阅读说明：本技术 作为抗病毒药的环戊基核苷类似物 (Cyclopentyl nucleoside analogs as antiviral agents ) 是由 钟明宏 王广义 于 2019-12-04 设计创作，主要内容包括：本文描述了式(I)的环戊基核苷类似物、包含一种或多种环戊基核苷类似物的药物组合物以及使用它们来治疗HBV、HDV和/或HIV的方法：(Described herein are cyclopentyl nucleoside analogs of formula (I), pharmaceutical compositions comprising one or more cyclopentyl nucleoside analogs, and methods of using them to treat HBV, HDV, and/or HIV:)

1. A compound of formula (I), or a pharmaceutically acceptable salt thereof, having the structure:

wherein:

B¹is an optionally substituted C-linked heterocyclic base or an optionally substituted N-linked heterocyclic base;

R¹selected from hydrogen, halogen, cyano, optionally substituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl and unsubstituted C_2-6Alkynyl, wherein when said C is_1-6When alkyl is substituted, said C_1-6Alkyl quiltAt least oneHalogen substitution;

R²is hydrogen or fluorine;

R³is hydrogen or fluorine;

R⁴selected from hydrogen, halogen, hydroxy, cyano and optionally substituted C_1-4Alkyl, wherein when said C is_1-4When alkyl is substituted, said C_1-4Alkyl substituted with hydroxy or at least one halogen;

R⁵Is hydrogen or hydroxy;

R⁶selected from hydrogen, halogen, cyano, optionally substituted C_1-4Alkyl radicalOptionally substituted C_2-4Alkenyl and unsubstituted C_2-4Alkynyl, wherein when said C is_1-4Alkyl or said C_2-4When alkenyl is substituted, the C_1-4Alkyl and said C_2-4Alkenyl is independently substituted with at least one halogen;

R⁷selected from the group consisting of hydrogen, optionally substituted acyl, optionally substituted O-linked alpha-amino acid,

R¹⁰And R¹¹Independently selected from the group consisting of absent, hydrogen, Or

R¹⁰Is composed ofAnd R is¹¹Absent or hydrogen;

R¹²absent, hydrogen, optionally substituted aryl or optionally substituted heteroaryl;

R¹³is an optionally substituted N-linked alpha-amino acid or an optionally substituted N-linked alpha-amino acid ester derivative;

R¹⁴and R¹⁵Independently an optionally substituted N-linked alpha-amino acid or an optionally substituted N-linked alpha-amino acid ester derivative;

R¹⁶、R¹⁷、R¹⁹and R²⁰Independently selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl;

R¹⁸and R²¹Independently selected from hydrogen, optionally substituted C_1-24Alkyl, optionally substituted aryl, optionally substituted-O-C_1-24Alkyl and optionally substituted-O-aryl;

R²²selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl;

R²³、R²⁴and R²⁵Independently absent or hydrogen;

R⁸and R⁹Independently hydrogen or halogen; and is

m is 0 or 1; and is

With the proviso that the compound of formula (I) or a pharmaceutically acceptable salt thereof is not a compound of (I), (ii) or (iii):

(i) when R is¹Is hydrogen; r²Is hydrogen or fluorine; r³Is hydrogen or fluorine; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen or fluorine; r⁸And R⁹Each is hydrogen, and B¹Selected from: when the current is over; then R is⁷Is not selected from: (a) hydrogen; (b)wherein R is¹⁰And R¹¹Each is hydrogen or each is absent; (c)wherein R is¹⁰Is composed ofR¹¹、R²³、R²⁴Or R²⁵Independently is absent or is hydrogen, and m is 0 or 1; and (d)Wherein R is¹²Is unsubstituted phenyl or unsubstituted naphthyl, and R¹³Is isopropyl alaninate, isobutyl alaninate or neopentyl alaninate;

(ii) when R is¹Is hydrogen; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen; r⁸And R⁹Each is hydrogen; b is¹Selected from: when the current is over;

R⁷selected from: (a)wherein R is¹⁰Is composed ofR¹¹、R²³、R²⁴Or R²⁵Independently is absent or is hydrogen, and m is 1; and (b)Wherein R is¹²Is unsubstituted phenyl, and R¹³Is isopropyl alaninate, then (a) when R is³When it is fluorine, R²Is not hydrogen; and (b) when R is³When it is hydrogen, R²Is not fluorine; and is

(iii) When R is¹Is hydrogen; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen; r⁷Is hydrogen, and R⁸And R⁹Each is hydrogen; then B is¹Is not selected from:

2. the compound of claim 1, wherein the compound of formula (I) is selected from:

Or a pharmaceutically acceptable salt of any of the foregoing.

3. The compound of claim 1 or 2, wherein B¹Selected from:

wherein:

R^A2selected from hydrogen, halogen and NHR^J2Wherein R is^J2Selected from hydrogen, -C (═ O) R^K2and-C (═ O) OR^L2；

R^B2Is halogen or NHR^M2Wherein R is^M2Selected from hydrogen, unsubstituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl, unsubstituted C_3-8Cycloalkyl, -C (═ O) R^N2and-C (═ O) OR^O2；

R^C2Is hydrogen or NHR^P2Wherein R is^P2Selected from hydrogen, -C (═ O) R^Q2and-C (═ O) OR^R2；

R^D2Selected from hydrogen, halogen, unsubstituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl and unsubstituted C_2-6An alkynyl group;

R^E2selected from hydrogen, hydroxy, unsubstituted C_1-6Alkyl, aryl, heteroaryl, and heteroaryl,Unsubstituted C_3-8Cycloalkyl, -C (═ O) R^s2and-C (═ O) OR^T2；

R^F2Selected from hydrogen, halogen, unsubstituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl and unsubstituted C_2-6An alkynyl group;

Y¹、Y²and Y⁴Independently is N or C, with the proviso that Y¹、Y²And Y⁴At least one of which is N;

Y³is N or CR^U2Wherein R is^U2Selected from hydrogen, halogen, unsubstituted C_1-6Alkyl, unsubstituted C_2-6-alkenyl and unsubstituted C_2-6-an alkynyl group;

Y⁵and Y⁶Independently is N or CH;

each one of which isIndependently a single bond or a double bond, with the proviso that the single and double bonds are in a ring such that each ring is aromatic;

R^G2is unsubstituted C _1-6An alkyl group;

R^H2is hydrogen or NHR^V2Wherein R is^V2Independently selected from hydrogen, -C (═ O) R^W2and-C (═ O) OR^X2(ii) a And is

R^K2、R^L2、R^N2、R^O2、R^Q2、R^R2、R^S2、R^T2、R^W2And R^X2Independently selected from unsubstituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl, unsubstituted C_2-6Alkynyl, optionally substituted C_3-6Cycloalkyl, optionally substituted C_3-6Cycloalkenyl, optionally substituted C_6-10Aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted aryl (C)_1-6Alkyl), optionally substituted heteroaryl (C)_1-6Alkyl) and optionally substituted heterocyclic group (C)_1-6Alkyl groups).

4. The compound of claim 1 or 2, wherein B¹Is an optionally substituted C-linked heterocyclic base.

5. The compound of claim 3, wherein B¹Is composed of

6. The compound of claim 3, wherein B¹Selected from:

7. the compound of claim 4, wherein B¹Selected from:

8. the compound of claim 1 or 2, wherein B¹Is an optionally substituted N-linked heterocyclic base.

9. The compound of claim 8, wherein B¹Is an optionally substituted purine.

10. The compound of claim 8, wherein B¹Is an optionally substituted pyrimidine.

11. The compound of claim 3, wherein B¹Selected from:

12. the compound of claim 8, wherein B ¹Selected from:

13. the compound of any one of claims 1-12, wherein R⁶Is halogen.

14. The compound of claim 13, wherein the halogen is fluorine.

15. The compound of any one of claims 1-12, wherein R⁶Is cyano.

16. The compound of any one of claims 1-12, wherein R⁶Is optionally substituted C_1-4Alkyl, wherein when said C is_1-4When alkyl is substituted, said C_1-4Alkyl is substituted by halogen.

17. The compound of any one of claims 1-12, wherein R⁶Is unsubstituted C_1-4An alkyl group.

18. The compound of any one of claims 1-12, wherein R⁶Is fluorine substituted C_1-4An alkyl group.

19. The compound of any one of claims 1-12, wherein R⁶Is chloro-substituted C_1-4An alkyl group.

20. The compound of any one of claims 1-12, wherein R⁶Is optionally substituted C_2-4Alkenyl, wherein when said C is_2-4When alkenyl is substituted, the C_2-4Alkenyl is substituted with halogen.

21. The compound of any one of claims 1-12, wherein R⁶Is unsubstituted C_2-4An alkenyl group.

22. The compound of any one of claims 1-12, wherein R⁶Is fluorine substituted C _2-4An alkenyl group.

23. The compound of any one of claims 1-12, wherein R⁶Is chloro-substituted C_2-4An alkenyl group.

24. The compound of any one of claims 1-12, wherein R⁶Is hydrogen.

25. The compound of any one of claims 1-24, wherein R⁵Is hydrogen.

26. The compound of any one of claims 1-24, wherein R⁵Is a hydroxyl group.

27. The compound of any one of claims 1-26, wherein R⁴Is halogen.

28. The compound of any one of claims 1-26, wherein R⁴Is a hydroxyl group.

29. The compound of any one of claims 1-26, wherein R⁴Is cyano.

30. The compound of any one of claims 1-26, wherein R⁴Is optionally substituted C_1-4Alkyl, wherein when said C is_1-4When alkyl is substituted, said C_1-4Alkyl is substituted with hydroxy or halogen.

31. The compound of claim 30, wherein R⁴Is unsubstituted C_1-4An alkyl group.

32. The compound of claim 30, wherein R⁴Is fluorine substituted C_1-4An alkyl group.

33. The compound of claim 30, wherein R⁴Is chloro-substituted C_1-4An alkyl group.

34. The compound of claim 30, wherein R ⁴Is hydroxy-substituted C_1-4An alkyl group.

35. The compound of any one of claims 1-26, wherein R⁴Is hydrogen.

36. The compound of any one of claims 1-35, wherein R¹Is hydrogen.

37. The compound of any one of claims 1-35, wherein R¹Is halogen.

38. The compound of any one of claims 1-35, wherein R¹Is cyano.

39. The compound of any one of claims 1-35, wherein R¹Is optionally substituted C_1-6Alkyl, wherein when said C is_1-6When alkyl is substituted, said C_1-6Alkyl is substituted by halogen.

