Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) receptor-activating antibody fusion proteins with non-Fc γ R dependent agonistic activity (TNFRSF receptor-activating antibody fusion proteins
阅读说明：本技术 具有非FcγR依赖性激动活性的肿瘤坏死因子(TNF)受体超家族(TNFRSF)受体-激活抗体融合蛋白(具有非FcγR依赖性激动活性的TNFRSF受体-激活抗体融合蛋白；TRAAFFIAA) (Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) receptor-activating antibody fusion proteins with non-Fc γ R dependent agonistic activity (TNFRSF receptor-activating antibody fusion proteins) 是由 安德烈亚斯·拜尔哈克 尤利亚妮·库姆斯 约翰内斯·内尔克 哈拉尔德·瓦赞特 于 2018-12-20 设计创作，主要内容包括：本发明涉及具有非FcγR依赖性激动活性的肿瘤坏死因子(TNF)受体超家族(TNFRSF)受体-激活抗体融合蛋白,及其组合物和方法。(The present invention relates to Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) receptor-activating antibody fusion proteins having non-Fc γ R dependent agonistic activity, and compositions and methods thereof.)
1. A fusion protein comprising:
i) an anti-TNFRSF receptor antibody or antigen binding portion thereof, and
ii) a domain capable of binding to a structure on the cell surface and/or to a structure of the extracellular matrix in an Fc γ R independent manner.
2. The fusion protein of claim 1, wherein the structure is a cell surface structure of a cell expressing the TNFRSF receptor, or a cell surface structure of a cell adjacent to a cell expressing the TNFRSF receptor.
3. The fusion protein of claim 1, wherein the structure is a structure of an extracellular matrix of a cell expressing the TNFRSF receptor, or a structure of an extracellular matrix of a cell adjacent to a cell expressing the TNFRSF receptor.
4. The fusion protein of claim 2, wherein the structure is a cell surface protein or a carbohydrate, preferably a cell surface protein.
5. The fusion protein of claim 3, wherein the structure is an extracellular matrix protein or a sugar, preferably an extracellular matrix protein.
6. The fusion protein of any preceding claim, wherein the antibody or antigen-binding portion thereof of i) is monoclonal.
7. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is a full-length antibody, a Fab2 fragment, a Fab fragment, or an antibody wherein VH and VL have been replaced with a TNFRSF receptor-specific scFv fragment.
8. The fusion protein of any preceding claim, wherein the antibody or antigen-binding portion thereof of i) does not comprise an Fc domain.
9. The fusion protein of any one of claims 1-7, wherein the antibody or antigen-binding portion thereof of i) is an antibody variant having reduced binding capacity to one or more Fc γ R types; preferably, full length antibodies comprising the N297A mutation.
10. The fusion protein of any preceding claim, wherein the antibody or antigen-binding portion thereof of i) is an IgG1, IgG2 or IgG4 antibody or antigen-binding portion thereof.
11. The fusion protein of any preceding claim, wherein the antibody or antigen-binding portion thereof of i) is a bivalent antibody or antigen-binding portion thereof.
12. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is selected from the group consisting of an anti-TNFR 2 antibody or antigen-binding portion thereof, an anti-CD 40 antibody or antigen-binding portion thereof, an anti-CD 95 antibody or antigen-binding portion thereof, an anti-Fn 14 antibody or antigen-binding portion thereof, an anti-TRAILR 2 antibody or antigen-binding portion thereof, an anti-TRAILR 1 antibody or antigen-binding portion thereof, an anti-CD 27 antibody or antigen-binding portion thereof, an anti-OX 40 antibody or antigen-binding portion thereof, an anti-4-1 BB antibody or antigen-binding portion thereof, an anti-BaffR antibody or antigen-binding portion thereof, an anti-TACI antibody or antigen-binding portion thereof, or an anti-BCMA antibody or antigen-binding portion thereof.
13. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is selected from the group consisting of an anti-TNFR 2 antibody or antigen-binding portion thereof, an anti-CD 40 antibody or antigen-binding portion thereof, an anti-CD 95 antibody or antigen-binding portion thereof, or an anti-Fn 14 antibody or antigen-binding portion thereof.
14. The fusion protein according to any of the preceding claims, wherein the domain according to ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is preferably a ligand of TNFR2, GITR, 4-1BB, BaffR, TACI, CD40, Fn14 or OX 40.
15. The fusion protein of any preceding claim, wherein the domain of ii) comprises an antibody or antigen-binding portion of an antibody that binds to the structure of the cell surface and/or the structure of the extracellular matrix.
16. The fusion protein of claim 15, wherein the antigen binding portion capable of binding to the structure of the cell surface and/or the structure of the extracellular matrix is an antigen binding portion with reduced ability to bind to one or more fcyr types, preferably a Fab2 fragment, a scFv fragment or a Fab fragment, more preferably a scFv fragment or a Fab fragment.
17. The fusion protein of claim 15 or 16, wherein the antigen binding portion capable of binding to the structure of the cell surface and/or the structure of the extracellular matrix is a Fab fragment.
18. The fusion protein of claim 15 or 16, wherein the antigen binding portion capable of binding to the structure of the cell surface and/or the structure of the extracellular matrix is an scFv fragment.
19. The fusion protein of any one of claims 15-18, wherein the antigen-binding portion or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix is selected from the group consisting of an anti-CD 20 antigen-binding portion, an anti-CD 70 antigen-binding portion, an anti-CD 19 antigen-binding portion, an anti-EGFR antigen-binding portion, an anti-Her 2 antigen-binding portion, an anti-Fn 14 antigen-binding portion, an anti-CD 40L antigen-binding portion, or an anti-PD 1L antigen-binding portion.
20. The fusion protein of any preceding claim, wherein the domain of ii) does not comprise an Fc domain.
21. The fusion protein of any one of claims 1-14, wherein the domain of ii) does not comprise an antibody or antigen-binding fragment thereof.
22. The fusion protein of any one of claims 1-14 or claim 21, wherein the binding of the domain of ii) to the structure of the cell surface and/or the structure of the extracellular matrix is antigen-independent.
23. The fusion protein of any preceding claim, wherein the domain of ii) does not comprise an anti-TNFRSF receptor antibody or antigen binding portion thereof.
24. The fusion protein of any preceding claim, wherein the domain of ii) comprises an interferon or interleukin domain.
25. The fusion protein according to any of the preceding claims, wherein the domain according to ii) comprises, and preferably consists of, IL-2, IL-4, IL-10, IFN α, IFN β or IFN γ; or comprises, and preferably consists of, a variant of IL-2, IL-4, IL-10, IFN alpha, IFN beta or IFN gamma which is capable of binding in an Fc gamma R-independent manner to said structure of the cell surface and/or to said structure of the extracellular matrix; wherein the IL-2, IL-4, IL-10, IFN alpha, IFN beta or IFN gamma is preferably human IL-2, human IL-4, human IL-10, human IFN alpha, human IFN beta or human IFN gamma.
26. The fusion protein of any one of the preceding claims, wherein said fusion protein enhances stimulation of said TNFRSF receptor compared to a protein comprising an anti-TNFRSF receptor antibody or antigen binding portion thereof according to i) but not comprising a domain according to ii).
27. A fusion protein of an anti-TNFRSF receptor antibody or antigen binding portion thereof, wherein said fusion protein is capable of binding to a structure on the surface of said cell or to a structure of said extracellular matrix in an antigen-independent and Fc γ R-independent manner.
28. The fusion protein of claim 27, which, when bound to the construct, enhances stimulation of the TNFRSF receptor.
29. The fusion protein of claim 27 or 28, which binds TNFRSF receptor TNFR2, CD40, CD95, Fn14, TRAILR2, TRAILR1, CD27, OX40, 4-1BB, BaffR, TACI, or BCMA.
30. The fusion protein of any one of claims 27-29, wherein the fusion protein is a fusion comprising an scFv domain of the structure that binds to a cell surface or to the structure of an extracellular matrix, or a fusion comprising a sctfsf ligand or other protein domain of the structure that binds to a cell surface or to the structure of an extracellular matrix.
31. The fusion protein of any one of claims 27-30, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is Fab2 or a Fab fragment.
32. The fusion protein according to any of the preceding claims, wherein the fusion protein is selected from the group consisting of fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 19 and 23, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 21 and 23, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 22 and 23, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 24 and 31, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 25 and 31, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 26 and 31, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 28 and 31, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 29 and 31, fusion proteins comprising the amino acid sequences as shown in SEQ ID NO 30 and 31, Comprises the amino acid sequence shown as SEQ ID NO:32 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:34 and 36, a fusion protein comprising the amino acid sequence shown as SEQ id no:35 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:118 and 23, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:119 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:120 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:121 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:122 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:123 and 124, a fusion protein comprising the amino acid sequences as set forth in SEQ ID NOs: 125 and 36.
33. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-CD 40 antibody or antigen-binding portion thereof; the anti-CD 40 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown as SEQ ID NO:37, the CDR2 of the amino acid sequence shown as SEQ ID NO:38, and the CDR3 of the amino acid sequence shown as LDY; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:39, CDR2 of the amino acid sequence shown in SEQ ID NO:40 and CDR3 of the amino acid sequence shown in SEQ ID NO: 41.
34. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-CD 95 antibody or antigen-binding portion thereof; the anti-CD 95 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 42, the CDR2 of the amino acid sequence shown in SEQ ID NO. 43, and the CDR3 of the amino acid sequence shown in SEQ ID NO. 44; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 45, the CDR2 of the amino acid sequence shown in SEQ ID NO. 46 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 47.
35. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-DR 5 antibody or antigen-binding portion thereof; the anti-DR 5 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 48, the CDR2 of the amino acid sequence shown in SEQ ID NO. 49, and the CDR3 of the amino acid sequence shown in SEQ ID NO. 50; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 51, the CDR2 of the amino acid sequence shown in SEQ ID NO. 52 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 53.
36. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-Fn 14 antibody or antigen-binding portion thereof; the anti-Fn 14 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:54, the CDR2 of the amino acid sequence shown in SEQ ID NO:55, and the CDR3 of the amino acid sequence shown in SEQ ID NO: 56; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 57, the CDR2 of the amino acid sequence shown in SEQ ID NO. 58 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 59.
37. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-Fn 14 antibody or antigen-binding portion thereof; the anti-Fn 14 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:84, the CDR2 of the amino acid sequence shown in SEQ ID NO:85 and the CDR3 of the amino acid sequence shown in SEQ ID NO: 86; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:87, the CDR2 of the amino acid sequence shown in SEQ ID NO:88 and the CDR3 of the amino acid sequence shown in SEQ ID NO: 89.
38. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-TNFR 2 antibody or antigen-binding portion thereof comprising a heavy chain; the anti-TNFR 2 antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO:60, CDR2 of the amino acid sequence shown as SEQ ID NO:61, and CDR3 of the amino acid sequence shown as SEQ ID NO: 62; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO. 63, CDR2 of the amino acid sequence shown in SEQ ID NO. 64 and CDR3 of the amino acid sequence shown in SEQ ID NO. 65.
39. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-4-1 BB antibody or antigen-binding portion thereof; the anti-4-1 BB antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:126, CDR2 of the amino acid sequence set forth in SEQ ID NO:127, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 128; comprises a light chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO:129, CDR2 of the amino acid sequence shown as SEQ ID NO:130 and CDR3 of the amino acid sequence shown as SEQ ID NO: 131.
40. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is HBBK4 or a 4-1BB binding portion thereof.
41. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to CD40 with the anti-TNFRSF receptor antibody of claim 33.
42. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is an antibody or antigen binding portion thereof that cross-competes for binding to CD95 with the anti-TNFRSF receptor antibody of claim 34.
43. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to DR5 with the anti-TNFRSF receptor antibody of claim 35.
44. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is an antibody or antigen binding portion thereof that cross-competes for binding to Fn14 with the anti-TNFRSF receptor antibody of claim 36.
45. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is an antibody or antigen binding portion thereof that cross-competes for binding to Fn14 with the anti-TNFRSF receptor antibody of claim 37.
46. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to TNFR2 with the anti-TNFRSF receptor antibody of claim 38.
47. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is an antibody or antigen binding portion thereof that cross-competes for binding to 4-1BB with the anti-TNFRSF receptor antibody of claim 39.
48. The fusion protein of any one of claims 1-31, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is an antibody or antigen binding portion thereof that cross-competes for binding to 4-1BB with the anti-TNFRSF receptor antibody of claim 40.
49. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to said structure of the cell surface and/or to said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 20 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID No. 66, CDR2 of the amino acid sequence set forth in SEQ ID No. 67, and CDR3 of the amino acid sequence set forth in SEQ ID No. 68; comprising a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:69, CDR2 of the amino acid sequence shown in SEQ ID NO:70 and CDR3 of the amino acid sequence shown in SEQ ID NO: 71.
50. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to said structure of the cell surface and/or to said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 19 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID No. 72, CDR2 of the amino acid sequence set forth in SEQ ID No. 73, and CDR3 of the amino acid sequence set forth in SEQ ID No. 74; comprising a light chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO. 75, CDR2 of the amino acid sequence shown as SEQ ID NO. 76 and CDR3 of the amino acid sequence shown as SEQ ID NO. 77.
51. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to said structure of the cell surface and/or to said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 70 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID No. 78, CDR2 of the amino acid sequence set forth in SEQ ID No. 79, and CDR3 of the amino acid sequence set forth in SEQ ID No. 80; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:81, CDR2 of the amino acid sequence shown in SEQ ID NO:82 and CDR3 of the amino acid sequence shown in SEQ ID NO: 83.
52. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to said structure of the cell surface and/or to said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 70 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID No. 90, CDR2 of the amino acid sequence set forth in SEQ ID No. 91, and CDR3 of the amino acid sequence set forth in SEQ ID No. 92; comprising a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:93, CDR2 of the amino acid sequence shown in SEQ ID NO:94 and CDR3 of the amino acid sequence shown in SEQ ID NO: 95.
53. The fusion protein of any one of claims 1-26 and claims 33-48, wherein the domain of ii) comprises an antibody or antigen binding portion thereof that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is a) an anti-CD 20 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 20 antibody that binds CD20 of claim 49, or b) an anti-CD 19 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 19 antibody that binds CD19 of claim 50, or c) an anti-CD 70 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 70 antibody that binds CD70 of claim 51, or d) an anti-CD 70 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 70 antibody that binds CD70 of claim 52.
54. The fusion protein of any one of claims 1-26 and 33-53, wherein the domain of claim ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion of said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 20 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:96 or an anti-CD 20 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 96.
55. The fusion protein of any one of claims 1-26 and 33-53, wherein the domain of ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion of said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 19 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:98 or an anti-CD 19 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 98.
56. The fusion protein of any one of claims 1-26 and 33-53, wherein the domain of claim ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion of said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 70 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:144 or an anti-CD 70 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 144.
57. The fusion protein of any one of claims 1-26 and 33-53, wherein the domain of claim ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion of said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 70 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:145 or an anti-CD 70 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 145.
58. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of claim ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is a ligand of TNFR2, said ligand being scTNF80 having an amino acid sequence as set forth in SEQ ID NO:102 or at least 90% identity thereto.
59. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is a scBaff having an amino acid sequence as set forth in SEQ ID NO. 103 or at least 90% identity thereto.
60. The fusion protein of any one of claims 1-26 and 33-48, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is scGITRL having an amino acid sequence as set forth in SEQ ID NO. 104 or at least 90% identity thereto.
61. The fusion protein of any of claims 1-26 and 33-48, wherein the domain of claim ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is sc41BBL having an amino acid sequence as set forth in SEQ ID NO. 105 or at least 90% identity thereto.
62. The fusion protein of any of claims 1-26 and 33-48, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is GITLL having an amino acid sequence as set forth in SEQ ID NO 106 or at least 90% identity thereto.
63. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a cell surface structure or extracellular matrix structure of an immune cell.
64. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a fibroblast cell surface structure or extracellular matrix structure.
65. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a tumor cell surface structure or extracellular matrix structure.
66. A composition for use in medicine comprising the fusion protein of any one of the preceding claims.
67. A nucleic acid or a set of nucleic acids encoding the fusion protein of any one of claims 1-65.
68. A method of producing the fusion protein of any one of claims 1-65, the method comprising expressing the nucleic acid or set of nucleic acids of claim 67 in at least one type of host cell, and harvesting the fusion protein.
Technical Field
The present invention relates to Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) receptor-activating antibody fusion proteins (abbreviated TRAAFFIAA) having non-Fc γ R dependent agonistic activity, and compositions and methods thereof.
Background
Receptors of the Tumor Necrosis Factor (TNF) receptor superfamily and activation thereof
Most receptors of the Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) are
1. TNFRSF receptors in the death receptor subset are defined by their structurally conserved protein-protein interaction domains in the intracellular domain, their "death domain" (DD), and are thus named. Some, but not all, of these receptors induce apoptosis or necrosis, but may also trigger other action/signaling pathways. Such as CD95 (also known as Fas or Apo1), TRAILR1(DR4) and TRAILR2(DR 5).
TNFRSF receptors in the TRAF interaction subgroup which do not have a DD but have a short amino acid sequence motif by which adaptor proteins of the TNF Receptor Associated Factor (TRAF) family are recruited. With the aid of these TRAF proteins, receptors of this TNFRSF subgroup can activate various signaling pathways. Such as TNFR2, CD40, 4-1BB, OX40, CD27, Fn14, and BaffR.
