccctc cttctctttc ctcgcttcgt 12000

gtgtgtttct cgtcgttttc tgtggcgtca cccccatcac tggctccctc cctcccatcc 12060

tgtctcttct gctgtcgcgt tctctctctt tttctgtgtt tgttcaatcc gcttgagctt 12120

ttcatctcgc tgcagctgtg ctcggctcgt gtggttctcc aggacgggaa ggagcagtgg 12180

agttcgtcga aggacgcgag ttgcctctcg gcgccagtcg tggcggccgc ggcggctgcg 12240

ggctcgctcg cggggaacgc ggcggtgcag ctgaggaaag gcgacagcgc agcttcgaac 12300

tttgcgagtc tgtggagatc gcctctggga tcaggagcag gtcgcacgag agaacgaacg 12360

ctcgcgcagt gggcggggca ggcaccgagc gccatcttca gtcgccccgt cggtgccgtt 12420

gaagttcgcg ccaacgcagc tggcagcaca gatcgcccaa cagacgagta g 12471

<210> 2

<211> 200

<212> DNA

<213> Toxoplasma gondii

<400> 2

atgctgtaca ccagggtttt cttccgtgca gtggttcgga cagacttcgg tgaacgagtc 60

gccgtcgtcg ggtcttcccc gtctctgggg aattggcagg tgaggctgcg tcgccgtcgc 120

ctgcgccgct tcgtgacacg gcgaacggtc gaaatgacaa gggaaaaccg ttcgttagga 180

aaaaccgttc gttctgaggc 200

<210> 3

<211> 3666

<212> DNA

<213> Toxoplasma gondii

<400> 3

atgctgtaca ccagggtttt cttccgtgca gtggttcgga cagacttcgg tgaacgagtc 60

gccgtcgtcg ggtcttcccc gtctctgggg aattggcagg ctgaacacgg ccatgagctg 120

accacaaacg aggatgtctt cccttcgtgg ttctccaagg agcctgtcta cttgccgcta 180

aagaaaccca tatcttacaa atatgttgtt ctcgacgaac gcggcgacat cgtgaggtgg 240

gaagaatgcg agggaaatcg cgagttggtg cccacgggct tggagatgac ggtggaggat 300

gacgatggcc tttttaggga gcagatgacg aatcgcggcg accacggagt cgaaggcgat 360

gacgacgtgt ctgtggcggc tctggacaag gaggaggtgg acgcgcgcaa ccggatgctg 420

gcgattcaag aagaagagcc tgagttcgac gagaacgaca gcgtaattgt gtgtgctctt 480

gacttgcctc tgcgcgtggt gcgtgtctcg ccgtctcgtg aggcttctcc gctgccctcc 540

tctctgcccg cgtcgtcgac cgactcttcc ggccaaacag aaaagcgcgc ggtttcattc 600

ccggaagacg cgggcgcgag tgcccggcgc tcgagttcga ccgtcgcggc gactcgggag 660

gaggaaacga ctcgcactgc gagttccttt ccaaaagtcg aggagacggc ggagagagga 720

cgcgacagct ctctcgctct ttggcctggc gcagcgcgcg acgctgccgg cgacttcggg 780

gaggcgcttc agccgcgcgc gacgcgcagc cgacgaggca cctttgaagt gaggccgagc 840

aagagcgcgt tgttgccttc gctgtttcac ctgaggaaga agacgcggct gcctgtgcgt 900

ttcgtcgggt ggccgggcat ccacgtcgag aacgaagagg agcaggcgga gattgcggag 960

ctgctgcgag cctacgactg ttcgccgatc ttcccagaca aagacgagtt cgactgccat 1020

ctcaccttct gccatcaggt cctgtggccg ctgtttcaca acgtcgtcgt ccttgactcc 1080

aatacccagg tcccgttcga ctccgacctc tgggccaagt accaggctgt gaacaaactg 1140

tgggcggacg cggtgctccg ccaggcgcac gaaaccgaca tggtctgggt ccacgactac 1200

cacctgctcc tcgcgcccat gcacattacg cggaaagtcc gacgcgccaa cgtcggcttc 1260

tttcttcaca tccccttccc ctcttccgaa atcttcaggt gtctcccttg ccgagacatt 1320

ttgcgaggga tgctgtgcgc ggacttgatt gggtttcacc tcttcgagta cgcgcgccac 1380

tttctggtcg catgcaagcg gctgctcggc ctcgagcacc atttttgtcg agggggcatt 1440

ctgaacatcg agtacggcgg ccgcaacgtc tcggtccgca tcggccatgt ccacattcag 1500

tacgccgaca ttcgctcgaa aatcgaggca aacccggtgg ttctgcagat ggcgcgagac 1560

atcagacaaa aacacgtcgg aaaattcatc ttcgtctccg tggaccgctg cgagaaattg 1620

gccggtctcc tcctcaaagt tcgcgccttc caggcgtttc tcgtgaccta ctcttatgcc 1680

aggggaaatg tcgtcctcat tcagtacgcg tatcctacca tcaaatacgc agaagacaca 1740

gaaaccatgg cgacggaact caaagagctc gtggagaaag tcaatgccca gttcgccttg 1800

ccagatcgcc cagatttcca acatatcgaa ctccacatcc agccggtcgg ctgggaggag 1860

aagtgggcgt tgtttaccgc gggcgactgc ttccttgaca catcgatccg agatggcctg 1920

aatctcaatc cgttcgaatt tatctgttgc cacaaagaca acgtcaccgg tgtgatttta 1980

tcagagttca cggggtgcag cagagccctc gcctcggcca ttcgcgtcaa tccttggaag 2040

gtggaggcgg tggcagatgc gatggacaga atcatcaaca tgcctgtgga ggagcagcgc 2100

gaccggttca cccgcgaccg cgactacttg agtcacaaca gtacgcagaa gtgggcagac 2160

gaaaacattc tggatctgcg acgagcccgg aaaccagacg acttcgtcta cgtctcttgg 2220

ggtctcggca acaccttccg cgtcctaggc atggactcca acttccggtt tctggacaca 2280

aatcaagtgg tgcgaggcta ccgaacttct cgacatcgcg tcttcttctt cgactgcgaa 2340

ggcacactcg cgccggacag acgccgaatc acttttgtac ctggcggcga aaatcttttt 2400

gcgcaaggtc gcccgccttc gccgcaagtc aaggactgtc tccaggcgct tgtcgacgac 2460

caaagaaaca ctgttgtcat tctctcggga cgcgacagac acctcctaga ggaatggttc 2520

tcttccatca gaggcattgg actttgtgcc gaacacggtt tttactaccg ggttccgggc 2580

atcacggggg accagtggca ctgcatgtct cgtcaaacag acttcacatg gaagcaagtg 2640

gcgatcgagc tgatgctgca gtatgtgaag cgaactcagg gctcattcat cgaaaacaaa 2700

ggaagtgctc tcgtcttcca gtaccgcgac gcagatccgg atttcggcag catgcaagcc 2760

aaggatctct cgaactacct cggggaactg ctcttcggct atcctgtctc ggtcatgagc 2820

gggaaaggct acgtggaagt gaaactgcga ggtgtcaaca aagggcatgc agtcgagaaa 2880

gttctgcgga aactcagcaa cctccacgga gacgtcgact tcgttctctg cgtcggagat 2940

gacagaagcg acgaagacat gttcgcggtc atcaacgcca tgacggaaga cggggaccag 3000

ctgtgcctgc cagagggcag cggcgccggg agcagcggcc tctatcgcca cacacagtcg 3060

aaggatcgaa ttcctagacg caactctgtc tcttcggatg agaaccgagc agaagctgtc 3120

gttggaaacg tggagggact catgaagcgt gacgggtcga tgcagcatgc gggggcgctc 3180

ggcagcggct tgacctctgc gtcttccagc acaagtctca gtgggcacac aaagaaaacg 3240

agtcctcact ttttcacatg cacagtcggc aagaagccgt ccaacgctcg gtattacctc 3300

aacgacactg aggatgtctc cgatctcctc gactctctgc agcagtgcac tgagaaggac 3360

gggaaggagc agtggagttc gtcgaaggac gcgagttgcc tctcggcgcc agtcgtggcg 3420

gccgcggcgg ctgcgggctc gctcgcgggg aacgcggcgg tgcagctgag gaaaggcgac 3480

agcgcagctt cgaactttgc gagtctgtgg agatcgcctc tgggatcagg agcaggtcgc 3540

acgagagaac gaacgctcgc gcagtgggcg gggcaggcac cgagcgccat cttcagtcgc 3600

cccgtcggtg ccgttgaagt tcgcgccaac gcagctggca gcacagatcg cccaacagac 3660

gagtag 3666

<210> 4

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> proto-spacer sequence, PAM motif and N-terminal sequence of WT T.

gondii targeted by CRISPR

<400> 4

