阅读说明：本技术 包含非结构蛋白的寨卡病毒嵌合多表位及其在免疫原性组合物中的用途 (Chimeric polyepitopes of Zika virus comprising non-structural proteins and their use in immunogenic compositions ) 是由 C·罗特 E·西蒙-洛列里 A·撒金塔巴伊 F·德尔加多 于 2018-11-08 设计创作，主要内容包括：本发明涉及一种包含非结构蛋白的寨卡病毒(ZIKV)嵌合多表位及其在免疫原性组合物中的用途。本发明提供了工具,尤其是表达嵌合多表位的多核苷酸、载体和细胞。本发明还涉及包含所述多表位、多核苷酸、载体或宿主细胞中的至少一种的组合物或疫苗,其用于预防人对象的ZIKV感染或用于预防人对象的ZIKV和登革热病毒(DENV)感染。(The present invention relates to a ZIKV chimeric multi-epitope comprising a non-structural protein and its use in immunogenic compositions. The invention provides means, in particular polynucleotides, vectors and cells expressing the chimeric polyepitopes. The invention also relates to a composition or vaccine comprising at least one of said polyepitope, polynucleotide, vector or host cell for use in preventing ZIKV infection or for preventing ZIKV and dengue virus (DENV) infection in a human subject.)

1. A chimeric polyepitope comprising: (i) at least the following T cell epitopes of (a) and (b), or (ii) at least the following T cell epitopes of (a) and (c), or (iii) at least the following T cell epitopes of (b) and (c), or a T cell epitope variant thereof:

(a) a T cell epitope of the non-structural (NS) NS1 protein of zika virus (ZIKV), comprising a sequence selected from SEQ ID NO: 10-12, 14, 15, 17-19, 23, 24, and 78-83 or a polypeptide consisting of an amino acid sequence selected from SEQ ID NOs: 10-12, 14, 15, 17-19, 23, 24 and 78-83,

(b) a T cell epitope of NS3 protein of ZIKV comprising a sequence selected from SEQ ID NO: 28. 29, 31, 33-35, 84 and 85 or a sequence consisting of an amino acid sequence selected from SEQ ID NOs: 28. 29, 31, 33-35, 84 and 85,

(c) a T cell epitope of NS5 protein of ZIKV comprising a sequence selected from SEQ ID NO: 46. 48-50, 52-55, 57-60, 62, 64, 67, 69, 72, 73, and 86-91 or an amino acid sequence consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 46. 48-50, 52-55, 57-60, 62, 64, 67, 69, 72, 73 and 86-91,

said variant T cell epitope differs from the original amino acid sequence of said T cell epitope of (a), (b) or (c) by point mutation of one or more amino acid residues and has at least 90% sequence identity or more than 95% sequence identity or 99% sequence identity to said original sequence.

2. The chimeric polyepitope of claim 1, comprising at least the T cell epitopes of (a), (b), and (c) or a T cell epitope variant thereof.

3. The chimeric polyepitope of claim 1 or 2, consisting of: (i) t cell epitopes of (a) and (b), or (ii) T cell epitopes of (a) and (c), or (iii) T cell epitopes of (b) and (c), or (iv) T cell epitopes of (a), (b) and (c), or T cell epitope variants thereof.

4. The chimeric polyepitope of any one of claims 1-3, wherein the T cell epitope of (a) comprises a sequence selected from the group consisting of SEQ ID NO: 17. 23 and 78-83 or an amino acid sequence selected from SEQ ID NOs: 17. 23 and 78-83, and the T cell epitope of (b) comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 31. 33, 84 and 85 or an amino acid sequence selected from SEQ ID NOs: 31. 33, 84 and 85, and the T cell epitope of (c) comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 46. 48, 52, 57, 62, 64, 67 and 86-91 or a sequence consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 46. 48, 52, 57, 62, 64, 67 and 86-91.

5. The chimeric polyepitope of any one of claims 1 to 3, wherein the T cell epitope of (a) comprises the amino acid sequence of SEQ ID NO: 11. 12, 17-19, 23, 24, 78, 80 and 83 or a polypeptide consisting of SEQ ID NO: 11. 12, 17-19, 23, 24, 78, 80 and 83, and the T cell epitope of (b) comprises the amino acid sequence of SEQ ID NO: 28. 31, 33, 34, 84 and 85 or a sequence consisting of SEQ ID NO: 28. 31, 33, 34, 84 and 85, and the T cell epitope of (c) comprises the amino acid sequence of SEQ ID NO: 48-50, 52-55, 57, 58, 60, 62, 67, 88, 89 and 90 or the amino acid sequence represented by SEQ ID NO: 48-50, 52-55, 57, 58, 60, 62, 67, 88, 89, and 90.

6. The chimeric polyepitope according to any one of claims 1 to 5, further comprising at least one T cell epitope of a ZIKV protein selected from:

(i) a T cell epitope of a C protein of ZIKV comprising a sequence selected from SEQ ID NO: 1. 2, 4-6 and 75 or an amino acid sequence consisting of SEQ ID NO: 1. 2, 4-6 and 75,

(ii) a T cell epitope of an E protein of ZIKV comprising a sequence selected from SEQ ID NO: 7. 76 and 77 or by an amino acid sequence selected from SEQ ID NOs: 7. 76 and 77, or a pharmaceutically acceptable salt thereof,

(iii) a T cell epitope of NS2B protein of ZIKV comprising SEQ ID NO: 25 or the amino acid sequence consisting of SEQ id no: 25, or a pharmaceutically acceptable salt thereof, wherein the amino acid sequence of the polypeptide consists of the amino acid sequence of 25,

(iv) a T-cell epitope of NS4A protein of ZIKV comprising SEQ ID NO: 36 or the amino acid sequence of SEQ id no: 36, and

(v) a T-cell epitope of NS4B protein of ZIKV comprising a sequence selected from SEQ ID NO: 40-43 or by an amino acid sequence selected from SEQ ID NO: 40-43.

7. The chimeric polyepitope of claim 6, wherein at least one T cell epitope of the ZIKV protein is selected from the group consisting of:

-a T cell epitope of the C protein of ZIKV comprising a sequence selected from SEQ ID NO: 1. 2, 4-6 and 75 or an amino acid sequence consisting of SEQ ID NO: 1. 2, 4-6 and 75, and

-a T-cell epitope of NS4B protein of ZIKV comprising a sequence selected from SEQ ID NO: 40-43 or the amino acid sequence of seq id NO: 40-43.

8. The chimeric polyepitope of claim 7, having the amino acid sequence of SEQ ID NO: 99.

9. The chimeric polyepitope according to any one of claims 1 to 8, which is (i) for use in preventing ZIKV infection in a human subject, or (ii) for use in preventing ZIKV and dengue virus (DENV) infection in a human subject.

10. The chimeric polyepitope for preventing ZIKV infection in a human subject according to claim 9, wherein the T cell epitope is a ZIKV-specific epitope comprising a sequence selected from the group consisting of SEQ ID NO: 1. 2, 5, 10, 11, 19, 27, 31, 40-43, 46, 72, 73, 75, 78-80, 82, 84, 85, 87, and 91 or from an amino acid sequence selected from SEQ ID NOs: 1. 2, 5, 10, 11, 19, 27, 31, 40-43, 46, 72, 73, 75, 78-80, 82, 84, 85, 87, and 91.

11. The chimeric polyepitope for preventing ZIKV and DENV infection in a human subject according to claim 9, wherein said T cell epitope is a ZIKV-DENV cross-reactive epitope comprising a sequence selected from the group consisting of SEQ ID NO: 1.5, 6, 12, 14, 15, 17-19, 23, 24, 27, 28, 33-35, 40, 41, 46, 48-50, 52-55, 57, 59, 60, 62, 64, 67, 69, 72, 73, 84, 85, and 86-91 or a sequence consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1.5, 6, 12, 14, 15, 17-19, 23, 24, 27, 28, 33-35, 40, 41, 46, 48-50, 52-55, 57, 59, 60, 62, 64, 67, 69, 72, 73, 84, 85, and 86-91.

12. According to claim 1The chimeric polyepitope of any one of to 11, which elicits Human Leukocyte Antigen (HLA) restricted CD8 (i) against ZIKV, or (ii) against ZIKV and DENV, particularly DENV serotype 1(DENV1), DENV serotype 2(DENV2), DENV serotype 3(DENV3), and DENV serotype 4(DENV4)⁺And/or CD4⁺T cell response.

13. The chimeric polyepitope of any one of claims 1 to 12, wherein the T cell epitope is assembled in a fusion polypeptide.

14. The chimeric polyepitope according to any one of claims 1 to 13, wherein the ZIKV is from the african lineage, in particular from african strain ArD158084 (GenBank: KF383119) or african strain ArD128000 (GenBank: KF383117) or african isolate ARB13565 (GenBank: KF268948), or from the asian lineage, in particular from asian strain FLR (GenBank: KX087102) or asian isolate SSABR1 (GenBank: KU707826) or asian isolate Z1106031 (GenBank: KU312314) or asian isolate Bahia07 (GenBank: KU940228) or asian strain f00318/VEN/maracaay/2016 (GenBank: KY693680) or asian isolate FLR (GenBank: KU 088297).

15. An isolated or purified polynucleotide encoding the chimeric polyepitope according to any one of claims 1 to 14.

16. A vector, in particular a non-replicating vector, suitable for delivering a chimeric polyepitope according to any one of claims 1 to 14, wherein said vector is a recombinant molecule carrying said polyepitope or is a viral or mammalian expression vector expressing said polyepitope.

17. A vector comprising the polynucleotide of claim 15.

18. A host cell transformed with the polynucleotide of claim 15 or the vector of claim 16 or 17.

19. The host cell according to claim 18, which is a eukaryotic cell, such as an avian cell, in particular a CEF (chicken embryo fibroblast) cell, a mammalian cell, in particular a HEK-293 (human embryonic kidney) cell or a yeast cell.

20. An immunogenic composition comprising at least one component selected from the group consisting of:

(i) the chimeric polyepitope of any one of claims 1 to 14,

(ii) the polynucleotide according to claim 15, wherein said polynucleotide is,

(iii) the vector of claim 16 or 17, and

(iv) the host cell of claim 18 or 19.

21. The immunogenic composition of claim 20, further comprising an adjuvant and/or a pharmaceutically acceptable vehicle.

22. The immunogenic composition according to claim 20 or 21, wherein the composition is formulated for administration by a parenteral route, such as subcutaneous (s.c.) injection, intradermal (i.d.) injection, intramuscular (i.m.) injection, intraperitoneal (i.p.) injection, or intravenous (i.v.) injection.

23. The immunogenic composition according to any one of claims 20 to 22, wherein said composition is administered in one or more administration doses, in particular in a prime-boost administration regimen.

24. The immunogenic composition of any one of claims 20 to 23, which is (i) for use in preventing ZIKV infection in a human subject, or (ii) for use in preventing ZIKV and dengue virus (DENV) infection in a human subject.

Drawings

FIG. 1 ZIKV specific response intensity and frequency of responding donors. Cumulative IFN- γ responses (in Spot Forming Cells (SFC) per million cells) across each overlapping peptide of the ZIKV proteome were shown for (a) all donors, (B) ZIKV donors, or (C) DENV/ZIKV donors. The heat maps indicated the number of donors with positive IFN- γ responses to each peptide in each protein (C, capsid; M, membrane; E, envelope, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS 5). The numbers below each graph represent the percentage of each protein in the total response.

FIG. 2 ZIKV donors who had been infected with DENV showed a more extensive T cell response, with greater intensity. Reaction breadth (a) and reaction intensity (B) for ZIKV and DENV/ZIKV donors. Each dot represents a donor (open circle: ZIKV donor; filled circle: DENV/ZIKV donor) and the bar represents the median for each group of donors. P values were calculated using a non-parametric two-tailed mann-whitney test. Frequency of response to individual peptides for each of the zikv (c) and DENV/zikv (d) donors. Each dot represents a peptide. Bars represent median response for each donor.

FIG. 3 comparison of response strength and sequence identity to DENV in ZIKV and DENV/ZIKV donors. Each dot represents the cumulative response of a different donor to one peptide. Percentages represent the average identity values between ZIKV sequences and 4 DENV serotypes. (A) Peptides that induce a response in ZIKV donors. (B) Peptides that induce a response in DENV/ZIKV donors.

FIG. 4.18 schematic representation of the AAHK3C _ pVAX-ZIKV _ polyEpitop _ pVAX1 plasmid. The inventors used the plasmid pVAX1 commercialized by ThermoFisher Scientific. Encoding the polypeptide of SEQ ID NO: 124 into the plasmid.