A decoy receptor for TNFRSF that does not have an intracellular domain and is secreted and anchored by GPI groups on the outer surface of the plasma membrane. These TNFRSF receptors do not transmit signals themselves, but control the activity of certain receptors of
Generally, the signaling transducible receptor of TNFRSF is naturally activated by interacting with a ligand of the TNF superfamily (TNFSF). The distribution of TNFSF ligands is governed by the C-terminal conserved domain, TNF Homeodomain (THD). Through their THD, TNFSF ligands form homotrimeric and in a few cases heterotrimeric molecules. All ligands of the TNF family, except for the secreted LTalpha homotrimerization, were initially expressed as type II membrane proteins. Thus, THD has extracellular localization. However, soluble trimeric ligand molecules can also be formed in these cases by proteolytic processes between the transmembrane domains of THD and TNFSF ligands (figure 1). A single TNFRSF receptor molecule is recruited into the contact surface region formed between adjacent protomers of a ligand trimer. Thus, one TNFSF ligand molecule binds three receptors of TNFRSF; this applies to soluble and membrane-bound TNFSF ligand molecules. It is now known that binding of membrane bound TNFSF ligands always results in strong receptor activation. However, the extent of potent and effective activation of intracellular signaling pathways upon binding of soluble TNFSF ligands depends on the particular TNFRSF receptor. Thus, TNFRSF receptors such as TNFR1, GITR, LTbR or DR3 are strongly activated by binding of soluble ligand trimers, whereas TNFRSF receptors such as TNFR2, Fn14, TRAILR1, TRAILR2, CD95, OX40, CD27, 4-1BB and CD40 are not or very poorly stimulated by soluble ligand trimers. In these cases, the soluble TNF ligand may even act as a competitive inhibitor of its membrane-bound form. The problem why the TNFRSF receptors of the second group are stimulated much better by their membrane-bound ligands than by their soluble ligand molecules has not been completely solved. However, it is presently believed that trimeric ligand-receptor complexes are insufficient to stimulate most signaling pathways, and at least two of these complexes must interact in a secondary manner for signaling to be effectively initiated. Accordingly, some receptors for TNFRSF have been shown to have, although weak, ligand-independent self-affinity. The membrane localization of membrane-bound ligand trimers results in spatial pre-orientation, reduced diffusion and very high local concentrations of interaction partners in the contact region between TNFRSF receptor-expressing cells and TNFSF ligand-expressing cells, compared to soluble ligands. Thus, in the case of binding to membrane-bound ligands, spontaneous secondary aggregation of the initially formed trimeric ligand-receptor complex may occur. However, in the case of binding to soluble ligand trimers, the self-affinity of the TNFRSF receptors of the second group may be too weak to ensure such secondary aggregation. According to this model, soluble fusion proteins and TNFSF ligand complexes, each comprising two or more trimeric ligand domains, can activate a second group of TNFRSF receptors, similar to membrane-bound ligands. In addition, it has also been shown that anchoring of only trimeric soluble TNFSF ligands on cells or other surfaces is sufficient to activate a second group of TNFRSF receptors (see Wajant et al, Cancer Lett.2013May 28; 332(2): 163-74.).
A second possibility for activating receptors for TNFRSF is the use of antibodies. The use of antibodies is very important in view of various clinical concepts, particularly, treatment involving tumor diseases aiming at activating cell death-inducing or immunostimulatory receptors of TNFRSF. Thus, antibodies targeting the TNFRSF receptors TRAILR2, CD40, Fn14, CD27, OX40, and 4-1BB are being tested or have been tested in clinical studies. In this respect, the question of when and under what conditions anti-TNFRSF receptor-specific antibodies act in a receptor-stimulating manner has long been ignored. It is generally believed that this is primarily a matter of the epitope specifically recognized by the antibody. In particular, over the last few years, studies in this regard have shown that, similar to soluble TNFSF ligands, it is primarily the valency and presentation pattern of the molecule that determines whether receptor activation occurs, i.e., whether the antibody acts as an agonist. Thus, for the various bivalent IgG1 and IgG2 antibodies that recognize the TNFRSF receptor, which are not fully stimulated by soluble ligands, it was found that they can only effectively act as agonists when they are cross-linked in a secondary manner by secondary antibodies or G-proteins, or these antibodies can simultaneously bind to Cell-bound Fc γ receptors (Fc γ Rs) (see Wajant 2015, Cell DeathDiffer.2015Nov; 22(11):1727-41 and FIGS. 2-3).
This may lead to a seemingly paradoxical situation where an antagonist antibody that blocks ligand binding acts as a strong agonist upon binding to Fc γ Rs, i.e. is not a recognized epitope, but rather primarily the form in which the antibody binds to its antigen determines the effect of the antibody (see trebin et al, mabs.2014 Jan-Feb; 6(1):297-308, fig. 3D, which is incorporated herein by reference in its entirety for all purposes). Furthermore, the inventors observed that IgG antibodies recognizing TNFRSF receptors, which have been effectively activated by soluble ligands, generally act also in an agonist fashion without further cross-linking or binding to Fc γ R (fig. 2, see the example panel containing relevant α TNF1 and α LTR).
The requirement for agonistic activity of bivalent IgG antibodies recognizing TNFRSF receptors (not stimulated by soluble TNF ligands and antibodies) is complex and even prevents their use in clinical methods. Since the binding of the anti-TNFRSF receptor antibody to Fc γ R not only leads to activation of TNFRSF receptor but also stimulates Fc γ receptor, an undesired reaction may occur, which complicates clinical use or even excludes clinical use thereof. Binding to activated Fc γ rs may, for example, result in ADCC, CDC or phagocytosis mediated removal/destruction of cells expressing TNFRSF receptors. To prevent this, IgG mutants that interact more strongly or more preferentially with inhibitory Fc γ R, CD32B can be used. However, immunosuppressive activity of CD32B may also cause distress. More specifically, however, there is no guarantee that a sufficient number of cells expressing CD32B will always be found in the vicinity of the target cells expressing the target TNFRSF receptor. Although IgM and IgG3 antibodies are highly susceptible to self-aggregation, due to their high affinity, they can act in an agonist fashion in the absence of Fc γ R binding-similar to soluble ligand trimers that oligomerize in a secondary manner-with greater effort and immaturity in their development compared to IgG1, IgG2 and IgG4 antibodies.
Therefore, there is a need for agents targeting TNFRSF receptors. In particular, it would be desirable to have a formulation that effectively and more reliably targets the receptor for TNFRSF and is less likely to have deleterious side effects than existing TNFRSF targeting formulations.
Disclosure of Invention
The present invention addresses the above-mentioned problems and meets the above-mentioned needs in the art.
The anti-TNFRSF receptor antibody fusion protein according to the present invention binds to a cell-binding structure or to a structure of the extracellular matrix in a manner independent of the antigen-binding domain of the antibody portion and the natural or mutated Fc domain, if any. Surprisingly, the inventors have found that said fusion proteins, i.e. fusion proteins comprising an anti-TNFRSF receptor antibody (or antigen binding portion thereof), act as strong agonists upon interaction with the target cell structure or extracellular matrix, i.e. a TNFRSF receptor stimulation pattern that is independent of Fc γ R binding (see, e.g., fig. 4-12 as non-limiting examples).
The above finding is advantageous for the following reasons: for example, Fc γ R independent stimulation is advantageous because it is not limited to situations expressing Fc γ R. In addition, this is also advantageous in that side effects due to stimulation of Fc γ R can be avoided. Such side effects include ADCC, CDC or phagocytosis removal/destruction of cells expressing TNFRSF receptors, as well as immunosuppressive activity of Fc γ RCD 32B.
Thus, in one aspect, the invention features forms of antibody fusion proteins that allow for effective stimulation of the receptor for TNFRSF without binding to Fc γ rs. Tumor Necrosis Factor (TNF) receptor superfamily (TNFRSF) receptor activating antibody fusion proteins (TRAAFFIAA) having Fc γ R independent agonistic activity according to the present invention may also be bifunctional and/or have prodrug properties after appropriate selection of the domain to which the anti-TNFRSF receptor antibody is fused. As used herein, "bifunctional" refers to a structure of a cell surface or extracellular matrix (e.g., a cell surface or extracellular matrix protein) that is inhibited or stimulated when bound by a domain that binds the structure in an Fc γ R independent manner. TRAAFFIAA is bifunctional in that it not only activates TNFRSF receptor signaling, but also modulates the activity of the target molecule structure. As described herein, the prodrug is activated by a tumor associated factor (e.g., an enzyme, hypoxia). For example, TRAAFFiAA targeting tumor antigens only gain agonistic activity in tumors and act like prodrugs.
It is immediately apparent from the work of the present inventors that local agonist effects, limited to the target structure, can be obtained in vivo using a suitably selected immobilization domain at TRAAFFIAA. Thereby making it possible to avoid systemic side effects that may limit treatment. Therefore, TRAAFFIAA not only can stimulate TNFRSF receptors advantageously with antibodies in an Fc γ R independent manner, but also opens up new fields of application, including clinical applications.
Accordingly, the present invention includes the following preferred embodiments:
1. a fusion protein comprising:
i) an anti-TNFRSF receptor antibody or antigen binding portion thereof, and
ii) a domain capable of binding to a structure on the cell surface and/or to a structure of the extracellular matrix in an Fc γ R independent manner.
2. The fusion protein of
3. The fusion protein according to
4. The fusion protein of
5. The fusion protein of
6. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is monoclonal.
7. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is a full-length antibody, a Fab2 fragment, a Fab fragment, or an antibody wherein VH and VL have been replaced with a TNFRSF receptor-specific scFv fragment.
8. The fusion protein of any one of the preceding claims, wherein the antibody or antigen binding portion thereof of i) does not comprise an Fc domain.
9. The fusion protein of any one of claims 1-7, wherein the antibody or antigen-binding portion thereof of i) is an antibody variant having reduced binding capacity to one or more Fc γ R types; preferably, full length antibodies comprising the N297A mutation.
10. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is an IgG1, IgG2, or IgG4 antibody or antigen-binding portion thereof.
11. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is a bivalent antibody or antigen-binding portion thereof.
12. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is selected from the group consisting of an anti-TNFR 2 antibody or antigen-binding portion thereof, an anti-CD 40 antibody or antigen-binding portion thereof, an anti-CD 95 antibody or antigen-binding portion thereof, an anti-Fn 14 antibody or antigen-binding portion thereof, an anti-TRAILR 2 antibody or antigen-binding portion thereof, an anti-TRAILR 1 antibody or antigen-binding portion thereof, an anti-CD 27 antibody or antigen-binding portion thereof, an anti-OX 40 antibody or antigen-binding portion thereof, an anti-4-1 BB antibody or antigen-binding portion thereof, an anti-BaffR antibody or antigen-binding portion thereof, an anti-TACI antibody or antigen-binding portion thereof, or an anti-BCMA antibody or antigen-binding portion thereof.
13. The fusion protein of any one of the preceding claims, wherein the antibody or antigen-binding portion thereof of i) is selected from the group consisting of an anti-TNFR 2 antibody or antigen-binding portion thereof, an anti-CD 40 antibody or antigen-binding portion thereof, an anti-CD 95 antibody or antigen-binding portion thereof, or an anti-Fn 14 antibody or antigen-binding portion thereof.
14. The fusion protein according to any of the preceding claims, wherein the domain according to ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is preferably a ligand of TNFR2, GITR, 4-1BB, BaffR, TACI, CD40, Fn14 or OX 40.
15. The fusion protein of any one of the preceding claims, wherein the domain of ii) comprises an antibody or an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix.
16. The fusion protein of
17. The fusion protein of
18. The fusion protein of any of claims 15-17, wherein the antigen binding portion of the structure that binds to a cell surface and/or the structure of extracellular matrix is an antigen binding portion with reduced ability to bind one or more Fc γ R types, preferably a Fab2 fragment, scFv fragment, or Fab fragment, more preferably a scFv fragment or Fab fragment.
19. The fusion protein of any one of claims 15-18, wherein the antigen binding portion that binds to the structure of the cell surface and/or the structure of the extracellular matrix is a Fab fragment.
20. The fusion protein of any of claims 15-18, wherein the antigen binding portion that binds to the structure on the cell surface and/or the structure of the extracellular matrix is an scFv fragment.
21. The fusion protein of any one of claims 15-20, wherein the antigen-binding portion or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix is selected from the group consisting of an anti-CD 20 antigen-binding portion, an anti-CD 70 antigen-binding portion, an anti-CD 19 antigen-binding portion, an anti-EGFR antigen-binding portion, an anti-Her 2 antigen-binding portion, an anti-Fn 14 antigen-binding portion, an anti-CD 40L antigen-binding portion, or an anti-PD 1L antigen-binding portion.
22. The fusion protein of any one of the preceding claims, wherein the domain of ii) does not comprise an Fc domain.
23. The fusion protein of any one of claims 1-14, wherein the domain of ii) does not comprise an antibody or antigen-binding fragment thereof.
24. The fusion protein of any of claims 1-14 or 23, wherein the binding of the domain of ii) to the structure of the cell surface and/or the structure of the extracellular matrix is antigen-independent.
25. The fusion protein of any one of items 1-16 and 18-24, wherein the domain of item ii) does not comprise an anti-TNFRSF receptor antibody or antigen binding portion thereof.
26. The fusion protein of any preceding claim, wherein the domain of ii) comprises an interferon or interleukin domain.
27. The fusion protein according to any of the preceding claims, wherein the domain according to ii) comprises, and preferably consists of, IL-2, IL-4, IL-10, IFN α, IFN β or IFN γ; or comprises, and preferably consists of, a variant of IL-2, IL-4, IL-10, IFN alpha, IFN beta or IFN gamma which is capable of binding in an Fc gamma R-independent manner to said structure of the cell surface and/or to said structure of the extracellular matrix; wherein the IL-2, IL-4, IL-10, IFN alpha, IFN beta or IFN gamma is preferably human IL-2, human IL-4, human IL-10, human IFN alpha, human IFN beta or human IFN gamma.
28. The fusion protein of any one of the preceding claims, wherein said fusion protein enhances stimulation of said TNFRSF receptor compared to a protein comprising an anti-TNFRSF receptor antibody or antigen binding portion thereof according to i) but not comprising a domain according to ii).
29. A fusion protein of an anti-TNFRSF receptor antibody or antigen binding portion thereof, wherein said fusion protein is capable of binding to a structure on the surface of said cell or to a structure of said extracellular matrix in an antigen-independent and Fc γ R-independent manner.
30. The fusion protein of claim 29, which, when bound to said construct, enhances stimulation of the TNFRSF receptor.
31. The fusion protein of item 29 or 30, which binds to TNFRSF receptor TNFR2, CD40, CD95, Fn14, TRAILR2, TRAILR1, CD27, OX40, 4-1BB, BaffR, TACI, or BCMA.
32. The fusion protein of any of claims 29-31, wherein said fusion protein is a fusion comprising an scFv domain of said structure that binds to a cell surface or to said structure of extracellular matrix, or a fusion comprising a sctfsf ligand or other protein domain of said structure that binds to a cell surface or to said structure of extracellular matrix.
33. The fusion protein of any one of claims 29-32, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is Fab2 or a Fab fragment.
34. The fusion protein according to any of the preceding claims, wherein the fusion protein is selected from the group consisting of fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 19 and 23, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 21 and 23, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 22 and 23, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 24 and 31, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 25 and 31, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 26 and 31, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 28 and 31, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 29 and 31, fusion proteins comprising the amino acid sequences as depicted in SEQ ID NO 30 and 31, Comprises the amino acid sequence shown as SEQ ID NO:32 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:34 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:35 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:118 and 23, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:119 and 36, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:120 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:121 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:122 and 31, a fusion protein comprising the amino acid sequence shown as SEQ ID NO:123 and 124, a fusion protein comprising the amino acid sequences as set forth in SEQ ID NOs: 125 and 36.
35. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-CD 40 antibody or antigen-binding portion thereof; the anti-CD 40 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown as SEQ ID NO:37, the CDR2 of the amino acid sequence shown as SEQ ID NO:38, and the CDR3 of the amino acid sequence shown as LDY; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:39, CDR2 of the amino acid sequence shown in SEQ ID NO:40 and CDR3 of the amino acid sequence shown in SEQ ID NO: 41.
36. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-CD 95 antibody or antigen-binding portion thereof; the anti-CD 95 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 42, the CDR2 of the amino acid sequence shown in SEQ ID NO. 43, and the CDR3 of the amino acid sequence shown in SEQ ID NO. 44; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 45, the CDR2 of the amino acid sequence shown in SEQ ID NO. 46 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 47.
37. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-DR 5 antibody or antigen-binding portion thereof; the anti-DR 5 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 48, the CDR2 of the amino acid sequence shown in SEQ ID NO. 49, and the CDR3 of the amino acid sequence shown in SEQ ID NO. 50; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 51, the CDR2 of the amino acid sequence shown in SEQ ID NO. 52 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 53.
38. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-Fn 14 antibody or antigen-binding portion thereof; the anti-Fn 14 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:54, the CDR2 of the amino acid sequence shown in SEQ ID NO:55, and the CDR3 of the amino acid sequence shown in SEQ ID NO: 56; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO. 57, the CDR2 of the amino acid sequence shown in SEQ ID NO. 58 and the CDR3 of the amino acid sequence shown in SEQ ID NO. 59.
39. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-Fn 14 antibody or antigen-binding portion thereof; the anti-Fn 14 antibody or antigen-binding portion thereof comprises a heavy chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:84, the CDR2 of the amino acid sequence shown in SEQ ID NO:85 and the CDR3 of the amino acid sequence shown in SEQ ID NO: 86; comprises a light chain comprising the CDR1 of the amino acid sequence shown in SEQ ID NO:87, the CDR2 of the amino acid sequence shown in SEQ ID NO:88 and the CDR3 of the amino acid sequence shown in SEQ ID NO: 89.
40. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-TNFR 2 antibody or antigen-binding portion thereof comprising a heavy chain; the anti-TNFR 2 antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO:60, CDR2 of the amino acid sequence shown as SEQ ID NO:61, and CDR3 of the amino acid sequence shown as SEQ ID NO: 62; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO. 63, CDR2 of the amino acid sequence shown in SEQ ID NO. 64 and CDR3 of the amino acid sequence shown in SEQ ID NO. 65.
41. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-4-1 BB antibody or antigen-binding portion thereof; the anti-4-1 BB antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:126, CDR2 of the amino acid sequence set forth in SEQ ID NO:127, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 128; comprises a light chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO:129, CDR2 of the amino acid sequence shown as SEQ ID NO:130 and CDR3 of the amino acid sequence shown as SEQ ID NO: 131.
42. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is HBBK4 or a 4-1BB binding portion thereof.
43. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-4-1 BB antibody or antigen-binding portion thereof; the anti-4-1 BB antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:132, CDR2 of the amino acid sequence set forth in SEQ ID NO:133, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 134; comprising a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO. 135, CDR2 of the amino acid sequence shown in SEQ ID NO. 136 and CDR3 of the amino acid sequence shown in SEQ ID NO. 137.
44. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is ureluab or a 4-1 BB-binding portion thereof.
45. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an anti-4-1 BB antibody or antigen-binding portion thereof; the anti-4-1 BB antibody or antigen-binding portion thereof comprises a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:138, CDR2 of the amino acid sequence set forth in SEQ ID NO:139, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 140; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO. 141, CDR2 of the amino acid sequence shown in SEQ ID NO. 142 and CDR3 of the amino acid sequence shown in SEQ ID NO. 143.
46. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen binding portion thereof is utomicilumab or a 4-1 BB-binding portion thereof.
47. The fusion protein of any one of claims 1-33, wherein said anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to CD40 with said anti-TNFRSF receptor antibody of claim 35.