cccgtctctg gggaattggc aggtgaggct gcgtcgccgt cgcc 44

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> Toxoplasma gondii mutant

<400> 5

cccgtctctg gggaattcgg caggtgaggc tgcgtcgccg tcgc 44

<210> 6

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Toxoplasma gondii mutant

<220>

<221> misc_feature

<222> (17)..(17)

<223> n is the a sequence of 181 heterologous nucleotides

<220>

<221> misc_feature

<222> (17)..(17)

<223> n is the a sequence of 182 heterologous nucleotides

<400> 6

cccgtctctg gggaaanggc aggcaggtga ggctgcgtcg ccg 43

<210> 7

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Toxoplasma gondii mutant

<400> 7

cccgtctctg gggaatggca ggtgaggctg cgtcgccgtc gcc 43

<210> 8

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> Toxoplasma gondii mutant

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a sequence of >1000 heterologous nucleotides

<400> 8

cccgtctctg gggaatttga nttaggcagg tgaggctg 38

<210> 9

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Toxoplasma gondii mutant

<400> 9

gacagacttc ggtgaacgag tcgcctgcgc cgcttcgtg 39

<210> 10

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 10

gggaattggc gttttagagc tagaaatagc aag 33

<210> 11

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 11

cagagacggg caacttgaca tccccattta c 31

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 12

atgctgtaca ccagggtttt cttcc 25

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 13

gatgcagact ctacgagaca ggcac 25

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 14

ctcagatcta ctttcccgag aggaagagtg 30

<210> 15

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 15

ttcctaggtc ctgctccagc agcgtagtcc gggacatcgt acgggtatcc tgcaccagcg 60

ttcacatctg cgatcagagc 80

<210> 16

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 16

ggtcttcccc gtctctgggg aattgactag ctgagcaggt gaggctgcgt cgccgtcgc 59

<210> 17

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<400> 17

gcgacggcga cgcagcctca cctgctcagc tagtcaattc cccagagacg gggaagacc 59

<210> 18

<211> 220

<212> DNA

<213> Artificial sequence

<220>

<223> sequence of Port of TPS/TPP-like gene with protospacer, PAM

motif and insert sequences

<400> 18

cccgtctctg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 60

cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg 120

cgcttaatgc gccgctacag ggcgcgtccc attcgcctcg ggggagccct tcagcttctc 180

atagtggctg gccaggtagg caggtgaggc tgcgtcgccg 220

<210> 19

<211> 1045

<212> DNA

<213> Artificial sequence

<220>

<223> sequence of port of TPS/TPP-like gene with protospacer and PAM

Sequence and partial sequence of insert sequence

<220>

<221> misc_feature

<222> (473)..(473)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (479)..(479)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (483)..(483)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (486)..(487)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (493)..(494)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (498)..(499)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (507)..(508)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (510)..(510)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (512)..(512)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (514)..(514)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (525)..(526)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (530)..(530)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (545)..(545)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (547)..(548)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (563)..(565)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (576)..(576)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (580)..(581)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (596)..(596)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (624)..(624)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (626)..(628)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (631)..(631)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (634)..(634)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (645)..(647)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (658)..(658)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (676)..(677)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (687)..(687)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (701)..(701)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (726)..(726)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (739)..(741)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (776)..(776)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (801)..(803)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (822)..(824)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (839)..(841)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (885)..(885)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (887)..(887)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (899)..(900)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (917)..(918)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (920)..(920)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (922)..(922)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (927)..(927)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (952)..(952)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (959)..(959)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (986)..(986)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (1005)..(1005)

<223> n is a, c, t or g

<220>

<221> misc_feature

<222> (1008)..(1008)