FIG. 5 immunization of HLA-A2402 transgenic mice with plasmid DNA encoding a chimeric polyepitope of ZIKV by intradermal injection and in vivo electroporation (priming with 2X50 μ g DNA on day 0, boosting with 2X50 μ g DNA on day 21.) the chimeric polyepitope of ZIKV has the amino acid sequence of SEQ ID NO: 99. the nucleotide sequence of the polynucleotide encoding the chimeric polyepitope is defined as SEQ ID NO: 124. on day 14 after boosting, IFN α responses in mice were transiently abolished by intraperitoneal injection of 2mg of anti-IFNAR antibody (MAR1-5A3) and virus inoculation was performed 24 hours after treatment with anti-IFNAR antibody for virus inoculation, mice received intraperitoneal injection of French Guyana strain FG15 of ZIKV, each mouse used 10³pfu, viremia was quantified by qRT-PCR on days 1, 2, 3 and 6 after virus inoculation. Four mice were used as control mice (electroporation with empty vector) and 5 mice were vaccinated with the pZIKV construct vaccine (electroporation with the chimeric polyepitope DNA encoding ZIKV). The electroporation setup using the agile apulse instrument (BTX, Harvard appaatus) consisted of 3 voltage sets: comprises a first group of 450V pulses with a pulse length of 50 microseconds and a pulse interval of 0.2 microseconds and 1 pulse, a second group of 450V pulses with a pulse length of 50 microseconds and a pulse interval of 50 microseconds and 1 pulse, and a third group of 110V pulses with a pulse length of 10 microsecondsThe millisecond, pulse interval was 20 milliseconds and 8 pulses.

Examples

Statement of ethics

Human blood samples were obtained anonymously from healthy adult donors of fundamenton hematology Colombia (Bogota d.c., Colombia). All protocols described in this study have been approved by the Institutional Review Board (IRB) of EL bosque university (Colombia).

Human blood sample

The donor is male or female, and the age is 20-60 years. A total of 82 samples were obtained from the ZIKV epidemic (mainly from villavicenciio, Meta) near Bogota d.c over a three month period of 10 months to 2016 months of 12 months. PBMC were purified by density gradient centrifugation (Lymphoprep)^TM(ii) a Stemcell technologies) were resuspended in fbs (gibco) containing 10% dimethyl sulfoxide and cryopreserved in liquid nitrogen. Due to poor cell viability, 11 of the 82 blood samples obtained had to be excluded from the study.

Viruses and cell lines

In vitro assays were performed using DENV1 KDH0026A (supplied by Dr l.lambrepeat, lnstuttputeur, Paris), DENV2R0712259 (supplied by dr.a.failloux, lnstuttputeur, Paris), DENV3 KDH0010A (supplied by dr.l.lambrepeat, lnstuttputeur, Paris), DENV4CRBIP 10.4VIMFH4 (from lnstuttutputeur Collection) and ZIKV KU312312 (supplied by dr.dominique Rousset set, lnstuttputteur.cayenne). All viruses were grown using the Aedes Albopictus (Aedes Albopictus) mosquito cell line C6/36 cultured in Leibovitz's L-15 medium supplemented with 10% fetal bovine serum containing 0.1mM nonessential amino acids and 1X phosphotrypsin medium. Dr M. Flaland and Dr B. Jacqelin (lnstuttpotteur, Paris) provided Vero-E6 cells and DC-SIGN-expressing U937, respectively.

HLA typing

Genomic DNA isolated from PBMCs of the subjects by standard techniques (QIAmp; Qiagen) was used for HLA typing. Luminex-based high resolution typing (Sequence-Specific Oligonucleotides (SSO) typing; Immunor, Lifecodes) using HLA class I (alleles A, B and C) and HLA class II (allele DRB1) according to the manufacturer's protocol.

Serology

ZIKV seropositivity was determined using recombinant antigen (EDIII antigen) based indirect ELISA as described previously (Aubry M, et al 2017, emulsifying in reactive disorders 23 (4): 669-672). Briefly, 96-well plates (Nunc, Life Technologies, Rochester, N.Y.) were coated with 50ng of antigen in PBS overnight at 4 ℃. After washing, 200. mu.l of PBS containing 3% skim milk and 0.1% Tween-20 was added at 37 ℃ for 1 hour. Blocking solution was replaced with 1: 100 μ l plasma at 500 dilution, and then the plate was incubated at 37 ℃ for 60 minutes. After 3 washes, bound antibodies were detected with horseradish peroxidase conjugated goat anti-human IgG immunoglobulin (ROCKLAND). After incubation for 1 hour at 37 ℃ and washing 3 times, 100. mu.l of substrate solution containing TMB (KPL, Eurobio) was added. After 15 minutes of incubation, the Optical Density (OD) was measured at 650nm using an automatic microplate reader (Tecan infinite 200 pro). Each plasma sample was tested in duplicate. Plasma samples obtained from individuals with positive DENV IgG serology collected prior to ZIKV outbreaks were used as negative controls. The cutoff value calculated from the negative control was 0.196. DENV seropositivity of IgG was determined by indirect ELISA (Panbio; Alere) and IgM (Tecnosuma) by capture ELISA according to the manufacturer's instructions. To further characterize seropositive donors and confirm the specificity of the ELISA, flow cytometry-based neutralization assays were performed as previously described (Andreatta M, et al 2015, Immunogenetics 67 (11-12): 641-650; Nielsen M & Andreatta M2016, Genome Med 8 (1): 33). Briefly, 10-fold serial dilutions of plasma samples were incubated with viral dilutions that induced 7-15% infection at 37 ℃ for 1 hour. The viral antibody mixture was then added to U937-DC-SIGN cells to neutralize DENV1-4 infection or Vero cells to neutralize ZIKV infection at 37 ℃ for 2 hours, then the cells were washed 2 times with fresh medium and then incubated for 24 hours. Cells were then fixed with 4% paraformaldehyde, stained with Alexa-488 conjugated 4G2 antibody, and the percentage of infected cells was measured by flow cytometry. The neutralizing titer of the antibody is expressed as the reciprocal dilution of plasma, at which 50% of the virus is inhibited. Plasma samples from donors collected prior to ZIKV outbreaks or from negative samples provided with the kit to detect anti-DENV antibodies did not show any neutralizing activity against ZIKV or DENV infection, respectively. After ELISA and neutralization assays were performed, a further total of 9 samples from ZIKV seropositive individuals and 11 samples from DENV/ZIKV seropositive individuals were selected for ELISPOT analysis from the 71 plasma samples selected in this study. Table 1 lists a complete list of twenty donors included in this study.

Viral sequences

The same amino acid sequence of ZIKV from Colombia (GenBank KX087102 and KU820897) was used as a reference for overlapping 15-mer peptide sets.

A total of 50 full-length proteins encoding DENV sequences from Colombia (serotype 1: 14 sequences; serotype 2: 16 sequences; serotype 3: 13 sequences; serotype 4: 7 sequences) were obtained from GenBank and used for pairwise sequence identity comparisons.

Peptides

All peptides were synthesized by Mimotopes (Victoria, Australia). A total of 853 15-mer peptides overlapping by 11 amino acids and 197 9-mer peptides overlapping by 8 amino acids were tested by ELISPOT assay. To identify T cell epitopes, 15-mer peptides were pooled into a pool of 12 peptides and the positive pool was tested for a single peptide in a second ELISPOT assay. Once positive 15-mer peptides were identified, and based on their HLA class I or class II HLA-restricted potential (predicted or shared between at least two donors), 9-mer peptides were synthesized and tested, respectively.

Ex vivo IFN-gamma ELISPOT assay

PBMC (2X 10) were incubated in 96-well flat-bottom plates (MSIPS 4510, Millipore, Bedford, MA) coated with anti-IFN- γ mAb (clone 1-D1K, Mabtech, Sweden) with 0.2ml complete RPMI containing 10% human AB serum with 12 peptide (2. mu.g/ml, final concentration) or single peptide (1. mu.g/ml, final concentration) pools⁵) For 20 hours. After incubation at 37 ℃ for 20 hours, wells were washed with PBS/0.05% Tween 20, and then incubated with biotinylated anti-IFN-. gamma.mAb (clone 7-B6-1, Mabtech) was incubated for 1 hour 30 minutes. Spots were developed using streptavidin alkaline phosphatase (Mabtech) and BCIP/NBT substrate (Promega, France) and counted using an automated ELISPOT reader (Immunospot, Cellular technology Limited, Germany). Relative to 1x10⁶PBMC, number of IFN- γ producing cells expressed as Spot Forming Cells (SFC). The value was calculated by subtracting the number of spots detected in the unstimulated control wells. A value is considered positive if it is equal to or greater than 20 spots and is at least three times higher than the average of unstimulated control wells. As a positive control, cells were stimulated with CEF peptide library (Mabtech).

Immunogenicity and HLA restriction prediction

The binding probability assessment of peptides to MHC class I and II alleles was analyzed using the NetMHCpan3.0 and NetMHCIIpan3.1 servers, respectively (Andreatta M, et al 2015, Immunogenetics 67 (11-12): 641-.

Statistics of

All data were analyzed using Prism Software version 7.0 (GraphPad Software). Statistical significance was determined using a non-parametric two-tailed mann-whitney test to compare two independent groups. The difference was considered significant at P < 0.05.

Results

Identification of ZIKV proteome immunodominant regions

To investigate the T cell immunity induced after ZIKV infection, the inventors examined the response of blood donors living in the ZIKV epidemic area in an interferon-gamma (IFN- γ) specific enzyme-linked immunosorbent assay (ELISPOT). Blood samples from all study participants were tested for the presence of ZIKV IgG and DENV IgM and IgG by ELISA, and PBMCs from ZIKV seropositive individuals were HLA typed by flow cytometry-based neutralization assays for the presence of virus-specific antibodies against ZIKV and 4 DENV serotypes. Details of the donors included in this study are listed in table 1. PBMCs from 20 ZIKV seropositive donors were screened for T cell reactivity across the 15-mer peptide pool (overlapping 11 amino acids) of the entire ZIKV proteome. Is divided intoAssay response intensity (spot forming cells (SFC) every 10⁶Individual cells) and frequency of responding donors, the Nonstructural (NS) proteins NS1, NS3, and NS5 were found to be the most active and most frequently recognized proteins, accounting for 69% of the total response (fig. 1A). Surprisingly, these NS1, NS3, and NS5 represent 15%, 19%, and 35%, respectively, of the total response in ZIKV donors, whereas NS3, NS4B, and NS5 proteins were reported to account for 31%, 15%, and 22%, respectively, of DENV-specific T cell responses (Simmons CP, et al 2005, J.Virol.79 (9): 5665-. Since these donors were selected in DENV and ZIKV epidemic areas, and since these viruses share a total of 43% protein sequence identity (up to 68% for non-structural proteins), the inventors attempted to distinguish ZIKV-specific epitopes from epitopes shared by both viruses. Of the 20 ZIKV seropositive donors, 11 individuals had both anti-DENV and anti-ZIKV IgG antibodies, while 9 individuals did not find any detectable anti-DENV antibodies (table 1). Thus, the inventors analyzed T cell responses from donors with a history of ZIKV infection only (ZIKV donors) and from donors with a history of DENV and ZIKV infection (DENV/ZIKV donors), respectively. As shown in fig. 1B and 1C, NS1, NS3, and NS5 proteins account for 13%, 31%, and 32%, respectively, of the response of the ZIKV donor, while they account for 15%, 16%, and 36% of the response in DENV/ZIKV donors, respectively. These results confirm that NS1, NS3, and NS5 are the primary targets of T cells in ZIKV-infected donors, regardless of whether or not DENV was previously infected, and reveal an increase in frequency and intensity of response to NS5 in donors previously infected with DENV compared to donors infected with ZIKV alone.