48. The fusion protein of any one of claims 1-33, wherein said anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to CD95 with said anti-TNFRSF receptor antibody of claim 36.
49. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to DR5 with the anti-TNFRSF receptor antibody of item 37.
50. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to Fn14 with the anti-TNFRSF receptor antibody of item 38.
51. The fusion protein of any one of claims 1-33, wherein the anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to Fn14 with the anti-TNFRSF receptor antibody of item 39.
52. The fusion protein of any one of claims 1-33, wherein said anti-TNFRSF receptor antibody or antigen-binding portion thereof is an antibody or antigen-binding portion thereof that cross-competes for binding to TNFR2 with the anti-TNFRSF receptor antibody of item 40.
53. The fusion protein of any one of
54. The fusion protein of any one of
55. The fusion protein of any one of
56. The fusion protein of any one of
57. The fusion protein of any one of
58. The fusion protein of any one of
59. The fusion protein of any of items 1-28 and 35-58, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 20 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:66, CDR2 of the amino acid sequence set forth in SEQ ID NO:67, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 68; comprising a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:69, CDR2 of the amino acid sequence shown in SEQ ID NO:70 and CDR3 of the amino acid sequence shown in SEQ ID NO: 71.
60. The fusion protein of any of items 1-28 and 35-58, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 19 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:72, CDR2 of the amino acid sequence set forth in SEQ ID NO:73, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 74; comprising a light chain comprising CDR1 of the amino acid sequence shown as SEQ ID NO. 75, CDR2 of the amino acid sequence shown as SEQ ID NO. 76 and CDR3 of the amino acid sequence shown as SEQ ID NO. 77.
61. The fusion protein of any of items 1-28 and 35-58, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 70 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:78, CDR2 of the amino acid sequence set forth in SEQ ID NO:79, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 80; comprises a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:81, CDR2 of the amino acid sequence shown in SEQ ID NO:82 and CDR3 of the amino acid sequence shown in SEQ ID NO: 83.
62. The fusion protein of any of items 1-28 and 35-58, wherein the domain of claim ii) comprises an antibody or antigen-binding portion thereof that binds to the structure of the cell surface and/or the structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is an anti-CD 70 antibody or antigen-binding portion thereof comprising a heavy chain comprising CDR1 of the amino acid sequence set forth in SEQ ID NO:90, CDR2 of the amino acid sequence set forth in SEQ ID NO:91, and CDR3 of the amino acid sequence set forth in SEQ ID NO: 92; comprising a light chain comprising CDR1 of the amino acid sequence shown in SEQ ID NO:93, CDR2 of the amino acid sequence shown in SEQ ID NO:94 and CDR3 of the amino acid sequence shown in SEQ ID NO: 95.
63. The fusion protein of any one of items 1-28 and 35-58, wherein the domain of ii) comprises an antibody or antigen binding portion thereof that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antibody or antigen-binding portion thereof is a) an anti-CD 20 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 20 antibody that binds CD20 as described in item 59, or b) an anti-CD 19 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 19 antibody that binds CD19 of item 60, or c) an anti-CD 70 antibody or an antigen-binding portion thereof that cross-competes with the anti-CD 70 antibody that binds CD70 of item 61, or d) an anti-CD 70 antibody or antigen-binding portion thereof that cross-competes with the anti-CD 70 antibody that binds CD70 of item 62.
64. The fusion protein of any of items 1-28 and 35-63, wherein the domain of ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion that binds to said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 20 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:96 or an anti-CD 20 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 96.
65. The fusion protein of any of items 1-28 and 35-63, wherein the domain of ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion that binds to said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 19 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:98 or an anti-CD 19 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 98.
66. The fusion protein of any of items 1-28 and 35-63, wherein the domain of ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion that binds to said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 70 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:144 or an anti-CD 70 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 144.
67. The fusion protein of any of items 1-28 and 35-63, wherein the domain of ii) comprises an antigen-binding portion of an antibody that binds to said structure of the cell surface and/or said structure of the extracellular matrix, and wherein the antigen-binding portion that binds to said structure of the cell surface and/or said structure of the extracellular matrix is an anti-CD 70 scFv fragment comprising the amino acid sequence set forth in SEQ ID NO:145 or an anti-CD 70 scFv fragment comprising at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 145.
68. The fusion protein of any of items 1-28 and 35-58, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is a ligand of TNFR2, which is scTNF80 having an amino acid sequence as set forth in SEQ ID NO. 102 or at least 90% identity thereto.
69. The fusion protein of any of items 1-28 and 35-58, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is scBaff having an amino acid sequence as set forth in SEQ ID NO. 103 or at least 90% identity thereto.
70. The fusion protein of any of items 1-28 and 35-58, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is scGITRL having an amino acid sequence as set forth in SEQ ID NO. 104 or at least 90% identity thereto.
71. The fusion protein of any of items 1-28 and 35-58, wherein the domain of ii) comprises a scTNFSF ligand, and wherein the scTNFSF ligand is sc41BBL having an amino acid sequence as set forth in SEQ ID NO. 105 or at least 90% identity thereto.
72. The fusion protein of any of items 1-28 and 35-58, wherein the domain of ii) comprises a sctfsf ligand, and wherein the sctfsf ligand is a GITLL having an amino acid sequence as set forth in SEQ ID NO:106 or having at least 90% identity thereto.
73. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a cell surface structure or extracellular matrix structure of an immune cell.
74. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a fibroblast cell surface structure or extracellular matrix structure.
75. The fusion protein of any preceding claim, wherein the cell surface structure or extracellular matrix structure is a tumor cell surface structure or extracellular matrix structure.
76. A composition for use in medicine comprising the fusion protein of any one of the preceding claims.
77. A nucleic acid or a set of nucleic acids encoding the fusion protein of any one of claims 1-75.
78. A method of producing the fusion protein of any one of claims 1-75, the method comprising expressing the nucleic acid or set of nucleic acids of claim 77 in at least one type of host cell, and harvesting the fusion protein.
Drawings
FIG. 1: ligands and receptors for TNFSF and TNFRSF.
FIG. 2: receptor-specific IgG induces Fc γ R-dependent stimulation of TNFRSF receptors. Hek293 cells transfected with the expression plasmid or empty vector for murine Fc γ R2B were co-cultured with cells of the indicated cell line in which stimulation of the indicated TNFRSF receptor resulted in the production of
The material and the method are as follows: hek293 cells (ATCC) which do not express (or only moderately express) the indicated TNFRSF receptor and Fc γ R were transiently transfected with the expression plasmid pCMV-SPORT6(Source biccoscience) encoding murine Fc γ R2B or an empty vector. Such as Kums et al, mabs.2017 apr; 9(3) 506 As described in 520, Hek293 cells were transfected with the Fc γ R expression plasmid or empty vector using Polyethyleneimine (PEI). The next day, Hek293 transfectants were harvested and aliquots of 20.000 cells were added to the wells of 96-well plates that had been seeded the day before (10000-. The co-cultures were then stimulated overnight with the indicated anti-TNFRSF receptor antibody (3 μ g/ml) in triplicate and the co-culture supernatants were finally assessed for IL8 content by elisa (bd biosciences).
FIG. 3: fc γ R dependent stimulation of TNFRSF receptor TNFR2 by receptor specific IgG. Hek293 cells transfected with the expression plasmid or empty vector for Fc γ R2B shown were co-cultured with cells stimulating TNFR2 to induce IL8 production. After overnight incubation with the indicated TNFR2 specific IgG, the production of IL8 was captured using ELISA.
The material and the method are as follows: hek293 cells (ATCC) that do not express TNFR2 or Fc γ R were transiently transfected with expression plasmid pCMV-port 6 (from biccoscience) encoding human active Fc γ R CD32A (Fc γ R2IIA), human inhibitory Fc γ R CD32B (Fc γ RIIB), or an empty vector. Such as Kums et al, mabs.2017 apr; 9(3) 506 As described in 520, Hek293 cells were transfected with the Fc γ R expression plasmid or empty vector using Polyethyleneimine (PEI). The following day, Hek293 transfectants were harvested and aliquots of 20.000 cells were added to wells of a 96-well plate that had been seeded the previous day with HT1080 cells stably expressing TNFR2 (density 20000 cells/well). The co-cultures were then stimulated overnight in triplicate with the anti-human TNFR2 antibody shown (1. mu.g/ml), which was produced and produced by itself. The Cysteine Rich Domain (CRD) subdomain of TNFR2 (CRD1-CRD4) recognized by the antibody is shown. Activation of TNFR2 in the cells used resulted in enhanced IL8 production. Therefore, to determine TNFR2 activity, the co-culture supernatants were finally evaluated for IL8 content by elisa (bd biosciences).
FIG. 4: anti-CD 40 IgG 1G 28.5 scBaff fusion proteins showed enhanced CD40 stimulatory activity upon binding to BaffR, TACI or BCMA. (A) Structure of the fusion protein. (B) The empty vector was transfected into Hek293 cells with expression plasmids encoding BaffR, BCMA and TACI, respectively. The following day, transfectants were co-cultured with HT1080-CD40 cells, which did not express BaffR, BCMA, and TACI, but produced IL8 strongly after CD40 stimulation. Cocultures were stimulated with the indicated concentrations of anti-CD 40(G28.5) -HC: scBaff in triplicate. The following day, the amount of human IL8 was determined in supernatants of different co-cultures. (C) L363 cells expressing BaffR and TACI, Hek293 cells (BaffR, BCMA and TACI negative), and HT1080-CD40 cells were co-cultured, and the co-culture was then stimulated with anti-CD 40(G28.5) -HC: scBaff at the indicated concentrations. The following day, the amount of human IL8 was again determined in the supernatant of the co-culture. Note that the three protomers of Baff in scBaff contain only the extracellular TNF homeodomain of the full-length Baff molecule.
The material and the method are as follows: such as Kums et al, mabs.2017 apr; 9(3) 506-520 Hek293 cells and FcgR expression vectors, Hek293 cells not expressing CD40, BaffR, TACI or BCMA were transiently transfected with expression plasmids encoding BaffR, TACI and BCMA or empty vectors (═ negative controls). Transfectants were harvested and aliquots of 30.000 cells were added to wells of 96-well plates that had been seeded with HT1080-CD40 cells (HT 1080 cells stably transfected with CD 40) at a density of 20000 cells/well the previous day. Alternatively, HT1080-CD40 cells were co-cultured with a 50.000 cell/well myeloma cell line L363 that endogenously expresses BaffR and TACI. The HT1080-CD40 cells produced a large response to activation of CD 40. Co-cultures were stimulated overnight with TRAAFFIAA anti-CD 40(G28.5) -IgG1(N297) -scBaff in triplicate and finally the yield of IL8 was determined by ELISA.
FIG. 5: the scBaff fusion protein against CD95 IgG 1E 09 showed increased CD95 stimulatory activity upon binding to BaffR, TACI or BCMA. (A) Structure of the fusion protein. (B) Hek293 cells were transfected with empty vectors or expression plasmids encoding BaffR, BCMA and TACI. The following day, transfectants were co-cultured with HT1080 cells, which did not express BaffR, BCMA, and TACI, and which underwent apoptosis following stimulation with CD 95. Cocultures were treated with anti-CD 95(E09) -HC: scBaff at the indicated concentrations and the activity of adhesively grown HT1080 cells was assessed by crystal violet staining the following day. (C) L363 cells expressing BaffR and TACI, Hek293 cells (BaffR, BCMA and TACI negative) were co-cultured with HT1080 cells. Co-cultures were stimulated again overnight with anti-CD 95(E09) -HC: scBaff, and finally the activity of HT1080 was assessed by crystal violet staining. Note that the three protomers of Baff in scBaff contain only the extracellular TNF homeodomain of the full-length Baff molecule.
Materials and methods: such as Kums et al, mabs.2017 apr; 9(3) 506 Hek293 cells and FcgR expression vectors described in 520 Hek293 cells which do not express BaffR, TACI or BCMA and express negligible amounts of CD95 were transiently transfected with expression plasmids encoding BaffR, TACI and BCMA or empty vectors (═ negative controls). Transfectants were harvested and aliquots of 30.000 cells were added to wells of a 96-well plate that had been seeded with HT1080 cells at a density of 20000 cells/well the day before. Alternatively, HT1080 cells were co-cultured with 50.000 cells/well of a myeloma cell line L363 that endogenously expresses BaffR and TACI. In the absence of a sensitizer, HT1080 cells were sensitive to CD 95-induced cell death. Cocultures were stimulated overnight with TRAAFFIAA anti-CD 95(E09) -IgG1(N297) -scBaff in triplicate and finally cell death induction was determined by crystal violet staining of adherent growing HT1080 cells.
FIG. 6: an anti-CD 40-IgG1 fusion protein that binds TNFR2 has enhanced CD40 stimulating activity upon
FIG. 7: anti-CD 95-IgG1 fusion protein that binds to CD19 showed enhanced induction of cell death in HT1080 cells when co-cultured with CD19 expressing cells. The CD95 sensitive cell line HT1080, which does not express CD19, was co-cultured with Jurkat (CD19 negative) cells and BJAB (CD19 positive) cells and incubated with anti-CD 95 fusion protein that binds CD19 (anti-CD 95(E09) -HC: scFv: CD19) at indicated concentrations. The next day, the activity of the adhesively grown HT1080 cells was determined by crystal violet staining.
The material and the method are as follows: experiments were performed in triplicate on 96-well plates. HT1080 cells were seeded at 20000 cells per well. Jurkat and BJAB cells (30000 cells per well) were then added along with the indicated concentration of anti-CD 95(E09) -HC: scFv: CD 19. Cell death induction was determined by crystal violet staining of adherently growing HT1080 cells. Cell activity was normalized by means of untreated HT1080 cells (═ 100% activity) and HT1080 cells (═ 0 activity) treated with a highly toxic mixture containing CHX, Velcade and Fc-CD 95L.
FIG. 8: IL2 fusion protein of antibody C4 specific for TNFR2 enhanced stimulation of TNFR2 in an IL2R dependent manner. Hek293 cells expressing neither TNFR2 nor IL2R were transfected with a mixture of expression plasmids encoding subunits of IL2R or an empty vector. Hek293 transfectants were then co-cultured with HeLa transfectants expressing TNFR2 and stimulated with the indicated concentrations of anti-TNFR 2(C4) -HC:
The material and the method are as follows: such as Kums et al, mabs.2017 apr; 9(3) 506-520 Hek293 cells were transiently transfected with a mixture of expression plasmids encoding IL-2 receptor subunits for Hek293 cells and FcgR expression vectors, or Hek293 cells were transiently transfected with an empty vector as a negative control. Transfectants were harvested and aliquots of 20.000 cells were added to wells of a 96-well plate that had been seeded with HeLa-TNFR2 cells at a density of 20000 cells/well the day before. The HeLa-TNFR2 cells produced IL8 in response to activation of
FIG. 9: the GITR and 41 BB-anchored fusion protein of TNFR 2-specific antibody C4 shows enhanced TNFR2 activation upon binding GITR and 41 BB. (A) The TNFR 2-stimulating domain structures anchored to human GITR and TRAAFFIAA of murine 4-1BB are used. (B, C) cells expressing neither GITR nor 41BB are transfected with empty vectors or expression plasmids encoding human GITR (B) or murine 41BB (C). The transfectants were then co-cultured with HeLa-TNFR2 cells that produced IL8 in response to TNFR2 activation. The co-cultures were stimulated with the indicated concentrations of anti-TNFR 2(C4) -HC: scGITRL (B) and anti-TNFR 2(C4) -HC: sc (mu)4-1BBL (C). The next day, the production of IL8 was determined using IL 8-specific ELISA. (D) The murine GITR anchored TNFR2 stimulated TRAAFFIAA domain structure was used. (E) Cells transfected with the empty vector or the expression plasmid for murine GITR were co-cultured with HeLa-TNFR2 cells. The next day IL8 production was monitored by ELISA after stimulation with anti-TNFR 2(C4) -HC (mu) GITRL. Note that in contrast to human GITRL and all other human and murine ligands of TNFSF, murine GITRL is a dimeric molecule and interacts with two rather than three receptor molecules. Thus, a single protomer of murine GITRL was fused to the C-terminus of the heavy chain to construct a single (mu) GITRL dimer, which serves as the anchoring domain for the corresponding antibody- (mu) GITRL. Instead, scTNFSF ligands (e.g., scGITRL, sc (mu)41BBL, and scTNF80) were fused to the heavy chain as anchor domains, such that two anchor domains were produced per antibody fusion protein. Note that the three protomers of GITRL and sc (mu)41BBL in scGITRL and sc (mu)41BBL comprise only the extracellular TNF homeodomain of the full-length ligand molecule. Likewise, (mu) GITRL refers only to the THD of the murine full-length murine GITRL.
Materials and methods: such as Kums et al, mabs.2017 apr; 9(3) 506-. Transfectants were harvested and aliquots of 20000 cells were added to wells of a 96-well plate that had been seeded with HeLa-TNFR2 cells at a density of 20000 cells/well. The HeLa-TNFR2 cells produced IL8 in response to TNFR2 activation. Co-cultures were stimulated overnight with TRAAFFIAA as indicated, in triplicate, and finally assayed for production of IL8 by ELISA.
FIG. 10: the scFv fusion protein of CD40 specific antibody G28.5, anchored to the cell surface antigen CD20, enhanced stimulation of CD40 in a CD 20-dependent manner. CD 20-negative Jurkat cells and CD 20-positive BJAB cells were co-cultured with HT1080-CD40 cells, which responded to CD40, and stimulated with the indicated concentrations of anti-CD 40(G28.5) -HC: scFv: CD 20. The next day, IL8, which can be induced by CD40, was captured using ELISA. A variant of the IgG1 molecule having the N297A mutation which has ADCC activity inhibiting Fc domain in vivo was used.
The material and the method are as follows: experiments were performed in triplicate on 96-well plates. 20000 cells per well were seeded with HT1080-CD40 cells. Jurkat (CD20-) and BJAB cells (CD20+) (30000 per well) were added the next day, along with the indicated concentrations of anti-CD 40-HC: scFv: CD 20. The co-culture supernatants were finally evaluated for IL8 content by elisa (bd biosciences).
FIG. 11: anti-CD 95-IgG1 Fab of antibody E092Fragment scFv CD20 fusion protein showed enhanced induction of cell death in HT1080 cells when co-cultured with CD20 expressing cells. The CD95 sensitive cell line HT1080 was co-cultured with Jurkat (CD20 negative) cells and BJAB cells (CD20 positive). Co-cultures were treated with indicated concentrations of anti-CD 95 fusion protein anti-CD 95-Fab2-HC: scFv: CD20 that binds CD 20. The next day, viability of the adhesively grown HT1080 cells was determined by crystal violet staining.