40. The compound of any one of claims 1-35, wherein R¹Is unsubstituted C_2-6An alkenyl group.

41. The compound of any one of claims 1-35, which isIn R¹Is unsubstituted C_2-6Alkynyl.

42. The compound of any one of claims 1-41, wherein R²Is hydrogen.

43. The compound of any one of claims 1-41, wherein R²Is fluorine.

44. The compound of any one of claims 1-43, wherein R³Is hydrogen.

45. The compound of any one of claims 1-43, wherein R³Is fluorine.

46. The compound of any one of claims 1-45, wherein R ⁸And R⁹Each is hydrogen.

47. The compound of any one of claims 1-45, wherein R⁸And R⁹Each is a halogen.

48. The compound of any one of claims 1-45, wherein R⁸And R⁹Is hydrogen, and R⁸And R⁹Is halogen.

49. The compound of any one of claims 1-48, wherein R⁷Is hydrogen.

50. The compound of any one of claims 1-48, wherein R⁷Is an optionally substituted acyl group.

51. A compound according to claim 50, wherein R⁷Is an unsubstituted acyl group.

52. The method of any one of claims 1-48Wherein R is⁷Is an optionally substituted O-linked alpha-amino acid.

53. The compound of any one of claims 1-48, wherein R⁷Is an unsubstituted O-linked alpha-amino acid.

54. A compound according to claim 53, wherein R⁷Selected from the group consisting of unsubstituted O-linked alanine, unsubstituted O-linked valine, unsubstituted O-linked leucine and unsubstituted O-linked glycine.

55. The compound of any one of claims 1-48, wherein R⁷Is composed of

56. A compound according to claim 55, wherein R¹⁰And R ¹¹Each absent or hydrogen.

57. A compound according to claim 53, wherein R¹⁰Is composed ofAnd R is¹¹Absent or hydrogen.

58. The compound of claim 55, wherein m is 0; r¹⁰、R²²And R²³Independently absent or hydrogen.

59. The compound of claim 55, wherein m is 1; r¹⁰、R²²、R²³And R²⁴Independently absent or hydrogen.

60. A compound according to claim 53, wherein R⁹And R¹⁰Is absent, is hydrogen orAnd R is⁹And R¹⁰The other one of them is

61. A compound according to claim 53, wherein R⁹And R¹⁰Are each independently

62. A compound according to claim 53, wherein R⁹And R¹⁰Is absent, is hydrogen orAnd R is⁹And R¹⁰The other one of them is

63. A compound according to claim 53, wherein R⁹And R¹⁰Are each independently

64. A compound according to claim 53, wherein R⁹And R¹⁰Is absent, is hydrogen orAnd R is⁹And R¹⁰The other one of them is

65. A compound according to claim 53, wherein R⁹And R¹⁰Are each independently

66. The compound of any one of claims 1-48, wherein R⁷Is composed of

67. A compound according to claim 64, wherein R¹¹Is an optionally substituted aryl group.

68. The compound of claim 65, wherein the optionally substituted aryl is optionally substituted phenyl or optionally substituted naphthyl.

69. The compound of claim 66, wherein the optionally substituted phenyl is unsubstituted phenyl.

70. A compound according to claim 64, wherein R¹¹Is an optionally substituted heteroaryl group.

71. A compound according to claim 68, wherein R¹¹Is an optionally substituted monocyclic heteroaryl.

72. The compound of any one of claims 64-69, wherein R¹²Is an optionally substituted N-linked alpha-amino acid.

73. The compound of any one of claims 64-69, wherein R¹²Is an optionally substituted N-linkGrafted alpha-amino acid ester derivatives.

74. A compound according to claim 70 or 71, wherein R¹²N-linked alanine, N-linked isopropyl alanine, N-linked cyclohexyl alanine, and N-linked neopentyl alanine.

75. The compound of any one of claims 1-48, wherein R⁷Is composed of

76. A compound according to claim 74, wherein R¹³And R¹⁴Independently an optionally substituted N-linked alpha-amino acid ester derivative.

77. A compound according to claim 74, wherein R ¹³And R¹⁴Independently an optionally substituted N-linked alpha-amino acid ester derivative.

78. A compound according to claim 74 or 75, wherein R¹³And R¹⁴Independently selected from the group consisting of N-linked alanine, N-linked isopropyl alanine, N-linked cyclohexyl alanine, and N-linked neopentyl alanine.

79. A compound according to claim 1 or 2, selected from:

or a pharmaceutically acceptable salt of any of the foregoing.

80. A compound according to claim 1 or 2, selected from:

or a pharmaceutically acceptable salt of any of the foregoing.

81. A pharmaceutical composition comprising an effective amount of a compound of any one of claims 1-80, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, diluent, excipient, or combination thereof.

82. Use of a compound according to any one of claims 1 to 80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81, for the manufacture of a medicament for the treatment of HBV and/or HDV infection.

83. Use of a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81, for the manufacture of a medicament for reducing the recurrence of HBV and/or HDV infection.

84. Use of a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81, for the manufacture of a medicament for inhibiting replication of HBV and/or HDV virus.

85. The use of any one of claims 82-84, further comprising the use of one or more agents selected from the group consisting of: HBV and/or HDV polymerase inhibitors, immunomodulators, interferons, pegylated interferons, viral fusion/entry inhibitors, viral maturation inhibitors, capsid assembly modulators, reverse transcriptase inhibitors, cyclophilin/TNF inhibitors, FXR agonists, TLR agonists, siRNA or ASO cccDNA inhibitors, gene silencing agents, HBx inhibitors, sAg secretion inhibitors and HBV vaccines, or pharmaceutically acceptable salts of any of the foregoing.

86. A method of ameliorating or treating an HBV and/or HDV infection comprising administering to a subject having said HBV and/or HDV infection an effective amount of a compound of any one of claims 1 to 80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 81.

87. A method of ameliorating or treating HBV and/or HDV infection comprising contacting a cell infected with HBV and/or HDV with a compound according to any one of claims 1 to 80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81.

88. A method of reducing the recurrence of HBV and/or HDV infection comprising contacting a cell infected with HBV and/or HDV with a compound of any one of claims 1 to 80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 81.

89. A method of inhibiting replication of HBV and/or HDV virus comprising contacting a cell infected with HBV and/or HDV with a compound of any one of claims 1 to 80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 81.

90. The method of any one of claims 86-89, further comprising the use of one or more agents selected from the group consisting of: HBV and/or HDV polymerase inhibitors, immunomodulators, interferons, pegylated interferons, viral fusion/entry inhibitors, viral maturation inhibitors, capsid assembly modulators, reverse transcriptase inhibitors, cyclophilin/TNF inhibitors, FXR agonists, TLR agonists, siRNA or ASO cccDNA inhibitors, gene silencing agents, HBx inhibitors, sAg secretion inhibitors and HBV vaccines, or pharmaceutically acceptable salts of any of the foregoing.

91. Use of a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81, for the manufacture of a medicament for ameliorating or treating an HIV infection.

92. Use of a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81, for the manufacture of a medicament for inhibiting replication of the HIV virus.

93. The use of any one of claims 91-92, further comprising the use of one or more antiretroviral therapy (ART) agents selected from the group consisting of: non-nucleoside reverse transcriptase inhibitors (NNRTIs), Nucleoside Reverse Transcriptase Inhibitors (NRTIs), Protease Inhibitors (PIs), fusion/entry inhibitors (also known as CCR5 antagonists), integrase chain transfer inhibitors (INSTI) and HIV other antiretroviral therapeutics or a pharmaceutically acceptable salt of any of the foregoing.

94. A method of ameliorating or treating an HIV infection comprising administering to a subject having the HIV infection an effective amount of a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81.

95. A method for inhibiting replication of the HIV virus, comprising contacting a cell infected with the HIV virus with a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81.

96. A method for ameliorating or treating HIV infection comprising contacting a cell infected with said HIV with a compound according to any one of claims 1-80, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 81.

97. The method of any one of claims 94-96, further comprising one or more antiretroviral therapy (ART) agents selected from the group consisting of: non-nucleoside reverse transcriptase inhibitors (NNRTIs), Nucleoside Reverse Transcriptase Inhibitors (NRTIs), Protease Inhibitors (PIs), fusion/entry inhibitors (also known as CCR5 antagonists), integrase chain transfer inhibitors (INSTI) and HIV other antiretroviral therapeutics, or pharmaceutically acceptable salts of any of the foregoing.

Technical Field

The present application relates to the fields of chemistry, biochemistry and medicine. More specifically, disclosed herein are cyclopentyl nucleoside analogs, pharmaceutical compositions comprising one or more cyclopentyl nucleoside analogs, and methods for synthesizing the same. Also disclosed herein are methods of treating viral diseases and/or disorders with cyclopentyl nucleoside analogs alone or in combination therapy with one or more additional agents.

Description of the invention

Nucleoside analogs are a class of compounds that have been shown to exert antiviral activity both in vitro and in vivo, and thus have been the subject of extensive research in the treatment of viral infections. Nucleoside analogs can be converted by host or viral enzymes into their corresponding active moieties which in turn can inhibit the polymerase enzymes involved in viral or cellular proliferation. Activation occurs by a variety of mechanisms, such as the addition of one or more phosphate groups and/or in combination with other metabolic processes.

Disclosure of Invention

Some embodiments described herein relate to compounds of formula (I), or a pharmaceutically acceptable salt thereof. Other embodiments described herein relate to pharmaceutical compositions comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof.

Some embodiments described herein relate to methods of treating HBV and/or HDV infection, which may include administering to a subject identified as having such HBV and/or HDV infection an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for treating HBV and/or HDV infection. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for treating HBV and/or HDV infection.

Some embodiments disclosed herein relate to methods of treating HBV and/or HDV infection, which may include contacting a cell infected with HBV and/or HDV with an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HBV and/or HDV infection, which treatment can comprise contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein, for treating HBV and/or HDV infection, wherein the use comprises contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or pharmaceutical composition.

Some embodiments disclosed herein relate to methods of inhibiting replication of HBV and/or HDV, which can include contacting a cell infected with HBV and/or HDV with an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for inhibiting replication of HBV and/or HDV, which treatment can comprise contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof), for inhibiting replication of HBV and/or HDV, wherein the use comprises contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or pharmaceutical composition.

Some embodiments described herein relate to methods of treating an HIV infection, which may include administering to a subject identified as having the HIV infection an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I), or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HIV infection. Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for treating HIV infection.

Some embodiments disclosed herein relate to methods of treating HIV infection that can include contacting a cell infected with HIV with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HIV infection, which treatment can include contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein, for treating HIV infection, wherein the use comprises contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition.

Some embodiments disclosed herein relate to methods of inhibiting replication of HIV, which can include contacting a cell infected with HIV with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for inhibiting replication of HIV, which treatment may comprise contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I), or a pharmaceutically acceptable salt thereof), for inhibiting the replication of HIV, wherein the use comprises contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition.

Drawings

Figure 1 shows an exemplary non-nucleoside reverse transcriptase inhibitor (NNRTI).

Figure 2 shows exemplary Nucleoside Reverse Transcriptase Inhibitors (NRTIs).

Fig. 3A shows an exemplary HIV protease inhibitor. Figure 3B shows additional HIV, HBV and/or HDV protease inhibitors.

Figure 4A shows HIV fusion/entry inhibitors. Fig. 4B shows HBV and/or HDV fusion/entry inhibitors.

FIG. 5 shows HIV integrase chain transfer inhibitor (INSTI).

Figure 6A shows additional HIV antiviral compounds. Figure 6B shows additional antiviral compounds.

Figure 7 shows exemplary HIV, HBV, and/or HDV virus maturation inhibitors.

Figure 8 shows exemplary HIV, HBV, and/or HDV capsid assembly modulators.

Figure 9 shows exemplary anti-HBV and/or anti-HDV Farnesoid X Receptor (FXR) agonists.