Of the 853 peptides across the entire ZIKV proteome, 410 peptides elicited significant T cell responses, some of which were recognized by multiple donors. For most antigenic peptides, the class HLAI and class II alleles of the responding donor coincide with the alleles predicted to bind this epitope (Andreatta M, et al 2015, Immunogenetics 67 (11-12): 641-650; Nielsen M650)&Andreatta M2016, Genome Med 8 (1): 33). Among the epitopes that induce strong responses in ZIKV and DENV/ZIKV donors, several 15-mer peptides contain short sequences that are expected to bind strongly to at least one allele expressed by the responding donor (table 2). For example, NS2B_117-131The peptide (having the amino acid sequence as defined in SEQ ID NO: 25) comprises a10 mer sequence (having the amino acid sequence as defined in SEQ ID NO: 26) which is predicted to strongly bind to HLA-a 0301 and-a 1101 molecules expressed in response to donor 55. In other cases, multiple responding donors express at least one common allele with a strong potential for binding to stimulatory peptides. This is for E in an envelope comprising a 9-mer (having an amino acid sequence as defined in SEQ ID NO: 9) and a 10-mer (having an amino acid sequence as defined in SEQ ID NO: 8) predicted to bind to HLA-B5101 and HLA-A0201 alleles_455-469The peptide (with the amino acid sequence as defined in SEQ ID NO: 7) holds, both alleles being expressed by responding donors 1 and 77. This also applies to the NS5_13-27Peptide (having the amino acid sequence as defined in SEQ ID NO: 46), the NS5_13-27The peptides induced a strong response in donors 55 and 69 sharing the HLA-B3501 allele, which was expected to bind with high affinity to 9-mer peptide MSALEFYSY (having the amino acid sequence as defined in SEQ ID NO: 47). Interestingly, this epitope was also shown to induce a significant response in transgenic mice carrying the HLA-A0101 molecule expressed by donor 69 (Wen J, et al.2017, Nat Microbiol 2: 17036). Similarly, targeting NS5 was observed in donors 28, 53 and 66 expressing HLA-B4002 and-B4403 alleles_546-560Peptides (having the structure as in SE)Q ID NO: 67) and observed against NS5 in donors 33 and 59 sharing the predicted HLA-a 2402 allele_605-619Strong T cell response of the peptide (having the amino acid sequence as defined in SEQ ID NO: 72). Finally, the inventors have also identified several 9-mer immunodominant epitopes in the NS4B and NS5 proteins, including NS4B_112-126Peptide (having the amino acid sequence as defined in SEQ ID NO: 41), NS5_293-307Peptides (having amino acid sequences as defined in SEQ ID NOS: 49 and 50), NS5_297-311A peptide (having an amino acid sequence as defined in SEQ ID NOS: 53-55) and NS5_345-359Peptides (having an amino acid sequence as defined in SEQ ID NO: 58) that induce a large number of T cell responses in donors sharing one or more alleles that have a strong potential to bind to these peptides.

Notably, in the NS3 and NS5 proteins, several epitopes have been described as immunodominant epitopes, whether predicted or experimentally verified after Infection of humans with DENV or vaccination or after Infection with mouse ZIKV (Wen J, et al 2017, Nat Microbiol 2: 17036; Dar H, et al 2016, Asian Pac J Trop Med 9 (9): 844-850; Weiskopf D, et al 2015, J.Virol.89 (1): 120-128; Dikhit MR, et al 2016, Infection, genetics and evaluation: journal of molecular epidemiology and genetic engineering in infections 45: 187-197). Indeed, of the 9-mer peptides identified in the DENV/ZIKV donor, NS5_293-307(having amino acid sequences as defined in SEQ ID NOS: 49 and 50), NS5_297-311(having an amino acid sequence as defined in SEQ ID NO: 53-55) and NS5_345-359(having the amino acid sequence as defined in SEQ ID NO: 58) has been detected in PBMCs of HLA-B3501 individuals infected with DENV1, DENV2 or vaccinated with live attenuated DENV vaccine (DLAV), NS5 from ZIKV, respectively_297-311Peptide (having an amino acid sequence as defined in SEQ ID NOS: 53-55) and NS5_345-359Peptides (having the amino acid sequence as defined in SEQ ID NO: 58) having lysine to arginine at residues 302 and 350Amino acid substitutions of acid and phenylalanine to tyrosine (Rivino L, et al 2013, J.Virol.87 (5): 2693-2706; WeiskopfD, et al 2015, J.Virol.89 (1): 120-128; Imrie A, et al 2007, J.Virol.81 (18): 10081-10091) (Table 2). These results obtained from DENV/ZIKV donors thus confirm that these NS5 peptides contain a nested epitope restricted by HLA-B3501 molecule. However, 15-mer NS3 containing the APRTVVAAEM epitope (having the amino acid sequence as defined in SEQ ID NO: 29)_219-233Peptides (having the amino acid sequence as defined in SEQ ID NO: 28) induced substantial responses in 2 DENV/ZIKV donors expressing neither HLA-B0702 nor B3501, although these alleles were expressed in responding donors vaccinated with DLAV or in ifnar-/-HLA-B0702 transgenic mice following ZIKV infection (Wen J, et al.2017, nat. Microbiol.2: 17036; WeiskopfD, et al.2015, J.Virol.89 (1): 120-. This indicates NS3_219-233The peptide (having the amino acid sequence as defined in SEQ ID NO: 28) comprises, in addition to HLA-B0702 or B3501, another epitope or promiscuous epitope that binds to other HLA alleles.

The response was broader and more intense in donors previously infected with DENV.

Given the ZIKV specific antibody response to NS1 and the low level of CD 4T cell cross-reactivity between DENV and ZIKV against E and NS1 proteins (Stettler K, et al 2016, Science 353 (6301): 823-. First, comparing the frequency of responding T cells in ZIKV and DENV/ZIKV donors shows that the intensity of response was higher in DENV/ZIKV donors relative to ZIKV donors (fig. 1B and 1C). The number of stimulatory peptides per donor and the average response per donor varied in both groups, with a significantly broader response and higher intensity of response in the previous DENV-infected donors (fig. 2A, left and right panels). To determine if this difference only relates to a small number of peptides that elicit a stronger response in each donor, or if it relates to most peptides, the inventors plotted the frequency of response of each donor against different peptides in two different donor groups. As shown in fig. 2B, 2 of 9 individuals showed median responses above 100 SFC/million cells in ZIKV donors, while 6 of 11 DENV/ZIKV donors showed such strong responses, which was also associated with a greater number of peptides. The results indicate that T cells against ZIKV peptide are more frequently activated and more intense in response in donors previously infected with DENV than in primary donors. This strongly demonstrated the presence of cross-reactive T cells that were primed during the initial infection of DENV and then expanded during subsequent ZIKV infection, as recently shown in mice after serial infection with DENV and ZIKV (Wen J, et al.2017, Nat Microbiol 2.17036).

DENV/ZIKV cross-reactive T cells mainly target the NS5 protein

To more specifically identify ZIKV-specific peptides and DENV/ZIKV cross-reactive peptides, the inventors compared the sequences of the two types of most immunodominant epitopes recognized by donors. As shown in figure 2A and table 3, NS1 and NS3 proteins contained a high proportion of peptides that elicited strong responses in both ZIKV and DENV/ZIKV donors, while the E protein and to a higher extent NS5 protein contained the majority of peptides that induced strong responses only in DENV/ZIKV donors. This indicates that NS1 and NS3 proteins contain more ZIKV-specific epitopes, while NS5 protein contains more epitopes shared by DENV and ZIKV and recognized by cross-reactive T cells. Surprisingly, most of the peptides recognized only by DENV/ZIKV donors were highly identical to the four DENV serotypes. For example, in the NS1 protein, sequences of 2 out of 5 epitopes inducing ZIKV donor response showed greater than 60% identity to 4 DENV serotypes, while 8 out of 11 epitopes of NS5 protein inducing strong DENV/ZIKV donor response showed greater than 66.7% sequence identity to four DENV serotypes (table 3). To determine whether the magnitude of the increased response correlates with the recognition of peptides with higher sequence identity to DENV, the inventors plotted the cumulative response for each peptide relative to the percent identity between DENV and ZIKV sequences. In ZIKV donors, only four ZIKV peptides with about 60% identity to DENV can elicit responses above 300SFC per million cells, while 21 ZIKV peptides with at least 70% identity to DENV induce such strong responses in DENV/ZIKV donors (fig. 3); the four peptides that induced the strongest T cell responses in these donors shared the highest sequence identity with DENV. Taken together, these data strongly support the activation of cross-reactive T cells induced after DENV and ZIKV infection, which recognize a common epitope between DENV and ZIKV and dominate the T cell response to ZIKV.

In this study, using PBMCs from human donors infected with ZIKV, the inventors identified a number of T-cell epitopes specific for ZIKV or shared between DENV and ZIKV. While DENV-specific T cell responses were predominantly directed against NS3, NS4B, and NS5, responses to ZIKV were predominantly targeted against epitopes in NS1, NS3, and NS5 proteins. The observation of a stronger and broader IFN- γ response against peptides from the NS5 protein in previously DENV-infected donors led the inventors to speculate that this region contains more peptides recognized by cross-reactive T cells, whereas the NS1 protein is preferentially targeted by ZIKV-specific T cells. These data are consistent with the higher percent identity observed in the ZIKV and DENV sequences in NS5 protein compared to NS1 protein. In addition to their sequence identity, the high NS1 secretion observed in Asian ZIKV lineages ((LiuY, et al.2017, Nature 545 (7655): 482-) -486) may also explain the higher frequency of NS 1-specific T cells induced in ZIKV-infected donors compared to the frequency of NS 1-specific T cells observed in DENV-infected donors (Weiskopf D, et al.2013, Proc Natl Acad Sci US A110 (22): E2046-2053).

For several epitopes, the 15-mer or 9-mer peptide matched the epitope recently identified in transgenic mice expressing human HLA molecules, confirming class I allelic restriction of the peptide. This is the case for 15 mer peptide VARVSPFGGLKRLPA (with the amino acid sequence as defined in SEQ ID NO: 92) that induced a response in donors expressing HLA-B x 0702 alleles (data not shown), which contained C25-35 peptide SPFGGLKRLPA (with the amino acid sequence as defined in SEQ ID NO: 93) shown to elicit a significant response in ZIKV-infected HLA-B0702 transgenic mice (Wen J, et al.2017, Nat Microbiol 2: 17036). The same correlations were established with the NS3 peptide (FPDSNSPIM, having the amino acid sequence as defined in SEQ ID NO: 94), the NS4B peptide (RGSYLAGASLIYTVT, having the amino acid sequence as defined in SEQ ID NO: 95) and the NS5 peptide (NQMSALEFYSY, having the amino acid sequence as defined in SEQ ID NO: 96) that induced a strong response in human donors expressing the HLA-B0702 and HLA-A0101 alleles, respectively (data not shown and Table 2) and in transgenic mice expressing these alleles (Wen J, et al.2017, Nat Microbiol 2: 17036). In other cases, epitopes identified in HLA-B0702 and HLA-A0101 transgenic mice can also be identified in responding donors, even though they do not express these alleles, e.g., NS3_219-233Peptide (having the amino acid sequence as defined in SEQ ID NO: 28) (Table 2) and NS1_19-33Peptide (having the same meaning as defined in SEQ ID NO: 78)A defined amino acid sequence) or NS5_13-27Peptides (having the amino acid sequence as defined in SEQ ID NO: 46) (Table 3) which elicited a response in donors that did not express both alleles HLA-B0702 or HLA-A0101. For these donors, one possibility might be that the epitope identified in the transgenic mouse has a higher affinity for a human HLA allele other than the allele expressed by the transgenic mouse, or that the 15-mer peptide contains another epitope that binds to a different allele. Binding studies using 9-mer epitopes and HLA class I stabilization assays using TAP deficient cells should distinguish these possibilities.