The material and the method are as follows: experiments were performed in triplicate on 96-well plates. 20000 cells per well were seeded with HT1080 cells. Jurkat and BJAB cells (30000 per well) were then co-added with TRAAFFIAA at the indicated concentrations. Cellular activity of HT1080 was normalized by untreated HT1080 cells (═ 100% activity) and HT1080 cells treated with a highly toxic cocktail containing CHX, Velcade and Fc-CD95L (═ 0 activity).
FIG. 12: the scFv fusion protein targeting the cell surface antigen of TNFR2 specific antibody C4 enhanced stimulation of TNFR2 in an antigen-dependent manner. CD19 and CD20 negative Jurkat cells and CD19 and CD20 positive Raji cells were co-cultured with a HeLa transfectant expressing TNFR2 and stimulated with indicated concentrations of anti-TNFR 2-IgG1(N297A) -HC: CD19 (top panel) or anti-TNFR 2-IgG1(N297A) -HC: scFv: CD20 (bottom panel), respectively. The next day, the production of IL8, inducible by TNFR2, was captured using ELISA. The IgG1 variant N297A, which did not trigger ADCC, was used. The parent TNFR 2-specific mAb C4 used herein was prepared internally.
The material and the method are as follows: experiments were performed in triplicate on 96-well plates. The upper diagram: 20000 cells per well were seeded with HeLa-TNFR2 cells. The next day Jurkat (CD19-/CD20-) and RAJI cells (CD19-/CD20-) (per well 30000) were added as well as anti-TNFR 2-IgG1(N297A) -HC: scFv: CD19 (top panel) or anti-TNFR 2-IgG1(N297A) -HC: scFv: CD20 (bottom panel) at indicated concentrations. The co-culture supernatants were finally assessed for IL8 levels produced by TNFR2 activation by elisa (bd biosciences) analysis.
FIG. 13: biochemical properties of scBaff fusion proteins against CD 40G 28.5. (A) Purified anti-CD 40(G28.5) -IgG1(N297) (I), anti-CD 40(G28.5) -IgG1(N297) -HC: scBaff (II), anti-CD 40(G28.5) -FAB2(III), and anti-CD 40(G28.5) -FAB2-HC: scBaff (IV) were separated by SDS-PAGE. The proteins were then visualized by Western blotting (left panel) or silver staining (right panel) with mAb M2 that recognized the Flag epitopes present in the heavy and light chains of the various antibody fusion proteins. Note that the two strands of construct II are very similar in size and therefore cannot be separated by SDS-PAGE. (B) Gel filtration analysis of the labeled protein mixture and proteins I through IV. (C) Schematic representation of proteins I to IV.
The material and the method are as follows: antibody fusion proteins were prepared and purified as described in Kums et al, SDS-PAGE,2017, silver staining and western blotting as described in Lang et al, 2016.
Kums J,Nelke J,RüthB,
Lang I,Füllsack S,Wyzgol A,Fick A,Trebing J,Arana JA,Weisenberger D,Wajant H,Binding Studies of TNF Receptor Superfamily(TNFRSF)Receptors on Intact Cells.J
FIG. 14: IgG1(N297A) anti-CD 40G 28.5 and scBaff fusion proteins of the FAB2 variant exhibited enhanced CD40 stimulatory activity upon binding to lymphoma/myeloma cells endogenously expressing BaffR and TACI. MM1S (expressing BCMA and median TACI), L363 (expressing BCMA and median TACI), and BJAB (expressing BaffR) cells or Jurkat cells lacking expression of all Baff binding receptors were used as controls, co-cultured with HT1080-CD40 cells that did not express BaffR, BCMA, and TACI but produced IL8 strongly after CD40 stimulation. Cocultures were stimulated with anti-CD 40(G28.5) -IgG1(N297A) -HC: scBaff or anti-CD 40(G28.5) -FAB2-HC: scBaff at the indicated concentrations in triplicate. The following day, the amount of human IL8 was determined in supernatants of different co-cultures.
The material and the method are as follows: HT1080-CD40 cells were cultured overnight (20.000 cells per well) in 96-well plates. The following day, 20.000 MM1S, L363, BJAB or Jurkat cells were added per well and the resulting co-cultures were stimulated overnight in triplicate with the indicated concentrations of anti-CD 40(G28.5) -IgG1(N297A) -HC: scBaff and anti-CD 40(G28.5) -FAB2-HC: scBaff. The cell supernatants were then analyzed for IL8 production by ELISA. Note that MM1S, L363, BJAB, and Jurkat cells produced no IL8 or negligible IL8 compared to HT1080-CD40 cells.
FIG. 15: competition with soluble Baff (TNC-Baff) inhibited the production of IL8 in anti-CD 40(G28.5) -IgG1(N297A) -HC: scBaff and anti-CD 40(G28.5) -FAB2-HC: scBaff. HT1080-CD40 cells were co-cultured with MM1S (expressing BCMA and moderate TACI), L363 (expressing BCMA and moderate TACI) and BJAB (expressing BaffR) cells, with Jurkat cells as controls. Note that HT1080-CD40 and Jurkat cells do not express Baff-interacting receptors (baffR, TACI, BCMA). Co-cultures were stimulated with 200ng/ml anti-CD 40(G28.5) -IgG1(N297A) -HC: scBaff or anti-CD 40(G28.5) -FAB2-HC: scBaff in the presence and absence of excess soluble TNC-Baff (5. mu.g/ml), in triplicate. The following day, the amount of human IL8 was determined in the supernatants of the various cocultures.
The material and the method are as follows: HT1080-CD40 cells were cultured overnight (20.000 cells per well) in 96-well plates. The following day, 20.000 MM1S, L363, BJAB or Jurkat cells were added per well and the resulting co-cultures were stimulated overnight in triplicate with 200ng/ml CD40(G28.5) -IgG1(N297A) -HC: scBaff and anti-CD 40(G28.5) -FAB2-HC: scBaff in the presence and absence of soluble TNC-Baff (5. mu.g/ml), a stable form of soluble Baff containing the Tenascin-C trimerization domain (Berg et al, 2007). The cell supernatants were then analyzed for production of IL8 by ELISA. Note that MM1S, L363, BJAB, and Jurkat cells produced no IL8 or negligible IL8 compared to HT10890-CD40 cells.
Berg D,Lehne M,MüllerN,Siegmund D,Münkel S,Sebald W,Pfizenmaier K,Wajant H,Enforced covalent trimerization increases the activity of the TNFligand family members TRAIL and CD95L,Cell Death Differ.2007Dec；14(12):2021-34,
FIG. 16: adherent HT1080 cell death was induced by binding of scBaff fusion proteins against CD95 IgG 1E 09 or FAB2 fragments thereof to lymphoma/myeloma suspension cells with endogenous expression of BaffR and TACI. Adherently growing HT1080 cells were co-cultured with MM1S (expressing BCMA and moderate TACI), L363 (expressing BCMA and moderate TACI), and BJAB (expressing BaffR) suspension cells, with Jurkat cells as controls. Note that HT1080 and Jurkat cells do not express receptors that interact with Baff (BaffR, TACI, BCMA). Cocultures were stimulated with the indicated concentrations of anti-CD 95(E09) -IgG1(N297A) -HC: scBaff or anti-CD 95(E09) -FAB2-HC: scBaff in the presence of 1. mu.g/ml CHX in triplicate. The next day, cell viability was determined by crystal violet staining of the remaining attached HT1080 cells.
The material and the method are as follows: the seeding density of HT1080 cells was 20.000 cells/well. The following day, 20.000 MM1S, L363, BJAB or Jurkat suspension cells were added per well and the resulting co-cultures were stimulated overnight in triplicate with 1. mu.g/ml anti-CD 95(E09) -IgG1(N297A) -HC: scBaff or anti-CD 95(E09) -FAB2-HC: scBaff. Finally, cell death induction was determined by crystal violet staining of adherently grown HT1080 cells. Viability was normalized by untreated HT1080 cells (═ 100% viability) and HT1080 cells treated with a highly toxic mixture of 0.03% azide, 50 μ g/ml CHX, and 500ng/ml Fc-CD95L (═ 0% viability).
FIG. 17: competition with soluble Baff (TNC-Baff) inhibited anti-CD 95(E09) -IgG1(N297A) -HC: scBaff and anti-CD 95(E09) -FAB2-HC: scBaff-induced HT1080 killing in co-cultures of HT1080 cells and Baff interacting receptor expressing cells. HT1080 cells were co-cultured with MM1S (expressing BCMA and moderate TACI), L363 (expressing BCMA and moderate TACI), and BJAB (expressing BaffR) cells, with Jurkat cells as controls. Note that HT1080-CD40 and Jurkat cells do not express Baff-interacting receptors (baffR, TACI, BCMA). Co-cultures were stimulated with 1. mu.g/ml CHX in triplicate with 20ng/ml anti-CD 95(E09) -IgG1(N297A) -HC: scBaff or anti-CD 95(E09) -FAB2-HC: scBaff in the presence and absence of excess soluble TNC-Baff (5. mu.g/ml). The next day, cell viability was determined by crystal violet staining of the remaining attached HT1080 cells.
The material and the method are as follows: the seeding density of HT1080 cells was 20.000 cells/well. The next day, w0.000 MM1S, L363, BJAB or Jurkat suspension cells per well were added and the overnight co-culture stimulated with 20ng/ml anti-CD 95(E09) -IgG1(N297A) -HC: scBaff or anti-CD 95(E09) -FAB2-HC: scBaff in the presence and absence of soluble TNC-Baff (5. mu.g/ml), in triplicate. Finally, cell death induction was determined by crystal violet staining of adherently grown HT1080 cells. Viability was normalized by untreated HT1080 cells (═ 00% viability) and HT1080 cells treated with a highly toxic mixture of 0.03% azide, 50 μ g/ml CHX, and 500ng/ml Fc-CD95L (═ 0% viability). TNC-Baff is a stable form of soluble Baff that contains the trimerization domain of tenascin-C (Berg et al, 2007).
Berg D,Lehne M,Müller N,Siegmund D,Münkel S,Sebald W,Pfizenmaier K,Wajant H.,Enforced covalent trimerization increases the activity of the TNFligand family members TRAIL and CD95L,Cell Death Differ,2007Dec；14(12):2021-34。
FIG. 18: anti-CD 95(E09) -IgG1(N297A) -HC: scBaff, but not anti-CD 95(E09) -IgG1(N297A), activates apoptotic cysteine proteases in BaffR-expressing cells. BJAB cells (expressing BaffR) and Jurkat cells not expressing any Baff receptor (BaffR, TACI, BCMA) as negative controls were treated overnight with anti-CD 95(E09) -IgG1(N297A) -HC: scBaff and anti-CD 95(E09) -IgG1(N297A) at the indicated concentrations. The next day, total cell lysates were analyzed by western blotting for the production of p18 fragment of caspase-8 and p17 fragment of caspase-3, both of which are indicators of apoptotic activation of these cysteine proteases. As a positive control, Jurkat and BJAB cells, from which both lines were induced to apoptosis, were treated with 500ng/ml Fc-CD 95L.
FIG. 19: TNFR2 specific antibody C4 of IgG2 isotype scFv fusion protein anchoring the cell surface antigen CD20 enhances stimulation of TNFR2 in a CD20 dependent manner. CD 20-negative Jurkat and CD 20-positive BJAB cells were co-cultured with TNFR 2-reactive HeLa-TNFR2 cells and stimulated with indicated concentrations of anti-TNFR 2(C4) -IgG2-HC: scFv: CD 20. The next day, IL8, which can be induced via TNFR2, was measured using ELISA.
The material and the method are as follows: 20.000 HeLa-TNFR2 transfectants per well (Weiss et al, 1997) were seeded in 96-well plates. The following day, CD20 positive BJAB cells or 20.000 Jurkat cells lacking endogenously expressed CD20 as negative controls were added. The co-cultures were then treated with the indicated concentrations of anti-TNFR 2(C4) -IgG2-HC: scFvCD20, and the next day the production of IL8 was determined by ELISA.
Weiss T,Grell M,Hessabi B,Bourteele S,Müller G,Scheurich P,WajantH.v,Enhancement of TNF receptor p6-mediated cytotoxicity by TNF receptor p80:requirement of the TNF receptor-associated factor-2binding site,J Immunol,
FIG. 20: TNFR2 specific antibody C4 of IgG1 isotype scFv fusion protein anchoring the cell surface antigen CD70 enhanced stimulation of TNFR2 in a CD27L/CD70r dependent manner. (A) Structure of the fusion protein. (B, C) Hek293 cells were transfected with either empty vectors or expression plasmids encoding CD27L (or CD 70). The next day, transfectants were co-cultured with HeLa-TNFR2 transfectants that produced IL8 upon TNFR2 expression. Cocultures (C) were treated with anti-TNFR 2(C4) -IgG1(N297A) -HC: scFv: CD70(1F6) (B) or anti-TNFR 2(C4) -IgG1(N297A) -HC: scFv: CD70(2H5) at the indicated concentrations. Finally, the production of IL8 was determined by ELISA.
Materials and methods: such as Kums et al, mabs.2017 apr; hek293 cells which do not express TNFR2 or CD27L (CD70) were transiently transfected with an expression plasmid encoding CD27L (═ negative control) for Hek293 cells and FcgR expression vectors as described in (9), (3) -. Transfectants were harvested and aliquots of 20.000 cells were added to wells of a 96-well plate that had been seeded with HeLa-TNFR2 cells at a density of 20.000 cells/well the previous day. Cocultures were stimulated overnight in triplicate with TRAAFFIAA, anti-TNFR 2(C4) -IgG1(N297A) -HC: scFv: CD70(1F6) (B) and anti-TNFR 2(C4) -IgG1(N297A) -HC: scFv: CD70(2H5) (C). 2H5 and 1F6 are two different antibodies specific for human CD 70.
FIG. 21: scFv of IgG1(N297) variant of 4-1 BB-specific antibody HBBK4, CD 40-specific antibody G28.5, and CD 95-specific antibody E09 CD20 fusion protein induced the production of IL8 in HT1080-41BB, HT1080-CD40, and HT1080 (endogenously expressed CD95) cells co-cultured with CD 20-expressing cells. (A) Schematic representation of the fusion protein. (B-D) the HT1080 variants shown were co-cultured with Hek293 cells transfected with empty vector or CD20 expression plasmid. The co-cultures were then treated with indicated concentrations of IgG1(N297A) fusion protein anti-41 BB (HBBK4) -IgG1(N297A) -HC: scFv: CD20(B), anti-CD 40(B28.5) -IgG1(N297A) -HC: scFv: CD20(C) and anti-CD 95(E09) -IgG1(N297A) -HC: scFv: CD20(D) that bind CD 20. The next day, the production of IL8 was determined by ELISA. For the anti-CD 95 variant, the cystatin ZVAD was added to prevent apoptosis.
The material and the method are as follows: HT1080-41BB transfectants (Wyzgol et al, 2009), HT1080-CD40 transfectants (Wyzgol et al, 2009) and HT1080 cells (endogenously expressing CD95) were seeded at a density of 20.000 cells/well. The next day, 20.000 Hek293 cells that had been transfected with either Empty Vector (EV) or CD27L (═ CD70) expression plasmid on the previous day were added. Cocultures were stimulated overnight in triplicate with indicated concentrations of anti-41 BB (HBBK4) -IgG1(N297A) -HC: scFvCD20(B), anti-CD 40(G28.5) -IgG1(N297A) -HC: scFvCD20(C), and anti-CD 95(E09) -IgG1(N297A) -HC: scFvCD20 (D). The latter was added in the presence of 20 μ g/ml ZVAD to prevent apoptosis induction. IL8 was determined by ELISA.
Wyzgol A,Müller N,Fick A,Munkel S,Grigoleit GU,Pfizenmaier K,WajantH.,Trimer stabilization,oligomerization,and antibody-mediated cell surfaceimmobilization improve the activity of soluble trimers of CD27L,CD40L,41BBL,and glucocorticoid-induced TNF receptor ligand,J Immunol,
FIG. 22: scFv of IgG1(N297) variant of 4-1 BB-specific antibody HBBK4, CD 40-specific antibody G28.5, and CD 95-specific antibody E09 CD20 fusion protein induced enhanced IL8 production in HT1080-41BB, HT1080-CD40, and HT1080 (endogenously expressed CD95) cells co-cultured with CD 20-positive BJAB cells. (A-C) the HT1080 variants shown were co-cultured with CD20 positive BJAB cells, lacking endogenously expressed CD20 as negative controls. The co-cultures were then treated with indicated concentrations of IgG1(N297A) fusion protein anti-41 BB (HBBK4) -IgG1(N297A) -HC: scFv: CD20(A), anti-CD 40(G28.5) -IgG1(N297A) -HC: scFv: CD20(B) and anti-CD 95(E09) -IgG1(N297A) -HC: scFv: CD20(C) that bound CD 20. The next day, the production of IL8 was determined by ELISA. For the anti-CD 95 variant, the cysteamine protease inhibitor ZVAD was added to prevent apoptosis.
The material and the method are as follows: HT1080-41BB transfectants (Wyzgol et al, 2009), HT1080-CD40 transfectants (Wyzgol et al, 2009) and HT1080 cells (endogenously expressing CD95) were seeded at a density of 20.000 cells/well. The following day, BJAB cells (CD20 positive) or 20.000 Jurkat cells (CD20 negative) were added. Cocultures were stimulated overnight in triplicate with indicated concentrations of anti-41 BB (HBBK4) -IgG1(N297A) -HC: scFvCD20(A), anti-CD 40(G28.5) -IgG1(N297A) -HC: scFvCD20(B), and anti-CD 95(E09) -IgG1(N297A) -HC: scFvCD20 (C). The latter was added in the presence of 20 μ g/ml ZVAD to prevent apoptosis induction. IL8 was determined by ELISA.