Figure 10 shows exemplary anti-HBV and/or anti-HDV Tumor Necrosis Factor (TNF)/cyclophilin inhibitors.

Figure 11 shows exemplary anti-HBV and/or anti-HDV toll-like receptor (TLR) agonists.

Figure 12 shows exemplary HBV and/or HDV polymerase inhibitors.

Figure 13 shows an exemplary HBV and/or HDV vaccine.

Detailed Description

The hepadnavirus family is a family of enveloped viruses that use a partially double-stranded, partially single-stranded circulating DNA genome. This family includes a group of viruses that cause liver disease in various organisms and which divide between two genera: avihpadnaviruses affecting birds and Orthohepdnaviruses affecting mammals. Hepatitis b is a causative agent of acute/chronic hepatitis and has a 3.2kb circular DNA partially double-stranded, from which four proteins are synthesized: core, polymerase, surface antigen and X-gene product.

During hepatitis infection, HBV virions enter hepatocytes by receptor-mediated methods. Viral replication proceeds through a multi-step mechanism. First, the circular, partially double-stranded DNA genome is transcribed by the host cellular machinery, and then the full-length RNA transcript is packaged into the viral pre-capsid. The intrinsic protein priming activity of the P protein is then exploited to reverse transcribe the transcript within the capsid via the P protein. The RNA component is then degraded by the intrinsic RNase H activity of the P protein to produce full-length negative-strand circular DNA. Finally, subsequent portions of the plus-strand DNA are synthesized to produce the final viral genome assembly.

The viral capsid may also release the circular, partially double-stranded genome into the nucleus of the host cell, where synthesis of the single-stranded region by the complementary strand is completed, and the remaining viral ends are ligated to form covalently closed circular dna (cccdna), which persists in the host nucleus and may be transferred to daughter cells during cell division. The presence of cccDNA creates a risk of virus re-emergence during the entire life of the host organism. In addition, HBV carriers can transmit disease for many years. Immunosuppressed individuals are particularly at risk of establishing persistent (chronic) or latent HBV infection.

HDV is a subviral satellite of HBV and can therefore only be transmitted in the presence of HBV. See, e.g., Shieh et al, Nature, 329(6137), pp 343-346 (1987). Replication of the single-stranded circular RNA HDV genome produces two forms of RNA-binding proteins, which are referred to as long delta antigen (Ag) and small delta antigen (Ag). After entering the hepatocytes, the virus is uncoated and the nucleocapsid translocates to the nucleus. The virus then uses the RNA polymerase of the host cell, which due to its tertiary structure treats the RNA genome as dsDNA. Three forms of RNA are produced during replication: circular genomic RNA, circular complementary antigenomic RNA and linear polyadenylated antigenomic RNA.

HBV and HDV are transmitted mainly through the blood or mucosa, including through sexual activity. Infection by HBV and/or HDV leads to acute hepatitis (including fulminant liver failure) to chronic hepatitis, cirrhosis and hepatocellular carcinoma. Acute HBV and/or HDV infection can be asymptomatic, or there are symptomatic acute effects, including fever, headache, joint pain, and diarrhea, leading to more severe symptoms of hepatomegaly and/or jaundice associated with conjugated hyperbilirubinemia and cholestasis. Most adults infected with the virus recover, but 5% -10% fail to clear the virus and become chronically infected. Many chronically infected individuals suffer from persistent mild liver disease (latent HBV and/or HDV), manifested by lymphoaggregates and bile duct damage, steatosis and/or increased fibrosis that may lead to cirrhosis. Others with chronic HBV and/or HDV infection develop active disease, which can lead to life threatening conditions such as cirrhosis and liver cancer. Some subjects with latent HBV and/or HDV may relapse and develop acute hepatitis.

HIV is a lentivirus genus belonging to the retrovirus family. HIV is an enveloped virus whose nucleus consists of two copies of a positive single-stranded RNA. HIV relies on reverse transcriptase to reverse transcribe RNA into DNA, which integrates into the host genome as a provirus. HIV uses the viral glycoprotein 120(gp 120) to bind to and infect CD4+ T lymphocytes. An increase in viral plasma burden corresponds to a decrease in CD4+ T lymphocyte count. Normal CD4+ T lymphocyte levels are about 500 to 1,200 cells/mL. Two types of HIV, HIV-1 and HIV-2, have been characterized. HIV-1 is more toxic and more infectious, and has a global prevalence, whereas HIV-2 is less toxic and geographically limited.

Definition of

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications cited herein are incorporated by reference in their entirety unless otherwise indicated. In the event that there are multiple definitions for terms herein, the terms in this section prevail unless otherwise indicated.

As used herein, any "R" group, such as but not limited to R ¹、R²、R³、R⁴、R⁵、R⁶、R⁷、R⁸、R⁹、R¹⁰、R¹¹、R¹²、R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁷、R¹⁸、R¹⁹、R²⁰、R²¹、R²²And R²³Represents a substituent that may be attached to the indicated atom. The R group may be substituted or unsubstituted. If two "R" groups are described as "taken together," the R groups and the atoms to which they are attached can form a cycloalkyl, cycloalkenyl, aryl, heteroaryl, or heterocyclyl group. For example, but not limited to, if NR^aR^bR of the radical^aAnd R^bAre indicated as "taken together" it is meant that they are covalently bonded to each other to form a ring:

further, alternatively, if two "R" groups are described as being "taken together" with the atoms to which they are attached to form a ring, the R groups are not limited to the previously defined variables or substituents when the R groups are not taken together.

Whenever a group is described as "optionally substituted," the group may be unsubstituted or substituted with one or more of the indicated substituents. Likewise, when a group is described as "unsubstituted or substituted", if substituted, the substituent may be selected from one or more of the indicated substituents. If no substituent is indicated, it is meant that the indicated "optionally substituted" or "substituted" group may be substituted with one or more groups independently and independently selected from alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), heterocyclyl (alkyl), hydroxy, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-monocarboxyl, isocyanato, thiocyanato, isothiocyanato, nitro, silyl, sulfoxy, sulfinyl, sulfonyl, and the like, Haloalkyl, haloalkoxy, trihalomethanesulphonyl, trihalomethanesulphonamido, amino, mono-substituted amine and di-substituted amine groups. The number and type of atoms present in each group of this paragraph are as defined herein, unless otherwise specified.

As used herein, "C" is_aTo C_b"(wherein" a "and" b "are integers) refers to the number of carbon atoms in an alkyl, alkenyl, or alkynyl group, or in the ring of a cycloalkyl, cycloalkenyl, aryl, heteroaryl, or heterocyclyl group. That is, the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, or heterocyclyl rings can contain "a" through "b" (including "a" and "b") carbon atoms. Thus, for example, "C₁To C₄Alkyl "groups means all alkyl groups having 1 to 4 carbons, i.e. CH₃-、CH₃CH₂-、CH₃CH₂CH₂-、(CH₃)₂CH-、CH₃CH₂CH₂CH₂-、CH₃CH₂CH(CH₃) -and (CH)₃)₃C-. If "a" and "b" are not specified with respect to alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, or heterocyclyl groups, it is assumed that the broadest scope is described in these definitions.

As used herein, "alkyl" refers to a straight or branched hydrocarbon chain containing a fully saturated (no double or triple bonds) hydrocarbon group. An alkyl group can have 1 to 20 carbon atoms (where present, a numerical range such as "1 to 20" refers to each integer in the given range; e.g., "1 to 20 carbon atoms" means that the alkyl group can consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to 20 carbon atoms, although the definition of the invention also encompasses the term "alkyl" when no numerical range is specified). The alkyl group may also be a medium size alkyl group having 1 to 10 carbon atoms. The alkyl group may also be a lower alkyl having 1 to 6 carbon atoms. The alkyl group of the compound may be designated as "C ₁-C₄Alkyl "or the like. By way of example only, "C₁-C₄Alkyl "means that there are from one to four carbon atoms in the alkyl chain, i.e. the alkyl chain is selected from methyl, ethyl, propyl, isopropyl, n-butyl,Isobutyl, sec-butyl and tert-butyl. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, and hexyl. The alkyl group may be substituted or unsubstituted.

As used herein, "alkenyl" refers to an alkyl group that contains one or more double bonds in a straight or branched hydrocarbon chain. The alkenyl group may comprise 2 to 20 carbon atoms, 2 to 10 carbon atoms, or 2 to 6 carbon atoms. Examples of alkenyl groups include allenyl, vinylmethyl, and vinyl. Alkenyl groups may be substituted or unsubstituted.

As used herein, "alkynyl" refers to an alkyl group containing one or more triple bonds in a straight or branched hydrocarbon chain. The alkynyl group can contain 2 to 20 carbon atoms, 2 to 10 carbon atoms, or 2 to 6 carbon atoms. Examples of alkynyl groups include ethynyl and propynyl. Alkynyl groups may be unsubstituted or substituted.

As used herein, "cycloalkyl" refers to a fully saturated (no double or triple bonds) monocyclic or polycyclic hydrocarbon ring system. When a ring is composed of two or more rings, the rings may be fused together. Cycloalkyl groups may contain 3 to 10 atoms in the ring, 3 to 8 atoms in the ring, or 3 to 6 atoms in the ring. Cycloalkyl groups may be unsubstituted or substituted. Typical cycloalkyl groups include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

As used herein, "cycloalkenyl" refers to a monocyclic or polycyclic hydrocarbon ring system that contains one or more double bonds in at least one ring; but if more than one is present, the double bond will not form a fully delocalized pi-electron system in all rings (otherwise the group will be an "aryl", as defined herein). When a ring is composed of two or more rings, the rings may be linked together in a fused manner. Cycloalkenyl groups can contain 3 to 10 atoms in the ring, or 3 to 8 atoms in the ring. Cycloalkenyl groups can be unsubstituted or substituted.

As used herein, "aryl" refers to a carbocyclic ring (all carbons) having a fully delocalized pi-electron system in all rings) Monocyclic or polycyclic aromatic ring systems (including fused ring systems in which two carbocyclic rings share a chemical bond). The number of carbon atoms in the aryl group can vary. For example, the aryl group may be C₆-C₁₄Aryl radical, C₆-C₁₀Aryl radicals or C₆An aryl group. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, and azulene. The aryl group may be substituted or unsubstituted.

As used herein, "heteroaryl" refers to monocyclic, bicyclic, and tricyclic aromatic ring systems (ring systems having a fully delocalized pi-electron system) containing one or more heteroatoms (e.g., 1 to 5 heteroatoms), i.e., elements other than carbon, including, but not limited to, nitrogen, oxygen, and sulfur. The number of atoms in the ring of the heteroaryl group can vary. For example, a heteroaryl group may contain 4 to 14 atoms in the ring, 5 to 10 atoms in the ring, or 5 to 6 atoms in the ring. In addition, the term "heteroaryl" includes fused ring systems in which two rings (such as at least one aryl ring and at least one heteroaryl ring, or at least two heteroaryl rings) share at least one chemical bond. Examples of heteroaryl rings include, but are not limited to, furan, furazan, thiophene, benzothiophene, phthalazine, pyrrole, oxazole, benzoxazole, 1, 2, 3-oxadiazole, 1, 2, 4-oxadiazole, thiazole, 1, 2, 3-thiadiazole, 1, 2, 4-thiadiazole, benzothiazole, imidazole, benzimidazole, indole, indazole, pyrazole, benzopyrazole, isoxazole, benzisoxazole, isothiazole, triazole, benzotriazole, thiadiazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, quinoline, isoquinoline, quinazoline, quinoxaline, cinnoline, and triazine. Heteroaryl groups may be substituted or unsubstituted.