The inventors also reported the identification of several peptides sharing a common sequence with DENV and being preferentially targeted by cross-reactive T cells following DENV infection and ZIKV infection. Among these peptides, NS5_293-307Peptide (having the amino acid sequence as defined in SEQ ID NO: 48) and NS5_297-311The peptide (having the amino acid sequence as defined in SEQ ID NO: 52) comprises the amino acid sequence HPYRTWAYH (having the amino acid sequence as defined in SEQ ID NO: 49) which shares seven amino acids with the epitope previously identified in Pacific islets infected with DENV1 (Imrie A, et al 2007, J.Virol.81 (18): 10081-10091). Similarly, NS5_325-339The peptide (having the amino acid sequence as defined in SEQ ID NO: 86) comprises the amino acid sequence KPWDVVTGV (having the amino acid sequence as defined in SEQ ID NO: 97) which is 66.7% identical to the epitope KPWDVIPMV (having the amino acid sequence as defined in SEQ ID NO: 98) identified in these individuals infected with DENV1 (Imrie A, et al.2007J.Virol.81 (18): 10081-. Finally, NS5, which induced the strongest response in DENV/ZIKV donors (table 3)_345-359Peptide (having the amino acid sequence as defined in SEQ ID NO: 58), NS5_465-479Peptide (having the amino acid sequence as defined in SEQ ID NO: 88) and NS5_481-495The peptide (having the amino acid sequence as defined in SEQ ID NO: 89) also comprises the 9-mer epitope previously identified in DENV-infected individuals (WeiskopfD, et al.2015, J.Virol.89 (1): 120-128). Taken together, these data reveal activation of DENV/ZIKV cross-reactive T cells, which are the primaryLeading to a continuous response after DENV and ZIKV infection. Notably, although these cross-reactive peptides show high sequence identity to DENV and can stimulate T cell responses following DENV infection, these peptides did not induce responses following the initial infection with ZIKV, suggesting that these peptides are immunodominant in the context of DENV but not ZIKV infection. This result can be expected because the immunodominance of the epitope or its relative abundance depends on the other epitopes expressed by the protein. This is also consistent with previous observations that suggest that epitope production is associated with the excisability of the expressed flanking residues in the protein sequence (Zhang SC, et al 2012, J.Immunol.188 (12): 5924-. Importantly, for these cross-reactive epitopes, there was no T cell response in ZIKV infected donors, not only due to the absence of presented HLA alleles in this population, since most of the alleles expressed in responding DENV/ZIKV donors were also expressed in ZIKV donors (table 1). This is the inventor's focus on NS5_13-27Epitope (having the amino acid sequence as defined in SEQ ID NO: 46), NS5_293-307Epitope (having the amino acid sequence as defined in SEQ ID NO: 48), NS5_345-359Epitope (having an amino acid sequence as defined in SEQ ID NO: 57) and NS5_546-560The epitopes (with amino acid sequences as defined in SEQ ID NO: 67) were observed and predicted to be strong binders to HLA-B3501 and HLA-B4002 alleles, respectively, frequently expressed by ZIKV donors (table 2 and fig. 3). Taken together, these results indicate that in the case of initial ZIKV infection, there is preferential recognition of ZIKV-specific epitopes, whereas after infection with heterologous DENV/ZIKV, there is a more frequent, stronger T cell response against cross-reactive epitopes. Interestingly, the strong T cell responses observed in DENV/ZIKV donors against these NS5 epitopes were mainly dependent on donors expressing HLA-B3501 alleles, which are alleles associated with a high intensity response to DENV, and were more protective against DENV infection and disease (Weiskopf D, et al.2013, ProcNatl Acad Sci U S a 110 (22): E2046-2053). Since all blood samples were obtained from donors with a history of asymptomatic ZIKV infection, the inventors were unable to test for presence of HLA-B3501 the magnitude of the ZIKV-specific T cell response obtained in donors correlates with protection from disease. More subjects with higher disease susceptibility following primary ZIKV infection need to be studied to determine whether HLA-associated protection is available for T cells in ZIKV infection in the case of DENV. Also, as recently suggested in mice, it is important to compare disease severity in donors who have or have not experienced previous DENV infection to determine whether cross-reactive T cells induced following infection with DENV can better protect against ZIKV infection and disease mediation (W Wen J, et al 2017, Nat Microbiol 2: 17036; Elong Ngonoo A, et al 2017, Cell host&micro 21 (1): 35-46). Since both CD4+ and CD8+ T cells showed protective effects against DENV infection, a thorough analysis of MHC class II restricted responses was required to determine the role of CD4 in ZIKV infection and disease protection. Finally, further phenotypic analysis of ZIKV-specific T cells in asymptomatic or symptomatic donors would help determine the relevance of protection in natural immunization and vaccination against ZIKV infection and disease. For DENV-specific T cells, it is particularly important to determine whether a strong response to ZIKV-specific peptides is more frequent in specific HLA alleles and associated with multiple functions (Weiskopf D, et al.2013, Proc Natl Acad Sci U S a 110 (22): E2046-2053).

In summary, while much research has focused on the identification of antibody responses to ZIKV, and more specifically the B-cell epitopes shared between ZIKV and DENV, little is known about the role of T-cells in controlling ZIKV infection. Using PBMCs from donors with a recent history of ZIKV infection, seropositive or non-DENV, the inventors screened the complete proteome by an Interferon (IFN) - γ Enzyme Linked Immunospot (ELISPOT) assay, creating the first plot of ZIKV T cell epitope distribution. The inventors showed that the non-structural proteins NS1, NS3 and NS5 comprise the majority of immunodominant peptides that induce strong T cell responses. The inventors also showed that the NS5 protein contains many epitopes shared by both viruses and that it induces the highest response after DENV and ZIKV infection. Surprisingly, donors with a history of DENV infection showed substantial responses to peptides previously identified as DENV CD8+ T cell epitopes. The strongest T cell responses observed in these donors corresponded to sequences with high amino acid identity to the four DENV serotypes, indicating that cross-reactive T cells were activated. These results are of crucial significance for future ZIKV and DENV vaccines and provide new opportunities to study the role of ZIKV-specific and DENV/ZIKV-shared T-cell epitopes in inducing long-term immunity against these viruses.

Multiple ZIKV DNA vaccination in mice

DNA immunization was performed with 2X 50. mu.g DNA, 3 weeks apart, using a plasmid encoding the chimeric polyepitope and electroporation, and challenge was performed 15 days after virus boosting (i.p. injection of ZIKV, 10)³pfu/mouse).

DNA vaccination with plasmids and Electroporation (EP) was performed as follows:

for vaccination, 25 μ l of DNA will be injected twice by dorsal intradermal vaccination, 2mg/ml each, followed immediately by electroporation using an AgilePulse instrument (BTX Harvard Apparatus).

The electroporation procedure will include 3 voltage sets:

group 1: 450V, pulse length 50 microseconds, pulse interval 0.2 microseconds, Nb pulses: 1; group 2: 450V, pulse length 50 microseconds, pulse interval 50 microseconds, Nb pulses: 1; group 3: 110V, pulse length 10 ms, pulse interval 20 ms, Nb pulses: 8.

intraperitoneal injection of 2mg of anti-IFNAR antibody (MAR1-5A3) was performed on day-1 prior to challenge with ZIKV to temporarily block type I IFN response.

Viremia in plasma samples was quantified by qRT-PCR from day 1 to day 6 post challenge.

DNA vaccination in non-human primates (Indian rhesus)

DNA vaccination will be performed at weeks 0 and 4 with 2 intramuscular injections of 1mg of the plasmid encoding the ZIKV chimeric polyepitope, followed by subcutaneous inoculation 10 weeks later as described previously⁴pfuzickv was subjected to an attack (Dowd, k.a., et. science 2016, 354, 237-.

PBMCs were collected on day 0 (before priming), 7 days after priming, then on days 35 (one week after boosting) and 60 days (before challenge with ZIKV) to analyze by ELISpot T cell responses (IFN- γ and TNF- α) against overlapping peptides covering the entire chimeric polyepitope sequence. The number and phenotype of monocytes CD14, DCs, T cells, B cells and NK cells, as well as the cytokine profile of T cells (CD 8T cells) were analyzed by intracellular staining.

Blood samples were also collected at day 0 (before immunization), day 14, day 28 (before booster immunization) and day 56 (before immune challenge) to determine neutralizing antibody titers by Focused Reduced Neutralization Titration (FRNT).

Plasma samples were tested daily by qRT-PCR from day 56 (pre-challenge) to day 66 for quantification of viremia.

Alternative to vaccination with DNA using plasmids expressing cytokines as genetic adjuvants to eliminate electroporation

Recent studies have shown that co-administration of plasmids expressing T-cell epitopes with plasmids expressing IL-12 or GM-CSF or a combination of IL-12 and GM-CSF improves T-cell responses, thereby substantially eliminating the need for Electroporation (EP) (Boyer, J.D., et al.J.Med.Primatol 2005, 34, 262-.

Thus, the inventors will evaluate the effect of IL-12 and GM-CSFDNA immunization in combination with multi-ZIKV DNA immunization on the strength of T cell responses against ZIKV peptides in rhesus monkeys and immunoprotection against ZIKV infection.

Sequence listing

<110> Pasteur institute

University of Eibosk

<120> Zika virus chimeric polyepitope comprising non-structural proteins and its use in immunogenic compositions

<130>B12633A/AD/DP

<140>PCT/EP2018/xxxxx

<141>2018-11-08

<150>EP17306553.3

<151>2017-11-09

<160>124

<170>PatentIn version 3.5

<210>1

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the C protein of ZIKV (C-13-27)

<400>1

Ile Val Asn Met Leu Lys Arg Gly Val Ala Arg Val Ser Pro Phe

1 5 10 15

<210>2

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the C protein of ZIKV (C-13-27)

<400>2

Leu Lys Arg Gly Val Ala Arg Val Ser

1 5

<210>3

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the C protein of ZIKV (C-13-27)

<400>3

Met Leu Lys Arg Gly Val Ala Arg Val

1 5

<210>4

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the C protein of ZIKV (C-85-99)

<400>4

Lys Lys Asp Leu Ala Ala Met Leu Arg Ile Ile Asn Ala Arg Lys

1 5 10 15

<210>5

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the C protein of ZIKV (C-85-99)

<400>5

Ala Ala Met Leu Arg Ile Ile Asn Ala

1 5

<210>6

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the C protein of ZIKV (C-85-99)

<400>6

Lys Asp Leu Ala Ala Met Leu Arg Ile

1 5

<210>7

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the E protein of ZIKV (E-455-469)

<400>7

Gly Met Ser Trp Phe Ser Gln Ile Leu Ile Gly Thr Leu Leu Met

1 5 10 15

<210>8

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the E protein of ZIKV (E-455-469)

<400>8

Gly Met Ser Trp Phe Ser Gln Ile Leu Ile

1 5 10

<210>9

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the E protein of ZIKV (E-455-469)

<400>9

Met Ser Trp Phe Ser Gln Ile Leu Ile

1 5

<210>10

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-63-77)

<400>10

Met Glu Asn Ile Met Trp Arg Ser Val Glu Gly Glu Leu Asn Ala

1 5 10 15

<210>11

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the NS1 protein of ZIKV (NS1-63-77)

<400>11

Ile Met Trp Arg Ser Val Glu Gly Glu

1 5

<210>12

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the NS1 protein of ZIKV (NS1-63-77)

<400>12

Trp Arg Ser Val Glu Gly Glu Leu Asn

1 5

<210>13

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS1 protein of ZIKV (NS1-63-77)

<400>13

Ile Met Trp Arg Ser Val Glu Gly Glu Leu

1 5 10

<210>14

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-83-97)

<400>14

Gly Val Gln Leu Thr Val Val Val Gly Ser Val Lys Asn Pro Met

1 5 10 15

<210>15

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS1 protein of ZIKV (NS1-83-97)

<400>15

Val Gln Leu Thr Val Val Val Gly Ser

1 5

<210>16

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS1 protein of ZIKV (NS1-83-97)

<400>16

Val Gln Leu Thr Val Val Val Gly Ser Val

1 5 10

<210>17

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-163-177)

<400>17

Phe His Thr Ser Val Trp Leu Lys Val Arg Glu Asp Tyr Ser Leu

1 5 10 15

<210>18

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the NS1 protein of ZIKV (NS1-163-177)

<400>18

Val Trp Leu Lys Val Arg Glu Asp Tyr

1 5

<210>19

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the NS1 protein of ZIKV (NS1-163-177)

<400>19

Trp Leu Lys Val Arg Glu Asp Tyr Ser

1 5

<210>20

<211>12

<212>PRT

<213>Artificial sequence

<220>

<223>12-mer predicted epitope in the NS1 protein of ZIKV (NS1-163-177)

<400>20

His Thr Ser Val Trp Leu Lys Val Arg Glu Asp Tyr

1 5 10

<210>21

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first predicted epitope in the NS1 protein of ZIKV

(NS1-163-177)

<400>21

His Thr Ser Val Trp Leu Lys Val Arg

1 5

<210>22

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second predicted epitope in the NS1 protein of ZIKV

(NS1-163-177)

<400>22

Phe His Thr Ser Val Trp Leu Lys Val

1 5

<210>23

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-275-289)

<400>23

Ile Arg Phe Glu Glu Cys Pro Gly Thr Lys Val His Val Glu Glu

1 5 10 15

<210>24

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS1 protein of ZIKV (NS1-275-289)

<400>24

Cys Pro Gly Thr Lys Val His Val Glu

1 5

<210>25

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS2B protein of ZIKV (NS2B-117-131)

<400>25

Ala Ala Gly Ala Trp Tyr Val Tyr Val Lys Thr Gly Lys Arg Ser

1 5 10 15

<210>26

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS2B protein of ZIKV

(NS2B-117-131)

<400>26

Ala Ala Gly Ala Trp Tyr Val Tyr Val Lys

1 5 10

<210>27

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS2B protein of ZIKV

(NS2B-117-131)

<400>27

Tyr Val Tyr Val Lys Thr Gly Lys Arg

1 5

<210>28

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS3 protein of ZIKV (NS3-219-233)

<400>28

Thr Val Ile Leu Ala Pro Thr Arg Val Val Ala Ala Glu Met Glu

1 5 10 15

<210>29

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer epitope in the NS3 protein of ZIKV (NS3-219-233)

<400>29

Ala Pro Thr Arg Val Val Ala Ala Glu Met

1 5 10

<210>30

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS3 protein of ZIKV (NS3-219-233)

<400>30

Ile Leu Ala Pro Thr Arg Val Val Ala Ala

1 5 10

<210>31

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS3 protein of ZIKV (NS3-271-285)

<400>31

Leu Gln Pro Ile Arg Val Pro Asn Tyr Asn Leu Tyr Ile Met Asp

1 5 10 15

<210>32

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS3 protein of ZIKV (NS3-271-285)

<400>32

Val Pro Asn Tyr Asn Leu Tyr Ile Met

1 5

<210>33

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS3 protein of ZIKV (NS3-311-325)

<400>33

Ala Ala Ile Phe Met Thr Ala Thr Pro Pro Gly Thr Arg Asp Ala

1 5 10 15

<210>34

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the NS3 protein of ZIKV (NS3-311-325)