<223> n is a, c, t or g

<400> 19

gtcgggtctt ccccgtctct ggggaatttg acgcgcctcc tgcagaacgc gagacactgg 60

gatatgtaga gccaaggggg aaaccttcga actctcgaat gtcttctctg acaagaatca 120

tatttccatc agttctgtca gattttcaaa tggcgacctg cagaggcctg cttcctccct 180

gtgcgctctt cgaaggggct ttctgtcgcg cagggtaact gagttgttcc gttgtggctt 240

gcaggtgtca catccacaaa aaccggccga ctctaaatag gagtgtttcg cagcaagcag 300

cgaaagttta tgactgggtc cgaatctctg aacggatgtg tggcggacct ggctgatgtt 360

gatcgccgtc gacacacgcg ccagtcgcaa cgaccagtct ttgaagctgc acgcacatga 420

aatcacggac cgtggaaaag gcaacggatg taaaacttat tccaataccg tcnacctcna 480

ggnggnnccc ggnncccnnt tcgcccnntn gngngtcgta ttgcnnttcn ctggccgtcg 540

ttttncnncg tcgtgcctgg gannnccctg gcgttncccn ncttggtcgc cttgcngcgc 600

gtcccccttt cgccggctgg cgtntnnnct naanggcccg ctccnnncgc ccttcccngc 660

tcttgcgctt cctgtnnggc ctgctgncac gtctccctgt ntgcggcgct gttcgtcgcg 720

gccgcntcgt ggttgtgtnn ngcctccccc ggtgtcccgg ctcccttttg cccttngccc 780

ttgtgcgccc cgcgtccctt nnngcctttc cttttccttt tnnnttttcc ccgccctgnn 840

ntcttgcttt gccttttgcc tctggcctcc cgttcctggc ttttntntcc cccgcgccnn 900

ctttccgctg ttcccgnncn tnctccnctg ccttttttcc ctggccgccc gncgcgccnt 960

ccgctgcgcc ccggttttcg ctctcntggg tctcgcctgg ggttngcntg acggtatcga 1020

taagctttta ggcaggtgag gctgc 1045

<210> 20

<211> 48

<212> PRT

<213> Artificial sequence

<220>

<223> hexokinase modified C-terminal

<400> 20

Ala Asp Val Asn Ala Gly Ala Gly Tyr Pro Tyr Asp Val Pro Asp Tyr

1 5 10 15

Ala Ala Gly Ala Gly Pro Arg Ala Gly Ala Gly Tyr Pro Tyr Asp Val

20 25 30

Pro Asp Tyr Ala Ala Gly Ala Gly Pro Gly Asp Val Asp Ile Glu Leu

35 40 45

<210> 21

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> sequence deleted from SEQ ID NO:9

<400> 21

gtcgccgtcg tcgggtcttc cccgtctctg gggaattggc aggtgaggct gcgtcgcc 58

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> prototype spacer sequences

