阅读说明：本技术 用于乙型肝炎病毒感染的RNAi剂 (RNAi agents for hepatitis b virus infection ) 是由 B·D·吉文 J·C·哈米尔顿 T·石吕普 M·G·博蒙 O·伦斯 R·C·M·卡尔梅耶 于 2020-02-07 设计创作，主要内容包括：本发明描述了用于抑制乙型肝炎病毒基因表达或治疗与乙型肝炎病毒感染相关联的症状和/或疾病的方法。还描述了用于施用这些RNAi剂的给药方案。本发明描述了用于抑制乙型肝炎病毒基因表达的RNA干扰(RNAi)剂。本文所公开的HBVRNAi剂可例如通过使用缀合的靶向配体靶向细胞,诸如肝细胞。本发明还描述了包含一种或多种HBVRNAi剂和任选地一种或多种另外的治疗剂的药物组合物。将所述HBVRNAi剂体内递送至受感染的肝脏提供了对HBV基因表达的抑制以及对与HBV感染相关联的疾病和病症的治疗。(Methods for inhibiting hepatitis B virus gene expression or treating symptoms and/or diseases associated with hepatitis B virus infection are described. Dosage regimens for administering these RNAi agents are also described. The present invention describes RNA interference (RNAi) agents for inhibiting the expression of hepatitis B virus genes. The hbv rnai agents disclosed herein can target cells, such as hepatocytes, for example, by using conjugated targeting ligands. The invention also describes pharmaceutical compositions comprising one or more hbv rnai agents and optionally one or more additional therapeutic agents. In vivo delivery of the HBV rnai agent to the infected liver provides inhibition of HBV gene expression and treatment of diseases and disorders associated with HBV infection.)

1. A pharmaceutical composition for use in treating or preventing a disease associated with infection by hepatitis b virus in a human subject, wherein the use comprises administering to the human subject an effective amount of the pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

And wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg every 28 days.

2. The pharmaceutical composition of claim 1, wherein the first RNAi agent and/or the second RNAi agent further comprises a targeting ligand conjugated to the sense strand or the antisense strand.

3. The pharmaceutical composition of claim 2, wherein the targeting ligand comprises N-acetyl-galactosamine.

4. The pharmaceutical composition of claim 3, wherein the targeting ligand is (NAG25), (NAG25) s, (NAG31), (NAG31) s, (NAG37) or (NAG37) s.

5. The pharmaceutical composition of any one of claims 2-4, wherein the targeting ligand is conjugated to the 5 'end or the 3' end of the sense strand of the RNAi agent.

6. The pharmaceutical composition of any one of claims 2-4, wherein the targeting ligand is conjugated to the 3' end of the antisense strand of the RNAi agent.

7. The pharmaceutical composition of any one of claims 1-6, wherein the first RNAi agent is administered in an amount from about 20mg to 275 mg.

8. The pharmaceutical composition of any one of claims 1-7, wherein the second RNAi agent is administered in an amount from about 10mg to 150 mg.

9. The pharmaceutical composition of any one of claims 1 to 8, wherein the pharmaceutical composition comprises an RNAi agent comprising a duplex structure of AD04511(SEQ ID NO:100 and SEQ ID NO:229), AD04872(SEQ ID NO:126 and SEQ ID NO:252), AD04873(SEQ ID NO:127 and SEQ ID NO:252), AD04874(SEQ ID NO:128 and SEQ ID NO:253), AD05070(SEQ ID NO:140 and SEQ ID NO:262), AD05148(SEQ ID NO:140 and SEQ ID NO:271), AD05164(SEQ ID NO:126 and SEQ ID NO:273), AD05165(SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

10. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872(SEQ ID NO:126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070(SEQ ID NO:140 and SEQ ID NO: 262).

11. The pharmaceutical composition of claim 10, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG 37).

12. The pharmaceutical composition of claim 11, wherein the (NAG37) is conjugated to the 5' end of the respective sense strands of the duplex of AD04872 and the duplex of AD 05070.

13. The pharmaceutical composition according to any one of claims 10 to 12, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is between about 1:2 to about 5: 1.

14. The pharmaceutical composition of claim 13, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is about 2: 1.

15. The pharmaceutical composition of any one of claims 1 to 14, wherein the composition further comprises a pharmaceutically acceptable excipient.

16. The pharmaceutical composition of any one of claims 1 to 15, wherein the composition is administered subcutaneously.

17. The pharmaceutical composition of any one of claims 1-16, wherein the first and second RNAi agents are administered in a combined amount of any one of about 25mg, 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg every 28 days.

18. The pharmaceutical composition of any one of claims 1-16, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days.

19. The pharmaceutical composition of claim 18, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days.

20. The pharmaceutical composition of claim 18, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days.

21. The pharmaceutical composition of claim 18, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days.

22. The pharmaceutical composition of any one of claims 1-21, wherein the first and second RNAi agents are administered at 7-day, 14-day, 21-day, or 28-day intervals.

23. The pharmaceutical composition of any one of claims 1-21, wherein the first and second RNAi agents are administered at 28-day intervals.

24. The pharmaceutical composition of claim 23, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days and at intervals of 28 days.

25. The pharmaceutical composition of claim 24, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days and at intervals of 28 days.

26. The pharmaceutical composition of claim 24, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days and at intervals of 28 days.

27. The pharmaceutical composition of claim 24, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days and at 28-day intervals.

28. The pharmaceutical composition of any one of claims 1 to 27, wherein the composition is administered to the subject for up to 6 months.

29. The pharmaceutical composition of any one of claims 1 to 28, further comprising administering a second active agent to the subject.

30. The pharmaceutical composition of claim 29, wherein the second active agent is a nucleoside analog.

31. The pharmaceutical composition of claim 30, wherein the nucleoside analog is entecavir or tenofovir.

32. The pharmaceutical composition of any one of claims 1 to 31, wherein the level of HBsAg, HBeAg or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

33. The pharmaceutical composition according to any one of claims 1 to 32, wherein the disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic disorder, proliferative hepatocyte disorder, hepatocellular carcinoma, hepatitis delta virus infection, acute HBV infection, chronic hepatitis b or chronic HBV infection.

34. The pharmaceutical composition according to claim 33, wherein said disease associated with said HBV infection is chronic hepatitis b or chronic HBV infection.

Technical Field

Disclosed herein are RNA interference (RNAi) agents for inhibiting expression of hepatitis b virus genes, compositions comprising HBV RNAi agents, and methods of use thereof. Also disclosed are methods for treating and/or preventing a symptom or disease associated with an infection caused by hepatitis b virus in a subject in need thereof.

Background

Hepatitis B Virus (HBV) is a strictly hepadnatropic virus containing double-stranded DNA. Although DNA is genetic material, the replication cycle involves a reverse transcription step that replicates pregenomic RNA into DNA. Hepatitis b virus is classified as a member of the hepadnaviruses, and belongs to the hepadnaviridae family. Primary infection with human hepatitis b virus causes acute hepatitis with symptoms of organ inflammation, fever, jaundice, and elevated liver transaminase in the blood. Those patients who fail to overcome viral infection suffer from years of chronic disease progression with an increased risk of developing cirrhosis or liver cancer. Perinatal transmission from hepatitis b virus infected mothers to newborns can also lead to chronic hepatitis.

After uptake by hepatocytes, the nucleocapsid is transferred into the nucleus and the DNA is released. There, DNA strand synthesis is completed and the nicks are repaired, yielding a 3.2kb covalent, closed, circular (ccc) supercoiled DNA. cccDNA serves as a template for transcription of five major viral mrnas, and has lengths of 3.5, 2.4, 2.1, and 0.7kb, respectively. All mrnas are 5 '-terminated and polyadenylated at the 3' end. There was sequence overlap at the 3' end between all five mrnas.

A3.5 kb mRNA was used as a template for core protein and polymerase production. In addition, this same transcript serves as a pregenomic replication intermediate and allows the viral polymerase to initiate reverse transcription to produce DNA. Core proteins are required for nucleocapsid formation. Another 3.5kb mRNA encodes the precore protein, the secretable e antigen (HBeAg). In the absence of replication inhibitors, the e antigen abundance in blood is associated with hepatitis b virus replication in the liver and serves as an important diagnostic marker for monitoring disease progression.

The 2.4kb and 2.1kb mRNAs carry the open reading frames ("ORFs") of pre-S1, pre-S2 and S for expression of the large, medium and small surface antigens of the virus. The s antigen is associated with infectious whole particles. Furthermore, the blood of infected patients also contains non-infectious particles derived only from the s antigen, and does not contain genomic DNA or polymerase. The function of these particles is not fully understood. Complete and sustained depletion of detectable s-antigen in the blood is considered a reliable indicator of hepatitis b virus clearance.

The 0.7kb mRNA encodes protein X. This gene product is important for efficient transcription of viral genes and also acts as a transactivator for host gene expression. The latter activity appears to be important for hepatocyte transformation during the development of liver cancer.

Patients with detectable s-antigen, e-antigen and/or viral DNA in the blood for more than 6 months are considered chronic infections. Nucleoside analogs as inhibitors of reverse transcriptase activity are often the first treatment of choice for many patients. Administration of lamivudine, tenofovir and/or entecavir has been shown to inhibit hepatitis b virus replication, sometimes to undetectable levels, with improvement in liver function and reduction in liver inflammation generally being considered as the most important benefits. However, only a few patients achieve complete and long-lasting relief after the treatment is over. In addition, hepatitis b virus develops resistance as the duration of treatment increases. This is particularly difficult for patients infected with both hepatitis b and Human Immunodeficiency Virus (HIV). Both viruses are susceptible to nucleoside analog drugs and may develop resistance together.

A second treatment option is the administration of interferon-alpha. Here, the patient received a high dose of interferon-alpha over a period of 6 months. The response rate for asian B genotypes is very low. Co-infection with Hepatitis Delta Virus (HDV) or human immunodeficiency virus has been shown to render interferon alpha therapy completely ineffective. Patients with severe liver damage and severe fibrotic conditions are not eligible for interferon alpha therapy.

It has been previously demonstrated that certain hepatitis B virus-specific RNA interference (RNAi) agents inhibit the expression of HBV genes. For example, U.S. patent application publication 2013/0005793 to Chin et al, which is incorporated herein by reference in its entirety, discloses certain double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of hepatitis B virus genes.

Disclosure of Invention

There is a need for a method of treating and/or preventing symptoms or diseases associated with infection by Hepatitis B Virus (HBV) in a subject in need thereof. In addition, there is a need for a method of inhibiting the expression of one or more hepatitis B virus genes. In particular, there is a need for a method of treating or preventing a Hepatitis B Virus (HBV) associated disease or condition or inhibiting the expression of one or more HBV genes in a subject using a Hepatitis B Virus (HBV) specific RNA interference (RNAi) agent (also referred to herein as an RNAi agent, RNAi trigger, or trigger) capable of selectively and effectively inhibiting the expression of a HBV gene. Furthermore, there is a need for a method of treating or preventing HBV-associated diseases or symptoms or inhibiting the expression of one or more HBV genes in a subject using a combination of novel HBV-specific RNAi agents for treating HBV infection and preventing HBV-associated diseases.

Described herein are methods for treating and/or preventing symptoms or diseases associated with HBV infection in a subject in need thereof (e.g., a human or animal subject). The method comprises administering one or more HBV gene-specific RNAi agents capable of selectively and effectively reducing HBV gene expression. In some embodiments, symptoms and diseases associated with HBV infection include, but are not limited to, chronic liver disease/disorder, inflammation, fibrotic disorders, proliferative disorders (including cancer, such as hepatocellular carcinoma), Hepatitis Delta Virus (HDV) infection, and acute HBV infection. In some embodiments, these symptoms and diseases are associated with chronic HBV infection and/or HDV infection.

In addition, described herein are methods for treating and/or preventing a symptom or disease associated with HBV infection in a subject in need thereof, comprising administering a pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents capable of selectively and effectively reducing HBV gene expression.

Also described herein are pharmaceutical compositions for use in treating and/or preventing symptoms or diseases associated with HBV infection in a human subject, e.g., by administering an effective amount of the pharmaceutical composition to the human subject. Also described is the use of a pharmaceutical composition in the manufacture of a medicament for use in the treatment and/or prevention of a symptom or disease associated with HBV infection in a human subject.

In some embodiments, there is a method for treating or preventing a disease associated with HBV infection in a subject, the method comprising administering a pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents. In some embodiments, a pharmaceutical composition for use in treating or preventing a disease associated with HBV infection in a subject comprises one or more of the disclosed HBV RNAi agents. In some embodiments, there is a method for treating a disease associated with HBV infection in a subject, the method comprising administering a pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents. In some embodiments, a pharmaceutical composition for use in treating a disease associated with HBV infection in a subject comprises one or more of the disclosed HBV RNAi agents. In some embodiments, there is a method for preventing a disease associated with HBV infection in a subject, the method comprising administering a pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents. In some embodiments, a pharmaceutical composition for use in preventing a disease associated with HBV infection in a subject comprises one or more of the disclosed HBV RNAi agents.

In some embodiments, the one or more HBV RNAi agents are administered to a subject in an amount from about 25mg to 400mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 35mg, 50mg, 200mg, 300mg, or 400mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40mg per dose, about 100mg per dose, or about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose administered. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose administered. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 1 to 18 weeks. In some embodiments, the one or more HBV RNAi agents are administered at about 1 month intervals (i.e., monthly dosing). In some embodiments, the one or more HBV RNAi agents are administered at intervals of about once every four weeks. In some embodiments, the one or more HBV RNAi agents are administered at a combined amount of about 40mg, about 100mg, or about 200mg per dose at an interval of about once every four weeks. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 40 mg. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 100 mg. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 200 mg.

Also described herein are methods for inhibiting the expression of one or more hepatitis b virus genes. In some embodiments, the method inhibits the expression of one or more HBV transcripts. In some embodiments, the method inhibits expression of most or all HBV transcripts. In some embodiments, the method comprises administering one or more HBV RNAi agents described herein. In some embodiments, the method comprises administering a pharmaceutical composition comprising one or more of the HBV RNAi agents described herein. In some embodiments, the method comprises administering two HBV RNAi agents described herein. In some embodiments, the method comprises administering a pharmaceutical composition comprising two HBV RNAi agents described herein. In some embodiments, the method comprises contacting a cell infected with HBV with one or more HBV RNAi agents described herein. In some embodiments, the method comprises contacting a cell infected with HBV with two HBV RNAi agents described herein. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 25mg to 400mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 35mg, 50mg, 200mg, 300mg, or 400mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose administered. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose administered. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 1 to 18 weeks. In some embodiments, the one or more HBV RNAi agents are administered at about 1 month intervals (i.e., monthly dosing). In some embodiments, the one or more HBV RNAi agents are administered at intervals of about once every four weeks, such as the one or more HBV RNAi agents are administered at a combined amount of any of about 40mg, 100mg, or 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 40mg per dose, about 100mg per dose, or about 200mg per dose. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 40 mg. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 100 mg. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 200 mg.

Each HBV RNAi agent disclosed herein includes at least a sense strand and an antisense strand. The sense strand and the antisense strand may be partially, substantially, or fully complementary to each other. The sense and antisense strands of the RNAi agents described herein can each be 16 to 30 nucleotides in length. In some embodiments, the length of the sense strand and the antisense strand are independently 17 to 26 nucleotides. In some embodiments, the sense strand and the antisense strand are independently 19 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 24 nucleotides in length. The sense strand and the antisense strand may be of the same length or of different lengths. The HBV RNAi agents disclosed herein have been designed to include antisense strand sequences that are at least partially complementary to sequences in the HBV genome that are conserved in most known HBV serotypes. The RNAi agents described herein inhibit the expression of one or more HBV genes in vivo or in vitro when delivered to HBV-expressing cells.

HBV RNAi agents include a sense strand (also referred to as a passenger strand) comprising a first sequence and an antisense strand (also referred to as a guide strand) comprising a second sequence. The sense strand of an HBV RNAi agent described herein comprises a core stretch having at least about 85% identity to a nucleotide sequence of at least 16 contiguous nucleotides in HBV mRNA. In some embodiments, the stretch of sense strand core nucleotides that is at least about 85% identical to a sequence of HBV mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. The antisense strand of the HBV RNAi agent comprises a nucleotide sequence that is at least about 85% complementary to a sequence in HBV mRNA and the corresponding sense strand over a core stretch of at least 16 contiguous nucleotides. In some embodiments, the antisense strand core nucleotide sequence having at least about 85% complementarity to a sequence in HBV mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

Examples of sense and antisense strands of HBV RNAi agents that can be used in HBV RNAi agents are provided in tables 3 and 4. An example of HBV RNAi agent duplexes is provided in table 5. An example of a 19 nucleotide core stretch sequence consisting of or comprised within the sense and antisense strands of an HBV RNAi agent disclosed herein is provided in table 2.

In some embodiments, one or more HBV RNAi agents are delivered to a target cell or tissue using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include, but are not limited to: in some embodiments, the HBV RNAi agent is delivered to a target cell or tissue by covalently linking the RNAi agent to a targeting group, in some embodiments, the targeting group can comprise or consist of a cell receptor ligand, such as an asialoglycoprotein receptor (ASGPr) ligand In an embodiment, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer.

The targeting group can be attached to the 3 'end or 5' end of the sense strand or antisense strand of the HBV RNAi agent. In some embodiments, the targeting group is attached to the 3 'end or the 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

The targeting group can be attached to the 3 'end or the 5' end of any of the sense strands and/or antisense strands disclosed in tables 2, 3, and 4, with or without a linker. The linker may be attached to the 3 'end or the 5' end of any of the sense strands and/or antisense strands disclosed in tables 2, 3, and 4, with or without a targeting group.

In some embodiments, described herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition comprising one or more HBV RNAi agents having a duplex sequence disclosed in table 5.

In some embodiments, described herein are methods for treating or preventing an HBV-associated disease in a subject, the method comprising administering a composition comprising one or more HBV RNAi agents having a duplex sequence disclosed in table 5.

In some embodiments, described herein are methods for treating an HBV-associated disease in a subject comprising administering a composition comprising one or more HBV RNAi agents having a duplex sequence disclosed in table 5.

In some embodiments, described herein are methods for preventing an HBV-associated disease in a subject, the method comprising administering a composition comprising one or more HBV RNAi agents having a duplex sequence disclosed in table 5.

In some embodiments, the composition comprises a combination or mixture of at least two HBV RNAi agents with different nucleotide sequences. In some embodiments, the two or more different HBV RNAi agents are each separately and independently linked to a targeting group. In some embodiments, the two or more different HBV RNAi agents are each linked to a targeting group consisting of N-acetyl-galactosamine. In some embodiments, when two or more RNAi agents are included in the composition, each of the RNAi agents is linked to the same targeting group. In some embodiments, when two or more RNAi agents are included in the composition, each of the RNAi agents is linked to a different targeting group, such as targeting groups having different chemical structures.

In some embodiments, the targeting group is linked to the HBV RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed with a linker that is readily present to facilitate attachment to the HBV RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the same linker can be used to connect the two or more RNAi agents to the targeting group. In some embodiments, when two or more RNAi agents are included in the composition, different linkers are used to attach the two or more RNAi agents to the targeting group.

HBV mRNA is known to be polycistronic, resulting in the translation of multiple polypeptides, and individual mrnas overlap in RNA sequence, so a single RNAi agent targeting the HBV gene can result in the suppression of most or all HBV transcripts. However, while not wishing to be bound by any theory, it is hypothesized that a composition comprising two or more HBV RNAi agents targeting different positions or regions of an HBV gene (and in particular, two or more HBV RNAi agents, wherein one HBV RNAi agent targets SORF and a second HBV RNAi agent targets the X ORF) may provide additional advantages over a composition comprising only a single HBV RNAi agent, such as: (a) ensuring targeting to all HBV viral transcripts (i.e., 3.5kb pregenomic RNA; 3.5kb precore mRNA; 2.4kb pre S1 mRNA; 2.1kb pre S2/S mRNA; 0.7kb xmRNA; and any S-antigen expressing mRNA produced from integrated HBV DNA); (b) for expanding genotype coverage to potentially address a larger patient population; and/or (c) potentially reduce viral resistance due to mutations in the siRNA binding site.

In some embodiments, described herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or a different region of an HBV gene. In some embodiments, described herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (e.g., a composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, and a second HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene). As used herein, an RNAi agent comprising an antisense strand at least partially complementary to the nucleotide sequence located in the S ORF targets a portion of the HBV genome of SEQ ID NO:1 between positions 1-1307 and positions 3185 and 3221. As used herein, an RNAi agent comprising an antisense strand at least partially complementary to the nucleotide sequence located in the X ORF targets a portion of the HBV genome between positions 1308 and 1930 of SEQ ID NO: 1. In some embodiments, these symptoms and diseases are associated with chronic HBV infection and/or HDV infection. In some embodiments, the subject is diagnosed with HBeAg-positive or HBeAg-negative chronic HBV infection for at least 6 months.

In some embodiments, described herein are methods for treating or preventing an HBV-associated disease in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or a different region of an HBV gene. In some embodiments, described herein are methods for treating or preventing an HBV-associated disease in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (e.g., a composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, and a second HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene).

In some embodiments, described herein are methods for treating an HBV-associated disease in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or a different region of an HBV gene. In some embodiments, described herein are methods for treating an HBV-associated disease in a subject, the method comprising administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (e.g., a composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, and a second HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene).

In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 25mg to 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 25mg to 50mg, 50mg to 75mg, 75mg to 100mg, 100mg to 125mg, 125mg to 150mg, 150mg to 175mg, 175mg to 200mg, 200mg to 225mg, 225mg to 250mg, 250mg to 275mg, 275mg to 300mg, 300mg to 325mg, 325mg to 350mg, 350mg to 375mg, 375mg to 400mg, 25mg to 75mg, 50mg to 100mg, 100mg to 150mg, 150mg to 200mg, 200mg to 250mg, 250mg to 300mg, 300mg to 350mg, 350mg to 400mg, 25mg to 100mg, 50mg to 150mg, 100mg to 200mg, 150mg to 250mg, 200mg to 300mg, 300mg to 400mg, 25mg to 200mg, or 200mg to 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 30 to 50mg per dose, about 90 to 110mg per dose, or about 190 to 210mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 30mg to 50mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 90mg to 110mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 190mg to 210mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 25mg, about 50mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg, about 300mg, about 325mg, about 350mg, about 375mg, or about 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 50mg, about 75mg, about 100mg, or about 125mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 40mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 100mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 200mg per dose. In some embodiments, the at least two HBV RNAi agents are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the at least two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, the at least two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, the at least two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 40 mg. In some embodiments, the at least two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 100mg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose of a combined amount of about 200 mg.

In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, the at least two HBV RNAi agents are administered at intervals of about 1 to 18 weeks. In some embodiments, the at least two HBV RNAi agents are administered at about 1 week intervals, about 2 week intervals, about 3 week intervals, about 4 week intervals, about 5 week intervals, about 6 week intervals, about 7 week intervals, about 8 week intervals, about 9 week intervals, about 10 week intervals, about 11 week intervals, about 12 week intervals, about 13 week intervals, about 14 week intervals, about 15 week intervals, about 16 week intervals, about 17 week intervals, or about 18 week intervals. In some embodiments, the at least two HBV RNAi agents are administered at intervals of about 1 month to 6 months. In some embodiments, the at least two HBV RNAi agents are administered at about 1 month intervals, about 2 month intervals, about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, the at least two HBV RNAi agents are administered at about 4-week intervals or 1-month intervals. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, the one or more HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals.

In some embodiments, the at least two HBV RNAi agents are administered for a duration of about 1 month to 12 months. In some embodiments, the at least two HBV RNAi agents are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, the at least two HBV RNAi agents are administered for a duration of about 1 to 18 weeks. In some embodiments, the at least two HBV RNAi agents are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, the at least two HBV RNAi agents are administered for a duration of about 12 weeks to 3 months.

In some embodiments, described herein are methods for treating or preventing HBV-associated diseases or symptoms or inhibiting expression of one or more HBV genes in a subject, the method comprising administering a pharmaceutical composition comprising a combination of two HBV RNAi agents, wherein one HBV RNAi agent targets the S ORF of HBV RNA (i.e., has an antisense strand targeting the S transcript (S, pre-S1 and pre-S2), pre-genomic RNA (core and polymerase), and pre-core transcript of HBV genome (HBeAg)), and the other HBV RNAi agent targets the X ORF of HBV RNA (i.e., has an antisense strand targeting the X transcript of HBV genome, the S transcript (S, pre-S1 and pre-S2), pre-genomic RNA (core and polymerase), and pre-core transcript of HBV genome (HBeAg)). In some embodiments, the pharmaceutical compositions described herein comprise at least one HBV RNAi agent comprising a sequence targeting the S ORF of an HBV gene and a second HBV RNAi agent comprising a sequence targeting the X ORF of an HBV gene.

In some embodiments, described herein are methods for treating or preventing an HBV-associated disease in a subject, the method comprising administering a pharmaceutical composition comprising a combination of two HBV RNAi agents, wherein one HBV RNAi agent targets the S ORF of HBV RNA (i.e., has an antisense strand that targets the S transcript (S, pre-S1 and pre-S2), pre-genomic RNA (core and polymerase), and pre-core transcript of HBV genome (HBeAg)), and the other HBV RNAi agent targets the X ORF of HBV RNA (i.e., has an antisense strand that targets the X transcript of HBV genome, S transcript (S, pre-S1 and pre-S2), pre-genomic RNA (core and polymerase), and pre-core transcript of HBV genome (HBeAg)). In some embodiments, the pharmaceutical compositions described herein comprise at least one HBV RNAi agent comprising a sequence targeting the S ORF of an HBV gene and a second HBV RNAi agent comprising a sequence targeting the X ORF of an HBV gene.

In some embodiments, the two HBV RNAi agents are administered at a ratio of about 1:1, 2:1, 3:1, 4:1, or 5: 1. In some embodiments, the two HBV RNAi agents are administered at a ratio of about 2: 1.

In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 150 to 250mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50mg to 100mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100 to 200mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 125mg to 225mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 150 to 250mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300 to 400mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 40mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered at a combined amount of any of about 40mg, about 100mg, or about 200mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered at a combined amount of about 40mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered at a combined amount of about 100mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered at a combined amount of about 200mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W).

In some embodiments, the first RNAi agent is administered in an amount from about 3mg to 650mg per dose administered, and the second RNAi agent is administered in an amount from about 2mg to 325mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 35mg to 265mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 50mg to 75mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 20mg to 125mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 25mg to 50mg per dose administered.

In some embodiments, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose. In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg, and the first RNAi agent is administered to the second RNAi agent at a ratio of 1: 1. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 20mg for a combined dose of about 40 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 200mg for a combined dose of about 400 mg. In some embodiments, the two RNAi agents are administered at an interval of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the two RNAi agents are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 20mg for a combined dose of about 40mg, or in an amount of about 50mg for a combined dose of about 100mg, or in an amount of about 100mg for a combined dose of about 200mg, and the two RNAi agents are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of each of the first and second RNAi agents is about 20mg, and the two RNAi agents are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of each of the first and second RNAi agents is an amount of about 50mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of each of the first and second RNAi agents is in an amount of about 100mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose, and the first RNAi agent is administered to the second RNAi agent at a 2:1 ratio. In one embodiment, for a combined dose of about 25mg, the dose of the first RNAi agent is in an amount of about 16mg and the dose of the second RNAi agent is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35mg, the dose of the first RNAi agent is in an amount of about 24mg and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 40mg, the dose of the first RNAi agent is in an amount of about 27mg and the dose of the second RNAi agent is in an amount of about 13 mg. In one embodiment, for a combined dose of about 50mg, the dose of the first RNAi agent is in an amount of about 33mg and the dose of the second RNAi agent is in an amount of about 17 mg. In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 65mg and the dose of the second RNAi agent is in an amount of about 35 mg. In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 133mg and the dose of the second RNAi agent is in an amount of about 67 mg. In one embodiment, for a combined dose of about 300mg, the dose of the first RNAi agent is in an amount of about 200mg and the dose of the second RNAi agent is in an amount of about 100 mg. In one embodiment, for a combined dose of about 400mg, the dose of the first RNAi agent is in an amount of about 270mg and the dose of the second RNAi agent is in an amount of about 135 mg. In some embodiments, the two RNAi agents are administered at an interval of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the two RNAi agents are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of the first RNAi agent is in an amount of about 27mg and the dose of the second RNAi agent is in an amount of about 13mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 65mg and the dose of the second RNAi agent is in an amount of about 35mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 133mg and the dose of the second RNAi agent is in an amount of about 67mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose, with the first RNAi agent and the second RNAi agent administered at a 3:1 ratio. In one embodiment, for a combined dose of about 25mg, the dose of the first RNAi agent is in an amount of about 18mg and the dose of the second RNAi agent is in an amount of about 6 mg. In one embodiment, for a combined dose of about 35mg, the dose of the first RNAi agent is in an amount of about 27mg and the dose of the second RNAi agent is in an amount of about 9 mg. In one embodiment, for a combined dose of about 40mg, the dose of the first RNAi agent is in an amount of about 30mg and the dose of the second RNAi agent is in an amount of about 10 mg. In one embodiment, for a combined dose of about 50mg, the dose of the first RNAi agent is in an amount of about 36mg and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 75mg and the dose of the second RNAi agent is in an amount of about 25 mg. In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 150mg and the dose of the second RNAi agent is in an amount of about 50 mg. In one embodiment, for a combined dose of about 300mg, the dose of the first RNAi agent is in an amount of about 225mg and the dose of the second RNAi agent is in an amount of about 75 mg. In one embodiment, for a combined dose of about 400mg, the dose of the first RNAi agent is in an amount of about 300mg and the dose of the second RNAi agent is in an amount of about 100 mg. In some embodiments, the two RNAi agents are administered at an interval of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the two RNAi agents are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of the first RNAi agent is in an amount of about 30mg and the dose of the second RNAi agent is in an amount of about 10mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 75mg and the dose of the second RNAi agent is in an amount of about 25mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 150mg and the dose of the second RNAi agent is in an amount of about 50mg, and the two RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, two HBV RNAi agents are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg, about 8.0mg/kg to 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg. In some embodiments, the two HBV RNAi agents are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the two HBV RNAi agents are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In some embodiments, the first RNAi agent is administered in an amount from about 0.6mg/kg to 7mg/kg per dose administered, and the second RNAi agent is administered in an amount from about 0.3mg/kg to 5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.5mg/kg to 2.5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.3mg/kg to 1.5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 0.6mg/kg to 5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 1mg/kg to 2.5mg/kg per dose administered. In some embodiments, the first RNAi agent and the second RNAi agent are administered at an interval of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the first RNAi agent and the second RNAi agent are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

Disclosed herein are methods for inhibiting HBV gene expression comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence in any of table 3.

Disclosed herein are methods for inhibiting HBV gene expression comprising administering one or more HBV RNAi agents having a sense strand comprising a sequence in any of table 4.

Disclosed herein are methods for inhibiting HBV gene expression comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence of any one of table 3 and a sense strand comprising a sequence of any one of table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for inhibiting HBV gene expression comprising administering one or more HBV RNAi agents having an antisense strand consisting of a sequence of any one of the sequences in table 3 and a sense strand consisting of a sequence of any one of the sequences in table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for inhibiting HBV gene expression in a cell comprising administering one or more HBV RNAi agents having the duplex structure of table 5.