Wyzgol A,Müller N,Fick A,Munkel S,Grigoleit GU,Pfizenmaier K,WajantH.,Trimer stabilization,oligomerization,and antibody-mediated cell surfaceimmobilization improve the activity of soluble trimers of CD27L,CD40L,41BBL,and glucocorticoid-induced TNF receptor ligand,J Immunol,
FIG. 23: fusion proteins of IgG1(N297A) isotype of TRAILR 2-specific antibody conatumumab (cona) with CD 70-specific scFv 9G2 enhanced stimulation of pro-inflammatory (a) and cytotoxic (B) TRAILR2 signaling in a CD 70-dependent manner. Hek293 cells transiently transfected with an expression plasmid encoding CD70 or Hek293 cells transfected with an empty vector were co-cultured with TRAILR 2-reactive HT1080 cells (no expression of CD 70). To sensitize HT1080 cells to TRAILR2 signaling, co-cultures were treated with 2.5. mu.g/ml CHX (B) or CHX plus 20. mu.M cysteine inhibitor ZVAD (A). CHX inhibits the expression of FLIP protein, a TRAILR2 signal inhibitor with high turnover rate. ZVAD prevented apoptosis and thus the gene-inducing properties of TRAILR2 could be evaluated. The co-cultures were then further treated with the indicated concentrations of anti-TRAILR 2(Cona) -IgG1(N297A) -HC: scFv: CD70(9G2) and after one day the production of IL8 was determined by ELISA (A) or the cell viability by crystal violet staining (B).
FIG. 24: fusion proteins of CD40 specific antibody C in the form of IgG1(N297A) or Fab2 with scFv derived from the checkpoint inhibitor Avelumab (Ave) targeted to PD-L1 activated CD40 in a PD-1L restricted manner. Hek293 cells transiently transfected with an expression plasmid encoding PD-1L or Hek293 cells transfected with an empty vector were co-cultured with CD 40-reactive HT1080-CD40 cells. The co-cultures were then treated with the indicated concentrations of anti-CD 40(C) -IgG1(N297A) -HC: scFv PD-L1(A) or anti-CD 40(C) -Fab2-HC: scFv: PD-L1 (B). The next day, IL8 production was measured by ELISA as a readout for CD40 activation.
FIG. 25: fusion proteins of 41 BB-specific antibody HBBK in the form of IgG1(N297A) or Fab2 with scFv derived from the checkpoint inhibitor avelumab (ave) activated 41BB in a PD-1L restricted manner. Hek293 cells transiently transfected with an expression plasmid encoding PD-1L or Hek293 cells transfected with an empty vector were co-cultured with 41BB reactive HT1080-41BB cells. The co-cultures were then treated with anti-41 BB (HBBK) -IgG1(N297A) -HC: scFv: PD-L1(A) or anti-41 BB (HBBK) -Fab2-HC: scFv: PD-L1(B) at the indicated concentrations. The next day, IL41 production was measured by ELISA as a reading of 41BB activation.
FIG. 26: fusion protein of IgG2 of the PD-1L-specific antibody Avelumab (Ave) with 41 BB-specific scFv was shown to enhance activation of 41BB in a PD-1L-restricted manner. Hek293 cells transiently transfected with an expression plasmid encoding PD-1L or Hek293 cells transfected with an empty vector were co-cultured with 41BB reactive HT1080-41BB cells. The co-cultures were then treated with anti-PD-L1 (Ave) -IgG2-HC: scFv:41BB (HBBK) at the indicated concentrations. The next day, IL41 production was measured by ELISA as a reading of 41BB activation. The examples illustrate that anti-TNFRSF receptor antibody derived scFv acquires anchor dependent agonist activity upon fusion with an antibody that recognizes a cell surface exposed antigen. Thus, TRAAFFIAA functions in principle with anti-TNFRSF receptor antibodies (as the stimulatory effector domain of the TNFRSF receptor) and scfvs (as the anchor domain), and also functions in mirror image form with antibodies (as the anchor domain) and TNFRSF receptor-specific scfvs (as the effector domain).
FIG. 27 is a schematic view showing: fusion proteins of IgG of murine CD 27-specific antibody (N297A) and Fn 14-specific scFv 18D1 showed enhanced Fn14 activation in a murine CD 27-restricted manner. Hek293 cells transiently transfected with an expression plasmid encoding murine CD27 (poor response to Fn 14) or empty vector transiently transfected Hek293 cells were co-cultured with HT1080 cells highly responsive to Fn 14. The co-cultures were then treated with anti-muCD 27-IgG1(N297A) -HC: scFv14(18D1) at the indicated concentrations. The next day, IL8 production was measured by ELISA as a reading of Fn14 activation. The examples again demonstrate that anti-TNFRSF receptor antibody derived scFv acquires anchor dependent agonist activity upon fusion with an antibody that recognizes a cell surface exposed antigen. Thus, TRAAFFIAA functions in principle with anti-TNFRSF receptor antibodies (as the stimulatory effector domain of the TNFRSF receptor) and scfvs (as the anchor domain), and also functions in mirror image form with antibodies (as the anchor domain) and TNFRSF receptor-specific scfvs (as the effector domain).
Detailed Description
Definitions and general techniques
Unless defined otherwise below, terms used in the present invention should be understood according to the general meaning known to those skilled in the art.
All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
As used herein, "sctfsf" refers to a single chain form of a functional (meaning receptor binding) TNFSF ligand. Typically, one sctfsf comprises a receptor binding domain of a TNFSF protomer of three units, wherein the units are joined by a polypeptide linker and form an intramolecular trimer.
The term "antibody" as used herein refers to any functional antibody that specifically binds to an antigen of interest, such as Paul, W.E, (Ed.)
The nomenclature of the antibody domains follows those known in the art. As is well known in the art, each monomer of an antibody comprises two heavy chains and two light chains. Wherein each of the heavy and light chains comprises a variable domain (referred to as V for the heavy chain)HReferred to as V for the light chainL) This is important for antigen binding. These heavy and light chain variable domains comprise (in N-terminal to C-terminal order) the regions FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4(FR, framework regions; CDR, complementarity determining regions, also known as hypervariable regions). The identification and assignment of the above-described antibody regions within an antibody sequence is generally according to the methods of Kabat et al (Sequences of proteins of immunological interest, U.S. Dept. of Health and Humanservices, Public Health Service, National Institutes of Health, Bethesda, Md.1983) or Chothia et al (formats of immunological competencin hydrologics, Nature,1989 Dec 21-28; 342(6252): 877-83), or may be by using the methods described in Giudelli et al (IMGT/V-QUEST, an integrated software program for immunological expression and cell retrieval)or V-J and V-D-J rearraring analysis, Nucleic Acids Res.2004
A "monoclonal antibody" is an antibody from a substantially homogeneous population of antibodies, wherein the antibodies are substantially identical in sequence (i.e., except for a small portion of the antibodies that contain naturally occurring sequence modifications, e.g., amino acid modifications at their N-and C-termini). Unlike polyclonal antibodies, which comprise a mixture of different antibodies directed against a single epitope or against many different epitopes, monoclonal antibodies are directed against the same epitope and therefore have a high specificity. The term "monoclonal antibody" includes, but is not limited to, antibodies obtained from a monoclonal cell population derived from a single cell clone, e.g., by
A "humanized antibody" is an antibody comprising a human sequence and a small portion of a non-human sequence that confers binding specificity to an antigen of interest. Typically, humanized antibodies are generated by replacing the hypervariable region sequences of a human recipient antibody with the hypervariable region sequences of a non-human donor antibody (e.g., a mouse, rabbit, rat donor antibody) that binds the antigen of interest. In some cases, the framework region sequences of the acceptor antibody may also be replaced by the corresponding sequences of the donor antibody. In addition to sequences derived from the donor and acceptor antibodies, a "humanized antibody" may or may not contain other (additional or alternative) residues or sequences. Such other residues or sequences may be used to further improve antibody properties, such as binding properties (e.g., lowering Kd values) and/or immunogenic properties (e.g., lowering antigenicity in humans). Non-limiting examples of methods for generating humanized antibodies are known in the art, e.g., from Riechmann et al (Nature,1988 Mar 24; 332(6162):323-7) or Jones et al (Nature,1986 May 29-
The term "human antibody" refers to antibodies comprising human variable and constant domain sequences. This definition encompasses antibodies having a single amino acid substitution or modified human sequence, which can be used to further improve antibody properties, such as binding properties (e.g., lowering Kd values) and/or immunogenic properties (e.g., lowering antigenicity in humans). The term "human antibody" does not include humanized antibodies that are part of a non-human sequence that confers binding specificity to an antigen of interest.
As used herein, an "antigen-binding portion" of an antibody refers to the portion of an antibody that retains the ability of the antibody to specifically bind to an antigen. The ability can be determined, for example, by determining the ability of the antigen-binding portion to specifically bind to an antigen of an antibody by methods known in the art. The antigen-binding portion may comprise one or more fragments of an antibody. Without particular limitation, the antigen-binding portion may be produced by any suitable method known in the art, including recombinant DNA methods and by chemical or enzymatic fragment preparation of antibodies. The antigen binding portion can be a Fab fragment, a F (ab') fragment, a Fab2A fragment, single chain antibody (scFv), single domain antibody, diabody, or any other portion of an antibody that retains the anti-infective ability of the antibody specifically binds to an antigen. It is understood that the term "Fab" is used according to the knowledge in the art2Meaning of "the term" Fab2"and the terms" Fab2 "," Fab2"and" FAB2 "are synonymous. Thus, for the purposes of this application, the term "
An "antibody" (e.g., a monoclonal antibody) or "antigen-binding portion" may have been derivatized or linked to a different molecule. For example, molecules that can be linked to antibodies are other proteins (e.g., other antibodies), molecular markers (e.g., fluorescent, luminescent, colored, or radioactive molecules), agents. The antibody or antigen-binding portion may be linked directly (e.g., in the form of a fusion between two proteins), or via a linker molecule (e.g., any suitable type of chemical linker known in the art).
In connection with the present invention including the fusion protein of the present invention, the meaning of "anti-TNFRSF receptor antibody or antigen-binding portion thereof" is not particularly limited as long as it is an antibody against at least one TNFRSF receptor or antigen-binding portion thereof. In a preferred embodiment according to all other embodiments of the present invention, the anti-TNFRSF receptor antibody or antigen-binding portion thereof may be an anti-TNFRSF receptor antibody or antigen-binding portion thereof directed against a single type of TNFRSF receptor. In another preferred embodiment according to all other embodiments of the present invention, said anti-TNFRSF receptor antibody or antigen binding portion thereof may be a bivalent anti-TNFRSF receptor antibody or antigen binding portion thereof directed against two different types of TNFRSF receptors.
The term "binding" as used herein refers to specific binding to an antigen of interest. Preferably, the Kd value is less than 100nM, more preferably less than 50nM, even more preferably less than 10nM, even more preferably less than 5nM, and most preferably less than 2 nM.
The term "epitope" as used herein refers to a small portion of an antigen that forms the binding site of an antibody.
In the context of the present invention, for the purpose of characterizing the binding properties of an antibody or antibody fusion protein, the antibody of the invention or said fusion protein (e.g. TRAAFFIAA) binds or competitively binds any antigen of interest or Fc γ R or said structure of said cell surface or said extracellular matrix, preferably using a luciferase-labelled (e.g. gauss apinaceps luciferase (GpL)) antibody or a variant of a fusion protein, as determined by cell binding studies (e.g. as described in Kums et al, MAbs,2017 Apr; 9(3): 506-.
The term "KD"or" KDThe value "refers to the equilibrium dissociation constant known in the art. In the context of the present invention, these terms refer to the equilibrium dissociation constant of an antibody or fusion protein of the invention (e.g., TRAAFFIAA) relative to a particular antigen of interest or Fc γ R of interest or relative to the structure of the cell surface or extracellular matrix. The equilibrium dissociation constant is a measure of the tendency of a complex (e.g., an antigen-antibody complex) to reversibly dissociate into its components (e.g., antigen and antibody). For the antibodies or fusion proteins according to the invention, KDThe value is preferably determined by intracellular competitive binding studies or surface plasmon resonance of GpL-labeled variants of the antibodies or fusion proteins (e.g., TRAAFFIAA) and unmodified antibodies or fusion proteins of interest (e.g., TRAAFFIAA).
As used herein, the term "capable of cross-competing with an antibody" to bind to a particular protein, such as a TNFRSF receptor, in conjunction with the antibody or antigen-binding portion thereof of the present invention generally means that the antibody or antigen-binding portion thereof is capable of cross-competing using an assay known in the art, such as an enzyme-linked immunosorbent assay (ELISA). As known in the art, it is understood that the term "capable of cross-competing with an antibody" refers to cross-competition with specific binding to the particular protein. One skilled in the art will be able to determine appropriate conditions for detecting such cross-competition for specific binding.
As used herein, an "isolated antibody" or "isolated TRAAFFIA" or "isolated fusion protein" has been identified and isolated from a majority of the components (by weight) of the environment from which it was derived, e.g., components from a hybridoma cell culture or a different cell culture used for production (e.g., producer cells, e.g., CHO or HEK293 cells, recombinantly expressing the antibody or fusion protein (e.g., TRAAFFIA)). The isolation is performed in order to substantially remove components that may interfere with the desired use for which the antibody or fusion protein (e.g. TRAAFFIA) is suitable (e.g. the therapeutic use of the antibody or fusion protein (e.g. TRAAFFIA) according to the invention). Methods for preparing isolated antibodies or antibody fusion proteins are known in the art and include protein a chromatography, anion exchange chromatography, cation exchange chromatography, virus retention filtration, and ultrafiltration. Preferably, the isolated antibody or fusion protein (e.g., TRAAFFIA) preparation is at least 70% pure (w/w), more preferably at least 80% pure (w/w), even more preferably at least 90% pure (w/w), even more preferably at least 95% pure (w/w), and most preferably at least 99% pure (w/w), as determined by the Lowry protein assay.
As used herein, a "diabody" is a small portion of a bivalent antigen-binding antibody that comprises a heavy chain variable domain that is linked to a light chain variable domain on the same polypeptide chain by a peptide linker that is too short to pair the two domains on the same chain. This results in pairing with the complementary domain of the other chain and assembly of a dimeric molecule with two antigen binding sites. Diabodies can be bivalent and monospecific (e.g., diabodies having two binding sites for the same antigen) or bivalent and bispecific (e.g., diabodies having two antigen binding sites, one binding site for an antigen and the other binding site for another antigen). A detailed description of Diabodies can be found in Holliger P et al ("Diabodies": small bivalents and bispecific fragments ", Proc Natl Acad Sci U S A.1993
As used herein, a "single domain antibody" (also referred to as a "nanobody")(s)TM") is an antibody fragment consisting of a single monomeric variable antibody domain. Structures and methods for producing Single Domain antibodies are known in the art, for example Holt LJ et. ("Domain antibodies: proteins for therapy." Trends Biotechnol.2003 Nov; 21(11):484-90), Saerens D et al. ("Single-Domain antibodies as building blocks for novel therapeutics." Curr Optin Pharmacol.2008 Oct., "8 (5):600-8.Epub 2008 Aug22), and Arbat Ghaudi M. (" Selection and identification of Single Domain antibodies from domains mutant chains of "antibodies Lett. 19915; Sep. 521) (6-521).
The "fusion protein" related to the present invention herein is not limited to a specific type of fusion protein as long as the parts of the fusion protein are fused by covalent bonds. For example, portions of the fusion protein may be fused by covalent linkage via expression in one or more single polypeptide chains, via one or more disulfide bonds, via chemical coupling (preferably via chemical coupling using click chemistry), and/or via any other suitable protein linkage known in the art. Preferably, the parts of the fusion protein are fused by expression in one or more single polypeptide chains and/or by one or more disulfide bonds. Thus, in the fusion proteins of the present invention, the anti-TNFRSF receptor antibody or antigen binding portion thereof, and the domain capable of binding to a cell surface structure and/or to a structure of the extracellular matrix in an Fc γ R independent manner, can be fused by expression in one or more single polypeptide chains, by one or more disulfide linkages, by chemical coupling (preferably chemical coupling using click chemistry), and/or by any other covalent linkage known in the art suitable protein linkage. Preferably, the anti-TNFRSF receptor antibody or antigen binding portion thereof is fused to a domain capable of binding to a cell surface structure and/or to a structure of the extracellular matrix in an Fc γ R independent manner, by expression in one or more single polypeptide chains and/or by one or more disulfide bonds. In all embodiments of the invention, the domain that binds to a cell surface structure and/or an extracellular matrix structure in an Fc γ R independent manner comprises:
-an antigen binding portion of an antibody, which is capable of binding to said structures of the cell surface and/or said structures of the extracellular matrix, wherein said antigen binding portion capable of binding to said structures of the cell surface and/or extracellular matrix is an antigen binding portion with reduced ability to bind to one or more fcyr types, which is a Fab2 fragment; or
-a full length antibody capable of binding to said structure of the cell surface and/or to said structure of the extracellular matrix;
very preferably, said anti-TNFRSF receptor antibody or antigen binding portion thereof is fused to said domain by chemical coupling, preferably chemical coupling using click chemistry.
In general, with respect to all fusion proteins of the present invention, it is understood that portions of the fusion protein (e.g., an anti-TNFRSF receptor antibody or antigen binding portion thereof and a domain capable of binding to the cell surface structure or the extracellular matrix structure in an Fc γ R independent manner) may be fused via a linker sequence. In such a case, the fusion protein of the invention will comprise such a linker sequence. Suitable linker sequences are known in the art and include, for example, peptide linkers, but are not limited thereto. For example, in the fusion protein of the anti-TNFRSF receptor antibody or antigen-binding portion thereof fused by expression in one or more single polypeptide chains according to the present invention and a domain capable of binding to the cell surface structure or the extracellular matrix structure in an Fc γ R-independent manner, the one or more single polypeptide chains may comprise one or more peptide linker sequences between the anti-TNFRSF receptor antibody or antigen-binding portion thereof and the domain capable of binding to the cell surface structure or the extracellular matrix structure in an Fc γ R-independent manner.
For the purposes of the present invention, the term "domain capable of binding in an Fc γ R independent manner to a structure of the cell surface or to a structure of the extracellular matrix" means that said domain is capable of binding to a structure of the cell surface and/or to a structure of the extracellular matrix which is different from Fc γ R. Unless otherwise stated, the possibility is not excluded that said domain may also comprise other moieties capable of binding to Fc γ R (e.g. Fc domains).
Each occurrence of the term "comprising" may optionally be replaced by the term "consisting".
Methods and techniques
Generally, unless otherwise defined herein, methods (e.g., cloning methods or methods related to antibodies) used in the present invention are performed according to methods known in the art, e.g., Sambrook et al ("molecular cloning: A Laboratory Manual", 2)ndEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 1989), Ausubel et al ("Current Protocols in molecular biology," Green Publishing Associates and Wiley Interscience; new York 1992) and Harlow and Lane ("Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 1988), all of which are incorporated herein by reference.
The binding of fusion proteins and domains thereof to their respective target proteins can be assessed by methods known in the art. The binding is preferably assessed by surface plasmon resonance measurement.