As used herein, "heterocyclyl" or "heteroalicyclic" refers to ternary, quaternary, pentavalent, hexavalent, heptavalent, octavalent, nonavalent, decavalent, up to 18-membered monocyclic, bicyclic and tricyclic ring systems in which carbon atoms, together with 1 to 5 heteroatoms, form the ring system. The heterocyclic ring may optionally contain one or more unsaturated bonds positioned in such a way that a fully delocalized pi-electron system does not occur in all rings. Heteroatoms are elements other than carbon, including but not limited to oxygen, sulfur, and nitrogen. The heterocyclic ring may also contain one or more carbonyl or thiocarbonyl functional groups so that this definition includes oxo-and thio-systems such as lactams, lactones, cyclic imides, cyclic thioimides and cyclic carbamates. When a ring is composed of two or more rings, the rings may be fused together. In addition, any nitrogen in the heteroalicyclic may be quaternized. The heterocyclyl or heteroalicyclic group may be unsubstituted or substituted. Examples of such "heterocyclyl" or "heteroalicyclic" groups include, but are not limited to, 1, 3-dioxine, 1, 3-dioxane, 1, 4-dioxane, 1, 2-dioxolane, 1, 3-dioxolane, 1, 4-dioxolane, 1, 3-oxathiane, 1, 4-oxathiadiene, 1, 3-oxathiane, 1, 3-dithiolene, 1, 3-dithiolane, 1, 4-oxathiane, tetrahydro-1, 4-thiazine, 2H-1, 2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-1, 3, 5-triazine, 2H-1, 2-oxazine, and the like, Imidazoline, imidazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, ethylene oxide, piperidine N-oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidinedione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiomorpholine sulfoxide, thiomorpholine sulfone, and benzo-fused analogs thereof (e.g., benzimidazolone, tetrahydroquinoline, and 3, 4-methylenedioxyphenyl).

As used herein, "aryl (alkyl)" refers to an aryl group linked as a substituent by an alkylidene group. The alkylidene group of an aryl (alkyl) group and the aryl group may be substituted or unsubstituted. Examples include, but are not limited to, benzyl, 2-phenyl (alkyl), 3-phenyl (alkyl), and naphthyl (alkyl).

As used herein, "heteroaryl (alkyl)" refers to a heteroaryl group that is linked as a substituent through an alkylidene group. The alkylidene group of heteroaryl (alkyl) and heteroaryl groups may be substituted or unsubstituted. Examples include, but are not limited to, 2-thienyl (alkyl), 3-thienyl (alkyl), furyl (alkyl), thienyl (alkyl), pyrrolyl (alkyl), pyridyl (alkyl), isoxazolyl (alkyl), imidazolyl (alkyl), and benzo-fused analogs thereof.

"(Heterocyclyl) alkyl" refers to a heterocyclic group attached as a substituent through an alkylidene group. The alkylidene group and heterocyclic group of the (heterocyclyl) alkyl group may be substituted or unsubstituted. Examples include, but are not limited to, tetrahydro-2H-pyran-4-yl (methyl), piperidin-4-yl (ethyl), piperidin-4-yl (propyl), tetrahydro-2H-thiopyran-4-yl (methyl), and 1, 3-thiazinan-4-yl (methyl).

An "alkylidene group" is a straight chain-CH having between one and ten carbon atoms, one to five carbon atoms, or one to three carbon atoms forming a bond to connect molecular fragments via their terminal carbon atoms ₂-a tethering group. Examples include, but are not limited to, methylene (-CH)₂-) ethylene (-CH₂CH₂-) propylene (-CH)₂CH₂CH₂-) and butylene (-CH)₂CH₂CH₂CH₂-) and pentylene (-CH)₂CH₂CH₂CH₂CH₂-). The alkylidene group may be substituted by: one or more of the hydrogens in the alkylidene group are replaced with a substituent listed as "optionally substituted" according to the definition.

As used herein, "alkoxy" refers to the formula-OR, wherein R is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aralkyl, heteroaryl (alkyl), OR heterocyclyl (alkyl) as defined herein. A non-limiting list of alkoxy groups includes methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, phenoxy, and benzoyloxy. Alkoxy groups may be substituted or unsubstituted.

As used herein, "acyl" refers to hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl (alkyl), aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl) as a substituent attached via a carbonyl group. Examples include formyl, acetyl, propionyl, benzoyl and acryloyl. The acyl group may be substituted or unsubstituted.

As used herein, "hydroxyalkyl" refers to an alkyl group in which one or more of the hydrogen or deuterium atoms is replaced with a hydroxyl group. Exemplary hydroxyalkyl groups include, but are not limited to, 2-hydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, and 2, 2-dihydroxyethyl. Hydroxyalkyl groups may be substituted or unsubstituted.

As used herein, "haloalkyl" refers to an alkyl group (e.g., monohaloalkyl, dihaloalkyl, and trihaloalkyl) in which one or more of the hydrogen atoms are replaced with a halogen. Such groups include, but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 1-chloro-2-fluoromethyl, and 2-fluoroisobutyl. Haloalkyl groups may be substituted or unsubstituted.

As used herein, "haloalkoxy" refers to an-O-alkyl group (e.g., monohaloalkoxy, dihaloalkoxy, and trihaloalkoxy) in which one or more of the hydrogen atoms are replaced with halogen. Such groups include, but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, 1-chloro-2-fluoromethoxy and 2-fluoroisobutoxy. Haloalkoxy groups may be substituted or unsubstituted.

"sulfenyl" group refers to an "-SR" group where R can be hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl). The sulfoxy group may be substituted or unsubstituted.

A "sulfinyl" group refers to an "-S (═ O) -R" group where R may be the same as defined for the sulfenylene group. The sulfinyl group may be substituted or unsubstituted.

A "sulfonyl" group refers to a "SO" group wherein R may be the same as defined for an oxysulfide group₂R' group. The sulfonyl group may be substituted or unsubstituted.

An "O-carboxy" group refers to an "RC (═ O) O" group where R can be hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl) as defined herein. The O-carboxyl group may be substituted or unsubstituted.

The terms "ester" and "C-carboxy" refer to a "-C (═ O) OR" group where R may be the same as defined for O-carboxy. The ester and C-carboxy groups may be substituted or unsubstituted.

A "thiocarbonyl" group refers to an "-C (═ S) R" group where R may be the same as defined for O-carboxyl. The thiocarbonyl group may be substituted or unsubstituted.

A "trihalomethylsulfonyl" group refers to an "X" wherein each X is halogen₃CSO₂- "group(s).

A "trihalomethanesulfonamido" group is one in which each X is halogen and R is_A"X" which is hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl) ₃CS(O)₂N(R_A) - "group(s).

As used herein, the term "amino" refers to-NH₂A group.

The term "hydroxy" as used herein refers to an-OH group.

A "cyano" group refers to a "-CN" group.

As used herein, the term "azido" refers to-N₃A group.

An "isocyanato" group refers to an "-NCO" group.

A "thiocyanato" group refers to an "-CNS" group.

An "isothiocyanato" group refers to an "-NCS" group.

"mercapto" groups refer to the "-SH" groups.

The "carbonyl" group refers to a C ═ O group.

"S-sulfonamido" group refers to where R is_AAnd R_B-SO that may be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)₂N(R_AR_B) "group". The S-sulfonamide group can be substituted or unsubstituted.

"N-sulfonamido" group refers to where R and R_A"RSO" which can be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)₂N(R_A) - "group(s). The N-sulfonamide group can be substituted or unsubstituted.

An "O-carbamoyl" group is intended to mean where R is _AAnd R_B-OC (═ O) N (R) that can be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)_AR_B) "group". The O-carbamoyl group may be substituted or unsubstituted.

"N-carbamoyl" group means where R and R_A"ROC (═ O) N (R) which may be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)_A) - "group(s). The N-carbamoyl group may be substituted or unsubstituted.

An "O-thiocarbamoyl" group is intended to mean where R is_AAnd R_B-OC (═ S) -N (R) that can be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)_AR_B) "group". The O-thiocarbamoyl group may be substituted or unsubstituted.

"N-thiocarbamoyl" group means where R and R_A"ROC (═ S) N (R) which may be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl) _A) - "group(s). The N-thiocarbamoyl group may be substituted or unsubstituted.

"C-amido" group means where R_AAnd R_BCan be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenylAryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)' -C (═ O) N (R)_AR_B) "group". The C-amido group may be substituted or unsubstituted.

"N-amido" group means where R and R_A"RC (═ O) N (R) which can be independently hydrogen, deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl)_A) - "group(s). The N-amido group may be substituted or unsubstituted.

A "monosubstituted amine" group is where R_A-NHR which may be alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl (alkyl), aryl (alkyl), heteroaryl (alkyl) or heterocyclyl (alkyl) as defined herein_A"group". R_AMay be substituted or unsubstituted. Examples of monosubstituted amine groups include, but are not limited to, -NH (methyl), -NH (ethyl), -NH (isopropyl), -NH (phenyl), -NH (benzyl), and the like.

A "disubstituted amine" group is where R is_AAnd R_BCan be independently an "-NR of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl (alkyl), aryl (alkyl), heteroaryl (alkyl), or heterocyclyl (alkyl) as defined herein_AR_B"group". R_AAnd R_BMay independently be substituted or unsubstituted. Examples of disubstituted amino groups include, but are not limited to, -N (methyl)₂N (phenyl) (methyl), -N (ethyl)₂-N (isopropyl)₂And the like.

As used herein, the term "halogen atom" or "halogen" refers to any of the radio-stable atoms in column 7 of the periodic table of elements, such as fluorine, chlorine, bromine, and iodine.

When the number of substituents (e.g., haloalkyl) is not specified, one or more substituents may be present. For example, "haloalkyl" may include one or more of the same or different halogens. As another example, "C₁-C₃Alkoxy phenyl"may include one or more of the same or different alkoxy groups containing one, two, or three atoms.

As used herein, unless otherwise indicated, the abbreviations for any chemical compound conform to their common usage, accepted forms of abbreviations, or the rules of biochemical nomenclature of the IUPAC-IUB committee, see biochem.11: 942-944(1972).