<400> 22

cccgtctctg gggaattggc 20

<210> 23

<211> 3277

<212> DNA

<213> Toxoplasma gondii

<400> 23

atgcagcctc gtcaaccagg cgacgaagcg aagcagctcg cggagctgga ggtgtggaca 60

tcacagctgg gtcgacgggg accataaaat ctgtgtaatt tcgtccgtgt gcagtgtggg 120

tgtgtacgta ggttatgcac acatttgagt tgatgctgat ttgcacgaat agcgctgcat 180

tttggcgcct tgtgtaaatg cgccgggaaa aatacgtcaa aatgtcctat ttttcgtccc 240

tggtgctgcc acctcgggaa tgtttcctgg gcattcgaag atgcacggtg gaaaaatggt 300

cgtacctact tcccccgatg aagtgcaagt ccgttggagc ctcgtatttg tgtgtggcag 360

ggtttgtgtg acaagcagct gcccaaaagc tgccttgatt tcagcacgaa caacttgggt 420

ctctcgtgcg acgcgaagca gtagcgagaa acctgagttt accggggagc ggggagtgac 480

aaatgtgaga tttctgagca catgcgggcc cgggaaagag ctttttttta gcatgcaacg 540

attctgtgtg acaggccaaa gaacaacagt cctatctttt ccaattccat gtccgctcag 600

gtcgttcgcc aaatgatgac cccgacacgc gaggttctgc tggagctgca cgaaagcttt 660

ttgaaggagc tacaacgcgt gagtattgtg gcctctgttt gacaaattgc tatttcgttt 720

caaggagtaa ctttcagtgg tgggaaggcc gtgcactacc atgctcttgc ctctctagca 780

acccccgttt acacttttgt ctctgtgaaa tgatcgaagc gagagagaat ttcgttttca 840

agcgtcacgg tactgacagt ctttcagaac ggaggtggga tgactgtacc gtctggttgc 900

atgacactcg tgcaagaagg ccgttgctgt tcttgtgcgt tcgctctcgg tgtcttctcg 960

gttgtgcata tttgctgttt gttcgaagct ctctccgctt cttcgcctgc ctcgctttcg 1020

ggcgcacgag acagcttcgc cttcatctcc atttcgtcgt ctgaaactgg attttgcgct 1080

cagggcttgg aaatgcacaa gagacacggc atcacatggg tgcctgagga atgctcgatg 1140

aaaatgctgg acagctgcgt gtcgaatctg ccgactggtg ccgaagttgg cgaggcatat 1200

gccatcgact tcggaggctc gacatgccgg gctgttcgtt gttctcttct tggcaagggc 1260

aaaatggaaa ttattcaaga caaaatctgg taagcacact ttaacgaatg gcgttggacg 1320

ctgtcgctag ctgccggttt gttgagagcg aacgagaagc tggcgagcct gtcatcgtgg 1380

tgctcaatgt gtgctttgct ttgcgtgttt acgtacagcc tgagaagcgc ggaacatcga 1440

tgcgccaagg gattcatgga caagaaggca ggaggcaaag aactgttcga ccaattcgcc 1500

atgtgcatcc gcggcctgat ggataggtcc ggagacctga agaaggcgga agagaccaac 1560

acacctgtcc cagttggatt cactttctct tttccttgcg cccaagcggt gagtttttgg 1620

aatcgtaaaa cagagcacta ttgggtcctc gatgtcggta actttcccga gaggaagagt 1680

gagggaacga cactttgctg acatttcttc aggaactggc aaggccacaa atgcggcgaa 1740

aggtggaagc cgggtttctg atgtcgtgac tcatacactt cgagaaagcc atcgatttgt 1800

gtttccaggc gttgaactct agctttctca ttgagtggac aaagggcttc gaaactggcc 1860

gcgagaaccc ggatcgtgta gaaggcaaag atgtggcagt gttgcttgcc gatgcactgc 1920

aacgtcataa cgttcctgct gtctgcaagg ctatcgtgaa cgacacggta agcacatttt 1980

acgtggaagc gtgagagacc atggttgtgt ccgaaggcat aactagccgt gcagcgatgg 2040

ctcccttgat gtgcgcatcc acgcgggagt attctttttt tctgctgact atagtctgtt 2100

gagtgggaaa gcggtgagcc gctcactgtg aaacccgtct ttggacttcg cttgcctctg 2160

tcaggttggc acattggtgt cttgcgcata tcaaagagtg ccaggcactc cggagtgccg 2220

tgttggactc atcatcggca ccgggttcaa cgcgtgctac gtggaacctg aagctagcaa 2280

ctatggctac acgggtaccg tcgtgaatat ggaggcaggc aacttccaca aggatcttcc 2340

gcgcaacgaa atcgacgtcg aggtgggtct gtggtgatgc aggatctgga agattaactc 2400

tccttgcgca catgcaagag ttggtgtttc ttttgaggac ggtatatgag gtgcagttat 2460

gggcgctcaa ttaggctatc ctgttacatt tgttctctgc gttcaggtcg atgagaagac 2520

acacaacaga ggcaaacagc aattcgagaa actcgtgtcg ggctactaca tcggcgaaat 2580

cgtccgggtc gctgcagtca gagtatttgg cgcccgtgcc cccgagaaag caaggtaaac 2640

aatcttctgt gtggatgttg aaggctgctg ggcgaatcct tgggttctta gacaccgcga 2700

cacggattcc ccgaataaca caacttccgg ttactgctgt gtatgtgttt ctcagtgtca 2760

gacactcgat tcatggtgaa acggcctcga cgatccgtga tgaccatagc caggacaaag 2820

ccgccagcat tcaggctatc aaggagtgct ggggtgtgac gatggacttg gacgacatca 2880

agtgcatctg ggagatttgc cgactcgtct tcgaccgctc agccgcgttc gctgcaacgc 2940

tggcggtcgc tctgtgctac cgaacagggg taagttccgt agtaactaaa attttttcca 3000

aactatcccg gcgcattcag ttctgatttt ttcccgttca ggcgcgattc ctaaacgagg 3060

tggacgctgt gattctgctt gtgctgttgt gcagcgactt gacaccggat ccaccgtagg 3120

aattgatggt gctttgtatg tgaagaacca gtggtaccgg gaggctgttg agtactacac 3180

aaaattggtc gccggcgacg cggcgaaaaa cattcactac tgcattgcgg atgacggctc 3240

tggcaagggt gctgctctga tcgcagatgt gaactga 3277

<210> 24

<211> 1789

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 1 sequence

<400> 24

catatagatc tatgctgtac accagggttt tcttccgtgc agtggttcgg acagacttcg 60

gtgaacgagt cgccgtcgtc gggtcttccc cgtctctggg gaattggcag gctgaacacg 120

gccatgagct gaccacaaac gaggatgtct tcccttcgtg gttctccaag gagcctgtct 180

acttgccgct aaagaaaccc atatcttaca aatatgttgt tctcgacgaa cgcggcgaca 240

tcgtgaggtg ggaagaatgc gagggaaatc gcgagttggt gcccacgggc ttggagatga 300

cggtggagga tgacgatggc ctttttaggg agcagatgac gaatcgcggc gaccacggag 360

tcgaaggcga tgacgacgtg tctgtggcgg ctctggacaa ggaggaggtg gacgcgcgca 420

accggatgct ggcgattcaa gaagaagagc ctgagttcga cgagaacgac agcgtaattg 480

tgtgtgctct tgacttgcct ctgcgcgtgg tgcgtgtctc gccgtctcgt gaggcttctc 540

cgctgccctc ctcgctgcct gcgtcgtcga ccgactcttc cggccaaaca gaaaagcgag 600

cggtttcatt cccggaagac gcgggagcga gtgcacggcg ctcgagttcg accgtcgcgg 660

caactcggga ggaggaaacg actcgcactg cgagttcctt tcctaaagtc gaggagacgg 720

cggaaagagg acgagacagc tcgctcgctc tttggcctgg cgcagcacgc gacgctgccg 780

gcgacttcgg ggaggcgctt cagccgagag cgacccgcag ccgacgaggc acctttgaag 840