According to the present invention, sequences are aligned by using the BLAST algorithm (see Altschul et al (1990) "Basic local alignment search tool." Journal of Molecular biology 215.p.403-410.; Altschul et al.: 1997) Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. nucleic acids Res.25:3389-3402, which are all incorporated herein by reference). Preferably, the following parameters are used:
According to the present invention, antibody fusion proteins can be produced by any method known in the art, including but not limited to the methods mentioned in Siegel DL ("Recombinant monoclonal antibody technology" -transfuss Clin biol.2002Jan; 9(1):15-22, which is incorporated herein by reference).
Stimulation of TNFRSF receptors can be determined by any method known in the art. For example, where the TNFRSF receptor is TNFR2, CD40, CD95, Fn14, secreted IL8 can be detected by using a cell-based IL8 secretion assay, followed by ELISA. Non-limiting examples of cells that can be used in such cell-based IL8 secretion assays are HT1080 CD40 transfectants (useful for assaying CD40 stimulation), Widr cells (useful for assaying Fn14 stimulation), H1080-cells (useful for assaying CD95 stimulation), and HeLa transfectants expressing TNFR2 (useful for assaying TNFR2 stimulation). Non-limiting examples of such assays can be found in examples 1-3 and corresponding figures. For TNFRSF receptors that have a cytotoxic effect when stimulated, such as CD95, a cell permeable cysteine protease inhibitor such as ZVAD is preferably added to the assay to prevent induction of cell death. Stimulation of various TNFRSF receptors by fusion proteins of the invention (e.g., TRAAFFIAAS) may also be detected by any of the methods that detect stimulation of the classical nfkb pathway (e.g., phosphorylation and degradation of I κ B α, IKK activation, phosphorylation and nuclear translocation of p65, detection of target genes) or stimulation of the nfkb alternative pathway (e.g., p100 degradation, NIK accumulation). TRAAFFIAA the stimulatory effects on CD95 and TRAIL death receptors (DR4, DR5) can also be assessed by various assays for cell death induction. Stimulation of CD40 by TRAAFFIA can be further assessed by determining the degree of maturation of dendritic cells.
Preparation of the compositions of the invention
The compositions according to the invention are prepared according to known standards for the preparation of pharmaceutical compositions.
For example, the compositions are prepared in such a way that they can be suitably stored and administered, e.g., by addition of pharmaceutically acceptable components such as carriers, excipients, or stabilizers.
Such pharmaceutically acceptable components are non-toxic with respect to the amount used when the pharmaceutical composition is administered to a patient. The pharmaceutically acceptable component added to the pharmaceutical composition may depend on the particular intended use and route of administration of the pharmaceutical composition.
Generally, pharmaceutically acceptable components for use in the present invention are used according to the knowledge available in the art, e.g. from Remington's Pharmaceutical Sciences, ed.ar Gennaro,20thedition,2000,Williams&Wilkins,PA,USA。
Sequence of
As used herein, the amino acid sequence is presented in N-terminal to C-terminal order in the single letter amino acid code. The nucleotide sequences used herein are represented in 5 'to 3' order by standard nucleic acid codes. Asterisks indicate the ends of the protein sequence. The underlined nucleic acid sequence represents a restriction endonuclease site.
The following non-limiting exemplary sequences are used in the examples of the present application:
table 1:
1 anti-CD 40-Flag-VH-heaviy-full-scTNF 80(mu) -pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattcgagttcacacgggacaaacctgtggctcatgtggtggccaatcatcaggtggaggaacagctggaatggctgagtcagagagcaaacgccctgctggcaaatgggatggacctcaaagacaatcagctcgtggtgcctgccgatggactgtacctggtgtactctcaggtcctgtttaagggacagggatgccccgattacgtgctgctcacccacactgtgtcacgcttcgccatctcataccaggagaaagtcaatctcctctccgccgtgaaatcaccatgtcctaaggatactcccgagggagccgaactgaaaccttggtacgaacccatctacctgggcggcgtgtttcagctggagaaaggcgatcagctctccgccgaagtgaatctgcccaaatacctcaactttagggaatccggacaggtctactttggcgtgattgccctgggaggcggatctggaggaggctctggcgggggatctgggggcggatccgacaaacctgtggcacacgtcgtggcaaaccatcaggtcgaggaacagctcgagtggctgtcacagagggccaatgccctgctggcaaatggaatggatctgaaggataatcagctcgtcgtgcctgccgacggcctctacctcgtctactctcaggtcctctttaagggacagggctgccccgactacgtcctgctcactcataccgtgagtcgcttcgctatttcataccaggaaaaagtcaacctgctgagtgctgtgaaatctccttgccctaaggatacccctgagggagccgaactcaaaccatggtacgagccaatctacctcggaggagtgtttcagctggaaaaaggggatcagctctccgccgaagtcaacctccccaaatacctcaatttccgggaatccggacaggtgtactttggagtcattgccctgggaggcggctctggcgggggatctggaggaggctccggaggaggcagtgacaaacccgtcgctcacgtggtggcaaatcatcaggtcgaggaacagctggaatggctgtctcagagagcaaacgctctcctcgccaatggaatggatctcaaggacaaccagctcgtcgtccctgccgatggactctacctggtctactctcaggtgctctttaagggacagggatgccccgattacgtcctgctcacacacaccgtgtctcgctttgctatttcataccaggagaaagtcaatctgctgtctgccgtcaaatctccttgtccaaaagacacacccgagggagccgaactcaaaccttggtacgagccaatctacctggggggagtgtttcagctggagaagggggatcagctctccgccgaagtgaatctcccaaaatacctcaattttcgggaatccggacaggtctactttggagtgattgccctgtag
protein construct expressed by SEQ ID NO 19: SEQ ID NO 1:
2 anti-CD 40-Flag-VH-heavy-full-pCR3(hIgG1):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccctgaactgctgggcggaccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagtacaacagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcctcccagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctacccctccgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagtaa
20 SEQ ID NO:2:
3 anti-CD 40-Flag-VH-heaviy-full-scFv-anti-CD 20-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattccaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaAatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagCcaggatcctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggcgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaGgggggaccaagctggaaatcaaacgttaa
protein construct expressed by SEQ ID NO 21: SEQ ID NO 3:
4 anti-CD 40-Flag-VH-heavy-full-scBaff-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgagggacccgaggaaactgtgactcaggactgtctccagctcattgccgatagtgaaacccctaccatccagaaaggctcttacaccttcgtgccatggctgctgtcattcaaacggggatctgctctggaggagaaggaaaacaaaatcctggtcaaggaaaccggctacttcttcatctacggccaggtcctctacaccgacaaaacatacgctatggggcatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtattcagaacatgcccgagactctgcccaataatagctgctactctgctggcattgccaaactggaggagggcgacgaactccagctggctattcctagggaaaatgcccagattagcctggacggggatgtgacattttttggcgccctgaaactgctgggaggcggagggagtggcgggggaggctctggacctgaggaaactgtgacccaggattgtctccagctcattgccgatagtgagactcctaccattcagaagggatcttacacctttgtgccttggctgctgtctttcaaacggggctctgctctggaggaaaaggagaacaaaattctggtcaaagagactggctacttcttcatctacggccaggtgctgtacaccgacaaaacatacgccatgggccatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtatccagaacatgcccgagacactgcccaataatagctgctactctgccggcattgctaaactggaggagggggacgaactccagctggctattcctagggaaaatgcccagatttctctcgatggggatgtgacattcttcggggccctcaaactgctgggaggcggcggatctggcggaggcgggagtcaattcgcagcaggtccagaagaaacagtcactcaagactgcttgcaactgattgcagacagtgaaacaccaactatacaaaaaggatcttacacatttgttccatggcttctcagctttaaaaggggaagtgccctagaagaaaaagagaataaaatattggtcaaagaaactggttacttttttatatatggtcaggttttatatactgataagacctacgccatgggacatctaattcagaggaagaaggtccatgtctttggggatgaattgagtctggtgactttgtttcgatgtattcaaaatatgcctgaaacactacccaataattcctgctattcagctggcattgcaaaactggaagaaggagatgaactccaacttgcaataccaagagaaaatgcacaaatatcactggatggagatgtcacattttttggtgcattgaaactgctgtga
22 SEQ ID No. 4 protein construct expressed in SEQ ID NO:
5 anti-CD 40-Flag-VL-light-full-pCR3:
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggacatcgtgatgactcagaacccactgtctctgcctgtgtctctgggggatgaggctagcatttcttgccgctcatctcagtcactggagaactccaatggcaacaccttcctgaattggtttttccagaaacccggccagtcacctcagctgctcatctaccgagtgagcaatcggtttagcggagtgcccgatcgattctctggctccggatctgggaccgactttaccctgaaaatctcacgagtggaggccgaggatctgggagtgtacttctgtctccaggtcacacatgtgccttacacatttggcggcggaacaactctcgaaatcaaaggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
23 SEQ ID No. 5 protein construct expressed in SEQ ID NO:
6: C4-HC-full-IL2(mu) -pCR3(hIgG1) (NO Flag):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccctgaactgctgggcggaccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagtacaacagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcctcccagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctacccctccgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattgcccggtaccgcccctaccagcagcagcacctctagctctacagccgaggctcaacaacaacaacaacagcaacagcagcagcagcagcacctggaacagctgctgatggacctgcaggaactgctgagccggatggaaaactaccggaacctgaagctgccccggatgctgaccttcaagttctacctgcccaagcaggccaccgagctgaaggatctgcagtgcctggaagatgagctgggccccctgagacacgtgctggatctgacccagagcaagagctttcagctggaagatgccgagaacttcatcagcaacatcagagtgaccgtcgtgaagctgaagggcagcgacaacaccttcgagtgccagttcgacgacgagagcgctaccgtggtggacttcctgcggagatggatcgccttctgccagagcatcatcagcaccagcccccagtaa
24: 6 expression of the protein construct of SEQ ID NO:
7: C4-HC-heavy-konst-full-scFv-anti-CD 19-pCR3(N297A) (NO Flag):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattcgacattcagatgacgcagtctccatcctccatgtctgtatctctgggagacacagtcagcatcacttgccatgcaagtcagggcattagcagtaatatagggtggttgcagcagaaaccagggaaatcatttaagggcctgatctatcatggaaccaacttggaagatggagttccatcaaggttcagtggcagtggatctggagcagattattctctcaccatcagcagcctggaatctgaagattttgcagactattactgtgtacagtatgctcagtttccgtacacgttcggaggggggaccaagctggagctgaaacgtggtggtggtggttctggtggtggtggttctggcggcggcggctccagtggtggtggatcccaggttcagctgcagcaatctggacctgagctggtgaagcctggggcctcagtgaagatttcctgcaaagcttctggctacgcattcagtagctcttggatggactgggtgaagcagaggcctggacagggtcttgagtggattggacggatttatcctggagatggagatactaactacaatgggaagttcaagggcaaggccacactgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacctctgtggactctgcggtctatttctgtgcaaggtccattactacggtagtagggtggtacttcgatgtctggggcgcagggaccacggtcaccgtttcctcctaa
protein construct expressed by SEQ ID NO 25: SEQ ID NO 7:
8: C4-HC-heavy-konst-full-scFv-anti-CD 20-pCR3(N297A) (NO Flag):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattccaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaaatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagccaggaccctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggctgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaggggggaccaagctggaaatcaaacgttaa
26 SEQ ID NO. 8 protein construct:
9: C4-HC-heavy-full-pCR3(IgG1) (NO Flag):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccctgaactgctgggcggaccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagtacaacagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcctcccagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctacccctccgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagtaa
protein construct expressed by SEQ ID NO 27: 9:
SEQ ID NO:10:C4-HC-heavy-full-scGITRL-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattcggcggagggagcggacagctggaaactgccaaagaaccctgtatggccaaattcggaccactgcctagcaaatggcagatggctagtagcgaacctccatgtgtgaacaaagtgagcgattggaaactcgagatcctccagaatggactgtacctcatctacggacaggtcgccccaaatgccaattacaatgatgtggccccctttgaagtccggctctacaaaaacaaggatatgatccagaccctcaccaacaaatccaaaatccagaatgtgggcggcacatacgaactccatgtcggcgataccatcgatctcattttcaactctgaacaccaggtgctcaaaaacaacacctactggggaatcatcctgctggcaaaccctcagttcatctccggcggcggctctggcggcggatctggcggagggagtggcggaggctcacagctggagactgctaaagaaccctgtatggcaaaattcgggcccctgccctcaaaatggcagatggcctcctctgaaccaccctgtgtgaacaaagtgagtgattggaaactggaaatcctccagaacggcctctacctcatctacggacaggtggcacccaatgccaattacaacgacgtggcacccttcgaagtgagactgtacaaaaacaaggatatgatccagaccctcaccaacaaatcaaaaatccagaatgtcggagggacatacgaactccatgtgggagacactatcgacctcattttcaattccgaacatcaggtcctgaaaaacaacacttactggggcattattctgctcgccaatccacagtttattagtggaggcgggggatctgggggaggctccggcggagggagtggaggcggatctcaattccaattagagactgctaaggagccctgtatggctaagtttggaccattaccctcaaaatggcaaatggcatcttctgaacctccttgcgtgaataaggtgtctgactggaagctggagatacttcagaatggcttatatttaatttatggccaagtggctcccaatgcaaactacaatgatgtagctccttttgaggtgcggctgtataaaaacaaagacatgatacaaactctaacaaacaaatctaaaatccaaaatgtaggagggacttatgaattgcatgttggggacaccatagacttgatattcaactctgagcatcaggttctaaaaaataatacatactggggtatcattttactagcaaatccccaattcatctcctag
28 SEQ ID NO:10 expression protein construct:
SEQ ID NO:11:C4-HC-heavy-full-sc(mu)41BBL-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattcggcggtggaagtggtactgaaccgcgacccgctctcactataaccaccagccctaacttgggaacgcgggagaataacgcggatcaagtaaccccagtttcccatatcgggtgtccaaataccactcaacaaggatcaccggtctttgctaagctcctggcgaaaaaccaagcgtccctctgtaatacaacccttaattggcactcccaagatggggcgggttcttcatacctctcacaggggctccgatacgaagaagacaaaaaggagttggtggtcgactcaccaggactttactatgtattcctggagttgaagctctctcctacattcaccaataccggtcacaaagtacagggttgggtgagccttgtgctccaggcgaagccgcaggtggacgacttcgacaaccttgcactcactgtagagctgttcccttgttccatggagaataaattggtggaccgctcttggagtcagctcctcctcctcaaggcgggtcatcgattgagcgttggccttcgggcatatcttcatggggcgcaagatgcataccgcgattgggaattgtcataccccaacacgacctcttttggcctgtttctggtcaaacccgacaatccgtgggaaggtgggggaagcggagggggttcaggaggaggatctgggggaggttcaactgaaccgaggcccgcgcttactatcacgacttccccaaatctggggactagggaaaacaatgccgatcaggtcactcctgttagtcacattggttgtcctaatacgacccagcaaggctctccggtgtttgccaaactgttggccaaaaatcaggcgtcactttgtaatacaacgctcaactggcatagtcaggatggggccggctcctcatacttgtctcaaggtcttaggtacgaagaagataagaaggagctggtggtagacagccccgggctctactatgtgttcctggagctcaaactgtcaccgacgttcactaacaccggtcataaggtacagggttgggtatccttggtgttgcaagcaaaaccccaggtggacgatttcgataatcttgcgcttactgtagagctctttccatgttcaatggaaaataaactggtcgataggagctggtcccaacttctccttcttaaagctggccatcgcctgagtgttggcctgagagcgtatcttcatggggcgcaggacgcttaccgggattgggaactgtcatacccaaacaccaccagctttgggctcttccttgtaaagccagacaatccgtgggaggggggaggcgggagtgggggcgggtctggagggggcagtggggggggtagtacggagccgcgccccgccctgaccatcacaacgtcacccaatcttgggactcgggagaataacgccgaccaggttacccctgtatcccatatcggttgtcctaatacgacacaacaaggcagtcctgtattcgctaaactcttggcaaaaaaccaggccagtctttgtaatacgacgcttaattggcatagccaggacggtgcgggcagctcctacctttcccaggggctcaggtatgaagaagataagaaagaactcgttgtagacagtcccggattgtattacgtttttttggaactcaagctctctccaaccttcaccaatacgggacataaggtccagggctgggtgagcctcgtactccaggctaagccgcaagttgacgatttcgataatctcgctcttacagtggagttgtttccctgtagtatggagaataagctcgtcgaccggtcttggagccaacttctgctgcttaaggctggtcaccggctcagtgtaggcctccgagcgtatttgcatggggcgcaggacgcctatcgagactgggagctttcctaccctaacacgaccagctttggactcttcttggtgaaacctgacaatccgtgggaataa
29: SEQ ID No. 11 expression protein construct:
SEQ ID NO:12:C4-HC-heavy-full-(mu)GITRL-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattcccaactgccatcgagtcctgcatggttaagtttgaactatcatcctcaaaatggcacatgacatctcccaaacctcactgtgtgaatacgacatctgatgggaagctgaagatactgcagagtggcacatatttaatctacggccaagtgattcctgtggataagaaatacataaaagacaatgcccccttcgtagtacagatatataaaaagaatgatgtcctacaaactctaatgaatgattttcaaatcttgcctataggaggggtttatgaactgcatgctggagataacatatatctgaagttcaactctaaagaccatattcagaaaactaacacatactgggggatcatcttaatgcctgatctaccattcatctcttag
30 SEQ ID No. 12 protein construct:
13: C4-LC-light-full-pCR3 (NO Flag):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggacattgtgatgacccagtctcacaaattcatgtccacatcagtaggagacagggtcagcatcacctgcaaggccagtcaggatgtggatactgctgtagcctggtatcaacaaaaaccagggcaatctcctaaactactgatttactgggcatccacccggcacactggagtccctgatcgcttcacaggcagtggatctgggacagattatactctcaccatcagcagtgtgcaggctgaagacctggcgcgttattactgtcagcaatattatagtgttcctccgacgttcggtggaggcaccaagctgggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
31 SEQ ID No. 13 protein construct expressed in SEQ ID NO:
14 anti-CD 95(E09) -Flag-VH-full-scFv-anti-CD 19-pCR3(IgG1):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccagatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccctgaactgctgggcggaccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagtacaacagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcctcccagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctacccctccgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgaggacattcagatgacgcagtctccatcctccatgtctgtatctctgggagacacagtcagcatcacttgccatgcaagtcagggcattagcagtaatatagggtggttgcagcagaaaccagggaaatcatttaagggcctgatctatcatggaaccaacttggaagatggagttccatcaaggttcagtggcagtggatctggagcagattattctctcaccatcagcagcctggaatctgaagattttgcagactattactgtgtacagtatgctcagtttccgtacacgttcggaggggggaccaagctggagctgaaacgtggtggtggtggttctggtggtggtggttctggcggcggcggctccagtggtggtggatcccaggttcagctgcagcaatctggacctgagctggtgaagcctggggcctcagtgaagatttcctgcaaagcttctggctacgcattcagtagctcttggatggactgggtgaagcagaggcctggacagggtcttgagtggattggacggatttatcctggagatggagatactaactacaatgggaagttcaagggcaaggccacactgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacctctgtggactctgcggtctatttctgtgcaaggtccattactacggtagtagggtggtacttcgatgtctggggcgcagggaccacggtcaccgtttcctcctaa
32 SEQ ID No. 14 protein construct:
15 anti-CD 95-E09-Flag-VH-heavy-full-pCR3(IgG1):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccagatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccctgaactgctgggcggaccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagtacaacagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcctcccagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctacccctccgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagtaa
33 SEQ ID No. 15 protein construct expressed in SEQ ID NO:
16 anti-CD 95(E09) -Flag-VH-FAB2(1-114) -scFv-anti-CD 20-pCR3(IgG1):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgccctcgagcaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaaatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagccaggatcctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggctgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaggggggaccaagctggaaatcaaacgttaa
protein construct expressed by SEQ ID NO. 34 SEQ ID NO. 16:
17 anti-CD 95-E09-Flag-VH-heavy-full-scBaff-pCR3(N297A):
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgagggacccgaggaaactgtgactcaggactgtctccagctcattgccgatagtgaaacccctaccatccagaaaggctcttacaccttcgtgccatggctgctgtcattcaaacggggatctgctctggaggagaaggaaaacaaaatcctggtcaaggaaaccggctacttcttcatctacggccaggtcctctacaccgacaaaacatacgctatggggcatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtattcagaacatgcccgagactctgcccaataatagctgctactctgctggcattgccaaactggaggagggcgacgaactccagctggctattcctagggaaaatgcccagattagcctggacggggatgtgacattttttggcgccctgaaactgctgggaggcggagggagtggcgggggaggctctggacctgaggaaactgtgacccaggattgtctccagctcattgccgatagtgagactcctaccattcagaagggatcttacacctttgtgccttggctgctgtctttcaaacggggctctgctctggaggaaaaggagaacaaaattctggtcaaagagactggctacttcttcatctacggccaggtgctgtacaccgacaaaacatacgccatgggccatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtatccagaacatgcccgagacactgcccaataatagctgctactctgccggcattgctaaactggaggagggggacgaactccagctggctattcctagggaaaatgcccagatttctctcgatggggatgtgacattcttcggggccctcaaactgctgggaggcggcggatctggcggaggcgggagtcaattcgcagcaggtccagaagaaacagtcactcaagactgcttgcaactgattgcagacagtgaaacaccaactatacaaaaaggatcttacacatttgttccatggcttctcagctttaaaaggggaagtgccctagaagaaaaagagaataaaatattggtcaaagaaactggttacttttttatatatggtcaggttttatatactgataagacctacgccatgggacatctaattcagaggaagaaggtccatgtctttggggatgaattgagtctggtgactttgtttcgatgtattcaaaatatgcctgaaacactacccaataattcctgctattcagctggcattgcaaaactggaagaaggagatgaactccaacttgcaataccaagagaaaatgcacaaatatcactggatggagatgtcacattttttggtgcattgaaactgctgtga
35 SEQ ID NO:17:
18 anti-CD 95-E09-Flag-VL-light-full-pCR3:
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagagcgtgctgacccagcctcctagcgtgtccgaagcccctagacagaccgtgaccatcagctgctccggcaacagcttcaacatcggcagataccccgtgaactggtatcagcagctgccaggcaaggcccctaaactgctgatctactataacaacctgcggttcagcggagtgtccgaccggttctctggcagcaagtctggcacatctgccagcctggccatccgggatctgctgtctgaggacgaggccgactactactgcagcacctgggacgacaccctgaagggctgggtgttcggcggaggcaccaaagtgacagtgctgggcg gatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
protein construct expressed by SEQ ID NO 36 SEQ ID NO 18:
table 2: CDR sequences (according to Kabat). Note that the heavy and light chain CDR sequences are indicated by "-H" and "-L", respectively.