As used herein, the term "N-linked heterocyclic base" refers to an optionally substituted nitrogen-containing heterocyclic group or an optionally substituted nitrogen-containing heteroaryl group that may be linked via a ring nitrogen. The N-linked heterocyclic base may be monocyclic or polycyclic (such as bicyclic). When a ring is composed of two or more rings, these rings may be connected in a fused manner. In some embodiments, the N-linked heterocyclic base can be an optionally substituted N-linked purine base or an optionally substituted N-linked pyrimidine base. The term "purine base" is used herein in its ordinary sense as understood by those skilled in the art, and includes tautomers thereof. Similarly, the term "pyrimidine base" is used herein in its ordinary sense as understood by those skilled in the art, and includes tautomers thereof. A non-limiting list of optionally substituted purine bases includes purine, adenine, guanine, hypoxanthine, xanthine, isoleucine, 7-alkylguanine (e.g., 7-methylguanine), theobromine, caffeine, uric acid and isoguanine. Examples of pyrimidine bases include, but are not limited to, cytosine, thymine, uracil, 5, 6-dihydrouracil, and 5-alkylcytosine (e.g., 5-methylcytosine). Other non-limiting examples of heterocyclic bases include diaminopurine, 8-oxo-N ⁶Alkyl-adenine (e.g. 8-oxo-N)⁶-methyladenine), 7-deazaxanthine, 7-deazaguanine, 7-deazaadenine, N⁴，N⁴-acetylcytosine, N⁶，N⁶-acetyl-2, 6-diaminopurine, 5-halouracils (e.g., 5-fluorouracil and 5-bromouracil), pseudoisocytosine, isocytosine, isoguanine, and other heterocyclic bases described in U.S. Pat. nos. 5,432,272 and 7,125,855, which are incorporated herein by reference for the purpose of limiting disclosure to additional heterocyclic bases.

The term "C-linked heterocyclic base" as used herein refers to an optionally substituted nitrogen-containing heterocyclic group or an optionally substituted nitrogen-containing heteroaryl group that may be attached via a ring carbon. The C-linked heterocyclic base can be monocyclic or polycyclic (e.g., bicyclic). When a ring is composed of two or more rings, these rings may be connected in a fused manner. In some embodiments, the C-linked heterocyclic base may be an optionally substituted imidazo [2, 1-f ] [1, 2, 4] triazine base or an optionally substituted pyrazolo [1, 5-a ] [1, 3, 5] triazine base. In some embodiments, the N-linked heterocyclic base and/or the C-linked heterocyclic base may include an amino or an enol protecting group.

The term "-N-linked α -amino acid" refers to an α -amino acid linked to the indicated moiety through a backbone amino group or a monosubstituted amine group. The δ -N-linked α -amino acid may be linked via one of the hydrogens as part of the main chain amino group or the monosubstituted amine group, such that the-N-linked α -amino acid δ is linked via the nitrogen of the main chain amino group or the monosubstituted amine group. The N-linked α -amino acid can be substituted or unsubstituted.

The term "-N-linked α -amino acid ester derivative" refers to an α -amino acid in which the backbone carboxylic acid groups have been converted to ester groups. In some embodiments, the ester group has a formula selected from alkyl-O-C (═ O) -, cycloalkyl-O-C (═ O) -, aryl-O-C (═ O) -, and aryl (alkyl) -O-C (═ O) -. A non-limiting list of ester groups includes substituted and unsubstituted versions of the following groups: methyl-O-C (═ O) -, ethyl-O-C (═ O) -, n-propyl-O-C (═ O) -, isopropyl-O-C (═ O) -, n-butyl-O-C (═ O) -, isobutyl-O-C (═ O) -, tert-butyl-O-C (═ O) -, neopentyl-O-C (═ O) -, cyclopropyl-O-C (═ O) -, cyclobutyl-O-C (═ O) -, cyclopentyl-O-C (═ O) -, cyclohexyl-O-C (═ O) -, phenyl-O-C (═ O) -, benzyl-O-C (═ O) -and naphthyl-O-C (═ O) -. The N-linked alpha-amino acid ester derivative may be substituted or unsubstituted.

The term "-O-linked α -amino acid" refers to an α -amino acid linked to the indicated moiety through a hydroxyl group from its backbone carboxylic acid group. the-O-linked a-amino acid can be linked via hydrogen as part of a hydroxyl group from its backbone carboxylic acid group, such that the-O-linked a-amino acid is linked via oxygen or the backbone carboxylic acid group. The O-linked α -amino acid can be substituted or unsubstituted.

As used herein, the term "alpha-amino acid" refers to any amino acid (both standard and non-standard amino acids). Examples of suitable a-amino acids include, but are not limited to, alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. Additional examples of suitable alpha-amino acids include, but are not limited to, ornithine, carboxyputrescine lysine (hypusine), 2-aminoisobutyric acid, dehydroalanine, citrulline, and norleucine.

As used herein, the term "phosphate ester" is used in its ordinary sense as understood by those skilled in the art, and includes its protonated form (e.g.,). As used herein, the terms "monophosphate", "diphosphate", and "triphosphate" are used in their ordinary sense as understood by those skilled in the art and include protonated forms.

As used herein, the terms "protecting group" and "protecting groups" refer to any atom or group of atoms added to a molecule to protect existing groups in the molecule from undesired chemical reactions. Examples of protecting group moieties are described in "T.W.Greene and P.G.M.Wuts," Protective Groups in Organic Synthesis ", 3 rd edition, John Wiley & Sons, 1999" and "J.F.W.McOmie," Protective Groups in Organic Chemistry, Plenum Press, 1973 ", which are both incorporated herein by reference for the purpose of disclosing suitable protecting Groups for limiting purposes. The protecting group moieties may be selected in such a way that they are stable under certain reaction conditions and can be easily removed at a convenient stage using methods known in the art. A non-limiting list of protecting groups includes benzyl; a substituted benzyl group; alkylcarbonyl and alkoxycarbonyl (e.g., tert-Butoxycarbonyl (BOC), acetyl or isobutyryl); arylalkylcarbonyl and arylalkoxycarbonyl (e.g., benzyloxycarbonyl); substituted methyl ethers (e.g., methoxymethyl ether); substituted ethyl ether; substituted benzyl ethers; a tetrahydropyranyl ether; silyl groups (e.g., trimethylsilyl, triethylsilyl, triisopropylsilyl, tert-butyldimethylsilyl, triisopropylsilyloxymethyl, [2- (trimethylsilyl) ethoxy ] methyl or tert-butyldiphenylsilyl); esters (e.g., benzoates); carbonates (e.g., methoxymethyl carbonate); sulfonates (e.g., tosylate or mesylate); acyclic ketals (e.g., dimethyl acetal); cyclic ketals (e.g., 1, 3-dioxane, 1, 3-dioxolane, and those described herein); an acyclic acetal; cyclic acetals (e.g., those described herein); an acyclic hemiacetal; a cyclic hemiacetal; cyclic dithioketals (e.g., 1, 3-dithiane or 1, 3-dithiolane); orthoesters (e.g., those described herein) and triarylmethyl groups (e.g., trityl; monomethoxytrityl (MMTr); 4, 4 '-dimethoxytrityl (DMTr); 4, 4' -trimethoxytrityl (TMTr); and those described herein).

The term "pharmaceutically acceptable salt" refers to a salt of a compound that does not cause significant irritation to the organism to which it is administered and does not abrogate the biological activity and properties of the compound. In some embodiments, the salt is an acid addition salt of the compound. Pharmaceutical salts can be obtained by reacting the compounds with inorganic acids, such as hydrohalic acids (e.g., hydrochloric or hydrobromic acid), sulfuric acid, nitric acid, and phosphoric acid. Pharmaceutical salts may also be obtained by reacting a compound with an organic acid such as an aliphatic or aromatic carboxylic or sulphonic acid, for example formic acid, acetic acid, succinic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, nicotinic acid, methanesulphonic acid, ethanesulphonic acid, p-toluenesulphonic acid, salicylic acid or naphthalenesulphonic acid. Pharmaceutical salts can also be formed by reacting a compound with a base to form a salt (such as an ammonium salt, an alkali metal salt (e.g., sodium or potassium salt), an alkaline earth metal salt (e.g., calcium or magnesium salt), a salt of an organic base (e.g., dicyclohexylamine, N-methyl-D-glucamine, tris (hydroxymethyl) methylamine)、C₁-C₇Alkylamine, cyclohexylamine, triethanolamine, ethylenediamine), and salts with amino acids such as arginine and lysine.

The terms and phrases used in this application, and variations thereof, and particularly in the appended claims, should be construed to be open ended as opposed to limiting unless otherwise expressly stated. As examples of the foregoing, the term "comprising" should be understood as "including, but not limited to", etc.; as used herein, the term "comprising" is synonymous with "including", "containing", or "characterized by", and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps; the term "having" should be interpreted as "having at least"; the term "comprising" should be interpreted as "including but not limited to"; the term "exemplary" is used to provide exemplary instances of the items in discussion, rather than an exhaustive or limiting list thereof; the terms "preferably," "preferred," "required," or "desired," and words of similar import, should not be construed as implying that certain features are critical, essential, or even important to structure or function, but are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment. Furthermore, the term "comprising" should be interpreted as being synonymous with the phrase "having at least" or "including at least". The term "comprising", when used in the context of a process, means that the process includes at least the recited steps, but may include additional steps. The term "comprising" when used in the context of a compound, composition or device means that the compound, composition or device includes at least the recited features or components, but may also include additional features or components.

With respect to substantially any plural and/or singular terms used herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. Various singular/plural permutations may be expressly set forth herein for clarity. The indefinite article "a" or "an" does not exclude a plurality. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims shall not be construed as limiting the scope.

It is to be understood that in any compound described herein having one or more chiral centers, each center can independently have the R-configuration or the S-configuration or mixtures thereof if the absolute stereochemistry is not explicitly indicated. When the compounds described herein have at least one chiral center, they may accordingly exist as enantiomers. If the compounds have two or more chiral centers, they may additionally exist in diastereomeric forms. Thus, the compounds provided herein can be enantiomerically pure, enantiomerically enriched, racemic mixtures, diastereomerically pure, diastereomerically enriched, or stereoisomeric mixtures. Additionally, it is to be understood that in any compound described herein having one or more double bonds (which result in a geometric isomer that may be defined as E or Z), each double bond may independently be E or Z, a mixture thereof. It is to be understood that all such isomers and mixtures thereof are encompassed unless otherwise indicated.

Likewise, it is to be understood that in any compound described, all tautomeric forms are also included. For example, all tautomers of heterocyclic bases known in the art are included, including tautomers of natural and non-natural purine and pyrimidine bases.

It is understood that if a compound disclosed herein has unfilled valences, the valences are filled with hydrogen or isotopes thereof (e.g., hydrogen-1 (protium) and hydrogen-2 (deuterium)).

It is to be understood that the compounds described herein may be labeled with an isotope. In addition, substitution with isotopes such as deuterium can afford certain therapeutic advantages resulting from greater metabolic stability, such as for example increased in vivo half-life or reduced dosage requirements. Each chemical element represented in the structure of the compound may include any isotope of the element. For example, at any position of a compound where a hydrogen atom may be present, the hydrogen atom may be any isotope of hydrogen, including but not limited to hydrogen-1 (protium) and hydrogen-2 (deuterium). Thus, reference herein to a compound includes all potential isotopic forms unless the context clearly dictates otherwise.

It is to be understood that the compounds, methods, and combinations described herein include crystalline forms (also referred to as polymorphs, which include different crystal packing arrangements of the same elemental composition of the compound), amorphous phases, solvates, and hydrates. In some embodiments, the compounds described herein (including those described in the methods and combinations) are present in solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like. In other examples, the compounds described herein (including those described in the methods and combinations) are present in unsolvated forms. Solvates contain stoichiometric or non-stoichiometric amounts of solvent and may be formed during crystallization with a pharmaceutically acceptable solvent such as water, ethanol, and the like. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is alcohol. In general, the solvated forms are considered equivalent to unsolvated forms for the purposes of the compounds and methods provided herein.