<400>34

Phe Met Thr Ala Thr Pro Pro Gly Thr

1 5

<210>35

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the NS3 protein of ZIKV (NS3-311-325)

<400>35

Ile Phe Met Thr Ala Thr Pro Pro Gly

1 5

<210>36

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS4A protein of ZIKV (NS4A-86-100)

<400>36

Val Thr Leu Gly Ala Ser Ala Trp Leu Met Trp Leu Ser Glu Ile

1 5 10 15

<210>37

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS4A protein of ZIKV

(NS4A-86-100)

<400>37

Ser Ala Trp Leu Met Trp Leu Ser Glu Ile

15 10

<210>38

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first predicted epitope in the NS4A protein of ZIKV

(NS4A-86-100)

<400>38

Val Thr Leu Gly Ala Ser Ala Trp Leu

1 5

<210>39

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second predicted epitope in the NS4A protein of ZIKV

(NS4A-86-100)

<400>39

Leu Gly Ala Ser Ala Trp Leu Met Trp

1 5

<210>40

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS4B protein of ZIKV (NS4B-112-126)

<400>40

Ala Ile Ile Leu Leu Val Ala His Tyr Met Tyr Leu Ile Pro Gly

1 5 10 15

<210>41

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS4B protein of ZIKV (NS4B-112-126)

<400>41

Ala Ile Ile Leu Leu Val Ala His Tyr

1 5

<210>42

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer epitope in the NS4B protein of ZIKV (NS4B-112-126)

<400>42

Leu Leu Val Ala His Tyr Met Tyr Leu Ile

1 5 10

<210>43

<211>8

<212>PRT

<213>Artificial sequence

<220>

<223>8-mer epitope in the NS4B protein of ZIKV (NS4B-112-126)

<400>43

Leu Val Ala His Tyr Met Tyr Leu

1 5

<210>44

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first predicted epitope in the NS4B protein of ZIKV

(NS4B-112-126)

<400>44

Leu Leu Val Ala His Tyr Met Tyr Leu

1 5

<210>45

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second predicted epitope in the NS4B protein of ZIKV

(NS4B-112-126)

<400>45

Leu Val Ala His Tyr Met Tyr Leu Ile

1 5

<210>46

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-13-27)

<400>46

Lys Ala Arg Leu Asn Gln Met Ser Ala Leu Glu Phe Tyr Ser Tyr

1 5 10 15

<210>47

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS5 protein of ZIKV (NS5-13-27)

<400>47

Met Ser Ala Leu Glu Phe Tyr Ser Tyr

1 5

<210>48

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-293-307)

<400>48

Trp Phe Phe Asp Glu Asn His Pro Tyr Arg Thr Trp Ala Tyr His

1 5 10 15

<210>49

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the NS5 protein of ZIKV (NS5-293-307)

<400>49

His Pro Tyr Arg Thr Trp Ala Tyr His

1 5

<210>50

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the NS5 protein of ZIKV (NS5-293-307)

<400>50

Phe Phe Asp Glu Asn His Pro Tyr Arg

1 5

<210>51

<211>8

<212>PRT

<213>Artificial sequence

<220>

<223>8-mer predicted epitope in the NS5 protein of ZIKV (NS5-293-307)

<400>51

Phe Phe Asp Glu Asn His Pro Tyr

1 5

<210>52

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-297-311)

<400>52

Glu Asn His Pro Tyr Arg Thr Trp Ala Tyr His Gly Ser Tyr Glu

1 5 10 15

<210>53

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer first epitope in the NS5 protein of ZIKV (NS5-297-311)

<400>53

Asn His Pro Tyr Arg Thr Trp Ala Tyr

15

<210>54

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer second epitope in the NS5 protein of ZIKV (NS5-297-311)

<400>54

Tyr Arg Thr Trp Ala Tyr His Gly Ser

1 5

<210>55

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer third epitope in the NS5 protein of ZIKV (NS5-297-311)

<400>55

Arg Thr Trp Ala Tyr His Gly Ser Tyr

1 5

<210>56

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS5 protein of ZIKV (NS5-297-311)

<400>56

Tyr Arg Thr Trp Ala Tyr His Gly Ser Tyr

1 5 10

<210>57

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-345-359)

<400>57

Thr Asp Thr Thr Pro Tyr Gly Gln Gln Arg Val Phe Lys Glu Lys

1 5 10 15

<210>58

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS5 protein of ZIKV (NS5-345-359)

<400>58

Thr Pro Tyr Gly Gln Gln Arg Val Phe

1 5

<210>59

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-425-439)

<400>59

Glu Ala Val Asn Asp Pro Arg Phe Trp Ala Leu Val Asp Lys Glu

1 5 10 15

<210>60

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS5 protein of ZIKV (NS5-425-439)

<400>60

Glu Ala Val Asn Asp Pro Arg Phe Trp

1 5

<210>61

<211>13

<212>PRT

<213>Artificial sequence

<220>

<223>13-mer predicted epitope in the NS5 protein of ZIKV (NS5-425-439)

<400>61

Ala Val Asn Asp Pro Arg Phe Trp Ala Leu Val Asp Lys

1 5 10

<210>62

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-461-475)

<400>62

Lys Lys Gln Gly Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile

1 5 10 15

<210>63

<211>12

<212>PRT

<213>Artificial sequence

<220>

<223>12-mer predicted epitope in the NS5 protein of ZIKV (NS5-461-475)

<400>63

Gly Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile

1 5 10

<210>64

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-473-487)

<400>64

Arg Ala Ile Trp Tyr Met Trp Leu Gly Ala Arg Phe Leu Glu Phe

1 5 10 15

<210>65

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS5 protein of ZIKV (NS5-473-487)

<400>65

Tyr Met Trp Leu Gly Ala Arg Phe Leu

1 5

<210>66

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS5 protein of ZIKV (NS5-473-487)

<400>66

Ala Ile Trp Tyr Met Trp Leu Gly Ala Arg

1 5 10

<210>67

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-546-560)

<400>67

Arg Phe Asp Leu Glu Asn Glu Ala Leu Ile Thr Asn Gln Met Glu

1 5 10 15

<210>68

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS5 protein of ZIKV (NS5-546-560)

<400>68

Asn Glu Ala Leu Ile Thr Asn Gln Met

1 5

<210>69

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-565-579)

<400>69

Leu Ala Leu Ala Ile Ile Lys Tyr Thr Tyr Gln Asn Lys Val Val

1 5 1015

<210>70

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS5 protein of ZIKV (NS5-565-579)

<400>70

Leu Ala Leu Ala Ile Ile Lys Tyr Thr Tyr

1 5 10

<210>71

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer predicted epitope in the NS5 protein of ZIKV (NS5-565-579)

<400>71

Ala Leu Ala Ile Ile Lys Tyr Thr Tyr

1 5

<210>72

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-605-619)

<400>72

Gln Val Val Thr Tyr Ala Leu Asn Thr Phe Thr Asn Leu Val Val

1 5 10 15

<210>73

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS5 protein of ZIKV (NS5-605-619)

<400>73

Tyr Ala Leu Asn Thr Phe Thr Asn Leu

1 5

<210>74

<211>10

<212>PRT

<213>Artificial sequence

<220>

<223>10-mer predicted epitope in the NS5 protein of ZIKV (NS5-605-619)

<400>74

Thr Tyr Ala Leu Asn Thr Phe Thr Asn Leu

1 5 10

<210>75

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the C protein of ZIKV (C-49-63)

<400>75

Ala Ile Leu Ala Phe Leu Arg Phe Thr Ala Ile Lys Pro Ser Leu

1 5 10 15

<210>76

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the E protein of ZIKV (E-67-81)

<400>76

Asp Met Ala Ser Asp Ser Arg Cys Pro Thr Gln Gly Glu Ala Tyr

1 5 10 15

<210>77

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the E protein of ZIKV (E-87-101)

<400>77

Asp Thr Gln Tyr Val Cys Lys Arg Thr Leu Val Asp Arg Gly Trp

1 5 10 15

<210>78

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-19-33)

<400>78

Val Phe Val Tyr Asn Asp Val Glu Ala Trp Arg Asp Arg Tyr Lys

1 5 10 15

<210>79

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-55-69)

<400>79

Cys Gly Ile Ser Ser Val Ser Arg Met Glu Asn Ile Met Trp Arg

1 5 10 15

<210>80

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-91-105)

<400>80

Gly Ser Val Lys Asn Pro Met Trp Arg Gly Pro Gln Arg Leu Pro

1 5 10 15

<210>81

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-107-121)

<400>81

Pro Val Asn Glu Leu Pro His Gly Trp Lys Ala Trp Gly Lys Ser

1 5 10 15

<210>82

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-147-161)

<400>82

His Arg Ala Trp Asn Ser Phe Leu Val Glu Asp His Gly Phe Gly

1 5 10 15

<210>83

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS1 protein of ZIKV (NS1-195-209)

<400>83

His Ser Asp Leu Gly Tyr Trp Ile Glu Ser Glu Lys Asn Asp Thr

1 5 10 15

<210>84

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS3 protein of ZIKV (NS3-131-145)

<400>84

Pro Ala Gly Thr Ser Gly Ser Pro Ile Leu Asp Lys Cys Gly Arg

1 5 10 15

<210>85

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS3 protein of ZIKV (NS3-143-157)

<400>85

Cys Gly Arg Val Ile Gly Leu Tyr Gly Asn Gly Val Val Ile Lys

1 5 10 15

<210>86

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-325-339)

<400>86

Val Val Arg Leu Leu Ser Lys Pro Trp Asp Val Val Thr Gly Val

1 5 10 15

<210>87

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-373-387)

<400>87

Gln Val Met Ser Met Val Ser Ser Trp Leu Trp Lys Glu Leu Gly

1 5 10 15

<210>88

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-465-479)

<400>88

Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp Tyr Met Trp

1 5 10 15

<210>89

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-481-495)

<400>89

Gly Ala Arg Phe Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu

1 5 10 15

<210>90

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-573-586)

<400>90

Thr Tyr Gln Asn Lys Val Val Lys Val Leu Arg Pro Ala Glu Lys

1 5 10 15

<210>91

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS5 protein of ZIKV (NS5-849-863)

<400>91

Cys Gly Ser Leu Ile Gly His Arg Pro Arg Thr Thr Trp Ala Glu

1 5 10 15

<210>92

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the C protein of ZIKV (C-21-35)

<400>92

Val Ala Arg Val Ser Pro Phe Gly Gly Leu Lys Arg Leu Pro Ala

1 5 10 15

<210>93

<211>11

<212>PRT

<213>Artificial sequence

<220>

<223>11-mer epitope in the C protein of ZIKV (C-25-35)

<400>93

Ser Pro Phe Gly Gly Leu Lys Arg Leu Pro Ala

1 5 10

<210>94

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS3 protein of ZIKV

<400>94

Phe Pro Asp Ser Asn Ser Pro Ile Met

1 5

<210>95

<211>15

<212>PRT

<213>Artificial sequence

<220>

<223>15-mer epitope in the NS4B protein of ZIKV

<400>95

Arg Gly Ser Tyr Leu Ala Gly Ala Ser Leu Ile Tyr Thr Val Thr

1 5 10 15

<210>96

<211>11

<212>PRT

<213>Artificial sequence

<220>

<223>11-mer epitope in the NS5 protein

<400>96

Asn Gln Met Ser Ala Leu Glu Phe Tyr Ser Tyr

1 5 10

<210>97

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope contained in the NS5 protein (NS5-331-339)

<400>97

Lys Pro Trp Asp Val Val Thr Gly Val

1 5

<210>98

<211>9

<212>PRT

<213>Artificial sequence

<220>

<223>9-mer epitope in the NS5 protein

<400>98

Lys Pro Trp Asp Val Ile Pro Met Val

1 5

<210>99

<211>962

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a chimeric polyepitope of ZIKV