Disclosed herein are methods for treating HBV infection or preventing a disease or condition caused by HBV infection, comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence in any of the sequences in table 3.

Disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence in any one of the sequences in table 3.

Disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence in any one of the sequences in table 3.

Disclosed herein are methods for treating HBV infection or preventing a disease or condition caused by HBV infection, comprising administering one or more HBV RNAi agents having a sense strand comprising a sequence in any of table 4.

Disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having a sense strand comprising a sequence in any of table 4.

Disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having a sense strand comprising a sequence in any of table 4.

Disclosed herein are methods for treating an HBV infection or preventing a disease or condition caused by an HBV infection, comprising administering one or more HBV RNAi agents comprising an antisense strand of a sequence in any one of the sequences in table 3 and a sense strand comprising a sequence in any one of the sequences in table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence of any one of table 3 and a sense strand comprising a sequence of any one of table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand comprising a sequence of any one of table 3 and a sense strand comprising a sequence of any one of table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating an HBV infection or preventing a disease or condition caused by an HBV infection, comprising administering one or more HBV RNAi agents having an antisense strand consisting of a sequence in any one of the sequences in table 3 and a sense strand consisting of a sequence in any one of the sequences in table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand consisting of a sequence of any one of the sequences in table 3 and a sense strand consisting of a sequence of any one of the sequences in table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having an antisense strand consisting of a sequence of any one of the sequences in table 3 and a sense strand consisting of a sequence of any one of the sequences in table 4 that is at least partially complementary to the antisense strand.

Disclosed herein are methods for treating HBV infection or preventing a disease or condition caused by HBV infection, comprising administering one or more HBV RNAi agents having the duplex structure of table 5.

Disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having the duplex structure of table 5.

Disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering one or more HBV RNAi agents having the duplex structure of table 5.

Disclosed herein are methods for inhibiting HBV gene expression comprising administering: (i) an HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3.

Disclosed herein are methods for treating HBV infection or preventing a disease or condition caused by HBV infection, the method comprising administering: (i) an HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3.

Disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering: (i) an HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3.

Disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering: (i) an HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any of table 2 or table 3.

Disclosed herein are methods for inhibiting HBV gene expression comprising administering: (i) a first HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 3 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

Disclosed herein are methods for treating HBV infection or preventing a disease or condition caused by HBV infection, the method comprising administering: (i) a first HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 3 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

Disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering: (i) a first HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 3 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

Disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering: (i) a first HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of a sequence in any one of tables 2 or 3 and a sense strand comprising or consisting of a sequence in any one of tables 2 or 3 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

a. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AUUGAGAGAAGUCCACCAC (SEQ ID NO:7) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAU (SEQ ID NO:34) by 0, 1, 2 or 3 nucleobases; or

b. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UUUGAGAGAAGUCCACCAC (SEQ ID NO:8) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAA (SEQ ID NO:35) by 0, 1, 2 or 3 nucleobases; or

c. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) by 0, 1, 2 or 3 nucleobases; or

d. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO:40) by 0, 1, 2 or 3 nucleobases; or

e. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:44) by 0, 1, 2 or 3 nucleobases; or

f. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO:45) by 0, 1, 2 or 3 nucleobases; or

g. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGC (SEQ ID NO:22) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO:49) by 0, 1, 2 or 3 nucleobases; or

h. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGC (SEQ ID NO:23) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO:50) by 0, 1, 2 or 3 nucleobases; or

i. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

j. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO:55) by 0, 1, 2 or 3 nucleobases; or

k. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises an HBV RNAi agent.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises an HBV RNAi agent.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises an HBV RNAi agent.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

and wherein the second HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

iii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

iii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) by 0, 1, 2 or 3 nucleobases; or

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

and wherein the second HBV RNAi agent comprises:

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO:40) by 0, 1, 2 or 3 nucleobases;

and wherein the second HBV RNAi agent comprises:

vii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

viii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

ix) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:44) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

iii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

iii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:44) by 0, 1, 2 or 3 nucleobases; or

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second HBV RNAi agent comprises:

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO:45) by 0, 1, 2 or 3 nucleobases;

and wherein the second HBV RNAi agent comprises:

vii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

viii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

ix) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting expression of one or more HBV genes in a subject, the method comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

and wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

iii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) by 0, 1, 2 or 3 nucleobases; or

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

And wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO:12) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCA (SEQ ID NO:13) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO:40) by 0, 1, 2 or 3 nucleobases;

and wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:44) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

iii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:44) by 0, 1, 2 or 3 nucleobases; or

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO:17), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO:18) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO:45) by 0, 1, 2 or 3 nucleobases;

and wherein the second HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the X ORF of the HBV mRNA.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or symptom or inhibiting the expression of one or more HBV genes in a subject, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the S ORF of an HBV mRNA, and wherein a second HBV RNAi agent comprises:

i) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases, and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

ii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

iii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the S ORF of an HBV mRNA, and wherein a second HBV RNAi agent comprises:

iv) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27), and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or

v) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

vi) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence at least partially complementary to a portion of the S ORF of an HBV mRNA, and wherein a second HBV RNAi agent comprises:

vii) an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:27) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) by 0, 1, 2 or 3 nucleobases; or

viii) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:28) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

ix) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') UACCAAUUUAUGCCUACAG (SEQ ID NO:29) and a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, an HBV RNAi agent disclosed herein comprises:

a. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO:149) by 0, 1, 2 or 3 nucleobases; or

b. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO:150) by 0, 1, 2 or 3 nucleobases; or

c. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO:151) by 0, 1, 2 or 3 nucleobases; or

d. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO:152) by 0, 1, 2 or 3 nucleobases; or

e. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases; or

f. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO:160) by 0, 1, 2 or 3 nucleobases; or

g. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases; or

h. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO:163) by 0, 1, 2 or 3 nucleobases; or

i. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO:170) by 0, 1, 2 or 3 nucleobases; or

j. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases; or

k. An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO:172) by 0, 1, 2 or 3 nucleobases; or

An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO:173) by 0, 1, 2 or 3 nucleobases; or

m. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO:174) by 0, 1, 2 or 3 nucleobases; or

n. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases; or

o. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO:178) by 0, 1, 2 or 3 nucleobases; or

p. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO:179) by 0, 1, 2 or 3 nucleobases; or

q. an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO:180) by 0, 1, 2 or 3 nucleobases; or

r. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:181) by 0, 1, 2 or 3 nucleobases; or

s. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO:182) by 0, 1, 2 or 3 nucleobases; or

t. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO:183) by 0, 1, 2 or 3 nucleobases; or

u. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO:184) by 0, 1, 2 or 3 nucleobases; or

v. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO:185) by 0, 1, 2 or 3 nucleobases; or

w. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO:186) by 0, 1, 2 or 3 nucleobases; or

x. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO:187) by 0, 1, 2 or 3 nucleobases; or

y. antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases; or

z. antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO:189) by 0, 1, 2 or 3 nucleobases; or

an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO:190) by 0, 1, 2 or 3 nucleobases; or

An antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO:191) by 0, 1, 2 or 3 nucleobases; or

cc. antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO:192) by 0, 1, 2 or 3 nucleobases; or

dd. antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO:193) by 0, 1, 2 or 3 nucleobases; or

ee. antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO:194) by 0, 1, 2 or 3 nucleobases;

And wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

a. an antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO:149) by 0, 1, 2 or 3 nucleobases; or

b. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO:150) by 0, 1, 2 or 3 nucleobases; or

c. An antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO:151) by 0, 1, 2 or 3 nucleobases; or

d. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO:152) by 0, 1, 2 or 3 nucleobases; or

e. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases; or

f. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO:160) by 0, 1, 2 or 3 nucleobases; or

g. An antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases; or

h. An antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO:163) by 0, 1, 2 or 3 nucleobases; or

i. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO:170) by 0, 1, 2 or 3 nucleobases; or

j. An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases; or

k. An antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO:172) by 0, 1, 2 or 3 nucleobases; or

An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO:173) by 0, 1, 2 or 3 nucleobases; or

m. an antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO:174) by 0, 1, 2 or 3 nucleobases; or

n. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases; or

o. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO:178) by 0, 1, 2 or 3 nucleobases; or

p. an antisense strand consisting of a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179); or

q. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO:180) by 0, 1, 2 or 3 nucleobases; or

r. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:181) by 0, 1, 2 or 3 nucleobases; or

s. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO:182) by 0, 1, 2 or 3 nucleobases; or

t. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO:183) by 0, 1, 2 or 3 nucleobases; or

u. an antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO:184) by 0, 1, 2 or 3 nucleobases; or

v. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO:185) by 0, 1, 2 or 3 nucleobases; or

w. an antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO:186) by 0, 1, 2 or 3 nucleobases; or

x. an antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO:187) by 0, 1, 2 or 3 nucleobases; or

y. antisense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases; or

z. antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO:189) by 0, 1, 2 or 3 nucleobases; or

an antisense strand consisting of a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or

An antisense strand consisting of a nucleobase sequence differing from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO:191) by 0, 1, 2 or 3 nucleobases; or

cc. antisense strand consisting of a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'→ 3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or

dd. antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO:193) by 0, 1, 2 or 3 nucleobases; or (b).

ee. antisense strand consisting of a nucleobase sequence that differs from the sequence (5'→ 3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO:194) by 0, 1, 2 or 3 nucleobases;

and wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

i. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usAffscFaAfuUfuAfuGfcCfuAfcAfGfcssuAu (SEQ ID NO:61) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing from the sequence (5'→ 3') usAffscFaAfuUfuAffCfCafGfcsCScu (SEQ ID NO:62) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAffcAfcAfGfcssu (SEQ ID NO:63) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAffcAfGgfsc (SEQ ID NO:64) by 0, 1, 2 or 3 nucleotides; or

v. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAfcAfCafgusu (SEQ ID NO:68) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfscscaauAfuAffCfuacagcsc (SEQ ID NO:85) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfsuggafafafGfcfcfcaccacsg (SEQ ID NO:94) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsufAfGfAfAfGfaGfuCfcAfcCfaCfgsa (SEQ ID NO:98) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'→ 3') usAfcscfaafuuuaugfccCfuafcAfgcsc (SEQ ID NO: 102); or

x. an antisense strand comprising a sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'→ 3') usAfcscfaafuuuaugfccCfuafcAfgcusu (SEQ ID NO: 103); or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfcsfaAfuauuGfcCfuAfcAfcaccsu (SEQ ID NO:104) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfcsfaAfuauuGfcCfuAfcAfcafgcccuu (SEQ ID NO:105) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') cppralsafcsfaafuaafafafafafafafafafgfcfafcafgusu (SEQ ID NO:107) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') cppralasfsusufgaafgaafafafagfagffcfccfcaccfasfg (SEQ ID NO:108) by 0, 1, 2 or 3 nucleotides; or

xv. antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcAfcCfausu (SEQ ID NO:109) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'→ 3') usAfsufUfgafgaaaGfuCfcafCfacsg (SEQ ID NO: 110); or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsufGAfgaaaGfufcAfccCfacsusu (SEQ ID NO:111) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsufGAfgaaaGfuCfcAfcCfacsgsa (SEQ ID NO:112) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsufGAfgaaaGfuCfcAfcFacusu (SEQ ID NO:120) by 0, 1, 2 or 3 nucleotides; or

xx. antisense strand comprising a sequence that differs from the sequence (5'→ 3') asGfsasafaAfuUfGAfGfAfAfAfaGfuCfccusu (SEQ ID NO:125) by 0, 1, 2 or 3 nucleotides;

xxi. an antisense strand comprising a sequence differing from the sequence (5'→ 3') asGfsasafaAfuUfAfGfAfGafaGfuCfccasc (SEQ ID NO:126) by 0, 1, 2 or 3 nucleotides; or

xxii. an antisense strand comprising a sequence differing from the sequence (5'→ 3') asGfsasafaAfuUfAfAfAfGafaGfuCfCasc (SEQ ID NO:127) by 0, 1, 2 or 3 nucleotides; or

xxiii. an antisense strand comprising a sequence differing from the sequence (5'→ 3') asGfsasafaAfuUfAfAfGafaGafaGfcfccacsc (SEQ ID NO:128) by 0, 1, 2 or 3 nucleotides; or

xxiv. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usgfasafaafuffuafgaafgaafgaafgafagfuffccusu (SEQ ID NO:129) by 0, 1, 2 or 3 nucleotides; or

xxv. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usgfasafaafuffuafgafgafafgafagffcscacc (SEQ ID NO:130) by 0, 1, 2 or 3 nucleotides; or

xxvi. an antisense strand comprising a sequence differing from the sequence (5'→ 3') ascfcsafafafafufafafafgcfcafafafagfcuss (SEQ ID NO:131) by 0, 1, 2 or 3 nucleotides; or

xxvii. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') ascfcsafafafufufufufufagcfufagcccusu (SEQ ID NO:132) by 0, 1, 2 or 3 nucleotides; or

xxviii. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') ascfcsafafafufufufufufgfcfufafafafagfcusccc (SEQ ID NO:133) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence differing from the sequence (5'→ 3') uscfcsafafafufufafagcfufafafagfccusu (SEQ ID NO:134) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') uscfcsafafafufufufufufufagcfufagcccusu (SEQ ID NO:135) by 0, 1, 2 or 3 nucleotides; or

xxxi. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') cppralsafcscfafafuaafafafafafafafafgfcfafcabgcsc (SEQ ID NO:136) by 0, 1, 2 or 3 nucleotides; or

xxxii. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') usafscscfaafuuuafafafugfccffaafcafsgsc (SEQ ID NO:137) by 0, 1, 2 or 3 nucleotides; or

xxxiii. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') cpprapufscscfafafafuafafafafafgfcfafcabgssc (SEQ ID NO:138) by 0, 1, 2 or 3 nucleotides; or

xxxiv. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAfcAfCafgcsu (SEQ ID NO:139) by 0, 1, 2 or 3 nucleotides; or

xxxv. an antisense strand comprising a sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'→ 3') usafscscfaafuuafafafafgagfcffafcsgsg (SEQ ID NO: 140); or

xxxvi. an antisense strand comprising a sequence differing from the sequence (5'→ 3') asafscscfaafuuuafafafugfccffaafcabgcsc (SEQ ID NO:141) by 0, 1, 2 or 3 nucleotides; or

xxxvii. an antisense strand comprising a sequence differing from the sequence (5'→ 3') usAfsCfaAfuUfUfAffAffGfcCfcAfCafgusu (SEQ ID NO:142) by 0, 1, 2 or 3 nucleotides; or

xxxviii. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') usafscscfaafuuafafafafgfcfcfafcabgcfsc (SEQ ID NO:143) by 0, 1, 2 or 3 nucleotides; or

xxxix. an antisense strand comprising a sequence that differs from the sequence (5'→ 3') ascfcscafafufufufufufufufufagcfufagcfcu (SEQ ID NO:144) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') uscfscafauffufaufufagcfcfufafaggfcfcfcu (SEQ ID NO:145) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') ascfscafauffuufufufufagcfufafafafaggccffagfccsg (SEQ ID NO:146) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') uscfscafauffuufufufufagcfcfufafagfcsg (SEQ ID NO:147) by 0, 1, 2 or 3 nucleotides; or

An antisense strand comprising a sequence that differs from the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAfcAfcAfgggsg (SEQ ID NO:148) by 0, 1, 2 or 3 nucleotides;

wherein a, g, c and u are 2 '-O-methyl (2' -OMe) modified nucleotides; af. Cf, Gf and Uf are 2' -fluoro modified nucleotides; s is a phosphorothioate internucleoside linkage, and the rest nucleotide monomers are connected by phosphodiester linkages; and cPrpu is 5 '-cyclopropylphosphonate-2' -O-methyl modified nucleotide; and wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

i. an antisense strand consisting of the sequence (5'→ 3') usAffscCfaAfuUfuAfuGfcCfuAfcAfGfcssuAu (SEQ ID NO: 61); or

An antisense strand consisting of the sequence (5'→ 3') usAffscFaAfuUfuAffGcfcCfuAfcAfGfcsicu (SEQ ID NO: 62); or

An antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAffCfCfuAfcAfGfcssu (SEQ ID NO: 63); or

An antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAffCfCfuAffcAfGfsc (SEQ ID NO: 64); or

v. an antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAfcAfGusu (SEQ ID NO: 68); or

An antisense strand consisting of the sequence (5'→ 3') usAfscscaauAfuAffGfcCfuacagcsc (SEQ ID NO: 85); or

An antisense strand consisting of the sequence (5'→ 3') usAfsuggAfaGfaCfcaccacg (SEQ ID NO: 94); or

An antisense strand consisting of the sequence (5'→ 3') usAfsufGAfAfgAfaFaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or

An antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuuuAUGfcCfuAfcAfgcsc (SEQ ID NO: 102); or

x. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuuuAUGfcCfuAfcAfgcusu (SEQ ID NO: 103); or

An antisense strand consisting of the sequence (5'→ 3') usAfcscfaafuuuaugfccCfuafcAfccusu (SEQ ID NO: 104); or

An antisense strand consisting of the sequence (5'→ 3') usAfcscfaafuuuaugfccCfuafcAfcccuu (SEQ ID NO: 105); or

An antisense strand consisting of the sequence (5'→ 3') cppufscscfaafuuafafgfcfcfcfafcabgusu (SEQ ID NO: 107); or

An antisense strand consisting of the sequence (5'→ 3') cppresafssuuufgafgafagagfucfcaccfcaccfaccfsg (SEQ ID NO: 108); or

xv. antisense strand consisting of the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcAfcfausu (SEQ ID NO: 109); or

An antisense strand consisting of the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcAfcfacsg (SEQ ID NO: 110); or

An antisense strand consisting of the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcafcCcfcCfacusu (SEQ ID NO: 111); or

An antisense strand consisting of the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcAfccfcFacsgsa (SEQ ID NO: 112); or

An antisense strand consisting of the sequence (5'→ 3') usAfsufgAfgaaaGfuCfcafcAfccusu (SEQ ID NO: 120); or

xx. antisense strand consisting of the sequence (5'→ 3') asGfsasafaAfuUfGAfgAfgAfaGfuCfcusu (SEQ ID NO: 125);

xxi. antisense strand consisting of the sequence (5'→ 3') asGfsasafaAfuUfGAfgAfgAfAfaGfuCfccasc (SEQ ID NO: 126); or

xxii. antisense strand consisting of the sequence (5'→ 3') asGfsasafaAfuUfGAfgAfgAfAfaGfuCfccausu (SEQ ID NO: 127); or

xxiii. antisense strand consisting of the sequence (5'→ 3') asGfsasafaAfuUfGAfgAfgAfAfaGfuCfccacsc (SEQ ID NO: 128); or

xxiv. antisense strand consisting of the sequence (5'→ 3') usGfsasafaAfuUfGAfgAfgAfAfaGfuCfccusu (SEQ ID NO: 129); or

xxv. antisense strand consisting of the sequence (5'→ 3') usGfsasafaAfuUfGAfgAfgAfAfaGfuCfccasc (SEQ ID NO: 130); or

xxvi. antisense strand consisting of the sequence (5'→ 3') asCfscsAfaUfuUfaUfCfCfUfaCfaGfcuu (SEQ ID NO: 131); or

xxvii. antisense strand consisting of the sequence (5'→ 3') ascfcsafafafufufufufufufagcfufagfcssu (SEQ ID NO: 132); or

xxviii. antisense strand consisting of the sequence (5'→ 3') ascfcsafafafufufafgccfufafafafaggccccucucucuscc (SEQ ID NO: 133); or

xxix. antisense strand consisting of the sequence (5'→ 3') uscfcsafafafafufafafagcfufagfccusu (SEQ ID NO: 134); or

xxx, antisense strand consisting of the sequence (5'→ 3') uscfcsafafafauufafgccfufafafafaggccu (SEQ ID NO: 135); or

xxxi. antisense strand consisting of the sequence (5'→ 3') cppralsafcscfafafuaafafafafafafafgfcfcfafcabgcsc (SEQ ID NO: 136); or

xxxii. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAfuGfcCfuAfcAfCafgscsc (SEQ ID NO: 137); or

xxxiii. antisense strand consisting of the sequence (5'→ 3') cppusfcscfaafuuafafafafgfcfcfafcabgssc (SEQ ID NO: 138); or

xxxiv. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or

xxxv. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAffCfuAfcAfgcgsg (SEQ ID NO: 140); or

xxxvi. antisense strand consisting of the sequence (5'→ 3') asafscscfaafuuafafafgfcfcfcfafcabgcsc (SEQ ID NO: 141); or

xxxvii. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfUfAfaGfcCfAFcAfCafgusu (SEQ ID NO: 142); or

xxxviii. antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAfuGfcCfuAfcAfcafgCfsc (SEQ ID NO: 143); or

xxxix. antisense strand consisting of the sequence (5'→ 3') ascfcsafafafafafafufafufagcfufafagcfcfafgcffsu (SEQ ID NO: 144); or

An antisense strand consisting of the sequence (5'→ 3') uscfcacafaufufaufagcfcfufafgagfcfcfcffagccfcu (SEQ ID NO: 145); or

An antisense strand consisting of the sequence (5'→ 3') ascfscafaufuufafgccfufufafafagfcsg (SEQ ID NO: 146); or

An antisense strand consisting of the sequence (5'→ 3') uscfcacafauufafugcfcfcfufufufafgagccfufagccsg (SEQ ID NO: 147); or

Antisense strand consisting of the sequence (5'→ 3') usAfsCfaAfuUfuAfuGfcCfuAfcAfcAfgggsg (SEQ ID NO: 148);

wherein a, g, c and u are 2 '-O-methyl (2' -OMe) modified nucleotides; af. Cf, Gf and Uf are 2' -fluoro modified nucleotides; s is a phosphorothioate internucleoside linkage, and the rest nucleotide monomers are connected by phosphodiester linkages; and cPrpu is 5 '-cyclopropylphosphonate-2' -O-methyl modified nucleotide; and wherein the HBV RNAi agent further comprises a sense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

a. a sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO 275) by 0, 1, 2 or 3 nucleobases; or

b. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO:276) by 0, 1, 2 or 3 nucleobases; or

c. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO:278) by 0, 1, 2 or 3 nucleobases; or

d. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO:285) by 0, 1, 2 or 3 nucleobases; or

e. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO:289) by 0, 1, 2 or 3 nucleobases; or

f. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases; or

g. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases; or

h. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO:300) by 0, 1, 2 or 3 nucleobases; or

i. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; or

j. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO:303) by 0, 1, 2 or 3 nucleobases; or

k. A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO:304) by 0, 1, 2 or 3 nucleobases; or

A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO:306) by 0, 1, 2 or 3 nucleobases; or

m. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; or

n. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:308) by 0, 1, 2 or 3 nucleobases; or

o. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO:318) by 0, 1, 2 or 3 nucleobases; or

p. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO:319) by 0, 1, 2 or 3 nucleobases; or

q. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO:320) by 0, 1, 2 or 3 nucleobases; or

r. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO:321) by 0, 1, 2 or 3 nucleobases; or

s. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO:322) by 0, 1, 2 or 3 nucleobases; or

t. a sense strand comprising a nucleobase sequence which differs from the sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO:323) by 0, 1, 2 or 3 nucleobases; or

A sense strand comprising a nucleobase sequence that differs from the sequence (5'→ 3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO:324) by 0, 1, 2 or 3 nucleobases; or

v. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO:325) by 0, 1, 2 or 3 nucleobases; or

w. the sense strand comprising a nucleobase sequence which differs from the sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO:326) by 0, 1, 2 or 3 nucleobases; or

x. a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:327) by 0, 1, 2 or 3 nucleobases; or

y., which comprises a nucleobase sequence that differs from the sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases; or

z., which comprises a nucleobase sequence differing from the sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO:329) by 0, 1, 2 or 3 nucleobases; or

an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO:330) by 0, 1, 2 or 3 nucleobases; or

A sense strand comprising a nucleobase sequence which differs from the sequence (5'→ 3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO:331) by 0, 1, 2 or 3 nucleobases; or

cc., which comprises a nucleobase sequence differing from the sequence (5'→ 3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO:332) by 0, 1, 2 or 3 nucleobases; or

dd., which comprises a nucleobase sequence that differs from the sequence (5'→ 3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO:333) by 0, 1, 2 or 3 nucleobases; or

ee., which comprises a nucleobase sequence that differs from the sequence (5'→ 3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO:334) by 0, 1, 2 or 3 nucleobases;

and wherein the HBV RNAi agent further comprises an antisense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an HBV RNAi agent disclosed herein comprises:

a. a sense strand consisting of a nucleobase sequence (5'→ 3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or

b. A sense strand consisting of a nucleobase sequence (5'→ 3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or

c. A sense strand consisting of a nucleobase sequence (5'→ 3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or

d. A sense strand consisting of a nucleobase sequence (5'→ 3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or

e. A sense strand consisting of a nucleobase sequence (5'→ 3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or

f. A sense strand consisting of a nucleobase sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or

g. A sense strand consisting of a nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or

h. A sense strand consisting of a nucleobase sequence (5'→ 3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or

i. A sense strand consisting of a nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or

j. A sense strand consisting of a nucleobase sequence (5'→ 3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303); or

k. A sense strand consisting of a nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or

A sense strand consisting of a nucleobase sequence (5'→ 3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or

m. the sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or

n. the sense strand consisting of the nucleobase sequence (5'→ 3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or

o. the sense strand comprising the nucleobase sequence (5'→ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or

p. the sense strand consisting of the nucleobase sequence (5'→ 3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or

q. the sense strand consisting of the nucleobase sequence (5'→ 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or

r. the sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or

s. the sense strand consisting of the nucleobase sequence (5'→ 3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or

t. the sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or

u. the sense strand consisting of the nucleobase sequence (5'→ 3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or

v. the sense strand consisting of the nucleobase sequence (5'→ 3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or

w. the sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or

x. the sense strand consisting of the nucleobase sequence (5'→ 3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327); or

y., the sense strand consisting of the nucleobase sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or

z., the sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or

an antisense strand comprising the nucleobase sequence (5'→ 3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or

A sense strand consisting of a nucleobase sequence (5'→ 3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or

cc. sense strand consisting of the nucleobase sequence (5'→ 3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or

dd. sense strand consisting of the nucleobase sequence (5'→ 3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or

ee. sense strand consisting of the nucleobase sequence (5'→ 3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334);

and wherein the HBV RNAi agent further comprises an antisense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2, or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of a nucleobase sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) and a sense strand consisting of a nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) and a sense strand consisting of the nucleobase sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) and a sense strand consisting of the nucleobase sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) and a sense strand consisting of the nucleobase sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of a nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of a nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) and a sense strand consisting of the nucleobase sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) and a sense strand consisting of the nucleobase sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition for inhibiting HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) and a sense strand consisting of the nucleobase sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, the composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, the composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, the composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2, or 3 nucleobases, and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2, or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307). In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand consisting of the nucleobase sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) and a sense strand consisting of the nucleobase sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO:175) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO:154) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:292) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO:188) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:328) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO:294) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject, comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all nucleotides in a sense strand are modified and/or all or substantially all nucleotides in an antisense strand in a first HBV RNAi agent and/or a second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0 nucleobases, A nucleobase sequence of 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering a composition that inhibits HBV gene expression in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first HBV RNAi agent and/or the second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises the antisense strand and the sense strand, the antisense strand comprises a nucleobase sequence that differs from the sequence (5'→ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO:171) by 0, 1, 2 or 3 nucleobases, the sense strand comprises a nucleobase sequence differing from the sequence (5'→ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO:302) by 0, 1, 2 or 3 nucleobases; and wherein the second HBV RNAi agent comprises an antisense strand comprising a nucleobase sequence differing from sequence (5'→ 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO:162) by 0, 1, 2 or 3 nucleobases and a sense strand comprising a nucleobase sequence differing from sequence (5'→ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) by 0, 1, 2 or 3 nucleobases; and wherein the sense strands of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.

In some embodiments, disclosed herein are methods of treating HBV infection or preventing a disease or condition caused by HBV infection, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 05070. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 2.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 05070. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 2.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 05070. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1: 2.

In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25mg to 400mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25mg to 50mg, 50mg to 75mg, 75mg to 100mg, 100mg to 125mg, 125mg to 150mg, 150mg to 175mg, 175mg to 200mg, 200mg to 225mg, 225mg to 250mg, 250mg to 275mg, 275mg to 300mg, 300mg to 325mg, 325mg to 350mg, 350mg to 375mg, 375mg to 400mg, 25mg to 75mg, 50mg to 100mg, 100mg to 150mg, 150mg to 200mg, 200mg to 250mg, 250mg to 300mg, 300mg to 350mg, 350mg to 400mg, 25mg to 100mg, 50mg to 150mg, 100mg to 200mg, 150mg to 250mg, 200mg to 300mg, 300mg to 400mg, 25mg to 200mg, or 200mg to 400mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 30mg to 50mg, about 90mg to 110mg, or about 190mg to 210mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 30mg to 50mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 90mg to 110mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 190mg to 210mg per dose. In some embodiments, AD04872 to AD05070 are administered in a combined amount of about 25mg, about 50mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg, about 300mg, about 325mg, about 350mg, about 375mg, or about 400mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50mg, about 75mg, about 100mg, or about 125mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 35mg, about 50mg, about 100mg, or about 125mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 40mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 100mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200mg per dose. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) at a combined amount of about 40mg per dose. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) at a combined amount of about 100mg per dose. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) at a combined amount of about 200mg per dose.

In some embodiments, AD04872 and AD05070 are administered at intervals of about 1 to 18 weeks. In some embodiments, AD04872 and AD05070 are administered at about 1 week intervals, about 2 week intervals, about 3 week intervals, about 4 week intervals, about 5 week intervals, about 6 week intervals, about 7 week intervals, about 8 week intervals, about 9 week intervals, about 10 week intervals, about 11 week intervals, about 12 week intervals, about 13 week intervals, about 14 week intervals, about 15 week intervals, about 16 week intervals, about 17 week intervals, or about 18 week intervals. In some embodiments, AD04872 and AD05070 are administered at intervals of about 1 month to 6 months. In some embodiments, AD04872 and AD05070 are administered at about 1 month intervals, about 2 month intervals, about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD05070 are administered at about 4 week intervals or 1 month intervals. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, AD04872 and AD05070 are administered at intervals of about 28 days.

In some embodiments, AD04872 and AD05070 are administered for a duration of about 1 month to 12 months. In some embodiments, AD04872 and AD05070 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, AD04872 and AD05070 are administered for a duration of about 1 to 18 weeks. In some embodiments, AD04872 and AD05070 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD05070 are administered for a duration of about 12 weeks or 3 months.

