Alkoxyphenyl derivative, nucleoside protector and nucleotide protector, method for producing oligonucleotide, and method for removing substituent

文档序号：883671 发布日期：2021-03-19 浏览：15次中文

阅读说明：本技术 烷氧基苯基衍生物、核苷保护体和核苷酸保护体、寡核苷酸制造方法以及取代基除去方法 (Alkoxyphenyl derivative, nucleoside protector and nucleotide protector, method for producing oligonucleotide, and method for removing substituent ) 是由千叶一裕冈田洋平梅本英彰大中卓也于 2019-03-01 设计创作，主要内容包括：本发明提供能够利用比以往更简易迅速的液相合成法合成寡核苷酸的烷氧基苯基衍生物、键合有上述烷氧基苯基衍生物的核苷保护体和核苷酸保护体、使用它们的寡核苷酸的制造方法、以及该烷氧基苯基衍生物部分的选择性除去方法等。一种通式(1)表示的化合物或其衍生物。(式中,R各自独立地表示可以被取代的碳原子数10～40的烷基。m表示1～5的整数。m为2以上的情况下,多个存在的RO可以相同或者可以不同。X表示O、S、NH或者NR～N。n表示1～4的整数。R～N表示可以被取代的碳原子数1～6的烷基。)(The present invention provides an alkoxyphenyl derivative capable of synthesizing an oligonucleotide by a liquid phase synthesis method which is simpler and faster than conventional methods, a nucleoside protector and a nucleotide protector to which the alkoxyphenyl derivative is bonded, a method for producing an oligonucleotide using the alkoxyphenyl derivative and the nucleotide protector, and a method for selectively removing a part of the alkoxyphenyl derivative. A compound represented by the general formula (1) or a derivative thereof. (wherein R independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms; m represents an integer of 1 to 5; m is 2 or more, a plurality of RO's may be the same or different; X represents O, S, NH or NR N . n represents an integer of 1 to 4. R N Represents an optionally substituted alkyl group having 1 to 6 carbon atoms. ))

1. A compound represented by the general formula (1) or a derivative thereof,

in the formula (1), the reaction mixture is,

r independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

m represents an integer of 1 to 5, and when m is 2 or more, the RO's present in a plurality are the same or different,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

2. The compound or derivative thereof according to claim 1, which is represented by the general formula (2),

in the formula (2), the reaction mixture is,

R¹、R²and R³Each independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

3. A compound represented by the general formula (3) or a derivative thereof,

in the formula (3), the reaction mixture is,

r independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

m represents an integer of 1 to 5, and when m is 2 or more, the RO's present in a plurality are the same or different,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B exist, a plurality of B exist in the same or different manner,

w represents a hydrogen atom or a protecting group,

R⁴represents an alkyl group having 1 to 4 carbon atoms and having an electron-withdrawing group, R⁴In the case where there are 2 or more, a plurality of R's are present⁴The same or different, or a combination thereof,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

v represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1－6Alkyl) amino group, or piperazinyl group in which the nitrogen atom at the 4-position is protected with a protecting group and which may be further substitutedWhen there are 2 or more V, the plural V may be the same or different,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3).

4. The compound or derivative thereof according to claim 3, which is represented by the general formula (6),

in the formula (6), the reaction mixture is,

R¹、R²and R³Each independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

v represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1－6Alkyl) amino group, or piperazinyl group which may be further substituted and in which the nitrogen atom at the 4-position is protected with a protecting group, and when 2 or more of V exist, a plurality of V exist in the same or different manner,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6).

5. The compound or derivative thereof according to claim 3 or 4, wherein W is a hydrogen atom, a trityl group, a di (C)_1－6Alkoxy) trityl, mono (C)_1－18Alkoxy) trityl, 9- (9-phenyl) xanthenyl or 9- (9-phenyl) thioxanthyl.

6. A compound or derivative thereof according to any one of claims 3 to 5, wherein R⁴Is an ethyl group having an electron-withdrawing group at the 2-position.

7. The compound or derivative thereof according to any one of claims 3 to 6, wherein Q is a hydrogen atom, a trityl group, or a di (C)_1－6Alkoxy) trityl, mono (C)_1－18Alkoxy) trityl, 9- (9-phenyl) xanthenyl or 9- (9-phenyl) thioxanthyl.

8. A compound or derivative thereof according to any one of claims 3 to 7 wherein y1 or y2 is 1 to 100.

9. A compound or derivative thereof according to any one of claims 3 to 7 wherein y1 or y2 is 1 to 30.

10. A compound or derivative thereof according to any one of claims 3 to 7 wherein y1 or y2 is 0.

11. A compound or derivative thereof according to any one of claims 1 to 10 wherein n is 1 or 2.

12. A compound or derivative thereof according to any one of claims 1 to 11, wherein m is an integer of 2 to 4.

13. A process for producing a compound represented by the general formula (7) or (8) or a derivative thereof, which comprises the step (1) of subjecting a compound represented by the general formula (3) or a derivative thereof to a reduction treatment,

in the formula (3), the reaction mixture is,

r independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

m represents an integer of 1 to 5, and when m is 2 or more, the RO's present in a plurality are the same or different,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3),

in the formula (7), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

in the formula (8), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

y2 represents an arbitrary integer of 0 or more.

14. The production method according to claim 13, comprising a step (1) of subjecting the compound represented by the general formula (6) or a derivative thereof to a reduction treatment,

in the formula (6), the reaction mixture is,

R¹、R²and R³Each independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6),

in the formula (7), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

in the formula (8), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

v represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1－6Alkyl) ammoniaA group or a piperazinyl group which is protected at the nitrogen atom at the 4-position with a protecting group and which may be further substituted, wherein when 2 or more V exist, a plurality of V exist, and are the same or different,

y2 represents an arbitrary integer of 0 or more.

15. The production method according to claim 13 or 14, wherein the reduction treatment uses a boron-containing reducing agent, or uses a boron-containing reducing agent and an amine.

16. The production method according to any one of claims 13 to 15, wherein the boron-containing reducing agent is lithium borohydride, sodium borohydride, lithium triethylborohydride, or tetrabutylammonium borohydride.

17. The production process according to claim 13 to 16, wherein W is a hydrogen atom, a trityl group or a di (C)_1－6Alkoxy) trityl, mono (C)_1－18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl.

18. The production method according to any one of claims 13 to 17, wherein R is⁴Is an ethyl group having an electron-withdrawing group at the 2-position.

19. The production process according to claim 13 to 18, wherein Q is a hydrogen atom, a trityl group or a di (C)_1－6Alkoxy) trityl, mono (C)_1－18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl.

20. The production method according to any one of claims 13 to 19, wherein y1 or y2 is 1 to 100.

21. The production method according to any one of claims 13 to 19, wherein y1 or y2 is 1 to 30.

22. The production method according to any one of claims 13 to 19, wherein y1 or y2 is 0.

23. The production method according to any one of claims 13 to 22, wherein n is 1 or 2.

24. The production method according to any one of claims 13 to 23, wherein m is an integer of 2 to 4.

25. A method for removing a substituent, comprising a step (1) of subjecting a compound represented by the general formula (3) or a derivative thereof to a reduction treatment,

in the formula (3), the reaction mixture is,

r independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

m represents an integer of 1 to 5, and when m is 2 or more, the RO's present in a plurality are the same or different,

x represents O, S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (3).

26. The method for removing a substituent according to claim 25, which comprises the step (1) of subjecting the compound represented by the general formula (6) or a derivative thereof to a reduction treatment,

in the formula (6), the reaction mixture is,

R¹、R²and R³Each independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms,

x represents O,S, NH or NR^N，

n represents an integer of 1 to 4,

R^Nrepresents an optionally substituted alkyl group having 1 to 6 carbon atoms,

y represents the following general formula (4) or general formula (5),

in the formula (4), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

b represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen, and when 2 or more of B are present, the plural B may be the same or different,

w represents a hydrogen atom or a protecting group,

z represents O or S, and when 2 or more Z exist, the Z exist in a plurality of Z are the same or different,

y1 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6),

in the formula (5), the reaction mixture is,

base represents a nucleic acid Base which may be modified, and when 2 or more bases are present, the bases present may be the same or different,

q represents a hydrogen atom or a protecting group,

v represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1－6Alkyl) amino, or piperazinyl in which the nitrogen atom at the 4-position is protected with a protecting group and which may be further substituted, wherein V is present in 2 or moreIn the case of (2), a plurality of existing Vs are the same or different,

y2 represents an arbitrary integer of 0 or more,

represents a bonding site in the general formula (6).

27. The substituent removal method according to claim 25 or 26, wherein the reduction treatment uses a boron-containing reducing agent, or uses a boron-containing reducing agent and an amine.

28. The substituent removal method according to any one of claims 25 to 27, wherein the boron-containing reducing agent is lithium borohydride, sodium borohydride, lithium triethylborohydride, or tetrabutylammonium borohydride.

Technical Field

The present invention relates to a method for producing an oligonucleotide, which can synthesize an alkoxyphenyl derivative of an oligonucleotide by a liquid phase synthesis method, can combine a nucleoside protector and a nucleotide protector of the alkoxyphenyl derivative, and can be constructed easily using the nucleotide protector and the nucleotide protector, and a method for removing a selective alkoxyphenyl derivative moiety of the nucleoside protector or the nucleotide protector combined with the alkoxyphenyl derivative.

Background

In recent years, oligonucleotides can generally be synthesized by sequentially connecting nucleotides as raw materials, but when an oligonucleotide of 20mer or more is synthesized, a component synthesis method (ブロックマ -synthesis method) in which a component group of 2 to 3mer nucleotides is prepared in advance and repeatedly connected to obtain a product having a desired chain length, a unit coupling (fragment condensation) synthesis method in which an oligonucleotide is obtained by connecting oligonucleotides of 10 bases or more, and the like are also used (for example, non-patent documents 1 to 3). The solid-phase synthesis method of an oligonucleotide using the phosphoramidite method has a problem that a nucleoside phosphoramidite compound and a tetrazole compound must be used in large excess in order to increase the yield of the target oligonucleotide. Further, in the solid-phase synthesis method, there is a limit to scale-up of equipment and the like, and it is difficult to confirm the progress of the reaction in the intermediate stage and analyze the structure of the intermediate.

On the other hand, in the conventional liquid phase synthesis methods, purification operations in the respective steps such as deprotection, coupling, and oxidation of nucleotides are required, and thus, it is difficult to synthesize oligonucleotides having a plurality of polymerization degrees rapidly and in large quantities. Therefore, for example, patent documents 1 and 2 propose liquid phase synthesis using a quasi-solid phase protecting group, but for example, the removal of the quasi-solid phase protecting group requires time, and it is difficult to selectively remove only the quasi-solid phase protecting group from an oligonucleotide having a quasi-solid phase protecting group, and therefore, it is also difficult to synthesize a nucleotide (hereinafter, also referred to as a "nucleotide protector" in the present specification) in which a nucleobase or a phosphate group is protected, which is a precursor of a building block or a fragment. In addition, in non-patent document 4, although the quasi-solid phase protecting group is removed by contact reduction using a Pd catalyst, it takes 20 to 40 hours to remove the protecting group using a toxic heavy metal or a dangerous hydrogen gas. Further, there is a problem in versatility because the quasi-solid phase protecting group is not removed under a general deprotection condition of the protecting group of a nucleotide.

Documents of the prior art

Patent document

Patent document 1: japanese patent No. 5548852

Patent document 2: international publication No. 2012/157723

Non-patent document

Non-patent document 1: s.l.beaucage, d.e.bergstorm, g.d.glick, r.a.jones; current Protocols in Nucleic Acid Chemistry; john Wiley & Sons (2000)

Non-patent document 2: guangGuangxiang, Zhaitengli edition, "genomic chemistry-scientific method using artificial nucleic acid", lecture society science (2003)

Non-patent document 3: C. h.chen, et al, aust.j.chem., 2010, 63, 227-.

Non-patent document 4: matsuno, et al, org, lett, 2016, 18, 800-.

Disclosure of Invention

In view of the above circumstances, it is an object of the present invention to provide an alkoxyphenyl derivative having high versatility, which not only enables the synthesis of an oligonucleotide, but also enables the synthesis of an oligonucleotide protector which has been difficult in the past, in a simple and rapid manner.

It is another object of the present invention to provide a nucleoside protector and a nucleotide protector (hereinafter, also referred to as "tagylated nucleoside protector" and "tagylated nucleotide protector", respectively) which are obtained by combining the above alkoxyphenyl derivative (hereinafter, also referred to as "tagylated") and have high versatility and which can synthesize an oligonucleotide as well as an oligonucleotide protector which has been difficult in the past with ease and rapidity.

Further, the present invention aims to provide a method for producing an oligonucleotide (synthesis method) which uses the above-mentioned alkoxyphenyl derivative, or the above-mentioned tagylated nucleoside protector or tagylated nucleotide protector and has higher versatility than conventional ones.

Further, the present invention aims to provide a method for selectively removing a Tag moiety from a tagylated nucleoside protector or a tagylated nucleotide protector. In the present invention, the "Tag moiety" refers to a moiety derived from the above-mentioned alkoxyphenyl derivative in the above-mentioned tagylated nucleoside protector or tagylated nucleotide protector.

The present inventors have conducted extensive studies to solve the above problems, and as a result, have succeeded in producing novel alkoxyphenyl compounds and derivatives thereof shown below, and have achieved the above objects by using the above compounds, thereby completing the present invention.

That is, the compound of the present invention and its derivative are represented by general formula (1) (hereinafter, may be referred to as "compound (1)" in the present specification.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms. )

The compound or derivative thereof of the present invention has a structure represented by the general formula (1), and thus can be used not only for the synthesis of an oligonucleotide by a liquid phase synthesis method but also for the synthesis of an oligonucleotide protector, which has been difficult in the past. More specifically, the compound of the present invention or a derivative thereof (alkoxyphenyl derivative) can be reacted with a nucleoside or nucleotide to obtain a tagylated nucleoside protector and a tagylated nucleotide protector. Further, since the Tag moiety of the obtained Tag nucleotide protector and Tag nucleotide protector has the above-mentioned structure, they can be easily separated from a side material such as an amide monomer by a filtration operation or the like by adding a polar solvent, and further only the Tag moiety can be selectively and rapidly removed, whereby not only an oligonucleotide but also an oligonucleotide protector which has been difficult in the past can be synthesized (produced).

The derivatives of the above-mentioned compounds include derivatives obtained by partially substituting the chemical structure of the above-mentioned compounds, for example, compounds in which the terminal OH group of a carboxyl group (-COOH) is partially substituted with a substituent, as long as the effects of the present invention are not impaired. Examples of the substituent include a substituent having a high leaving ability so as to easily form a bond with a nucleoside or nucleotide, and examples thereof include a halogen atom such as F, Cl, Br, and I, and an alkyl ester structure substituted with an alkoxy group. As the substituent, a known leaving group can be suitably used.

Among the compounds of the present invention or derivatives thereof, the compounds represented by the general formula (2) or derivatives thereof are preferable.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms. )

In addition, among the compounds of the present invention or derivatives thereof, the compounds represented by the general formula (3) or derivatives thereof may be used.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents a carbon atom which may be substitutedAlkyl groups having a seed number of 1 to 6.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

R⁴Represents an alkyl group having 1 to 4 carbon atoms and having an electron-withdrawing group. R⁴In the case where there are 2 or more, a plurality of R's are present⁴May be the same or may be different.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

V represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1-6Alkyl) amino, or piperazinyl in which the nitrogen atom at the 4-position is protected by a protecting group and which may be further substituted. When there are 2 or more V, the plural V may be the same or different.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

With the above-mentioned structure, the Tag nucleotide protector and the Tag nucleotide protector are obtained, but the Tag moiety has the above-mentioned structure, and therefore, particularly in liquid phase synthesis (including quasi-liquid phase synthesis), it is possible to easily separate from a side material such as an amide monomer by addition of a polar solvent, a filtration operation, or the like, and further, it is possible to selectively and rapidly remove only the Tag moiety, and it is possible to synthesize not only an oligonucleotide but also an oligonucleotide protector which has been difficult in the past.

The nucleoside of the present invention generally represents a substance in which a purine or pyrimidine base and a sugar are bonded to each other by a glycosidic bond, but includes a substance in which the general structure thereof is partially substituted and analogs thereof as long as the action and effect of the present invention are not impaired. For example, there may be mentioned nucleosides in which the base moiety is not necessarily a purine or pyrimidine structure (for example, modified bases and the like), nucleosides in which the sugar moiety is not a D-ribose or a deoxy-D-ribose (for example, morpholino nucleosides represented by general formulae (5) and (8)), and the like.

The nucleotide in the present invention generally represents a phosphate ester of the above nucleoside in which a purine or pyrimidine base and a sugar are glycosidically bonded, but includes an analog thereof and a substance obtained by partially substituting the general structure thereof in a wide range as long as the action and effect of the present invention are not impaired. For example, there may be mentioned a nucleotide having a base moiety not necessarily having a purine or pyrimidine structure (for example, a modified base), a nucleotide having a sugar moiety other than D-ribose or deoxy-D-ribose (for example, morpholino type morpholino nucleotide), and a phosphorothioate in which one O atom of a phosphate moiety is substituted with an S atom.

Among the compounds of the present invention or derivatives thereof, the compounds represented by the general formula (6) or derivatives thereof are preferable.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

In the compound of the present invention or a derivative thereof, W is preferably a hydrogen atom, a trityl group or a di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When W is any of the above, oligonucleotide synthesis can be performed more easily.

In addition, in the compound of the present invention or a derivative thereof, R⁴Preferably an ethyl group having an electron-withdrawing group at the 2-position.

In the compound of the present invention or a derivative thereof, Q is preferably a hydrogen atom, a trityl group or a di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When Q is any of the above, oligonucleotide synthesis can be performed more easily.

In the compound or the derivative thereof of the present invention, y1 or y2 may be 1 to 100.

In the compound or the derivative thereof of the present invention, y1 or y2 may be 1 to 30.

In the compound of the present invention or a derivative thereof, y1 or y2 may be 0.

In the compound of the present invention or a derivative thereof, n is preferably 1 or 2.

In the compound or the derivative thereof of the present invention, m is preferably an integer of 2 to 4.

On the other hand, the production method of the present invention includes a step (1) of obtaining a compound represented by general formula (7) or (8) by subjecting a compound represented by general formula (3) or a derivative thereof to a reduction treatment.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more. )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more. )

According to the production method of the present invention, since the above-mentioned tagylated nucleoside protector and tagylated nucleotide protector are used, particularly in liquid phase synthesis (including quasi-liquid phase synthesis), it is possible to easily separate from by a filtration operation or the like a side material such as an amide monomer or the like by adding a polar solvent, and further to selectively and rapidly remove only the Tag portion, and it is possible to synthesize not only an oligonucleotide but also an oligonucleotide protector which has been difficult in the past. In addition, for example, the production method of the present invention can remove a substituent (leaving reaction of a Tag moiety) under milder conditions (for example, 35 ℃ in ammonia water) than the method of patent document 2, and can be produced in a shorter time.

The method for producing an oligonucleotide protector of the present invention preferably comprises the step (1) of reducing a compound represented by the general formula (6) or a derivative thereof.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more. )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more. )

In the production method of the present invention, it is preferable that the reduction treatment is performed using a boron-containing reducing agent or using a boron-containing reducing agent and an amine. By having the above-mentioned constitution, the oligonucleotide protector can be synthesized more easily.

In the production method of the present invention, the boron-containing reducing agent is preferably lithium borohydride, sodium borohydride, lithium triethylborohydride or tetrabutylammonium borohydride. By having the above-mentioned constitution, the oligonucleotide protector can be synthesized in a higher yield and in a simple manner.

In the production method of the present invention, W is preferably a hydrogen atom, a trityl group or a di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When W is any of the above, the synthesis of the oligonucleotide protector can be more easily performed.

In the production method of the present invention, R is⁴Preferably an ethyl group having an electron-withdrawing group at the 2-position.

In the production method of the present invention, Q is preferably a hydrogen atom, a trityl group or a di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When Q is any of the above, oligonucleotide synthesis can be performed more easily.

In the production method of the present invention, y1 or y2 may be 1 to 100.

In the production method of the present invention, y1 or y2 may be 1 to 30.

In the production method of the present invention, y1 or y2 may be 0.

In the production method of the present invention, n is preferably 1 or 2.

In the production method of the present invention, m is preferably an integer of 2 to 4.