tgaggccgag caagagcgcg ttgcttcctt cgctgtttca cctgcgcaag aagacgcggc 900

tgcctgtgcg tttcgtcggg tggccgggaa tccacgtcga gaacgaagag gagcaggcgg 960

agattgcgga gctgctgcga gcctacgact gttcgccgat cttcccagac aaagacgagt 1020

tcgactgcca tctcaccttc tgccatcagg tcctgtggcc gctgtttcac aacgtcgtcg 1080

tccttgactc caatacccag gtcccgttcg actccgacct ctgggccaag taccaggctg 1140

tgaacaaact gtgggcggac gcggtgctcc gccaggcgca cgaaaccgac atggtctggg 1200

tccacgacta ccacctgctc ctcgcgccca tgcacattac gcggaaagtc cgacgcgcca 1260

acgtcggctt ctttcttcac atccccttcc cctcttccga aatcttcagg tgtctccctt 1320

gccgagaaga cattttgcga gggatgctgt gcgcggactt gattgggttt cacctcttcg 1380

agtacgcgcg ccactttctg gtcgcatgca agcggctgct cggcctcgag caccattttt 1440

gtcgaggggg cattctgaac atcgagtacg gcggccgcaa cgtctcggtc cgcatcggcc 1500

atgtccacat tcagtacgcc gacattcgct cgaaaatcga ggcaaacccg gtggttctgc 1560

agatggcgcg agacatcaga caaaaacacg tcggaaaatt catcttcgtc tccgtggacc 1620

gctgcgagaa attggccggt ctcctcctca aagttcgcgc cttccaggcg tttctcgtga 1680

cctactctta tgccagggga aatgtcgtcc tcattcagta cgcgtatcct accatcaaat 1740

acgcagaaga cacagaaacc atggcgacgg aactcaaaga gctcgtgga 1789

<210> 25

<211> 1915

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock2 sequence

<400> 25

ctcaaagagc tcgtggagaa agtcaatgcc cagttcgcct tgccagatcg cccagatttc 60

caacatatcg aactccacat ccagccggtc ggctgggagg agaagtgggc gttgtttacc 120

gcgggcgact gcttccttga cacatcgatc cgagatggcc tgaatctcaa tccgttcgaa 180

tttatctgtt gccacaaaga caacgtcacc ggtgtgattt tatcagagtt cacggggtgc 240

agcagagccc tcgcctcggc cattcgcgtc aatccttgga aggtggaggc ggtggcagat 300

gcgatggaca gaatcatcaa catgcctgtg gaggagcagc gcgaccggtt cacccgcgac 360

cgcgactact tgagtcacaa cagtacgcag aagtgggcag acgaaaacat tctggatctg 420

cgacgagccc ggaaaccaga cgacttcgtc tacgtctctt ggggtctcgg caacaccttc 480

cgcgtcctag gcatggactc caacttccgg tttctggaca caaatcaagt ggtgcgaggc 540

taccgaactt ctcgacatcg cgtcttcttc ttcgactgcg aaggcacact cgcgccggac 600

agacgccgaa tcacttttgt acctggcggc gaaaatcttt ttgcgcaagg tcgcccgcct 660

tcgccgcaag tcaaggactg tctccaggcg cttgtcgacg accaaagaaa cactgttgtc 720

attctctcgg gacgcgacag acacctccta gaggaatggt tctcttccat cagaggcatt 780

ggactttgtg ccgaacacgg tttttactac cgggttccgg gcatcacggg ggaccagtgg 840

cactgcatgt ctcgtcaaac agacttcaca tggaagcaag tggcgatcga gctgatgctg 900

cagtatgtga agcgaactca gggctcattc atcgaaaaca aaggaagtgc tctcgtcttc 960

cagtaccgcg acgcagatcc ggatttcggc agcatgcaag ccaaggatct ctcgaactac 1020

ctcggggaac tgctcttcgg ctatcctgtc tcggtcatga gcgggaaagg ctacgtggaa 1080

gtgaaactgc gaggtgtcaa caaagggcat gcagtcgaga aagttctgcg gaaactcagc 1140

aacctccacg gagacgtcga cttcgttctc tgcgtcggag atgacagaag cgacgaagac 1200

atgttcgcgg tcatcaacgc aatgacggaa gacggagacc agctgtgcct gccagagggc 1260

agcggagccg gcagcagcgg cctctatcgc cacacgcagt cgaaggatcg aattcctaga 1320

cgcaactctg tcagttcgga tgagaatcga gcagaagctg tcgttggaaa cgtcgaagga 1380

ctcatgaagc gtgacggctc gatgcaacac gcaggagcac tgggatctgg attgacgagt 1440

gcatcgtcta gcaccagtct tagtggacac accaagaaga ccagtccgca cttcttcacc 1500

tgtaccgtcg ggaagaaacc ttcgaacgca cggtattacc tgaacgacac ggaagatgtc 1560

tccgatctgc tcgactcgct gcagcaatgc actgagaaag acggcaagga gcagtggagt 1620

tcgagcaagg acgcgagttg cctctcggca ccagtcgtgg cagctgcagc ggctgcggga 1680

tcgctcgcag gcaacgcagc ggtccagctg cgcaaaggcg actctgcagc atcgaacttt 1740

gcgagtctgt ggagatcgcc gctcggatct ggagctggac gcaccagaga gcgaacgctc 1800

gcgcagtggg ctggacaggc accgagcgcc atcttcagtc gacctgtcgg agcagttgag 1860

gttcgagcca acgcagctgg cagcacagat cgcccaacag acgaggctag catat 1915

<210> 26

<211> 885

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 3 sequence

<400> 26

catatagatc tatgcacgag atcgtcgaca agaacggaaa gaaggtccag aaaaacaacc 60

tcaatgacga gatcaagatc attttcacag accttgatgg cacgcttctg aattcggaga 120

ataaagtttc cgaacagaac ctggagtctc ttatccgagc gcaagaaaag gggatcaaag 180

tggtcatcgc gacggggcga tctatcttca gcgtcgaaaa cgtgattggc gaacacgtga 240

agaaaaaccg catttctctg cttcccggca tctacatgaa cggctgcgtg acgtttgatg 300

aaaagggatc tcgggtcatc gacagaatta tgaataacga tctcaagatg gagattcacg 360

aattctctaa acagattaac atttcgaagt acgcgatctg gttctgcctc gagaagacgt 420

actgcttcga aatcaatgac tgcattcgcg agtatatgga ggtcgaggcg ctgaacccgg 480

atgtgattga agacaatatg ctcgaggggc tgacagtcta taaggttctc ttttcgctcc 540

cggagaacat tctggaaaac acacttaaac tctgtaggga gaagttttcg cacaggatca 600

acgtcgcgaa taccttccag tcctacgtgg agctcttcca ccaacatacc aataaattcg 660

aaggggtgaa ggaaatctgt aaatactaca acatttccct taacaacgcc ttggccatgg 720

gcgatggcga gaatgatatt gaaatgttgt cgggattgac acattctgtt ggagttcaca 780

atgcgagcga gaaggttaag aactcggcgg cctatgtcgg gccttctaat aatgaacatg 840

cgatctctca tgttctcaaa accttctgcg acattgctag catat 885

<210> 27

<211> 1487

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 4 sequence

<400> 27

catatagatc tatgtccgtt tatggcaaga tccctagcac ttcttttgag catgagaata 60

cattcgagct ctctggcgac ctcttggacc cggaggaact gaagtctctt ggagtctccg 120

gaagaattat ctatgtcctg cgccaccttc cgtttaaaag ctcgattaat gaagagacgc 180

gagaatggga tctttccgga cgacggggcg ctactactat gtactcgtcc atgaactggt 240