In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 150mg to 250mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200mg to 300mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50mg to 100mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 125mg to 225mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 150mg to 250mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200mg to 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 35mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 40mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 100mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered at a combined amount of about 40mg, about 100mg, or about 200mg per dose, at a ratio of about 2:1, and at 28 day intervals or about 28 day intervals. In some embodiments, AD04872 and AD05070 are administered at a combined amount of about 40mg per dose, at a ratio of about 2:1, and at 28 day intervals or at about 28 day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered at a combined amount of about 100mg per dose, at a ratio of about 2:1, and at 28 day intervals or at about 28 day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered at a combined amount of about 200mg per dose, at a ratio of about 2:1, and at 28 day intervals or at about 28 day intervals (i.e., Q4W).

In some embodiments, AD04872 is administered in an amount of about 3mg to 650mg per dose, and AD05070 is administered in an amount of about 2mg to 325mg per dose. In some embodiments, AD04872 is administered in an amount of about 35mg to 265mg per dose. In some embodiments, AD04872 is administered in an amount of about 50mg to 75mg per dose. In some embodiments, AD05070 is administered in an amount of about 20mg to 125mg per dose. In some embodiments, AD05070 is administered in an amount of about 25mg to 50mg per dose.

In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 1mg to 10mg per dose. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, AD04872 and AD05070 are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, AD05070 is administered in an amount of about 0.3mg/kg to 5mg/kg per dose, and AD04872 is administered in an amount of about 0.6mg/kg to 7mg/kg per dose. In some embodiments, AD05070 is administered in an amount of about 0.5mg/kg to 2.5mg/kg per dose. In some embodiments, AD05070 is administered in an amount of about 0.3mg/kg to 1.5mg/kg per dose. In some embodiments, AD04872 is administered in an amount of about 0.6mg/kg to 5mg/kg per dose. In some embodiments, AD04872 is administered in an amount of about 1mg/kg to 2.5mg/kg per dose.

In some embodiments, AD04872 and AD05070 are administered at a combined dose of 25mg to 400mg per dose. In one embodiment, AD04872 and AD05070 are administered at a combined dose of 25mg to 400mg, and AD04872 and AD05070 are administered at a ratio of 1: 1. In one embodiment, the dose of AD04872 administered with AD05070 is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 20mg for a combined dose of about 40 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 200mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 20mg for a combined dose of about 40mg, or in an amount of about 50mg for a combined dose of about 100mg, or in an amount of about 100mg for a combined dose of about 200mg, and AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 20mg for a combined dose of about 40mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 50mg for a combined dose of about 100mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD05070 is an amount of about 100mg for a combined dose of about 200mg, and AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD05070 are administered at a combined dose of 25mg to 400mg per dose, and AD05070 and AD04872 are administered at a ratio of 1: 2. In one embodiment, the dose of AD04872 is an amount of about 16mg and the dose of AD05070 is an amount of about 8mg for a combined dose of about 25 mg. In one embodiment, the dose of AD05070 is in an amount of about 12mg and the dose of AD04872 is in an amount of about 24mg for a combined dose of about 35 mg. In one embodiment, the dose of AD05070 is in an amount of about 13mg and the dose of AD04872 is in an amount of about 27mg for a combined dose of about 40 mg. In one embodiment, the dose of AD04872 is an amount of about 33mg and the dose of AD05070 is an amount of about 17mg for a combined dose of about 50 mg. In one embodiment, the dose of AD05070 is in an amount of about 35mg and the dose of AD04872 is in an amount of about 65mg for a combined dose of about 100 mg. In one embodiment, the dose of AD05070 is in an amount of about 67mg and the dose of AD04872 is in an amount of about 133mg for a combined dose of about 200 mg. In one embodiment, the dose of AD05070 is in an amount of about 100mg and the dose of AD04872 is in an amount of about 200mg for a combined dose of about 300 mg. In one embodiment, the dose of AD05070 is in an amount of about 135mg and the dose of AD04872 is in an amount of about 270mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD05070 is an amount of about 13mg, and the dose of AD04872 is an amount of about 27mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD05070 is an amount of about 35mg and the dose of AD04872 is an amount of about 65mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD05070 is an amount of about 67mg and the dose of AD04872 is an amount of about 133mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD05070 are administered at a combined dose of 25mg to 400mg per dose, AD05070 and AD04872 are administered at a ratio of 1: 3. In one embodiment, the dose of AD04872 is an amount of 18mg and the dose of AD05070 is an amount of about 6mg for a combined dose of about 25 mg. In one embodiment, the dose of AD05070 is in an amount of about 9mg and the dose of AD04872 is in an amount of about 27mg for a combined dose of about 35 mg. In one embodiment, the dose of AD05070 is in an amount of about 10mg and the dose of AD04872 is in an amount of about 30mg for a combined dose of about 40 mg. In one embodiment, the dose of AD04872 is an amount of about 36mg and the dose of AD05070 is an amount of about 12mg for a combined dose of about 50 mg. In one embodiment, the dose of AD05070 is in an amount of about 25mg and the dose of AD04872 is in an amount of about 75mg for a combined dose of about 100 mg. In one embodiment, the dose of AD05070 is in an amount of about 50mg and the dose of AD04872 is in an amount of about 150mg for a combined dose of about 200 mg. In one embodiment, the dose of AD05070 is in an amount of about 75mg and the dose of AD04872 is in an amount of about 225mg for a combined dose of about 300 mg. In one embodiment, the dose of AD05070 is in an amount of about 100mg and the dose of AD04872 is in an amount of about 300mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD05070 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD05070 is an amount of about 10mg, and the dose of AD04872 is an amount of about 30mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD05070 is an amount of about 25mg, and the dose of AD04872 is an amount of about 75mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD05070 is an amount of about 50mg, and the dose of AD04872 is an amount of about 150mg, and AD04872 and AD05070 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W).

In some embodiments, a subject in need thereof is administered about 1mg/kg (mpk) of AD04872 and about 1mg/kg of AD 05070. In some embodiments, about 1.5mg/kg of AD04872 and about 1.5mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 2.0mg/kg of AD04872 and about 1.0mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 3.0mg/kg of AD04872 and about 1.0mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 3.2mg/kg of AD04872 and about 0.8mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 2.7mg/kg of AD04872 and about 1.3mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 4.0mg/kg of AD04872 and about 1.0mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 3.3mg/kg of AD04872 and about 1.7mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, between about 0.05mg/kg and about 5mg/kg of AD04872 and between about 0.05mg/kg and about 5mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about AD04872 and about AD05070 are administered separately (e.g., injected separately). In some embodiments, a respective dose of AD04872 and a respective dose of AD05070 are administered together (e.g., in the same injection). In some embodiments, a corresponding dose of AD04872 and a corresponding dose of AD05070 are prepared in a single pharmaceutical composition.

In some embodiments, disclosed herein are methods of treating an HBV infection or preventing a disease or condition caused by an HBV infection, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04776. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1: 2.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04776. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1: 2.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04776. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1: 2.

In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25mg to 400mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25mg to 50mg, 50mg to 75mg, 75mg to 100mg, 100mg to 125mg, 125mg to 150mg, 150mg to 175mg, 175mg to 200mg, 200mg to 225mg, 225mg to 250mg, 250mg to 275mg, 275mg to 300mg, 300mg to 325mg, 325mg to 350mg, 350mg to 375mg, 375mg to 400mg, 25mg to 75mg, 50mg to 100mg, 100mg to 150mg, 150mg to 200mg, 200mg to 250mg, 250mg to 300mg, 300mg to 350mg, 350mg to 400mg, 25mg to 100mg, 50mg to 150mg, 100mg to 200mg, 150mg to 250mg, 200mg to 300mg, 300mg to 400mg, 25mg to 200mg, or 200mg to 400mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 30mg to 50mg, about 90mg to 110mg, or about 190mg to 210mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 30mg to 50mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 90mg to 110mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 190mg to 210mg per dose. In some embodiments, AD04872 to AD04776 are administered in a combined amount of about 25mg, about 50mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg, about 300mg, about 325mg, about 350mg, about 375mg, or about 400mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50mg, about 75mg, about 100mg, or about 125mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 35mg, about 50mg, about 100mg, about 200mg, about 300mg, or about 400mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 100mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200mg per dose. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 40mg, about 100mg, or about 200 mg. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 40 mg. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) in a combined amount of about 100mg per dose. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 200 mg.

In some embodiments, AD04872 and AD04776 are administered at intervals of about 1 to 18 weeks. In some embodiments, AD04872 and AD04776 are administered at about 1 week intervals, about 2 week intervals, about 3 week intervals, about 4 week intervals, about 5 week intervals, about 6 week intervals, about 7 week intervals, about 8 week intervals, about 9 week intervals, about 10 week intervals, about 11 week intervals, about 12 week intervals, about 13 week intervals, about 14 week intervals, about 15 week intervals, about 16 week intervals, about 17 week intervals, or about 18 week intervals. In some embodiments, AD04872 and AD04776 are administered at intervals of about 1 month to 6 months. In some embodiments, AD04872 and AD04776 are administered at about 1 month intervals, about 2 month intervals, about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD04776 are administered at about 4 week intervals or 1 month intervals. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, AD04872 and AD04776 are administered at about 28 day intervals (i.e., Q4W).

In some embodiments, AD04872 and AD04776 are administered for a duration of about 1 month to 12 months. In some embodiments, AD04872 and AD04776 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, AD04872 and AD04776 are administered for a duration of about 1 to 18 weeks. In some embodiments, AD04872 and AD04776 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD04776 are administered for a duration of about 12 weeks or 3 months.

In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 150mg to 250mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200mg to 300mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50mg to 100mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 125mg to 225mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 150mg to 250mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200mg to 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 35mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 100mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered at a combined amount of about 40mg, about 100mg, or about 200mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered at a combined amount of about 40mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered at a combined amount of about 100mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered at a combined amount of about 200mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W).

In some embodiments, AD04872 is administered in an amount of about 3mg to 650mg per dose, and AD04776 is administered in an amount of about 2mg to 325mg per dose. In some embodiments, AD04872 is administered in an amount of about 35mg to 265mg per dose. In some embodiments, AD04872 is administered in an amount of about 50mg to 75mg per dose. In some embodiments, AD04776 is administered in an amount of about 20mg to 125mg per dose. In some embodiments, AD04776 is administered in an amount of about 25mg to 50mg per dose.

In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 1mg to 10mg per dose. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, AD04872 and AD04776 are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 8.5mg/kg, 8.0mg/kg, about 8.0mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, AD04776 is administered in an amount of about 0.3 to 5mg/kg per dose, and AD04872 is administered in an amount of about 0.6 to 7mg/kg per dose. In some embodiments, AD04776 is administered in an amount of about 0.5mg to 2.5mg per dose. In some embodiments, AD04776 is administered in an amount of about 0.3mg to 1.5mg per dose. In some embodiments, AD04872 is administered in an amount of about 0.6mg to 5mg per dose. In some embodiments, AD04872 is administered in an amount of about 1mg to 2.5mg per dose.

In some embodiments, AD04872 and AD04776 are administered at a combined dose of 25mg to 400mg per dose. In one embodiment, AD04872 and AD04776 are administered at a combined dose of 25mg to 400mg, and AD04872 to AD04776 are administered at a 1:1 ratio. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 20mg for a combined dose of about 40 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 200mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 20mg for a combined dose of about 40mg, or in an amount of about 50mg for a combined dose of about 100mg, or in an amount of about 100mg for a combined dose of about 200mg, and AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of each of AD04872 and AD04776 is an amount of about 20mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD04776 is an amount of about 50mg for a combined dose of about 100mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of each of AD04872 and AD04776 is an amount of about 100mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD04776 are administered at a combined dose of 25mg to 400mg per dose, and AD04776 is administered at a 1:2 ratio to AD 04872. In one embodiment, for a combined dose of about 25mg, the dose of AD04872 is in an amount of about 16mg and the dose of AD04776 is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35mg, the dose of AD04776 is in an amount of about 12mg and the dose of AD04872 is in an amount of about 24 mg. In one embodiment, the dose of AD04776 is in an amount of about 13mg and the dose of AD04872 is in an amount of about 27mg for a combined dose of about 40 mg. In one embodiment, for a combined dose of about 50mg, the dose of AD04872 is in an amount of about 33mg and the dose of AD04776 is in an amount of about 17 mg. In one embodiment, the dose of AD04776 is in an amount of about 35mg and the dose of AD04872 is in an amount of about 65mg for a combined dose of about 100 mg. In one embodiment, for a combined dose of about 200mg, the dose of AD04776 is in an amount of about 67mg and the dose of AD04872 is in an amount of about 133 mg. In one embodiment, the dose of AD04776 is in an amount of about 100mg and the dose of AD04872 is in an amount of about 200mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04776 is in an amount of about 135mg and the dose of AD04872 is in an amount of about 270mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD04776 is an amount of about 13mg and the dose of AD04872 is an amount of about 27mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD04776 is an amount of about 35mg and the dose of AD04872 is an amount of about 65mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD04776 is an amount of about 67mg and the dose of AD04872 is an amount of about 133mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD04776 are administered at a combined dose of 25mg to 400mg per dose, AD04776 and AD04872 are administered at a 1:3 ratio. In one embodiment, for a combined dose of about 25mg, the dose of AD04872 is in an amount of 18mg and the dose of AD04776 is in an amount of about 6 mg. In one embodiment, for a combined dose of about 35mg, the dose of AD04776 is in an amount of about 9mg and the dose of AD04872 is in an amount of about 27 mg. In one embodiment, the dose of AD04776 is in an amount of about 10mg and the dose of AD04872 is in an amount of about 30mg for a combined dose of about 40 mg. In one embodiment, for a combined dose of about 50mg, the dose of AD04872 is in an amount of about 36mg and the dose of AD04776 is in an amount of about 12 mg. In one embodiment, the dose of AD04776 is in an amount of about 25mg and the dose of AD04872 is in an amount of about 75mg for a combined dose of about 100 mg. In one embodiment, the dose of AD04776 is in an amount of about 50mg and the dose of AD04872 is in an amount of about 150mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04776 is in an amount of about 75mg and the dose of AD04872 is in an amount of about 225mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04776 is in an amount of about 100mg and the dose of AD04872 is in an amount of about 300mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD04776 is an amount of about 10mg and the dose of AD04872 is an amount of about 30mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD04776 is an amount of about 25mg and the dose of AD04872 is an amount of about 75mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD04776 is an amount of about 50mg and the dose of AD04872 is an amount of about 150mg, and AD04872 and AD04776 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In some embodiments, a subject in need thereof is administered about 1mg/kg (mpk) of AD04872 and about 1mg/kg of AD 04776. In some embodiments, about 1.5mg/kg of AD04872 and about 1.5mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 2.0mg/kg of AD04872 and about 1.0mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 3.0mg/kg of AD04872 and about 1.0mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, a subject in need thereof is administered about 3.2mg/kg of AD04872 and about 0.8mg/kg of AD 04776. In some embodiments, a subject in need thereof is administered about 2.7mg/kg of AD04872 and about 1.3mg/kg of AD 04776. In some embodiments, about 4.0mg/kg of AD04872 and about 1.0mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, a subject in need thereof is administered about 3.3mg/kg of AD04872 and about 1.7mg/kg of AD 04776. In some embodiments, between about 0.05mg/kg and about 5mg/kg of AD04872 and between about 0.05mg/kg and about 5mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, the AD04872 and AD04776 are administered separately at respective doses (e.g., separate injections). In some embodiments, the respective doses of AD04872 and AD04776 are administered together (e.g., in the same injection). In some embodiments, the respective doses of AD04872 and AD04776 are prepared in a single pharmaceutical composition.

In some embodiments, disclosed herein are methods of treating HBV infection or preventing a disease or condition caused by HBV infection, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04982. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1: 2.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with infection by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04982. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1: 2.

In some embodiments, disclosed herein are methods for treating a disease associated with infection by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD 04982. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1: 2.

In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25mg to 400mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25mg to 50mg, 50mg to 75mg, 75mg to 100mg, 100mg to 125mg, 125mg to 150mg, 150mg to 175mg, 175mg to 200mg, 200mg to 225mg, 225mg to 250mg, 250mg to 275mg, 275mg to 300mg, 300mg to 325mg, 325mg to 350mg, 350mg to 375mg, 375mg to 400mg, 25mg to 75mg, 50mg to 100mg, 100mg to 150mg, 150mg to 200mg, 200mg to 250mg, 250mg to 300mg, 300mg to 350mg, 350mg to 400mg, 25mg to 100mg, 50mg to 150mg, 150mg to 250mg, 200mg to 300mg, 300mg to 400mg, 25mg to 200mg, or 200mg to 400 mg. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 30mg to 50mg, about 90mg to 110mg, or about 190mg to 210mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 30mg to 50mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 90mg to 110mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 190mg to 210mg per dose. In some embodiments, AD04872 to AD04982 are administered in a combined amount of about 25mg, about 50mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg, about 300mg, about 325mg, about 350mg, about 375mg, or about 400mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 50mg, about 75mg, about 100mg, or about 125mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 35mg, about 50mg, about 100mg, about 200mg, about 300mg, or about 400mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200mg per dose. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 40mg, about 100mg, or about 200 mg. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 40 mg. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 100 mg. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W) per dose in a combined amount of about 200 mg.

In some embodiments, AD04872 and AD04982 are administered at intervals of about 1 to 18 weeks. In some embodiments, AD04872 and AD04982 are administered at about 1 week intervals, about 2 week intervals, about 3 week intervals, about 4 week intervals, about 5 week intervals, about 6 week intervals, about 7 week intervals, about 8 week intervals, about 9 week intervals, about 10 week intervals, about 11 week intervals, about 12 week intervals, about 13 week intervals, about 14 week intervals, about 15 week intervals, about 16 week intervals, about 17 week intervals, or about 18 week intervals. In some embodiments, AD04872 and AD04982 are administered at intervals of about 1 month to 6 months. In some embodiments, AD04872 and AD04982 are administered at about 1 month intervals, about 2 month intervals, about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD04982 are administered at about 4 week intervals or 1 month intervals. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, AD04872 and AD04982 are administered at about 28 day intervals (i.e., Q4W).

In some embodiments, AD04872 and AD04982 are administered for a duration of about 1 month to 12 months. In some embodiments, AD04872 and AD04982 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, AD04872 and AD04982 are administered for a duration of about 1 to 18 weeks. In some embodiments, AD04872 and AD04982 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD04982 are administered for a duration of about 12 weeks or 3 months.

In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 150mg to 250mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200mg to 300mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 50mg to 100mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100mg to 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 125mg to 225mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 150 to 250mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 35mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 400mg per dose and at a ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at a combined amount of about 40mg, about 100mg, or about 200mg per dose, at a ratio of about 2:1, and at 28 day intervals or about 28 day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at a combined amount of about 40mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at a combined amount of about 100mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at a combined amount of about 200mg per dose, at a ratio of about 2:1, and at 28-day intervals or about 28-day intervals (i.e., Q4W).

In some embodiments, AD04872 is administered in an amount of about 3mg to 650mg per dose, and AD04982 is administered in an amount of about 2mg to 325mg per dose. In some embodiments, AD04872 is administered in an amount of about 35mg to 265mg per dose. In some embodiments, AD04872 is administered in an amount of about 50mg to 75mg per dose. In some embodiments, AD04982 is administered in an amount of about 20mg to 125mg per dose. In some embodiments, AD04982 is administered in an amount of about 25mg to 50mg per dose.

In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 1mg to 10mg per dose. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, AD04872 and AD04982 are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 8.5mg/kg, 8.0mg/kg, about 8.0mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, AD04982 is administered in an amount of about 0.3 to 5mg/kg per dose, and AD04872 is administered in an amount of about 0.6 to 7mg/kg per dose. In some embodiments, AD04982 is administered in an amount of about 0.5mg/kg to 2.5mg/kg per dose. In some embodiments, AD04982 is administered in an amount of about 0.3mg/kg to 1.5mg/kg per dose. In some embodiments, AD04872 is administered in an amount of about 0.6mg/kg to 5mg/kg per dose. In some embodiments, AD04872 is administered in an amount of about 1mg/kg to 2.5mg/kg per dose.

In some embodiments, AD04872 and AD04982 are administered at a combined dose of 25mg to 400mg per dose. In one embodiment, AD04872 and AD04982 are administered at a combined dose of 25mg to 400mg, and AD04872 and AD04982 are administered at a ratio of 1: 1. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 20mg for a combined dose of about 40 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 200mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 20mg for a combined dose of about 40mg, or in an amount of about 50mg for a combined dose of about 100mg, or in an amount of about 100mg for a combined dose of about 200mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of each of AD04872 and AD04982 is an amount of about 20mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04872 and AD04982 is an amount of about 50mg for a combined dose of about 100mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of each of AD04872 and AD04982 is an amount of about 100mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD04982 are administered at a combined dose of 25mg to 400mg per dose, and AD04982 is administered at a ratio of 1:2 to AD 04872. In one embodiment, for a combined dose of about 25mg, the dose of AD04872 is in an amount of about 16mg and the dose of AD04982 is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35mg, the dose of AD04982 is an amount of about 12mg and the dose of AD04872 is an amount of about 24 mg. In one embodiment, the dose of AD04982 is in an amount of about 13mg and the dose of AD04872 is in an amount of about 27mg for a combined dose of about 40 mg. In one embodiment, for a combined dose of about 50mg, the dose of AD04872 is in an amount of about 33mg and the dose of AD04982 is in an amount of about 17 mg. In one embodiment, the dose of AD04982 is an amount of about 35mg and the dose of AD04872 is an amount of about 65mg for a combined dose of about 100 mg. In one embodiment, for a combined dose of about 200mg, the dose of AD04982 is an amount of about 67mg and the dose of AD04872 is an amount of about 133 mg. In one embodiment, for a combined dose of about 300mg, the dose of AD04982 is an amount of about 100mg and the dose of AD04872 is an amount of about 200 mg. In one embodiment, for a combined dose of about 400mg, the dose of AD04982 is an amount of about 135mg and the dose of AD04872 is an amount of about 270 mg. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD04982 is an amount of about 13mg and the dose of AD04872 is an amount of about 27mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD04982 is an amount of about 35mg and the dose of AD04872 is an amount of about 65mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD04982 is an amount of about 67mg and the dose of AD04872 is an amount of about 133mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In one embodiment, AD04872 and AD04982 are administered at a combined dose of 25mg to 400mg per dose, AD04982 and AD04872 are administered at a ratio of 1: 3. In one embodiment, for a combined dose of about 25mg, the dose of AD04872 is an amount of 18mg and the dose of AD04982 is an amount of about 6 mg. In one embodiment, for a combined dose of about 35mg, the dose of AD04982 is an amount of about 9mg and the dose of AD04872 is an amount of about 27 mg. In one embodiment, the dose of AD04982 is in an amount of about 10mg and the dose of AD04872 is in an amount of about 30mg for a combined dose of about 40 mg. In one embodiment, for a combined dose of about 50mg, the dose of AD04872 is in an amount of about 36mg and the dose of AD04982 is in an amount of about 12 mg. In one embodiment, the dose of AD04982 is an amount of about 25mg and the dose of AD04872 is an amount of about 75mg for a combined dose of about 100 mg. In one embodiment, for a combined dose of about 200mg, the dose of AD04982 is an amount of about 50mg and the dose of AD04872 is an amount of about 150 mg. In one embodiment, for a combined dose of about 300mg, the dose of AD04982 is an amount of about 75mg and the dose of AD04872 is an amount of about 225 mg. In one embodiment, for a combined dose of about 400mg, the dose of AD04982 is an amount of about 100mg and the dose of AD04872 is an amount of about 300 mg. In some embodiments, AD04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of AD04982 is an amount of about 10mg and the dose of AD04872 is an amount of about 30mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of AD04982 is an amount of about 25mg and the dose of AD04872 is an amount of about 75mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the dose of AD04982 is an amount of about 50mg and the dose of AD04872 is an amount of about 150mg, and AD04872 and AD04982 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W).

In some embodiments, a subject in need thereof is administered about 1mg/kg (mpk) of AD04872 and about 1mg/kg of AD 04982. In some embodiments, about 1.5mg/kg of AD04872 and about 1.5mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 2.0mg/kg of AD04872 and about 1.0mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 3.0mg/kg of AD04872 and about 1.0mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 3.2mg/kg of AD04872 and about 0.8mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 2.7mg/kg of AD04872 and about 1.3mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 4.0mg/kg of AD04872 and about 1.0mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 3.3mg/kg of AD04872 and about 1.7mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, between about 0.05mg/kg and about 5mg/kg of AD04872 and between about 0.05mg/kg and about 5mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, the AD04872 and AD04982 are administered separately at respective doses (e.g., separate injections). In some embodiments, respective doses of AD04872 and AD04982 are administered together (e.g., in the same injection). In some embodiments, the respective doses of AD04872 and AD04982 are prepared in a single pharmaceutical composition.

In some embodiments, disclosed herein are methods of treating an HBV infection or preventing a disease or condition caused by an HBV infection, comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD 04585. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 2. In some embodiments, a subject in need thereof is administered with an AD04580 of about 1mg/kg (mpk) and an AD04585 of about 1 mg/kg. In some embodiments, a subject in need thereof is administered with about 1.5mg/kg AD04580 and about 1.5mg/kg AD 04585. In some embodiments, a subject in need thereof is administered an AD04580 of between about 0.05mg/kg and about 5mg/kg and an AD04585 of between about 0.05mg/kg and about 5 mg/kg.

In some embodiments, disclosed herein are methods for treating or preventing a disease associated with an infection caused by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD 04585. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 2. In some embodiments, a subject in need thereof is administered with an AD04580 of about 1mg/kg (mpk) and an AD04585 of about 1 mg/kg. In some embodiments, a subject in need thereof is administered with about 1.5mg/kg AD04580 and about 1.5mg/kg AD 04585. In some embodiments, a subject in need thereof is administered an AD04580 of between about 0.05mg/kg and about 5mg/kg and an AD04585 of between about 0.05mg/kg and about 5 mg/kg.

In some embodiments, disclosed herein are methods for treating a disease associated with an infection caused by HBV, the method comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD 04585. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 2. In some embodiments, a subject in need thereof is administered with an AD04580 of about 1mg/kg (mpk) and an AD04585 of about 1 mg/kg. In some embodiments, a subject in need thereof is administered with about 1.5mg/kg AD04580 and about 1.5mg/kg AD 04585. In some embodiments, a subject in need thereof is administered an AD04580 of between about 0.05mg/kg and about 5mg/kg and an AD04585 of between about 0.05mg/kg and about 5 mg/kg.

In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 25mg to 400 mg. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 50mg, about 75mg, about 100mg, or about 125mg per dose. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 40mg, about 100mg, or about 200mg per dose. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 40mg per dose. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 100mg per dose. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 200mg per dose. In some embodiments, AD04580 and AD04585 are administered at intervals of about 1 to 18 weeks. In some embodiments, AD04580 and AD04585 are administered at intervals of about 1 month to 6 months. In some embodiments, AD04580 and AD04585 are administered at about 4 week intervals or 1 month intervals. In some embodiments, AD04580 and AD04585 are administered at an interval of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W) per dose in a combined amount of about 40mg, about 100mg, or about 200 mg. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W) per dose in a combined amount of about 40 mg. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W) per dose in a combined amount of about 100 mg. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W) per dose in a combined amount of about 200 mg.

In some embodiments, AD04580 and AD04585 are administered for a duration of about 1 month to 12 months. In some embodiments, AD04580 and AD04585 are administered for a duration of about 3 months. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 25mg to 400mg per dose and are administered at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 100mg per dose and are administered at a ratio of about 2: 1.

In some embodiments, AD04580 is administered in an amount from about 3mg to 650mg per dose, and AD04585 is administered in an amount from about 2mg to 325mg per dose. In some embodiments, AD04580 is administered in an amount of about 35mg to 265mg per dose. In some embodiments, AD04580 is administered in an amount of about 50mg to 75mg per dose. In some embodiments, AD04585 is administered in an amount from about 20mg to 125mg per dose. In some embodiments, AD04585 is administered in an amount of about 25mg to 50mg per dose.

In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 1mg to 10mg per dose. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, AD04580 and AD04585 are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, AD04585 is administered in an amount of about 0.3 to 5mg/kg per dose, and AD04580 is administered in an amount of about 0.6 to 7mg/kg per dose. In some embodiments, AD04585 is administered in an amount of about 0.5 to 2.5mg/kg per dose. In some embodiments, AD04585 is administered in an amount of about 0.3 to 1.5mg/kg per dose. In some embodiments, AD04580 is administered in an amount of about 0.6mg/kg to 5mg/kg per dose. In some embodiments, AD04580 is administered in an amount of about 1mg/kg to 2.5mg/kg per dose.

In some embodiments, AD04580 and AD04585 are administered in a combined dose of 25mg to 400mg per dose. In one embodiment, AD04580 and AD04585 are administered in a combined dose of 25mg to 400mg, and AD04580 and AD04585 are administered at a 1:1 ratio. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 20mg for a combined dose of about 40 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of AD04580 and AD04585 is an amount of about 200mg for a combined dose of about 400 mg. In some embodiments, AD04580 and AD04585 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 20mg for a combined dose of about 40mg, or in an amount of about 50mg for a combined dose of about 100mg, or in an amount of about 100mg for a combined dose of about 200mg, and AD04580 and AD04585 are administered at 28-day intervals or at about 28-day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the dose of each of AD04580 and AD04585 is an amount of about 20mg, and AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the dose of each of AD04580 and AD04585 is an amount of about 50mg, and AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combination dose of about 200mg, the dose of each of AD04580 and AD04585 is an amount of about 100mg, and AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W).

In one embodiment, AD04580 and AD04585 are administered in a combined dose of 25mg to 400mg per dose, and AD04585 and AD04580 are administered at a 1:2 ratio. In one embodiment, the dose of AD04580 is in an amount of about 16mg and the dose of AD04585 is in an amount of about 8mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04585 is in an amount of about 12mg and the dose of AD04580 is in an amount of about 24mg for a combined dose of about 35 mg. In one embodiment, the dose of AD04585 is in an amount of about 13mg and the dose of AD04580 is in an amount of about 27mg for a combined dose of about 40 mg. In one embodiment, the dose of AD04580 is in an amount of about 33mg and the dose of AD04585 is in an amount of about 17mg for a combined dose of about 50 mg. In one embodiment, the dose of AD04585 is in an amount of about 35mg and the dose of AD04580 is in an amount of about 65mg for a combined dose of about 100 mg. In one embodiment, the dose of AD04585 is an amount of about 67mg and the dose of AD04580 is an amount of about 133mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04585 is in an amount of about 100mg and the dose of AD04580 is in an amount of about 200mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04585 is in an amount of about 135mg and the dose of AD04580 is in an amount of about 270mg for a combined dose of about 400 mg. In some embodiments, AD04580 and AD04585 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the AD04585 dose is in an amount of about 13mg and the AD04580 dose is in an amount of about 27mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the AD04585 dose is in an amount of about 35mg and the AD04580 dose is in an amount of about 65mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the AD04585 dose is in an amount of about 67mg and the AD04580 dose is in an amount of about 133mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W).