Where a range of values is provided, it is understood that the upper and lower limits and each intervening value between the upper and lower limits of that range is encompassed within the embodiments.

Compound (I)

Some embodiments disclosed herein relate to a compound of formula (I), or a pharmaceutically acceptable salt thereof:

wherein: b is¹Can be an optionally substituted C-linked heterocyclic base or an optionally substituted N-linked heterocyclic base; r¹Can be selected from hydrogen, halogen, cyano, optionally substituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl and unsubstituted C_2-6Alkynyl, wherein when said C is_1-6When alkyl is substituted, said C_1-6The alkyl group may be substituted byOne less halogen substitution; r²Can be hydrogen or fluorine; r³Can be hydrogen or fluorine; r⁴Can be selected from hydrogen, halogen, hydroxy, cyano and optionally substituted C_1-4Alkyl, wherein when said C is_1-4When alkyl is substituted, said C_1-4Alkyl may be substituted by hydroxy or at least one halogen; r⁵Can be hydrogen or hydroxy; r⁶Can be selected from hydrogen, halogen, cyano, optionally substituted C1-4 alkyl, optionally substituted C_2-4Alkenyl and unsubstituted C_2-4Alkynyl, wherein when said C is_1-4Alkyl or said C_2-4When alkenyl is substituted, the C_1-4Alkyl and said C_2-4Alkenyl groups may be independently substituted with at least one halogen; r⁷May be selected from hydrogen, optionally substituted acyl, optionally substituted O-linked alpha-amino acids, R¹⁰And R¹¹May be independently selected from absent, hydrogen,Andor R¹⁰(may be)And R is¹¹May be absent or hydrogen; r¹²May be absent, is hydrogen, optionally substituted aryl or optionally substituted heteroaryl; r¹³May be an optionally substituted N-linked α -amino acid or an optionally substituted N-linked α -amino acid ester derivative; r¹⁴And R¹⁵May independently be an optionally substituted N-linked α -amino acid or an optionally substituted N-linked α -amino acid ester derivative; r¹⁶、R¹⁷、R¹⁹And R²⁰Can be independently selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl; r¹⁸And R²¹Can be independently selected from hydrogen, optionally substituted C_1-24Alkyl, optionally substituted arylsubstituted-O-C_1-24Alkyl, optionally substituted-O-aryl; r²²May be selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl; r²³、R²⁴And R²⁵May independently be absent or hydrogen; r⁸And R⁹Independently hydrogen or halogen; and m may be 0 or 1.

The orientation of the substituents attached to the cyclopentyl ring can vary. For example, the following formulae (Ia), (Ib), (Ic) and (Id) are each exemplary of embodiments of compounds of formula (I).

Or a pharmaceutically acceptable salt of any of the foregoing.

A variety of groups can be attached to the cyclopentyl ring. In some embodiments, R ⁶May be a halogen. For example, R⁶May be fluorine. In other embodiments, R⁶May be a cyano group. In other embodiments, R⁶And may be a substituted or unsubstituted, saturated or unsaturated hydrocarbon containing 1 to 4 carbons. In some embodiments, R⁶May be optionally substituted C_1-4Alkyl radical, wherein when C_1-4When alkyl is substituted, C_1-4The alkyl group may be substituted with at least one halogen. Suitable C_1-4Examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, and tert-butyl. In some embodiments, R⁶May be unsubstituted C_1-4Alkyl groups such as those described herein. In other embodiments, R⁶C which may be substituted_1-4Alkyl radical, wherein C_1-4The alkyl group may be substituted with at least one halogen. For example, R⁶May be C substituted by 1, 2 or 3 halogens such as fluorine or chlorine_1-4An alkyl group. When R is⁶When substituted by a halogen (e.g. F or Cl), R⁶Halogeno C which may be monosubstituted_1-4Alkyl radical. In some embodiments, R⁶C which may be fluorine substituted_1-4An alkyl group. In other embodiments, R⁶C which may be chloro-substituted_1-4An alkyl group. Halogen substituted C_1-4A non-limiting list of alkyl groups includes-CH₂F or-CH₂And (4) Cl. In some embodiments, R⁶The hydrocarbon(s) may contain double and/or triple bonds. For example, in some embodiments, R ⁶May be optionally substituted C_2-4Alkenyl, wherein when C_2-4When the alkenyl group is substituted, C_2-4The alkenyl group may be substituted with halogen. When substituted C_1-4The alkyl group being present in R⁶In the presence of, substituted C_2-4The alkenyl group may be substituted with 1, 2 or 3 halogens such as fluorine or chlorine. For example, in some embodiments, R⁶May be optionally substituted C_2-4An alkenyl group. In other embodiments, R⁶C which may be chloro-substituted_2-4An alkenyl group. In some embodiments, R⁶May be unsubstituted C_2-4An alkenyl group. Exemplary C_2-4Alkenyl groups include ethenyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl and 3-butenyl. In some embodiments, R⁶May be hydrogen.

The group attached to the 2' -position of the cyclopentyl ring can vary. In some embodiments, R²May be hydrogen. In other embodiments, R²May be fluorine. In some embodiments, R³May be hydrogen. In other embodiments, R³May be fluorine. In some embodiments, R²And R³May each be hydrogen. In other embodiments, when R²And R³When each is fluorine, the 2' -position may be disubstituted. In other embodiments, R²Can be hydrogen; and R is³May be fluorine. In other embodiments, R²May be fluorine; and R is³May be hydrogen.

The group attached to the 3' -position of the cyclopentyl ring can also vary. In some embodiments, R ⁴May be a halogen. Halogen can be F, Cl, Br or I. In some embodiments, R⁴May be F. In other embodiments, R⁴May be Cl. In some casesIn embodiments, R⁴May be a hydroxyl group (-OH). In other embodiments, R⁴May be cyano (-CN). In other embodiments, R⁴May be optionally substituted C_1-4Alkyl radical, wherein when C_1-4When alkyl is substituted, C_1-4The alkyl group may be substituted with hydroxyl or at least one halogen. In some embodiments, R⁴May be unsubstituted C_1-4Alkyl groups (such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl or tert-butyl). In other embodiments, R⁴C which may be substituted_1-4Alkyl radical, wherein C_1-4The alkyl group may be substituted with at least one halogen. For example, R⁴May be C substituted by 1, 2 or 3 halogens such as fluorine or chlorine_1-4An alkyl group. When R is⁴When substituted by a halogen (e.g. F or Cl), R⁴Halogeno C which may be monosubstituted_1-4An alkyl group. In some embodiments, R⁴C which may be fluorine substituted_1-4An alkyl group. In other embodiments, R⁴C which may be chloro-substituted_1-4An alkyl group. In various embodiments, fluorine substituted C_1-4Alkyl may be monosubstituted, fluoro-substituted C_1-4Alkyl radicals, such as CH₂F. In various other embodiments, chloro-substituted C _1-4Alkyl may be monosubstituted, chloro-substituted C_1-4Alkyl radicals, such as CH₂And (4) Cl. In some embodiments, R⁴May be C substituted by one or more hydroxy groups_1-4An alkyl group. As an example, R⁴May be monosubstituted by hydroxy. In various embodiments, R⁴Can be-CH₂And (5) OH. In some embodiments, R⁴May be C substituted with 1 or 2 hydroxy groups and 1 or 2 halogens (such as F or Cl)_1-4An alkyl group. In some embodiments, R⁴May be hydrogen. In various embodiments (including those of this paragraph), R⁵May be hydrogen. In other various embodiments (including those of this paragraph), R⁵May be a hydroxyl group.

R is as described herein⁸And R⁹And may independently be hydrogen or halogen. In some embodiments, R⁸And R⁹May each be hydrogen such that the substituent attached to the cyclopentyl ring is ═ CH₂. In other embodiments, R⁸And R⁹May each be halogen. When R is⁸And R⁹When each is halogen, the halogens may be the same or different. For example, R⁸And R⁹Can each be fluorine, or R⁸And R⁹One of which may be fluorine, and R⁸And R⁹The other of which may be chlorine. In other embodiments, R⁸And R⁹One of which can be hydrogen, and R⁸And R⁹Another of which may be a halogen. In various embodiments, when R ⁸And R⁹When one or both of them are halogen, the halogen may be fluorine. Examples of substituents attached to the halogen-containing cyclopentyl ring include, but are not limited to, the following: CF ═ CF₂、＝CCl₂CFH, CClH and CClF.

As in the other positions on the cyclopentyl ring, B¹The attached carbons may further be substituted or unsubstituted. In some embodiments, R¹May be hydrogen. In other embodiments, R¹May be a halogen. Suitable halogens are described herein. For example, R¹May be fluorine. In other embodiments, R¹Can be cyano; in other embodiments, R¹May be optionally substituted C_1-6Alkyl, wherein when said C is_1-6When alkyl is substituted, said C_1-6The alkyl group may be substituted with at least one halogen. In various embodiments described herein, when R is¹Is unsubstituted C_1-6When alkyl, R¹And may be methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl (branched or straight), or hexyl (branched or straight). In various embodiments, when R¹When substituted, C_1-6Alkyl groups may be substituted with one or more halogens, such as 1, 2, 3, 4, 5, or 6 halogens. Examples of suitable halogens are described herein. In some embodiments, R ¹C which may be monohalogenated_1-6An alkyl group. In other embodiments, R¹Can be allHalogenated C_1-6An alkyl group. R¹Exemplary of (A) halogenated C_1-6Alkyl includes-CH₂F、-CH₂Cl、-CHF₂、-CHCl₂、-CF₃、-CCl₃、-CH₂CH₂F、CH₂CF₃、-CH₂CHClF、-CHFCH₂F and-CHClCH₂F. In some embodiments, R¹May be unsubstituted C_2-6An alkenyl group. In other embodiments, R¹May be unsubstituted C_2-6Alkynyl. When R is¹Is unsaturated C_2-6When a hydrocarbon, in various embodiments, R¹Can be vinyl, ethynyl or-CH₂-CH＝CH₂。

The compound of formula (I) or a pharmaceutically acceptable salt thereof may be referred to as a cyclopentyl nucleoside analog. In some embodiments, R⁷May be hydrogen. When R is⁷When hydrogen, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be a cyclopentyl nucleoside.

In some embodiments, R⁷(may be)Wherein m can be 0 or 1; and R is¹⁰、R¹¹、R²³、R²⁴And R²⁵Independently, it may be absent or hydrogen. When R is⁷Is composed ofWherein m can be 0 or 1; r⁷(may be)And R is¹¹、R²³、R²⁴And R²⁵The compound of formula (I), or a pharmaceutically acceptable salt thereof, may be a cyclopentyl nucleotide monophosphate, diphosphate, and/or triphosphate, independently absent or hydrogen. Those skilled in the art understand that when R is⁷Is composed ofAnd R is¹⁰And R¹¹Independently absent or hydrogen, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be a monophosphate salt. It is also understood by those skilled in the art that when R is ⁷Is composed ofR¹⁰Is composed ofR¹¹、R²³、R²⁴And R²⁵May independently be absent or hydrogen; and m is 0 or 1, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be a diphosphate (m is 0) or a triphosphate (m is 1). When R is¹⁰、R¹¹、R²³、R²⁴And R²⁵In the absence of either, R is understood by those skilled in the art to be¹⁰、R¹¹、R²³、R²⁴And R²⁵Showing that the corresponding oxygen attached will have an associated negative charge. For example, when R is¹⁰And R¹¹In each case absent, R⁷(may be)As another example, when R⁷Is composed ofR¹⁰Is composed ofR¹¹、R²³、R²⁴And R²⁵Is absent; and m is 0 or 1, a compound of formula (I) or a pharmaceutically acceptable salt thereof, R⁷May have the following structure:(m is 0) and(m is 1).