On the other hand, the method for removing a Tag portion (substituent removing method) of the present invention includes the step (1) of reducing a compound represented by the general formula (3) or a derivative thereof.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

According to the method for removing a Tag moiety of the present invention, since the above-mentioned tagylated nucleoside protector and tagylated nucleotide protector are used, only the Tag moiety can be selectively and rapidly removed. The reason why the above-mentioned action and effect are exerted is presumed to be that the carbonyl group (C ═ O group) directly bonded to the phenyl group and the X atom (O, S, NH or NR) bonded to the carbonyl group in the general formula (3) and the like^N) With LiBH₄The reducing agent forms a certain interaction, and the reduction reaction proceeds more preferably easily at the Tag compound site, so that the removal reaction proceeds selectively and more rapidly, but the scope of the present invention is not limited by this presumption.

The method for removing a Tag portion of the present invention preferably includes the step (1) of reducing the compound represented by the general formula (6) or a derivative thereof.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

V represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1-6Alkyl) amino, or piperazinyl in which the nitrogen atom at the 4-position is protected by a protecting group and which may be further substituted. V has more than 2In this case, the plurality of existing V may be the same or may be different.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

In the method for removing a Tag portion of the present invention, it is preferable that the reducing treatment is performed using a boron-containing reducing agent or using a boron-containing reducing agent and an amine. By having the above-mentioned constitution, it is possible to easily selectively remove a Tag moiety in a tagylated nucleoside protector or a tagylated nucleotide protector.

In the method for removing a Tag portion of the present invention, the boron-containing reducing agent is preferably lithium borohydride, sodium borohydride, lithium triethylborohydride or tetrabutylammonium borohydride. By having the above-mentioned constitution, it is possible to selectively remove a Tag moiety in a tagylated nucleoside or nucleotide protector in a higher yield.

The compounds of the present invention or derivatives thereof (alkoxyphenyl derivatives such as compounds (1) and (2)) are novel compounds, and the above-mentioned tagylated nucleoside protectors and nucleotide protectors can be easily obtained by using the novel compounds.

Further, since the compound of the present invention or a derivative thereof (e.g., the compound (3) or (6), the tagylated nucleoside protector, the tagylated nucleotide protector, and the like) has the above structure in the Tag moiety, it can be easily separated from a side material such as an amide monomer and the like by a filtration operation or the like by adding a polar solvent, particularly in liquid phase synthesis (including quasi-liquid phase synthesis), and further, it is possible to selectively and rapidly remove only the Tag moiety, and it is possible to synthesize not only an oligonucleotide by a liquid phase synthesis method, but also an oligonucleotide protector which has been difficult in the past.

Further, the method for producing the compound of the present invention or a derivative thereof (e.g., the oligonucleotide such as the compounds (7) and (8)) uses the above-mentioned tagylated nucleoside protector and tagylated nucleotide protector, and therefore, an oligonucleotide can be synthesized more easily and more rapidly by a liquid phase synthesis method than in the past.

In addition, the method for removing a Tag moiety (substituent removal method) of the compound of the present invention or a derivative thereof (e.g., an alkoxyphenyl derivative such as the compounds (1), (2), (3) and (6), a tagylated nucleoside protector, and a tagylated nucleotide protector) can selectively and rapidly remove only the Tag moiety under mild conditions, because the above-mentioned tagylated nucleoside protector and tagylated nucleotide protector are used.

Detailed Description

Hereinafter, embodiments of the present invention will be described in detail.

[ alkoxyphenyl compounds and derivatives thereof ]

The alkoxyphenyl compound and the derivative thereof of the present invention are compounds represented by general formula (1) or derivatives thereof.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms. )

In the general formula (1), R represents an alkyl group having 10 to 40 carbon atoms which may be substituted independently of each other. The R may be an alkyl group having 13 to 30 carbon atoms, or an alkyl group having 15 to 20 carbon atoms, and a preferred example thereof is an alkyl group having 18 carbon atoms. When a plurality of R groups are present, each of the R groups may be independently a straight-chain alkyl group or a branched-chain alkyl group, but a straight-chain alkyl group is preferable. Further, when R is an alkyl group having 10 to 40 carbon atoms, the synthesis of the tagylated nucleoside protector and the tagylated nucleotide protector of the present invention becomes easy, and the effects of improving the solubility and the separation ability can be obtained.

In the general formula (1), m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different. m is preferably an integer of 2 to 4, and m is more preferably 3. When the carbonyl group directly bonded to the phenyl group (C ═ O group) is the 1-position, the RO group is preferably bonded to the 3-position, 4-position or 5-position, and when m is 3, it is preferably bonded to the 3-position, 4-position or 5-position. Further, by adjusting the value of m to fall within the above range, the dissolving ability of the tagylated nucleoside protector and the tagylated nucleotide protector of the present invention with respect to a nonpolar solvent can be adjusted.

In the general formula (1), X represents O, S, NH or NR^N. Among them, X is preferably O.

In the general formula (1), n represents an integer of 1 to 4. Among them, n is preferably 1 or 2.

In the above general formula (1), R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms. As the above-mentioned R^NExamples thereof include methyl, ethyl, 1-propyl, 1-methyl-1-ethyl, 1-butyl, 1-methyl-1-propyl, 1-dimethyl-1-ethyl, 2-methyl-1-propyl, 1-pentyl and 2-pentyl.

In the present invention, the alkoxyphenyl compound and the derivative thereof are preferably a compound represented by the general formula (2) or a derivative thereof.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms. )

In the above general formula (2), R¹、R²And R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted. R is as defined above¹、R²And R³The alkyl group may be one having 13 to 30 carbon atoms, or one having 15 to 20 carbon atoms, and among them, one having 18 carbon atoms is preferable. In addition, the above R¹、R²And R³Each independently may be a straight chain alkyl group or a branched chain alkyl group, but preferably all are straight chain alkyl groups.

In the above general formula (2), X, n and R^NThe same as in the above general formula (1).

The methods for synthesizing the alkoxyphenyl compounds and derivatives thereof according to the present invention are exemplified in the examples, but they can be synthesized by known methods using commercially available starting materials.

[ Tag-formed nucleoside protectors and Tag-formed nucleotide protectors, etc. ]

The tagylated nucleoside protector and the tagylated nucleotide protector in the present invention are compounds represented by the general formula (3) or derivatives thereof.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

In the general formula (3), R, m, X, n, R^NThe same as in the above general formula (1).

In the general formula (3), Y represents the following general formula (4) or general formula (5).

In the general formula (4), Base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Examples of the Base include an adenine group (adenoyl), a guanine group (guanyl), a cytosine group (Cytosinyl), a thymine group (thyminyl), a uracil group (uracil), derivatives thereof, and modifications thereof. The modified compound may be, for example, a modified compound in which a polar group or the like is protected with a known protecting group or the like. In addition, the bases present in the oligonucleotides may be the same or may be different.

In the general formula (4), B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different. In the case of a protected hydroxyl group, a known method can be suitably used as a protecting group or a protecting method.

In the above general formula (4), W represents a hydrogen atom or a protecting group. When W is a protecting group, a known method can be suitably used as the protecting group and the protecting method.

W is preferably a hydrogen atom, trityl group or di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When W is any of the above, oligonucleotide synthesis can be performed more easily.

In the above general formula (4), R⁴Represents an alkyl group having 1 to 4 carbon atoms and having an electron-withdrawing group. R⁴In the case where there are 2 or more, a plurality of R's are present⁴May be the same or may be different. In addition, R⁴Preferably an ethyl group having an electron-withdrawing group at the 2-position. Further, a preferable example of the electron-withdrawing group is a cyano group.

In the general formula (4), Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

In the general formula (4), y1 represents an arbitrary integer of 0 or more. y1 may be 1 to 100, 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 0.

In the general formula (4), the bonding site in the general formula (3) is represented.

In the general formula (5), Base is the same as in the general formula (4).

In the general formula (5), Q represents a hydrogen atom or a protecting group. When Q is a protecting group, a known method can be suitably used as the protecting group and the protecting method.

Q is preferably a hydrogen atom, trityl group or di (C)_1-6Alkoxy) trityl, mono (C)_1-18Alkoxy) trityl, 9- (9-phenyl) xanthenyl, or 9- (9-phenyl) thioxanthyl. When Q is any of the above, oligonucleotide synthesis can be performed more easily.

In the general formula (5), V represents an alkoxy group having 1 to 6 carbon atoms, a di (C)_1-6Alkyl) amino, or piperazinyl in which the nitrogen atom at the 4-position is protected by a protecting group and which may be further substituted. When there are 2 or more V, the plural V may be the same or different.

In the general formula (5), y2 represents an arbitrary integer of 0 or more. y2 may be 1 to 100, 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 0.

In the general formula (5), the bonding site in the general formula (3) is represented.

Further, the tagylated nucleoside protector and the tagylated nucleotide protector of the present invention are preferably a compound represented by the general formula (6) or a derivative thereof.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents a C1-6 group which may be substitutedAn alkyl group.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

In the above general formula (6), R¹、R²、R³X, n and R^NThe same as in the above general formula (2).

In the general formula (6), Y is the same as in the general formula (3).

The method for synthesizing a tagylated nucleotide protector and a tagylated nucleotide protector of the present invention are exemplified in the examples, but they can be synthesized by a known method using commercially available raw materials.

The tagylated nucleoside protector and the method for producing the tagylated nucleotide protector (synthesis method) of the present invention can be obtained, for example, by a method of bonding a nucleoside or nucleotide to the above-mentioned alkoxyphenyl compound or derivative thereof. Examples of the bonding method include a method in which the above-mentioned alkoxyphenyl compound or derivative thereof is subjected to a condensation reaction with a nucleoside or nucleotide. When the condensation reaction is used, for example, a method of bonding the above-mentioned alkoxyphenyl compound represented by the general formula (1) or (2) to a nucleoside or nucleotide using a condensing agent; a method of bonding a nucleoside or nucleotide with a derivative (for example, an ester derivative, an acid chloride derivative or the like) of the above-mentioned alkoxyphenyl compound represented by the general formula (1) or (2) having improved reactivity with a substituent or the like; a method of bonding a nucleoside or nucleotide having an improved reactivity with a substituent or the like to the above alkoxyphenyl compound represented by the general formula (1) or (2).

[ methods for producing oligonucleotide protectors and for removing Tag portions ], etc. ]

The method for producing an oligonucleotide protector of the present invention (method for synthesizing) and the method for removing a Tag moiety of the present invention (method for removing a substituent) comprise a step (1) of subjecting a compound represented by the general formula (3) or a derivative thereof to a reduction treatment.

(in the formula, wherein,

r independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

m represents an integer of 1 to 5. When m is 2 or more, a plurality of existing ROs may be the same or may be different.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (3). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more. )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more. )

In the method for producing an oligonucleotide protector, the general formulae (3), (4) and (5) are the same as described above.

In the method for producing an oligonucleotide protector, Base, B, W, R in the general formula (7)⁴Z and y1 are the same as in the above general formula (4).

In the method for producing an oligonucleotide protector according to the above general formula (8), Base, Q, V and y2 are the same as those in the above general formula (5).

The method for producing an oligonucleotide protector of the present invention and the method for removing a Tag portion of the present invention preferably include the step (1) of reducing a compound represented by the general formula (6) or a derivative thereof.

(in the formula, wherein,

R¹、R²and R³Each independently represents an alkyl group having 10 to 40 carbon atoms which may be substituted.

X represents O, S, NH or NR^N。

n represents an integer of 1 to 4.

R^NRepresents an optionally substituted alkyl group having 1 to 6 carbon atoms.

Y represents the following general formula (4) or (5). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more.

The bond site in the above general formula (6). )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

B represents a hydrogen atom, a hydroxyl group which may be protected, or a halogen. When there are 2 or more B, a plurality of B may be the same or different.

W represents a hydrogen atom or a protecting group.

Z represents O or S. When there are 2 or more Z, the plural Z may be the same or different.

y1 represents an arbitrary integer of 0 or more. )

(in the formula, wherein,

base represents a nucleic acid Base which may be modified. When there are 2 or more bases, the bases may be the same or different.

Q represents a hydrogen atom or a protecting group.

y2 represents an arbitrary integer of 0 or more. )

In the method for producing the oligonucleotide protector and the method for removing a Tag portion of the present invention, the general formulae (3), (4) and (5) are the same as described above.

In the method for producing an oligonucleotide protector and the method for removing a Tag portion of the present invention, in the general formula (7), Base, B, W, R⁴Z and y1 are the same as in the above general formula (4).

In the method for producing the oligonucleotide protector and the method for removing a Tag portion of the present invention, in the general formula (8), Base, Q, V and y2 are the same as those in the general formula (5).

In the method for producing an oligonucleotide protector and the method for removing a Tag portion of the present invention, it is preferable that a boron-containing reducing agent or a boron-containing reducing agent and an amine are used for the reduction treatment. By having the above-mentioned constitution, the oligonucleotide protector can be synthesized more easily.

As the boron-containing reducing agent, a known boron-containing reducing agent can be used, and among them, lithium borohydride, sodium borohydride, lithium triethylborohydride, tetrabutylammonium borohydride, and the like are preferable. These compounds may be used alone, or 2 or more kinds thereof may be mixed and used. By having the above-mentioned constitution, the oligonucleotide protector can be synthesized in a higher yield and in a simple manner.

When the boron-containing reducing agent and the amine are used, known amines can be used as the amine, and among them, diisopropylethylamine, triethylamine, pyridine, and the like are preferable. These compounds may be used alone, or 2 or more kinds thereof may be mixed and used. By having the above-mentioned constitution, the oligonucleotide protector can be synthesized in a higher yield and in a simple manner.

The synthesis method and reaction method in the step (1) may be any known method as long as the chemical structure of the compound represented by the general formula (6) or the like or the derivative thereof is not damaged, and a commercially available raw material may be used.

The step (1) may be, for example, a step of dissolving or mixing the compound represented by the general formula (6) or the derivative thereof and the boron-containing reducing agent or the boron-containing reducing agent and the amine in an organic solvent, and reacting the mixture by stirring at-10 ℃ or room temperature.

The method for producing the oligonucleotide protector of the present invention, the method for synthesizing the Tag portion-removing method of the present invention, and the reaction method are exemplified in the examples, but a known method may be used using commercially available raw materials.

The method for producing a tagated oligonucleotide protector of the present invention includes, for example, the following methods, taking a dimer as an example: the tagylated nucleotide protector or the tagylated nucleotide protector is subjected to a coupling reaction with an amidated nucleoside or nucleotide (step A), the resulting dimer is subjected to phosphorylation in an oxidation step (step B), the protecting group W is deprotected (step C), and the dimer of the tagylated nucleotide protector is obtained by filtration (step D). Further, as the higher order (n +1) mer, there may be mentioned a method in which the above method is repeated n times in the same manner, a method in which a nucleotide derivative having a certain length is used and these are bonded, and the like.

Examples

Hereinafter, examples and the like which specifically show the configuration and effects of the present invention will be described. The concentration operation in the examples is carried out under reduced pressure unless otherwise specified. The evaluation items in examples and the like were measured as follows.

＜¹Determination of H-NMR Spectroscopy

¹The measurement of the H-NMR spectrum was carried out using a nuclear magnetic resonance apparatus (product name AL400, manufactured by Nippon electronic Co., Ltd., product name ECS-600, manufactured by Nippon electronic Co., Ltd.) using tetramethylsilane as an internal standard.

＜¹³Determination of C-NMR spectra

¹³The C-NMR spectrum was measured using a nuclear magnetic resonance apparatus (product name AL400, manufactured by Nippon electronic Co., Ltd.) and a product name ECS-600, manufactured by Nippon electronic Co., Ltd.) using tetramethylsilane as an internal standard.

< determination of TOF/MS Spectrum >

The TOF/MS spectrum was measured using a time-of-flight mass spectrometer (product name LCT-PremierXE manufactured by Waters, Inc. and product name JMS T-100 LP manufactured by Nippon electronic Co., Ltd.).

Synthesis of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid

(A) Process via tert-butyl ester

[ example 1-1 ]

(1) Synthesis of 2- (tert-butoxy) -2-oxoethyl 3, 4, 5-trioctadecyloxy) benzoate

Triethylamine (0.39g, 3.87mmol) and tert-butyl 2-bromoacetate (0.76g, 3.87mmol) were added to a suspension of 3, 4, 5-trioctadecyloxy benzoic acid (1.80g, 1.94mmol) in THF (10mL), and the mixture was stirred at 60 ℃ for 2 hours. The reaction mixture was cooled to room temperature, and then a solid precipitated by dropwise addition of methanol (54mL) was filtered. The solid was washed with methanol and dried under reduced pressure at 50 ℃ to give the title compound (1.95g, 97%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.16－1.41(m，84H)，1.41-1.57(m，6H)，1.49(s，9H)，1.66-1.88(m，6H)，3.95－4.11(m，6H)，4.70(s，2H)，7.31(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.02，22.48，22.66，22.83，26.08，26.11，27.88，28.08，29.35，29.40，29.56，29.64，29.65，29.70，29.97，30.22，30.36，31.76，31.93，32.10，61.66，69.35，73.51，82.32，108.69，108.90，123.82，123.93，143.11，143.38，152.93，165.83，166.90.

TOF/MS(ESI)：C₆₇H₁₂₄O₇Na[M+Na]⁺Calculated value of 1063.9245, experimental value 1063.9254.

[ examples 1-2 ]

(2) Synthesis of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid

To a solution of 2- (tert-butoxy) -2-oxoethyl 3, 4, 5-trioctadecyloxy) benzoate (5.21g, 5.0mmol) in chloroform (20mL) was added trifluoroacetic acid (11.40g, 100.0mmol), and the mixture was stirred at 50 ℃ for 17 hours. The reaction mixture was cooled to room temperature, and then a solid precipitated by dropwise addition of acetonitrile (50mL) was filtered. The solid was washed with an acetonitrile-chloroform mixed solvent and then dried under reduced pressure at 50 ℃ to obtain the title compound (4.89g, 99%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.16-1.54(m，90H)，1.69－1.88(m，6H)，3.95－4.11(m，6H)，4.87(s，2H)，7.30(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.08，22.68，26.06，26.10，29.36，29.41，29.57，29.65，29.66，29.72，30.35，31.93，60.49，69.30，73.57，108.53，123.31，143.17，152.96，165.74.

TOF/MS(ESI)：C₆₃H₁₁₆O₇Na[M+Na]⁺Calculated value of 1007.8619, experimental value 1007.8639.

(B) Process via benzyl esters

[ examples 1 to 3]

(1) Synthesis of 2-benzyloxy-2-oxoethyl 3, 4, 5-tris (octadecyloxy) benzoate

Triethylamine (0.20g, 1.94mmol) and benzyl 2-bromoacetate (0.45g, 1.94mmol) were added to a chloroform (5mL) suspension of 3, 4, 5-tris (octadecyloxy) benzoic acid (0.90g, 0.97mmol), and the mixture was stirred at 50 ℃ for 14 hours. The reaction mixture was cooled to room temperature, and then a solid precipitated by dropwise addition of methanol (18mL) was filtered. The solid was washed with methanol and dried under reduced pressure at 50 ℃ to give the title compound (1.02g, 97%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.16－1.41(m，84H)，1.41－1.54(m，6H)，1.66-1.91(m,6H)，3.95－4.08(m，6H)，4.86(s，2H)，5.23(s，2H)，7.24-7.41(m，7H).

¹³C－NMR(100MHz，CDCl₃)：δ14.08，22.71，26.13，26.16，29.40，29.43，29.46，29.62，29.69，29.71，29.76，30.00，30.43，31.98，61.24，67.07，69.40，73.59，108.76，123.69，128.32，128.50，128.65，135.35，143.28，152.96，153.01，165.84，167.77.

[ examples 1 to 4]

(2) Synthesis of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid

To a solution of 2-benzyloxy-2-oxoethyl 3, 4, 5-tris (octadecyloxy) benzoate (0.91g, 0.85mmol) in THF (4.3mL) was added 10% Pd-C (0.09g), and the mixture was stirred under a hydrogen balloon at 40 ℃ for 19 hours. After the reaction solution was cooled to room temperature, 10% Pd-C was removed by filtration through Celite. After concentrating the filtrate, the residue was filtered, and acetonitrile (18mL) was added dropwise to the residue to precipitate a solid. The solid was washed with acetonitrile and dried under reduced pressure at 50 ℃ to give the title compound (0.84g, 100%) as a white solid.