tggccaatag cacgtattgg cagaccacac tggtcggctg gaccggggtt attccgaccg 300

tttctgagaa ggaggagaat aaggatgcgg ttaccagatt ggactcgcaa gacgtgaagc 360

gcttcgaaga aacatattcc caatggaact ctggggaacg cagcacagag tatgtgcctg 420

tgtggctgcc tgggccggaa aaaggcagcg aaaccatcat taacgaaacc agatcccagc 480

agtctcgctg gctcgcgtac gcagaaaatg ttatccgacc ccttattcac tataagtatt 540

ggccgtctag cgaggtggac gagaatgagg agcaatggtg gcgggattac gttaagatga 600

atcacgcttt cgctgataaa atttgtgaaa tctataagcc gggagacttt attatcgttc 660

aagactacag cctgttcctg gttccgcagc tgatcagaaa taaaattgac gacgcagtta 720

ttgggttcta tcatcatcac ccgtttccgt cctccgaaat cgctcgatgc ttcccccggc 780

gcagagcaat tctgcgatcg gttctcggag cggattttat cgggtttgaa gactattctt 840

atgcacgcca ttttatttcc tgctgttccc gtgttctgga cttggagatc gggcacgatt 900

gggtgaatct gaatggcaat aaggtgactg tgagagcaat tacagtgggc attgacgttc 960

cccgcattat ccgtagcagc gggaatgttt cggtctccga gaaattggaa gagcttaata 1020

aacggtatga gaacatgaag gtgatccttg gcagagatcg gctcgacgag ctgtatgggg 1080

tccctcagaa acttagatcg tttcagcgct ttttgcgaac gtacccggag tggcgaaaaa 1140

aggttgtgct cattcagatc acgatctcct ctgcctttaa gcatcctaag cttctcagca 1200

gcatcaagaa gctcgtgcaa gcaatcaacc aagagttcgg gacggacgac tacactcccg 1260

ttcaccatgt ggaagagcaa ctggaaccgg cagactattt cgcccttttg accagagccg 1320

atgctttgtt tatcaattcg atccgagagg gcgtctctaa tcttgccctt gaatacgtgg 1380

tttgccagcg agatcgctat ggtatggtct tgctctcgga atttacggcc acaagcgcca 1440

tgttgcacga cgttcctctg atcaatccgt gggattataa cgaatgt 1487

<210> 28

<211> 1006

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 5 sequence

<400> 28

ccgtgggatt ataacgaatg tgctgaaatc atttctaatg cactttccac ccctctggaa 60

cgccgcaaga tgattgaacg cgagtcgtat aagcaagtca ctacacacac gatgcaatct 120

tggaccagct ctctgatccg atctctcgcc aacaagcttg ccgctactaa aactgaccaa 180

agaatcccta ctctgacgcc ggaacacgct ctgtcggtct actccaaggc gtctaagcga 240

ctgtttatga tggactatga tggaacgttg accccgatcg tccgcgatcc taatgctgcg 300

gtcccttcga agaaacttct ggataatctg gcaacacttg ccgccgaccc caaaaatcag 360

gtgtggatta tctcgggccg agatcaacag ttcctgcgaa attggatgga cgatatcaag 420

ggactcgggt tgtctgctga gcatggctcg ttcgttcgaa agccgcattc cacaacgtgg 480

attaatcttg cagagctgct ggatatgtcg tggaagaagg aggttcgacg aatcttccag 540

tattatacag accgcaccca ggggtctagc atcgaagaga aacgctgtgc gatgacgtgg 600

cattacagaa aagctgaccc cgaaaacgga gcattccagg cacttgagtg tgaagccctt 660

ctcgaggaac tggtctgtag caagtacgat gtcgaaatca tgcgaggaaa agcgaatctc 720

gaagtcagac cctctagcat caataaagga ggcattgtca agcaaatctt gtccagctat 780

cctgaggaca gcctgccctc gttcattttc tgcgcaggcg acgaccgcac ggacgaggac 840

atgtttcggt cccttcataa aaatacgcgg attaataagg aaacatcctt tgctgtcacg 900

atcggctcgg acaagaagct gtccatcgca gactggtgca tcgccgatcc cgcaaatgtt 960

attgatatcc tggcagacct ggccaatttc accaacgcta gcatat 1006

<210> 29

<211> 1505

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 6 sequence

<400> 29

tataagatct atgactacgg acaacgctaa agcgcagctg acctcgtctt ctggaggcaa 60

cattatagtg gtgtcgaacc gccttcccgt gacaatcact aaaaacagca gcacgggaca 120

gtacgagtat gcgatgtcgt ccggaggcct ggtcacggcg ctcgaagggc tgaagaaaac 180

gtacacgttc aagtggttcg gatggcctgg gcttgagatt ccggacgatg agaaggacca 240

ggtgcgcaag gaccttctgg agaagtttaa tgccgtcccc atctttctga gcgatgaaat 300

cgcagacctc cactacaacg ggttcagcaa ttctattctc tggccgctct tccattacca 360

tcctggcgag atcaattttg acgagaatgc gtggttggca tacaacgagg caaaccagac 420

gttcaccaac gagattgcta agacgatgaa ccacaacgac cttatctggg tgcatgacta 480

ccacctcatg ctcgttccgg agatgctgcg cgtcaagatt cacgagaagc aactgcagaa 540

cgttaaggtc ggctggttcc tgcacacgcc gtttccttcg agcgagattt acagaatcct 600

tccggtccgc caagagattt tgaagggagt cctctcgtgt gatctcgtcg ggttccacac 660

atatgactat gcgagacact tcttgtcttc cgtccagcga gtgcttaacg tgaacacact 720

cccgaatggg gtggaatacc agggcagatt cgttaacgtc ggggcctttc ctatcggcat 780

cgacgtggac aagttcaccg atgggttgaa aaaggaatcc gtccaaaaga gaatccaaca 840

gcttaaggaa actttcaaag gctgcaagat catagttgga gtcgaccggc tggactacat 900

caaaggcgtg cctcagaagt tgcacgctat ggaggtgttt ctgaatgagc atccagaatg 960

gcgaggcaaa gttgttctgg tccaggttgc agtgccatct cgcggagatg tggaagagta 1020

ccaatatctc cgatctgtgg tcaatgagct cgtcggacga atcaacggcc agttcggcac 1080

tgtggaattt gtccccatcc atttcatgca caagtctata ccatttgaag agctgatttc 1140

gctctatgcc gtgagcgacg tctgccttgt ctcgtccact cgggacggca tgaacttggt 1200

ttcctacgaa tatattgctt gccaagaaga gaagaaaggc tccctcatcc tgtctgagtt 1260

tacaggtgcc gcacagtcct tgaatggtgc gattattgtc aatccttgga acaccgacga 1320

tctttctgat gcgatcaacg aggccttgac gttgcccgac gtcaagaaag aagttaactg 1380

ggaaaaactt tacaaataca tctctaaata cacttctgcc ttctggggtg aaaatttcgt 1440

ccacgaactc tactctacat cgtctagctc gacaagctcc tctgcgacca aaaacgctag 1500

ctata 1505

<210> 30

<211> 1733

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 7 sequence

<400> 30

catatagatc tatgctgtac accagggttt tcttccgtgc agtggttcgg acagacttcg 60

gtgaacgagt cgccgtcgtc gggtcttccc cgtctctggg gaattggcag gctgaacacg 120

gccatgagct gaccacaaac gaggatgtct tcccttcgtg gttctccaag gagcctgtct 180

acttgccgct aaagaaaccc atatcttaca aatatgttgt tctcgacgaa cgcggcgaca 240

tcgtgaggtg ggaagaatgc gagggaaatc gcgagttggt gcccacgggc ttggagatga 300