96: 21, scFv-anti-CD 20 anchoring domain of the protein construct shown in SEQ ID NO:
murine IL-2 anchoring domain of the protein construct shown in SEQ ID NO:97 SEQ ID NO:24:
98: 25, scFv-anti-CD 19 anchoring domain of the protein construct shown in SEQ ID NO:
99: SEQ ID No. 26 scFv-anti-CD 20 anchor domain of the protein construct:
scFv-anti-CD 19 Anchor Domain of the protein construct shown in SEQ ID NO:100 SEQ ID NO:32:
scFv-anti-CD 20 anchoring domain of the protein construct shown in SEQ ID NO:101: SEQ ID NO:34:
102 SEQ ID NO:19 the scTNF80 (murine) anchoring domain of the protein construct shown in SEQ ID NO:19:
103 SEQ ID No. 22 scBaff anchor domain of the protein construct:
scGITRL anchoring domain of the protein construct shown in SEQ ID NO:104 SEQ ID NO:28:
105: SEQ ID No. 29 murine sc41BBL anchoring domain of the protein construct shown in SEQ ID NO:
106 SEQ ID NO:30 murine GITRL anchoring domain of the protein construct:
107 human IL-2 anchoring domain:
108 anti-CD 40(G28.5) -VH (1-114)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcctaa
Protein construct shown in SEQ ID NO:117 SEQ ID NO:108:
109 anti-CD 40(G28.5) -VH (1-114) -scBaff
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggatatccagctccagcagtctggccctggactcgtcaaaccatctcagagcctgtctctcacctgttctgtcaccggatactccatcaccaccaactacaactggaattggattcggcagtttcctgggaacaaactcgaatggatgggatacatccgatacgacggcactagtgaatacaccccatctctcaaaaatcgggtgtccattacccgggacacttctatgaaccagttctttctccgactcacctctgtgacacctgaggataccgccacatactactgtgctagactggactactgggggcagggaacactggtgaccgtgtcatctggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgccctcgagggacccgaggaaactgtgactcaggactgtctccagctcattgccgatagtgaaacccctaccatccagaaaggctcttacaccttcgtgccatggctgctgtcattcaaacggggatctgctctggaggagaaggaaaacaaaatcctggtcaaggaaaccggctacttcttcatctacggccaggtcctctacaccgacaaaacatacgctatggggcatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtattcagaacatgcccgagactctgcccaataatagctgctactctgctggcattgccaaactggaggagggcgacgaactccagctggctattcctagggaaaatgcccagattagcctggacggggatgtgacattttttggcgccctgaaactgctgggaggcggagggagtggcgggggaggctctggacctgaggaaactgtgacccaggattgtctccagctcattgccgatagtgagactcctaccattcagaagggatcttacacctttgtgccttggctgctgtctttcaaacggggctctgctctggaggaaaaggagaacaaaattctggtcaaagagactggctacttcttcatctacggccaggtgctgtacaccgacaaaacatacgccatgggccatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtatccagaacatgcccgagacactgcccaataatagctgctactctgccggcattgctaaactggaggagggggacgaactccagctggctattcctagggaaaatgcccagatttctctcgatggggatgtgacattcttcggggccctcaaactgctgggaggcggcggatctggcggaggcgggagtcaattcgcagcaggtccagaagaaacagtcactcaagactgcttgcaactgattgcagacagtgaaacaccaactatacaaaaaggatcttacacatttgttccatggcttctcagctttaaaaggggaagtgccctagaagaaaaagagaataaaatattggtcaaagaaactggttacttttttatatatggtcaggttttatatactgataagacctacgccatgggacatctaattcagaggaagaaggtccatgtctttggggatgaattgagtctggtgactttgtttcgatgtattcaaaatatgcctgaaacactacccaataattcctgctattcagctggcattgcaaaactggaagaaggagatgaactccaacttgcaataccaagagaaaatgcacaaatatcactggatggagatgtcacattttttggtgcattgaaactgctgtga
Protein construct shown as SEQ ID NO. 118 and SEQ ID NO. 109
110 anti-CD 95(E09) -VH (1-114) -scBaff
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccggatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgccctcgagggacccgaggaaactgtgactcaggactgtctccagctcattgccgatagtgaaacccctaccatccagaaaggctcttacaccttcgtgccatggctgctgtcattcaaacggggatctgctctggaggagaaggaaaacaaaatcctggtcaaggaaaccggctacttcttcatctacggccaggtcctctacaccgacaaaacatacgctatggggcatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtattcagaacatgcccgagactctgcccaataatagctgctactctgctggcattgccaaactggaggagggcgacgaactccagctggctattcctagggaaaatgcccagattagcctggacggggatgtgacattttttggcgccctgaaactgctgggaggcggagggagtggcgggggaggctctggacctgaggaaactgtgacccaggattgtctccagctcattgccgatagtgagactcctaccattcagaagggatcttacacctttgtgccttggctgctgtctttcaaacggggctctgctctggaggaaaaggagaacaaaattctggtcaaagagactggctacttcttcatctacggccaggtgctgtacaccgacaaaacatacgccatgggccatctcattcagcggaaaaaagtccacgtgttcggcgacgaactctctctcgtgacactgttccggtgtatccagaacatgcccgagacactgcccaataatagctgctactctgccggcattgctaaactggaggagggggacgaactccagctggctattcctagggaaaatgcccagatttctctcgatggggatgtgacattcttcggggccctcaaactgctgggaggcggcggatctggcggaggcgggagtcaattcgcagcaggtccagaagaaacagtcactcaagactgcttgcaactgattgcagacagtgaaacaccaactatacaaaaaggatcttacacatttgttccatggcttctcagctttaaaaggggaagtgccctagaagaaaaagagaataaaatattggtcaaagaaactggttacttttttatatatggtcaggttttatatactgataagacctacgccatgggacatctaattcagaggaagaaggtccatgtctttggggatgaattgagtctggtgactttgtttcgatgtattcaaaatatgcctgaaacactacccaataattcctgctattcagctggcattgcaaaactggaagaaggagatgaactccaacttgcaataccaagagaaaatgcacaaatatcactggatggagatgtcacattttttggtgcattgaaactgctgtga
Protein construct shown as SEQ ID NO. 119 and SEQ ID NO. 110
111 anti-TNFR 2(C4) -IgG2-VH-scFv of SEQ ID NO: CD20
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatcctcgagtgctagcaccaagggcccatcggtcttccccctggcgccctgctccaggagcacctccgagagcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgctctgaccagcggcgtgcacaccttcccagctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcaacttcggcacccagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagacagttgagcgcaaatgttgtgtcgagtgcccaccgtgcccagcaccacctgtggcaggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagaccccgaggtccagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccacgggaggagcagttcaacagcacgttccgtgtggtcagcgtcctcaccgttgtgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccagcccccatcgagaaaaccatctccaaaaccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaagaatt ccaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaaatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagccaggatcctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggctgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaggggggaccaagctggaaatcaaacgttaa
Protein construct shown as SEQ ID NO. 120 and SEQ ID NO. 111
112 anti-TNFR 2(C4) -IgG1(N297A) -VH-scFv CD70(1F6)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattccagattcagctcgtccagtccggacctgaagtgaaaaaacctggcgaaaccgtgaaaatttcctgtaaggcctctggctacacctttaccaactacggcatgaactgggtcaaacaggctcctgggaagggcctgaaatggatgggatggatcaacacctacaccggcgaaccaacatacgccgatgcctttaagggacgctttgccttctctctggaaacttccgcctctactgcttacctccagatcaataacctcaaaaacgaggacaccgccacttacttttgtgctcgggattacggggactacgggatggattactggggacagggaacatctgtgaccgtgtctagcgcttctacaaaggggcctaaactggaggagggcgagtttagcgaggctagagtggatatcgtgctcacacagtctcccgcttctctggctgtctcactgggccagcgagcaacaatctcttgtcgggcttccaaatccgtgtctactagcggctactcttttatgcactggtaccagcagaaacctgggcagcctccaaaactgctcatctacctggcttcaaacctcgaatccggagtgcctgctcgattttctggctctggctccgggaccgactttacactgaacattcatcctgtcgaggaggaggacgctgccacatactactgtcagcattctagggaggtgccatggacatttggcgggggaacaaaactggaaatcaaacggtaa
Protein construct shown in SEQ ID NO. 121: SEQ ID NO. 112:
113 anti-TNFR 2(C4) -IgG1(N297A) -VH-scFv CD70(2H5)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattgcaggttcagctgctgcagtctggacctgagctggtgaagcctggggcttcagtgaagttgtcctgcaaggcttctggttatagtttcacaagttacgatattaactgggtgaagcagaggcctggacagggacttgagtgggttggatggatttatcctagagatggtgatactaagtacaatgagaaattcaagggcaaggccatattgactgtagacacatcctccaacacagcgtacatgaacctccacagcctgacatctgaggactctgcggtctatttctgtgcaagactaactgggccctactggtacttcgatgtctggggcacagggaccacggtcaccgtctcctcaggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattccaggtgcagctggtggaatctggcggcggagtggtgcagcctggcagaagcctgagactgagctgtgccgccagcggcttcaccttcagcagctacatcatgcactgggtgcgccaggcccctggcaagggactggaatgggtggccgtgatcagctacgacggccggaacaagtactacgccgacagcgtgaagggccggttcaccatctcccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgcgggccgaggacaccgccgtgtactactgtgccagagacaccgacggctacgacttcgactattggggccagggcaccctcgtgaccgtgtctagcggaggcggaggatctggcggagggggatcaggcgggggaggctctgaaatcgtgctgacacagagccccgccaccctgtcactgtctccaggcgaaagagccaccctgagctgcagagccagccagagcgtgtccagctacctggcctggtatcagcagaagcccggacaggcccccagactgctgatctacgacgccagcaatcgggccacaggcatccctgccagattttccggctctggcagcggcaccgacttcaccctgacaatcagcagcctggaacccgaggactttgccgtgtattattgccagcagcggaccaactggcccctgacctttggcggaggcaccaaggtggaaatcaaggccagcaccaagggctaa
Protein construct shown in SEQ ID NO. 122: SEQ ID NO. 113:
114: anti-41 BB (HBBK4) -IgG1(N297A) -VH-scFv: CD 20: SEQ ID NO
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtccagctgcagcagtctggcgccgaagttattaagcctggcgcctccgtgaagctgagctgtaaagccagcggctacaccttcagcagctactggatgcactgggtccgacaggctccaggacaaggcctggaatggatcggcgagatcaaccctggcaacggccacaccaactacaacgagaagttcaagagccgggccacactgaccggcgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcgccagatcctttaccaccgccagagcctttgcctattggggccagggaacactggtcaccgtgtccagcagatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgagcaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaaatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagccaggatcctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggctgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaggggggaccaagctggaaatcaaacgttaa
123 SEQ ID NO:114:
115: anti-41 BB (HBBK4) -VL SEQ ID NO
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggacatcgtgatgactcagagccccgccttcctgtctgtgacccctggcgagaaagtgaccatcacctgtagagccagccagaccatcagcgactacctgcactggtatcagcagaagcccgatcaggcccctaagctgctgattaagtacgcctctcagagcatcagcggcatccccagcagattttctggcagcggctctggcaccgacttcacctttaccatcagctccctggaagccgaggatgccgccacctactattgtcaggacggccacagcttccctccaacctttggacagggcacaaagctggaaatcaagggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
Protein construct shown in SEQ ID NO:124 SEQ ID NO:115:
116 anti-CD 95(E09) -IgG1(N297A) -VH-scFv CD20
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagctgcagctgcaggaatctggccctggcctcgtgaagcccagcgagacactgagcctgacctgtaccgtgtccggcgccagcatcagcgccaacagctactatggcgtgtgggtgcgccagagccctggcaagggactggaatgggtgggatctatcgcctaccggggcaacagcaacagcggcagcacctactacaaccccagcctgaagtcccgggccaccgtgtctgtggacaccagcaagaaccaggtgtccctgcggctgacctctgtgacagccgccgataccgccctgtactactgcgccagaaggcagctgctggacgacggcacaggatatcagtgggccgccttcgatgtgtggggccagggaacaatggtcaccgtgtcctccggatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaaggaattccaggtacaactgcagcagcctggggctgagctggtgaagcctggggcctcagtgaagatgtcntgcaaggcttctggctacacatttaccagttacaatatgcactgggtaaaacagacacctggtcggggcctggaatggattggagctatttatcccggaaatggtgatacttcctacaatcagaagttcaaaggcaaggccacattgactgcagacaaatcctccagcacagcctacatgcagctcagcagcctgacatctgaggactctgcggtctattactgtgcaagatcgacttactacggcggtgactggtacttcaatgtctggggcgcagggaccacggtcaccgtctcttcaggaggaggcgg atccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtctccagcaatcctgtctgcatctccaggggagaaggtcacaatgacttgcagggccagctcaagtgtaagttacatccactggttccagcagaagccaggatcctcccccaaaccctggatttatgccacatccaacctggcttctggagtccctgttcgcttcagtggcagtgggtctgggacttcttactctctcacaatcagcagagtggaggctgaagatgctgccacttattactgccagcagtggactagtaacccacccacgttcggaggggggaccaagctggaaatcaaacgttaa
Protein construct shown as
The following amino acid sequences as shown in SEQ ID NO 126 to 143 are the CDR sequences of the anti-4-1 BB monoclonal antibody HBBK4 (which was used in the non-limiting experiments of the present application), URELUMAB and UTOMILUMB. Note that the terms "CDR 1-H", "CDR 2-H", and "CDR 3-H" refer to heavy chain CDR1, CDR2, and CDR3 sequences, respectively, and the terms "CDR 1-L", "CDR 2-L", and "CDR 3-L" refer to light chain CDR1, CDR2, and CDR3 sequences, respectively:
SEQ ID NO:126:HBBK4 CDR1-H:
YTFSSYWMH
SEQ ID NO:127:HBBK4 CDR2-H:
EINPGNGHTNYNEKFKS
SEQ ID NO:128:HBBK4 CDR3-H:
SFTTARAFAY
SEQ ID NO:129:HBBK4 CDR1-L:
RASQTISDYLH
SEQ ID NO:130:HBBK4 CDR2-L:
LASQSIS
SEQ ID NO:131:HBBK4 CDR3-L:
QDGHSFPPT
SEQ ID NO:132:URELUMAB CDR1-H:
GSFSGYYWS
SEQ ID NO:133:URELUMAB CDR2-H:
EINHGGYVTYNPSLES
SEQ ID NO:134:URELUMAB CDR3-H:
DYGPGNYDWYFDL
SEQ ID NO:135:URELUMAB CDR1-L:
RASQSVSSYLA
SEQ ID NO:136:URELUMAB CDR2-L:
DASNRAT
SEQ ID NO:137:URELUMAB CDR3-L:
QQRSNWPPALT
SEQ ID NO:138:UTOMILUMAB CDR1-H:
YSFSTYWIS
SEQ ID NO:139:UTOMILUMAB CDR2-H:
KIYPGDSYTNYSPSFQG
SEQ ID NO:140:UTOMILUMAB CDR3-H:
GYGIFDY
SEQ ID NO:141:UTOMILUMAB CDR1-L:
SGDNIGDQYAH
SEQ ID NO:142:UTOMILUMAB CDR2-L:
QDKNRPS
SEQ ID NO:143:UTOMILUMAB CDR3-L:
ATYTGFGSLAV
scFv of the protein construct shown in SEQ ID NO:144 SEQ ID NO:121 CD70(1F6) anchoring domain:
scFv of the protein construct shown in SEQ ID NO:145 SEQ ID NO:122 CD70(2H5) anchoring domain:
SEQ ID NO 146 anti-TRAILR 2(Cona) -IgG1(N297A) -VH-scFv CD70(9G2)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtgcagctgcaggaatctggccctggcctcgtgaagcctagccagaccctgagcctgacctgtaccgtgtctggcggcagcatcagcagcggcgactacttctggtcctggatcagacagctgcccggcaagggcctggaatggatcggccacatccacaacagcggcaccacctactacaaccccagcctgaagtccagagtgaccatcagcgtggacaccagcaagaagcagttcagcctgcggctgagcagcgtgacagccgccgatacagccgtgtactactgcgccagagacagaggcggcgattactactacggcatggacgtgtggggccagggcaccaccgtgaccgtgtctagcagatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagccccggcaagctcgagcaggtgcagctggtggaatctggcggcggactgatgcagcctggcggctctctgagactgagctgtgccgccagcggcttcacctttagcagcagcgccatgagctgggtgcgccaggctcctggaaagggcctggaatgggtgtccagcatctacagcgacagcagctacacctactacgccgacagcgtgaagtcccggttcaccatcagcaccgacaacgccaagaacaccctgtacctgcagatgaacagcctgaagcccgacgacaccgccgtgtactactgtgccggcagcagcgattacgagggcagctttgcctcttggggccagggcacacaagtgaccgtgtcctccagatctagcaccaagggccccaagctggaagagggcgagttcagcgaggcccaattgcagagcgtcgtgacccagcctcctagcctgtctgcctctcctggaagcagcgtgcggctgacctgtacactgagcagcggcaacagcgtgggcaactacgacatcagctggtatcagcagaaggccggcagcccccccagatacctgctgtactactacagcgattccgtgaagcaccagggcagcggcgtgcccagcagattttccggaagctctgacgccagcgccaacgccggactgctgctgatttctggcctgcagcctgaggacgaggccgactactactgcagcgcctacaagagcggcagccacgtgttcggcggaggcaccaaactgacagtgctgggctaa
Protein construct shown as SEQ ID NO. 157 SEQ ID NO. 146
147 anti-TRAILR 2(Cona) -VL of SEQ ID NO
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggagatcgtgctgacccagagccctggcaccctgtcactgtctccaggcgagagagccaccctgagctgtagagccagccagggcatcagccggtcttacctggcctggtatcagcagaagcccggccaggctcctagcctgctgatctacggcgccagcagcagagccaccggcatccccgatagattttccggcagcggctccggcaccgacttcaccctgacaatcagcagactggaacccgaggacttcgccgtgtattattgccagcagttcggcagcagcccctggacctttggccagggaacaaaagtgggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
Protein construct shown as SEQ ID NO. 158 and SEQ ID NO. 147
148 anti-CD 40(C) -IgG1(N297A) -VH-scFv PD-L1(Ave)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtgcagctggttcagtctggcgccgaagtgaaaaagcctggcgcctctgtgaaggtgtcctgtacagccagcggcttcaacatcaaggactactacgtgcactgggtcaagcaggcccctggacaaggactggaatggatgggcagaatcgaccccgaggacggcgactctaagtacgcccctaagttccagggcaaagccaccatgaccgccgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcaccaccagctactatgtgggcacctacggctattggggccagggcacactggtcaccgtgtccagcagatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgaggaggtgcagctgctggaatctggcggaggacttgttcagcctggcggctctctgagactgtcttgtgccgccagcggcttcaccttcagcagctatatcatgatgtgggtccgacaggcccctggcaaaggccttgaatgggtgtccagcatctatcccagcggcggcatcaccttttacgccgacacagtgaagggcagattcaccatcagccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgtgtactactgcgccagaatcaagctgggcaccgtgaccaccgtggattattggggacagggcaccctggtcaccgtgtcctccagatcttctacaaagggccccaagctggaagagggcgagtttagcgaagcccaattgcagagcgccctgacacagcctgcatccgtgtctggatctccaggccagagcatcaccatctcttgtaccggcacaagctccgatgtcggcggctacaattacgtgtcctggtatcagcagcaccccggcaaggcccctaagctgatgatctacgacgtgtccaacagaccctccggcgtgtccaatagattcagcggcagcaagagcggcaacaccgccagcctgacaattagcggactgcaggccgaggacgaggccgattactactgtagcagctacaccagctcctccaccagagtgtttggcaccggcaccaaagtgaccgtgctttaa
159 SEQ ID NO. 148 protein construct
149 anti-CD 40(C) -VL of SEQ ID NO:149
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggacatccagatgacacagagccccagcagcctgtctgccagcgtgggagatagagtgaccatcacctgtagcgccagcagcagcgtgtcctacatgctgtggttccagcagaagcctggcaaggcccctaagctgctgatctacagcacctccaatctggccagcggcgtgccaagcagattttctggctctggcagcggcaccgacttcaccctgaccatatctagcctgcagccagaggacttcgccacctactactgccagcagcggacattctacccctacacctttggcggaggcaccaaggtggaaatcaagggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
160 SEQ ID NO:149
SEQ ID NO:150 anti-CD 40(C) -Fab2-scFv PD-L1(Ave)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtgcagctggttcagtctggcgccgaagtgaaaaagcctggcgcctctgtgaaggtgtcctgtacagccagcggcttcaacatcaaggactactacgtgcactgggtcaagcaggcccctggacaaggactggaatggatgggcagaatcgaccccgaggacggcgactctaagtacgcccctaagttccagggcaaagccaccatgaccgccgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcaccaccagctactatgtgggcacctacggctattggggccagggcacactggtcaccgtgtccagcagatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgccctcgaggaggtgcagctgctggaatctggcggaggacttgttcagcctggcggctctctgagactgtcttgtgccgccagcggcttcaccttcagcagctatatcatgatgtgggtccgacaggcccctggcaaaggccttgaatgggtgtccagcatctatcccagcggcggcatcaccttttacgccgacacagtgaagggcagattcaccatcagccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgtgtactactgcgccagaatcaagctgggcaccgtgaccaccgtggattattggggacagggcaccctggtcaccgtgtcctccagatcttctacaaagggccccaagctggaagagggcgagtttagcgaagcccaattgcagagcgccctgacacagcctgcatccgtgtctggatctccaggccagagcatcaccatctcttgtaccggcacaagctccgatgtcggcggctacaattacgtgtcctggtatcagcagcaccccggcaaggcccctaagctgatgatctacgacgtgtccaacagaccctccggcgtgtccaatagattcagcggcagcaagagcggcaacaccgccagcctgacaattagcggactgcaggccgaggacgaggccgattactactgtagcagctacaccagctcctccaccagagtgtttggcaccggcaccaaagtgaccgtgctttaa
Protein construct shown as SEQ ID NO. 161 and SEQ ID NO. 150
SEQ ID NO 151 anti-41 BB (HBBK) -IgG1(N297A) -VH-scFv PD-L1(Ave)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtccagctgcagcagtctggcgccgaagttattaagcctggcgcctccgtgaagctgagctgtaaagccagcggctacaccttcagcagctactggatgcactgggtccgacaggctccaggacaaggcctggaatggatcggcgagatcaaccctggcaacggccacaccaactacaacgagaagttcaagagccgggccacactgaccggcgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcgccagatcctttaccaccgccagagcctttgcctattggggccagggaacactggtcaccgtgtccagcagatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgaggaggtgcagctgctggaatctggcggaggacttgttcagcctggcggctctctgagactgtcttgtgccgccagcggcttcaccttcagcagctatatcatgatgtgggtccgacaggcccctggcaaaggccttgaatgggtgtccagcatctatcccagcggcggcatcaccttttacgccgacacagtgaagggcagattcaccatcagccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgtgtactactgcgccagaatcaagctgggcaccgtgaccaccgtggattattggggacagggcaccctggtcaccgtgtcctccagatcttctacaaagggccccaagctggaagagggcgagtttagcgaagcccaattgcagagcgccctgacacagcctgcatccgtgtctggatctccaggccagagcatcaccatctcttgtaccggcacaagctccgatgtcggcggctacaattacgtgtcctggtatcagcagcaccccggcaaggcccctaagctgatgatctacgacgtgtccaacagaccctccggcgtgtccaatagattcagcggcagcaagagcggcaacaccgccagcctgacaattagcggactgcaggccgaggacgaggccgattactactgtagcagctacaccagctcctccaccagagtgtttggcaccggcaccaaagtgaccgtgctttaa
Protein construct shown as SEQ ID NO. 162 and SEQ ID NO. 151
SEQ ID NO:152 anti-41 BB (HBBK) -Fab2-scFv PD-L1(Ave)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtccagctgcagcagtctggcgccgaagttattaagcctggcgcctccgtgaagctgagctgtaaagccagcggctacaccttcagcagctactggatgcactgggtccgacaggctccaggacaaggcctggaatggatcggcgagatcaaccctggcaacggccacaccaactacaacgagaagttcaagagccgggccacactgaccggcgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcgccagatcctttaccaccgccagagcctttgcctattggggccagggaacactggtcaccgtgtccagcagatcctctagcgccagcacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgacagtgtcctggaactctggcgccctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgactgtgcccagcagcagcctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgccctcgaggaggtgcagctgctggaatctggcggaggacttgttcagcctggcggctctctgagactgtcttgtgccgccagcggcttcaccttcagcagctatatcatgatgtgggtccgacaggcccctggcaaaggccttgaatgggtgtccagcatctatcccagcggcggcatcaccttttacgccgacacagtgaagggcagattcaccatcagccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgtgtactactgcgccagaatcaagctgggcaccgtgaccaccgtggattattggggacagggcaccctggtcaccgtgtcctccagatcttctacaaagggccccaagctggaagagggcgagtttagcgaagcccaattgcagagcgccctgacacagcctgcatccgtgtctggatctccaggccagagcatcaccatctcttgtaccggcacaagctccgatgtcggcggctacaattacgtgtcctggtatcagcagcaccccggcaaggcccctaagctgatgatctacgacgtgtccaacagaccctccggcgtgtccaatagattcagcggcagcaagagcggcaacaccgccagcctgacaattagcggactgcaggccgaggacgaggccgattactactgtagcagctacaccagctcctccaccagagtgtttggcaccggcaccaaagtgaccgtgctttaa
163: 152 SEQ ID NO
153 anti-PD-L1 (Ave) -IgG2-VH-scFv 41BB (HBBK)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattcgaggtgcagctgctggaatctggcggaggacttgttcagcctggcggctctctgagactgtcttgtgccgccagcggcttcaccttcagcagctatatcatgatgtgggtccgacaggcccctggcaaaggccttgaatgggtgtccagcatctatcccagcggcggcatcaccttttacgccgacacagtgaagggcagattcaccatcagccgggacaacagcaagaacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgtgtactactgcgccagaatcaagctgggcaccgtgaccaccgtggattattggggacagggcaccctggtcaccgtgtcctccagatcctcgagtgctagcaccaagggcccatcggtcttccccctggcgccctgctccaggagcacctccgagagcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgctctgaccagcggcgtgcacaccttcccagctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcaacttcggcacccagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagacagttgagcgcaaatgttgtgtcgagtgcccaccgtgcccagcaccacctgtggcaggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagaccccgaggtccagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccacgggaggagcagttcaacagcacgttccgtgtggtcagcgtcctcaccgttgtgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccagcccccatcgagaaaaccatctccaaaaccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaagaattccaggtccagctgcagcagtctggcgccgaagttattaagcctggcgcctccgtgaagctgagctgtaaagccagcggctacaccttcagcagctactggatgcactgggtccgacaggctccaggacaaggcctggaatggatcggcgagatcaaccctggcaacggccacaccaactacaacgagaagttcaagagccgggccacactgaccggcgataccagcacaagcaccgtgtacatggaactgagcagcctgagaagcgaggacaccgccgtgtactactgcgccagatcctttaccaccgccagagcctttgcctattggggccagggaacactggtcaccgtgtccagcagatctagcacaaagggccccaagctggaagagggcgagtttagcgaggcccaattggacatcgtgatgactcagagccccgccttcctgtctgtgacccctggcgagaaagtgaccatcacctgtagagccagccagaccatcagcgactacctgcactggtatcagcagaagcccgatcaggcccctaagctgctgattaagtacgcctctcagagcatcagcggcatccccagcagattttctggcagcggctctggcaccgacttcacctttaccatcagctccctggaagccgaggatgccgccacctactattgtcaggacggccacagcttccctccaacctttggacagggcacaaagctggaaatcaagtaa
Protein construct shown as SEQ ID NO. 164 to 153
154 anti-PD-L1 (Ave) -VL of SEQ ID NO:154
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattgcagagcgccctgacacagcctgcatccgtgtctggatctccaggccagagcatcaccatctcttgtaccggcacaagctccgatgtcggcggctacaattacgtgtcctggtatcagcagcaccccggcaaggcccctaagctgatgatctacgacgtgtccaacagaccctccggcgtgtccaatagattcagcggcagcaagagcggcaacaccgccagcctgacaattagcggactgcaggccgaggacgaggccgattactactgtagcagctacaccagctcctccaccagagtgtttggcaccggcaccaaagtgaccgtgcttggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
165: 154 as shown in SEQ ID NO
155 of SEQ ID NO anti-muCD 27-IgG1(N297A) -VH-scFv Fn14(18D1)
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattccaggtccagctgcagcagtctggcgccgaacttgtgaagcctggcagcagcgtgaagatcagctgtaaagccagcggctacaccttcaccagctacgacatgcactggatcaagcagcagcccggcaaaggcctggaatggatcggctggatctaccccggcaacggcaacaccaagtacaaccagaagttcaacggcaaggccacactgaccgccgacatctctagcagcacagcctacatgcagctgagcagcctgaccagcgaagatagcgccgtgtacttctgcgccaaatggggctacaacaacttcgactactggggccagggcgtgatggtcaccgtgtctagcagatccagcagcgcctctacaaagggccccagcgtgttccctctggcccctagcagcaagagcacatctggcggaacagccgccctgggctgcctcgtgaaggactactttcccgagcccgtgaccgtgtcctggaactctggcgctctgacaagcggcgtgcacacctttccagccgtgctgcagagcagcggcctgtactctctgagcagcgtcgtgacagtgcccagcagctctctgggcacccagacctacatctgcaacgtgaaccacaagcccagcaacaccaaggtggacaagaaggtggaacccaagagctgcgacaagacccacacctgtcccccttgtcctgcccccgaactgctgggaggcccttccgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccacgaggaccctgaagtgaagtttaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagcctagagaggaacagtacgccagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaaggccctgcctgcccccatcgagaaaaccatcagcaaggccaagggccagccccgcgaaccccaggtgtacacactgcccccaagcagggacgagctgaccaagaaccaggtgtccctgacctgtctcgtgaaaggcttctaccccagcgatatcgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcaagctgaccgtggacaagtcccggtggcagcagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgagcctgagccccggcaagctcgaggaggtgcagctggtggaatctggcggcggactggtgcagcctggcggatctctgagactgagctgtgccgccagcggcttcaccttcagcaactactggatgagctgggtgcgccaggcccctggcaaaggactggaatgggtgtccggcatcaacccaggcggcacctctacctactacgccgacagcgtgaagggccggttcaccatcagccgggacaacgccaagaacaccctgtacctgcagatgaacagcctgaagtccgaggacaccgccgtgtactactgcgccaagcacctgggcaactggggcgagtacaattactggggccagggcacacaagtgaccgtgtccagtagatctagcaccaagggccccaagctggaagagggcgagttcagcgaggcccaattgcagagcgccctgacccagcctccaagcgtgtcaggctctcctggcaagaccgtgaccatcagctgtgctggcaccggcggagatgtgggctacagaaacagcgtgtcctggtatcagcagctgcccggcatggcccccaaactgctgatctacgacgtggacaagcgggcctctggcatcaccgacagattcagcggcagcaagagcggcgataccgccagcctgacaatcagcggagtgcagagcgaggacgaggccgactactactgtgccagccagagaagcggaatcgccgccgtgtttggcggaggcacacacctgacagtgctgggctaa
Protein construct shown as SEQ ID NO. 166 and SEQ ID NO. 155
156 anti-mucD 27-VL of SEQ ID NO
atgaacttcggcttcagcctgatcttcctggtgctggtgctgaagggcgtgcagtgcgaagtgaagctggtgccccggcaattggactacaaggacgacgacgacaaagaattggacatccagatgacacagagccctgccagcctgtctgcctctctgggagagacagtgtccatcgattgtctggccagcgagggcatcagcaacgacctggcttggtatcagcagaagtccggcaagagccctcagctgctgatcaacagcgccagcagactggaagatggcgtgcccagcagattttctggctctggcagcggcacccggtacagcctgaagatttctggcatgcagcccgaggacgaggccgaatacttctgcctgcaaagctacagaagcccctggacctttggcggaggcacaaagctggaactgaagggatccgaaatcaagcgtacggtggccgctcccagcgtgttcatcttcccacctagcgacgagcagctgaagtccggcacagcctctgtcgtgtgcctgctgaacaacttctacccccgcgaggccaaggtgcagtggaaggtggacaatgccctgcagagcggcaacagccaggaaagcgtgaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcacaaggtgtacgcctgcgaagtgacccaccagggcctgtctagccccgtgaccaagagcttcaaccggggcgagtgctaa
Protein construct shown as SEQ ID NO. 167 and SEQ ID NO. 156
The invention is further illustrated by the following non-limiting examples.
Examples
- 上一篇：一种医用注射器针头装配设备
- 下一篇：PD1结合剂