2. The thymidylate- [3 '→ 5' ] deoxycytidine- [3 '→ 5' ] -thymidylate- [3 '→ 5' ] -deoxyguanosine- [3 '→ 5' ] -thymidylate- [3 '→ 5' ] -deoxyguanosine- [3 '→ 5' ] -deoxycytidine- [3 '→ 5' ] -deoxyadenosine- [3 '→ 5' ] -thymidylate- [3 '] -deoxycytidine- [ 3' → 5 '] -thymidylate- [ 3' → 5 '] -deoxyguanosine- [ 3' ] -5 '] -thymidylate- [ 3' ] -5 '] -deoxyguanosine- [ 3' ] -5 '] -3' ] -deoxyadenosine.

[ example 2-1 ]

(1) Synthesis of 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate

After COMU (4.73g, 11.05mmol) was added to a suspension of 2- ((3, 4, 5-trioctadecyloxy) acetic acid (4.95g, 5.02mmol), 5 '-O- (4, 4' -dimethoxytrityl) thymidine (3.28g, 6.03mmol) and 1-methylimidazole (2.27g, 27.62mmol) in THF (50mL), the mixture was stirred at room temperature for 3.5 hours. The solid precipitated by adding acetonitrile (248mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-THF and dried under reduced pressure at 50 ℃ to obtain the title compound (7.16g, 95%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.16－1.54(m，93H)，1.69－1.88(m，6H)，2.42－2.58(m，2H)，3.42－3.55(m，2H)，3.78(s，6H)，3.95－4.05(m，6H)，4.18(s，1H)，4.82(s，2H)，5.56(d，1H，J＝5.6Hz)，6.40-6.50(m，1H)，6.80-6.90(m，4H)，7.20－7.40(m，9H)，7.61(s，1H)，8.03(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.62，14.10，22.71，26.11，26.15，29.38，29.45，29.61，29.68，29.75，30.40，31.96，37.88，55.28，61.12，63.68，69.35，73.60，83.93，84.40，87.36，108.59，111.66，113.43，123.26，127.29，128.08，128.19，130.10，130.15，135.20，135.25，135.32，144.22，150.11，153.02，158.92，163.16，165.85，167.50.

TOF/MS(ESI)：C₉₄H₁₄₆N₂O₁₃Na[M+Na]⁺Calculated value of 1534.0723, experimental value 1534.0759.

[ example 2-2 ]

(2) Synthesis of thymidine-3' -yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate

To a solution of 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 2- ((3, 4, 5-trioctadecyloxy) acetate (6.95g, 4.60mmol) in methylene chloride (174mL) were added pyrrole (1.54g, 22.98mmol) and trifluoroacetic acid (0.66g, 5.75mmol), and the mixture was stirred at room temperature for 2.5 hours. The solid precipitated by adding acetone (52mL) and acetonitrile (156mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-acetone-dichloromethane and acetonitrile, and dried under reduced pressure at 50 ℃ to obtain the title compound (5.04g, 91%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.39(m，84H)，1.43－1.51(m，6H)，1.66(s，1H)，1.71－1.85(m，6H)，1.95(s，3H)，2.36－2.58(m，3H)，3.89－3.97(m，2H)，3.97－4.08(m，6H)，4.15(dd，1H，J＝2.0，2.4Hz)，4.84(s，2H)，5.45－5.53(m，1H)，6.20(dd，1H，J＝6.0，8.8Hz)，7.29(s，2H)，7.45(d，1H，J＝1.2Hz)，8.59(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.58，14.12，22.70，26.07，26.11，29.33，29.38，29.43，29.59，29.67，29.68，29.73，30.35，31.94，36.99，61.12，62.57，69.24，73.58，75.97，84.91，86.46，108.36，111.48，123.17，136.41，143.09，150.29，152.96，163.40，165.91，167.71.

TOF/MS(ESI)：C₇₃H₁₂₈N₂O₁₁Na[M+Na]⁺Calculated value of 1231.9416, experimental value 1231.9432.

[ examples 2 to 3]

(3) Synthesis of 5 ' -O- ((cyanoethoxy) (thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid

To a suspension (15mL) of thymidine-3 '-yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) acetate (1.00g, 0.83mmol), 5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl-phosphoramidite (1.23g, 1.65mmol) in methylene chloride under argon was added 5-benzylthio-1H-tetrazole (0.32g, 1.65mmol), and the mixture was stirred at room temperature for 1.5 hours. Then, cumene hydroperoxide (content 82%) (0.23g, 1.24mmol) was added thereto, followed by stirring at room temperature for 2 hours. To the reaction mixture were added pyrrole (0.56g, 8.27mmol) and trifluoroacetic acid (0.28g, 2.48mmol), and the mixture was stirred at room temperature for 2 hours. The solid precipitated by dropping acetone (15mL) and acetonitrile (45mL) to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-acetone-dichloromethane and acetonitrile, and dried at 50 ℃ under reduced pressure to obtain the title compound (1.20g, 92%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.55(m，90H)，1.65－2.05(m，12H)，2.40－2.60(m，4H)，2.75－2.90(m，2H)，3.84(s，2H)，3.95－4.10(m，6H)，4.15－4.50(m，6H)，4.85(s，2H)，5.15－5.25(m，1H)，5.35－5.55(m，1H)，6.10－6.35(m，2H)，7.29(s，2H)，7.35(d，1H，J＝1.2Hz)，7.47(s，1H)，9.60－9.95(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ12.42，12.46，14.10，19.72，19.79，22.71，26.12，26.19，29.38，29.43，29.49，29.63，29.70，29.75，30.43，31.96，36.47，36.56，38.46，61.14，61.91，62.00，62.63，62.68，62.75，62.80，67.53，69.42，73.64，74.66，74.77，78.94，79.12，82.33，82.40，82.48，85.60，85.66，85.79，86.02，86.21，86.35，108.61，111.27，111.33，111.73，111.82，116.58，116.66，123.15，135.87，135.94，136.53，136.62，143.41，150.49，150.59，153.07，163.94，164.02，165.96，167.79，167.83.

TOF/MS(ESI)：C₈₆H₁₄₄N₅O₁₈PNa[M+Na]⁺Calculated value of 1589.0142, experimental value 1589.0104.

[ examples 2 to 4]

(4) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5' -O- ((2-cyanoethoxy)) (5 ' -O- ((2-cyanoethoxy) (thymidine-3 ' -yl) phosphoryl) -N ' -O- ((2-cyanoethoxy) (5 ' -O- ((2-cyanoethoxy) (thymidine-3 ' -yl) phosphoryl)⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁴-benzoyldeoxycytidine-3 '-yl) phosphoryl) -thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosin-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosyl-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶Synthesis of-benzoyldeoxyadenosin-3 '-yl) phosphoryl) thymidine-3' -yl ester

The same procedures as in example 2-3 were repeated 18 times to obtain the title compound (1.10 g).

TOF/MS(ESI)：m/z 3114.3[M－3H]^3－，2335.6[M－4H]^4－，1868.9[M－5H]^5－，1557.6[M－6H]^6－.

[ examples 2 to 5]

(5) Deprotection and purification Process

To the compound synthesized in example 2-4 (50mg, 5.4. mu. mol), 28% aqueous ammonia (2.1mL) was added, and the mixture was stirred at 80 ℃ for 1.5 hours. After the reaction mixture was concentrated under reduced pressure, insoluble matter precipitated by adding 0.1mol/L triethylamine-acetate buffer to the concentrated residue was removed by filtration. The filtrate was purified by passing through a C-18 column to obtain an eluate, which was dried to obtain a target product, i.e., a thymidylate- [3 ' → 5 ' ] deoxycytidine- [3 ' → 5 ' ] -deoxyguanosine- [3 ' → 5 ' ] -deoxycytidine- [3 ' → 5 ' ] -thymidylate- [3 ' → 5 ' ] -deoxyguanosine- [3 ' → 5 ' ] -deoxyadenosine- [3 ' → 5 ' ] -deoxyguanosine- [3 ' ] -5 ' ] -deoxyadenosine- [3 ' ] -5 ' ] -deoxyadenosine- [3 ' ].

HPLC (shodex ODP (4.6. PHI. times.150 mm), flow rate: 1.0mL/min, mobile phase: 0.1mol/L triethylamine-acetic acid buffer, acetonitrile gradient: 0-15min (acetonitrile 2% to 98%), Rt ═ 3.9min (98.6%)

TOF/MS(ESI)：m/z 3020.9[M－2H]^2－，2013.4[M－3H]^3－，1509.8[M－4H]^4－.

(6) Synthesis of 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate

[ examples 2 to 6]

(case of Using EDCL-HCl as condensing agent)

After adding 4-dimethylaminopyridine (0.02g, 0.18mmol) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.34g, 1.77mmol) to a solution of 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid (0.87g, 0.89mmol), 5 '-O- (4, 4' -dimethoxytrityl) thymidine (0.97g, 1.77mmol) in THF (9mL), stirring was carried out at room temperature for 14 hours. The solid precipitated by adding acetonitrile (18mL) dropwise to the reaction solution was filtered. The solid was washed with a mixed solvent of acetonitrile and THF, and dried under reduced pressure at 50 ℃ to obtain a crude product (1.28 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: chloroform-THF), whereby the title compound (1.06g, 79%) was obtained as a white solid.

[ examples 2 to 7]

(case of using CDI as condensing agent)

To a suspension of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid (9.86g, 10.0mmol) and 4-dimethylaminopyridine (0.12g, 1.0mmol) in methylene chloride (210mL) was added 1, 1' -carbonyldiimidazole (2.43g, 15.0mmol), and the mixture was stirred at room temperature for 1 hour and then at 30 to 35 ℃ for 4 hours. Subsequently, 5 '-O- (4, 4' -dimethoxytrityl) thymidine (10.89g, 20.0mmol) was added thereto, and the mixture was stirred at room temperature for 17 hours. Further, 5 '-O- (4, 4' -dimethoxytrityl) thymidine (1.09g, 0.4mmol) was added to the reaction mixture, which was then stirred at room temperature for 4.5 hours. After dichloromethane (10mL) was added to the reaction mixture, a solid precipitated by dropwise addition of acetonitrile (400mL) was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried under reduced pressure at 50 ℃ to obtain a crude product (14.44 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol), whereby the title compound (11.11g, 74%) was obtained as a white solid.

3.2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -N²-isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N⁶Synthesis of (E) -benzoyldeoxyadenosyl-3' -yl esters

[ example 3-1 ]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- (4, 4' -dimethoxytrityl) -N⁶Synthesis of (E) -benzoyldeoxyadenosyl-3' -yl esters

The procedure of example 2-1 was followed using 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid (1.97g, 2.00mmol) and 5 '-O- (4, 4' -dimethoxytrityl) -N⁶Benzoyl deoxyadenosine (1.58g, 2.40mmol) gave the title compound (3.11g, 96%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.40(m，84H)，1.42－1.50(m，6H)，1.71－1.84(m，7H)，2.73(dd，1H，J＝4.4，12.8Hz)，3.04－3.13(m，1H)，3.46(d，2H，J＝4.0Hz)，3.77(s，6H)，3.99－4.05(m，6H)，4.34－4.37(m，1H)，4.86(s，2H)，5.67(d，1H，J＝5.6Hz)，6.51(dd，1H，J＝5.6，8.4Hz)，6.79(d，2H，J＝9.4Hz)，7.18－7.29(m，7H)，7.31(s，2H)，7.38(d，2H，J＝7.2Hz)，7.53(dd，2H，J＝7.2，7.6Hz)，7.59－7.63(m，1H)，8.03(d，2H，J＝7.2Hz)，8.17(s，1H)，8.74(s，1H)，8.98(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.13，22.71，26.08，26.11，29.33，29.38，29.43，29.60，29.67，29.74，30.36，31.94，38.00，55.23，61.16，63.52，69.23，73.58，84.35，84.48，86.82，108.35，113.25，123.22，123.32，127.03，127.85，127.95，128.08，128.91，129.99，130.04，132.82，133.66，135.38，135.42，141.21，143.07，144.33，149.53，151.56，152.75，152.97，158.63，164.48，165.89，167.38.

TOF/MS(ESI)：C₁₀₁H₁₄₉N₅O₁₂Na[M+Na]⁺Calculated value of 1647.1100, Experimental value of 1647.1149.

[ example 3-2 ]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁶Synthesis of (E) -benzoyldeoxyadenosyl-3' -yl esters

The procedure of example 2-2 was followed using 5 '-O- (4, 4' -dimethoxytrityl) -N-2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid⁶-benzoyldeoxyadenosin-3' -yl ester (3.00g, 1.85mmol) to give the title compound (2.25g, 92%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.40(m，84H)，1.44－1.50(m，6H)，1.71－1.85(m，7H)，2.53(dd，1H，J＝5.6，14.0Hz)，3.21－3.28(m，1H)，3.89－3.96(m，1H)，3.98－4.06(m，6H)，4.36(s，1H)，4.87(s，2H)，5.70(d，1H，J＝5.2Hz)，5.91(brs，1H)，6.32(dd，1H，J＝5.6，10.0Hz)，7.32(s，2H)，7.54(dd，2H，J＝7.2，8.0Hz)，7.61－7.65(m，1H)，8.03(d，2H，J＝7.2Hz)，8.07(s，1H)，8.79(s，1H)，9.07(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.12，22.70，26.07，26.11，29.33，29.37，29.42，29.59，29.67，29.73，30.35，31.94，37.76，61.20，63.17，69.28，73.60，87.18，87.61，108.39，123.17，124.66，127.90，128.96，133.01，133.39，142.42，143.17，150.40，150.68，152.26，153.00，164.42，165.97，167.41.

TOF/MS(ESI)：C₈₀H₁₃₁N₅O₁₀Na[M+Na]⁺Calculated value of 1344.9794, experimental value 1344.9828.

[ examples 3-3 ]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (thymidine-3' -yl) phosphoryl) -N⁶Synthesis of (E) -benzoyldeoxyadenosyl-3' -yl esters

The procedure of examples 2 to 3 was followed using N-acetic acid 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate⁶-benzoyldeoxyadenosin-3' -yl ester (2.00g, 1.51mmol) and DMTr-dT-CE-phosphoramidite (2.25g, 3.02mmol) to give the title compound (2.50g, 97%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.12－1.40(m，84H)，1.43－1.50(m，6H)，1.71－1.85(m，9H)，1.94(s，1H)，2.22－2.51(m，2H)，2.70－2.78(m，3H)，3.14－3.26(m，1H)，3.45－3.56(m，1H)，3.69－3.85(m，2H)，3.95－4.07(m，6H)，4.07－4.32(m，3H)，4.40－4.48(m，3H)，4.88(s，2H)，4.99－5.11(m，1H)，5.67－5.73(m，1H)，6.11－6.22(m，1H)，6.50－6.58(m，1H)，7.30(s，2H)，7.41－7.53(m，3H)，7.57－7.61(m，1H)，8.02－8.06(m，2H)，8.38(m，1H)，8.81(m，1H)，9.58－9.67(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ12.43，14.14，19.66，19.73，19.78，22.71，26.09，26.15，29.35，29.38，29.46，29.61，29.68，29.74，29.99，30.38，31.94，36.57，36.87，38.35，61.13，61.84，61.92，62.45，62.49，62.58，62.62，67.39，69.27，73.61，74.81，75.06，78.89，79.19，79.24，82.98，83.05，83.12，84.47，84.54，85.43，85.48，85.62，85.67，85.79，85.93，108.34，111.22，111.27，116.52，116.64，123.01，123.82，124.08，128.27，128.31，128.69，128.72，132.87，132.94，133.17，133.41，136.45，141.68，141.86，143.18，149.93，150.00，150.47，151.84，152.05，152.67，153.01，163.81，163.86，165.43，165.53，165.99，167.76.

TOF/MS(ESI)：C₉₃H₁₄₇N₈O₁₇PNa[M+Na]⁺Meter (2)Calculated 1702.0520 and experimental 1702.0604.

[ examples 3 to 4]

(4) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -N²-isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N⁶Synthesis of (E) -benzoyldeoxyadenosyl-3' -yl esters

In 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (thymidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosin-3' -yl ester (7.98g, 4.75mmol), N²After 5-benzylthio-1H-tetrazole (2.74g, 14.25mmol) was added to a suspension of isobutyryl-DMTr-dG-CE phosphoramidite (11.97g, 14.25mmol) in methylene chloride (90mL), the mixture was stirred at room temperature for 3 hours. Then, cumene hydroperoxide (content 82%) (2.64g, 14.25mmol) was added thereto, followed by stirring at room temperature for 1 hour. The solid precipitated by adding acetone (120mL) and acetonitrile (359mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-acetone-dichloromethane, acetonitrile and methanol, and dried under reduced pressure at 50 ℃ to obtain the title compound (10.86g, 94%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.12－1.40(m，90H)，1.43－1.50(m，6H)，1.71－1.93(m，9H)，1.95－2.16(m，2H)，2.35－2.87(m，9H)，3.16－3.37(m，3H)，3.76(s，6H)，3.99－4.05(m，6H)，4.09－4.43(m，10H)，4.86(s，2H)，5.07－5.26(m，2H)，5.65－5.71(m，1H)，5.91－6.22(m，2H)，6.49－6.54(m，1H)，6.78(d，4H，J＝8.4Hz)，7.15－7.27(m，8H)，7.30(s，2H)，7.34－7.36(m，2H)，7.43－7.48(m，2H)，7.54－7.59(m，1H)，7.69－7.71(m，1H)，7.98－8.02(m，2H)，8.30－8.41(m，1H)，8.75－8.82(m，1H)，9.43－9.58(m，1H)，9.88－10.27(m，1H)，12.09－12.22(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.23，12.36，14.13，18.84，19.00，19.05，19.65，19.73，22.70，26.09，26.15，29.35，29.37，29.46，29.61，29.68，29.74，29.77，30.38，31.94，35.89，36.47，36.63，55.26，61.13，62.47，62.63，62.68，63.42，67.55，69.28，73.61，74.86，75.05，79.76，81.43，83.08，83.59，84.68，86.85，108.33，111.11，111.17，113.15，113.26，116.48，116.75，116.88，121.42，121.59，123.03，124.05，127.07，127.12，127.78，127.85，127.98，128.06，128.74，129.14，130.05，132.88，133.37，135.23，139.48，141.92，142.01，143.18，144.23，147.35，148.11，148.27，148.49，149.98，150.09，151.80，152.60，153.01，155.40，155.47，158.62，158.68，164.77，165.20，165.96，167.71，167.74，179.81，180.21.

TOF/MS(ESI)：C₁₃₁H₁₈₆N₁₄O₂₆P₂Na[M+Na]⁺Calculated value of 2456.3036, experimental value 2456.2988.

2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴Synthesis of (E) -benzoyldeoxycytidine-3' -yl ester

[ examples 3 to 5]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- (4, 4' -dimethoxytrityl) -N⁴Synthesis of (E) -benzoyldeoxycytidine-3' -yl ester

The procedure of example 2-1 was followed, starting from 2- ((3, 4,5-Trioctadecyloxy) benzoyl) oxy acetic acid (1.97g, 2.00mmol) and 5 '-O- (4, 4' -dimethoxytrityl) -N⁴Benzoyl deoxycytidine (1.52g, 2.40mmol) gave the title compound (3.10g, 97%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.12－1.53(m，90H)，1.71－1.85(m，6H)，2.36－2.43(m，1H)，2.83－2.95(m，1H)，3.49(ddd，2H，J＝3.2，10.4，18.0Hz)，3.78(s，3H)，3.79(s，3H)，3.95－4.07(m，6H)，4.30－4.35(m，1H)，4.83(dd，2H，J＝16.0，23.6Hz)，5.51－5.58(m，1H)，6.33(dd，1H，J＝6.0，7.6Hz)，6.86(dd，4H，J＝2.4，8.8Hz)，7.20－7.38(m，11H)，7.50－7.54(m，2H)，7.60－7.64(m，1H)，7.88(d，2H，J＝7.2Hz)，8.14(d，1H，J＝7.6Hz)，8.40－8.60(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.09，22.70，26.10，26.15，29.38，29.46，29.61，29.68，29.75，30.40，31.95，39.47，55.26，61.10，63.17，69.33，73.59，75.77，84.68，87.32，108.54，113.46，123.32，127.22，128.10，128.13，129.10，130.04，130.10，133.20，135.13，135.30，144.07，153.01，158.84，165.81，167.43.

TOF/MS(ESI)：C₁₀₀H₁₄₉N₃O₁₃Na[M+Na]⁺Calculated value of 1623.0988, experimental value 1623.1069.