cggtggagga tgacgatggc ctttttaggg agcagatgac gaatcgcggc gaccacggag 360

tcgaaggcga tgacgacgtg tctgtggcgg ctctggacaa ggaggaggtg gacgcgcgca 420

accggatgct ggcgattcaa gaagaagagc ctgagttcga cgagaacgac agcgtaattg 480

tggtcgctaa ccgcttgcct ctgcgcgtgg tgcgtgtctc gccgtctcgt gaggcttctc 540

cgctgccctc ctcgctgcct gcgtcgtcga ccgactcttc cggccaaaca gaaaagcgag 600

cggtttcatt cccggaagac gcgggagcga gtgcacggcg ctcgagttcg accgtcgcgg 660

caactcggga ggaggaaacg actcgcactg cgagttcctt tcctaaagtc gaggagacgg 720

cggaaagagg acgagacagc tcgctcgctc tttggcctgg cgcagcacgc gacgctgccg 780

gcgacttcgg ggaggcgctt cagccgagag cgacccgcag ccgacgaggc acctttgaag 840

tgaggccgag caagggcgga ttgcttcctt cgctgtttca cctgcgcaag aagacgcggc 900

tgcctgtgcg ttgggtcggg tggccgggaa tccacgtcga gaacgaagag gagcaggcgg 960

agattgcgga gctgctgcga gcctacgact gttcgccgat cttcctcgac aaagacgagt 1020

tcgactgcca ttacaacggc ttctcgaatt ctatcctgtg gccgctgttt cacaacgtcg 1080

tcgtccttga ctccaatacc caggtcccgt tcgactccga cctctgggcc aagtaccagg 1140

ctgtgaacaa actgtgggcg gacgcggtgc tccgccaggc gcacgaaacc gacatggtct 1200

gggtccacga ctaccacctg ctcctcgcgc ccatgcacct ccgccggaaa gtccgacgcg 1260

ccaacgtcgg cttctttctt cacatcccct tcccctcttc cgaaatcttc aggtgtctcc 1320

cttgccgaga agacattttg cgaggggtgc tgtgcgcgga cttgattggg tttcacctct 1380

tcgagtacgc gcgccacttt ctggtcgcat gcaagcggct gctcggcctc gagcaccatt 1440

tttgtcgagg gggcattctg aacatcgagt acggcggccg caacgtctcg gtccgcatcg 1500

gccctatcgg cattgactac gccgacattc gctcgaaaat cgaggcaaac ccggtggttc 1560

tgcagatggc gcgagacatc agacaaaaac acgtcggaaa attcatcttc gtctccgtgg 1620

accgcctgga catgatcaag ggtctcctcc tcaaagttcg cgccttccag gcgtttctcg 1680

tgacctactc ttatgccagg ggaaatgtcg tcctcattca gtacgcgtat cct 1733

<210> 31

<211> 1964

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 8 sequence

<400> 31

cgtcctcatt cagtacgcgt atcctacccg cacggacgtc cctgagtacc agaagctcaa 60

atctcaggtg cacgagctcg tgggcagaat caatggacag ttcggcttgg tcgatcgccc 120

agatttccaa catatcgaac tccacatcca gccggtcggc tgggaggagc tctgggcgtt 180

gtttaccgcg ggcgacgtta tgcttgtgac atcgatccga gatggcatga atctcgtctc 240

gtacgaattt atctgttgcc acaaagacaa cgtcaccggt gtgattttat cagagttcac 300

ggggtgcagc agagccctcg cctcggccat tcgcgtcaat ccttggaagg tggaggcggt 360

ggcagatgcg atggacagaa tcatcaacat gcctgtggag gagcagcgcg accggttcac 420

ccgcgaccgc gactacttga gtcacaacag tacgcagaag tgggcagacg aaaacattct 480

ggatctgcga cgagcccgga aaccagacga cttcgtctac gtctcttggg gtctcggcaa 540

caccttccgc gtcctaggca tggactccaa cttccggttt ctggacacaa atcaagtggt 600

gcgaggctac cgaacttctc gacatcgcgt cttcttcttc gactacgacg gcacactctc 660

tccgatcgta gaggacccgg ataatctttt tgcgcaaggt cgcccgcctt cgccgcaagt 720

caaggactgt ctccaggcgc ttgtcgacga ccaaagaaac actgttgtca ttctctcggg 780

acgcgacaga cacctcctag aggaatggtt ctcttccatc agaggcattg gactttgtgc 840

cgaacacggt ttttactacc gggttccggg catcacgggg gaccagtggc actgcatgtc 900

tcgtcaaaca gacttcacat ggaagcaagt ggcgatcgag ctgatgctgc agtatgtgaa 960

gcgaactcag ggctcattca tcgaaaacaa aggaagtgct ctcgtcttcc agtaccgcga 1020

cgcagatccg gatttcggca gcatgcaagc caaggatctc tcgaactacc tcggggaact 1080

gctcttcggc tatcctgtct cggtcatgag cgggaaaggc tacgtggaag tgaaactgcg 1140

aggtgtcaac aaagggcatg cagtcgagaa agttctgcgg aaactcagca acctccacgg 1200

agacgtcgac ttcgttctct gcgtcggaga tgacagaacg gacgaagaca tgttcgcggt 1260

catcaacgcc atgacggaag acggggacca gctgtgcctg ccagagggca gcggcgccgg 1320

gagcagcggc ctctatcgcc acacacagtc gaaggatcga attcctagac gcaactctgt 1380

ctcttcggat gagaaccgag cagaagctgt cgttggaaac gtggagggac tcatgaagcg 1440

tgacgggtcg atgcagcatg cgggggcgct cggcagcggc ttgacctctg cgtcttccag 1500

cacaagtctc agtgggcaca caaagaaaac gagtcctcac tttttcacat gcacagtcgg 1560

caagaagccg tccaacgctc ggtattacct caacgacact gaggatgtct ccgatctcct 1620

cgactctctg cagcagtgca ctgagaagga cgggaaggag cagtggagtt cgtcgaagga 1680

cgcgagttgc ctctcggcgc cagtcgtggc agctgcagct gctgcgggat cgctcgcggg 1740

gaacgcggcg gtgcagctga ggaaaggcga cagcgcagct tcgaactttg cgagtctgtg 1800

gagatcgcct ctgggatcag gagcaggtcg cacgagagaa cgaacgctcg cgcagtgggc 1860

ggggcaggca ccgagcgcca tcttcagtcg ccccgtcggt gccgttgaag ttcgcgccaa 1920

cgcagctggc agcacagatc gcccaacaga cgaggctagc atat 1964

<210> 32

<211> 1789

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 9 sequence

<400> 32

catatagatc tatgctgtac accagggttt tcttccgtgc agtggttcgg acagacttcg 60

gtgaacgagt cgccgtcgtc gggtcttccc cgtctctggg gaatctccag gctgaacacg 120

gccatgagct gaccacaaac gaggatgtcg cgccttcgtg gttctccaag gagcctgtct 180

acttgccgct aaagaaaccc atatcttaca aatatgttgt tctcgacgaa cgcggcgaca 240

tcgtgaggct ggaagaatgc gagggaaatc gcgagttggt gcccacgggc ttggagatga 300

cggtggagga tgacgatggc ctttttaggg agcagatgac gaatcgcggc gaccacggag 360

tcgaaggcga tgacgacgtg tctgtggcgg ctctggacaa ggaggaggtg gacgcgcgca 420

accggatgct ggcgattcaa gaagaagagc ctgagttcga cgagaacgac agcgtaattg 480

tgtgtgctct tgacttgcct ctgcgcgtgg tgcgtgtctc gccgtctcgt gaggcttctc 540

cgctgccctc ctcgctgcct gcgtcgtcga ccgactcttc cggccaaaca gaaaagcgag 600

cggtttcatt cccggaagac gcgggagcga gtgcacggcg ctcgagttcg accgtcgcgg 660