In one embodiment, AD04580 and AD04585 are administered in a combined dose of 25mg to 400mg per dose, and AD04585 and AD04580 are administered at a 1:3 ratio. In one embodiment, the dose of AD04580 is an amount of 18mg and the dose of AD04585 is an amount of about 6mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04585 is in an amount of about 9mg and the dose of AD04580 is in an amount of about 27mg for a combined dose of about 35 mg. In one embodiment, the dose of AD04585 is in an amount of about 10mg and the dose of AD04580 is in an amount of about 30mg for a combined dose of about 40 mg. In one embodiment, the dose of AD04580 is in an amount of about 36mg and the dose of AD04585 is in an amount of about 12mg for a combined dose of about 50 mg. In one embodiment, the dose of AD04585 is in an amount of about 25mg and the dose of AD04580 is in an amount of about 75mg for a combined dose of about 100 mg. In one embodiment, the dose of AD04585 is in an amount of about 50mg and the dose of AD04580 is in an amount of about 150mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04585 is in an amount of about 75mg and the dose of AD04580 is in an amount of about 225mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04585 is in an amount of about 100mg and the dose of AD04580 is in an amount of about 300mg for a combined dose of about 400 mg. In some embodiments, AD04580 and AD04585 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 40mg, the AD04585 dose is in an amount of about 10mg and the AD04580 dose is in an amount of about 30mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 100mg, the AD04585 dose is in an amount of about 25mg and the AD04580 dose is in an amount of about 75mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W). In one embodiment, for a combined dose of about 200mg, the AD04585 dose is in an amount of about 50mg and the AD04580 dose is in an amount of about 150mg, and the AD04580 and AD04585 are administered at 28 day intervals or at about 28 day intervals (i.e., Q4W).

Provided herein is a method for inhibiting expression of a hepatitis b virus gene in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 111, 126, 127, 128, 171, 175, 179 and 180 SEQ ID NOs, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 235 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 307 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

And wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 50mg to 400mg per month.

Also provided herein is a method for treating a disease, disorder or condition associated with infection by hepatitis b virus in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

And wherein the first RNAi agent and the second RNAi agent are administered in an amount of about 50mg to 400mg per month.

In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered at a ratio of about 1:1, 2:1, 3:1, 4:1, or 5: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered at a ratio of about 2: 1.

In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 25mg to 75mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 50mg to 125mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 75mg to 150mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 100mg to 200mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 150 to 250mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 200 to 300mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 300mg to 400mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 50mg to 100mg per dose and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 25 to 400mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 50 to 125mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 75 to 150mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 100 to 200mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 125mg to 225mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 150 to 250mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 300 to 400mg per dose and at a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 35mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 40mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 100mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 200mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 300mg per dose and in a ratio of about 2: 1. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 400mg per dose and in a ratio of about 2: 1.

In some embodiments, the first RNAi agent is administered in an amount from about 3mg to 650mg per dose administered, and the second RNAi agent is administered in an amount from about 2mg to 325mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 35mg to 265mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 50mg to 75mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 20mg to 125mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 25mg to 50mg per dose administered.

In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 1mg/kg to 10mg/kg per dose administered. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered in a combined amount of about 1mg/kg to 5mg/kg per dose administered. In some embodiments, the first HBV RNAi agent and the second HBV RNAi agent are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 8.5mg/kg to 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, the first RNAi agent is administered in an amount from about 0.6mg/kg to 7mg/kg per dose administered, and the second RNAi agent is administered in an amount from about 0.3mg/kg to 5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.5mg/kg to 2.5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.3mg/kg to 1.5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 0.6mg/kg to 5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 1mg/kg to 2.5mg/kg per dose administered.

In some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD05070 linked to (NAG37) s, the AD05070 exhibiting a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD05070 linked to (NAG25) s, the AD05070 exhibiting a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD05070 linked to (NAG37) s, the AD05070 being shown as a free acid having a structure represented by the formula:

In some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD04580 linked to (NAG31) s, the AD04580 being shown as a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD04585 linked to (NAG25) s, the AD04585 being shown as a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD04872 linked to (NAG37) s, the AD04872 appearing as a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD04872 linked to (NAG25) s, the AD04872 appearing as a sodium salt having a structure represented by the formula:

in some embodiments, the HBV RNAi agents disclosed herein consist of or comprise AD04872 linked to (NAG37) s, the AD04872 displayed as a free acid having a structure represented by the formula:

in some embodiments, the HBV RNAi agent is optionally combined with one or more additional therapeutic agents (i.e., second, third, etc.). The second therapeutic agent can be another HBV RNAi agent (e.g., an HBV RNAi agent targeting a different sequence within the HBV genome). The additional therapeutic agent may also be a small molecule drug, an antibody fragment, and/or a vaccine. The HBV RNAi agent can be combined with one or more excipients to form a pharmaceutical composition, with or without one or more additional therapeutic agents.

In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is a nucleoside inhibitor or a nucleotide inhibitor. In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is entecavir, tenofovir alafenamide, tenofovir disoproxil, lamivudine, or another antiviral therapeutic agent. In some embodiments, the nucleoside inhibitor is entecavir or tenofovir. In some embodiments, entecavir is administered in an amount of 0.5mg to 1mg per day. In some embodiments, tenofovir is administered in an amount of 300mg once per day.

In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is an interferon. In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is interferon-alpha. In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional HBV therapeutic agents, wherein the additional therapeutic agent is an HBV vaccine.

In some embodiments, the one or more HBV RNAi agents are optionally combined with one or more additional therapeutic agents in a single dosage form (i.e., a mixture contained in a single injection). In some embodiments, the one or more HBV RNAi agents can be administered separately from one or more optional additional therapeutic agents. In some embodiments, the one or more HBV RNAi agents are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutic agents are administered orally, which together provide a treatment regimen for diseases and disorders associated with HBV infection. In some embodiments, the one or more HBV RNAi agents are administered to a subject in need thereof by subcutaneous injection, and the one or more optional additional therapeutic agents are administered by subcutaneous injection alone.

In some embodiments, disclosed herein are compositions for in vivo delivery of an HBV RNAi agent to a hepatocyte, the compositions comprising an HBV RNAi agent conjugated or linked to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein receptor ligand. In some embodiments, compositions for in vivo delivery of HBV RNAi agents to hepatocytes are described, the compositions comprising an HBV RNAi agent linked to an N-acetyl-galactosamine targeting ligand.

In some embodiments, one or more of the HBV RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

The use of one or more hepatitis b virus RNAi agents provides methods for the therapeutic and/or prophylactic treatment of diseases/disorders associated with HBV infection. The HBV RNAi agents mediate RNA interference to inhibit expression of one or more genes necessary for replication and/or pathogenesis of hepatitis b virus. In particular, for example, HBV RNAi agents can inhibit viral polymerase, core protein, surface antigen, e antigen, and/or X protein in a cell, tissue, or mammal. HBV RNAi agents are useful for treating HBV infection. HBV RNAi agents may also be used to treat or prevent chronic liver diseases/disorders associated with HBV infection, inflammation, fibrotic disorders and proliferative disorders, such as cancer. In some embodiments, the method further comprises treating Hepatitis Delta Virus (HDV) in the subject. Such methods comprise administering an HBV RNAi agent to a human or animal infected with HBV. In addition, compositions for in vivo delivery of HBV RNAi agents to liver cells are described.

In another aspect, described herein are methods for treating and/or prophylactically treating a disease/disorder associated with HBV infection or inhibiting expression of one or more HBV genes, comprising administering a pharmaceutical composition comprising one or more HBV RNAi agents, which can be administered in a variety of ways, depending on whether local or systemic treatment is desired. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., by an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

The HBV RNAi agents and/or compositions can be used in methods of prophylactic treatment of HBV infection or a disease or disorder caused by HBV infection. Such methods comprise administering an HBV RNAi agent as described herein to a subject, e.g., a human or animal subject.

As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may be independently modified or unmodified.

As used herein, an "RNAi agent" or "RNAi trigger" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent may act through an RNA interference mechanism (i.e., RNA interference is induced by interaction with an RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of a mammalian cell) or through any alternative mechanism or pathways. It is believed that while the term RNAi agent as used herein acts primarily through the RNA interference mechanism, the RNAi agents disclosed herein are not constrained or limited by any particular pathway or mechanism of action. RNAi agents disclosed herein consist of a sense strand and an antisense strand, and include, but are not limited to: short interfering rna (sirna), double-stranded rna (dsrna), micro rna (mirna), short hairpin rna (shrna), and dicer substrate. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA. The RNAi agent can consist of modified nucleotides and/or one or more non-phosphodiester linkages.

As used herein, the terms "silence," "decrease," "inhibit," "down-regulate," or "knock-out," when referring to the expression of a given gene, means that when a cell, population of cells, tissue, organ, or subject is treated with an oligomeric compound (such as an RNAi agent) described herein, the expression of the gene will be reduced, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in the cell, population of cells, tissue, organ, or subject that is transcribed from the gene, as compared to a second cell, population of cells, tissue, organ, or subject that is not, or has not, so treated.

As used herein, the term "sequence" or "nucleotide sequence" means a succession or order of nucleobases or nucleotides described by a series of letters using standard nomenclature.

As used herein, a "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound, which is a standard component of all nucleic acids, and includes bases that form the nucleotides adenine (a), guanine (G), cytosine (C), thymine (T), and uracil (U). Nucleobases can be further modified to include but are not limited to universal bases, hydrophobic bases, hybrid bases, size-enlarging bases, and fluorine-containing bases.

As used herein, and unless otherwise indicated, the term "complementary," when used to describe the relatedness of a first nucleotide sequence (e.g., RNAi agent sense strand or target mRNA) to a second nucleotide sequence (e.g., RNAi agent antisense strand or single-stranded antisense oligonucleotide), means that the oligonucleotide or polynucleotide comprising the first nucleotide sequence hybridizes (under mammalian physiological conditions (or in vitro similar conditions) to form base-pair hydrogen bonds) to an oligonucleotide or polynucleotide comprising the second nucleotide sequence and under certain conditions forms a duplex or duplex structure. Complementary sequences include Watson Crick base pairs or non-Watson Crick base pairs and include natural or modified nucleotides or nucleotide mimics at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is not relevant for the modification. For example, a and Af are complementary to U (or T) and identical to a for the purpose of determining identity or complementarity.

As used herein, "fully complementary" or "fully complementary" means that all (100%) bases in a contiguous sequence of a first polynucleotide will hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

As used herein, "partially complementary" means that at least 70% but not all of the bases in a contiguous sequence of a first polynucleotide will hybridize to the same number of bases in a contiguous sequence of a second polynucleotide in a hybridizing pair of nucleobase sequences.

As used herein, "subject," "patient," or "individual" includes mammals, such as humans or other animals, and typically humans. In some embodiments, the subject (e.g., patient) to whom the therapeutic agents and compositions are administered is a mammal, typically a primate, such as a human. In some embodiments, the primate is a monkey or a simian. The subject may be male or female and may be of any suitable age, including infant, juvenile, adolescent, adult and geriatric subjects. In some embodiments, the subject is a non-primate mammal, such as a rodent, dog, cat, livestock (such as a cow or horse), and the like.

As used herein, "substantially complementary" refers to at least about 85% but not all of the bases in a contiguous sequence of a first polynucleotide that will hybridize to the same number of bases in a contiguous sequence of a second polynucleotide in a hybridizing pair of nucleobase sequences. The terms "complementary," "fully complementary," and "substantially complementary" herein may be used for base matching between the sense and antisense strands of a double-stranded RNAi agent, between the antisense strand of a RNAi agent and the sequence of a target mRNA, or between a single-stranded antisense oligonucleotide and a target mRNA sequence.

As used herein, the term "substantially identical" or "substantial identity" when applied to nucleic acid sequences means that the nucleic acid sequences comprise sequences having at least about 85% or more (preferably at least 90%, at least 95%, or at least 99%) sequence identity as compared to a reference sequence. The percent sequence identity is determined by comparing the two optimally aligned sequences over a comparison window. The percentage is calculated as follows: the number of positions at which the same nucleobase occurs in both sequences is determined to give the number of matched positions, the number of matched positions is divided by the total number of positions in the window of comparison, and the result is then multiplied by 100 to give the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein (e.g., in table 2, table 3, and table 4). In some embodiments, the sequences disclosed herein are identical or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to those disclosed herein (e.g., in table 1, table 2, table 3, and table 4).

As used herein, the terms "treat", "treating" and the like refer to a method or step taken to alleviate or reduce the number, severity and/or frequency of one or more symptoms of a disease or disorder in a subject.

As used herein, when referring to oligomeric compounds, the phrase "introduced into a cell" refers to the functional delivery of the oligomeric compounds to the cell. The phrase "functional delivery" refers to the delivery of an oligomeric compound to a cell in a manner that results in the oligomeric compound having a desired biological activity (e.g., sequence-specific inhibition of gene expression).

Unless otherwise indicated, the symbols used hereinBy use of (a) is meant that any one or more groups may be attached thereto, consistent with the scope of the invention described herein.

As used herein, the term "isomer" refers to compounds having the same molecular formula but differing in the nature or order of bonding of their atoms or arrangement of their atoms in space. Isomers that differ in their arrangement in atom space are referred to as "stereoisomers". Stereoisomers that are not mirror images of each other are referred to as "non-stereoisomers", while stereoisomers that are not overlapping mirror images are referred to as "enantiomers" or sometimes optical isomers. The carbon atom bonded to four different substituents is called a "chiral center".

As used herein, unless a structure is specifically indicated as having a particular conformation, for each structure in which an asymmetric center is present and thus enantiomers, diastereomers, or other stereoisomeric configurations are produced, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as individual stereoisomers.

As used in the claims herein, the phrase "consisting of …" excludes any element, step, or ingredient not specified in the claims. The phrase "consisting essentially of," as used in the claims herein, limits the scope of the claims to the specified materials or steps and to materials or steps that do not materially affect one or more of the basic and novel features of the claimed invention.

One of ordinary skill in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (such as pH), as will be readily understood by one of ordinary skill in the art.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

Drawings

The features and advantages of the present disclosure will be better understood with reference to the following detailed description, which sets forth illustrative embodiments of the disclosure, and the accompanying drawings.

Fig. 1 shows the mean log HBsAg change from day 1 for CHB patients from different cohorts (c 2b, c3b, c4b, c5b, c8 and c9 of example 19).

FIG. 2 shows the individual variation of HBV DNA from CHB patients of different cohorts (c 2b, c8 and c9 of example 19). The solid line indicates patients who are HBeAg positive, and the dotted line indicates patients who are HBeAg negative.

FIG. 3 shows the individual variation of HBV DNA from CHB patients of different cohorts (c 1b, c1c, c4b, c5b, c7, c9, c10 and c11 of example 19).

Figure 4 shows the individual variation of log HBV RNA for CHB patients from cohort 10 of example 19.

Figure 5 shows the individual variation of log HBV RNA for CHB patients from cohort 7 of example 19.

Fig. 6 shows the individual variation of log HBV RNA from different cohorts (c 2b, c3b, c4b, c5b, c8 and c9 of example 19) of CHB patients. The solid line indicates patients who are HBeAg positive, and the dotted line indicates patients who are HBeAg negative.

Fig. 7 shows the individual variation of HBeAg from different cohorts of CHB patients (c 2b, c4b, c5b, c8 and c9 of example 19).

Figure 8 shows the individual variation of HBeAg from different cohorts of CHB patients (c 1b, c3b and c10 of example 19).

Fig. 9 shows the individual variation of HBcrAg for CHB patients from different cohorts (c 2b, c3b, c4b, c5b, c8 and c9 of example 19). The solid line indicates patients who are HBeAg positive, and the dotted line indicates patients who are HBeAg negative.

Figure 10 shows the individual variation of HBcrAg of CHB patients from cohort 6 of example 19.

Figure 11 shows the individual variation of HBcrAg of CHB patients from cohort 7 of example 19.

Figure 12 shows the individual variation of HBcrAg from the CHB patients of cohort 10 of example 19.

Figure 13 shows the nadir log HBsAg reduction in HBeAg positive and HBeAg negative patients.

Fig. 14 shows the mean log HBsAg change from day 1 for CHB patients from different cohorts (c 2b, c3b, c4b, c5b, c8 and c9 of example 19).

Figure 15 shows the mean change in antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of example 20).

Figure 16 shows the mean change of antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of example 20).

Figure 17 shows the mean HBsAg change from day 1 to day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of example 21, respectively. On days 1, 29 and 57, three subcutaneous doses of RNAi components were administered to the patient: 25mg (cohort 1b), 50mg (cohort 1c), 100mg (cohort 2b), 200mg (cohort 3b), 300mg (cohort 4b) or 400mg (cohort 5 b). All patients were given NA daily.

Figure 18 shows mean HBsAg and individual HBsAg changes at day 113 from day 1 for all patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of example 21. The arrowed dots indicate HBeAg positive patients. The circle without arrows indicates HBeAg negative patients.

Fig. 19A to 19D show individual changes of HBV DNA, HBV RNA, HBeAg and HBcrAg from day 1 to day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of example 21, respectively. On days 1, 29 and 57, three subcutaneous doses of RNAi components were administered to the patient: 25mg (cohort 1b), 50mg (cohort 1c), 100mg (cohort 2b), 200mg (cohort 3b), 300mg (cohort 4b) or 400mg (cohort 5 b). And all patients were given NA daily. Each line represents an individual CHB patient.

Figure 20 shows the mean change in antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at 28 day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of example 20; up to day 932).

Figure 21 shows the mean change in antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of example 20, up to day 392).

Figure 22 shows sustained inhibition of HBsAg in patient subpopulations approximately 9 months after the last RNAi dose (mean 1.74); see example 20: 8 CHB patients/cohort (with or without NA; HBeAg + ve or-ve) received 3 subcutaneous JNJ-3989 doses of 100mg, 200mg, 300mg (n-16) or 400mg (day 1, day 27, day 57); patients started/continued to use NA on day 1 and continued throughout the study.

Detailed Description

Described herein are methods of treating and/or preventing a symptom or disease associated with an infection caused by Hepatitis B Virus (HBV) or inhibiting the expression of one or more hepatitis b virus genes in a subject in need thereof. In particular, described herein are methods for treating or preventing an HBV-associated disease or condition or inhibiting the expression of one or more HBV genes in a subject comprising administering an RNAi agent that inhibits the expression of Hepatitis B Virus (HBV) (referred to herein as an HBV RNAi agent or HBV RNAi trigger). Each HBV RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand may each be 16 to 30 nucleotides in length. In some embodiments, the sense strand and antisense strand may each be 17 to 26 nucleotides in length. The sense strand and antisense strand may be of the same length or they may be of different lengths. In some embodiments, the sense strand and antisense strand are each independently 17 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 17 to 21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand and antisense strand are both 26 nucleotides in length. In some embodiments, the RNAi agent sense strand and antisense strand are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the double stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. The region of complete or substantial complementarity between the sense and antisense strands is typically 15 to 25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length and occurs at or near the 5 'end of the antisense strand (e.g., the region of incomplete or substantial complementarity may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides).

The sense strand and antisense strand each comprise a core stretch sequence of 16 to 23 nucleobases in length. The antisense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to as, e.g., a target sequence) present in the HBV mRNA target. The sense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch in the antisense strand, and thus the sense strand core stretch is identical or at least about 85% identical to the nucleotide sequence present in the HBV mRNA target (the target sequence). The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence or it may be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

Examples of nucleotide sequences for the sense and antisense strands used to form the HBV RNAi agents are provided in tables 3 and 4. Examples of RNAi agent duplexes comprising the nucleotide sequences in tables 3 and 4 are provided in table 5.

The sense and antisense strands of the HBV RNAi agent anneal to form a duplex. The sense and antisense strands of the HBV RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least about 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least about 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense strand of the HBV RNAi agent and the antisense core stretch sequence have a region of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that are at least 85% base paired or 100% base paired).

In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs from any of the antisense strand sequences in table 2 or table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs from any of the sense strand sequences in table 2 or table 4 by 0, 1, 2, or 3 nucleotides.

The sense and antisense strands of the HBV RNAi agents described herein are independently 16 to 30 nucleotides in length. In some embodiments, the length of the sense strand and the antisense strand are independently 17 to 26 nucleotides. In some embodiments, the sense strand and the antisense strand are 19 to 26 nucleotides in length. In some embodiments, the RNAi agent sense strand and antisense strand are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The sense strand and antisense strand may be of the same length or they may be of different lengths. In some embodiments, the sense strand and antisense strand are each 26 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length.

The sense strand and/or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3 'end, 5' end, or both the 3 'end and 5' end of the core sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in the HBV mRNA. The additional nucleotides of the sense strand, if present, may be the same or different from the corresponding sequence in the HBV mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

As used herein, an extension comprises 1, 2, 3, 4, 5 or 6 nucleotides at the 5 'and/or 3' end of the sense strand core stretch sequence and/or the antisense strand core stretch sequence. The extended nucleotide on the sense strand may or may not be complementary to the nucleotide (core stretch sequence nucleotide or extended nucleotide) in the corresponding antisense strand. Conversely, an extension nucleotide on the antisense strand may or may not be complementary to a nucleotide (core stretch sequence nucleotide or extension nucleotide) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent comprise 3 'and 5' extensions. In some embodiments, one or more of the 3 'extending nucleotides of one strand base pair with one or more of the 5' extending nucleotides of the other strand. In other embodiments, one or more of the 3 'extending nucleotides of one strand do not base pair with one or more of the 5' extending nucleotides of the other strand. In some embodiments, the HBV RNAi agent has an antisense strand with a 3 'extension and a sense strand with a 5' extension.

In some embodiments, the HBV RNAi agent comprises a 3' extended antisense strand 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the HBV RNAi agent comprises a 3' extended antisense strand 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymine nucleotides or nucleotides complementary to a corresponding HBV mRNA sequence. In some embodiments, 3' antisense strand extension includes, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5 'to 3'), or a combination thereof.

In some embodiments, the 3' end of the antisense strand may include an additional abasic nucleoside (Ab). In some embodiments, an Ab or AbAb may be added to the 3' end of the antisense strand.

In some embodiments, the HBV RNAi agent comprises a 5' extended antisense strand 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, the HBV RNAi agent comprises a 5' extended antisense strand 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymine nucleotides or nucleotides complementary to a corresponding HBV mRNA sequence. In some embodiments, the 5' antisense strand extension includes, or consists of, but is not limited to, UA, TU, U, T, UU, TT, CUC (each listed 5' to 3 '). If present, the antisense strand may have a combination of any of the 3 'extensions described above with any of the 5' antisense strand extensions.

In some embodiments, the HBV RNAi agent comprises a 3' extended sense strand 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise an adenosine, uracil or thymine nucleotide, an AT dinucleotide, or a nucleotide corresponding to a nucleotide in the HBV mRNA sequence. In some embodiments, the 3' sense strand extension includes, but is not limited to: t, UT, TT, UU, UUT, TTT, or TTTT (each listed 5 'to 3'), or consist thereof.

In some embodiments, the 3' end of the sense strand may include an additional abasic nucleoside. In some embodiments, a UUAb, UAb, or Ab may be added to the 3' end of the sense strand. In some embodiments, one or more abasic nucleosides added to the 3' end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted abasic nucleosides at or near one or more ends of a sense strand of a RNAi agent can allow for enhanced activity or other desirable properties of the RNAi agent.

In some embodiments, the HBV RNAi agent comprises a 5' extended sense strand 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides corresponding to nucleotides in HBV mRNA sequences. In some embodiments, the sense strand 5' extension may be, but is not limited to: CA. AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5 'to 3'). The sense strand may have a 3 'extension and/or a 5' extension.

In some embodiments, the 5' end of the sense strand may include an additional abasic nucleoside (Ab) or nucleoside (AbAb). In some embodiments, one or more abasic nucleosides added to the 5' end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted abasic nucleosides at or near one or more ends of a sense strand of a RNAi agent can allow for enhanced activity or other desirable properties of the RNAi agent.

Examples of nucleotide sequences for forming HBV RNAi agents are provided in tables 3 and 4. In some embodiments, the HBV RNAi agent antisense strand comprises the nucleotide sequence of any one of the sequences of table 3. In some embodiments, the HBV RNAi agent antisense strand comprises a nucleotide sequence of 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any one of the sequences of table 3. In some embodiments, the sense strand of the HBV RNAi agent comprises the nucleotide sequence of any one of the sequences in table 4. In some embodiments, the HBV RNAi agent detection strand comprises 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 6-20, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-23, 3-24, 4-23, 4-24, 6-26, or 6-26, 7-24, 7-25, 8-25 and 8-26.

In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise a different number of nucleotides. In some embodiments, the 5 'end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, the 3 'end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is blunt. As used herein, blunt end refers to the end of a double stranded RNAi agent in which the terminal nucleotides of the two annealing strands are complementary (forming complementary base pairs). In some embodiments, the 5 'end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a loose end. In some embodiments, the 3 'end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a loose end. In some embodiments, both ends of the RNAi agent form a dispersing end. In some embodiments, neither end of the RNAi agent is a loose end. As used herein, a loose end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealing strands form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, overhang is the stretching of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. Unpaired nucleotides can be located on either the sense or antisense strand, thereby creating a 3 'or 5' overhang. In some embodiments, the RNAi agent comprises: blunt end and loose end, blunt end and 5 'overhang end, blunt end and 3' overhang end, loose end and 5 'overhang end, loose end and 3' overhang end, two 5 'overhang ends, two 3' overhang ends, 5 'overhang end and 3' overhang end, two loose ends or two blunt ends.

A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids, and includes adenine (a), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term "nucleotide" may include modified nucleotides (such as nucleotide mimics, abasic sites (abs), or alternative replacement moieties). When used in various polynucleotide or oligonucleotide constructs, the modified nucleotides can retain the activity of compounds in the cell while increasing the serum stability of these compounds, and can also minimize the likelihood of activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

In some embodiments, the HBV RNAi agent is prepared or provided in the form of a salt, a mixed salt, or a free acid. In some embodiments, the HBV RNAi agent is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein.

Modified nucleotide

In some embodiments, the HBV RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2' -hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides (denoted Ab herein), 2' -modified nucleotides, 3' to 3' linked (inverted) nucleotides (denoted invdN, invN, invAb herein), non-natural base containing nucleotides, bridging nucleotides, Peptide Nucleic Acids (PNAs), 2',3' -seco nucleotide mimetics (unlocked nucleobase analogs, denoted NUNA or NUNA herein), locked nucleotides (denoted NLNA or NLNA herein), 3' -O-methoxy (2' internucleoside linked) nucleotides (denoted 3' -OMen herein), 2' -F-arabinonucleotides (denoted NfANA or NfANA herein), 5' -Me,2' -fluoro nucleotides (denoted 5Me-Nf herein), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (denoted vnn herein) pd herein, Vinyl phosphonate containing nucleotides and cyclopropyl phosphonate containing nucleotides (cPrpN). 2 '-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to: 2 '-O-methyl nucleotides (denoted herein as the lower case' n 'in the nucleotide sequence), 2' -deoxy-2 '-fluoro nucleotides (denoted herein as Nf, also denoted herein as 2' -fluoro nucleotides), 2 '-deoxy nucleotides (denoted herein as dN), 2' -methoxyethyl (2 '-O-2-methoxyethyl) nucleotides (denoted herein as NM or 2' -MOE), 2 '-amino nucleotides and 2' -alkyl nucleotides. All sites in a given compound do not need to be uniformly modified. Conversely, more than one modification may be incorporated in a single HBV RNAi agent or even in a single nucleotide thereof. Sense and antisense strands of HBV RNAi agents can be synthesized and/or modified by methods known in the art. The modification on one nucleotide is independent of the modification on the other nucleotide.

Modified nucleobases include synthetic and natural nucleobases such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthines, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-N-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-N-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azacytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is one having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands that are ribonucleotides. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are both ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand that are both ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are ribonucleotides.

Modified internucleoside linkages

In some embodiments, one or more nucleotides of the HBV RNAi agent are linked by a non-standard bond or backbone (i.e., a modified internucleoside bond or a modified backbone). In some embodiments, the modified internucleoside linkage is a covalent internucleoside linkage comprising a non-phosphate group. Modified internucleoside linkages or backbones include, but are not limited to: a 5' -phosphorothioate group (denoted herein as lower case "s"), a chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphotriester, alkylphosphonate (e.g., methylphosphonate or 3' -alkylenephosphonate), chiral phosphonate, phosphinate, phosphoramide (e.g., 3' -phosphoramide, aminoalkyl phosphoramide, or thiophosphoramide), thioalkyl-phosphonate, thioalkyl phosphate, morpholino linkage, boranophosphate with normal 3' -5' linkage, a boranophosphate analog with 2' -5' linkage, or a boranophosphate with reversed polarity in which adjacent nucleotide units are 3' -5' to 5' -3' or 2' -5' to 5' -2' linkages. In some embodiments, the modified internucleoside linkage or the backbone does not comprise a phosphorus atom. Modified internucleoside linkages that do not contain a phosphorus atom include, but are not limited to: short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatoms and alkyl or cycloalkyl intersugar linkages or one or more short chain heteroatoms or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to: siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formylacetyl and thiocarbonylacyl backbones, methylene formylacetyl and thiocarbonylacyl backbones, alkene-containing backbones, sulfamic acid backbones, methylene imino and methylene hydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S and CH2 components.

In some embodiments, the sense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, and the antisense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, and each of the sense and antisense strands can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, and both the sense and antisense strands can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

In some embodiments, the sense strand of the HBV RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides from 1 to 3 positions from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, the HBV RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides from 1 to 3 positions from the 5 'end of the sense strand and between the nucleotides from 19 to 21, 20 to 22, 21 to 23, 22 to 24, 23 to 25 or 24 to 26 positions from the 5' end. In some embodiments, the HBV RNAi agent comprises at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.

In some embodiments, the HBV RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2' -modified nucleoside is mixed with the modified internucleoside linkage.

HBV RNAi agents

In some embodiments, the HBV RNAi agents disclosed herein target HBV genes at or near the HBV genomic positions shown in table 1 below. In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target HBV 19-mer sequence disclosed in table 1.

TABLE 1 exemplary 19-mer HBV cDNA target sequences (taken from hepatitis B Virus (ADW 2) Subtype), genotype A, complete genome GenBank AM282986.1(SEQ ID NO:1))。

In some embodiments, the HBV RNAi agent comprises an antisense strand, wherein position 19 (5 '→ 3') of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in table 1. In some embodiments, the HBV RNAi agent comprises an antisense strand, wherein position 1 (5 '→ 3') of the antisense strand is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in table 1.

In some embodiments, the HBV RNAi agent comprises an antisense strand, wherein position 2 (5 '→ 3') of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in table 1. In some embodiments, the HBV RNAi agent comprises an antisense strand, wherein positions 2 to 18 (5 '→ 3') of the antisense strand are capable of forming base pairs with each of the corresponding complementary bases disclosed in table 1 at positions 18 to 2 of the 19-mer target sequence.

In some embodiments, the HBV RNAi agent comprises a core 19-mer nucleotide sequence set forth in table 2 below.

Table 2.HBV RNAi agent antisense and sense strand core stretch sequences (N ═ any nucleotides)。

The sense and antisense strands of the HBV RNAi agents comprising or consisting of the nucleotide sequences in table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the HBV RNAi agent having sense and antisense strand sequences comprising or consisting of the nucleotide sequences in table 2 are all modified or substantially all modified nucleotides.

In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs from any of the antisense strand sequences in table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs from any of the sense strand sequences in table 2 by 0, 1, 2, or 3 nucleotides.