<400>99

Gly Gly Phe Arg Ile Val Asn Met Leu Lys Arg Gly Val Ala Arg Val

1 5 10 15

Ser Pro Phe Gly Gly Leu Lys Arg Leu Pro Ala Gly Leu Leu Leu Gly

20 25 30

His Gly Pro Ile Arg Met Val Leu Ala Ile Leu Ala Phe Leu Arg Phe

35 40 45

Thr Ala Ile Lys Pro Ser Leu Gly Leu Ile Asn Arg Trp Gly Ser Val

50 55 60

Gly Lys Lys Glu Ala Met Glu Ile Ile Lys Lys Phe Lys Lys Asp Leu

65 70 75 80

Ala Ala Met Leu Arg Ile Ile Asn Ala Arg Lys Glu Lys Val Phe Val

85 90 95

Tyr Asn Asp Val Glu Ala Trp Arg Asp Arg Tyr Lys Tyr His Pro Asp

100 105 110

Ser Pro Arg Arg Leu Ala Ala Ala Val Lys Gln Ala Trp Glu Asp Gly

115 120 125

Ile Cys Gly Ile Ser Ser Val Ser Arg Met Glu Asn Ile Met Trp Arg

130 135 140

Ser Val Glu Gly Glu Leu Asn Ala Ile Leu Glu Glu Asn Gly Val Gln

145 150 155 160

Leu Thr Val Val Val Gly Ser Val Lys Asn Pro Met Trp Arg Gly Pro

165 170 175

Gln Arg Leu Pro Val Pro Val Asn Glu Leu Pro His Gly Trp Lys Ala

180 185 190

Trp Gly Lys Ser Tyr Phe Val Arg Ala Ala Lys Thr Asn Asn His Arg

195 200 205

Ala Trp Asn Ser Phe Leu Val Glu Asp His Gly Phe Gly Val Phe His

210 215 220

Thr Ser Val Trp Leu Lys Val Arg Glu Asp Tyr Ser Leu Glu Cys Asp

225 230 235 240

Pro Ala Val Ile Gly Thr Ala Val Lys Gly Lys Glu Ala Val His Ser

245 250 255

Asp Leu Gly Tyr Trp Ile Glu Ser Glu Lys Asn Asp Thr Trp Ile Arg

260 265 270

Phe Glu Glu Cys Pro Gly Thr Lys Val His Val Glu Glu Thr Ile Phe

275 280 285

Lys Thr Lys Asp Gly Asp Ile Gly Ala Val Ala Leu Asp Tyr Pro Ala

290 295 300

Gly Thr Ser Gly Ser Pro Ile Leu Asp Lys Cys Gly Arg Val Ile Gly

305 310 315 320

Leu Tyr Gly Asn Gly Val Val Ile Lys Asn Gly Lys Thr Arg Arg Val

325 330 335

Leu Pro Glu Ile Val Arg Glu Ala Ile Lys Thr Arg Leu Arg Thr Val

340 345 350

Ile Leu Ala Pro Thr Arg Val Val Ala Ala Glu Met Glu Glu Ala Leu

355 360 365

Arg Gly Leu Pro Val Arg Tyr Met Thr Thr Ala Val Asn Val Thr His

370 375 380

Ser Gly Thr Glu Ile Val Asp Leu Met Cys His Ala Thr Phe Thr Ser

385 390 395 400

Arg Leu Leu Gln Pro Ile Arg Val Pro Asn Tyr Asn Leu Tyr Ile Met

405 410 415

Asp Glu Ala His Phe Thr Asp Pro Ser Ser Ile Ala Ala Arg Gly Tyr

420 425 430

Ile Ser Thr Arg Val Glu Met Gly Glu Ala Ala Ala Ile Phe Met Thr

435 440 445

Ala Thr Pro Pro Gly Thr Arg Asp Ala Phe Pro Asp Ser Asn Ser Pro

450 455 460

Ile Met Asp Thr Glu Val Glu Val Pro Gln Ala Gly Val Leu Phe Gly

465 470 475 480

Met Gly Lys Gly Met Pro Phe Tyr Ala Trp Asp Phe Gly Val Pro Leu

485 490 495

Leu Met Ile Gly Cys Tyr Ser Gln Leu Thr Pro Leu Thr Leu Ile Val

500 505 510

Ala Ile Ile Leu Leu Val Ala His Tyr Met Tyr Leu Ile Pro Gly Leu

515 520 525

Gln Ala Ala Ala Ala Arg Ala Ala Gln Lys Arg Thr Ala Ala Gly Ile

530 535 540

Met Lys Asn Ile Ile Gly Asn Arg Ile Glu Arg Ile Arg Ser Glu His

545 550 555 560

Ala Glu Thr Trp Phe Phe Asp Glu Asn His Pro Tyr Arg Thr Trp Ala

565 570 575

Tyr His Gly Ser Tyr Glu Ala Pro Thr Gln Gly Ser Ala Ser Ser Leu

580 585 590

Ile Asn Gly Val Val Arg Leu Leu Ser Lys Pro Trp Asp Val Val Thr

595 600 605

Gly Val Thr Gly Ile Ala Met Thr Asp Thr Thr Pro Tyr Gly Gln Gln

610 615 620

Arg Val Phe Lys Glu Lys Val Asp Thr Arg Val Pro Asp Pro Gln Glu

625 630 635 640

Gly Thr Arg Gln Val Met Ser Met Val Ser Ser Trp Leu Trp Lys Glu

645 650 655

Leu Gly Lys His Lys Arg Pro Arg Val Cys Thr Lys Glu Glu Phe Ile

660 665 670

Asn Lys Val Arg Ser Asn Ala Ala Leu Gly Ala Ile Phe Glu Glu Glu

675 680 685

Lys Glu Trp Lys Thr Ala Val Glu Ala Val Asn Asp Pro Arg Phe Trp

690 695 700

Ala Leu Val Asp Lys Glu Arg Glu His His Leu Arg Gly Glu Cys Gln

705 710 715 720

Ser Cys Val Tyr Asn Met Met Gly Lys Arg Glu Lys Lys Gln Gly Glu

725 730 735

Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp Tyr Met Trp Leu Gly

740 745 750

Ala Arg Phe Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu Arg Phe

755 760 765

Asp Leu Glu Asn Glu Ala Leu Ile Thr Asn Gln Met Glu Lys Gly His

770 775 780

Arg Ala Leu Ala Leu Ala Ile Ile Lys Tyr Thr Tyr Gln Asn Lys Val

785 790 795 800

Val Lys Val Leu Arg Pro Ala Glu Lys Gly Lys Thr Val Met Asp Ile

805 810 815

Ile Ser Arg Gln Asp Met Glu Ala Glu Glu Val Leu Glu Met Gln Asp

820 825 830

Leu Trp Leu Leu Arg Arg Ser Lys Pro Ser Thr Gly Trp Asp Asn Trp

835 840 845

Glu Glu Val Pro Phe Cys Ser His His Phe Asn Lys Leu His Leu Lys

850 855 860

Asp Gly Arg Ser Ile Val Val Pro Cys Arg His Gln Asp Glu Leu Ile

865 870 875 880

Gly Arg Ala Arg Val Ser Pro Gly Ala Gly Trp Ser Ile Arg Glu Thr

885 890 895

Ala Cys Leu Ala Lys Ser Tyr Ala Gln Met Trp Gln Leu Leu Tyr Phe

900 905 910

His Arg Arg Asp Leu Arg Leu Met Ala Asn Ala Ile Cys Ser Ser Val

915 920 925

Pro Val Asp Trp Val Pro Thr Gly Arg Thr Thr Trp Ser Ile His Gly

930 935 940

Lys Gly Glu Trp Met Thr Thr Glu Asp Met Leu Val Val Trp Asn Arg

945 950 955 960

Val Trp

<210>100

<211>2886

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

chimeric polyepitope of ZIKV

<400>100

ggaggattcc ggattgtcaa tatgctaaaa cgcggagtag cccgtgtgag cccctttggg 60

ggcttgaaga ggctgccagc cggacttctg ctgggtcatg ggcccatcag gatggtcttg 120

gcgattctag cctttttgag attcacggca atcaagccat cactgggtct catcaataga 180

tggggttcag tggggaaaaa agaggctatg gaaataataa agaagttcaa gaaagatctg 240

gctgccatgc tgagaataat caatgctagg aaggagaagg tgttcgtcta taacgacgtt 300

gaagcctgga gggacaggta caagtaccat cctgactccc cccgtagatt ggcagcagca 360

gtcaagcaag cctgggaaga tggtatctgc gggatctcct ctgtttcaag aatggaaaac 420

atcatgtgga gatcagtaga aggggagctc aacgcaatcc tggaagagaa tggagttcaa 480

ctgacggtcg ttgtgggatc tgtaaaaaac cccatgtgga gaggtccaca gagattgccc 540

gtgcctgtga acgagctgcc ccacggctgg aaggcttggg ggaaatcgta cttcgtcaga 600

gcagcaaaga caaataacca tagagcatgg aacagctttc ttgtggagga tcatgggttc 660

ggggtatttc acactagtgt ctggctcaag gttagagaag attattcatt agagtgtgat 720

ccagccgtta ttggaacagc tgttaaggga aaggaggctg tacacagtga tctaggctac 780

tggattgaga gtgagaagaa tgacacatgg attcggtttg aggaatgccc aggcactaag 840

gtccacgtgg aggaaacaat atttaagaca aaggatgggg acattggagc ggttgcgctg 900

gattacccag caggaacttc aggatctcca atcctagaca agtgtgggag agtgatagga 960

ctttatggca atggggtcgt gatcaaaaat gggaaaacca ggagagttct tcctgaaata 1020

gtccgtgaag ccataaaaac aagactccgt actgtgatct tagctccaac cagggttgtc 1080

gctgctgaaa tggaggaagc ccttagaggg cttccagtgc gttatatgac aacagcagtc 1140

aatgtcaccc actctggaac agaaatcgtc gacttaatgt gccatgccac cttcacttca 1200

cgtctactac agccaatcag agtccccaac tataatctgt atattatgga tgaggcccac 1260

ttcacagatc cctcaagtat agcagcaaga ggatacattt caacaagggt tgagatgggc 1320

gaggcggctg ccatcttcat gaccgccacg ccaccaggaa cccgtgacgc atttccggac 1380

tccaactcac caattatgga caccgaagtg gaagtcccac aagctggagt gttgtttggt 1440

atgggcaaag ggatgccatt ctacgcatgg gactttggag tcccgctgct aatgataggt 1500

tgctactcac aattaacacc cctgacccta atagtggcca tcattttgct cgtggcgcac 1560

tacatgtact tgatcccagg gctgcaggca gcagctgcgc gtgctgccca gaagagaacg 1620

gcagctggca tcatgaagaa catcattggt aaccgcattg aaaggatccg cagtgagcac 1680

gcggaaacgt ggttctttga cgagaaccac ccatatagga catgggctta ccatggaagc 1740

tatgaggccc ccacacaagg gtcagcgtcc tctctaataa acggggttgt caggctcctg 1800

tcaaaaccct gggatgtggt gactggagtc acaggaatag ccatgaccga caccacaccg 1860

tatggtcagc aaagagtttt caaggaaaaa gtggacacta gggtgccaga cccccaagaa 1920

ggcactcgtc aggttatgag catggtctct tcctggttgt ggaaagagct aggcaaacac 1980

aaacggccac gagtctgtac caaagaagag ttcatcaaca aggttcgtag caatgcagca 2040

ttaggggcaa tatttgaaga ggaaaaagag tggaagactg cagtggaagc tgtgaacgat 2100

ccaaggttct gggctctagt ggacaaggaa agagagcacc acctgagagg agagtgccag 2160

agttgtgtgt acaacatgat gggaaaaaga gaaaagaaac aaggggaatt tggaaaggcc 2220

aagggcagcc gcgccatctg gtatatgtgg ctaggggcta gatttctaga gttcgaagcc 2280

cttggattct tgaacgagag gtttgatctg gagaatgaag ctctaatcac caaccaaatg 2340

gagaaagggc acagggcctt ggcattggcc ataatcaagt acacatacca aaacaaagtg 2400

gtaaaggtcc ttagaccagc tgaaaaaggg aaaacagtta tggacattat ttcgagacaa 2460

gacatggagg ctgaggaagt tctagagatg caagacttgt ggctgctgcg gaggtcaaaa 2520

ccctcaactg gatgggacaa ctgggaagaa gttccgtttt gctcccacca cttcaacaag 2580

ctccatctca aggacgggag gtccattgtg gttccctgcc gccaccaaga tgaactgatt 2640

ggccgggccc gcgtctctcc aggggcggga tggagcatcc gggagactgc ttgcctagca 2700

aaatcatatg cgcaaatgtg gcagctcctt tatttccaca gaagggacct ccgactgatg 2760

gccaatgcca tttgttcatc tgtgccagtt gactgggttc caactgggag aactacctgg 2820

tcaatccatg gaaagggaga atggatgacc actgaagaca tgcttgtggt gtggaacaga 2880

gtgtgg 2886

<210>101

<211>2886

<212>DNA

<213>Artificial sequence

<220>

<223>Optimised nucleotide sequence of the polynucleotide encoding a

chimeric polyepitope of ZIKV

<400>101

ggcggcttca gaatcgtgaa catgctgaag cgcggcgtgg ccagagtgtc tccatttggc 60

ggactgaaga gactgcctgc cggactgctt ctcggacacg gccctattag aatggtgctg 120

gccatcctgg cctttctgcg gttcacagcc atcaagccta gcctgggcct gatcaacaga 180

tggggcagcg tgggcaagaa agaagccatg gaaatcatca agaagttcaa gaaagacctg 240

gccgccatgc tgcggatcat caacgcccgg aaagaaaagg tgttcgtgta caacgacgtg 300

gaagcctggc gggacagata caagtatcac cctgacagcc ccagacggct ggccgctgct 360

gtgaaacaag cttgggagga tggcatctgc ggcatcagca gcgtgtcccg gatggaaaac 420

atcatgtggc ggagcgtgga aggcgagctg aacgccattc tggaagagaa cggcgtgcag 480

ctgacagtgg ttgtgggctc cgtgaagaac cctatgtggc ggggacctca gagactcccc 540

gtgcctgtta atgagctgcc tcacggatgg aaggcctggg gcaagagcta ttttgtgcgg 600