A compound of formula (I) or a pharmaceutically acceptable salt thereofThe acceptable salt may include a prodrug group. The prodrug group may be present in an amount equivalent to R⁷At the location of (a). In some embodiments, R⁷May be an optionally substituted acyl group. In some embodiments, an acyl group can be unsubstituted. In other embodiments, the acyl group may be substituted. An exemplary structure of an optionally substituted acyl group may be-C (═ O) R²⁶Wherein R is²⁶May be optionally substituted C_1-12Alkyl, optionally substituted monocyclic C_3-8Cycloalkyl or optionally substituted phenyl. In some embodiments, R²⁶May be unsubstituted C_1-12An alkyl group. In other embodiments, R ²⁶Monocyclic C which may be unsubstituted_3-8A cycloalkyl group. In other embodiments, R²⁶May be unsubstituted phenyl. In some embodiments, R⁷May be-C (═ O) R²⁶Wherein R is²⁶May be unsubstituted C_1-6An alkyl group.

In some embodiments, R⁷Optionally substituted O-linked alpha-amino acids. Examples of O-linked alpha-amino acids include alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. In various embodiments, the O-linked α -amino acid can be unsubstituted. In various other embodiments, the O-linked α -amino acid may be substituted. In some embodiments, R⁷May be selected from the group consisting of unsubstituted O-linked alanine, unsubstituted O-linked valine, unsubstituted O-linked leucine and unsubstituted O-linked glycine. The alpha-amino acid may be a natural alpha-amino acid. Examples of suitable optionally substituted O-linked α -amino acids include the following:

in some implementationsIn the scheme, R ⁷(may be)Wherein R is¹⁰And R¹¹May be absent, hydrogen orR¹⁰And R¹¹Another one of them can beR¹⁶And R¹⁷Can be independently selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl; and R is¹⁸May be selected from hydrogen, optionally substituted C_1-24Alkyl, optionally substituted aryl, optionally substituted-O-C_1-24Alkyl, optionally substituted-O-aryl. In other embodiments, R⁷(may be)Wherein R is¹⁰And R¹¹Can each beIn various embodiments, when R¹⁰And R¹¹One or both of them areWhen R is¹⁶And R¹⁷May each be hydrogen; and R is¹⁸May be unsubstituted C_1-24An alkyl group. In other embodiments, R¹⁶And R¹⁷At least one of which may be optionally substituted C_1-24Alkyl or optionally substituted aryl. In some embodiments, R¹⁸May be optionally substituted C_1-24An alkyl group. In some embodiments, R¹⁸May be unsubstituted C_1-4An alkyl group. In other embodiments, R¹⁸May be an optionally substituted aryl group. In other embodiments, R¹⁸May be optionally substituted-O-C_1-24Alkyl, optionally substituted-O-arylsubstituted-O-heteroaryl or optionally substituted-O-monocyclic heterocyclyl. In some embodiments, R¹⁸Can be unsubstituted-O-C_1-4An alkyl group.

In some embodiments, R⁷(may be)Wherein R is¹⁰And R¹¹May be absent, hydrogen or R¹⁰And R¹¹Another one of them can beR¹⁹And R²⁰Can be independently selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl; and R is²¹May be selected from hydrogen, optionally substituted C_1-24Alkyl, optionally substituted aryl, optionally substituted-O-C_1-24Alkyl, optionally substituted-O-aryl. In other embodiments, R⁷(may be)Wherein R is¹⁰And R¹¹Can each beIn various embodiments, when R¹⁰And R¹¹One or both of them areWhen R is¹⁹And R²⁰May each be hydrogen; and R is²¹May be unsubstituted C_1-24An alkyl group. In various other embodiments, when R¹⁰And R¹¹One or both of them areWhen R is¹⁹And R²⁰May each be hydrogen; and R is²¹Can be taken beforesubstituted-O-C_1-24An alkyl group. In some embodiments, R¹⁹And R²⁰May be hydrogen. In other embodiments, R¹⁹And R²⁰At least one of which may be optionally substituted C_1-24Alkyl or optionally substituted aryl. In some embodiments, R²¹May be optionally substituted C_1-24An alkyl group. In some embodiments, R²¹May be unsubstituted C_1-4An alkyl group. In other embodiments, R²¹May be an optionally substituted aryl group. In other embodiments, R²¹May be optionally substituted-O-C_1-24Alkyl, optionally substituted-O-aryl, optionally substituted-O-heteroaryl or optionally substituted-O-monocyclic heterocyclyl. In some embodiments, R ²¹Can be unsubstituted-O-C_1-4An alkyl group. In some embodiments, R¹⁰And R¹¹One or both of which may be a Pivaloyloxymethyl (POM) group. In some embodiments, R¹⁰And R¹¹Each may be a Pivaloyloxymethyl (POM) group and form a bis (pivaloyloxymethyl) (bis (POM)) prodrug. In some embodiments, R¹⁰And R¹¹One or both of which may be isopropoxycarbonyloxymethyl (POC) groups. In some embodiments, R¹⁰And R¹¹Each may be an isopropoxycarbonyloxymethyl (POC) group and form a bis (isopropoxycarbonyloxymethyl) (bis (POC)) prodrug.

In some embodiments, R⁷(may be)Wherein R is¹⁰And R¹¹May be absent, hydrogen orR¹⁰And R¹¹Another one of them can beAnd R is²²May be selected from hydrogen, optionally substituted C_1-24Alkyl and optionally substituted aryl. In thatIn other embodiments, R⁷(may be)Wherein R is¹⁰And R¹¹Can each beIn various embodiments, R²²C which may be substituted_1-24An alkyl group. In various other embodiments, R²²May be unsubstituted C_1-24An alkyl group. In various other embodiments, R²²May be unsubstituted C_1-4An alkyl group. In some embodiments, R¹⁰And R¹¹May each be an S-acylthioethyl (SATE) group, and form a SATE ester prodrug. In some embodiments, R ⁱ⁰And R¹¹Can each be

In some embodiments, R⁷(may be)Wherein R is¹²May be absent, is hydrogen, optionally substituted aryl or optionally substituted heteroaryl; and R is¹³May be an optionally substituted N-linked α -amino acid or an optionally substituted N-linked α -amino acid ester derivative. In some embodiments, R¹²May be an optionally substituted phenyl group. In other embodiments, R¹²May be an optionally substituted naphthyl group. In other embodiments, R¹²May be unsubstituted phenyl. In other embodiments, R¹²May be unsubstituted naphthyl. In some embodiments, R¹²Optionally substituted heteroaryl groups may be present, such as optionally substituted monocyclic heteroaryl groups.

In some embodiments, R¹³Optionally substituted N-linked alpha-amino acids. In some embodiments, R¹³Optionally substituted N-linked alpha-amino acid ester derivatives. Various alpha-amino acids are known to the person skilled in the artAnd include alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. The ester derivative of the N-linked alpha-amino acid ester derivative may have one of the following structures: c _1-6alkyl-O-C (═ O) -, C_3-6cycloalkyl-O-C (═ O) -, phenyl-O-C (═ O) -, naphthyl-O-C (═ O) -, and benzyl-O-C (═ O) -. In some embodiments, the N-linked alpha-amino acid ester derivative can be a C of alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, or valine_1-6Alkyl radical, C_3-6Cycloalkyl, phenyl, naphthyl or benzyl esters. In some embodiments, R¹³Can be N-linked alanine, N-linked isopropyl alanine, N-linked cyclohexyl alanine or N-linked neopentyl alanine. In some embodiments, R¹²May be unsubstituted phenyl. And R is¹³C which may be N-linked alanine, N-linked glycine, N-valine, N-linked leucine or N-linked isoleucine_1-6alkyl-O-C (═ O) -, C_3-6cycloalkyl-O-C (═ O) -, phenyl-O-C (═ O) -, naphthyl-O-C (═ O) -or benzyl-O-C (═ O) -esters. In some embodiments, when R⁷Is composed ofWhen used, the compound of formula (I) or a pharmaceutically acceptable salt thereof can be a phosphoramidate prodrug, such as an aryl phosphoramidate prodrug.

In some embodiments, R⁷(may be)Wherein R is¹⁴And R¹⁵May independently be an optionally substituted N-linked alpha-amino acid ester derivative. In various embodimentsIn (b), the α -amino acid moiety of the optionally substituted N-linked α -amino acid ester derivative may be selected from the group consisting of alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. As described herein, the ester moiety of an alpha-amino acid ester derivative can have a variety of structures. In some embodiments, the ester derivative of the N-linked α -amino acid ester derivative may have one of the following structures: c_1-6alkyl-O-C (═ O) -, C_3-6cycloalkyl-O-C (═ O) -, phenyl-O-C (═ O) -, naphthyl-O-C (═ O) -, and benzyl-O-C (═ O) -. In some embodiments, R¹⁴And R¹⁵Can be independently selected from N-linked alanine, N-linked isopropyl alanine, N-linked cyclohexyl alanine, or N-linked neopentyl alanine. In some embodiments, R¹⁴And R¹⁵C which may each independently be N-linked alanine, N-linked glycine, N-valine, N-linked leucine or N-linked isoleucine _1-6alkyl-O-C (═ O) -, C_3-6cycloalkyl-O-C (═ O) -, phenyl-O-C (═ O) -, naphthyl-O-C (═ O) -or benzyl-O-C (═ O) -esters. In some embodiments, R¹⁴And R¹⁵May be the same. In other embodiments, R¹⁴And R¹⁵May be different. In some embodiments, when R⁷(may be)When the compound of formula (I) or a pharmaceutically acceptable salt thereof, may be an optionally substituted phosphonic acid diamide prodrug.

May be present in R¹³、R¹⁴And/or R¹⁵Examples of suitable N-linked α -amino acid ester derivative groups include the following:

a heterocyclic base B present on a compound of formula (I) or a pharmaceutically acceptable salt thereof¹Can be attached through nitrogen (optionally substituted N-linked heterocyclic base) or carbon (optionally substituted C-linked heterocyclic base). In some embodiments, B¹May be an optionally substituted N-linked heterocyclic base. In some embodiments, B¹May be an optionally substituted C-linked heterocyclic base.

When B is present¹When being an optionally substituted N-linked heterocyclic base, B¹In various embodiments may be an optionally substituted purine. In other various embodiments, B¹Optionally substituted pyrimidines. In some embodiments, B¹May be substituted guanine, substituted adenine, substituted thymine, substituted cytosine or substituted uracil. In other embodiments, B ¹Can be unsubstituted guanine, unsubstituted adenine, unsubstituted thymine, unsubstituted cytosine or unsubstituted uracil.