[ examples 3 to 6]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁴Synthesis of (E) -benzoyldeoxycytidine-3' -yl ester

The procedure of example 2-2 was followed using 5 '-O- (4, 4' -dimethoxytrityl) -N-2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid⁶-benzoyl deoxycytidine-3' -yl ester(3.04g, 1.90mmol) to give the title compound (2.39g, 97%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.20－1.51(m，90H)，1.71－1.85(m，6H)，2.46－2.53(m，1H)，2.69－2.80(m，1H)，3.92－4.04(m，8H)，4.27(d，1H，J＝2.4Hz)，4.84(dd，2H，J＝16.4，20.4Hz)，5.51－5.53(m，1H)，6.26(dd，1H，J＝5.6，7.6Hz)，7.29(s，2H)，7.48－7.62(m，4H)，7.88(d，2H，J＝7.6Hz)，8.28(d，1H，J＝7.2Hz)，8.66－8.91(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.10，22.71，26.10，26.14，29.38，29.45，29.61，29.68，29.75，30.39，31.95，38.46，61.15，62.37，69.34，73.61，75.80，85.82，88.44，108.55，123.25，127.61，129.07，133.25，143.25，145.32，153.01，162.38，165.89，167.79.

TOF/MS(ESI)：C₇₉H₁₃₁N₃O₁₁Na[M+Na]⁺Calculated value of 1320.9681, experimental value 1320.9723.

[ examples 3 to 7]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5' -O- ((2-cyanoethoxy) (N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴Synthesis of (E) -benzoyldeoxycytidine-3' -yl ester

The procedure of examples 2 to 3 was followed using N-acetic acid 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate⁴-benzoyl deoxycytidine-3' -yl ester (2.27g, 1.75mmol) and N²Isobutyryl DMTr-dG-CE-phosphoramidite (2.94g, 3.50mmol) gave the title compound (3.02g, 99%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.08－1.53(m，96H)，1.70－1.84(m，6H)，2.36－2.62(m，2H)，2.75－3.30(m，7H)，3.75－3.87(m，2H)，3.98－4.04(m，6H)，4.26－4.53(m，6H)，4.78－4.89(m，2H)，5.26－5.29(m，1H)，5.42－5.52(m，1H)，5.92－6.11(m，1H)，6.24－6.38(m，1H)，7.26－7.28(m，2H)，7.38－7.67(m，4H)，7.80－7.89(m，2H)，7.95－8.00(m，1H)，8.14－8.24(m，1H)，10.22－10.70(m，1H)，12.08－12.22(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，18.96，18.99，19.05，19.81，19.87，22.71，26.08，26.15，29.34，29.38，29.46，29.61，29.68，29.75，30.37，31.94，36.01，36.06，38.37，38.83，39.11，61.09，62.01，62.59，62.64，62.77，62.82，67.20，67.51，69.25，73.60，74.76，75.03，80.49，83.50，83.75，84.57，84.81，86.32，87.91，88.04，97.29，97.50，108.30，116.55，116.68，120.72，121.05，123.01，127.73，127.80，128.88，128.93，132.71，132.81，133.28，138.19，138.30，143.13，144.20，144.42，147.79，147.99，148.16，148.33，152.99，155.25，155.65，162.86，163.04，165.92，165.95，167.77，167.85，179.77，180.03.

TOF/MS(ESI)：C₉₆H₁₅₂N₉O₁₈PNa[M+Na]⁺Calculated value of 1773.0891, experimental value 1773.0914.

[ examples 3 to 8]

(4) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴Synthesis of (E) -benzoyldeoxycytidine-3' -yl ester

5' -O- ((2-cyanoethoxy) (N)²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyldeoxycytidine-3' -yl ester (2.80g, 1.60mmol) and DMTr-dT-CE phosphoramidite (3.58g, 4.80mmol) to give the title compound (3.44g, 89%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.13－1.55(m，99H)，1.71－1.84(m，6H)，1.95－2.14(m，2H)，2.27－2.95(m，9H)，3.00－3.55(m，3H)，3.73－3.81(m，6H)，3.99－4.04(m，6H)，4.14－4.48(m，11H)，4.82－4.85(m，2H)，5.05－5.53(m，3H)，6.00－6.46(m，3H)，6.76－6.87(m，4H)，7.20－7.36(m，11H)，7.44－7.64(m，4H)，7.72－7.88(m，3H)，8.11－8.22(m，1H)，9.00－9.15(m，1H)，10.29－10.49(m，1H)，12.14－12.17(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.67，11.71，14.13，18.86，18.90，18.94，18.98，19.00，19.59，19.67，19.81，19.88，22.70，26.08，26.15，29.35，29.37，29.46，29.61，29.67，29.74，29.77，30.37，31.94，35.88，38.67，55.29，61.13，62.66，62.73，62.87，63.33，69.25，73.59，84.20，84.28，85.31，87.29，108.31，111.69，111.73，113.15，113.35，116.64，116.79，123.01，127.31，127.71，127.77，128.08，128.99，129.14，130.09，133.33，134.93，134.97，135.01，135.17，143.14，143.96，144.04，147.84，147.93，148.16，150.40，150.48，152.99，155.48，158.83，163.52，165.96，167.86，179.65，179.76.

TOF/MS(ESI)：C₁₃₀H₁₈₆N₁₂O₂₇P₂Na[M+Na]⁺Calculated value of 2432.2923, experimental value 2432.2937.

2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

[ examples 3 to 9]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- (4, 4' -dimethoxytrityl) -N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

The procedure of example 2-1 was followed using 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid (1.97g, 2.00mmol) and 5 '-O- (4, 4' -dimethoxytrityl) -N²Isobutyryl deoxyguanosine (1.54g, 2.40mmol) gave the title compound (3.14g, 98%).

¹H－NMR(400MHz，CDCl₃)：δ0.86－0.89(m，12H)，1.03(d，3H，J＝6.8Hz)，1.11－1.40(m，84H)，1.42－1.50(m，6H)，1.70－1.83(m，6H)，1.95(sept，1H，J＝6.8Hz)，2.51(dd，1H，J＝5.2，12.4Hz)，3.17－3.29(m，2H)，3.42(dd，1H，J＝3.2，10.4Hz)，3.76(s，3H)，3.77(s，3H)，3.98－4.05(m，6H)，4.22(s，1H)，4.83(s，2H)，5.70(d，1H，J＝6.0Hz)，6.07(dd，1H，J＝5.2，9.2Hz)，6.76－6.82(m，4H)，7.16－7.38(m，9H)，7.43－7.50(m，2H)，7.71(s，1H)，7.73(s，1H)，11.96(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.13，18.64，18.77，22.71，26.05，26.11，29.32，29.37，29.42，29.60，29.66，29.68，29.74，29.75，29.77，30.33，31.94，36.17，37.21，55.24，61.24，63.48，69.30，73.64，76.16，83.94，84.44，86.49，108.33，113.27，113.29，122.34，123.24，127.15，128.02，129.99，135.47，135.77，137.83，143.04，144.70，147.18，148.02，152.94，155.38，158.74，166.00，167.35，178.30.

TOF/MS(ESI)：C₉₈H₁₅₁N₅O₁₃Na[M+Na]⁺Calculated value of 1629.1206, experimental value 1629.1240.

[ examples 3 to 10 ]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

The procedure of example 2-2 was followed using 5 '-O- (4, 4' -dimethoxytrityl) -N-2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid²Isobutyryl deoxyguanosine-3' -yl ester (3.05g, 1.90mmol) gave the title compound (2.42g, 98%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.20－1.50(m，96H)，1.71－1.85(m，6H)，2.48(dd，1H，J＝5.6，14.0Hz)，2.72(sept，1H，J＝6.8Hz)，2.97－3.05(m，1H)，3.49(brs，2H)，3.86－4.05(m，8H)，4.26(s，1H)，4.86(s，2H)，5.59(d，1H，J＝6.0)，6.13(dd，1H，J＝5.6，9.2Hz)，7.30(s，2H)，7.86(s，2H)，8.82(s，1H)，12.16(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.10，18.94，18.97，22.71，26.09，26.15，29.38，29.45，29.61，29.69，29.75，30.39，31.96，36.50，37.85，61.26，62.92，69.43，73.67，86.27，86.34，108.59，122.49，123.26，138.42，143.34，147.09，147.73，153.04，155.01，166.02，167.52，178.69.TOF/MS(ESI)：C₇₇H_{133 5}O₁₁Na[M+Na]⁺Calculated value of 1326.9899, experimental value 1326.9879.

[ examples 3 to 11 ]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (thymidine-3' -yl) phosphoryl) -N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

The procedure of examples 2 to 3 was followed using N-acetic acid 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate²Isobutyryl deoxyguanosin-3' -yl ester (2.25g, 1.72mmol) and DMTr-dT-CE-phosphoramidite (2.57g, 3.45mmol) gave the title compound (2.68g, 94%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.05－1.52(m，96H)，1.71－1.89(m，9H)，2.24－2.78(m，8H)，3.38－3.49(m，1H)，3.69－4.05(m，8H)，4.17－4.89(m，7H)，5.20－5.29(m，1H)，5.55－5.66(m，1H)，6.08－6.24(m，2H)，7.30(s，2H)，7.42－7.54(m，1H)，7.68－7.73(m，1H)，8.64－8.83(m，1H)，10.20－10.32(m，1H)，12.11－12.22(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.46，14.14，18.59，18.93，19.06，19.42，19.66，19.71，19.73，19.78，22.71，26.07，26.14，29.33，29.38，29.45，29.61，29.68，29.74，30.36，31.94，35.57，35.93，38.42，61.12，61.24，61.71，61.89，62.56，62.64，62.69，69.26，73.62，75.69，75.81，79.29，82.80，85.73，86.04，86.41，108.29，111.23，111.32，116.46，116.51，122.39，122.98，123.03，136.55，136.78，139.04，143.11，143.18，147.93，147.98，150.30，150.37，152.98，155.39，155.59，163.53，163.62，166.00，166.12，167.69，167.86，179.92，180.04.

TOF/MS(ESI)：C₉₀H₁₄₉N₈O₁₈PNa[M+Na]⁺Calculated value of 1684.0625, experimental value 1684.0648.

[ examples 3 to 12 ]

(4) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

The procedure of examples 3 to 4 was followed using 5 '-O- ((2-cyanoethoxy) (thymidine-3' -yl) phosphoryl) -N- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid²Isobutyryl deoxyguanosin-3' -yl ester (2.50g, 1.50mmol) and DMTr-dT-CE phosphoramidite (3.36g, 4.51mmol) gave the title compound (3.11g, 89%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.4Hz)，1.05－1.53(m，96H)，1.71－1.88(m，13H)，2.24－2.87(m，10H)，3.25－3.53(m，3H)，3.72－3.81(m，7H)，3.95－4.05(m，6H)，4.05－4.72(m，10H)，4.81－4.91(m，2H)，5.03－5.24(m，2H)，5.55－5.61(m，1H)，5.95－6.43(m，3H)，6.82－6.85(m，4H)，7.18－7.37(m，12H)，7.53(s，1H)，7.73(s，1H)，9.10－9.31(m，2H)，10.05－10.09(m，1H)，12.18(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.68，11.72，12.33，12.37，14.14，18.78，18.88，19.13，19.24，19.58，19.65，19.70，19.77，22.70，26.08，26.16，29.34，29.38，29.46，29.62，29.68，29.74，29.77，30.36，31.94，35.84，35.99，37.65，38.95，55.29，61.18，62.62，62.77，62.83，63.26，67.10，67.45，69.27，73.63，75.55，79.91，82.62，82.87，84.27，87.31，108.29，111.50，111.80，113.15，113.35，116.66，116.74，116.86，122.51，122.59，123.07，127.32，128.08，128.13，129.13，130.13，134.95，135.12，136.32，138.75，143.10，143.99，147.93，147.97，148.04，150.28，150.37，150.60，150.69，152.98，155.49，155.54，158.81，163.63，163.68，163.79，166.02，167.69，167.71，179.73，179.77.

TOF/MS(ESI)：C₁₂₄H₁₈₃N₁₁O₂₇P₂Na[M+Na]⁺Calculated value of 2343.2658, experimental value 2343.2742.

2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (i) -isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl ester

[ examples 3 to 13 ]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5' -O- ((2-cyanoethoxy) (N²Synthesis of (i) -isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl ester

Following the procedure of examples 2-3, thymidine-3' -yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate (1.82g, 1.50mmol) and N²isobutyryl-DMTr-dG-CE phosphoramidite (2.52g, 3.00mmol) gave the title compound (2.43g, 98%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.2Hz)，1.00－1.41(m，90H)，1.41－1.54(m，6H)，1.71－1.85(m，6H)，1.92－2.00(m，3H)，2.24－2.97(m，6H)，3.68－4.08(m，8H)，4.14－4.54(m，6H)，4.78－4.92(m，2H)，5.14－5.78(m，2H)，5.95－6.24(m，2H)，7.27－7.43(m，3H)，7.87－7.95(m，1H)，10.19－10.49(m，2H)，12.24－12.38(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.35，14.14，19.01，19.06，19.10，19.73，19.80，19.85，22.70，26.07，26.14，29.33，29.38，29.45，29.61，29.68，29.74，30.02，30.36，31.77，31.94，35.80，35.92，36.62，38.19，38.48，61.05，61.13，62.26，62.44，62.49，62.70，62.75，66.12，67.37，69.21，73.58，74.51，80.47，80.64，82.33，82.40，85.33，85.52，86.12，86.55，86.84，87.31，108.24，111.24，112.18，116.50，116.83，121.43，121.59，123.05，123.08，136.55，137.73，138.66，138.99，143.02，143.06，147.75，147.78，148.49，150.42，151.06，152.96，152.97，155.23，155.27，164.76，164.83，165.92，165.96，167.73，167.80，180.26，180.45.

TOF/MS(ESI)：C₉₀H₁₄₉N₈O₁₈PNa[M+Na]⁺Calculated value of 1684.0625, experimental value 1684.0643.

[ examples 3 to 14 ]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (i) -isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl ester

The procedure of examples 3 to 4 was followed using 5' -O- ((2-cyanoethoxy) (N-cyanoethoxy) (2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid²Isobutyryl deoxyguanosin-3 '-yl) phosphoryl) thymidine-3' -yl ester (2.20g, 1.32mmol) and DMTr-dT-CE-phosphoramidite (2.96g, 3.97mmol) gave the title compound (2.76g, 90%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.13－1.47(m，96H)，1.71－2.01(m，15H)，2.35－2.85(m，10H)，3.31－3.51(m，2H)，3.78(s，6H)，3.96－4.04(m，6H)，4.05－4.59(m，10H)，4.84(s，2H)，5.13－5.55(m，3H)，6.11－6.42(m，3H)，6.83(d，4H，J＝8.8Hz)，7.16－7.37(m，12H)，7.45－7.55(m，1H)，7.72－7.80(m，1H)，9.23－10.39(m，3H)，12.15－12.21(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.70，12.39，12.45，14.14，18.82，18.86，19.04，19.08，19.58，19.65，19.74，19.80，22.70，26.08，26.15，29.34，29.38，29.46，29.61，29.68，29.74，29.77，30.37，31.94，35.89，36.13，36.52，38.68，55.29，61.12，62.74，62.89，63.22，63.32，67.12，69.23，73.60，74.76，79.03，79.98，82.49，84.28，85.14，87.28，108.26，111.37，111.49，111.69，111.72，113.14，113.34，116.74，116.84，116.92，121.89，121.96，123.02，127.08，127.31，127.76，127.85，128.08，129.13，130.11，134.94，134.99，135.03，135.20，135.30，136.93，138.26，139.46，143.07，143.96，144.04，147.98，148.02，148.14，148.23，150.46，150.57，150.62，152.97，155.42，158.60，158.79，163.79，164.43，164.50，165.96，167.79，179.87，179.95.

TOF/MS(ESI)：C₁₂₄H₁₈₃N₁₁O₂₇P₂Na[M+Na]⁺Calculated value of 2343.2658, experimental value 2343.2693.

[ examples 3 to 15 ]

Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -thymidine-3 ' -yl) thiophosphoryl) -thymidine-3 ' -yl ester of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid

To a suspension of thymidine-3' -yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate (1.82g, 1.50mmol) and DMTr-dT-CE phosphoramidite (2.23g, 3.00mmol) in methylene chloride (27mL) was added 5-benzylthio-1H-tetrazole (0.58g, 3.00mmol), and the mixture was stirred at room temperature for 1.5 hours. Then ((N, N-dimethylaminomethylene) amino) -3H-1, 2, 4-dithiazole-3-thione (1.13g, 4.50mmol) and pyridine (0.87g, 9.00mmol) were added, and the mixture was stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetonitrile (109mL) into the reaction solution was filtered. The solid was washed with a mixed solvent of acetonitrile-dichloromethane, acetonitrile and methanol, and dried under reduced pressure at 50 ℃ to obtain the title compound (2.71g, 96%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.53(m，93H)，1.72－1.84(m，6H)，1.92－1.95(m，3H)，2.28－2.49(m，3H)，2.57－2.66(m，2H)，2.77(dd，1H，J＝6.0，7.2Hz)，3.39－3.50(m，2H)，3.79(s，6H)，3.97－4.04(m，6H)，4.09－4.40(m，6H)，4.83(d，2H，J＝6.8Hz)，5.31－5.43(m，2H)，6.27－6.32(m，1H)，6.35－6.41(m，1H)，6.82－6.86(m，4H)，7.22－7.32(m，10H)，7.37－7.39(m，2H)，7.56(s，1H)，8.69－8.91(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ11.79，12.58，14.14，19.31，19.40，19.47，19.55，22.70，26.07，26.13，29.32，29.38，29.44，29.60，29.68，29.73，30.35，31.94，36.78，39.00，55.29，61.06，62.65，62.69，62.90，62.94，63.21，67.63，69.19，73.56，75.01，75.09，80.18，82.27，82.36，84.40，84.53，84.91，85.39，87.31，108.25，111.74，111.90，113.37，116.15，116.39，123.06，127.28，128.05，128.11，130.09，134.97，135.03，135.06，135.30，143.01，144.04，150.22，150.27，150.35，152.94，158.78，163.36，163.46，165.86，165.88，167.71，167.76.

TOF/MS(ESI)：C₁₀₇H₁₆₂N₅O₁₉PSNa[M+Na]⁺Calculated value of 1907.1220, experimental value 1907.1223.

4.2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁴Synthesis of (E) -benzoyl-5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O-methyluridine-3 ' -yl) phosphoryl) -2 ' -O-methylcytidin-3 ' -yl ester

[ example 4-1 ]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁴Synthesis of (E) -benzoyl-5 '-O- (4, 4' -dimethoxytrityl) -2 '-O-methylcytidin-3' -yl ester

The procedure of example 2-1 was followed using 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid (1.97g, 2.00mmol) and N⁴-benzoyl-5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O-methylcytidine (1.59g, 2.40mmol) to give the title compound (2.96g, 91%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.38(m，84H)，1.42－1.50(m，6H)，1.70－1.85(m，6H)，3.48(d，1H，J＝11.6Hz)，3.62(s，3H)，3.69(d，1H，J＝11.2Hz)，3.71(s，1H)，3.83(s，5H)，3.97－4.04(m，6H)，4.18(d，1H，J＝4.8Hz)，4.36(d，1H，J＝8.4Hz)，4.80－4.89(m，2H)，5.29(dd，1H，J＝4.8Hz，8.4Hz)，6.11(d，1H，J＝1.6Hz)，6.90(dd，4H，J＝2.0，8.8Hz)，7.27－7.42(m，11H)，7.52(t，2H，J＝7.6Hz)，7.62(t，1H，J＝7.6Hz)，7.89(d，2H，J＝7.6Hz)，8.55(d，1H，J＝6.4Hz)，8.61－8.72(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，22.70，26.07，26.09，26.11，29.31，29.38，29.43，29.59，29.66，29.68，29.73，30.34，31.94，52.31，55.24，59.15，60.47，60.72，61.06，69.14，70.07，73.53，80.42，82.21，87.49，88.91，108.22，113.43，123.33，123.50，127.27，127.49，128.17，129.06，130.06，130.08，133.17，135.07，135.22，142.85，143.86，152.87，152.90，158.75，165.64，165.84，167.17，168.42.

TOF/MS(ESI)：C₁₀₁H₁₅₁N₃O₁₄Na[M+Na]⁺Calculated value of 1653.1094, experimental value 1653.1171.