caactcggga ggaggaaacg actcgcactg cgagttcctt tcctaaagtc gaggagacgg 720

cggaaagagg acgagacagc tcgctcgctc tttggcctgg cgcagcacgc gacgctgccg 780

gcgacttcgg ggaggcgctt cagccgagag cgacccgcag ccgacgaggc acctttgaag 840

tgaggccgag caagagcgcg ttgcttcctt cgctgtttca cctgcgcaag aagacgcggc 900

tgcctgtgcg tttcgtcggg tggccgggaa tccacgtcga gaacgaagag gagcaggcgg 960

agattgcgga gctgctgcga gcctacgact gttcgccgat cttcccagac aaagacgagt 1020

tcgactgcca tctcaccttc tgccatcagg tcctgtggcc gctgtttcac aacgtcgtcg 1080

tccttgactc caatacccag gtcccgttcg actccgacct ctgggccaag taccaggctg 1140

tgaacaaact gtgggcggac gcggtgctcc gccaggcgca cgaaaccgac atggtctggg 1200

tccacgacta ccacctgctc ctcgcgccca tgcacattac gcggaaagtc cgacgcgcca 1260

acgtcggctt ctttcttcac atccccttcc cctcttccga aatcttcagg tgtctccctt 1320

gccgagaaga cattttgcga gggatgctgt gcgcggactt gattgggttt cacctcttcg 1380

agtacgcgcg ccactttctg gtcgcatgca agcggctgct cggcctcgag caccattttt 1440

gtcgaggggg cattctgaac atcgagtacg gcggccgcaa cgtctcggtc cgcatcggcc 1500

atgtccacat tcagtacgcc gacattcgct cgaaaatcga ggcaaacccg gtggttctgc 1560

agatggcgcg agacatcaga caaaaacacg tcggaaaatt catcttcgtc tccgtggacc 1620

gctgcgagaa attggccggt ctcctcctca aagttcgcgc cttccaggcg tttctcgtga 1680

cctactctta tgccagggga aatgtcgtcc tcattcagta cgcgtatcct accatcaaat 1740

acgcagaaga cacagaaacc atggcgacgg aactcaaaga gctcgtgga 1789

<210> 33

<211> 440

<212> DNA

<213> Artificial sequence

<220>

<223> gBlock 10 sequence

<400> 33

ctctcaggtg ggcagtggcg tcggtttctt ctctcttcat tctcttgtcg cctgcgaagt 60

cgcgctgcgt gtctgcagct cgcgtttctt gtcgaggata aatacgcggt gccccaagac 120

atcgaaggag tcgtcgtcgg tgcggagact gttgccctgg tccagacgcg tacgcaggtc 180

cctagggaac aaaagttgat ttctgaagaa gatttgaacg gtgaacaaaa gctaatctcc 240

gaggaagact tgaacggtgc tagggccgag gagcagaagc tgatctccga ggaggacctg 300

tgagcacaca gcatcgtctt gacgcgtctc gacctcgctc tcgcgactca cttctccgga 360

gagacggaaa aacggtgcga gtcaagaact caggagaccc cgaatccgca gcttctacac 420

atcacggttc aggccggtca 440

<210> 34

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 34

catatagatc tatgctgtac accagggttt tcttc 35

<210> 35

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 35

tccacgagct ctttgagttc cgtc 24

<210> 36

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 36

ctcaaagagc tcgtggagaa agtcaatgc 29

<210> 37

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 37

atatgctagc ctcgtctgtt gggcgatc 28

<210> 38

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 38

catatagatc tatgcacgag atcgtcgaca ag 32

<210> 39

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 39

atatgctagc aatgtcgcag aaggttttga g 31

<210> 40

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 40

catatagatc tatgtccgtt tatggcaaga tc 32

<210> 41

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 41

acattcgtta taatcccacg gattgatc 28

<210> 42

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 42

ccgtgggatt ataacgaatg tgctgaaatc 30

<210> 43

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 43

atatgctagc gttggtgaaa ttggccag 28

<210> 44

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 44

atatgctagc gagacagtcc ttgacttgc 29

<210> 45

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 45

cacgagatcg tcgacaagaa cggaaag 27

<210> 46

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 46

gcatatagat ctatgctgta caccagg 27

<210> 47

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 47

aggcgggcga ccttgc 16

<210> 48

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 48

cttgacttgc ggcgaagg 18

<210> 49

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 49

tccgtttatg gcaagatccc tagcacttc 29

<210> 50

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 50

tataagatct atgactacgg acaacgctaa agc 33

<210> 51

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 51

tatagctagc gtttttggtc gcagagg 27

<210> 52

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 52

tataagatct atgctgtaca ccagggtttt cttccgtgc 39

<210> 53

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 53

cggaggcctg ccctgctccc taaaaag 27

<210> 54

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 54

tcccgagcct ccgcgattcg tcatc 25

<210> 55

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 55

actacggaca acgctaaagc gcagctgacc 30

<210> 56

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 56

aggatacgcg tactgaatga ggacgac 27

<210> 57

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 57

cgtcctcatt cagtacgcgt atcctacc 28

<210> 58

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 58

tgatagatct tgtgcagaag gtgctccac 29

<210> 59

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 59

tatacctagg ctcgtctgtt gggcgatc 28

<210> 60

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 60

ctctcaggtg ggcagtggcg tc 22

<210> 61

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 61

tgaccggcct gaaccgtgat g 21

<210> 62

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 62

gagtcgtcgt gttttagagc tagaaatagc aag 33

<210> 63

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide sequences

<400> 63

cttcgatgtc aacttgacat ccccatttac 30

PCT/RO/134 Table