The modified HBV RNAi agent antisense strand sequences, as well as their potential unmodified sequences, are provided in table 3. The modified HBV RNAi agent sense strand sequences, as well as their potential unmodified sequences, are provided in table 4. In forming the HBV RNAi agent, each nucleotide in each unmodified sequence listed in tables 3 and 4 can be a modified nucleotide.

As used herein (including in tables 3 and 4), the following symbols are used to represent modified nucleotides, targeting groups, and linking groups. Unless sequence is otherwise indicated, as will be readily understood by one of ordinary skill in the art, when present in an oligonucleotide, these monomers are linked to each other by a 5'-3' -phosphodiester linkage:

a ═ adenosine-3' -phosphate;

c ═ cytidine-3' -phosphate;

g ═ guanosine-3' -phosphate;

u-uridine-3' -phosphate

n-any 2' -OMe modified nucleotide

a ═ 2 '-O-methyladenosine-3' -phosphate

as 2 '-O-methyladenosine-3' -phosphorothioate

c ═ 2 '-O-methylcytidine-3' -phosphate

cs ═ 2 '-O-methylcytidine-3' -phosphorothioate

2 '-O-methylguanosine-3' -phosphate

2 '-O-methylguanosine-3' -phosphate

t ═ 2 '-O-methyl-5-methyluridine-3' -phosphate

ts ═ 2 '-O-methyl-5-methyluridine-3' -phosphorothioate

u ═ 2 '-O-methyluridine-3' -phosphate

us ═ 2 '-O-methyluridine-3' -phosphorothioate

Any 2' -fluoro modified nucleotide

Af 2 '-fluoroadenosine-3' -phosphate ester

Afs-2 '-fluoroadenosine-3' -phosphorothioate

2 '-Fluorocytidine-3' -phosphate

2 '-fluorocytidine-3' -thiophosphate in Cfs

2 '-fluoroguanosine-3' -phosphate

Gfs-2 '-fluoroguanosine-3' -phosphorothioate

Tf 2' -fluoro-5 ' -methyluridine-3 ' -phosphate

Tfs ═ 2' -fluoro-5 ' -methyluridine-3 ' -phosphorothioate

2 '-Fluorouridine-3' -phosphate

Ufs-2 '-fluorouridine-3' -thiophosphate

dN ═ any 2' -deoxyribonucleotide

dT 2 '-deoxythymidine-3' -phosphate

N_UNA2',3' -secondary nucleotide mimetics (unlocked nucleobase analogues)

N_LNALocked nucleotide

Nf_ANA2' -F-arabino-nucleotides

NM ═ 2' -methoxyethyl nucleotide

AM ═ 2 '-methoxyethyladenosine-3' -phosphorothioate

AMs-2 '-methoxyethyladenosine-3' -phosphorothioate

TM 2 '-methoxyethyl thymidine 3' -phosphate

TMs 2 '-methoxyethyl thymidine-3' -phosphorothioate

R ═ ribitol

(invdN) ═ any inverted deoxyribonucleotides (3'-3' linked nucleotides)

(invAb) ═ inverted (3'-3' linked) abasic deoxyribonucleotides, see Table 6

(invAb) s ═ inverted (3 '-linked) abasic deoxyribonucleotide-5' -phosphorothioate, see Table 6

(invn) ═ any inverted 2' -OMe nucleotides (3' -3' linked nucleotides)

s ═ phosphorothioate linkages

vpdN ═ vinylphosphonate deoxyribonucleotide

(5Me-Nf) ═ 5'-Me,2' -fluoronucleotide

cPrp ═ cyclopropyl phosphonate, see table 6

See Table 6 for epTcPr ═ e

See table 6 for epTM ═ c

One of ordinary skill in the art will readily appreciate that the terminal nucleotide at the 3 'end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of a given monomer, rather than a phosphate moiety in vitro. Thus, for example, AS shown above in the structural representation of AD05070, the "g" modified nucleotide at the terminal 3 'end of the antisense strand of AM06606-AS has a hydroxyl group at its 3' position. Such understanding by one of ordinary skill in the art is used when describing the HBV RNAi agents and compositions of HBV RNAi agents disclosed herein, unless otherwise specifically indicated herein.

Targeting groups and linking groups include the following, the chemical structures of which are provided in table 6 below: (PAZ), (NAG13), (NAG13) s, (NAG18), (NAG18) s, (NAG24), (NAG24) s, (NAG25), (NAG25) s, (NAG26), (NAG26) s, (NAG27), (NAG27) s, (NAG28), (NAG28) s, (NAG29), (NAG29) s, (NAG30), (NAG30) s, (NAG31), (NAG31) s, (NAG32), (NAG32) s, (NAG33), (NAG33) s, (NAG34), (NAG34) s, (NAG35), (NAG35 NAG), (NAG36), (NAG36) s, (NAG37), (NAG37) s, (NAG38), (NAG38) s, (NAG39) NAG39) NAG. Each sense strand and/or antisense strand may have any of the targeting groups or linking groups listed above as well as other targeting or linking groups conjugated to the 5 'and/or 3' ends of the sequence.

The HBV RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand comprising a sequence listed in table 4 can hybridize to any antisense strand comprising a sequence listed in table 3, provided that the two sequences have regions that are at least about 85% complementary over the contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequences.

In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs from any of the antisense strand sequences in table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs from any of the sense strand sequences in table 4 by 0, 1, 2, or 3 nucleotides.

In some embodiments, the HBV RNAi agent antisense strand comprises the nucleotide sequence of any one of the sequences in table 3. In some embodiments, the HBV RNAi agent antisense strand comprises a nucleotide sequence (from 5 'end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any one of the sequences in table 3.

In some embodiments, the sense strand of the HBV RNAi agent comprises the nucleotide sequence of any one of the sequences in table 4. In some embodiments, the sense strand of the HBV RNAi agent comprises (from 5 'end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, any one of the sequences in Table 4, 2-26, 3-26 or 4-26.

For the HBV RNAi agents disclosed herein, the nucleotide at position 1 (from 5 'end → 3' end) of the antisense strand may be fully complementary to the HBV gene, or may be non-complementary to the HBV gene. In some embodiments, the nucleotide at position 1 (from 5 'end → 3' end) of the antisense strand is U, A or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5 'end → 3' end) forms an a: U or U: a base pair with the sense strand.

In some embodiments, the HBV RNAi agent antisense strand comprises the nucleotide sequence of (from 5 'end → 3' end) 2-18 or 2-19 of any one of the antisense strand sequences in table 3. In some embodiments, the sense strand of the HBV RNAi agent comprises the nucleotide sequence of (from 5 'end → 3' end) 1-17 or 1-18 of any of the sense strand sequences in table 4.

In some embodiments, the HBV RNAi agent comprises: (i) an antisense strand comprising (from 5 'end → 3' end) a nucleotide sequence of 2-18 or 2-19 of any one of the antisense strand sequences in table 3, and (ii) a sense strand comprising (from 5 'end → 3' end) a nucleotide sequence of 1-17 or 1-18 of any one of the sense strand sequences in table 4.

A sense strand comprising a sequence listed in table 4 can hybridize to any antisense strand comprising a sequence listed in table 3, provided that the two sequences have regions that are at least about 85% complementary over 16, 17, 18, 19, 20, or 21 contiguous nucleotide sequences. Representative sequence pairings are exemplified by the duplex ID numbers shown in table 5.

In some embodiments, the HBV RNAi agent comprises any one of the duplex ID numbers shown herein. In some embodiments, the HBV RNAi agent consists of any one of the duplex ID numbers shown herein. In some embodiments, the HBV RNAi agent comprises the sense strand and/or antisense strand nucleotide sequences of any of the duplex ID numbers shown herein. In some embodiments, an HBV RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers shown herein and a targeting group and/or a linking group, wherein the targeting group and/or linking group is covalently linked (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, the HBV RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers shown herein. In some embodiments, an HBV RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers shown herein and a targeting group and/or a linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

In some embodiments, the HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any one of the antisense/sense strand duplexes of table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, the HBV RNAi agent comprises an antisense strand and a sense strand comprising any of the antisense and/or sense strand nucleotide sequences having any of the duplexes of table 5, and further comprises a targeting group selected from the group consisting of: (PAZ), (NAG13), (NAG13) s, (NAG18), (NAG18) s, (NAG24), (NAG24) s, (NAG25), (NAG25) s, (NAG26), (NAG26) s, (NAG27), (NAG27) s, (NAG28), (NAG28) s, (NAG29), (NAG29) s, (NAG30), (NAG30) s, (NAG31), (NAG31) s, (NAG32), (NAG32) s, (NAG33), (NAG33) s, (NAG34), (NAG34) s, (NAG35), (NAG35) NAs, (NAG36), (NAG36) s, (NAG37) and (NAG37) s.

In some embodiments, the HBV RNAi agent comprises an antisense strand and a sense strand having any one of the antisense and/or sense strand nucleotide sequences of any one of the duplexes of table 5.

In some embodiments, the HBV RNAi agent comprises an antisense strand and a sense strand having any one of the antisense and/or sense strand nucleotide sequences of any one of the duplexes of table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, the HBV RNAi agent comprises any one of the duplexes of table 5.

In some embodiments, the HBV RNAi agent consists of any one of the duplexes of table 5.

TABLE 5 examples of HBV RNAi agent duplexes。

In some embodiments, the HBV RNAi agent is prepared or provided in the form of a salt, a mixed salt, or a free acid. The RNAi agents described herein inhibit or knock down the expression of one or more HBV genes in vivo after delivery to cells expressing HBV genes.

Targeting groups, linking groups and delivery vehicles

In some embodiments, the HBV RNAi agent is conjugated to one or more non-nucleotide moieties, including but not limited to a targeting moiety, a linking moiety, a delivery polymer, or a delivery vehicle. The non-nucleotide group may enhance targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in table 6. The non-nucleotide group can be covalently linked to the 3 'end and/or the 5' end of the sense strand and/or the antisense strand. In some embodiments, the HBV RNAi agent comprises a non-nucleotide group attached to the 3 'end and/or the 5' end of the sense strand. In some embodiments, a non-nucleotide group is attached to the 5' end of the sense strand of the HBV RNAi agent. The non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

In some embodiments, the non-nucleotide groups enhance the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which they are attached to improve the cell or tissue specific distribution and cell specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

The targeting group or moiety enhances the pharmacokinetic or biodistribution properties of the conjugate to which it is attached to improve the cell-specific distribution and cell-specific uptake of the conjugate. The targeting group may be monovalent, divalent, trivalent, tetravalent, or have a higher valence. Representative targeting groups include, but are not limited to: compounds having affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments and antibody mimetics having affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker (such as a PEG linker) or one, two, or three abasic groups and/or ribitol (abasic ribose) groups. In some embodiments, the targeting group comprises a galactose derivative cluster.

The HBV RNAi agents described herein can be synthesized with a reactive group at the 5' end, such as an amine group. The reactive group may be used to subsequently attach a targeting moiety using methods typical in the art.

In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term "galactose derivative" includes galactose and lactose derivatives having an affinity for asialoglycoprotein receptors equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-N-butyryl-galactosamine and N-isobutyryl-galactosamine (see, for example, Iobst, S.T. and Drickamer, K.J.B.C.1996, Vol.271, p.6686). Galactose derivatives and galactose derivative clusters useful for targeting oligonucleotides and other molecules to the liver in vivo are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell,22, 611-945; Connolly et al, 1982, J.biol.chem.,257, 939-945). Galactose derivatives have been used to target molecules to hepatocytes in vivo by their binding to asialoglycoprotein receptors (ASGPr) expressed on the surface of hepatocytes. The binding of ASGPr ligands to ASGPr(s) facilitates cell-specific targeting of hepatocytes and entry of endocytosed molecules into hepatocytes. The ASGPr ligand may be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster may be linked to the 3 'end or 5' end of the RNAi polynucleotide using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described, for example, in U.S. patent application serial nos. 15/452,324 and 15/452,423, the contents of both of which are incorporated herein in their entirety.

As used herein, a galactose derivative cluster comprises molecules having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.

As used herein, a galactose derivative trimer contains three galactose derivatives, each galactose derivative being linked to a central branch point. As used herein, a galactose derivative tetramer comprises four galactose derivatives, each galactose derivative being linked to a central branch point. Galactose derivatives may be linked to a central branch point through the C-1 carbon of the sugar. In some embodiments, the galactose derivative is linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, e.g., U.S. Pat. No. 5,885,968; Biessen et al, J.Med.chem.1995, Vol.39, p.1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point may be any small molecule that allows attachment of three galactose derivatives and also allows attachment of the branch point to an RNAi agent. Examples of branch point groups are dilysine or diglutamate. Attachment of the branch point to the RNAi agent can be through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

In some embodiments, pharmaceutical compositions for delivering HBV RNAi agents to hepatocytes in vivo are described. Such pharmaceutical compositions may comprise, for example, HBV RNAi agents conjugated to galactose derivative clusters. In some embodiments, the galactose derivative cluster consists of galactose derivative trimers, which may be, for example, N-acetyl-galactosamine trimers or galactose derivative tetramers, which may be, for example, N-acetyl-galactosamine tetramers.

Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13) s, (NAG18), (NAG18) s, (NAG24), (NAG24) s, (NAG25), (NAG25) s, (NAG26), (NAG26) s, (NAG27), (NAG27) s, (NAG28), (NAG28) s, (NAG29), (NAG29) s, (NAG30), (NAG30) s, (NAG31), (NAG31) s, (NAG32), (NAG32) s, (NAG33), (NAG33) s, (NAG34), (NAG34) s, (NAG35), (NAG35) s, (NAG36), (NAG36) s, (NAG37) s, (NAG37) s, (NAG38), (NAG38) s, (NAG39) s and (NAG39) NAG39) s. Other targeting groups including galactose cluster targeting ligands are known in the art.

In some embodiments, the linking group is conjugated to an RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group or a delivery polymer or a delivery vehicle. The linking group can be attached to the 3 'end or the 5' end of the sense strand or the antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 3 'end or the 5' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to: reactive groups (such as primary and alkyne), alkyl, abasic nucleoside, ribitol (abasic ribose), and/or PEG groups.

A linker or linking group is a connection between two atoms that connects one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. The labile linkage contains a labile bond. The attachment may optionally include a spacer that increases the distance between the two bonding atoms. The spacer may further increase the flexibility and/or length of the connection. Spacers may include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl and aralkynyl; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art and the foregoing list is not intended to limit the scope of the specification.

Any of the HBV RNAi agent nucleotide sequences listed in tables 3 and 4, whether modified or unmodified, may contain a 3 'or 5' targeting group and/or a linking group. Any of the HBV RNAi agent sequences listed in tables 3 and 4 containing a 3 'or 5' targeting group and/or linking group may alternatively not contain a 3 'or 5' targeting group and/or linking group, or may contain a different 3 'or 5' targeting group and/or linking group, including but not limited to those shown in table 3. Any of the HBV RNAi agent duplexes listed in table 5, whether modified or unmodified, may further comprise targeting groups and/or linking groups, including but not limited to those shown in table 3, and the targeting groups or linking groups may be attached to the 3 'end or 5' end of the sense strand or antisense strand of the HBV RNAi agent duplex.

Examples of targeting groups and linking groups are provided in table 6. Table 4 provides several embodiments of sense strands of HBV RNAi agents with targeting or linking groups attached to the 5 'or 3' ends.

TABLE 6 shows the structure of various modified nucleotides, targeting groups and linker groups。

In each of the above structures in table 6, NAG comprises N-acetyl-galactosamine or another ASGPr ligand, attached as would be understood by one of ordinary skill in the art according to the above structures and the description provided herein. For example, in some embodiments, the NAG in the structures provided in table 6 is represented by the following structure:

each (NAGx) can be linked to the HBV RNAi agent via a phosphate group (e.g., (NAG25), (NAG30), and (NAG31)) or a phosphorothioate group (e.g., (NAG25) s, (NAG29) s, (NAG30) s, (NAG31) s, or (NAG37) s) or another linking group.

Other linking groups known in the art may be used.

Delivery vehicle

In another aspect, the methods described herein further comprise a delivery vehicle. In some embodiments, a delivery vector can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. Delivery vehicles may include, but are not limited to: polymers (such as amphiphilic polymers), membrane active polymers, peptides, melittin-like peptides (MLP), lipids, reversibly modified polymers or peptides or reversibly modified membrane active polyamines.

In some embodiments, the RNAi agent can be combined with a lipid, nanoparticle, polymer, liposome, micelle, DPC, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO 2000/053722, WO 2008/0022309, WO 2011/104169 and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

Pharmaceutical compositions and formulations

In another aspect, the methods described herein comprise one or more HBV RNAi agents, wherein the one or more HBV agents are prepared as a pharmaceutical composition or formulation. In some embodiments, the pharmaceutical composition comprises at least one HBV RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of a target mRNA in a target cell, cell population, tissue or organism. The pharmaceutical composition can be used to treat a subject having a disease or disorder that would benefit from a reduction in the level of a target mRNA or inhibition of expression of a target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering to a subject to be treated an HBV RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to a pharmaceutical composition comprising the HBV RNAi agent, thereby forming a pharmaceutical formulation suitable for delivery into the human body.

Pharmaceutical compositions comprising HBV RNAi agents and methods disclosed herein can reduce target mRNA levels in a cell, population of cells, tissue or subject, including: administering to the subject a therapeutically effective amount of an HBV RNAi agent described herein, thereby inhibiting expression of a target mRNA in the subject.

In some embodiments, the pharmaceutical composition comprising an HBV RNAi agent is used to treat or manage clinical manifestations associated with HBV infection. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment, prevention, or management. In some embodiments, administration of any of the disclosed HBV RNAi agents can be used to reduce the number, severity, and/or frequency of disease symptoms in a subject.

The pharmaceutical compositions comprising HBV RNAi agents are useful for treating at least one symptom in a subject having a disease or disorder that would benefit from a reduction or inhibition of HBV mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an HBV RNAi agent is administered to a subject, thereby treating the condition. In other embodiments, a prophylactically effective amount of one or more HBV RNAi agents is administered to the subject, thereby preventing the at least one symptom.

The route of administration is the route by which the HBV RNAi agent comes into contact with the body. Generally, methods of administration of drugs and nucleic acids for the treatment of mammals are well known in the art and may be applied to the administration of the compositions described herein. The HBV RNAi agents disclosed herein can be administered via any suitable route in a formulation appropriate for the particular route. The pharmaceutical compositions described herein may be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, pharmaceutical compositions via subcutaneous injection are described herein.

Pharmaceutical compositions comprising the HBV RNAi agents described herein can be delivered to a cell, cell population, tumor, tissue, or subject using oligonucleotide delivery techniques known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) may be suitable for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intracerebroventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical administration. In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.

Thus, in some embodiments, a pharmaceutical composition described herein may comprise one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to a subject.

As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. The pharmaceutically acceptable excipient or excipients are substances other than the active pharmaceutical ingredient (API, therapeutic product, e.g. HBV RNAi agent) intentionally included in the drug delivery system. Excipients are not or are not intended to have an effect on the therapeutic effect at the intended dosage. Excipients may be used to a) aid in handling the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) aid in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness of the API delivered during storage or use. The pharmaceutically acceptable excipient may or may not be an inert substance.

Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextrans, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, wetting agents, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (herein water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ), or phosphate buffered saline. It should be stable under the conditions of manufacture and storage and should be resistant to the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation include vacuum drying and freeze-drying of the powder obtained containing the active ingredient in admixture with any additional desired ingredient resulting from the previously described sterile filtered solutions of such ingredients.

Formulations suitable for intra-articular administration may be in the form of sterile aqueous formulations of the medicament, which may be in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to provide drugs for intra-articular and ophthalmic administration.

The active compounds may be formulated with carriers that protect the compound from rapid elimination by the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions may also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

The HBV RNAi agent can be formulated in the composition in dosage unit form for ease of administration and consistency of dosage. Dosage unit form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with a desired pharmaceutically acceptable carrier. The specifications for the dosage unit forms of the present disclosure are dictated by and directly dependent upon the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as limitations inherent in the art of formulating such active compounds for individual treatment.

The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritic, astringent, local anesthetic, or anti-inflammatory (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues or isolated organs expressing or comprising an RNAi agent as defined herein may be used as "pharmaceutical compositions". As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or prophylactic effect.

Generally, an effective amount of the active compound will range from about 0.1mg/kg body weight/day to about 100mg/kg body weight/day, for example from about 1.0mg/kg body weight/day to about 50mg/kg body weight/day. In some embodiments, an effective amount of the active compound will range from about 0.25 body weight/dose to about 5mg/kg body weight/dose. In some embodiments, an effective amount of the active compound will range from 25mg to 400mg every 1 week to 18 weeks or 1 month to 6 months. In some embodiments, an effective amount of the active compound will range from 50mg to 125mg every 4 weeks or months. In some embodiments, an effective amount of the active compound will range from 40mg to 200mg every 4 weeks or months. In some embodiments, an effective amount of the active compound will be 40mg every 4 weeks or monthly. In some embodiments, an effective amount of the active compound will be 100mg every 4 weeks or monthly. In some embodiments, an effective amount of the active compound will be 200mg every 4 weeks or monthly. In some embodiments, an effective amount of the active ingredient will range from about 0.5 body weight/dose to about 3mg/kg body weight/dose. In some embodiments, an effective amount of the active ingredient will range from about 25 mg/dose to 400 mg/dose. In some embodiments, an effective amount of the active ingredient will range from about 50 mg/dose to 125 mg/dose. In some embodiments, the effective amount of the active ingredient will be about 35 mg/dose, 50 mg/dose, 100 mg/dose, 200 mg/dose, 300 mg/dose, or 400 mg/dose. In some embodiments, the effective amount of the active ingredient will be about 40 mg/dose, 100 mg/dose, or 200 mg/dose. The amount administered may also depend on variables such as the overall health of the patient, the relative biological efficacy of the compounds delivered, the pharmaceutical formulation, the presence and type of excipients in the formulation, and the route of administration. In addition, it is understood that the initial dose administered may be increased beyond the upper limit described above to quickly reach the desired blood or tissue level, or the initial dose may be less than the optimal dose.

The one or more (e.g., at least two) HBV RNAi agents described herein can be formulated as a single composition or as separate individual compositions. In some embodiments, the HBV RNAi agents in separate individual compositions can be formulated with the same or different excipients and carriers. In some embodiments, the HBV RNAi agents in separate individual compositions can be administered by the same or different routes of administration. In some embodiments, the HBV RNAi agent is administered subcutaneously.

To treat a disease or form a drug or composition for treating a disease, a pharmaceutical composition comprising an HBV RNAi agent as described herein may be combined with an excipient or with a second therapeutic agent or treatment, including but not limited to: a second or other RNAi agent, a small molecule drug, an antibody fragment, and/or a vaccine.

When the HBV RNAi agent is added to a pharmaceutically acceptable excipient or adjuvant, it can be packaged into a kit, container, package, or dispenser. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

Methods of treatment and inhibition of expression

Described herein are methods for treating a subject (e.g., a human or mammal) having a disease or disorder that would benefit from administration of a compound, the method comprising administering to the subject one or more HBV RNAi agents described herein. In some embodiments, a subject (e.g., a human) has a disease or disorder that would benefit from a reduction or inhibition of HBV mRNA expression. Administering to the subject a therapeutically effective amount of any one or more RNAi agents. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child or infant. Also described herein are methods for treating a subject in need thereof, comprising administering a pharmaceutical composition described herein, wherein the pharmaceutical composition comprises an HBV RNAi agent. Such methods comprise administering a pharmaceutical composition described herein to a human or animal.

In some embodiments, symptoms and diseases associated with HBV infection include, but are not limited to, chronic liver disease/disorder, inflammation, fibrotic disorders, proliferative disorders (including cancer, such as hepatocellular carcinoma), Hepatitis Delta Virus (HDV) infection, and acute HBV infection. In some embodiments, these symptoms and diseases are associated with chronic HBV infection and/or HDV infection. In some embodiments, the subject has been tested for HBV infection for at least 6 months to 12 months. In some embodiments, the subject is diagnosed with HBeAg-positive or HBeAg-negative chronic HBV infection. In some embodiments, the subject is diagnosed with HBeAg-positive or HBeAg-negative chronic HBV infection for at least 6 months. In some embodiments, the symptom or disease associated with HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic disorder, proliferative hepatocyte disorder, hepatocellular carcinoma, hepatitis delta virus infection, acute HBV infection, chronic hepatitis b or chronic HBV infection. In some embodiments, the symptom or disease associated with HBV infection is chronic HBV infection or chronic hepatitis b.

In some embodiments, the subject is infected with HBV. In some embodiments, the method is for treating at least one symptom in a subject having HBV infection. Administering to the subject a therapeutically effective amount of any one or more of the RNAi agents.

In some embodiments, the subject has both HBV infection and HDV infection. In some embodiments, the methods described herein are used to treat a subject infected with both HBV and HDV. In some embodiments, the method is for treating at least one symptom in a subject having HBV or HDV infection. Administering to the subject a therapeutically effective amount of any one or more of the RNAi agents.

In some embodiments, the methods described herein are used to treat or manage clinical manifestations of a subject infected with HBV. Administering to the subject a therapeutically effective amount of one or more of the HBV RNAi agents described herein or a composition comprising an HBV RNAi agent. In some embodiments, the method comprises administering to a subject to be treated a composition comprising an HBV RNAi agent described herein.

In some embodiments, the method comprises administering one or more HBV RNAi agents described herein. In some embodiments, the one or more HBV RNAi agents are administered in an amount from about 5mg to 1000mg per dose. In some embodiments, the one or more HBV RNAi agents are administered at about 5 to 25mg, about 25 to 50mg, about 50 to 75mg, about 75 to 100mg, about 100 to 125mg, about 125 to 150mg, about 150 to 175mg, about 175 to 200mg, about 200 to 225mg, about 225 to 250mg, about 250 to 275mg, about 275 to 300mg, about 300 to 325mg, about 325 to 350mg, about 350 to 375mg, about 375 to 400mg, about 400 to 425mg, about 425 to 450mg, about 450 to 475mg, about 475 to 500mg, about 500 to 550mg, about 550 to 600mg, about 600 to 650mg, about 650 to 700mg, about 700 to 750mg, about 750 to 800mg, about 800 to 850mg, about 850 to 900mg, about 900 to 950mg, about 950 to 200mg, about 200 to 200mg, about 1000mg, about 100 to 200mg, about 200 to 200mg, about 375mg, about 200mg, or more, or a pharmaceutically acceptable salt thereof, or a composition, in a composition, or a composition, per dose, or a composition, in a form, or a composition, in an oral composition, for a composition, or a composition, about 300 to 400mg, about 400 to 500mg, about 500 to 750mg, about 750 to 1000mg, 25 to 100mg, 50 to 150mg, 100 to 200mg, 150 to 250mg, 200 to 300mg, 300 to 400mg, 25 to 200mg, or 200 to 400 mg. In some embodiments, the one or more HBV RNAi agents are administered in an amount of about 25mg, about 50mg, about 75mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 250mg, about 300mg, about 350mg, about 400mg, about 450mg, about 500mg, about 600mg, about 700mg, about 800mg, about 900mg, or about 1000mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in an amount of about 25mg, about 50mg, about 75mg, about 100mg, or about 125mg per dose administered. In some embodiments, the one or more HBV RNAi agents are administered in an amount of about 35mg, about 50mg, about 100mg, about 200mg, about 300mg, or about 400mg per dose. In some embodiments, the one or more HBV RNAi agents are administered in an amount of about 40mg, about 100mg, or about 200mg per dose administered.

In some embodiments, the method comprises administering a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (e.g., a composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, and a second HBV RNAi agent comprises an antisense strand at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene).

In some embodiments, the at least two HBV RNAi agents are administered in an amount from about 5mg to 1000mg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered at about 5mg to 25mg, about 25mg to 50mg, about 50mg to 75mg, about 75mg to 100mg, about 100mg to 125mg, about 125mg to 150mg, about 150mg to 175mg, about 175mg to 200mg, about 200mg to 225mg, about 225mg to 250mg, about 250mg to 275mg, about 275mg to 300mg, about 300mg to 325mg, about 325mg to 350mg, about 350mg to 375mg, about 375mg to 400mg, about 400mg to 425mg, about 425mg to 450mg, about 450mg to 475mg, about 475mg to 500mg, about 500mg to 550mg, about 550mg to 600mg, about 600mg to 650mg, about 650mg to 700mg, about 700mg to 750mg, about 750mg to 800mg, about 800mg to 850mg, about 850mg to 900mg, about 900mg to 950mg, about 1000mg to 200mg, about 50mg to 200mg, about 1000mg to 100mg, about 200mg to 200mg, about 375mg, about 200mg to 200mg, about 200mg, or more, about 200mg, or more, or a suitable for each, or a composition thereof, or a composition thereof, or a composition thereof, or a composition thereof, in a composition, or a composition, About 300 to 400mg, about 400 to 500mg, about 500 to 750mg, about 750 to 1000mg, 25 to 100mg, 50 to 150mg, 100 to 200mg, 150 to 250mg, 200 to 300mg, 300 to 400mg, 25 to 200mg, or 200 to 400 mg. In some embodiments, the at least two HBV RNAi agents are administered in an amount of about 25mg, about 50mg, about 75mg, about 100mg, about 125mg, about 150mg, about 175mg, about 200mg, about 250mg, about 300mg, about 350mg, about 400mg, about 450mg, about 500mg, about 600mg, about 700mg, about 800mg, about 900mg, or about 1000mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in an amount of about 25mg, about 50mg, about 75mg, about 100mg, or about 125mg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered in an amount of about 35mg, about 50mg, about 100mg, about 200mg, about 300mg, or about 400mg per dose. In some embodiments, the at least two HBV RNAi agents are administered in an amount of about 40mg, about 100mg, or about 200mg per dose administered.

In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose administered. In some embodiments, the at least two HBV RNAi agents are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg to 8.5mg/kg, about 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, the at least two HBV RNAi agents are administered simultaneously. In some embodiments, the at least two HBV RNAi agents are administered sequentially. In some embodiments, the at least two HBV RNAi agents are administered as a single composition. In some embodiments, the at least two HBV RNAi agents are administered as two or more individual compositions.

In some embodiments, described herein are methods for treating or preventing HBV-associated diseases or symptoms or inhibiting expression of one or more HBV genes in a subject, the method comprising administering a composition comprising a combination of two HBV RNAi agents, wherein one HBV RNAi agent targets the S ORF of HBV RNA (i.e., has an antisense strand that targets the S transcript (S, pre-S1 and pre-S2), the pregenomic RNA (core and polymerase), and the precore transcript of the HBV genome (HBeAg)), and the other HBV RNAi agent targets the X ORF of HBV RNA (i.e., has an antisense strand that targets the X transcript of the HBV genome, the S transcript (S, pre-S1 and pre-S2), the precore RNA (core and polymerase), and the precore transcript of the HBV genome (HBeAg)). In some embodiments, the compositions described herein comprise at least one HBV RNAi agent comprising a sequence targeting the S ORF of an HBV gene and a second HBV RNAi agent comprising a sequence targeting the X ORF of an HBV gene.

In some embodiments, the two HBV RNAi agents are administered at a ratio of about 1:1, 2:1, 3:1, 4:1, or 5: 1. In some embodiments, the two HBV RNAi agents are administered at a ratio of about 2: 1.