[ example 4-2 ]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁴Synthesis of (E) -benzoyl-2 '-O-methylcytidin-3' -yl ester

The procedure of example 2-2 was followed using N-acetic acid 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate⁴-benzoyl-5 '-O- (4, 4' -dimethoxytrityl) -2 '-O-methylcytidin-3' -yl ester (2.80g, 1.72mmol) gave the title compound (2.26g, 99%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.55(m，90H)，1.70－1.85(m，6H)，3.51(s，3H)，3.79－3.83(m，2H)，3.95－4.08(m，7H)，4.34(d，1H，J＝4.8Hz)，4.50(t，1H，J＝4.8Hz)，4.83－4.90(m，2H)，5.44(t，1H，J＝4.8Hz)，5.73(d，1H，J＝4.4Hz)，7.29－7.30(m，2H)，7.47－7.66(m，3H)，7.90(d，2H，J＝7.6Hz)，8.16(d，1H，J＝7.6Hz)，8.75－9.00(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，22.71，26.07，26.11，29.30，29.38，29.42，29.59，29.66，29.68，29.73，30.34，31.94，52.32，59.19，60.97，61.07，61.24，69.15，69.20，71.18，73.56，80.58，83.43，92.64，108.28，123.20，123.50，127.61，129.09，132.80，133.36，142.99，147.07，152.87，152.93，162.63，165.85，167.66，168.43.

TOF/MS(ESI)：C₈₀H₁₃₃N₃O₁₂Na[M+Na]⁺Calculated value of 1350.9787, experimental value 1350.9855.

[ examples 4-3 ]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid N⁴Synthesis of (E) -benzoyl-5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O-methyluridine-3 ' -yl) phosphoryl) -2 ' -O-methylcytidin-3 ' -yl ester

The procedure of examples 3 to 4 was followed using N-acetic acid 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate⁴Benzoyl-2 '-O-methylcytidin-3' -yl ester (2.10g, 1.58mmol) and 5 '-O-DMTr-2' -O-methyluridine-CE phosphoramidite (2.40g, 3.16mmol) gave the crude product (2.80 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol) to give the title compound (2.21g, 70%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.53(m，90H)，1.71－1.83(m，6H)，2.50－2.74(m，1H)，2.79(t，1H，J＝6.4Hz)，3.46－3.76(m，8H)，3.77(s，3H)，3.79(s，3H)，3.97－4.04(m，6H)，4.11－4.58(m，7H)，4.82－4.95(m，2H)，5.13－5.30(m，3H)，5.86－6.08(m，2H)，6.82－6.88(m，4H)，7.23－7.36(m，11H)，7.51(t，2H，8.0Hz)，7.61(t，1H，J＝7.2Hz)，7.82－8.05(m，4H)，8.69－8.96(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，19.52，19.58，22.70，26.07，26.13，29.33，29.38，29.45，29.60，29.68，29.73，30.35，31.94，55.25，55.30，58.84，59.27，60.82，61.14，62.35，62.40，62.68，62.73，65.55，66.16，69.19，69.90，70.16，73.56，74.28，74.38，79.38，79.46，79.52，79.60，81.32，81.38，81.52，82.19，86.71，86.87，87.46，90.07，90.64，102.58，102.62，108.24，113.34，113.36，116.36，116.43，123.19，127.39，127.44，127.64，128.10，128.12，128.26，128.29，129.04，130.21，130.27，130.30，133.28，134.64，134.73，139.53，139.75，142.96，143.82，143.90，150.02，150.07，152.93，158.81，158.84，158.86，162.70，162.73，165.77，165.81，167.22，167.26.

TOF/MS(ESI)：C₁₁₄H₁₆₇N₆O₂₂PNa[M+Na]⁺Calculated value of 2026.1769, experimental value 2026.1764.

2－((3，4，5-Trioctadecyloxy) benzoyl) oxy acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -fluorodeoxyuridine-3 '-yl) phosphoryl) -2' -fluoro-N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

[ examples 4 to 4]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -fluoro-N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

Following the procedure of example 2-1, starting from 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid (1.97g, 2.00mmol) and 5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -fluoro-N²Isobutyryl deoxyguanosine (1.58g, 2.40mmol) gave the title compound (3.13g, 96%).

¹H－NMR(400MHz，CDCl₃)：δ0.81(d，3H，J＝6.8Hz)，0.88(t，9H，J＝6.8Hz)，0.94(d，3H，J＝7.2Hz)，1.10－1.53(m，90H)，1.70－1.87(m，6H)，1.93(sept，1H，J＝6.8Hz)，3.17(d，1H，J＝11.2Hz)，3.59(d，1H，J＝11.2Hz)，3.77(s，6H)，3.97－4.05(m，6H)，4.32－4.34(m，1H)，4.85(d，1H，J＝16.0Hz)，4.92(d，1H，J＝16.0Hz)，5.92－6.07(m，2H)，6.18－6.24(m，1H)，6.78(dd，4H，J＝5.2，8.8Hz)，7.16－7.29(m，7H)，7.30(s，2H)，7.36(d，2H，J＝8.0Hz)，7.79(s，1H)，8.01(s，1H)，11.92(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，18.39，18.47，18.88，18.91，22.70，25.61，26.06，26.11，29.30，29.38，29.42，29.59，29.66，29.68，29.73，30.34，31.94，36.25，36.43，55.24，55.25，60.68，60.84，61.24，67.98，69.25，70.85，71.00，73.61，79.97，81.44，83.15，86.36，86.47，86.67，90.96，108.26，113.15，113.22，122.23，123.17，127.08，127.13，127.76，127.85，127.89，127.98，129.13，129.85，129.92，135.20，135.66，138.43，138.70，139.43，143.05，144.47，147.30，147.34，147.47，147.90，152.93，152.96，155.04，155.31，158.62，158.69，165.65，165.89，167.23，167.60，178.18，178.76.

TOF/MS(ESI)：C₉₈H₁₅₀N₅O₁₃F[M+H]⁺Calculated value of 1623.1136, experimental value 1623.1160.

[ examples 4 to 5]

(2) 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 2' -fluoro-N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

Following the procedure of example 2-2, starting from 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -fluoro-N²Isobutyryl deoxyguanosine-3' -yl ester (3.00g, 1.85mmol) gave the title compound (2.40g, 98%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.55(m，96H)，1.70－1.85(m，6H)，2.71(sept，1H，J＝6.8Hz)，3.37－3.72(brs，2H)，3.80(d，1H，J＝11.6Hz)，3.99－4.05(m，7H)，4.34(d，1H，J＝4.0Hz)，4.94(s，2H)，5.69(dt，1H，J＝4.4，52.0Hz)，5.78－5.84(m，1H)，5.97(dd，1H，J＝4.0，16.0Hz)，7.31(s，2H)，7.90(s，1H)，9.22(s，1H)，12.15(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，18.85，18.95，22.70，26.06，26.11，29.30，29.38，29.43，29.60，29.68，29.74，30.33，31.94，36.32，60.86，69.24，71.25，71.39，73.60，82.89，87.22，87.55，89.60，91.55，108.27，121.56，123.15，138.45，142.99，147.29，148.08，152.91，155.03，165.91，167.26，179.15.

TOF/MS(ESI)：C₇₇H₁₃₂N₅O₁₁FNa[M+Na]⁺Calculated value of 1344.9805, experimental value 1344.9834.

[ examples 4 to 6]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -fluorodeoxyuridine-3 '-yl) phosphoryl) -2' -fluoro-N²Synthesis of (iso) butyryl deoxyguanosine-3' -yl ester

The procedure of examples 3 to 4 was followed using 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid 2' -fluoro-N²Isobutyryl deoxyguanosine-3 ' -yl ester (2.20g, 1.66mmol) and 5 ' -O-DMTr-2 ' -fluoro-deoxyuridine-CE phosphoramidite (2.49g, 3.33mmol) gave the title compound (3.07g, 93%).

¹H－NMR(400MHz，CDCl₃)：0.88(t，9H，J＝7.2Hz)，0.97－1.53(m，96H)，1.71－1.83(m，6H)，2.56－2.75(m，3H)，3.37－3.66(m，2H)，3.74－3.79(m，6H)，3.97－4.55(m，12H)，4.78－5.08(m，2H)，5.08－5.50(m，3H)，5.70－6.01(m，4H)，6.80－6.84(m，4H)，7.17－7.40(m，11H)，7.57－7.73(m，2H)，8.94－9.07(m，1H)，10.00(s，1H)，12.18－12.26(m，1H).

δ¹³C－NMR(100MHz，CDCl₃)：δ14.14，18.51，18.76，18.92，19.20，19.55，19.62，22.70，26.07，26.14，29.33，29.38，29.45，29.60，29.68，29.74，30.36，31.94，35.90，35.99，55.23，55.30，60.70，60.88，62.85，69.26，73.61，79.54，79.63，87.17，87.21，102.93，108.31，113.31，116.34，116.52，122.55，122.61，122.95，122.98，127.25，127.31，128.07，128.10，130.14，134.79，134.88，134.92，138.65，140.55，143.15，143.19，143.92，144.02，147.71，147.74，148.30，148.43，149.68，149.98，152.98，152.99，155.30，155.48，158.74，158.79，162.67，165.89，166.00，167.20，179.68.

TOF/MS(ESI)：C₁₁₀H₁₆₃N₈O₂₀F₂PNa[M+Na]⁺Calculated value of 2008.1587, experimental value 2008.1593.

Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl) phosphoryl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate

[ examples 4 to 7]

(1) Synthesis of 5 '-O- (4, 4' -dimethoxytrityl) -2 '-O- (tert-butyldimethylsilyl) uridine-3' -yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate

After adding 4-dimethylaminopyridine (0.03g, 0.25mmol) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.58g, 3.00mmol) to a suspension of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) acetic acid (2.46g, 2.50mmol) and 5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O- (tert-butyldimethylsilyl) uridine (1.98g, 3.00mmol) in dichloromethane (25mL), the mixture was stirred at room temperature for 5 hours. The solid precipitated by adding acetonitrile (148mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried under reduced pressure at 50 ℃ to obtain a crude product (2.89 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (2.76g, 68%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.08(s，3H)，0.11(s，3H)，0.81－0.92(m，18H)，1.04－1.53(m，90H)，1.70－1.84(m，6H)，3.49(dd，2H，J＝10.8，27.6Hz)，3.79(s，6H)，3.79－4.04(m，6H)，4.26－4.27(m，1H)，4.56(t，1H，J＝5.2Hz)，4.81(d，1H，J＝16.0Hz)，4.96(d，1H，16.4Hz)，5.30(d，1H，J＝8.0Hz)，5.47(t，1H，J＝4.0Hz)，6.02(d，1H，J＝5.6Hz)，6.85(d，4H，J＝8.4Hz)，7.23－7.37(m，11H)，7.85(d，1H，J＝8.4Hz)，8.37(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ－5.22，－5.09，14.14，17.87，22.71，25.51，26.07，26.11，29.30，29.38，29.43，29.59，29.67，29.74，30.34，31.94，55.25，60.75，62.47，69.14，73.36，73.54，74.40，81.20，87.58，88.03，102.56，108.25，113.40，113.43，123.33，127.33，128.03，128.14，130.03，130.17，134.71，134.83，140.00，142.87，144.10，150.14，152.89，158.78，158.83，162.59，165.67，167.10.

TOF/MS(ESI)：C₉₉H₁₅₈N₂O₁₄SiNa[M+Na]⁺Calculated value of 1650.1380, experimental value 1650.1455.

[ examples 4 to 8]

(2) Synthesis of 2 '-O- (tert-butyldimethylsilyl) uridine-3' -yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate

The title compound (2.05g, 97%) was obtained from 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 5 '-O- (4, 4' -dimethoxytrityl) -2 '-O- (tert-butyldimethylsilyl) uridine-3' -yl ester (2.60g, 1.60mmol) according to the method of example 2-2.

¹H－NMR(400MHz，CDCl₃)：δ0.04(s，3H)，0.07(s，3H)，0.81－0.92(m，18H)，1.11－1.53(m，90H)，1.70－1.85(m，6H)，2.95－3.10(brs，1H)，3.77－3.82(m，1H)，3.93－4.04(m，7H)，4.25－4.28(m，1H)，4.67(t，1H，J＝5.2Hz)，4.81(d，1H，16.0Hz)，4.96(d，1H，16.0Hz)，5.34(dd，1H，J＝3.2，4.8Hz)，5.60(d，1H，J＝5.6Hz)，5.76(d，1H，J＝8.0Hz)，7.29(s，2H)，7.63(d，1H，J＝8.0Hz)，8.71(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ－5.22，－5.19，14.14，17.88，22.71，25.52，26.07，26.10，29.30，29.38，29.42，29.59，29.66，29.68，29.73，30.34，31.94，60.84，61.84，69.20，72.78，73.24，73.57，82.99，92.46，102.70，108.32，123.24，141.88，142.99，150.17，152.92，162.72，165.78，167.38.

TOF/MS(ESI)：C₇₈H₁₄₀N₂O₁₂SiNa[M+Na]⁺Calculated value of 1348.0073, experimental value 1348.0115.

[ examples 4 to 9]

(3) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl) phosphoryl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate

The title compound (2.84g, 92%) was obtained from 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 2 '-O- (tert-butyldimethylsilyl) uridine-3' -yl ester (1.95g, 1.47mmol) and 5 '-O-DMTr-2' -O- (tert-butyldimethylsilyl) uridine-CE phosphoramidite (2.53g, 2.94mmol) according to the method of example 3-4.

¹H－NMR(400MHz，CDCl₃)：δ0.03－0.13(m，12H)，0.86－0.90(m，27H)，1.02－1.53(m，90H)，1.68－1.84(m，6H)，2.45－2.69(m，1H)，2.73(t，1H，J＝6.0Hz)，3.48(d，1H，J＝10.8Hz)，3.60－3.68(m，1H)，3.76－3.84(m，6H)，3.97－4.04(m，6H)，4.10－4.58(m，8H)，4.73－4.84(m，1H)，4.90－5.03(m，2H)，5.20－5.25(m，2H)，5.67－5.78(m，2H)，5.95－6.03(m，1H)，6.80－6.89(m，4H)，7.21－7.44(m，12H)，7.84(d，1H，J＝8.0Hz)，8.72－8.83(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ－5.27，－5.24，－5.07，－4.94，－4.92，14.14，17.86，18.06，19.50，19.57，19.65，22.70，25.50，25.55，25.60，26.07，26.13，29.32，29.38，29.44，29.60，29.68，29.74，30.35，31.94，55.27，55.30，60.69，61.96，62.37，62.42，62.58，62.63，69.19，71.39，71.60，72.86，73.00，73.57，74.47，79.43，79.51，81.75，87.65，87.68，87.99，88.18，90.56，91.22，102.54，102.64，103.05，103.13，108.28，113.39，116.31，116.40，123.21，127.43，128.13，128.21，128.25，130.25，130.27，130.32，134.56，134.65，134.70，134.73，139.84，140.05，140.15，142.97，143.01，143.92，143.97，149.95，150.19，150.40，152.92，158.83，158.87，162.53，162.58，162.69，165.64，165.68，167.05，167.12.

TOF/MS(ESI)：C₁₁₇H₁₈₆N₅O₂₂Si₂PNa[M+Na]⁺Calculated value of 2123.2763, experimental value 2123.2769.

Synthesis of 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionic acid

[ example 5-1 ]

(1) Synthesis of tert-butyl 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionate

To a suspension of 3, 4, 5-tris (octadecyloxy) benzoic acid (2.78g, 3.0mmol), 4-dimethylaminopyridine (0.04g, 0.3mmol), tert-butyl 3-hydroxypropionate (4.39g, 30.0mmol) and triethylamine (0.46g, 4.5mmol) in methylene chloride (60mL) was added 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.86g, 4.5mmol), and the mixture was stirred at room temperature for 20 hours. The solid precipitated by adding acetonitrile (180mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried under reduced pressure at 50 ℃ to obtain a crude product (3.07 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane), whereby the title compound (1.90g, 60%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，99H)，1.70－1.85(m，6H)，2.68(t，2H，J＝6.4Hz)，3.95－4.05(m，6H)，4.53(t，2H，J＝6.4Hz)，7.23(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.08，22.68，26.08，28.09，29.35，29.40，29.57，29.65，29.71，30.35，31.93，35.42，60.72，69.25，73.51，80.97，108.19，124.57，152.84，166.14，169.93.

TOF/MS(ESI)：C₆₈H₁₂₆O₇Na[M+Na]⁺Calculated value of 1077.9401, experimental value 1077.9427.

[ example 5-2 ]

(2) Synthesis of 3- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) propanoic acid

To a solution of tert-butyl 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionate (2.75g, 2.6mmol) in dichloromethane (52mL) was added methanesulfonic acid (3.75g, 39.0mmol), and the mixture was stirred at room temperature for 20 hours. The solid precipitated by adding acetonitrile (156mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-dichloromethane and acetonitrile, and dried under reduced pressure at 50 ℃ to obtain the title compound (2.54g, 98%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，90H)，1.70－1.85(m，6H)，2.85(t，2H，J＝6.6Hz)，3.95－4.10(m，6H)，4.57(t，2H，J＝6.4Hz)，7.23(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.10，22.71，26.10，26.13，29.38，29.45，29.61，29.68，29.75，30.38，31.96，33.54，59.99，69.34，73.57，108.35，124.32，142.88，152.91，166.17.

TOF/MS(ESI)：C₆₄H₁₁₈O₇Na[M+Na]⁺Calculated value of 1021.8775, experimental value 1021.8817.

Synthesis of 2- (N-methyl-3, 4, 5-tris (octadecyloxy) benzamide) acetic acid

[ examples 5 to 3]

(1) Synthesis of tert-butyl 2- (N-methyl-3, 4, 5-trioctadecylbenzamide) acetate

To a suspension of 3, 4, 5-tris (octadecyloxy) benzoic acid (2.78g, 3.0mmol), 4-dimethylaminopyridine (0.04g, 0.3mmol), sarcosine tert-butyl ester hydrochloride (2.73g, 15.0mmol) and triethylamine (1.52g, 15.0mmol) in methylene chloride (60mL) was added 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.86g, 4.5mmol), and the mixture was stirred at room temperature for 20 hours. The solid precipitated by adding acetonitrile (180mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried under reduced pressure at 50 ℃ to obtain a crude product (3.07 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (2.66g, 84%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，99H)，1.70－1.85(m，6H)，3.04(s，3H)，3.80－4.20(m，8H)，6.63(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.01，22.66，26.13，26.15，28.16，29.35，29.42，29.48，29.65，29.71，30.39，31.93，69.51，73.52，82.02，106.19，130.61，139.93，153.25，168.33，172.01.

TOF/MS(ESI)：C₆₈H₁₂₇NO₆Na[M+Na]⁺Calculated value of 1076.9561, experimental value 1076.9591.

[ examples 5 to 4]

(2) Synthesis of 2- (N-methyl-3, 4, 5-tris (octadecyloxy) benzamide) acetic acid

According to the method of example 5-2, from tert-butyl 2- (N-methyl-3, 4, 5-trioctadecylbenzamide) acetate (2.53g, 2.4mmol), the title compound (2.38g, 99%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，90H)，1.70－1.85(m，6H)，3.11(s，3H)，3.85－4.35(m，8H)，6.15－6.30(brs，1H)，6.66(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.05，22.67，26.12，29.36，29.43，29.61，29.66，29.72，29.98，30.36，31.93，39.20，50.02，69.49，73.56，106.47，129.16，140.27，152.97，153.24，172.11，172.92.

TOF/MS(ESI)：C₆₄H₁₁₈NO₆[M－H]^－Calculated value of 996.8959, experimental value 996.8947.

Synthesis of 3- (3, 4, 5-trioctadecyloxy) benzamide) propionic acid

[ examples 5 to 5]

(1) Synthesis of tert-butyl 3- (3, 4, 5-trioctadecyloxy) benzamide) propionate

To a suspension of 3, 4, 5-tris (octadecyloxy) benzoic acid (2.78g, 3.0mmol), 4-dimethylaminopyridine (0.04g, 0.3mmol), β -alanine tert-butyl ester hydrochloride (2.73g, 15.0mmol) and triethylamine (1.52g, 15.0mmol) in methylene chloride (60mL) was added 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.86g, 4.5mmol), and the mixture was stirred at room temperature for 19.5 hours. The solid precipitated by adding acetonitrile (180mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried under reduced pressure at 50 ℃ to obtain a crude product (3.12 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (2.75g, 87%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，99H)，1.70－1.85(m，6H)，2.55(t，2H，J＝5.8Hz)，3.66(q，2H，J＝6.0Hz)，3.95－4.05(m，6H)，6.72(t，1H，J＝6.0Hz)，6.94(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.09，22.71，26.11，28.16，29.38，29.43，29.61，29.68，29.74，30.36，31.95，35.18，35.58，69.45，73.53，81.19，105.86，129.57，141.32，153.14，167.20，172.27.