gctgccaaga ccaacaacca cagagcctgg aacagcttcc tggtggaaga tcacggcttc 660

ggcgtgttcc acacaagcgt gtggctgaaa gtgcgcgagg actacagcct ggaatgcgac 720

cctgccgtga ttggcacagc cgtgaaggga aaagaagccg tgcacagcga tctcggctac 780

tggatcgaga gcgagaagaa cgacacctgg atcagattcg aggaatgccc cggcaccaag 840

gtgcacgtgg aagagacaat cttcaagacc aaggacggcg acatcggcgc cgtggctctt 900

gattatcctg ccggcacatc tggcagcccc atcctggata agtgcggcag agtgatcggc 960

ctgtacggca atggcgtcgt gatcaagaac ggcaagacca gaagagtgct gcccgagatt 1020

gtgcgggaag ccattaagac ccggctgcgg acagtgattc tggcccctac aagagtggtg 1080

gccgccgaga tggaagaagc cctgagagga ctgcctgtgc ggtacatgac aaccgccgtg 1140

aatgtgaccc acagcggcac cgaaatcgtg gacctgatgt gccacgccac cttcacctct 1200

agactgctgc agcccatcag agtgcccaac tacaacctgt acatcatgga cgaggcccac 1260

ttcacagacc ccagctctat tgccgccaga ggctacatca gcaccagagt ggaaatgggc 1320

gaagccgccg ctatcttcat gaccgctaca ccacctggca ccagggacgc ctttccagac 1380

agcaacagcc ctatcatgga caccgaggtg gaagtgcctc aggccggcgt tctgtttggc 1440

atgggaaagg gcatgccatt ctacgcctgg gatttcggcg tgcccctgct gatgatcggc 1500

tgttactctc agctgacccc tctgacactg atcgtggcca tcattctgct ggtggcccac 1560

tacatgtatc tgatccctgg actgcaggcc gctgccgcta gagctgctca gaaaagaaca 1620

gccgccggaa tcatgaagaa catcatcggc aaccggatcg agcggatcag aagcgagcac 1680

gccgagacat ggttcttcga cgagaatcac ccctaccgga cctgggccta ccacggctct 1740

tatgaagctc ctacacaggg cagcgccagc agcctgatta acggcgttgt cagactgctg 1800

agcaagccct gggatgtcgt gacaggcgtg accggaatcg ccatgaccga cacaacacct 1860

tacggccagc agcgggtgtt caaagaaaaa gtggacacca gggtgcccga tcctcaagag 1920

ggcaccagac aagtgatgag catggtgtcc agctggctgt ggaaagagct gggcaagcac 1980

aagaggccca gagtgtgcac caaagaggaa ttcatcaaca aagtgcggag caacgccgct 2040

ctgggcgcca tctttgagga agagaaagaa tggaaaaccg ccgtcgaggc cgtgaacgac 2100

cctagatttt gggccctcgt ggacaaagag agagagcacc acctgagagg cgagtgccag 2160

agctgcgtgt acaatatgat gggcaaacgc gagaaaaagc agggcgagtt cggcaaggcc 2220

aagggcagta gagccatctg gtacatgtgg ctgggagcca gattcctgga attcgaggcc 2280

ctgggcttcc tgaacgagag attcgacctg gaaaatgagg ccctgatcac caaccagatg 2340

gaaaagggac acagagccct ggctctggcc attatcaagt acacctacca gaacaaggtg 2400

gtcaaggtgc tgcggcctgc cgagaagggc aagacagtga tggacatcat ctcccggcag 2460

gacatggaag ccgaagaggt gctggaaatg caggacctgt ggctgctgag aagaagcaag 2520

ccaagcaccg gctgggacaa ctgggaagaa gtgcccttct gcagccacca cttcaacaag 2580

ctgcacctga aggacggccg gtccatcgtg gtgccttgta gacaccagga cgagctgatc 2640

ggcagagcta gagtttctcc tggcgccgga tggtccatca gagagacagc ctgtctggcc 2700

aagagctacg cccagatgtg gcagctgctg tacttccaca gacgggacct gagactgatg 2760

gccaacgcca tctgtagcag cgtgccagtg gattgggtgc caaccggcag aaccacctgg 2820

tccattcatg gcaaaggcga gtggatgacc accgaggaca tgctggtcgt gtggaataga 2880

gtgtgg 2886

<210>102

<211>93

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fragment of the C protein in the

chimeric polyepitope of ZIKV

<400>102

Gly Gly Phe Arg Ile Val Asn Met Leu Lys Arg Gly Val Ala Arg Val

1 5 10 15

Ser Pro Phe Gly Gly Leu Lys Arg Leu Pro Ala Gly Leu Leu Leu Gly

20 25 30

His Gly Pro Ile Arg Met Val Leu Ala Ile Leu Ala Phe Leu Arg Phe

35 40 45

Thr Ala Ile Lys Pro Ser Leu Gly Leu Ile Asn Arg Trp Gly Ser Val

50 55 60

GlyLys Lys Glu Ala Met Glu Ile Ile Lys Lys Phe Lys Lys Asp Leu

65 70 75 80

Ala Ala Met Leu Arg Ile Ile Asn Ala Arg Lys Glu Lys

85 90

<210>103

<211>279

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fragment of the C protein in the chimeric polyepitope of ZIKV

<400>103

ggaggattcc ggattgtcaa tatgctaaaa cgcggagtag cccgtgtgag cccctttggg 60

ggcttgaaga ggctgccagc cggacttctg ctgggtcatg ggcccatcag gatggtcttg 120

gcgattctag cctttttgag attcacggca atcaagccat cactgggtct catcaataga 180

tggggttcag tggggaaaaa agaggctatg gaaataataa agaagttcaa gaaagatctg 240

gctgccatgc tgagaataat caatgctagg aaggagaag 279

<210>104

<211>113

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fragment of the NS1 protein in the

chimeric polyepitope of ZIKV

<400>104

Val PheVal Tyr Asn Asp Val Glu Ala Trp Arg Asp Arg Tyr Lys Tyr

1 5 10 15

His Pro Asp Ser Pro Arg Arg Leu Ala Ala Ala Val Lys Gln Ala Trp

20 25 30

Glu Asp Gly Ile Cys Gly Ile Ser Ser Val Ser Arg Met Glu Asn Ile

35 40 45

Met Trp Arg Ser Val Glu Gly Glu Leu Asn Ala Ile Leu Glu Glu Asn

50 55 60

Gly Val Gln Leu Thr Val Val Val Gly Ser Val Lys Asn Pro Met Trp

65 70 75 80

Arg Gly Pro Gln Arg Leu Pro Val Pro Val Asn Glu Leu Pro His Gly

85 90 95

Trp Lys Ala Trp Gly Lys Ser Tyr Phe Val Arg Ala Ala Lys Thr Asn

100 105 110

Asn

<210>105

<211>339

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fragment of the NS1 protein in the chimeric polyepitope of ZIKV

<400>105

gtgttcgtct ataacgacgt tgaagcctgg agggacaggt acaagtacca tcctgactcc 60

ccccgtagat tggcagcagc agtcaagcaa gcctgggaag atggtatctg cgggatctcc 120

tctgtttcaa gaatggaaaa catcatgtgg agatcagtag aaggggagct caacgcaatc 180

ctggaagaga atggagttca actgacggtc gttgtgggat ctgtaaaaaa ccccatgtgg 240

agaggtccac agagattgcc cgtgcctgtg aacgagctgc cccacggctg gaaggcttgg 300

gggaaatcgt acttcgtcag agcagcaaag acaaataac 339

<210>106

<211>64

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a second fragment of the NS1 protein in

the chimeric polyepitope of ZIKV

<400>106

His Arg Ala Trp Asn Ser Phe Leu Val Glu Asp His Gly Phe Gly Val

1 5 10 15

Phe His Thr Ser Val Trp Leu Lys Val Arg Glu Asp Tyr Ser Leu Glu

20 25 30

Cys Asp Pro Ala Val Ile Gly Thr Ala Val Lys Gly Lys Glu Ala Val

35 40 45

His Ser Asp Leu Gly Tyr Trp Ile Glu Ser Glu Lys Asn Asp Thr Trp

50 55 60

<210>107

<211>192

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

second fragment of the NS1 protein in the chimeric polyepitope of

ZIKV

<400>107

catagagcat ggaacagctt tcttgtggag gatcatgggt tcggggtatt tcacactagt 60

gtctggctca aggttagaga agattattca ttagagtgtg atccagccgt tattggaaca 120

gctgttaagg gaaaggaggc tgtacacagt gatctaggct actggattga gagtgagaag 180

aatgacacat gg 192

<210>108

<211>16

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a third fragment of the NS1 protein in the

chimeric polyepitope of ZIKV

<400>108

Ile Arg Phe Glu Glu Cys Pro Gly Thr Lys Val His Val Glu Glu Thr

1 5 10 15

<210>109

<211>48

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a third

fragment of the NS1 protein in the chimeric polyepitope of ZIKV

<400>109

attcggtttg aggaatgccc aggcactaag gtccacgtgg aggaaaca 48

<210>110

<211>45

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fragment of the NS3 protein in the

chimeric polyepitope of ZIKV

<400>110

Ile Phe Lys Thr Lys Asp Gly Asp Ile Gly Ala Val Ala Leu Asp Tyr

1 5 10 15

Pro Ala Gly Thr Ser Gly Ser Pro Ile Leu Asp Lys Cys Gly Arg Val

20 25 30

Ile Gly Leu Tyr Gly Asn Gly Val Val Ile Lys Asn Gly

35 40 45

<210>111

<211>135

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fragment of the NS3 protein in the chimeric polyepitope of ZIKV

<400>111

atatttaaga caaaggatgg ggacattgga gcggttgcgc tggattaccc agcaggaact 60

tcaggatctc caatcctaga caagtgtggg agagtgatag gactttatgg caatggggtc 120

gtgatcaaaa atggg 135

<210>112

<211>142

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a second fragment of the NS3 protein in

the chimeric polyepitope of ZIKV

<400>112

Lys Thr Arg Arg Val Leu Pro Glu Ile Val Arg Glu Ala Ile Lys Thr

1 5 10 15

Arg Leu Arg Thr Val Ile Leu Ala Pro Thr Arg Val Val Ala Ala Glu

20 25 30

Met Glu Glu Ala Leu Arg Gly Leu Pro Val Arg Tyr Met Thr Thr Ala

35 40 45

Val Asn Val Thr His Ser Gly Thr Glu Ile Val Asp Leu Met Cys His

50 55 60

Ala Thr Phe Thr Ser Arg Leu Leu Gln Pro Ile Arg Val Pro Asn Tyr

65 70 75 80

Asn Leu Tyr Ile Met Asp Glu Ala His Phe Thr Asp Pro Ser Ser Ile

85 9095

Ala Ala Arg Gly Tyr Ile Ser Thr Arg Val Glu Met Gly Glu Ala Ala

100 105 110

Ala Ile Phe Met Thr Ala Thr Pro Pro Gly Thr Arg Asp Ala Phe Pro

115 120 125

Asp Ser Asn Ser Pro Ile Met Asp Thr Glu Val Glu Val Pro

130 135 140

<210>113

<211>426

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

second fragment of the NS3 protein in the chimeric polyepitope of

ZIKV

<400>113

aaaaccagga gagttcttcc tgaaatagtc cgtgaagcca taaaaacaag actccgtact 60

gtgatcttag ctccaaccag ggttgtcgct gctgaaatgg aggaagccct tagagggctt 120

ccagtgcgtt atatgacaac agcagtcaat gtcacccact ctggaacaga aatcgtcgac 180

ttaatgtgcc atgccacctt cacttcacgt ctactacagc caatcagagt ccccaactat 240

aatctgtata ttatggatga ggcccacttc acagatccct caagtatagc agcaagagga 300

tacatttcaa caagggttga gatgggcgag gcggctgcca tcttcatgac cgccacgcca 360

ccaggaaccc gtgacgcatt tccggactcc aactcaccaa ttatggacac cgaagtggaa 420

gtccca 426

<210>114

<211>74

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fragment of the NS4B protein in the

chimeric polyepitope of ZIKV

<400>114

Gln Ala Gly Val Leu Phe Gly Met Gly Lys Gly Met Pro Phe Tyr Ala

1 5 10 15

Trp Asp Phe Gly Val Pro Leu Leu Met Ile Gly Cys Tyr Ser Gln Leu

20 25 30

Thr Pro Leu Thr Leu Ile Val Ala Ile Ile Leu Leu Val Ala His Tyr

35 40 45

Met Tyr Leu Ile Pro Gly Leu Gln Ala Ala Ala Ala Arg Ala Ala Gln

50 55 60

Lys Arg Thr Ala Ala Gly Ile Met Lys Asn

65 70

<210>115

<211>222

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fragment of the NS4B protein in the chimeric polyepitope of ZIKV