In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5mg to 1000mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 150mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50mg to 200mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100mg to 250mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300mg to 400mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400 to 500mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 500 to 750mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 750mg to 1000mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 125mg per dose and at a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1: 2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5mg to 1000mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25mg to 75mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50mg to 125mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75mg to 150mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100 to 200mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 to 300mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300 to 400mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400 to 500mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 500 to 750mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 750mg to 1000mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 40mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300mg per dose and at a ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400mg per dose and at a ratio of about 2: 1. In another aspect, the methods described herein comprise administering one or more HBV RNAi agents (e.g., two or more) at 1-18 week intervals or 1-6 month intervals. In some embodiments, the HBV RNAi agent is administered at intervals of about 1 to 18 weeks. In some embodiments, the HBV RNAi agent is administered at about 1 week intervals, about 2 week intervals, about 3 week intervals, about 4 week intervals, about 5 week intervals, about 6 week intervals, about 7 week intervals, about 8 week intervals, about 9 week intervals, about 10 week intervals, about 11 week intervals, about 12 week intervals, about 13 week intervals, about 14 week intervals, about 15 week intervals, about 16 week intervals, about 17 week intervals, or about 18 week intervals. In some embodiments, the HBV RNAi agent is administered at intervals of about 1 month to 6 months. In some embodiments, the HBV RNAi agent is administered at about 1 month intervals, about 2 month intervals, about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, the HBV RNAi agent is administered at about 4 week intervals or 1 month intervals. In some embodiments, the HBV RNAi agent is administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, the HBV RNAi agent is administered at about 28 day intervals (i.e., Q4W).

In another aspect, the methods described herein comprise administering one or more HBV RNAi agents (e.g., two or more) for a duration of about 1 month to 12 months or 1 week to 18 weeks. In some embodiments, the RNAi agent is administered for a duration of about 1 month to 12 months. In some embodiments, the HBV RNAi agent is administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, the HBV RNAi agent is administered for a duration of about 1 to 18 weeks. In some embodiments, the HBV RNAi agent is administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, the HBV RNAi agent is administered for a duration of about 12 weeks to 3 months.

In some embodiments, the first RNAi agent is administered in an amount from about 3mg to 650mg per dose administered, and the second RNAi agent is administered in an amount from about 2mg to 325mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 35mg to 265mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount from about 50mg to 75mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 20mg to 125mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount from about 25mg to 50mg per dose administered.

In some embodiments, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose. In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg, and the first RNAi agent is administered to the second RNAi agent at a ratio of 1: 1. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 12mg for a combined dose of about 25 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 17mg for a combined dose of about 35 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 25mg for a combined dose of about 50 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 50mg for a combined dose of about 100 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 100mg for a combined dose of about 200 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 150mg for a combined dose of about 300 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is an amount of about 200mg for a combined dose of about 400 mg.

In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose, and the first RNAi agent is administered to the second RNAi agent at a 2:1 ratio. In one embodiment, for a combined dose of about 25mg, the dose of the first RNAi agent is in an amount of about 16mg and the dose of the second RNAi agent is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35mg, the dose of the first RNAi agent is in an amount of about 24mg and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 50mg, the dose of the first RNAi agent is in an amount of about 33mg and the dose of the second RNAi agent is in an amount of about 17 mg. In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 65mg and the dose of the second RNAi agent is in an amount of about 35 mg. In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 133mg and the dose of the second RNAi agent is in an amount of about 67 mg. In one embodiment, for a combined dose of about 300mg, the dose of the first RNAi agent is in an amount of about 200mg and the dose of the second RNAi agent is in an amount of about 100 mg. In one embodiment, for a combined dose of about 400mg, the dose of the first RNAi agent is in an amount of about 270mg and the dose of the second RNAi agent is in an amount of about 135 mg.

In one embodiment, the two RNAi agents are administered at a combined dose of 25mg to 400mg per dose, with the first RNAi agent and the second RNAi agent administered at a 3:1 ratio. In one embodiment, for a combined dose of about 25mg, the dose of the first RNAi agent is in an amount of about 18mg and the dose of the second RNAi agent is in an amount of about 6 mg. In one embodiment, for a combined dose of about 35mg, the dose of the first RNAi agent is in an amount of about 27mg and the dose of the second RNAi agent is in an amount of about 9 mg. In one embodiment, for a combined dose of about 50mg, the dose of the first RNAi agent is in an amount of about 36mg and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 100mg, the dose of the first RNAi agent is in an amount of about 75mg and the dose of the second RNAi agent is in an amount of about 25 mg. In one embodiment, for a combined dose of about 200mg, the dose of the first RNAi agent is in an amount of about 150mg and the dose of the second RNAi agent is in an amount of about 50 mg. In one embodiment, for a combined dose of about 300mg, the dose of the first RNAi agent is in an amount of about 225mg and the dose of the second RNAi agent is in an amount of about 75 mg. In one embodiment, for a combined dose of about 400mg, the dose of the first RNAi agent is in an amount of about 300mg and the dose of the second RNAi agent is in an amount of about 100 mg.

In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 10mg/kg per dose. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1mg/kg to 5mg/kg per dose. In some embodiments, two HBV RNAi agents are administered at about 1mg/kg to 1.5mg/kg, about 1.5mg/kg to 2.0mg/kg, about 2.0mg/kg to 2.5mg/kg, about 2.5mg/kg to 3.0mg/kg, about 3.0mg/kg to 3.5mg/kg, about 3.5mg/kg to 4.0mg/kg, about 4.0mg/kg to 4.5mg/kg, about 4.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 5.5mg/kg, about 5.5mg/kg to 6.0mg/kg, about 6.0mg/kg to 6.5mg/kg, about 6.5mg/kg to 7.0mg/kg, about 7.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 8.0mg/kg, about 8.5mg/kg, about 8.0mg/kg to 8.0mg/kg, about 5mg/kg, About 9.0mg/kg to 9.5mg/kg, about 9.5mg/kg to 10mg/kg, about 1mg/kg to 2.5mg/kg, about 2.5mg/kg to 5.0mg/kg, about 5.0mg/kg to 7.5mg/kg, about 7.5mg/kg to 10mg/kg, about 1mg/kg to 5.0mg/kg or about 5.0mg/kg to 10 mg/kg.

In some embodiments, the first RNAi agent is administered in an amount from about 0.6mg/kg to 7mg/kg per dose administered, and the second RNAi agent is administered in an amount from about 0.3mg/kg to 5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.5mg/kg to 2.5mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.3mg/kg to 1.5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 0.6mg/kg to 5mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 1mg/kg to 2.5mg/kg per dose administered.

In some embodiments, the subject administered the HBV RNAi agent has at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% reduction in gene expression levels and/or mRNA levels of the HBV gene relative to the subject prior to or without administration of the HBV RNAi agent. The gene expression level and/or mRNA level of the subject may be decreased in a cell, cell population, and/or tissue of the subject. In some embodiments, a subject having been administered the HBV RNAi agent has at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% reduction in the level of HBV gene expression protein relative to a subject prior to administration of the HBV RNAi agent or a subject not receiving the HBV RNAi agent. The protein level of a subject may be reduced in cells, cell populations, tissues, blood, and/or other fluids of the subject. For example, in some embodiments, a subject that has been administered the HBV RNAi agent has at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% reduction in the amount or level of hepatitis b surface antigen (HBsAg) relative to the subject prior to administration of the HBV RNAi agent or to a subject that has not received the HBV RNAi agent. In some embodiments, a subject having been administered the HBV RNAi agent has at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% reduction in the amount or level of hepatitis b e antigen (HBeAg) relative to the subject prior to administration of the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. In some embodiments, a subject having been administered the HBV RNAi agent has at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% reduction in the amount or level of serum HBV DNA relative to the subject prior to administration of the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. The reduction in serum HBV DNA, HBV gene expression, the presence of amount or level of HBV mRNA or HBV protein can be assessed by methods known in the art. Reduction or reduction of the amount or level of HBV mRNA, the amount or level of expressed protein, and/or the amount or level of serum HBV DNA is collectively referred to herein as reduction or reduction of HBV or inhibition or reduction of HBV expression.

Cells and tissues and non-human organisms

Cells, tissues, and non-human organisms comprising at least one of the HBV RNAi agents described herein are contemplated. The cell, tissue or non-human organism is prepared by delivering an RNAi agent to the cell, tissue or non-human organism.

The embodiments and items provided above are now illustrated with the following non-limiting examples.

Examples

Example 1 Synthesis of HBV RNAi Agents。

The HBV RNAi agent duplexes shown in table 5 were synthesized according to the following method:

A. and (4) synthesizing. Sense and antisense strands of HBV RNAi agents are synthesized according to the solid phase phosphoramidite technique used in oligonucleotide synthesis. According to the proportion, use(Bioautomation)、(Bioautomation) or OP Pilot 100(GE Healthcare). In the case of a glass consisting of controlled pore glass (CPG,orCommercially available from Prime Synthesis, Aston, PA, USA). All RNA and 2' -modified phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the following 2' -O-methylphosphonite amides were used: (5' -O-dimethoxytrityl-N⁶- (benzoyl) -2' -O-methyl-adenosine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5' -O-dimethoxytrityl-N ⁴- (acetyl) -2' -O-methyl-cytidine-3 ' -O- (2-cyanoethyl-N, N-diisopropyl-amino) phosphoramidite, (5' -O-dimethoxybenzyl-N²- (isobutyryl) -2' -O-methyl-guanosine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5' -O-dimethoxytrityl-2 ' -O-methyl-uridine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite. 2' -deoxy-2 ' -fluoro-phosphoramidites bear the same protecting group as 2' -O-methyl phosphoramidites. Abasic (3' -O-dimethoxytrityl-2 ' -deoxyribose-5 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidites from ChemGenes (Wilmington, MA, USA.) the targeting ligand containing the phosphoramidite was dissolved in either anhydrous dichloromethane or anhydrous acetonitrile (50mM) while all other phosphoramidites were dissolved in anhydrous acetonitrile (50mM) and molecular sieves were added5-benzylthio-1H-tetrazole (BTT, 250mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250mM in acetonitrile) was used as the activator solution. Coupling times were 12 minutes (RNA), 15 minutes (targeting ligand), 90 seconds (2'OMe) and 60 seconds (2' F). For the introduction of phosphorothioate linkages, 100mM of 3-phenyl 1,2, 4-dithiazolin-5-one (POS, available from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

B. Cleavage and deprotection of the carrier-bound oligomer. After completion of the solid phase synthesis, the dried solid support was treated with 1:1 volumes of 40% by weight aqueous methylamine solution and 28% ammonium hydroxide solution (Aldrich) at 30 ℃ for 1.5 hours. The solution was evaporated off and the solid residue was reconstituted in water (see below).

C. And (5) purifying. The crude oligomer was purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20mM Tris, 5mM EDTA, pH 9.0 and contained 20% acetonitrile, and buffer B was the same as buffer A except 1.5M sodium chloride was added. The UV trace at 260nm was recorded. The appropriate fractions were combined and then run on a size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-25 gel, with filtered DI water or running buffer of 100mM ammonium bicarbonate at pH 6.7 and 20% acetonitrile.

D. And (6) annealing. The complementary strands (sense and antisense) were mixed by combining an equimolar RNA solution in 1 x phosphate buffered saline (Corning, Cellgro) to form the RNAi agent. Some of the RNAi agents were lyophilized and stored at-15 ℃ to-25 ℃. Duplex concentrations were determined by measuring solution absorbance in 1 x phosphate buffered saline by UV-Vis spectrometer. The absorbance of the solution at 260nm was then multiplied by a conversion factor and a dilution factor to determine duplex concentration. All conversion factors were 0.037 mg/(mL-cm), unless otherwise indicated. For some experiments, the conversion factor was calculated from the experimentally determined extinction coefficient.

Example 2 pHBV model mice。

Six to eight week old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were transiently transfected with MC-HBV1.3 by Hydrodynamic tail vein injection (Yang PL et al, "Hydrodynamic injection of viral DNA: a mouse model of acid hepatitis B viruses infection," PNAS USA 2002, Vol. 99, p. 13825-13830), administered for 30 to 45 days, followed by RNAi HBV agent and controls. MC-HBV1.3 is a plasmid-derived mini-loop containing the same terminally redundant human hepatitis B virus sequence HBV1.3(GenBank accession number V01460) as the plasmid pHBV1.3 and HBV1.3.32 transgenic mice (Guidotti LG et al, "High-level hepatitis B virus replication in transgenic mice," J Virol1995, volume 69, page 6158-. A total volume of 10% of the animal body weight of 5. mu.g or 10. mu.g of MC-HBV1.3 dissolved in ringer's solution was injected into mice via the tail vein to generate a pHBV model of chronic HBV infection. As previously described, this solution is injected through a 27-gauge needle within 5-7 seconds (Zhang G et al, "High levels of expression of a foreign Gene in a platelet after needle in the injection of the bound plasmid DNA," Human Gene Therapy 1999, Vol. 10, p. 1735-1737). Before dosing (day 1, day-1 or day-2 before dosing), the hepatitis b surface antigen (HBsAg) HBsAg expression level in serum was measured by ELISA and mice were grouped according to the mean HBsAg expression level.

And (3) analysis: serum HBsAg, serum HBeAg, serum HBV DNA, or liver HBV RNA can be measured at various times before and after administration of the HBV RNAi agent. HBV expression levels were normalized to those of pre-administration and phosphate buffered saline ("PBS") injected control mice.

i) Collecting serum: mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & co., bumrecht, Germany). The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 Xg for 3 minutes to separate the serum and stored at 4 ℃.

ii) serum hepatitis B surface antigen (HBsAg) levels: serum was collected and diluted 10 to 8000 fold in PBS containing 5% skim milk powder. A standard of secondary HBsAg diluted in skim milk solution was prepared from the serum of ICR mice (Harlan Sprague Dawley) which had been transfected with 10. mu.g of HBsAg expressing plasmid pRc/CMV-HBs (Aldevron, Fargo, ND). HBsAg levels were determined using the GS HBsAg EIA 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, WA) as described by the manufacturer. Recombinant HBsAg protein of the ayw subtype, also diluted in PBS with skimmed milk, was used as the main standard (Aldevron).

HBsAg expression from each animal was normalized to a control group of PBS-injected mice to account for the non-treatment-related decrease in MC-HBV1.3 expression. First, the HBsAg level of each animal at one time point was divided by the expression level of that animal before treatment to determine the ratio of expression "normalized to before treatment". Expression at specific time points was then normalized to the control group by dividing the "normalized to pre-treatment" ratio of a single animal by the average "normalized to pre-treatment" ratio of all mice in the normal PBS control group.

iii) serum hepatitis B e antigen (HBeAg) levels: HBeAg analysis was performed by HBeAg enzyme-linked immunosorbent assay (ELISA) as described by the manufacturer (DiaSorin) using serum diluted 4 to 20 fold in 5% skim milk powder. The amount of antigen was determined within the linear range of the assay and quantified against a HBeAg protein standard (Fitzgerald Industries International, Cat. 30-AH18, Acton,. MA).

HBeAg expression for each animal was normalized to a control group of PBS-injected mice in order to illustrate a non-treatment-related decrease in MC-HBV1.3 expression. To assess HBeAg in serum, HBeAg was analyzed from pooled group or subgroup serum samples. First, the HBeAg level of each pooled group or subgroup is divided by the pre-treatment expression level in the same group or subgroup to determine the ratio of expression "normalized to pre-treatment". Expression at a particular time point was then normalized to the control group by dividing the "normalized to pre-treatment" ratio of one group or subgroup by the average "normalized to pre-treatment" ratio of all samples of the normal PBS control group.

iv) serum HBV DNA levels: equal volumes of serum from mice in a group or subgroup were pooled to a final volume of 100 μ L. DNA was isolated from serum samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. Sterile 0.9% saline was added to each sample to a final volume of 200 μ L. Serum samples were added to tubes containing buffer and protease. Vector RNA was added to aid in the isolation of small amounts of DNA. 1ng of pHCR/UbC-SEAP plasmid DNA (Wooddell CI et al, "Long-term RNA interference from optimized siRNA expression constructs in adult. mice," Biochem Biophys Res Commun (2005)334, 117-. After incubation at 56 ℃ for 15 minutes, the nucleic acids were precipitated from the lysate with ethanol and the entire solution was applied to the column. After washing, the samples were eluted into a volume of 50 μ L of buffer AVE.

The copy number of HBV genome in DNA isolated from serum of pHBV mouse model was determined by qPCR. A six log standard curve was generated using plasmid pSEAP-HBV353-777 encoding a short fragment within the S gene of the HBV genome (base 353-777 of GenBank accession No. V01460). Samples with DNA recovery rates 2 standard deviations below the mean based on pHCR/UbC-SEAP detection were omitted. Primers based on TaqMan chemistry and probes with fluor/ZEN/IBFQ were used.

qPCR assays were performed on 7500Fast or StepOne Plus real-time PCR systems (Life Technologies). To assess HBV DNA in serum, DNA was isolated from pooled serum samples by single or double purification steps. Quantification of HBV DNA and recovery control plasmid was determined by performing triplicate qPCR reactions. Each reaction included probes for quantification of HBV and pHCR/UbC-SEAP.

Example 3 use of HBV RNAi Agents in pHBV model mice。

The pHBV mouse model described in example 2 above was used. On day 1, a single subcutaneous injection was administered to each mouse with 200 μ l of HBV RNAi agent containing 2mg/kg (mpk) formulated in phosphate buffered saline ("PBS"), or 200 μ l of phosphate buffered saline without HBV RNAi agent as a control. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The HBV RNAi agents tested included those with the duplex numbers shown in table 7 below. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Sera were collected at day 8, day 15, day 22 and day 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 7 mean HBsAg levels in pHBV mice were normalized to after administration of HBV RNAi agents from example 3 Pre-treatment and PBS control (standard deviation reflected as (+/-))。

Group of	Day 8	Day 15	Day 22	Day 29
					PBS	1.000±0.185	1.000±0.288	1.000±0.540	1.000±0.326
AD04178	0.164±0.043	0.206±0.044	0.293±0.050	0.348±0.099
					AD04579	0.083±0.028	0.099±0.022	0.112±0.022	0.138±0.056
AD04580	0.048±0.007	0.073±0.012	0.085±0.012	0.126±0.014
					AD04570	0.241±0.076	0.294±0.071	0.276±0.068	0.474±0.092
AD04572	0.190±0.040	0.279±0.011	0.323±0.049	0.441±0.046
					AD04573	0.333±0.143	0.505±0.106	0.361±0.060	0.444±0.068
AD04574	0.291±0.032	0.650±0.056	0.388±0.048	0.485±0.070
					AD04575	0.397±0.189	0.514±0.234	0.574±0.204	0.689±0.207
AD04419	0.262±0.038	0.174±0.042	0.258±0.064	0.311±0.089
					AD04578	0.210±0.056	0.235±0.033	0.298±0.035	0.336±0.049

RNAi agents AD04178, AD04579, AD04580, AD04570, AD04572, AD04573, AD04574, AD04575, AD04419, and AD04578 were each designed to have an antisense strand sequence that is at least partially complementary to the X open reading frame at positions 1781 to 1789 of the HBV genome set forth in tables 1 and 2 above. At all measurement time points, each of the HBV RNAi agents showed a significant reduction in HBsAg compared to the PBS control. For example, AD04580 showed greater than 95% reduction in s antigen levels (0.048 ± 0.007HBsAg levels) on day 8 when normalized to pre-treatment and PBS control.

In addition, serum HBV DNA levels in serum samples collected on days 8, 15, 22, 29, 36, 43 and 50 were determined for the PBS, AD04579 and AD04580 groups according to the protocol described in example 2 above. The sera of each group were pooled and then the DNA was isolated from the sera in a repeated manner. The data are shown in the following table:

TABLE 8 mean serum HBV DNA levels in pHBV mice after administration of HBV RNAi agents from example 3 Normalized to pre-treatment and PBS control (standard deviation reflected as (+/-))。

The data in table 8 indicate that both RNAi agents tested provided a significant reduction in HBV DNA levels compared to the PBS group, with AD04580 achieving slightly more than 1 log knock-out at nadir (e.g., mean serum DNA level of 0.0869 ± 0.0117 at day 15).

Example 4 use of HBV RNAi Agents in pHBV model mice。

The pHBV mouse model described in example 2 above was used. On day 1, each mouse was given a single subcutaneous injection of 200 μ l of either HBV RNAi agent at 2mg/kg (mpk) in phosphate buffered saline, or 200 μ l of phosphate buffered saline without HBV RNAi agent as a control. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The HBV RNAi agents administered include those listed in table 9 below. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Sera were collected at day 8, day 15, day 22 and day 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 9 mean HBsAg levels in pHBV mice were normalized to after administration of HBV RNAi agents from example 4 Pre-treatment and PBS control (standard deviation reflected as (+/-))。

The RNAi agents AD04010, AD04581, AD04591, AD04434, AD04583, AD04584, AD04585, AD04586, AD04588 and AD04438 were designed to have antisense strand sequences that were at least partially complementary to the S open reading frame at position 257-275 of the HBV genomes shown in table 1 and table 2. At all time points of measurement, the HBV RNAi agents shown in table 9 immediately above each showed a significant reduction in HBsAg compared to the PBS control. For example, the AD04585 group showed approximately 90% reduction in HBsAg on day 8, 95% reduction on day 15, 97% reduction on day 22, and 95% reduction on day 29.

In addition, serum HBV DNA levels in serum samples collected on days 8, 15, 22, 29, 36, 43 and 50 were determined for the PBS, AD04585 group according to the protocol described in example 2 above. The sera of each group were pooled and then the DNA was isolated from the sera in a repeated manner. The data are shown in the following table:

TABLE 10 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 4 Normalization to pre-treatment and PBS control (standard deviation reflected as (+/-)) 。

The data in table 10 show that HBV RNAi agent AD04585 provides a reduction in HBV DNA levels compared to the PBS group.

Example 5 dose response and combination of HBV RNAi Agents in pHVV model mice。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups, including those listed in table 11 below, and the mice were injected subcutaneously with 200 μ l according to the dosing schedule shown in table 11:

TABLE 11 dose grouping of pHBV mice of example 5。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 11. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Sera were collected at day 8, day 15, day 22, day 29, day 36, day 43, day 50 and day 57 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 12 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 5 Before treatment and PBS control (standard deviation reflected as (+/-))。

At all time points of measurement, HBV RNAi agents AD04580 and AD04585 each showed a reduction in HBsAg compared to PBS control, respectively. Furthermore, at all measurement time points, the combination treatment of AD04585 and AD04580 targeting different regions of the HBV genome as described in the above examples also showed a reduction in HBsAg compared to the PBS control.

In addition, serum HBV DNA levels in serum samples collected on days 8, 15, 22, 29 and 36 were determined for each group in table 11 according to the protocol described in example 2 above. The sera of each group were pooled and the DNA was then isolated from the sera in repeated reactions. The data are shown in the following table:

TABLE 13 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 5 Normalization to pre-treatment and PBS control (standard deviation reflected as (+/-))。

The data in table 13 show that RNAi agents tested alone and in combination provide a reduction in HBV DNA levels compared to the PBS group. Re-administration or increased dosing produces additional HBV DNA reduction.

Example 6 use of HBV RNAi agents in pHBV mice: dose response and combination studies 。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 14 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 14:

TABLE 14 dose grouping of pHBV mice of example 6。

Group of	RNAi agents and dosages	Dosing regimens
			A	PBS (without RNAi agent)	Single injection on day 1
B	4.0mg/kgAD04981	Single injection on day 1
			C	1.0mg/kgAD04981	Single injection on day 1
D	2.0mg/kgAD04981	Single injection on day 1
			E	1.0mg/kgAD04963	Single injection on day 1
F	2.0mg/kgAD04963	Single injection on day 1
			G	3.0mg/kgAD04872	Single injection on day 1
H	3.0mg/kgAD04872+1.0mg/kgAD04981	Single injection on day 1
			I	3.0mg/kgAD04872+1.0mg/kgAD04963	Single injection on day 1
J	3.0mg/kgAD04872+2.0mg/kgAD04981	Single injection on day 1

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 14. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Sera were collected on day-1 prior to administration, then on days 8, 15, 22, 29 and 36, and serum HBsAg levels were determined according to the procedure described in example 2 above. The experimental data are shown in table 15 below, where the mean HBsAg reflects the normalized mean of HBsAg:

TABLE 15 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 6 Before treatment and PBS control (standard deviation reflected as (+/-))。

At all measurement time points, the tested HBV RNAi agents showed a reduction in HBsAg compared to the PBS control. Furthermore, at all time points of measurement, the combination therapy of AD04872 (which included antisense strand sequences at least partially complementary to the S ORF at positions 261-279 of the HBV genome as shown in tables 1 and 2) and AD04981 or AD04963 (both of which included antisense strand sequences at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome as shown in tables 1 and 2) compared to the PBS control, as shown by H, I and group J in example 6, showed that the combination therapy of two RNAi agents (one targeting the S ORF, the other targeting the X ORF of the HBV genome) also showed a reduction in HBsAg.

In addition, serum hepatitis b e antigen (HBeAg) levels were also evaluated. Samples from each respective group of mice were first pooled and the resulting serum samples were assayed in a singleplex fashion. The experimental data are shown in the following table:

TABLE 16 mean HBeAg levels in pHBV mice were normalized following administration of HBV RNAi agents from example 6 Before treatment and PBS control。

Group of	Day 8	Day 15	Day 22	Day 29	Day 36
						A	1.000	1.000	1.000	0.183	1.000
B	0.138	0.180	0.274	0.005	0.089
						C	0.316	0.376	0.588	0.055	0.436
D	0.167	0.250	0.262	0.036	0.190
						E	0.301	0.327	0.447	0.023	0.436
F	0.167	0.172	0.305	0.015	0.167
						G	0.275	0.135	0.158	0.002	0.010
H	0.080	0.053	0.094	0.005	0.020
						I	0.165	0.124	0.185	0.003	0.032
J	0.120	0.057	0.101	0.002	0.021

As shown in table 16, the combination of D04872 (which targets the S ORF of the HBV genome) and AD04981 or AD04963 (both targeting the X ORF of the HBV genome) showed a further reduction in HBeAg levels relative to AD04872 administered alone.

Example 7 HBV RNAi agents for pHBV mice: additional dosageResponse and combination study。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 17 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 17:

TABLE 17 dose grouping of pHBV mice of example 7。

Group of	RNAi agents and dosages	Dosing regimens
			A	PBS (without RNAi agent)	Single injection on day 1
B	4.0mg/kgAD04776	Single injection on day 1
			C	1.0mg/kgAD04982	Single injection on day 1
D	2.0mg/kgAD04982	Single injection on day 1
			E	1.0mg/kgAD04776	Single injection on day 1
F	2.0mg/kgAD04776	Single injection on day 1
			G	3.0mg/kgAD04872	Single injection on day 1
H	3.0mg/kgAD04872+1.0mg/kgAD04982	Single injection on day 1
			I	3.0mg/kgAD04872+2.0mg/kgAD04982	Single injection on day 1

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 17. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Four (4) mice in each group were tested on day-1 and day 8 (n-4), and one mouse per group was then euthanized for histological evaluation. Three (3) mice (n-3) in each group were tested on day 22 and day 29.

Serum was collected on day-1 prior to administration, then on days 8, 15, 22 and 29, and serum hepatitis b surface antigen (HBsAg) levels were determined according to the procedure described in example 2 above. The experimental data are shown in table 18 below:

TABLE 18 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 7 Before treatment (day-1) and PBS control (standard deviation reflected as (+/-))。

Group of	Day 8	Day 15	Day 22	Day 29
					A	1.000±0.347	1.000±0.278	1.000±0.194	1.000±0.318
B	0.117±0.069	0.085±0.039	0.148±0.045	0.198±0.049
					C	0.519±0.058	0.375±0.012	0.422±0.046	0.525±0.037
D	0.342±0.062	0.255±0.046	0.272±0.122	0.314±0.068
					E	0.279±0.057	0.245±0.032	0.374±0.121	0.304±0.035
F	0.224±0.018	0.161±0.009	0.310±0.016	0.482±0.053
					G	0.029±0.010	0.005±0.001	0.004±0.001	0.006±0.001
H	0.016±0.005	0.004±0.001	0.010±0.006	0.015±0.008
					I	0.026±0.012	0.008±0.001	0.010±0.002	0.015±0.005

At all measurement time points, the tested HBV RNAi agents showed a reduction in HBsAg compared to the PBS control.

In addition, serum hepatitis b e antigen (HBeAg) levels were also evaluated. Samples from each respective group of mice were first pooled and the resulting serum samples were assayed in a singleplex fashion. The experimental data are shown in the following table:

TABLE 19 mean HBeAg levels in pHBV mice were normalized following administration of HBV RNAi agents from example 7 Before treatment and PBS control。

TABLE 19-1 mean HBeAg fold knock-outs in pHBV mice after administration of HBV RNAi agents from example 7 Normalized to pre-treatment and PBS control。

Table 19-1 reflects the HBeAg fold knockout rate compared to the control, calculated as normalized HBeAg levels for the control (PBS) group/normalized HBeAg levels for the corresponding group of one or more RNAi agents (i.e., 1.000/HBeAg level). The data in Table 19-1 show that AD04872 (which, as described above, includes an antisense strand sequence at least partially complementary to the S ORF at positions 261-279 of the HBV genome) and AD04982 (which includes an antisense strand sequence at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome) show a further reduction in HBeAg levels relative to the administration of a single RNAi agent alone (see, e.g., Table 19 and 19-1, panels H and I). Furthermore, the data from this example also show that the combination of AD04872 and AD04982 resulted in a fold reduction in HBeAg that was greater than the sum of the fold reductions in HBeAg in AD04872 and AD04982 administered alone. For example, group I (administered 3.0mg/kg AD04872+2.0mg/kg AD04982) resulted in a fold reduction of HBeAg of 17.0 at day 15, which is greater than the sum of the fold reduction of 4.6 for group G (3.0mg/kg AD04872) plus the fold reduction of 3.2 for group D (2.0mg/kg AD 04982).

In addition, serum HBV DNA levels in serum samples collected on days-1, 8, 15, 22, 29 and 36 were determined for each group in table 17 according to the protocol described in example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are shown in the following table:

TABLE 20 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 7 Normalized to pre-treatment and PBS control (standard deviation reflected as (+/-)).

The data in table 20 show that RNAi agents tested alone and in combination provide a reduction in HBV DNA levels compared to the PBS group, and further show that AD04872 (targeting the S ORF) and AD04982 (which targets the X ORF) reduce serum HBV DNA to a similar extent to an equivalent amount of AD04872 alone.

Example 8 HBV RNAi agents for pHBV mice: further dose response and combination studies。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 21 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 21:

TABLE 21 dose grouping of pHBV mice of example 8。

In addition, mice were euthanized as planned according to the following schedule:

Day 11: groups 2A, 3A, 4A, 5A, 6A, 7A and 8A were euthanized and one mouse in group 9 was euthanized.

Day 14: groups 2A, 3A, 4A, 5A, 6A, 7A and 8A were euthanized.

Day 21: groups 2B, 3B, 4B, 5B, 6B, 7B and 8B were euthanized.