TOF/MS(ESI)：C₆₈H₁₂₇NO₆Na[M+Na]⁺Calculated value of 1076.9561, experimental value 1076.9579.

[ examples 5 to 6]

(2) Synthesis of 3- (3, 4, 5-trioctadecyloxy) benzamide) propionic acid

According to the method of example 5-2, tert-butyl 3- (3, 4, 5-trioctadecyloxy) benzamide propionate (2.64g, 2.5mmol) gave the title compound (2.52g, 101%) as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝7.0Hz)，1.15－1.55(m，90H)，1.65－1.85(m，6H)，2.74(t，2H，J＝5.8Hz)，3.72(t，2H，J＝5.8Hz)，3.90－4.05(m，6H)，6.95(s，2H).

¹³C－NMR(100MHz，CDCl₃)：δ14.06，22.71，26.16，26.19，29.40，29.50，29.53，29.65，29.71，29.77，30.44，31.98，33.68，35.85，39.37，69.77，73.67，106.51，128.33，142.29，153.35，168.43，175.46.

TOF/MS(ESI)：C₆₄H₁₁₈NO₆[M－H]^－Calculated value of 996.8959, experimental value 996.8912.

Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester of 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionic acid

[ examples 5 to 7]

(1) Synthesis of thymidine-3' -yl 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionate

To a suspension of 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionic acid (2.40g, 2.40mmol), 5 '-O- (4, 4' -dimethoxytrityl) thymidine (1.57g, 2.88mmol) and 1-methylimidazole (0.99g, 12.00mmol) in THF (24mL) was added COMU (2.06g, 4.80mmol), and the mixture was stirred at room temperature for 6.5 hours. After further addition of COMU (0.21g, 0.48mmol), the mixture was stirred at room temperature for 17.5 hours. The solid precipitated by adding acetonitrile (120mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and THF, and dried under reduced pressure at 50 ℃ to obtain a crude product (2.76 g). The crude product was used directly in the next reaction without purification.

To a dichloromethane solution (68mL) of the crude product (2.60g), pyrrole (0.57g, 8.50mmol) and trifluoroacetic acid (0.24g, 2.13mmol) were added, and the mixture was stirred at room temperature for 3.5 hours. After further addition of trifluoroacetic acid (0.05g, 0.43mmol), the mixture was stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetone (20mL) and acetonitrile (61mL) to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-acetone-dichloromethane and acetonitrile, and dried under reduced pressure at 50 ℃ to obtain a crude product (2.44 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (0.52g, 18%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.15－1.55(m，90H)，1.65－1.85(m，7H)，1.92(s，3H)，2.30－2.40(m，1H)，2.45－2.55(m，1H)，2.60－2.70(m，1H)，2.80－2.90(m，2H)，3.85－3.95(m，2H)，3.95－4.05(m，6H)，4.05－4.10(m，1H)，4.55－.65(m，2H)，5.40－5.55(m，1H)，6.10－6.20(m，1H)，7.22(s，2H)，7.41(s，1H)，8.58－8.64(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.57，14.14，22.71，26.07，26.11，29.33，29.38，29.43，29.59，29.67，29.74，30.02，30.34，31.94，34.16，36.90，60.05，62.58，69.24，73.54，75.25，85.10，86.67，108.06，111.42，124.14，136.56，142.69，150.26，152.87，163.40，166.10，170.43.

TOF/MS(ESI)：C₇₄H₁₃₀N₂O₁₁Na[M+Na]⁺Calculated value of 1245.9572, experimental value 1245.9548.

[ examples 5 to 8]

(2) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester of 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionic acid

Thymidin-3' -yl 3- ((3, 4, 5-tris ((octadecyloxy) benzoyl) oxy) propionate (1.50g, 1.23mmol) and DMTr-dT-CE phosphoramidite (1.83g, 2.45mmol) gave the title compound as a white solid (2.22g, 96%) according to example 3-4.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.38(m，84H)，1.41－1.50(m，9H)，1.70－1.83(m，7H)，1.91(s，3H)，2.30－2.46(m，3H)，2.62－2.68(m，2H)，2.75(t，1H，J＝6.0Hz)，2.84(dd，2H，J＝4.8，6.4Hz)，3.37－3.42(m，1H)，3.50－3.55(m，1H)，3.79(s，6H)，3.98－4.02(m，6H)，4.12－4.38(m，6H)，4.56(dd，2H，J＝4.8，7.2Hz)，5.16－5.20(m，1H)，5.28－5.35(m，1H)，6.21－6.26(m，1H)，6.38－6.44(m，1H)，6.84(d，4H，J＝7.6Hz)，7.21－7.32(m，10H)，7.34－7.37(m，2H)，7.50－7.59(m，1H)，8.91－9.06(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ11.72，12.46，14.13，19.59，19.66，19.75，22.70，26.08，26.15，29.37，29.46，29.61，29.67，29.74，30.36，31.94，33.94，36.62，38.95，55.29，59.89，59.93，62.39，62.45，62.54，62.59，63.23，67.62，69.27，73.55，74.09，79.77，79.82，79.87，79.92，82.52，84.29，84.34，84.46，84.53，85.36，85.57，87.34，108.14，111.70，111.82，113.36，116.17，116.36，124.17，127.34，128.08，128.14，130.13，134.94，135.03，135.07，135.35，135.49，142.74，143.97，143.99，150.23，150.27，150.38，150.46，152.89，158.84，163.40，163.50，166.14，170.29，170.34.

TOF/MS(ESI)：C₁₀₈H₁₆₄N₅O₂₀PNa[M+Na]⁺Calculated value of 1905.1605, experimental value 1905.1636.

Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester of 2- (N-methyl-3, 4, 5-trioctadecyloxy) benzamide) acetic acid

[ examples 5 to 9]

(1) Synthesis of 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 2- (N-methyl-3, 4, 5-trioctadecylbenzamide) acetate

COMU (1.80g, 4.20mmol) was added to a suspension of 2- (N-methyl-3, 4, 5-tris (octadecyloxy) benzamide) acetic acid (2.10g, 2.10mmol), 5 '-O- (4, 4' -dimethoxytrityl) thymidine (1.37g, 2.52mmol) and 1-methylimidazole (0.86g, 10.50mmol) in THF (32mL), and the mixture was stirred at room temperature for 3.5 hours. After further addition of COMU (0.27g, 0.63mmol), the mixture was stirred at room temperature for 20 hours. The solid precipitated by adding acetonitrile (158mL) dropwise to the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile and THF, and dried under reduced pressure at 50 ℃ to obtain a crude product (2.96 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (2.51g, 78%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.15－1.55(m，93H)，1.65－1.90(m，6H)，2.35－2.60(m，2H)，3.08(s，3H)，3.45－3.55(m，2H)，3.79(s，6H)，3.85－4.00(m，6H)，4.10－4.40(m，3H)，5.50－5.60(m，1H)，6.40－6.50(m，1H)，6.65(s，2H)，6.80－6.90(m，4H)，7.20－7.40(m，9H)，7.62(s，1H)，8.36(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.64，14.07，22.71，26.17，29.38，29.48，29.65，29.70，29.75，30.41，31.97，38.01，55.30，63.79，69.54，73.58，76.72，84.09，84.54，87.42，106.36，111.64，113.49，127.31，128.09，128.26，129.90，130.15，135.30，135.38，140.18，144.29，150.20，153.29，159.01，163.21，168.70，172.20.

TOF/MS(ESI)：C₉₅H₁₄₉N₃O₁₂Na[M+Na]⁺Calculated value of 1547.1039, Experimental value of 1547.1042.

[ examples 5 to 10 ]

(2) Synthesis of thymidine-3' -yl 2- (N-methyl-3, 4, 5-trioctadecylbenzamide) acetate

The title compound (1.86g, 98%) was obtained as a white solid according to the method of example 2-2 from 2- (N-methyl-3, 4, 5-trioctadecylbenzamide) acetic acid 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl ester (2.36g, 1.55 mmol).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.05－1.55(m，90H)，1.65－1.85(m，6H)，1.92(s，3H)，2.30－2.60(m，3H)，3.09(s，3H)，3.85－4.05(m，8H)，4.05－4.35(m，3H)，5.45(s，1H)，6.05－6.30(brs，1H)，6.64(s，2H)，7.44(s，1H)，8.28(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.50，14.08，22.71，26.17，29.38，29.47，29.51，29.65，29.70，29.75，30.41，31.97，37.20，39.06，62.67，69.59，73.60，75.74，85.09，86.62，106.33，111.45，129.86，136.38，140.23，150.26，153.33，163.22，168.96，172.29.

TOF/MS(ESI)：C₇₄H₁₃₁N₃O₁₀Na[M+Na]⁺Calculated value of 1244.9732, experimental value 1244.9786.

[ examples 5 to 11 ]

(3) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester of 2- (N-methyl-3, 4, 5-trioctadecyloxy) benzamide) acetic acid

Thymidin-3' -yl 2- (N-methyl-3, 4, 5-trioctadecyloxy) benzamide acetate (1.71g, 1.40mmol) and DMTr-dT-CE-phosphoramidite (2.09g, 2.80mmol) gave the title compound as a white solid (2.54g, 96%) according to example 3-4.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.6Hz)，1.05－1.55(m，93H)，1.65－1.85(m，6H)，1.91(s，3H)，2.30－2.55(m，3H)，2.60－2.80(m，3H)，3.08(s，3H)，3.35－3.45(m，1H)，3.50－3.60(m，1H)，3.78(s，3H)，3.79(s，3H)，3.90－4.05(m，6H)，4.10－4.45(m，8H)，5.10－5.20(m，1H)，5.30－5.45(m，1H)，6.10－6.30(brs，1H)，6.35－6.45(m，1H)，6.64(s，2H)，6.75－6.90(m，4H)，7.15－7.40(m，10H)，7.49(d，1H，J＝6.4Hz)，8.50－8.75(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ11.76，12.41，12.46，14.07，19.63，19.70，19.78，19.85，22.70，26.20，29.37，29.50，29.52，29.70，29.75，29.79，30.43，31.96，36.86，38.50，39.03，55.30，55.34，61.99，62.10，62.50，62.55，62.63，63.33，67.69，69.61，69.64，73.60，74.61，79.78，81.51，82.43，84.41，84.52，84.57，85.65，85.88，86.36，87.47，106.43，111.40，111.78，111.83，111.89，113.31，113.50，116.07，116.42，127.09，127.38，127.86，128.11，128.27，129.21，130.20，135.07，135.18，135.45，135.54，136.37，139.66，140.30，144.12，147.51，150.16，150.21，150.26，150.38，153.30，158.81，159.03，163.33，168.90，172.25，172.43.

TOF/MS(ESI)：C₁₀₈H₁₆₅N₆O₁₉PNa[M+Na]⁺Calculated value of 1904.1765, experimental value 1904.1780.

Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl 3- (3, 4, 5-trioctadecyloxy) benzamide) propionate

[ examples 5 to 12 ]

(1) Synthesis of 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 3- (3, 4, 5-trioctadecylbenzamide) propionate

After COMU (1.88g, 4.40mmol) was added to a suspension of 3- (3, 4, 5-trioctadecylbenzamide) propionic acid (2.20g, 2.20mmol), 5 '-O- (4, 4' -dimethoxytrityl) thymidine (1.44g, 2.64mmol) and 1-methylimidazole (0.90g, 11.00mmol) in THF (44mL), the mixture was stirred at room temperature for 3.5 hours. 1-methylimidazole (0.36g, 4.4mmol) and COMU (0.94g, 2.20mmol) were further added thereto, and the mixture was stirred at room temperature for 68 hours. The solid precipitated by adding acetonitrile (220mL) dropwise to the reaction mixture was filtered. The solid was washed with an acetonitrile-THF mixed solvent and methanol, and dried under reduced pressure at 50 ℃ to obtain a crude product (3.07 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-THF), whereby the title compound (2.01g, 60%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.15－1.55(m，93H)，1.60－1.85(m，6H)，2.40－2.55(m，2H)，2.65－2.75(m，2H)，3.40－3.55(m，2H)，3.65－3.75(m，2H)，3.78(s，6H)，3.95－4.05(m，6H)，4.14(d，1H，J＝1.6Hz)，5.47(d，1H，J＝4.8Hz)，6.42(t，1H，J＝6.2Hz)，6.59(t，1H，J＝6.0Hz)，6.80－6.90(m，4H)，6.94(s，2H)，7.20－7.45(m，9H)，7.60(s，1H)，8.43(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.62，14.14，22.71，26.11，29.38，29.45，29.61，29.68，29.74，30.33，31.94，34.05，35.35，37.92，55.24，63.65，69.36，73.51，75.85，83.94，84.34，87.24，105.67，111.65，113.15，113.32，127.26，127.76，127.85，128.06，128.10，129.12，130.04，130.08，135.03，135.24，135.35，141.26，144.12，150.23，153.10，158.78，163.39，167.36，172.25.

TOF/MS(ESI)：C₉₅H₁₄₉N₃O₁₂Na[M+Na]⁺Calculated value of 1547.1039, experimental value 1547.1014.

[ examples 5 to 13 ]

(2) Synthesis of thymidine-3' -yl 3- (3, 4, 5-trioctadecyloxy) benzamide propionate

The title compound (1.51g, 99%) was obtained as a white solid according to the method of example 2-2 from 5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl 3- (3, 4, 5-trioctadecylbenzamide) propionate (1.91g, 1.25 mmol).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.15－1.55(m，90H)，1.65－1.85(m，6H)，1.91(s，3H)，2.30－2.55(m，2H)，2.55－2.75(m，3H)，3.65－3.75(m，2H)，3.85－3.95(m，2H)，3.95－4.05(m，6H)，4.05－4.10(m，1H)，5.35－5.40(m，1H)，6.16(dd，1H，J＝6.0，8.4Hz)，6.55－6.65(m，1H)，6.95(s，2H)，7.43(s，1H)，8.25－8.55(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.51，14.09，22.71，26.13，26.16，29.38，29.47，29.62，29.69，29.75，29.99，30.38，31.96，34.26，35.57，37.12，62.57，69.57，73.59，75.09，85.06，86.65，106.04，111.41，129.08，136.51，141.64，150.33，153.20，163.40，167.46，172.39.

TOF/MS(ESI)：C₇₄H₁₃₁N₃O₁₀Na[M+Na]⁺Calculated value of 1244.9732, experimental value 1244.9789.

[ examples 5 to 14 ]

(3) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl 3- (3, 4, 5-trioctadecyloxy) benzamide) propionate

The title compound (2.07g, 95%) was obtained as a white solid according to the method of example 3-4 from thymidine-3' -yl 3- (3, 4, 5-trioctadecylbenzamide) propionate (1.41g, 1.15mmol) and DMTr-dT-CE-phosphoramidite (1.71g, 2.30 mmol).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.15－1.55(m，93H)，1.65－1.85(m，7H)，1.90(d，3H，J＝1.2Hz)，2.25－2.55(m，3H)，2.55－2.80(m，5H)，3.30－3.45(m，1H)，3.50－3.60(m，1H)，3.60－3.75(m，2H)，3.78(s，3H)，3.79(s，3H)，3.90－4.05(m，6H)，4.05－4.40(m，6H)，5.10－5.25(m，1H)，5.30－5.40(m，1H)，6.15－6.25(m，1H)，6.40－6.50(m，1H)，6.75－6.90(m，4H)，6.99(d，2H，J＝3.6Hz)，7.20－7.40(m，9H)，7.50－7.60(m，1H)，8.95－9.05(m，1H)，9.05－9.15(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ11.72，12.49，14.14，19.59，19.67，19.75，22.71，26.11，26.14，29.38，29.47，29.63，29.69，29.75，29.78，30.35，31.94，34.03，35.53，35.58，36.64，38.95，55.29，62.36，62.41，62.52，62.57，63.24，67.60，69.38，73.53，73.84，79.90，82.35，82.44，84.25，84.32，84.39，85.48，85.67，87.35，105.86，111.64，111.74，111.88，113.14，113.35，116.25，116.44，127.34，127.76，127.85，128.09，129.03，129.13，130.13，134.91，134.95，135.00，135.07，135.48，135.61，141.22，143.93，143.97，150.21，150.26，150.46，150.49，153.03，158.83，163.48，163.53，167.47，167.51，172.19.

TOF/MS(ESI)：C₁₀₈H₁₆₅N₆O₁₉PNa[M+Na]⁺Calculated value of 1904.1765, experimental value 1904.1807.

6.2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (4- (((6- (N-octadecyloxy) benzoyl) oxy)⁶Synthesis of (E) -benzoyladenin-9-yl) -4-tritylmorpholin-2-yl) methoxy) (dimethylamino) phosphoryl) -6- (thymin-1-yl) morpholin-2-yl) methyl ester

[ example 6-1 ]

(1) Synthesis of (6- (thymin-1-yl) -4-tritylmorpholin-2-yl) methyl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate

The title compound (2.85g, 98%) was obtained from 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid (1.97g, 2.00mmol) and 6- (hydroxymethyl) -4-tritylmorpholin-2-yl) -5-methylpyrimidine-2, 4- (1H, 3H) -dione (1.16g, 2.40mmol) according to the method of example 2-1.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.11－1.53(m，91H)，1.68－1.83(m，6H)，1.84(s，3H)，3.13(d，1H，J＝12.0Hz)，3.37(d，1H，J＝11.2Hz)，3.98－4.04(m，6H)，4.17(d，2H，J＝5.2Hz)，4.37－4.41(m，1H)，4.78(s，2H)，6.13(dd，1H，J＝2.0，9.6Hz)，7.00(s，1H)，7.15－7.26(m，3H)，7.26－7.38(m，8H)，7.34－7.58(m，6H)，8.34(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.45，14.13，22.70，26.07，26.11，29.32，29.38，29.42，29.59，29.66，29.68，29.73，30.35，31.94，49.01，51.85，60.89，65.08，69.19，73.55，74.58，80.50，108.31，110.68，123.33，126.64，127.97，129.13，135.33，142.95，149.63，152.91，163.23，165.75，167.64.

TOF/MS(ESI)：C₉₂H₁₄₃N₃O₁₀Na[M+Na]⁺Calculated value of 1473.0671, experimental value 1473.0629.

[ example 6-2 ]

(2) Synthesis of methyl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate (6- (thymin-1-yl) morpholin-2-yl) acetate trifluoroacetate

According to the method of example 2-2, from 6- (thymin-1-yl) -4-tritylmorpholin-2-yl) methyl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate (2.76g, 1.90mmol) the title compound was obtained (2.44g, 97%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.39(m，84H)，1.42－1.50(m，6H)，1.70－1.83(m，6H)，1.87(s，3H)，2.95－3.16(m，2H)，3.42(d，1H，J＝11.2Hz)，3.62－3.75(m，1H)，3.95－4.05(m，6H)，4.31(d，1H，J＝8.4Hz)，4.46(d，2H，J＝10.0Hz)，4.86(s，2H)，6.17(d，1H，J＝9.6Hz)，7.25(s，1H)，7.30(s，2H)，10.15－10.75(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.48，14.13，22.71，26.09，26.15，29.35，29.39，29.47，29.63，29.69，29.75，29.78，30.38，31.94，43.24，44.99，60.87，63.56，69.21，72.38，73.57，108.30，112.18，114.99，117.90，123.12，134.33，143.10，150.40，152.99，162.55，162.90，163.78，166.02，167.45.

TOF/MS(ESI)：C₇₃H₁₂₉N₃O₁₀－CF₃COOH[M－H]^－Calculated value of 1320.9528, experimental value 1320.9517.