<400>115

caagctggag tgttgtttgg tatgggcaaa gggatgccat tctacgcatg ggactttgga 60

gtcccgctgc taatgatagg ttgctactca caattaacac ccctgaccct aatagtggcc 120

atcattttgc tcgtggcgca ctacatgtac ttgatcccag ggctgcaggc agcagctgcg 180

cgtgctgccc agaagagaac ggcagctggc atcatgaaga ac 222

<210>116

<211>219

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fragment of the NS5 protein in the

chimeric polyepitope of ZIKV

<400>116

Ile Ile Gly Asn Arg Ile Glu Arg Ile Arg Ser Glu His Ala Glu Thr

1 5 10 15

Trp Phe Phe Asp Glu Asn His Pro Tyr Arg Thr Trp Ala Tyr His Gly

20 25 30

Ser Tyr Glu Ala Pro Thr Gln Gly Ser Ala Ser Ser Leu Ile Asn Gly

35 40 45

Val Val Arg Leu Leu Ser Lys Pro Trp Asp Val Val Thr Gly Val Thr

50 55 60

Gly Ile Ala Met Thr Asp Thr Thr Pro Tyr Gly Gln Gln Arg Val Phe

65 70 75 80

Lys Glu Lys Val Asp Thr Arg Val Pro Asp Pro Gln Glu Gly Thr Arg

85 90 95

Gln Val Met Ser Met Val Ser Ser Trp Leu Trp Lys Glu Leu Gly Lys

100 105 110

His Lys Arg Pro Arg Val Cys Thr Lys Glu Glu Phe Ile Asn Lys Val

115 120 125

Arg Ser Asn Ala Ala Leu Gly Ala Ile Phe Glu Glu Glu Lys Glu Trp

130 135 140

Lys Thr Ala Val Glu Ala Val Asn Asp Pro Arg Phe Trp Ala Leu Val

145 150 155 160

Asp Lys Glu Arg Glu His His Leu Arg Gly Glu Cys Gln Ser Cys Val

165 170 175

Tyr Asn Met Met Gly Lys Arg Glu Lys Lys Gln Gly Glu Phe Gly Lys

180 185 190

Ala Lys Gly Ser Arg Ala Ile Trp Tyr Met Trp Leu Gly Ala Arg Phe

195 200 205

Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu

210 215

<210>117

<211>657

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fragment of the NS5 protein in the chimeric polyepitope of ZIKV

<400>117

atcattggta accgcattga aaggatccgc agtgagcacg cggaaacgtg gttctttgac 60

gagaaccacc catataggac atgggcttac catggaagct atgaggcccc cacacaaggg 120

tcagcgtcct ctctaataaa cggggttgtc aggctcctgt caaaaccctg ggatgtggtg 180

actggagtca caggaatagc catgaccgac accacaccgt atggtcagca aagagttttc 240

aaggaaaaag tggacactag ggtgccagac ccccaagaag gcactcgtca ggttatgagc 300

atggtctctt cctggttgtg gaaagagcta ggcaaacaca aacggccacg agtctgtacc 360

aaagaagagt tcatcaacaa ggttcgtagc aatgcagcat taggggcaat atttgaagag 420

gaaaaagagt ggaagactgc agtggaagct gtgaacgatc caaggttctg ggctctagtg 480

gacaaggaaa gagagcacca cctgagagga gagtgccaga gttgtgtgta caacatgatg 540

ggaaaaagag aaaagaaaca aggggaattt ggaaaggcca agggcagccg cgccatctgg 600

tatatgtggc taggggctag atttctagag ttcgaagccc ttggattctt gaacgag 657

<210>118

<211>55

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a second fragment of the NS5 protein in

the chimeric polyepitope of ZIKV

<400>118

Arg Phe Asp Leu Glu Asn Glu Ala Leu Ile Thr Asn Gln Met Glu Lys

1 5 10 15

Gly His Arg Ala Leu Ala Leu Ala Ile Ile Lys Tyr Thr Tyr Gln Asn

20 25 30

Lys Val Val Lys Val Leu Arg Pro Ala Glu Lys Gly Lys Thr Val Met

35 40 45

Asp Ile Ile Ser Arg Gln Asp

50 55

<210>119

<211>165

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

second fragment of the NS5 protein in the chimeric polyepitope of

ZIKV

<400>119

aggtttgatc tggagaatga agctctaatc accaaccaaa tggagaaagg gcacagggcc 60

ttggcattgg ccataatcaa gtacacatac caaaacaaag tggtaaaggt ccttagacca 120

gctgaaaaag ggaaaacagt tatggacatt atttcgagac aagac 165

<210>120

<211>18

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a third fragment of the NS5 protein in the

chimeric polyepitope of ZIKV

<400>120

Met Glu Ala Glu Glu Val Leu Glu Met Gln Asp Leu Trp Leu Leu Arg

1 5 10 15

Arg Ser

<210>121

<211>54

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a third

fragment of the NS5 protein in the chimeric polyepitope of ZIKV

<400>121

atggaggctg aggaagttct agagatgcaa gacttgtggc tgctgcggag gtca 54

<210>122

<211>123

<212>PRT

<213>Artificial sequence

<220>

<223>Amino acid sequence of a fourth fragment of the NS5 protein in

the chimeric polyepitope of ZIKV

<400>122

Lys Pro Ser Thr Gly Trp Asp Asn Trp Glu Glu Val Pro Phe Cys Ser

1 5 10 15

His His Phe Asn Lys Leu His Leu Lys Asp Gly Arg Ser Ile Val Val

20 25 30

Pro Cys Arg His Gln Asp Glu Leu Ile Gly Arg Ala Arg Val Ser Pro

35 40 45

Gly Ala Gly Trp Ser Ile Arg Glu Thr Ala Cys Leu Ala Lys Ser Tyr

50 55 60

Ala Gln Met Trp Gln Leu Leu Tyr Phe His Arg Arg Asp Leu Arg Leu

65 70 75 80

Met Ala Asn Ala Ile Cys Ser Ser Val Pro Val Asp Trp Val Pro Thr

85 90 95

Gly Arg Thr Thr Trp Ser Ile His Gly Lys Gly Glu Trp Met Thr Thr

100 105 110

Glu Asp Met Leu Val Val Trp Asn Arg Val Trp

115 120

<210>123

<211>369

<212>DNA

<213>Artificial sequence

<220>

<223>Native nucleotide sequence of the polynucleotide encoding a

fourth fragment of the NS5 protein in the chimeric polyepitope of

ZIKV

<400>123

aaaccctcaa ctggatggga caactgggaa gaagttccgt tttgctccca ccacttcaac 60

aagctccatc tcaaggacgg gaggtccatt gtggttccct gccgccacca agatgaactg 120

attggccggg cccgcgtctc tccaggggcg ggatggagca tccgggagac tgcttgccta 180

gcaaaatcat atgcgcaaat gtggcagctc ctttatttcc acagaaggga cctccgactg 240

atggccaatg ccatttgttc atctgtgcca gttgactggg ttccaactgg gagaactacc 300

tggtcaatcc atggaaaggg agaatggatg accactgaag acatgcttgt ggtgtggaac 360

agagtgtgg 369

<210>124

<211>2886

<212>DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence of the polynucleotide encoding a chimeric

epitope of ZIKV

<400>124

ggcggcttcc ggatcgtgaa tatgctgaag agaggcgtgg ccagagtcag cccttttggc 60

ggactgaaaa gactgcctgc cggactgctt ctcggccacg gacctattag aatggtgctg 120

gccatcctgg cctttctgcg gtttacagcc atcaagccta gcctgggcct gatcaataga 180

tggggcagcg tgggcaagaa agaagccatg gaaatcatca agaagttcaa gaaagacctg 240

gccgccatgc tgcggatcat caacgcccgg aaagaaaagg tgttcgtgta caacgacgtc 300

gaggcctggc gggacagata caagtatcac cctgacagcc ctagaaggct ggccgctgct 360

gtgaaacagg cctgggagga tggcatctgt ggcatcagca gcgtgtcccg gatggaaaac 420

atcatgtggc ggagcgtgga aggcgagctg aacgccattc tggaagaaaa cggcgtgcag 480

ctgacagtgg tcgtgggctc cgtgaagaat cctatgtggc gaggacctca gagactgccc 540

gtgcctgtga atgaactgcc tcatggatgg aaggcctggg gcaagagcta ttttgtgcgg 600

gctgccaaga ccaacaacca cagagcctgg aacagcttcc tggtggaaga tcacggcttc 660

ggcgtgttcc acaccagcgt gtggctgaaa gtgcgcgagg attacagcct ggaatgcgat 720

cctgccgtga tcggaacagc cgtgaaggga aaagaagccg tgcacagcga tctcggctac 780

tggatcgaga gcgagaagaa cgacacctgg atcagattcg aggaatgccc cggcaccaag 840

gtgcacgtgg aagagacaat cttcaagacc aaggacggcg acatcggcgc cgtggctctt 900

gattatcctg ccggaacaag cggcagcccc atcctggata agtgtggcag agtgatcggc 960

ctgtacggca acggcgttgt gatcaagaac ggcaagacca gaagagtgct gcccgagatc 1020

gtgcgggaag ccattaagac ccggctgaga acagtgattc tggcccctac aagagtggtg 1080

gccgccgaaa tggaagaagc cctgagaggc ctgcctgtgc ggtacatgac aaccgccgtg 1140

aatgtgacac acagcggcac agagatcgtg gacctgatgt gtcacgccac cttcacctct 1200

agactgctgc agcccatcag agtgcccaac tacaacctgt acatcatgga cgaggcccac 1260

ttcacagacc ccagctctat tgccgccaga ggctacatca gcaccagagt ggaaatgggc 1320

gaagccgccg ctatcttcat gacagccaca cctccaggca ccagggacgc ctttccagac 1380

agcaacagcc ctatcatgga caccgaggtg gaagtgcctc aggctggcgt tctgtttggc 1440

atgggcaagg gcatgccttt ctacgcctgg gattttggcg tgcccctgct gatgatcggc 1500

tgctactctc agctgacccc tctgacactg atcgtggcca ttattctgct ggtggcccac 1560

tacatgtatctgatccctgg actgcaggcc gctgcagcca gagctgctca aaaaagaaca 1620

gccgccggaa tcatgaagaa catcatcggc aaccggatcg agcggatcag aagcgagcac 1680

gccgagacat ggttcttcga cgagaatcac ccctaccgga catgggccta ccacggatct 1740

tatgaagccc ctacacaggg cagcgccagc agccttatca atggcgttgt gcggctgctg 1800

agcaagccct gggatgttgt tacaggcgtg accggaatcg ccatgaccga tacaacaccc 1860

tacggccagc agcgggtgtt caaagaaaaa gtggacacca gggtgcccga tcctcaagag 1920

ggcacaagac aagtgatgag catggtgtcc agctggctgt ggaaagagct gggcaagcac 1980

aagaggccca gagtgtgcac caaagaggaa ttcatcaaca aagtgcggag caacgccgct 2040

ctgggcgcca tctttgagga agagaaagaa tggaaaactg ccgttgaggc cgtgaacgac 2100

cctagatttt gggccctcgt ggacaaagag agagagcacc atctgagagg cgagtgccag 2160

tcctgcgtgt acaatatgat gggcaaacgc gagaaaaagc agggcgagtt cggcaaggcc 2220

aagggaagca gagccatctg gtatatgtgg ctgggagcca gattcctgga attcgaggcc 2280

ctgggcttcc tgaacgagag attcgacctg gaaaatgagg ccctgatcac caaccagatg 2340

gaaaagggac acagagccct ggctctggcc atcatcaagt acacctacca gaacaaggtg 2400

gtcaaggtgc tgaggccagc cgagaagggc aagactgtga tggacatcat cagccggcag 2460

gacatggaag ccgaagaggt gctggaaatg caggatctgt ggctgctgcg gagaagcaag 2520

ccttccacag gctgggacaa ctgggaagaa gtgcccttct gcagccacca cttcaacaag 2580

ctgcacctga aggacggcag atccatcgtg gtgccttgca gacaccagga cgaactgatc 2640

ggcagagcta gagtttctcc tggcgccgga tggtccatca gagaaacagc ctgtctggcc 2700

aagagctacg cccagatgtg gcagctgctg tacttccaca gacgggacct gagactgatg 2760

gccaatgcca tctgtagcag cgtgccagtg gattgggtgc caaccggcag aaccacatgg 2820

tctatccacg gcaaaggcga gtggatgacc accgaggata tgctggtcgt gtggaataga 2880

gtttgg 2886