Day 28: groups 1, 2B, 3B, 4B, 5B, 6B, 7B and 8B were euthanized in 2 mice and groups 10 and 12 (4) were euthanized in all mice.

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 21. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. As shown in table 14 above, four (4) mice (n-4) in each group were tested, except that three mice (n-3) in groups 10, 11, 12 and 13 were tested.

Sera were collected on day-1 and days 8, 14, 21 and 28 prior to administration and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 22 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 8 Before treatment and PBS control (standard deviation reflected as (+/-))。

At all measurement time points, the HBV RNAi agents tested alone and in combination showed a significant reduction in HBsAg compared to the PBS control.

Example 9 delivery of RNAi Agents。

The pHBV mouse model described in example 2 above was used. On day 1, a single subcutaneous injection was administered to each mouse with 200 μ l of HBV RNAi agent containing 10mg/kg (mpk) in phosphate buffered saline, or 200 μ l of phosphate buffered saline without HBV RNAi agent as a control. The HBV RNAi agents tested included those with the duplex numbers shown in table 23 below, each of which included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand, as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was collected prior to dosing, then on days 8, 15, 22 and 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 23 mean HBsAg levels in pHBV mice were normalized following administration of HBV RNAi agents from example 9 Before treatment and PBS control (standard deviation reflected as (+/-))。

Each of the HBV RNAi agents shown in Table 23 above includes an antisense strand sequence that is at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome. Each of the RNAi agents showed significant knockdown compared to the PBS control.

Example 10 use of HBV RNAi agents in pHBV mice: further combinatorial studies。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 24 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 24:

TABLE 24 dose grouping of pHBV mice of example 10。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 24. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was collected prior to administration, and then serum was collected on days-1, 8, 15, 22, 29, 36, 43, 50, 57 and 64. Serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are as follows:

TABLE 25 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 10 Before treatment and PBS control (group A was used as control) (standard deviation is reflected as (+/-))。

The HBV RNAi agents AD04585 and AD04771 were designed to have antisense strand sequences at least partially complementary to the S open reading frame at position 257-275 of the HBV genome, as shown in tables 1 and 2. The HBV RNAi agents AD04580 and AD04776 are designed to have antisense strand sequences at least partially complementary to the X open reading frame at position 1781-1799 of the HBV genome, as shown in tables 1 and 2. At all measurement time points, the HBV RNAi agents tested alone and in combination showed a reduction in HBsAg compared to the PBS control. Each subsequent dose further reduced the nadir of HBsAg reduction.

In addition, serum HBV DNA levels in serum samples collected on days-1, 8, 15, 22, 29, 36, 43 and 50 were determined for group C (3.0mg/kg AD04585), group E (3.0mg/kg AD04580) and group G (1.5mg/kg AD04585+1.5mg/kg AD04580) in Table 24 according to the protocol described in example 2 above. At each of these time points, serum HBV DNA isolation was performed for each animal. The data are shown in the following table:

TABLE 26 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 10 Normalization to pre-treatment and PBS controls (both PBS groups A and B) (standard deviation reflected as (+/-))。

The data in table 26 show that the HBV RNAi agents tested alone and in combination provide a reduction in HBV DNA levels compared to the PBS group.

Example 11 HBV RNAi agents for pHBV mice: combinatorial study。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 27 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 27:

TABLE 27 dose grouping of pHBV mice of example 11。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 24. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was collected on day-1 prior to administration, then on days 8, 15, 22, 29 and 36 (except for L (AD04882) and M (AD 04885)), and serum hepatitis b surface antigen (HBsAg) levels were determined according to the procedure described in example 2 above. The experimental data are shown in the following table:

TABLE 28 mean HBsAg of pHBV mice normalized to zero after administration of HBV RNAi agents from example 11 Pretreatment and PBS control (standard deviation reflected as (+/-))。

The RNAi agent AD04962 was designed to have an antisense strand sequence at least partially complementary to the S open reading frame from 257 th to 275 th of the HBV genome, as shown in tables 1 and 2. RNAi agent AD04872 was designed with an antisense strand sequence at least partially complementary to the S open reading frame at positions 261 to 279 of the HBV genome, as shown in tables 1 and 2. RNAi agent AD04963 was designed with an antisense strand sequence at least partially complementary to the X open reading frame from position 1781 to 1799 of the HBV genome, as shown in tables 1 and 2. RNAi agents AD04882 and AD04885 were designed with antisense strand sequences at least partially complementary to the X open reading frame from position 1780 to 1798 of the HBV genome, as shown in tables 1 and 2. At all time points of measurement, the HBV RNAi agents, alone and in combination, shown in table 9 immediately above, showed a reduction in HBsAg compared to the PBS control. Re-administration resulted in an additional HBsAg reduction.

In addition, serum hepatitis b e antigen (HBeAg) levels were also evaluated for all groups except L and M groups. Samples from each respective group of mice were first pooled and the resulting serum samples were assayed in a singleplex fashion. The experimental data are shown in the following table:

TABLE 29 mean HB of pHBV mice after administration of HBV RNAi agents from example 11eAg level normalization Before treatment and PBS control。

Group of	Day 8	Day 22	Day 29	Day 36
					A	1.000	1.000	1.000	1.000
B	0.425	0.291	0.371	0.365
					C	0.152	0.170	0.328	0.356
D	0.266	0.249	0.456	0.440
					E	0.278	0.295	0.589	0.561
F	0.306	0.291	0.718	0.522
					G	0.183	0.138	0.291	0.249
H	0.091	0.131	0.315	0.238
					I	0.183	0.052	0.069	0.036
J	0.089	0.114	0.190	0.236
					K	0.458	0.172	0.322	0.207

In addition, serum HBV DNA levels in serum samples collected on days 8, 15, 22 and 29 were determined for each group in table 27 according to the protocol described in example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are shown in the following table:

TABLE 30 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 7 Normalization to pre-treatment and PBS control (standard deviation reflected as (+/-))。

The data in table 30 show that RNAi agents tested alone and in combination provide a reduction in HBV DNA levels compared to the PBS group. Re-administration resulted in additional reduction of HBV DNA.

Example 12 use of HBV RNAi Agents in pHBV mice。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 31 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 31:

TABLE 31 dose grouping of pHBV mice of example 12。

Group of	RNAi agents and dosages	Dosing regimens
			A	PBS (without RNAi agent)	Single injection on day 1
B	2.0mg/kgAD04871	Single injection on day 1
			C	2.0mg/kgAD04872	Single injection on day 1
D	2.0mg/kgAD04874	Single injection on day 1
			E	2.0mg/kgAD04875	Single injection on day 1
F	2.0mg/kgAD04876	Single injection on day 1
			G	2.0mg/kgAD04881	Single injection on day 1
H	2.0mg/kgAD04883	Single injection on day 1
			I	2.0mg/kgAD04884	Single injection on day 1

Each mouse was administered subcutaneously with 200 μ l containing this amount of HBV RNAi agent formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agent, as shown in table 24. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was then collected on days 8, 15 and 22 prior to administration. Sera were also collected on days 29, 36, 43, and 50 for group A (PBS), group B (2.0mg/kg AD04871), group C (2.0mg/kg AD04872), group D (2.0mg/kg AD04874), group E (2.0mg/kg AD04875), and group F (2.0mg/kg AD 04876). Serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 32 mean HBsAg of pHBV mice normalized to place after administration of HBV RNAi agent from example 12 Pretreatment and PBS control (standard deviation reflected as (+/-))。

The HBV RNAi agents AD04871, AD04872, AD04874, AD04875 and AD04876 were each designed to have an antisense strand sequence at least partially complementary to the S open reading frame from position 261 to 279 of the HBV genome, as shown in tables 1 and 2. Each of these HBV RNAi agents should significantly reduce HBsAg compared to PBS control. For example, at various time points measured from day 15 to day 43, HBsAg at a single 2mg/kg dose of each of AD04871 (group B), AD04872 (group C) and AD04874 (group D), and AD04876 (group F) showed a greater than 90% reduction in HBsAg compared to controls. The HBV RNAi agents AD04881, AD04883, AD04884 were each designed with an antisense strand sequence at least partially complementary to the X open reading frame from position 1780 to position 1798 of the HBV genome, as shown in tables 1 and 2.

Example 13 dose response and combination of HBV RNAi Agents in region X knockout model mice。

As an alternative method to evaluate the effect of a combination of two RNAi agents, one comprising an antisense strand sequence at least partially complementary to a region located in the S ORF of HBV mRNA and a second RNAi agent comprising an antisense strand sequence at least partially complementary to a region located in the X ORF of HBV mRNA, a plasmid comprising an HBV genome was generated in which the binding sites of HBV RNAi agents targeting positions 1780 and 1781 were knocked out as shown in tables 1 and 2 (hereinafter referred to as X-region knock-out mice). This model was generated by mutating ten (10) bases in the pHBV1.3 plasmid within the binding site of these RNAi agents. The remainder of the HBV mRNA, including the S region, remains functional. Thus, in this HBV mouse model, HBV RNAi agents comprising antisense strands with targets at positions 1780 and 1781 of the HBV genome disclosed herein are expected to be ineffective for silencing expression.

The mice were divided into various groups, including those listed in table 33 below, and the mice were injected subcutaneously with 200 μ l according to the dosing regimen given in the table below:

TABLE 33 dose grouping of X-region knockout mice of example 13。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 33. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Sera were collected at day 5, day 8, day 15, day 22 and day 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. Sera from groups 1 to 5 were also collected on days 36 and 43. The experimental data are shown in table 34 below:

TABLE 34 administration of HBV from example 13 After RNAi agent, mean HBsAg normalization in X-region knockout mice Before treatment and PBS control (standard deviation reflected as (+/-)) 。

It was predicted that group 6, which is a single dose of 3.0mg/kg HBV RNAi agent AD04963 and comprises an antisense strand at least partially complementary to the X open reading frame at position 1781-1799 of the HBV genome, could not provide knock-out of HBsAg. In addition, each of groups 2-5 provided significant knockouts of HBsAg compared to PBS control, with both groups 3 and 5 showing greater than 2 log reductions of HBsAg at nadir (day 22).

Example 14 dose response and combination of HBV RNAi Agents in X-region knockout model mice。

The X-region knockout mouse model described in example 13 above was used. The mice were divided into various groups, including those listed in table 31 below, and a single 200 μ Ι subcutaneous injection was administered to each mouse according to the dosing regimen shown in table 35:

TABLE 35 dose grouping of X-region knockout mice of example 14。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 35. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) per group shown in table 35 were tested.

Sera were collected on day 1 (pre-dose), day 8, day 15, day 22 and day 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 36 in the X-region knockout mice of example 14, mean HBsAg levels were normalized to pre-treatment and PBS pairs Light block。

Group of	Day 8	Day 15	Day 22	Day 29
					1	1.000±0.120	1.000±0.255	1.000±0.224	1.000±0.143
2	0.104±0.104	0.009±0.009	0.005±0.004	0.005±0.003
					3	0.076±0.041	0.010±0.009	0.006±0.005	0.005±0.005
4	0.036±0.008	0.002±0.001	0.001±0.001	0.002±0.001
					5	0.019±0.017	0.003±0.002	0.003±0.001	0.004±0.000

Table 36 shows that administration of HBV RNAi agents AD04872 alone and a combination of AD04872 (which includes an antisense strand at least partially complementary to the S open reading frame from position 261 to 279 of the HBV genome) and AD05070 (which includes an antisense strand at least partially complementary to the X open reading frame from position 1781 to 1799 of the HBV genome) provided significant knock-outs of HBsAg at each time point measured compared to PBS control. In this X-region knockout model, the addition of 2mg/kg to 0.7mg/kg of HBV RNAi agent AD05070 with the mutant target site did not attenuate the activity of 2mg/kg HBV RNAi agent AD 04872.

In addition, serum HBV DNA levels in serum samples collected on days 8, 15 and 22 were determined according to the procedure described in example 2 above. The sera of each group were pooled and then DNA was isolated from the sera in a singleplex fashion. The data are shown in the following table:

TABLE 37 in the administration of HBV from example 14 After RNAi agent, the mean serum HBV DNA of mice is knocked out in region X Levels were normalized to pre-treatment and PBS control (standard deviation reflected as (+/-))。

Group of	Day 8	Day 15	Day 22
				1	1.000±0.007	1.000±0.011	1.000±0.066
2	0.225±0.019	0.022±0.001	0.036±0.001
				3	0.151±0.002	0.029±0.001	0.042±0.003
4	0.140±0.006	0.016±0.000	0.018±0.000
				5	0.069±0.002	0.018±0.003	0.043±0.002

In this X-region knockout model, the addition of 2mg/kg to 0.7mg/kg of HBV RNAi agent AD05070 with the mutant target site did not attenuate the activity of 2mg/kg HBV RNAi agent AD 04872.

Example 15 use of HBV RNAi Agents in pHBV mice。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups, including those listed in table 38 below, and a single 200 μ Ι subcutaneous injection was administered to each mouse according to the dosing regimen shown in table 38:

TABLE 38 dose grouping of pHBV mice of example 15。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 38. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was collected on day-1 prior to dosing, and then on days 8, 15, 22, 29, 36, 43 and 50. Serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in table 39 below, where the mean HBsAg reflects the normalized mean of HBsAg:

TABLE 39 average HBsAg of pHBV mice normalized to zero after administration of HBV RNAi agents from example 15 Pre-treatment and PBS controls。

RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074 were each designed with an antisense strand sequence at least partially complementary to the X open reading frame from position 1781 to position 1799 of the HBV genome, as shown in tables 1 and 2. RNAi agents AD05075, AD05076, AD05077, and AD05078 were each designed with antisense strand sequences at least partially complementary to the X open reading frame from position 1780 to position 1798 of the HBV genome, as shown in tables 1 and 2.

Table 39 shows that at each time point measured, administration of HBV RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073 and AD05074 alone or in combination with AD04872 (which includes an antisense strand at least partially complementary to the S open reading frame at position 261-279 of the HBV genome) provided a significant reduction in HBsAg compared to the PBS control.

Example 16 use of HBV RNAi agents in pHBV mice: dose response and combination studies。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 40 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing schedule shown in table 40:

TABLE 40 dose grouping of pHBV mice of example 16。

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 40. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Six (6) mice (n-6) in each group were tested.

Serum was collected prior to dosing, then on days 8, 15, 22 and 29 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in table 41 below:

TABLE 41 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 16 Before treatment and PBS control (standard deviation reflected as (+/-))。

Group of	Day 8	Day 15	Day 22	Day 29
					1	1.000±0.117	1.000±0.213	1.000±0.169	1.000±0.130
2	0.050±0.018	0.015±0.007	0.011±0.005	0.009±0.006
					3	0.051±0.037	0.014±0.011	0.010±0.006	0.002±0.001
4	0.029±0.018	0.010±0.006	0.011±0.006	0.010±0.005
					5	0.022±0.003	0.007±0.001	0.009±0.003	0.001±0.001
6	0.027±0.012	0.007±0.004	0.008±0.005	0.011±0.005
					7	0.028±0.012	0.010±0.005	0.009±0.005	0.001±0.000
8	0.033±0.016	0.016±0.008	0.020±0.009	0.021±0.011
					9	0.034±0.025	0.015±0.011	0.018±0.013	0.003±0.002
10	0.038±0.021	0.015±0.005	0.019±0.004	0.003±0.001
					11	0.446±0.143	0.376±0.120	0.474±0.149	0.338±0.123
12	0.307±0.111	0.257±0.122	0.236±0.057	0.138±0.031

At all measurement time points, the HBV RNAi agents tested alone and in combination showed a reduction in HBsAg compared to the PBS control. HBsAg expression was further reduced in all groups re-dosed on day 22.

In addition, serum hepatitis b e antigen (HBeAg) levels were also evaluated. For day 8 measurements, serum samples from all six mice in each group were pooled and the resulting samples were assayed in a singleplex fashion. For day-1, day 15, day 22 and day 29 measurements, six mice from each group were paired within each group and their corresponding serum samples were pooled, each group forming three subgroups. Serum samples were then assayed for each of the three subgroups of each group. The experimental data are shown in table 42 below:

TABLE 42 mean HBeAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 16 Standard deviations by day 15, day 22 and day 29, as reflected by (+/-) and PBS controls before treatment。

At all time points of measurement, the HBV RNAi agents tested alone and in combination showed a reduction in HBeAg compared to the saline control. HBeAg expression was further reduced in all groups re-dosed on day 22.

In addition, serum HBV DNA levels in serum samples collected on days-1, 8, 15 and 22 were determined for each group in table 40 according to the protocol described in example 2 above. Sera from each pair of mice were pooled and a single isolation was performed to isolate DNA from each serum pool. The data are shown in the following table:

TABLE 43 mean serum HBV DNA levels of pHBV mice after administration of HBV RNAi agents from example 16 Normalization to pre-treatment and PBS control (standard deviation reflected as (+/-))。

Group of	Day 8	Day 15	Day 22
				1	1.000±0.122	1.000±0.299	1.000±0.241
2	0.312±0.016	0.126±0.008	0.087±0.018
				3	0.264±0.065	0.081±0.023	0.073±0.028
4	0.321±0.254	0.120±0.066	0.134±0.101
				5	0.319±0.081	0.108±0.038	0.098±0.051
6	0.260±0.095	0.068±0.010	0.076±0.031
				7	0.170±0.028	0.082±0.013	0.062±0.018
8	0.188±0.020	0.192±0.160	0.307±0.309
				9	0.242±0.003	0.100±0.042	0.075±0.028
10	0.322±0.028	0.159±0.025	0.086±0.016
				11	1.124±0.142	0.742±0.127	0.807±0.192
12	1.004±0.144	0.541±0.340	0.569±0.060

Except groups 11 and 12, which had no serum HBV DNA reduction on day 8, the HBV RNAi agents tested alone and in combination showed serum HBV DNA reduction compared to serum controls at all measurement time points.

Example 17 use of HBV RNAi Agents in pHBV mice。

The pHBV mouse model described in example 2 above was used. The mice were divided into various groups as shown in table 44 below, and each mouse was administered a single 200 μ l subcutaneous injection according to the dosing regimen shown in table 44:

TABLE 44 dose grouping of pHBV mice of example 17。

Group of	RNAi agents and dosages	Dosing regimens
			1	PBS (without RNAi agent)	Single injection on day 1
2	5mg/kgAD04585+1mg/kgAD04963	Single injection on day 1
			3	5mg/kgAD04872+1mg/kgAD04963	Single injection on day 1
4	5mg/kgAD04585+1mg/kgAD04963	Single injection on day 1 and day 8
			5	5mg/kgAD04872+1mg/kgAD04963	Single injection on day 1 and day 8
6	2.5mg/kgAD04585+0.5mg/kgAD04963	Single injection on day 1
			7	2.0mg/kgAD04585+1.0mg/kgAD04963	Single injection on day 1
8	2.5mg/kgAD04872+0.5mg/kgAD04963	Single injection on day 1
			9	2.0mg/kgAD04872+1.0mg/kgAD04963	Single injection on day 1
10	5mg/kgAD04872+1mg/kgAD04981	Single injection on day 1
			11	2.5mg/kgAD04872+0.5mg/kgAD04981	Single injection on day 1 and day 8
12	2.5mg/kgAD04872+0.5mg/kgAD04981	Single injection on day 1
			13	2mg/kgAD04872+1mg/kgAD04981	Single injection on day 1
14	2.5mg/kgAD04585+0.5mg/kgAD04981	Single injection on day 1
			15	2mg/kgAD04585+1mg/kgAD04981	Single injection on day 1
16	0.5mg/kgAD04981	Single injection on day 1

Each mouse was administered subcutaneously 200 μ l containing this amount of one or more HBV RNAi agents formulated in phosphate buffered saline, or 200 μ l phosphate buffered saline without HBV RNAi agents, as shown in table 44. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area. Three (3) mice (n-3) in each group were tested.

Serum was collected prior to dosing, then on days 8, 14, 21 and 29 and 36 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in table 45 below:

TABLE 45 mean HBsAg levels in pHBV mice were normalized after administration of HBV RNAi agents from example 17 Before treatment and PBS control (standard deviation reflected as (+/-))。

At all measurement time points, the tested HBV RNAi agent combinations showed a reduction in HBsAg compared to the saline control. The combination containing AD04872 showed a greater reduction than the equivalent combination of AD04585 instead of AD 04872.

In addition, serum HBV DNA levels in serum samples collected on days 8, 14, 21 and 29 were determined according to the procedure described in example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data are shown in table 46 below:

TABLE 46 mean serum HBV DNA levels of pHBV mice following administration of HBV RNAi agents from example 17 Normalization to pre-treatment and PBS control (standard deviation reflected as (+/-))。

Group of	8 thSky	Day 14	Day 21	Day 29
					1	1.000±0.280	1.000±0.269	1.000±0.418	1.000±0.383
2	0.136±0.068	0.192±0.071	0.173±0.032	0.292±0.039
					3	0.097±0.034	0.068±0.016	0.076±0.034	0.131±0.061
4	0.061±0.039	0.002±0.001	0.003±0.001	0.019±0.013
					5	0.068±0.025	0.003±0.002	0.0009±0.0003	0.0009±0.0003
6	0.354±0.299	0.345±0.187	0.522±0.234	0.509±0.106
					7	0.103±0.064	0.291±0.025	0.203±0.043	0.203±0.015
8	0.336±0.142	0.185±0.071	0.183±0.065	0.162±0.064
					9	0.198±0.055	0.093±0.023	0.118±0.054	0.143±0.032
10	0.122±0.071	0.024±0.026	0.023±0.020	0.014±0.017
					11	0.160±0.069	0.016±0.023	0.003±0.001	0.005±0.004
12	0.158±0.039	0.120±0.044	0.100±0.049	0.091±0.034
					13	0.190±0.038	0.169±0.025	0.066±0.015	0.081±0.015
14	0.434±0.136	0.318±0.104	0.144±0.094	0.240±0.029
					15	0.358±0.185	0.287±0.108	0.279±0.080	0.303±0.038
16	0.713±0.085	0.674±0.140	0.496±0.128	0.590±0.093

At all measurement time points, the tested HBV RNAi agent combinations showed a reduction in serum HBV DNA compared to the saline control. The combination containing AD04872 showed a greater reduction than the equivalent combination of AD04585 instead of AD 04872. These greater reductions were observed at day 22 and day 29.

Example 18 HBV RNAi Agents in humanized mouse model of HBV infection。

For this study, males will be(genotype Fah-/-/Rag2-/-/Il2 rg-/-triple knockout mice on C57BL/6 background (Yecuris)) were transplanted onto human hepatocytes that were 1-2 months old. Human hepatocytes were refilled with liver for about 6 months by regular NTBC treatment to prevent growth of mouse hepatocytes. Mice were inoculated intravenously with 4x10 at 9 months of age ⁸Individual genomes/kg HBV genotype C, followed by infection of human hepatocytes. After 2-3 months, serum HBV DNA levels reached a plateau indicating that human hepatocytes were maximally infected (mouse hepatocytes were not infected with HBV). Treatment with HBV RNAi drugs was started at one year of age of the mice, thus approaching the end of their lifespan.

Pre-treatment serum samples were collected on days-10 and-3. From day 1, each mouse was administered 0.01mg/kg entecavir in water daily by gavage to inhibit HBV replication. The daily dose of entecavir continues until the day the mice are euthanized. Administration of entecavir is expected to reduce serum HBV DNA in chronically infected human patients, but not HBsAg.

The mice were divided into various groups, including those listed in table 47 below:

TABLE 47 dose grouping of FRG humanized model mice infected with HBV of example 18。

On days 1 and 29 (if still viable on day 29), each mouse was administered 100 μ l subcutaneously per each 20g body weight per day of either HBV RNAi agent formulated in phosphate buffered saline containing that amount, or an equal volume of phosphate buffered saline without HBV RNAi agent, according to the schedule set forth in table 47 immediately above. Each HBV RNAi agent included an N-acetyl-galactosamine targeting ligand conjugated to the 5' -terminus of the sense strand as shown in tables 4 and 5. The injection is a loose skin that is made between the skin and the muscle (i.e., subcutaneous injection) to the neck and shoulder area.

Sera were collected at day 8, day 15, day 22, day 29, day 36 and day 40 and serum hepatitis b surface antigen (HBsAg) levels were determined according to the protocol described in example 2 above. The experimental data are shown in the following table:

TABLE 48 mean HBsAg levels for each of the humanized FRG model mice infected with HBV from example 18 Normalized to before treatment (day-3)。

Group of	Day 8	Day 15	Day 22	Day 29	Day 36	Day 40
							A-1	0.830	0.828	0.932	0.858	1.107
A-2	1.303	1.328
							B-1	0.548	0.314	0.272	0.207	0.138
B-2	0.592	0.337	0.243	0.215	0.160	0.175
							C-1	0.643	0.460	0.415	0.251	0.164
C-2	0.353	0.228	0.182	0.172	0.224	0.216
							C-3	0.814	0.674

In addition, serum HBV DNA levels were determined in serum samples collected on days-10, -3, 8, 15, 22, 29, 36 and 40 according to the protocol described in example 2 above. The data are shown in table 4 below:

TABLE 49 humanized mice of each HBV-infected FRG after administration of the HBV RNAi agent from example 14 Serum HBV DNA levels were normalized to mean values from day-10 and day-3 before treatment。

It is anticipated that administration of entecavir reduces viral replication in the absence and presence of HBV RNAi agents.

Example 19 clinical study of HBV RNAi Agents

Phase 1/2a, randomized, double-blind, single dose escalation study was performed in healthy volunteers (NHV), and an open label, multiple dose escalation study was performed in patients with chronic HBV infection (CHB). The study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in healthy patients and patients chronically infected with hepatitis b virus (CHB). The study population included healthy adult males and females (18 to 55 years) and adult males and females (18 to 65 years) that had been diagnosed with HBeAg positive or HBeAg negative chronic (>6 months) HBV infection.

NHV subjects were divided into five cohorts with 6 subjects per cohort (cohort 1 to cohort 5). NHV cohorts (4 receiving the active substance, 2 receiving placebo) received single doses of 35mg, 100mg, 200mg, 300mg or 400mg of a combination of AD04872 and AD05070 or saline in a blinded manner via subcutaneous injection. CHB cohorts 1, 1c and 2b to 5b were HBeAg positive or negative, either not undergoing nucleoside inhibitors (NUC) or undergoing NUC at baseline, and received a three month dose of a combination of AD04872 and AD05070 in amounts of 25mg, 50mg, 100mg, 200mg, 300mg or 400mg via subcutaneous injection. Cohort 6 enrolled 4 CHB patients who received a 100mg dose of AD04872 in combination with AD05070 three times every two weeks. Cohort 7 enrolled 4 CHB patients who received a 100mg dose of a combination of AD04872 and AD05070 for three weeks. CHB cohorts 8 and 9(4 receiving actives) were HBeAg positive, either not undergoing treatment or undergoing NUC, respectively, receiving a combination of AD04872 and AD05070 at a dose of 300mg for three months via subcutaneous injection. Cohort 10 and cohort 11 each recruited 4 CHB patients to receive a combination of AD04872 and AD05070 at doses of 200mg and 300mg for 3 weeks, respectively. CHB patients who experienced NUC continued their daily NUC throughout the study, and CHB patients who did not experience NUC began daily NUC on day 1. For CHB, viral DNA, viral RNA and antigens HBsAg, HBeAg and HBcrAg were measured periodically. Study parameters are summarized in table 50.

Watch 50

Fig. 1 and 14 show the mean log change of antigen HBsAg from day 1 in CHB patients (cohorts 2b, 3b, 4b, 5b, 8 and 9). Table 51 below shows the nadir HBsAg response for CHB patients with HBsAg data collected for more than 6 weeks. Strong HBsAg responses were observed in all HBV patients at monthly doses, and similar responses were also observed in HBeAg-positive and HBeAg-negative patients as well as in patients who did not experience NUC and experienced NUC. HBsAg reduction ranged from-1.3 to-3.8 Log₁₀. Fig. 2 to 12 show the individual changes of HBV DNA, HBV RNA, HBeAg and HBcrAg in CHB patients (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 6, 7, 8, 9, 10 and 11). All these pathological parameters (HBV DNA, HBV RNA, HBeAg and HBcrAg) show a response to HBV RNAi agents (AD04872 and AD 05070). Figure 13 shows the lowest point Log HBsAg reduction data for CHB patients. Similar responses were observed for both patients who were HBeAg positive and HBeAg negative.

TABLE 51 nadir HBsAg response in CHB patients

Nadir HBsAg response	Percentage of CHB patients
		>1 log (90%) reduction	100％
>1.5 log (9)7%) reduction	83％
		>2 log (99%) reduction	38％
>3 log (99.9%) reduction	3％

Table 52 and table 53 show the safety and tolerability results from the study of healthy patients and CHB patients, respectively. Subcutaneously administered HBV RNAi agents (AD04872 and AD05070) appear to be well tolerated at single or multiple monthly doses up to 400 mg. Mild injection site reactions were observed with approximately 12% subcutaneous injections.

TABLE 52 safety and tolerability in healthy patients

TABLE 53.CHB patient safety and tolerability

Example 20 clinical study of HBV RNAi Agents

A phase 1/2a, randomized, double-blind, multiple dose escalation study was performed on healthy volunteers (NHV), and an open label, multiple dose escalation study was performed on patients with chronic HBV infection (CHB). The study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in healthy patients and patients chronically infected with hepatitis b virus (CHB). The study population included healthy adult males and females (18 to 55 years) and adult males and females (18 to 65 years) that had been diagnosed with HBeAg positive or HBeAg negative chronic (>6 months) HBV infection.

NHV subjects were divided into five cohorts with 6 subjects per cohort (cohort 1 to cohort 5). NHV cohorts (4 receiving the active substance, 2 receiving placebo) received single doses of 35mg, 100mg, 200mg, 300mg or 400mg of a combination of AD04872 and AD05070 or saline in a blinded manner via subcutaneous injection. CHB cohorts 1, 1c and 2b to 5b were HBeAg positive or negative, either not undergoing nucleoside inhibitors (NUC) or undergoing NUC at baseline, and received three doses of a combination of AD04872 and AD05070 in amounts of 35mg, 50mg, 100mg, 200mg, 300mg or 400mg at 28 day intervals via subcutaneous injection. Cohort 6 enrolled 4 CHB patients who received a 100mg dose of AD04872 in combination with AD05070 three times every two weeks. Cohort 7 enrolled 4 CHB patients who received a 100mg dose of a combination of AD04872 and AD05070 for three weeks. CHB cohorts 8 and 9(4 receiving actives) were HBeAg positive, not undergoing treatment or undergoing NUC, respectively, receiving three doses of a combination of AD04872 and AD05070 in an amount of 300mg at 28 day intervals via subcutaneous injection. Cohort 10 and cohort 11 each recruited 4 CHB patients to receive a combination of AD04872 and AD05070 at doses of 200mg and 300mg for 3 weeks, respectively. CHB patients who experienced NUC continued their daily NUC throughout the study, and CHB patients who did not experience NUC began daily NUC on day 1. For CHB, viral DNA, viral RNA and antigens HBsAg, HBeAg and HBcrAg were measured periodically. Study parameters are summarized in table 54.