[ examples 6-3 ]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (4- (((6- (N-octadecyloxy) benzoyl) oxy)⁶Process for preparing (E) -benzoyladenin-9-yl) -4-tritylmorpholin-2-yl) methoxy) (dimethylamino) phosphoryl) -6- (thymin-1-yl) morpholin-2-yl) methyl esterSynthesis of

To a solution of (6- (N, 3-dimethyl-2-imidazolidinone (16mL) -THF (18mL) of methyl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetate (6- (thymin-1-yl) morpholin-2-yl) methyl ester trifluoroacetate (2.32g, 1.76mmol), N-diisopropylethylamine (4.16g, 32.16mmol) in 1, 3-dimethyl-2-imidazolidinone (16mL)⁶After (3.81g, 5.27mmol) of-benzoyladenin-9-yl) -4-tritylmorpholin-2-yl) methyldimethylphosphamide chloride, it was stirred at room temperature for 2.5 hours. The slurry obtained by adding methanol (93mL) to the reaction mixture was concentrated under reduced pressure. The slurry obtained by adding methanol to the concentrated residue was stirred at room temperature for 30 minutes, and then filtered. After washing the solid with methanol, it was dried under reduced pressure at 50 ℃ to obtain a crude product (3.23 g). The crude product was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol), whereby the title compound (1.96g, 59%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.53(m，90H)，1.55－1.97(m，12H)，2.46(d，3H，J＝10.4Hz)，2.63(d，3H，J＝9.6Hz)，2.46－2.63(m，1H)，3.12－3.60(m，4H)，3.75－4.07(m，10H)，4.15－4.50(m，2H)，4.78－4.91(m，2H)，5.41－5.53(m，1H)，6.42(d，1H，J＝10.4Hz)，7.12－7.20(m，4H)，7.20－7.32(m，9H)，7.40－7.58(m，8H)，8.05(d，2H，J＝7.6Hz)，8.07－8.10(m，1H)，8.68－8.80(m，1H)，9.50－9.76(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ12.44，12.53，14.14，22.70，26.08，26.12，29.32，29.38，29.43，29.60，29.68，29.73，30.35，31.94，36.47，36.51，36.63，36.67，44.56，44.84，47.02，48.64，48.78，52.81，53.10，60.93，64.23，65.34，65.69，69.19，73.56，74.90，74.97，75.34，79.53，79.61，79.97，80.79，108.27，110.92，111.25，122.82，123.26，126.65，128.00，128.22，128.29，128.57，128.63，129.16，132.47，132.57，133.49，133.92，134，74，134.80，140.75，140.78，142.97，143.00，149.31，149.68，149.82，150.12，150.89，151.40，152.65，152.77，152.92，152.94，163.62，165.02，165.23，165.82，165.84，167.56，167.63.

TOF/MS(ESI)：C₁₁₁H₁₆₅N₁₀O₁₄PNa[M+Na]⁺Calculated value of 1916.2142, experimental value 1916.2216.

2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (4- (((6- (N-octadecyloxy) benzoyl) oxy)⁴-benzoylcytosin-1-yl) -4-tritylmorpholin-2-yl) methoxy) (dimethylamino) phosphoryl) -6- (N²Synthesis of (isobutyrylguanine-9-yl) morpholin-2-yl) methyl ester

[ examples 6-4 ]

(1) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (6- (N-octadecyloxy) carbonyl²Synthesis of (E) -isobutyrylguanin-9-yl) -4-tritylmorpholin-2-yl) methyl ester

The title compound (3.00g, 97%) was obtained from 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid (1.97g, 2.00mmol) and N- (9- (6- (hydroxymethyl) -4-tritylmorpholin-2-yl)) -6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (1.51g, 2.60mmol) according to the method of example 2-1.

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.10－1.60(m，97H)，1.70－1.90(m，7H)，2.64(sept，1H)，3.18(d，1H，J＝12.0Hz)，3.45(d，1H，J＝11.6Hz)，3.95－4.15(m，6H)，4.13－4.25(m，2H)，4.37－4.46(m，1H)，4.72(d，1H，J＝16.0Hz)，4.84(d，1H，J＝16.0Hz)，5.89(dd，1H，J＝2.2，9.8Hz)，7.06－7.37(m，12H)，7.39－7.55(m，5H)，7.61(s，1H)，8.18(s，1H)，11.92(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.14，18.93，19.03，22.71，26.07，26.12，29.33，29.37，29.42，29.60，29.67，29.74，30.35，31.94，36.64，49.04，52.24，60.90，65.03，69.25，73.58，74.22，80.36，108.38，121.30，123.27，126.69，127.96，129.18，136.12，143.08，147.32，147.42，152.95，155.36，165.98，167.61，177.85.

TOF/MS(ESI)：C₉₆H₁₄₈N₆O₁₀Na[M+Na]⁺Calculated value of 1568.1155, experimental value 1568.1176.

[ examples 6 to 5]

(2) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (6- (N-octadecyloxy) carbonyl²Synthesis of (isobutyrylguanine-9-yl) morpholin-2-yl) methyl ester trifluoroacetate

The procedure of example 2-2 was followed using 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid (6- (N-octadecyloxy) carbonyl)²Isobutyrylguanin-9-yl) -4-tritylmorpholin-2-yl methyl ester (2.78g, 1.80mmol) gives the title compound (2.45g, 96%).

¹H－NMR(400MHz，CDCl₃)：δ0.87(t，9H，J＝6.8Hz)，1.00－1.53(m，96H)，1.69－1.88(m，6H)，2.72－2.88(m，1H)，3.19－3.38(m，1H)，3.44－3.63(m，1H)，3.75－4.13(m，8H)，4.25－4.63(m，3H)，4.69－4.94(m，2H)，6.06－6.31(m，1H)，7.20－7.30(m，3H)，7.87－8.06(m，1H)，10.19－10.63(brs，1H)，12.19－12.63(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.12，18.92，22.70，26.09，26.16，29.35，29.38，29.47，29.63，29.68，29.75，29.79，30.04，30.38，31.94，36.17，42.86，60.73，63.62，69.21，71.44，73.57，108.29，115.13，118.04，123.10，143.09，148.28，152.95，156.00，165.93，167.50，180.39.

TOF/MS(ESI)：C₇₇H₁₃₄N₆O₁₀－CF₃COOH[M－H]^－Calculated value of 1416.0012, experimental value 1415.9960.

[ examples 6 to 6]

(3) 2- ((3, 4, 5-Trioctadecyloxy) benzoyl) oxy) acetic acid (4- (((6- (N-octadecyloxy) benzoyl) oxy)⁴-benzoylcytosin-1-yl) -4-tritylmorpholin-2-yl) methoxy) (dimethylamino) phosphoryl) -6- (N²Synthesis of (isobutyrylguanine-9-yl) morpholin-2-yl) methyl ester

The procedure of examples 6-3 was followed using 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid (6- (N-octadecyloxy) benzoyl) oxy)²-isobutyrylguanin-9-yl) morpholin-2-yl methyl ester trifluoroacetate (2.27g, 1.60mmol) and (6- (N-N)⁴-benzoylcytosin-1-yl) -4-tritylmorpholin-2-yl) methyldimethylphosphamide chloride (3.35g, 4.80mmol) to give the title compound (2.87g, 91%).

¹H－NMR(400MHz，CDCl₃)：δ0.88(t，9H，J＝6.8Hz)，1.00－1.56(m，96H)，1.69－1.88(m，9H)，2.38－2.97(m，8H)，3.06－3.69(m，5H)，3.75－4.56(m，12H)，4.69－4.94(m，2H)，5.34－5.63(m，1H)，6.28－6.50(m，1H)，7.13－8.00(m，23H)，8.69－8.94(brs，1H)，9.31－9.63(brs，1H)，10.06－10.31(brs，1H)，12.13－12.31(m，1H).

¹³C－NMR(100MHz，CDCl₃)：δ14.13，19.01，19.04，19.17，19.22，22.70，26.07，26.12，29.32，29.37，29.43，29.60，29.67，29.73，29.98，30.35，31.94，36.17，36.27，36.64，36.68，36.74，36.78，45.00，45.08，46.96，47.43，48.25，48.76，52.48，60.82，60.90，64.27，65.84，69.20，69.22，73.57，74.31，74.51，75.41，79.30，80.47，81.36，81.59，108.31，121.25，122.00，123.26，123.33，126.67，126.73，127.73，127.99，128.80，128.98，132.71，133.07，133.27，136.19，137.10，142.90，143.01，147.88，148.00，148.09，152.89，152.93，155.79，155.90，165.79，165.91，167.56，167.58，178.67，179.37.

TOF/MS(ESI)：C₁₁₄H₁₇₀N₁₁O₁₅PNa[M+Na]⁺Calculated value of 1987.2513, experimental value 1987.2521.

7. Confirmation of Tag-off

[ example 7-1 ]

5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (i) -isobutyryl deoxyguanosine-3' -yl) phosphoryl) thymidine

Mixing 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²A mixed solution of (i) -isobutyryldeoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl ester (233mg, 0.10mmol) in THF (9mL) -2-propanol (1mL) was cooled to 0 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) under cooling, stirring was carried out at this temperature for 30 minutes. After an aqueous ammonium chloride solution was added to the reaction mixture, the mixture was extracted with dichloromethane 3 times. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. Part (2.5mL) of the dimethylsulfoxide/methanol mixed solution (1:1, 5mL) of the concentrated residue was purified by preparative chromatography for 5 times to obtain white solidTitle compound as a colored solid (64mg, 95%).

Preparative chromatographic conditions: column Guandong chemical Mightysil RP-18 GP (5 μm, 20. phi. times.250 mm), flow rate 5mL/min, mobile phase acetonitrile-water (gradient 0-30 min (acetonitrile ratio 50 → 60%).

¹H－NMR(600MHz，DMSO－d₆)：δ1.12(d，6H，J＝6.0Hz)，1.42(d，3H，J＝7.2Hz)，1.74(d，3H，J＝2.8Hz)，2.07(s，1H)，2.30－2.41(m，3H)，2.60－2.90(m，6H)，3.18－3.29(m，2H)，3.73(d，6H，J＝4.2Hz)，4.00－4.43(m，12H)，4.97(s，1H)，5.10(s，1H)，5.51－5.52(m，1H)，6.15－6.25(m，3H)，6.88(d，4H，J＝9.0Hz)，7.20－7.50(m，11H)，8.17(q，1H，J＝1.8Hz)，11.33－12.07(m，3H).

¹³C－NMR(151MHz，DMSO－d₆)：δ10.56，10.88，17.66，33.65，35.78，52.00，53.86，56.34，61.48，61.80，65.49，66.58，68.73，76.58，77.11，81.63，82.11，82.52，82.87，84.98，90.73，108.72，112.08，116.98，119.14，125.69，126.46，126.77，128.53，133.81，134.00，134.26，134.70，136.15，143.26，147.04，147.32，149.14，153.53，156.99，162.50，168.14，178.89.

TOF/MS(ESI)：C₆₁H₆₉N₁₁O₂₁P₂Na[M+Na]⁺Calculated value of 1376.4, experimental value 1376.6.

[ example 7-2 ]

5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -N)²-isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N⁶Synthesis of (E) -benzoyldeoxyadenosine

The procedure of example 7-1 was followed, starting from 2- ((3, 4, 5-trioctadecylbenzoyl) oxy)) Acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -N)²-isobutyryl deoxyguanosine-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosin-3' -yl ester (244mg, 0.10mmol) to give the title compound as a yellow solid (55mg, 75%).

¹H－NMR(600MHz，DMSO－d₆)：δ1.17－1.30(m，7H)，1.74－1.79(m，3H)，1.97－2.30(m，2H)，2.45－2.51(m，2H)，2.68－2.76(m，1H)，2.79－2.83(m，1H)，2.96(dt，4H，J＝6.4，12.4Hz)，3.03－3.12(m，1H)，3.22(t，1H，J＝11.3Hz)，3.77(s，6H)，3.93(s，1H)，4.07－4.38(m，11H)，5.07－5.45(m，5H)，6.05－6.45(m，3H)，6.85(t，4H，J＝10.7Hz)，7.24(d，5H，J＝8.9Hz)，7.29(t，2H，J＝7.6Hz)，7.36(d，2H，J＝7.6Hz)，7.49－7.56(m，3H)，7.65(t，1H，J＝7.2Hz)，7.90(dt，1H，J＝3.0，8.1Hz)，8.07(d，2H，J＝7.6Hz)，8.13－8.16(m，1H)，10.89－12.13(m，3H).

¹³C－NMR(151MHz，DMSO－d₆)：δ12.52，14.58，19.33，35.33，36.13，37.02，55.48，60.34，62.73，63.24，64.06，67.31，68.33，70.66，77.30，79.12，82.64，83.37，84.09，84.74，86.25，113.58，118.69，121.00，123.54，127.24，128.19，128.72，128.94，130.23，132.68，133.50，134.55，135.77，136.46，137.81，139.68，145.08，148.56，149.12，150.82，155.31，158.56，161.08，164.11，165.03，180.61.

TOF/MS(ESI)：C₆₈H₇₂N₁₄O₂₀P₂Na[M+Na]⁺Calculated value of 1489.4, experimental value 1489.4.

[ examples 7-3 ]

5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-Synthesis of benzoyldeoxycytidineBecome into

The procedure of example 7-1 was followed using 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl ester (243mg, 0.10mmol) gave the title compound (57mg, 79%) as a white solid.

¹H－NMR(600MHz，DMSO－d₆)：δ1.09－1.12(m，6H)，1.42(s，3H)，1.75－2.10(m，4H)，2.61－2.95(m，7H)，3.15－3.25(m，3H)，3.70－3.77(m，7H)，4.08－4.36(m，11H)，5.09(d，2H，J＝41.9Hz)，5.32(d，2H，J＝44.0Hz)，6.18－6.29(m，3H)，6.85－6.88(m，4H)，7.20－7.22(m，5H)，7.29(q，2H，J＝6.9Hz)，7.34(d，2H，J＝7.6Hz)，7.41－7.53(m，4H)，7.86(d，2H，J＝7.6Hz)，8.19(dt，1H，J＝4.4，8.2Hz)，8.84(q，1H，J＝6.4Hz)，11.34－12.05(m，3H).

¹³C－NMR(151MHz，DMSO－d₆)：δ12.17，19.35，27.86，35.35，55.56，57.07，63.19，63.61，67.29，68.60，70.86，78.19，78.93，82.62，83.40，83.86，84.14，86.67，110.47，113.78，118.59，118.88，120.91，127.38，128.02，128.69，130.24，131.86，134.55，135.51，135.97，137.92，144.97，148.76，149.02，150.84，154.36，155.25，158.69，164.09，165.95，166.18，180.60.

TOF/MS(ESI)：C₆₇H₇₂N₁₂O₂₁P₂Li[M+Li]⁺Calculated value of 1449.5, experimental value 1449.6.

[ examples 7 to 4]

5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -di)Methoxytrityl) thymidine-3' -yl) phosphoryl) -N²Synthesis of (iso) butyryl deoxyguanosine

The procedure of example 7-1 was followed using 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) -N²Isobutyryl deoxyguanosine-3' -yl ester (232mg, 0.10mmol) gave the title compound (63mg, 93%) as a white solid.

¹H－NMR(600MHz，DMSO－d₆)：δ1.12(d，6H，J＝6.2Hz)，1.42(d，3H，J＝7.6Hz)，1.73(d，3H，J＝2.7Hz)，2.07(s，1H)，2.32－2.43(m，3H)，2.61－2.91(m，6H)，3.20－3.29(m，2H)，3.73(d，6H，J＝3.8Hz)，4.04－4.43(m，12H)，4.97(s，1H)，5.10(s，1H)，5.51－5.52(m，1H)，6.13－6.26(m，3H)，6.88(d，4H，J＝8.9Hz)，7.23(d，5H，J＝7.6Hz)，7.30(t，2H，J＝6.2Hz)，7.36(d，2H，J＝8.2Hz)，7.43－7.47(m，2H)，7.89－8.18(m，1H)，11.33－12.07(m，3H).

¹³C－NMR(151MHz，DMSO－d₆)：δ10.46，10.84，17.69，17.83，33.61，35.32，36.22，53.86，61.50，61.98，65.53，66.44，68.89，75.88，77.15，80.92，81.78，82.16，82.47，82.92，83.51，85.00，108.75，108.90，112.08，116.92，119.11，125.71，126.48，126.77，128.55，133.80，134.02，134.33，134.53，136.24，143.27，146.96，147.20，149.17，153.63，157.01，162.41，178.92.

TOF/MS(ESI)：C₆₁H₆₉N₁₁O₂₁P₂Na[M+Na]⁺Calculated value of 1376.4, experimental value 1376.6.

[ examples 7 to 5]

Synthesis of 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -thymidine-3' -yl) thiophosphoryl) -thymidine

A mixed solution of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -thymidine-3 ' -yl) thiophosphoryl) -thymidine-3 ' -yl ester (189mg, 0.10mmol) in THF (9mL) -2-propanol (1mL) was cooled to 0 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) under cooling, stirring was carried out at this temperature for 30 minutes. After adding an aqueous ammonium chloride solution to the reaction mixture, the mixture was extracted with dichloromethane 3 times. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, developing solvent: chloroform-methanol), whereby the title compound (86mg, 93%) was obtained as a white solid.

¹H－NMR(600MHz，CDCl₃)：δ1.46(d，3H，J＝15.8Hz)，1.91(d，3H，J＝8.2Hz)，2.21－2.79(m，6H)，3.39－3.49(m，2H)，3.79(d，6H，J＝3.4Hz)，4.08－4.52(m，8H)，5.26－5.31(m，1H)，6.25－6.41(m，2H)，6.85(dd，4H，J＝2.7，8.9Hz)，7.22－7.38(m，9H)，7.58(d，1H，J＝24.1Hz)，9.45－10.50(m，2H).

¹³C－NMR(151MHz，CDCl₃)：δ11.90，12.57，19.43，38.92，39.90，55.30，62.59，63.36，67.70，71.03，80.38，84.66，85.46，87.28，111.32，111.97，113.38，116.54，127.28，128.00，128.11，130.06，135.00，135.80，144.09，150.64，150.92，158.74，163.98.

TOF/MS(ESI)：C₄₄H₄₈N₅O₁₃PSNa[M+Na]⁺Calculated value of 940.3, experimental value 940.2.

[ examples 7 to 6]

5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -fluorodeoxyuridine-3 '-yl) phosphoryl) -2' -fluoro-N²Synthesis of (iso) butyryl deoxyguanosine

Mixing 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -fluorodeoxyuridine-3 '-yl) phosphoryl) -2' -fluoro-N²A mixed solution of isobutyryl deoxyguanosine-3' -yl ester (0.397g, 0.200mmol) in THF (27mL) -2-propanol (3mL) was cooled to 0-10 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.10mL, 0.400mmol) under cooling, stirring was carried out at this temperature for 20 minutes. After 10% ammonium chloride aqueous solution (4mL) was added to the reaction solution, liquid separation was performed, and the organic layer was washed with 10% saline. The organic layer was dried over anhydrous sodium sulfate, the sodium sulfate was removed by filtration, and the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. The concentrated residue was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol), whereby the title compound (0.137g, 67%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ1.16－1.26(m，6H)，2.19(s，2H)，2.45－2.87(m，3H)，3.44－3.66(m，2H)，3.72－3.75(m，6H)，3.92－4.18(m，2H)，4.25－4.50(m，4H)，4.89－5.55(m，6H)，5.85－6.00(m，2H)，6.80－6.82(m，4H)，7.15－7.30(m，7H)，7.33－7.37(m，2H)，7.71－7.82(m，2H)，10.05－10.42(brs，1H)，10.55－10.87(brs，1H)，12.36(s，1H).

¹³C－NMR(100MHz，CDCl₃)：δ18.75，18.85，19.01，19.07，19.38，19.45，36.01，50.81，55.26，55.28，60.65，62.85，67.86，80.26，81.13，87.13，87.19，87.53，87.88，90.59，92.53，102.62，113.33，116.74，121.28，127.26，128.05，128.19，130.22，134.80，134.91，134.96，135.07，140.41，144.01，144.11，148.00，148.06，148.50，148.55，150.44，155.70，158.76，163.72，180.33，180.39.

TOF/MS(ESI)：C₄₇H₄₉N₈O₁₄F₂PNa[M+Na]⁺Calculated value of 1041.2972, experimental value 1041.2975.

[ examples 7 to 7]

N⁴Synthesis of (E) -benzoyl-5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -O-methyluridine-3 '-yl) phosphoryl) -2' -O-methylcytidine

A mixed solution of N, N-diisopropylethylamine (0.065g, 0.50mmol) in THF (13.5mL) and 2-propanol (1.5mL) was cooled to 0-10 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) under cooling, stirring was carried out at this temperature for 10 minutes. Followed by addition of 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetic acid N⁴After a mixed solution of-benzoyl-5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O-methyluridine-3 ' -yl) phosphoryl) -2 ' -O-methylcytidin-3 ' -yl ester (0.200g, 0.10mmol) in THF (0.9mL) -2-propanol (0.1mL), it was stirred at that temperature for 0.5 hour. After a 10% ammonium chloride aqueous solution (2mL) was added to the reaction mixture, liquid separation was performed, and the organic layer was washed with 10% saline. The organic layer was dried over anhydrous sodium sulfate, the sodium sulfate was removed by filtration, and the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. Refining the concentrated residue with column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol),the title compound was obtained as a white solid (0.055g, 53%).