Watch 54

Figure 15 shows the mean change in antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The mean HBsAg reduction was more pronounced in HBeAg positive than in HBeAg negative participants. Generally, HBsAg decline persists over time in all doses at least until day 168. Figure 16 shows the mean change of antigens HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). RNAi agents show targeting activity to both HBeAg and HBsAg, with HBsAg reduction being more pronounced.

Figure 20 shows the mean change in antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The mean HBsAg reduction was more pronounced in HBeAg positive than in HBeAg negative participants. Generally, HBsAg decline persists over time in all doses at least until day 392. Figure 21 shows the mean change in antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injection at intervals of 28 days (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). RNAi agents showed targeting activity to both HBeAg and HBsAg, with HBsAg reduction being more pronounced and with sustained average HBeAg and HBsAg responses.

For all ginsengNumber, sustained inhibition is defined as ≧ 1.0log from day 1₁₀Decrease or quantified on day 336 < lower limit. Safety and viral parameters (HBsAg, HBeAg, HBV DNA, HBV RNA, HBcrAg) were evaluated in 8 CHB patients/cohorts (with or without NA; HBeAg + ve or-ve) receiving 3 subcutaneous doses of JNJ-3989 (day 1, day 27, day 57) of 100mg, 200mg, 300mg (n ═ 16) or 400 mg. Patients started/continued to use NA on day 1 and continued throughout the study. For patients with quantifiable parameters on day 1 and available data on day 336, sustained inhibition of HBV RNA was observed in 15/26 patients, sustained inhibition of HBeAg was observed in 9/14 patients, and sustained inhibition of HBcrAg was observed in 10/24 patients. JNJ-3989(100mg to 400mg) was well tolerated in CHB patients along with NA. Greater than or equal to 1.0log of lowest point HBsAg is achieved in 98% of patients₁₀And decreases. Approximately 9 months after the last RNAi dose, patient subpopulations had sustained inhibition of HBsAg (mean 1.74); see fig. 22. Sustained inhibition of other viral parameters was also observed.

Example 21 clinical study of HBV RNAi Agents

A phase 1/2a, randomized, double-blind, multiple dose escalation study was performed on healthy volunteers (NHV), and an open label, multiple dose escalation study was performed on patients with chronic HBV infection (CHB). This study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in NHV and patients chronically infected with hepatitis b virus (CHB). The study population included healthy adult males and females (18 to 55 years) and adult males and females (18 to 65 years) who had been diagnosed with HBeAg positive or HBeAg negative chronic (HBsAg positive >6 months) HBV infection.

NHV subjects were divided into five cohorts with 6 subjects per cohort (cohort 1 to cohort 5). NHV cohorts (4 receiving the active substance, 2 receiving placebo) received single doses of 35mg, 100mg, 200mg, 300mg or 400mg of a combination of AD04872 and AD05070 or saline in a blinded manner via subcutaneous injection. CHB cohorts 1b, 1c and 2b to 5b were HBeAg positive or negative, either not undergoing nucleoside inhibitors (NUC) or undergoing NUC at baseline, and received three doses of a combination of AD04872 and AD05070 in amounts of 25mg, 50mg, 100mg, 200mg, 300mg or 400mg at 28 day intervals via subcutaneous injection. Cohort 6 enrolled 4 CHB patients who received a 100mg dose of AD04872 in combination with AD05070 three times every two weeks. Cohort 7 enrolled 4 CHB patients who received a 100mg dose of a combination of AD04872 and AD05070 for three weeks. CHB cohorts 8 and 9(4 receiving actives) were HBeAg positive, not undergoing NUC treatment or undergoing NUC, respectively, receiving three doses of a combination of AD04872 and AD05070 in an amount of 300mg at 28 day intervals via subcutaneous injection. Cohort 10 and cohort 11 each recruited 4 CHB patients to receive a combination of AD04872 and AD05070 at doses of 200mg and 300mg for 3 weeks, respectively. CHB patients who experienced NUC continued their daily NUC throughout the study, and CHB patients who did not experience NUC began daily NUC on day 1. For the CHB cohort, viral DNA, viral RNA and antigens HBsAg, HBeAg and HBcrAg were measured periodically.

HBV RNAi agents (AD04872 and AD05070) were designed to silence HBV RNA transcripts from episomal cccDNA and host-integrated HBV DNA. HBV RNAi agents reduced serum HBsAg levels by > 1log10 in all patients receiving three doses of HBV RNAi agents (100mg to 400mg once every 4 weeks (Q4w) along with NA), regardless of baseline HBeAg status or prior NA treatment, as shown in example 19. Given the lack of dose response to 100mg to 400mg Q4w HBV RNAi agent, in this example cohorts 2b to 5b were expanded from four patients to eight patients and two lower dose cohorts 1b and 1c (25 mg and 50mg Q4w, respectively) were added. As described below, efficacy data and safety data up to day 113 (i.e., two months after HBV RNAi agent administration) for cohorts 2b to 5b and 1c are shown.

In cohorts 1b, 1c, and 2 b-5 b, HBeAg positive or negative, NA experienced or naive CHB patients were enrolled on days 1, 27, and 57 and received three subcutaneous HBV RNAi agent doses of 25mg, 50mg, 100mg, 200mg, 300mg, or 400mg Q4 w. All patients started (without NA) or continued (with NA) daily NA (TDF or ETV) treatment on day 1 and continued after the end of HBV RNAi agent administration. At screening and on days 1, 8, 15, 29, 43 Study visits were performed on days 57, 85 and 113, followed by an extended follow-up approximately every 2 months for 12 months. Evaluation of serum viral parameters, i.e., HBV DNA (lower limit of quantitation [ LLOQ ]]：20IU/mL)、HBV RNA(LLOQ：1.65log₁₀U/mL⁴) HBsAg (LLOQ: 0.05IU/mL), HBeAg (LLOQ: 0.01 PEIU/mL; values below 0.11PEIU/mL were reported as undetected) and HBcrAg (LLOQ: 1 KU/mL). Safety assessments included clinical laboratory assessments and Adverse Events (AEs) assessed from screening to day 113 (as reported herein) and to an extended follow-up period. The study parameters are summarized in table 55.

Watch 55

Baseline characteristics and demographic information for clusters 1b, 1c, 2b, 3b, 4b, and 5b are shown in table 56. Most patients experience NA (40/48, 83%). All patients received their planned HBV RNAi agent dose without treatment interruption.

Watch 56

AA: african americans; BMI: a body mass index; HBeAg: hepatitis b e antigen; HBsAg: hepatitis b surface antigen; NA: a nucleoside analog; SEM: standard error of the mean.

Mean HBsAg changes from day 1 to day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b are shown in fig. 17. On days 1, 29 and 57, three subcutaneous doses of HBV RNAi agent were administered to the patient: 25mg (cohort 1b), 50mg (cohort 1c), 100mg (cohort 2b), 200mg (cohort 3b), 300mg (cohort 4b) or 400mg (cohort 5 b). And all patients were given NA daily. HBV RNAi agents reduced HBsAg levels at all doses evaluated. Mean HBsAg (SEM) log at 25mg dose of HBV RNAi agent on day 1 on day 113 (typical mean nadir after three doses, 56 days after the last dose) ₁₀The reduction was 1.00(0.18), 1.18(0.08) at a 50mg dose, 1.54(0.18) at a 100mg dose, 1.71(0.15) at a 200mg dose, 1.48(0.11) at a 300mg dose, and 1.75(0.16) at a 400mg dose.

Mean and individual HBsAg changes at day 113 from day 1 for all patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b are shown in figure 18. HBsAg achieves greater than or equal to 1.0log from the lowest point day 1₁₀The patient ratios for the day 113 data were 4/8(25mg), 6/8(50mg), 7/8(100mg), 8/8(200mg), 8/8(300mg) and 8/8(400 mg). Similar responses were observed for both HBeAg positive and HBeAg negative patients. HBeAg positive patients (n 11) showed HBsAg reduction-1.52 log₁₀IU/mL (mean nadir). HBeAg negative patients (n 37) showed HBsAg reduction-1.62 log₁₀IU/mL (mean nadir). One patient receiving 200mg did not detect HBsAg on day 113 and achieved a 1.6log10 reduction on day 15 prior to HBsAg serum clearance. For HBsAg>Patients with 100IU/mL (day 1) and data from day 113, treated with HBV RNAi agents, 2/7(25mg), 3/8(50mg), 5/7(100mg), 5/6(200mg), 6/8(300mg) and 5/7(400mg) achieved HBsAg<100IU/mL。

Changes in HBV DNA, HBV RNA, HBeAg and HBcrAg in individual participants (cohorts 1b, 1c, 2b, 3b, 4b and 5b) receiving 25mg (cohort 1b), 50mg (cohort 1c), 100mg (cohort 2b), 200mg (cohort 3b), 300mg (cohort 4b) or 400mg (cohort 5b) on days 1, 29 and 57 are shown in figures 19A to 19D. All patients were given NA daily. HBV DNA and HBV RNA levels were greatly reduced for patients with measurable parameters on day 1, and the reduction in HBeAg and HBcrAg was less significant when treated with HBV RNAi agents. In addition to HB, sustained inhibition was observed in a proportion of patients for HBV RNA, HBeAg and HBcrAg. For patients with quantifiable parameters on day 1 and available data on day 336, sustained inhibition of HBV RNA was observed in 15/26 patients, sustained inhibition of HBeAg was observed in 9/14 patients, and sustained inhibition of HBcrAg was observed in 10/24 patients.

Drug-related Adverse Event (AE) events that were likely or likely to occur by participants in cohorts 1b, 1c, 2b, 3b, 4b and 5b prior to day 113 of treatment (including day 113 of treatment) are shown in table 57 below. By day 113, safety data for cohorts 1b to 5b indicated that three month doses of 25mg to 400mg of HBV RNAi agent together with NA were generally well tolerated in CHB patients. Three non-drug related major adverse events were reported (single patient anxiety with depression and menorrhagia, each requiring hospitalization). The most commonly reported AEs were at least likely drug-related, consisting of various AEs at the injection site (e.g., discoloration, erythema, bruising, rash), all of which were mild and reported in five patients. There is no report of thrombocytopenia and one possible drug-related report of phase 1 acute kidney injury with increased creatinine (from 1.10mg/dL on day 1 to a peak of 1.55mg/dL on day 8 before administration and a return to 1.06mg/dL on day 15), which is a treatment period but may be due to creatine supplementation and does not result in treatment interruption or adjustment. A single AE was reported for a mild, possibly related, abnormal liver function test (peak alanine aminotransferase [ ALT ]136U/L), indicating the highest elevation of ALT during treatment in cohorts 1b to 5b by day 113 (end of study). There were no simultaneous elevations of ALT > 3 times the upper limit of normal and total bilirubin > 2 times the upper limit of normal.

Watch 57

^aMeddra preferred terminology based on similarity aggregation

In CHB patients, HBV RNAi agents have strong activity together with NA on HBsAg, HBV DNA and HBV RNA. The reduction in HBeAg and HBcrAg is generally less pronounced. The reduction in HBsAg was similar in patients who were HBeAg positive and HBeAg negative. The previously found reductions in HBsAg were similar to these doses as demonstrated by an amplified cohort of 100mg to 400mg hbv RNAi agent; 97% (31/32) of these patients achieved ≧ 1.0log of HBsAg₁₀(90%) decreased. The 25mg and 50mg HBV RNAi agent doses were active in reducing HBsAg and did not appear to be as effective as the higher doses. The HBsAg response of HBV RNAi agents is consistent with their ability to silence HBV RNA from cccDNA and host integrated viral DNA, which is the major source of HBsAg in certain CHB populations. HBV RNAi agent (and NA) treatment was well tolerated at three doses up to 400mg Q4 w. Overall, HBV RNAi agents exhibit the anti-HBV properties required for RNAi therapy.

Other embodiments

The following embodiments are exemplary and should not be considered as limiting the invention as described herein.

Embodiment 1 a method for inhibiting expression of a hepatitis b virus gene in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) A first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 111, 126, 127, 128, 171, 175, 179 and 180 SEQ ID NOs, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 235 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 307 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 50mg to 400mg per month.

Embodiment 2 a method for treating or preventing a symptom or disease associated with infection by a hepatitis b virus in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) A first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 50mg to 400mg per month.

Embodiment 3 the method of embodiment 1 or embodiment 2, wherein the first RNAi agent and/or the second RNAi agent further comprises a targeting ligand conjugated to the 5' end of the sense strand or the antisense strand.

Embodiment 4 the method of embodiment 3, wherein the targeting ligand comprises N-acetyl-galactosamine.

Embodiment 5 the method of embodiment 4, wherein the targeting ligand is (NAG25), (NAG25) s, (NAG31), (NAG31) s, (NAG37) or (NAG37) s.

Embodiment 6 the method of any one of embodiments 3-5, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

Embodiment 7 the method of any one of embodiments 3-5, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

Embodiment 8 the method of any one of embodiments 1 to 7, wherein the first RNAi agent is administered in an amount from about 20mg to 275 mg.

Embodiment 9 the method of any one of embodiments 1-8, wherein the second RNAi agent is administered in an amount from about 10mg to 150 mg.

Embodiment 10. the method according to any one of embodiments 1 to 9, wherein the pharmaceutical composition comprises an RNAi agent comprising a duplex structure of AD04511(SEQ ID NO:100 and SEQ ID NO:229), AD04872(SEQ ID NO:126 and SEQ ID NO:252), AD04873(SEQ ID NO:127 and SEQ ID NO:252), AD04874(SEQ ID NO:128 and SEQ ID NO:253), AD05070(SEQ ID NO:140 and SEQ ID NO:262), AD05148(SEQ ID NO:140 and SEQ ID NO:271), AD05164(SEQ ID NO:126 and SEQ ID NO:273), AD05165(SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

Embodiment 11 the method according to embodiment 10, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872(SEQ ID NOs: 126 and 252) and an RNAi agent comprising the duplex structure of AD05070(SEQ ID NOs: 140 and 262).

Embodiment 12 the method of embodiment 11, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG 37).

Embodiment 13 the method of embodiment 12, wherein the (NAG37) is conjugated to the 5' end of the respective sense strands of the duplex of AD04872 and the duplex of AD 05070.

Embodiment 14 the method of any one of embodiments 11 to 13, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is between about 1:2 to about 5: 1.

Embodiment 15 the method of embodiment 14, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is about 2: 1.

Embodiment 16 the method of any one of embodiments 1 to 15, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment 17 the method of any one of embodiments 1 to 16, wherein the composition is administered subcutaneously.

Embodiment 18 the method of any one of embodiments 1-17, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg, 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg per month.

Embodiment 19 the method of any one of embodiments 1-18, wherein the first RNAi agent and the second RNAi agent are administered at 7-day, 14-day, 21-day, or 28-day intervals.

Embodiment 20 the method of any one of embodiments 1 to 19, wherein the composition is administered to the subject for up to 6 months.

Embodiment 21 the method of any one of embodiments 1 to 20, further comprising administering a second active agent to the subject.

Embodiment 22 the method of embodiment 21, wherein the second active agent is a nucleoside analog.

Embodiment 23 the method of embodiment 22, wherein the nucleoside analog is entecavir or tenofovir.

Embodiment 24. the method of any one of embodiments 1 to 23, wherein the level of HBsAg, HBeAg or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

Embodiment 25 the method of any one of embodiments 2 to 24, wherein the symptom or the disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, fibrotic disease, proliferative disorder, hepatocellular carcinoma, hepatitis delta virus infection, acute HBV infection, or chronic HBV infection.

Embodiment 26 the method according to any one of embodiments 2 to 25, wherein the symptom or the disease associated with the HBV infection is chronic HBV infection.

Embodiment 27. a method for inhibiting expression of a hepatitis b virus gene in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 111, 126, 127, 128, 171, 175, 179 and 180 SEQ ID NOs, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 235 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 307 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) A sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg per month.

Embodiment 28 a method for treating or preventing a symptom or disease associated with infection by a hepatitis b virus in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) An antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg per month.

Embodiment 29 the method of embodiment 27 or embodiment 28, wherein the first RNAi agent and/or the second RNAi agent further comprises a targeting ligand conjugated to the sense strand or the antisense strand.

Embodiment 30 the method of embodiment 29, wherein the targeting ligand comprises N-acetyl-galactosamine.

Embodiment 31 the method of embodiment 30, wherein the targeting ligand is (NAG25), (NAG25) s, (NAG31), (NAG31) s, (NAG37) or (NAG37) s.

Embodiment 32 the method of any one of embodiments 29 to 31, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

Embodiment 33 the method of any one of embodiments 29 to 31, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

Embodiment 34 the method of any one of embodiments 27 to 33, wherein the first RNAi agent is administered in an amount from about 20mg to 275 mg.

Embodiment 35 the method of any one of embodiments 28-34, wherein the second RNAi agent is administered in an amount from about 10mg to 150 mg.

Embodiment 36. the method of any one of embodiments 27 to 35, wherein the pharmaceutical composition comprises an RNAi agent comprising a duplex structure of AD04511(SEQ ID NO:100 and SEQ ID NO:229), AD04872(SEQ ID NO:126 and SEQ ID NO:252), AD04873(SEQ ID NO:127 and SEQ ID NO:252), AD04874(SEQ ID NO:128 and SEQ ID NO:253), AD05070(SEQ ID NO:140 and SEQ ID NO:262), AD05148(SEQ ID NO:140 and SEQ ID NO:271), AD05164(SEQ ID NO:126 and SEQ ID NO:273), AD05165(SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

Embodiment 37 the method according to embodiment 36, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872(SEQ ID NOs: 126 and 252) and an RNAi agent comprising the duplex structure of AD05070(SEQ ID NOs: 140 and 262).

Embodiment 38 the method of embodiment 37, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG 37).

Embodiment 39 the method of embodiment 38, wherein said (NAG37) is conjugated to the 5' end of the respective sense strand of the duplex of AD04872 and the duplex of AD 05070.

Embodiment 40 the method of any one of embodiments 37 to 39, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is between about 1:2 to about 5: 1.

Embodiment 41 the method of embodiment 40, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is about 2: 1.

Embodiment 42. the method according to any one of embodiments 27 to 41, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment 43 the method of any one of embodiments 27 to 42, wherein the composition is administered subcutaneously.

Embodiment 44 the method of any one of embodiments 27-43, wherein the first and second RNAi agents are administered in a combined amount of any one of about 25mg, 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg per month.

Embodiment 45 the method of any of embodiments 27-43, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg per month.

Embodiment 46 the method of embodiment 45, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg per month.

Embodiment 47 the method of embodiment 45, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg per month.

Embodiment 48 the method of embodiment 45, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg per month.

Embodiment 49 the method of any one of embodiments 27 to 48, wherein the first and second RNAi agents are administered at 7-day, 14-day, 21-day, or 28-day intervals.

Embodiment 50 the method of any one of embodiments 27 to 48, wherein the first RNAi agent and the second RNAi agent are administered at 28-day intervals.

Embodiment 51 the method of embodiment 50, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg per month and at 28-day intervals.

Embodiment 52 the method of embodiment 51, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg per month and at 28-day intervals.

Embodiment 53 the method of embodiment 51, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg per month and at 28-day intervals.

Embodiment 54 the method of embodiment 51, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg per month and at 28-day intervals.

Embodiment 55 the method of any one of embodiments 27 to 54, wherein the composition is administered to the subject for up to 6 months.

Embodiment 56 the method of any one of embodiments 27 to 55, further comprising administering a second active agent to the subject.

Embodiment 57 the method of embodiment 56, wherein the second active agent is a nucleoside analog.

Embodiment 58 the method of embodiment 57, wherein the nucleoside analog is entecavir or tenofovir.

Embodiment 59. the method according to any one of embodiments 27 to 58, wherein the level of HBsAg, HBeAg or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

Embodiment 60 the method according to any one of embodiments 28 to 59, wherein said symptom associated with said HBV infection or said disease is a chronic liver disease or disorder, liver inflammation, liver fibrotic disorder, proliferative hepatocyte disorder, hepatocellular carcinoma, hepatitis D virus infection, acute HBV infection, chronic hepatitis B or chronic HBV infection.

Embodiment 61 the method according to any one of embodiments 28 to 60, wherein said symptom or said disease associated with said HBV infection is chronic HBV infection or chronic hepatitis b.

Embodiment 62 a method for inhibiting expression of a hepatitis b virus gene in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 111, 126, 127, 128, 171, 175, 179 and 180 SEQ ID NOs, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 235 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 307 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) A second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg every 28 days.

Embodiment 63 a method for treating or preventing a symptom or disease associated with infection by a hepatitis b virus in a human subject in need thereof, the method comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:

(a) a first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) A sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg every 28 days.

Embodiment 64 the method of embodiment 62 or embodiment 63, wherein the first RNAi agent and/or the second RNAi agent further comprises a targeting ligand conjugated to the 5' end of the sense strand or the antisense strand.

Embodiment 65. the method of embodiment 64, wherein the targeting ligand comprises N-acetyl-galactosamine.

Embodiment 66. the method of embodiment 65, wherein the targeting ligand is (NAG25), (NAG25) s, (NAG31), (NAG31) s, (NAG37) or (NAG37) s.

Embodiment 67. the method of any one of embodiments 64 to 66, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

Embodiment 68 the method of any one of embodiments 64 to 66, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

Embodiment 69 the method of any one of embodiments 62 to 68, wherein the first RNAi agent is administered in an amount from about 20mg to 275 mg.

Embodiment 70 the method of any one of embodiments 62 to 69, wherein the second RNAi agent is administered in an amount from about 10mg to 150 mg.

Embodiment 71. the method according to any one of embodiments 62 to 70, wherein the pharmaceutical composition comprises an RNAi agent comprising a duplex structure of AD04511(SEQ ID NO:100 and SEQ ID NO:229), AD04872(SEQ ID NO:126 and SEQ ID NO:252), AD04873(SEQ ID NO:127 and SEQ ID NO:252), AD04874(SEQ ID NO:128 and SEQ ID NO:253), AD05070(SEQ ID NO:140 and SEQ ID NO:262), AD05148(SEQ ID NO:140 and SEQ ID NO:271), AD05164(SEQ ID NO:126 and SEQ ID NO:273), AD05165(SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

Embodiment 72 the method of embodiment 71, wherein said pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872(SEQ ID NOs: 126 and 252) and an RNAi agent comprising the duplex structure of AD05070(SEQ ID NOs: 140 and 262).

Embodiment 73. the method of embodiment 72, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG 37).

Embodiment 74. the method of embodiment 73, wherein said (NAG37) is conjugated to the 5' end of the respective sense strand of the duplex of AD04872 and the duplex of AD 05070.

Embodiment 75 the method of any one of embodiments 72 to 74, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is between about 1:2 to about 5: 1.

Embodiment 76 the method of embodiment 75, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is about 2: 1.

Embodiment 77 the method according to any one of embodiments 62 to 76, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment 78 the method of any one of embodiments 62 to 77, wherein the composition is administered subcutaneously.

Embodiment 79 the method of any of embodiments 62-78, wherein the first and second RNAi agents are administered in a combined amount of any one of about 25mg, 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg every 28 days.

Embodiment 80 the method of any of embodiments 62-78, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days.

Embodiment 81 the method of embodiment 80, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days.

Embodiment 82 the method of embodiment 80, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days.

Embodiment 83 the method of embodiment 80, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days.

Embodiment 84 the method of any of embodiments 62-83, wherein the first RNAi agent and the second RNAi agent are administered at 7-day, 14-day, 21-day, or 28-day intervals.

Embodiment 85 the method of any one of embodiments 62 to 84, wherein the first RNAi agent and the second RNAi agent are administered at 28-day intervals.

Embodiment 86 the method of embodiment 85, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days and at 28-day intervals.

Embodiment 87 the method of embodiment 86, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days and at 28-day intervals.

Embodiment 88 the method of embodiment 86, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days and at 28-day intervals.

Embodiment 89 the method of embodiment 86, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days and at 28-day intervals.

Embodiment 90 the method of any one of embodiments 62 to 89, wherein said composition is administered to said subject for up to 6 months.

Embodiment 91 the method of any one of embodiments 62 to 90, further comprising administering to the subject a second active agent.

Embodiment 92 the method of embodiment 91, wherein the second active agent is a nucleoside analog.

Embodiment 93 the method of embodiment 92, wherein the nucleoside analog is entecavir or tenofovir.

Embodiment 94 the method according to any one of embodiments 62 to 93, wherein the level of HBsAg, HBeAg or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

Embodiment 95 the method according to any one of embodiments 63 to 94, wherein said symptom associated with said HBV infection or said disease is a chronic liver disease or disorder, liver inflammation, liver fibrotic disorder, proliferative hepatocyte disorder, hepatocellular carcinoma, hepatitis delta virus infection, acute HBV infection, chronic hepatitis b or chronic HBV infection.

Embodiment 96 the method according to any one of embodiments 63 to 95, wherein said symptom or said disease associated with said HBV infection is chronic HBV infection or chronic hepatitis b.

Embodiment 97. a pharmaceutical composition for use in inhibiting hepatitis b virus gene expression in a human subject, wherein said use comprises administering to said human subject an effective amount of said pharmaceutical composition comprising:

(a) A first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 111, 126, 127, 128, 171, 175, 179 and 180 SEQ ID NOs, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 235 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 307 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg every 28 days.

Embodiment 98. a pharmaceutical composition for use in treating or preventing a symptom or disease associated with infection by hepatitis b virus in a human subject, wherein said use comprises administering to said human subject an effective amount of said pharmaceutical composition comprising:

(a) A first RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 100, 126, 127, 128, 171, 179 and 180 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 229 of SEQ ID NO, 252 of SEQ ID NO, 253 of SEQ ID NO, 273 of SEQ ID NO, 302 of SEQ ID NO and 319 of SEQ ID NO, and

(b) a second RNAi agent comprising:

(i) an antisense strand comprising the nucleotide sequence of any one of: 140, 107, 136, 137, 188, 154 and 162 SEQ ID NO, and

(ii) a sense strand comprising a nucleotide sequence of any one of: 262, 271, 216, 248, 274, 328, 292 and 294;

and wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25mg to 400mg every 28 days.

Embodiment 99 the pharmaceutical composition of embodiment 97 or embodiment 98, wherein the first RNAi agent and/or the second RNAi agent further comprises a targeting ligand conjugated to the 5' end of the sense strand or the antisense strand.

Embodiment 100 the pharmaceutical composition of embodiment 99, wherein the targeting ligand comprises N-acetyl-galactosamine.

Embodiment 101 the pharmaceutical composition of embodiment 100, wherein the targeting ligand is (NAG25), (NAG25) s, (NAG31), (NAG31) s, (NAG37) or (NAG37) s.

Embodiment 102 the pharmaceutical composition of any one of embodiments 99 to 101, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

Embodiment 103 the pharmaceutical composition of any one of embodiments 99 to 101, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

Embodiment 104 the pharmaceutical composition of any one of embodiments 97 to 103, wherein the first RNAi agent is administered in an amount from about 20mg to 275 mg.

Embodiment 105 the pharmaceutical composition of any one of embodiments 97 to 104, wherein the second RNAi agent is administered in an amount from about 10mg to 150 mg.

Embodiment 106. the pharmaceutical composition of any one of embodiments 97 to 105, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04511(SEQ ID NO:100 and SEQ ID NO:229), AD04872(SEQ ID NO:126 and SEQ ID NO:252), AD04873(SEQ ID NO:127 and SEQ ID NO:252), AD04874(SEQ ID NO:128 and SEQ ID NO:253), AD05070(SEQ ID NO:140 and SEQ ID NO:262), AD05148(SEQ ID NO:140 and SEQ ID NO:271), AD05164(SEQ ID NO:126 and SEQ ID NO:273), AD05165(SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

Embodiment 107. the pharmaceutical composition of embodiment 106, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872(SEQ ID NOs: 126 and 252) and an RNAi agent comprising the duplex structure of AD05070(SEQ ID NOs: 140 and 262).

Embodiment 108. the pharmaceutical composition of embodiment 107, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG 37).

Embodiment 109. the pharmaceutical composition of embodiment 108, wherein the (NAG37) is conjugated to the 5' end of the respective sense strands of the duplex of AD04872 and the duplex of AD 05070.

Embodiment 110 the pharmaceutical composition according to any one of embodiments 107 to 109, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is between about 1:2 to about 5: 1.

Embodiment 111 the pharmaceutical composition of embodiment 110, wherein the ratio of the duplex of AD04872 to the duplex of AD05070 is about 2: 1.

Embodiment 112 the pharmaceutical composition of any one of embodiments 97 to 111, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment 113 the pharmaceutical composition of any one of embodiments 97 to 112, wherein the composition is administered subcutaneously.

Embodiment 114 the pharmaceutical composition of any one of embodiments 97-113, wherein the first and second RNAi agents are administered in a combined amount of any one of about 25mg, 35mg, 50mg, 100mg, 200mg, 300mg, or 400mg every 28 days.

Embodiment 115 the pharmaceutical composition of any one of embodiments 97-114, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days.

Embodiment 116 the pharmaceutical composition of embodiment 115, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days.

Embodiment 117 the pharmaceutical composition of embodiment 115, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days.

The pharmaceutical composition of embodiment 115, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days.

Embodiment 119 the pharmaceutical composition of any one of embodiments 97 to 118, wherein the first and second RNAi agents are administered at 7-day, 14-day, 21-day, or 28-day intervals.

Embodiment 120 the pharmaceutical composition of any one of embodiments 97-118, wherein the first RNAi agent and the second RNAi agent are administered at 28-day intervals.

Embodiment 121 the pharmaceutical composition of embodiment 120, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg, about 100mg, or about 200mg every 28 days and at 28-day intervals.

Embodiment 122 the pharmaceutical composition of embodiment 121, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 40mg every 28 days and at 28-day intervals.

Embodiment 123 the pharmaceutical composition of embodiment 121, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 100mg every 28 days and at 28-day intervals.

Embodiment 124 the pharmaceutical composition of embodiment 121, wherein the first RNAi agent and the second RNAi agent are administered in a combined amount of about 200mg every 28 days and at 28-day intervals.

Embodiment 125 the pharmaceutical composition of any one of embodiments 97 to 124, wherein the composition is administered to the subject for up to 6 months.

Embodiment 126 the pharmaceutical composition of any one of embodiments 97 to 125, further comprising administering to the subject a second active agent.

Embodiment 127 the pharmaceutical composition of embodiment 126, wherein the second active agent is a nucleoside analog.

Embodiment 128 the pharmaceutical composition of embodiment 127, wherein the nucleoside analog is entecavir or tenofovir.

Embodiment 129 the pharmaceutical composition of any one of embodiments 97 to 128, wherein the level of HBsAg, HBeAg or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

Embodiment 130 the pharmaceutical composition according to any one of embodiments 98 to 129, wherein said symptom associated with said HBV infection or said disease is a chronic liver disease or disorder, liver inflammation, liver fibrotic disorder, proliferative hepatocyte disorder, hepatocellular carcinoma, hepatitis delta virus infection, acute HBV infection, chronic hepatitis b or chronic HBV infection.

Embodiment 131 the pharmaceutical composition according to any one of embodiments 98 to 130, wherein said symptom or said disease associated with said HBV infection is chronic HBV infection or chronic hepatitis b.

It is to be understood that while the invention has been described in conjunction with the specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.