¹H－NMR(400MHz，CDCl₃)：δ2.00－2.27(brs，2H)，2.55－2.74(m，1H)，2.80(t，1H，J＝6.2Hz)，3.14－3.41(m，1H)，3.44－3.92(m，14H)，4.03－4.64(m，7H)，5.12(q，1H，J＝5.6Hz)，5.27(t，1H，J＝8.0Hz)，5.87－6.05(m，2H)，6.78－6.89(m，4H)，7.19－7.64(m，12H)，7.76－8.16(m，4H)，9.05－9.42(brs，1H)，9.50－9.87(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ19.54，19.56，19.61，19.64，55.28，55.32，58.80，58.82，58.93，61.30，61.34，62.38，62.43，62.68，62.73，66.03，66.08，66.41，66.46，67.85，67.95，74.30，74.34，74.42，74.47，81.32，81.41，81.49，81.58，81.64，81.72，82.17，82.99，83.08，86.58，86.79，87.46，87.48，89.42，89.51，96.78，102.69，102.71，113.39，116.35，116.48，127.37，127.42，127.80，127.85，128.12，128.25，128.29，128.57，128.90，128.93，130.22，130.27，130.30，131.01，132.94，133.02，133.14，133.17，134.72，134.75，134.82，134.84，139.51，139.66，143.90，143.97，144.26，150.43，154.73，158.81，158.85，162.82，162.86，163.22，166.72.

TOF/MS(ESI)：C₅₁H₅₃N₆O₁₆PNa[M+Na]⁺Calculated value of 1059.3153, experimental value 1059.3202.

[ examples 7 to 8]

Synthesis of 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) -2' -O- (tert-butyldimethylsilyl) uridin-3 '-yl) phosphoryl) -2' -O- (tert-butyldimethylsilyl) uridine

A mixed solution of 2- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl) phosphoryl) -2 ' -O- (tert-butyldimethylsilyl) uridin-3 ' -yl ester (0.420g, 0.20mmol) in THF (27mL) -2-propanol (3mL) was cooled to 0 to-10 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.25mL, 1.00mmol) under cooling, stirring was carried out at this temperature for 1.5 hours. After 10% ammonium chloride aqueous solution (4mL) was added to the reaction solution, liquid separation was performed, and the organic layer was washed with 10% saline. The organic layer was dried over anhydrous sodium sulfate, the sodium sulfate was removed by filtration, and the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. The concentrated residue was purified by column chromatography (spherical neutral silica gel, developing solvent: dichloromethane-methanol), whereby the title compound (0.135g, 60%) was obtained as a white solid.

¹H－NMR(400MHz，CDCl₃)：δ0.11－0.15(m，12H)，0.89－0.93(m，18H)，1.66－1.84(brs，2H)，2.50－2.77(m，3H)，3.46－3.67(m，2H)，3.80(s，6H)，3.98－4.55(m，9H)，4.92－4.96(m，1H)，5.23－5.27(m，1H)，5.61－5.75(m，2H)，5.97－6.00(m，1H)，6.84－6.87(m，4H)，7.14－7.45(m，10H)，7.77－7.87(m，1H)，9.00－9.50(brs，2H).

¹³C－NMR(100MHz，CDCl₃)：δ－5.14，－4.98，－4.96，－4.90，－4.82，－4.76，－4.74，－4.70，－4.68，17.96，18.02，18.06，19.54，19.60，19.67，25.56，25.60，25.66，25.69，55.31，62.02，62.29，62.34，62.52，62.57，62.62，67.06，67.12，67.32，69.38，69.54，70.49，70.93，73.61，74.57，74.63，74.71，74.88，81.55，81.60，81.73，81.84，81.93，82.01，87.37，87.65，87.85，87.95，88.05，91.58，91.81，93.18，93.89，102.60，102.67，102.76，102.82，102.86，113.41，116.26，116.30，127.41，127.45，128.13，128.17，128.21，130.16，130.23，130.29，130.34，134.65，134.69，134.72，134.75，139.67，139.75，140.36，140.40，141.65，141.77，143.99，144.03，149.97，150.09，150.19，150.40，150.55，150.75，158.83，158.88，162.93，163.00，163.18.

TOF/MS(ESI)：C₅₄H₇₂N₅O₁₆Si₂PNa[M+Na]⁺Calculated value of 1156.4148, experimental value 1156.4148.

Synthesis of 5 '-O- ((2-cyanoethoxy) (5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl) phosphoryl) thymidine

[ examples 7 to 9]

(1) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester from 3- ((3, 4, 5-trioctadecyloxy) benzoyl) oxy) propionic acid

The title compound (0.136g, 76%) was obtained as a white solid from 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl 3- ((3, 4, 5-trioctadecylbenzoyl) oxy) propionate (0.377g, 0.200mmol) according to the method of example 7-8.

¹H－NMR(400MHz，CDCl₃)：δ1.41(d，3H，J＝5.4Hz)，1.87(d，3H，J＝2.0Hz)，2.19－2.27(m，1H)，2.34－2.48(m，2H)，2.62－2.77(m，3H)，3.39(t，1H，J＝7.2Hz)，3.47－3.52(m，1H)，3.78(s，6H)，4.07－4.55(m，8H)，5.12－5.18(m，1H)，6.18－6.24(m，1H)，6.35－6.40(m，1H)，6.84(d，4H，J＝8.8Hz)，7.21－7.31(m，8H)，7.32－7.38(m，2H)，7.51－7.58(m，1H)，9.92－10.14(m，2H).

¹³C－NMR(100MHz，CDCl₃)：δ11.78，12.45，12.49，19.59，19.67，19.71，38.83，39.01，39.61，39.67，55.31，62.45，62.50，62.60，62.65，63.31，67.74，70.84，80.08，84.40，84.50，85.60，87.30，87.36，111.23，111.34，111.91，112.00，113.37，116.49，116.74，127.32，128.10，130.11，130.14，134.98，135.01，135.04，135.19，136.00，144.01，144.06，150.69，151.00，151.05，158.80，163.96，164.16.

TOF/MS(ESI)：C₄₄H₄₈N₅O₁₄PNa[M+Na]⁺Calculated value of 924.2833, experimental value 924.2836.

[ examples 7 to 10 ]

(2) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester from 2- (N-methyl-3, 4, 5-tris (octadecyloxy) benzamide) acetic acid

A mixed solution of 2- (N-methyl-3, 4, 5-tris (octadecyloxy) benzamide) acetic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester (189mg, 0.10mmol) in THF (9mL) -2-propanol (1mL) was cooled to 0 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) under cooling, stirring was carried out at this temperature for 30 minutes. After adding an aqueous ammonium chloride solution to the reaction mixture, the mixture was extracted with dichloromethane 3 times. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, developing solvent: chloroform-methanol), whereby the title compound (89mg, 98%) was obtained as a white solid.

TOF/MS(ESI)：C₄₄H₄₈N₅O₁₄PNa[M+Na]⁺Calculated value of 924.3, experimental value 924.2.

[ examples 7 to 11 ]

(3) Synthesis of 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl 3- (3, 4, 5-trioctadecyloxy) benzamide) propionate

A mixed solution of 3- (3, 4, 5-tris (octadecyloxy) benzamide) propionic acid 5 ' -O- ((2-cyanoethoxy) (5 ' -O- (4, 4 ' -dimethoxytrityl) thymidine-3 ' -yl) phosphoryl) thymidine-3 ' -yl ester (189mg, 0.10mmol) in THF (9mL) -2-propanol (1mL) was cooled to 0 ℃. After addition of a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) under cooling, the mixture was stirred at room temperature for 1 hour. After adding an aqueous ammonium chloride solution to the reaction mixture, the mixture was extracted with dichloromethane 3 times. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, developing solvent: chloroform-methanol), whereby the title compound (74mg, 82%) was obtained as a white solid.

TOF/MS(ESI)：C₄₄H₄₈N₅O₁₄PNa[M+Na]⁺Calculated value of 924.3, experimental value 924.2.

[ examples 7 to 12 ]

(6－(N⁶Synthesis of (E) -benzoyladenin-9-yl) -4-tritylmorpholin-2-yl) methyl P- (2- (hydroxymethyl) -6-thymin-1-yl) morpholinyl) -N, N-dimethylphosphamide

The procedure of examples 7-7 was followed using 4- (((6- (N-octadecyloxy) benzoyl) oxy) acetic acid (2- ((3, 4, 5-trioctadecylbenzoyl) oxy)⁶-benzoyladenin-9-yl) -4-tritylmorpholin-2-yl) methoxy) (bisMethylamino) phosphoryl) -6- (thymin-1-yl) morpholin-2-yl) methyl ester (0.379g, 0.20mmol) to give the title compound as a white solid (0.114g, 61%).

¹H－NMR(400MHz，CDCl₃)：δ0.87－1.95(m，6H)，2.01(s，1H)，2.45－2.64(m，7H)，3.06－4.04(m，9H)，4.43－4.46(m，1H)，5.52(dd，1H，J＝2.4，10.4Hz)，6.41(dt，1H，J＝2.4，10.0Hz)，7.05－7.64(m，19H)，8.03(d，2H，J＝8.4Hz)，8.09(s，1H)，8.71－8.80(m，1H)，9.69－9.78(m，1H)，10.28(s，1H)，10.75－11.05(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ12.41，12.45，36.54，36.58，36.62，36.66，44.61，44，82，47.13，48.68，48.78，52.80，52.85，62.72，62.78，65.46，65.61，75.07，75.14，75.45，75.52，78.06，78.13，78.27，78.33，79.60，79.65，80.01，80.49，110.96，111.03，122.47，122.78，126.65，128.00，128.24，128.41，128.49，128.62，129.17，132.61，132.69，133.48，133.64，134.86，134.96，140.94，149.54，149.75，149.82，150.02，151.23，151.42，152.66，152.75，163.75，163.79，165.25.

TOF/MS(ESI)：C₄₈H₅₁N₁₀O₈PNa[M+Na]⁺Calculated value of 949.3527, experimental value 949.3545.

[ examples 7 to 13 ]

(6－(N⁴-benzoylcytosin-1-yl) -4-tritylmorpholin-2-yl) methyl P- (2- (hydroxymethyl) -6- (N²Synthesis of (isobutyrylguanin-9-yl) morpholinyl) -N, N-dimethylphosphamide

The procedure of examples 7-7 was followed using 4- (((6- (N-octadecyloxy) benzoyl) oxy) acetic acid (2- ((3, 4, 5-trioctadecylbenzoyl) oxy)⁴-benzoylcytosin-1-yl) -4-tritylMorpholin-2-yl) methoxy) (dimethylamino) phosphoryl) -6- (N²Isobutyrylguanin-9-yl) morpholin-2-yl methyl ester (0.197g, 0.10mmol) gives the title compound as a white solid (0.052g, 52%).

¹H－NMR(400MHz，CDCl₃)：δ0.78－1.55(m，9H)，2.37－2.95(m，8H)，3.08－3.94(m，9H)，4.13－4.43(m，2H)，5.42－5.54(m，1H)，6.22－6.38(m，1H)，7.05－7.80(m，19H)，7.93(d，2H，J＝7.2Hz)，9.58－9.92(brs，1H)，10.64－10.86(brs，1H)，12.05－12.21(brs，1H).

¹³C－NMR(100MHz，CDCl₃)：δ13.91，14.12，19.03，19.06，19.28，22.69，25.76，28.55，29.36，29.70，31.72，31.92，35.99，36.05，36.62，36.65，36.69，44.63，44.92，47.15，47.56，48.44，48.79，52.26，52.42，61.85，62.58，62.73，65.66，66.15，71.09，71.69，75.40，75.86，75.91，78.19，79.73，80.56，81.37，81.76，97.87，120.56，120.92，126.65，127.96，128.04，128.70，128.83，128.92，129.13，131.00，132.21，132.97，133.02，133.14，136.66，137.43，144.02，144.54，147.92，147.98，148.00，154.99，155.57，155.62，162.69，163.09，167.24，179.62，179.86.

TOF/MS(ESI)：C₅₁H₅₆N₁₁O₉PNa[M+Na]⁺Calculated value of 1020.3898, experimental value 1020.3942.

[ examples 7 to 14 ]

Confirmation of detag of octamer

(1) 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 5' -O- ((2-cyanoethoxy) (N)⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosyl-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl radicalDeoxyguanosin-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶Synthesis of (octamer) of (benzoyldeoxyadenosyl-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl

To a suspension (10mL) of thymidine-3 '-yl 2- ((3, 4, 5-trioctadecyloxy) benzoyl) acetate (1.19g, 0.98mmol) and 5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl-phosphoramidite (1.46g, 1.96mmol) in methylene chloride under argon was added 5-benzylthio-1H-tetrazole (0.38g, 1.96mmol), and the mixture was stirred at room temperature for 1.5 hours. Subsequently, pyridine (0.93g, 11.77mmol), water (0.11g, 5.89mmol) and iodine (1.25g, 4.91mmol) were added, and the mixture was stirred at room temperature for 4 hours. A1.2 mol/L aqueous ascorbic acid solution (3mL) was added to the reaction mixture, and the mixture was stirred at room temperature for 15 minutes. The solid precipitated by adding acetonitrile (24mL) dropwise to the reaction solution was filtered. The solid was washed with a mixed solvent of acetonitrile and dichloromethane, and dried at 50 ℃ under reduced pressure to obtain a DMTr (2.22 g).

Then, to a dichloromethane suspension (15mL) of DMTr (1.83g, 0.98mmol), pyrrole (0.33g, 4.91mmol) and trifluoroacetic acid (0.13g, 1.18mmol) were added, and the mixture was stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetonitrile (37mL) and methanol (18mL) into the reaction mixture was filtered. The solid was washed with a mixed solvent of acetonitrile-methanol-dichloromethane and dried under reduced pressure at 50 ℃ to obtain a dimer (1.48 g).

The same operation as above was repeated 6 times to obtain an octamer (2.94 g).

TOF/MS(ESI)：m/z 2106.3[M+2H]²⁺，1403.9[M+3H]³⁺.

[ examples 7 to 15 ]

(2) 2- ((3, 4, 5-tris (octadecyloxy) benzoyl) oxy) acetic acid 5' -O- ((2-cyanoethoxy) (N)⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosyl-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶Tagging of (benzoyldeoxyadenosin-3 '-yl) phosphoryl) thymidine-3' -yl ester

N, N-diisopropylethylamine (65mg, 0.50mmol) was added to a mixed solution of dichloromethane (0.4mL), THF (0.2mL) and 2-propanol (0.04mL), and cooled to 0 to-10 ℃. Next, a 4mol/L lithium borohydride-THF solution (0.125mL, 0.50mmol) was added, and then stirred at that temperature for 20 minutes to prepare a reducing agent. To a mixture of octamer (84mg, 0.02mmol) in dichloromethane (4.2mL) -THF (1.8mL) -2-propanol (0.4mL) cooled to 0-10 ℃ in advance was added the reducing agent, and the mixture was stirred at that temperature for 40 minutes. After a 10% ammonium chloride aqueous solution (5mL) was added to the reaction mixture, the mixture was extracted with dichloromethane. The organic layer was washed with brine, and then concentrated and dried to a solid. The solid precipitated by suspending the concentrated residue in dichloromethane was filtered off. The solid was washed with methylene chloride and dried under reduced pressure to give 5 '-O- ((2-cyanoethoxy) (N-cyanoethoxy) (5' -O- ((2-cyanoethoxy) (N)⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosyl-3 '-yl) phosphoryl) thymidine-3' -yl) phosphoryl) -N²-isobutyryl deoxyguanosine-3' -yl) phosphoryl) -N⁴-benzoyl deoxycytidine-3' -yl) phosphoryl) -N⁶-benzoyldeoxyadenosyl-3' -yl) phosphoryl) thymidine (25 mg).

TOF/MS(ESI)：m/z 1621.9[M+2H]²⁺，1081.6[M+3H]³⁺，811.2[M+4H]⁴⁺.

8. Comparison of DeTag progress rates

[ example 8]

The rate of progress of the Tag removal under the basic conditions of ammonia shown below was compared between 5 '-O- (4, 4' -dimethoxytrityl) thymidine-3 '-yl 2- ((3, 4, 5-trioctadecylbenzoyl) oxy) acetate (abbreviated to A-Tag-dT-DMTr) and 3, 4, 5-trioctadecylbenzyl 5' -O- (4, 4 '-dimethoxytrityl) thymidine-3' -yl succinate (abbreviated to S-Tag-dT-DMTr).

< Tag removal Condition >

< generation rate of dT-DMTr (Tag-removed form) >

[ Table 1]

< HPLC Condition >

Column: inertsil WP300 Diol (5 μm, 4.6. phi. times.150 mm)

Flow rate: 1.0mL/min

Mobile phase: n-hexane, CHCl₃－MeOH(1/1)

Gradient: 0-11 min; 5% to 30% (CHCl)₃－MeOH)

The detection method comprises the following steps: UV (λ 254nm)

Retention time: A-Tag-dT-DMTr: rt 4.23min, S-Tag-dT-DMTr: rt 4.17min, dT-DMTr: rt 9.40min

The generation rate is: (dT-DMTr)/[ (A-Tag-dT-DMTr or S-Tag-dT-DMTr) + (dT-DMTr) ]

As described above, it was confirmed that A-Tag was detangled more rapidly than succinate under the general deprotection conditions for oligonucleotide synthesis.

9. Summary of the synthetic examples

Synthesis examples in the above-described embodiments are collectively shown below.

9.1 Synthesis of the trimer

[ Table 2]

As shown in Table 2, various Tag-bound trimer DNA oligomers can be obtained in high yield.

9.2 Synthesis of dimer

[ Table 3]

As shown in Table 3, various Tag-bound oligonucleotides (dimers) can be obtained in high yield.

9.3 Synthesis of dimers

[ Table 4]

As shown in Table 4, various Tag-bound oligonucleotides (dimers) can be obtained in high yield.

9.4 Synthesis of dimer

[ Table 5]

As shown in Table 5 above, various Tag-bound oligonucleotides (dimers) can be obtained in high yield.

9.5 Synthesis and deprotection of the icosamer

Synthesis and deprotection of icosamers

5′-OH-dT-3′-A-Tag→5′-OH-d(TC^BzC^BzC^BzG^iBuC^BzC^BzTG^iBuTG^iBuA^BzC^BzA^BzTG^iBuC^BzA^BzTT)-3′-A-Tag

→5′OH-d(TCCCGCCTGTGACATGCATT)-3′-OH

The use of the alkoxyphenyl derivative and the tagylated oligonucleotide protector of the present invention enables the above-mentioned tagylated oligonucleotide protector (icosamer) to be obtained easily. Further, by removing the Tag moiety and the protecting group, an oligonucleotide can be obtained easily.

9.6 Tag removal of trimer

[ Table 6]

Tag removal from trimer

As shown in Table 6 above, the respective oligonucleotide protectors (trimers) can be obtained in high yield by removing the Tag portions of the respective tagated oligonucleotide protectors (trimers).

9.7 DeTag of dimer

[ Table 7]

Dimer Tag removal

As shown in Table 7, the respective oligonucleotide protectors (dimers) can be obtained in high yield by removing the Tag portion of each of the tagated oligonucleotide protectors (dimers).

9.8 DeTag of dimer

[ Table 8]

Dimer Tag removal

As shown in Table 8 above, the respective oligonucleotide protectors (dimers) can be obtained in high yield by removing the Tag portion of each of the tagated oligonucleotide protectors (dimers).

9.9 DeTag of dimer

[ Table 9]

Dimer Tag removal

As shown in Table 9 above, the respective oligonucleotide protectors (dimers) can be obtained in high yield by removing the Tag portion of each of the tagated oligonucleotide protectors (dimers).

Industrial applicability

The alkoxyphenyl derivative of the present invention can be used for the production of the above-mentioned tagylated nucleoside protector and tagylated nucleotide protector. The method for producing an oligonucleotide and the method for selectively removing a Tag moiety from a tagylated nucleoside or nucleotide protector of the present invention can be used for the synthesis of an oligonucleotide protector, particularly in liquid phase synthesis (including quasi-liquid phase synthesis). These compounds and methods are very useful for the development of nucleic acid medicines, the elucidation of biological mechanisms, and the like.

94页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：阳离子性脂质

Alkoxyphenyl derivative, nucleoside protector and nucleotide protector, method for producing oligonucleotide, and method for removing substituent

相关技术

网友询问留言