In some embodiments, B¹Can be selected from:

wherein: r^A2Can be selected from hydrogen, halogen and NHR^J2Wherein R is^J2May be selected from hydrogen, -C (═ O) R^K2and-C (═ O) OR^L2；R^B2Can be halogen or NHR^w2Wherein R is^W2May be selected from hydrogen, optionally substituted C_1-6Alkyl, optionally substituted C_2-6Alkenyl, optionally substituted C_3-8Cycloalkyl, -C (═ O) R^M2and-C (═ O) OR^N2；R^C2Can be hydrogen or NHR^O2Wherein R is^O2May be selected from hydrogen, -C (═ O) R^P2and-C (═ O) OR^Q2；R^D2Can be selected from hydrogen, deuterium, halogen, optionally substituted C_1-6Alkyl, optionally substituted C_2-6Alkenyl and optionally substitutedC_2-6An alkynyl group; r^E2Can be selected from hydrogen, hydroxy, optionally substituted C_1-6Alkyl, optionally substituted C_3-8Cycloalkyl, -C (═ O) R^R2and-C (═ O) OR^S2；R^F2Can be selected from hydrogen, halogen, optionally substituted C_1-6Alkyl, optionally substituted C_2-6Alkenyl and optionally substituted C_2-6An alkynyl group; y is¹、Y²And Y⁴May independently be N (nitrogen) or C (carbon), with the proviso that Y¹、Y²And Y⁴At least one of which is N; y is³Can be N (nitrogen) or CR^I2Wherein R is^I2Can be selected from hydrogen, halogen, unsubstituted C_1-6Alkyl, unsubstituted C_2-6-alkenyl and unsubstituted C_2-6-an alkynyl group; y is⁵And Y⁶May independently be N (nitrogen) or CH; each one of which is May independently be a single bond or a double bond, provided that the single and double bonds are located in the ring such that each ring is aromatic; r^G2May be optionally substituted C_1-6An alkyl group; r^H2Can be hydrogen or NHR^T2Wherein R is^T2May be independently selected from hydrogen, -C (═ O) R^U2and-C (═ O) OR^V2(ii) a And R is^K2、R^L2、R^M2、R^N2、R^P2、R^Q2 R^R2、R^S2、R^U2And R^V2Can be independently selected from unsubstituted C_1-6Alkyl, unsubstituted C_2-6Alkenyl, unsubstituted C_2-6Alkynyl, optionally substituted C_3-6Cycloalkyl, optionally substituted C_3-6Cycloalkenyl, optionally substituted C_6-10Aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted aryl (C)_1-6Alkyl), optionally substituted heteroaryl (C)_1-6Alkyl) and optionally substituted heterocyclic group (C)_1-6Alkyl groups).

Suitable B¹Examples of groups include the following:

wherein R is^A2、R^B2、R^C2、R^D2、R^E2、R^F2、R^G2、R^H2、Y¹、Y²、Y³And Y⁵Provided herein. In some embodiments, B¹(may be)In other embodiments, B¹(may be)In other embodiments, B¹(may be)In other embodiments, B¹(may be)In some embodiments, B¹(may be)In other embodiments, B¹(may be)In other embodiments, B¹(may be)In other embodiments, B¹(may be)In some embodiments, B¹(may be)In other embodiments, B¹(may be)In other embodiments, B¹(may be)When B is present¹Is composed ofIn various embodiments, R^G2Can be unsubstituted ethyl, and R ^H2May be NH₂。

When B is present¹In the case of an optionally substituted C-linked heterocyclic base, in various embodiments, B¹Can have a structureIn some embodiments, B¹Can be selected from For example, B¹(may be)

In some embodiments, the compound of formula (I), or a pharmaceutically acceptable salt thereof, may have a structure selected from:

or a pharmaceutically acceptable salt of any of the foregoing. In some embodiments of this paragraph, B¹May be an optionally substituted N-linked heterocyclic base. In some embodiments of this paragraph, B¹May be an optionally substituted C-linked heterocyclic base. In some embodiments of this paragraph, B¹May be an optionally substituted purine base. In other embodiments of this paragraph, B¹May be an optionally substituted pyrimidine base. In some embodiments of this paragraph, B¹May be guanine. In other embodiments of this paragraph, B¹Can be thymine. In other embodiments of this paragraph, B¹Can be cytosine. In other embodiments of this paragraph, B¹May be uracil. In some embodiments of this paragraph, B¹May be adenine. In some embodiments of this paragraph, R⁷May be hydrogen. In other embodiments of this paragraph, R7 can be an optionally substituted acyl group. In other embodiments of this paragraph, R ⁷And may be a monophosphate, diphosphate or triphosphate. In other embodiments of this paragraph, R⁷Can be a phosphoramidate prodrug, such as an aryl phosphoramidate prodrug. In some embodiments of this paragraph, R⁷Can be acyloxyalkyl phosphate prodrugs. In other embodiments of this paragraph, R⁷May be an S-acylthioethyl (SATE) prodrug. In other embodiments, R⁷Can be a phosphonic acid diamide prodrug. In some embodiments of this paragraph, R⁷May be an optionally substituted O-linked alpha-amino acid, such as one of those described herein. In some embodiments of this paragraph, R⁶Can be selected from halogen, cyano, optionally substituted C_1-4Alkyl, optionally substituted C_2-4Alkenyl and unsubstituted C_2-4Alkynyl, wherein when C_1-4Alkyl or C_2-4When the alkenyl group is substituted, C_1-4Alkyl and C_2-4Alkenyl is independently substituted with at least one halogen; in some embodiments of this paragraph, R⁶Can be selected from fluorine, cyano, unsubstituted C_1-4Alkyl, - (CH)₂)_1-4F) (such as-CH)₂F)、-(CH₂)_1-4Cl (such as-CH)₂Cl), unsubstituted C_2-4Alkenyl and unsubstitutedSubstituted C_2-4Alkynyl.

Examples of suitable compounds of formula (I) or pharmaceutically acceptable salts thereof include, but are not limited to, the following:

Or a pharmaceutically acceptable salt of any of the foregoing.

Additional examples of suitable compounds of formula (I) include, but are not limited to, the following:

or a pharmaceutically acceptable salt of any of the foregoing.

Even further examples of suitable compounds of formula (I) include, but are not limited to, the following:

or a pharmaceutically acceptable salt of any of the foregoing.

In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof is not a compound of (I) or a pharmaceutically acceptable salt thereof, wherein when R is¹Is hydrogen; r²Is hydrogen or fluorine; r³Is hydrogen or fluorine; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen or fluorine; r⁸And R⁹Each is hydrogen, and B¹Selected from: when the current is over; then R is⁷Is not selected from: (a) hydrogen; (b)wherein R is¹⁰And R¹¹Each is hydrogen or each is absent; (c)wherein R is¹⁰Is composed ofR¹¹、R²³、R²⁴Or R²⁵Independently is absent or is hydrogen, and m is 0 or 1; and (d)Wherein R is¹²Is unsubstituted phenyl or unsubstituted naphthyl, and R¹³Is isopropyl alanine, isobutyl alanine or neopentyl alanine. In some embodiments, a compound of formula (I) or a pharmaceutical thereof(iii) A compound whose pharmaceutically acceptable salt is not (ii) or a pharmaceutically acceptable salt thereof, when R ¹Is hydrogen; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen; r⁸And R⁹Each is hydrogen; b is¹Selected from: when the current is over; r⁷Selected from: (a)wherein R is¹⁰Is composed ofR¹¹、R²³、R²⁴Or R²⁵Independently is absent or is hydrogen, and m is 1; and (b)Wherein R is¹²Is unsubstituted phenyl, and R¹³Is isopropyl alaninate, then (a) when R is³When it is fluorine, R²Is not hydrogen; and (b) when R is³When it is hydrogen, R²Is not fluorine. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof is not a compound of (iii) or a pharmaceutically acceptable salt thereof, when R¹Is hydrogen; r⁴Is a hydroxyl group; r⁵Is hydrogen; r⁶Is hydrogen; r⁷Is hydrogen, and R⁸And R⁹Each is hydrogen; then B is¹Is not selected from: in some embodiments, B¹Is not uridine. In some embodiments, B¹Is not cytosine. In some embodiments, B¹Is not thymine. In some embodiments, B¹Other than guanine in some embodiments, B¹Is not adenine. In some embodiments, B¹Not substituted uridine. In some embodiments, R⁸And R⁹And not each hydrogen. In some embodiments, R⁷Is not thatWherein R is¹²Is a substituted or unsubstituted phenyl group or a substituted or unsubstituted naphthyl group. In some embodiments, R ⁷Is not thatWherein R is¹²Is unsubstituted phenyl or unsubstituted naphthyl; and R is¹³Is N-linked alanine or an ester derivative of N-linked alanine (such as isopropyl N-linked alanine, isobutyl N-linked alanine and neopentyl N-linked alanine). In some embodiments, R⁷Is hydrogen. In some embodiments, R²Is not hydrogen. In some embodiments, R²Is not fluorine. In some embodiments, R³Is not hydrogen. In some embodiments, R³Is not fluorine. In some embodiments, when R³When it is fluorine, R²Is not hydrogen. In some embodiments, when R³When it is hydrogen, R²Is not fluorine. In some embodiments, R²And R³Not each being fluorine. In some embodiments, R⁶Is not hydrogen. In some embodiments, R⁶Not halogen (e.g., fluorine). In some embodiments, R⁵Is not a hydroxyl group. In some embodiments, the compound of formula (I), or a pharmaceutically acceptable salt thereof, is not a compound, or a pharmaceutically acceptable salt thereof, provided in: WO 2017/040895(2017 year 3)Published 9 months), WO 2017040892 (published 3, 9 days in 2017), WO 2016/182936 (published 17 days in 2016, 11 months in 2016), WO 2016/182935 (published 17 days in 2016, 11 months in 2016), WO 2016/134056 (published 25 days in 2016, 8 months in 2016), WO 2016/134054 (published 25 days in 2016, 8 months in 2016), WO 2017/165489 (published 28 days in 9 months in 2017), WO 2015/077360 (published 28 days in 5 months in 2015), US publication No. 2016/0280729 (published 29 days in 9 months in 2016), WO 2012/094248 (published 12 days in 7 months in 2012), US patent No. 9,156,874 (published 15 days in 8 months in 2012), WO 2012/094248 (published 12 days in 7 months in 2012), US patent No. 9,095,599 (published 4 days in 2015, 8 months in 2015), US publication No. US 2014/0038916 (published 6 days in 2014 in 2 months in 2014), WO 2010/091386 (published 12 days in 2010 in 8 months in 12 days in 2012), U.S. patent No. 8,609,627 (published on 12/17/2013), U.S. patent No. 9,173,893 (published on 11/3/2015), WO 2010/036407 (published on 4/1/2010), WO 2010/030858 (published on 3/18/2010), U.S. patent No. 8,163,707 (published on 24/4/2012), WO 2008/089105 (published on 24/2008), U.S. patent No. 8,440,813 (published on 14/5/2013), WO 2003/072757 (published on 4/9/2003), U.S. patent No. 7,285,658 (published on 23/2007), U.S. patent No. 7,598,230 (published on 6/10/2009), and/or U.S. patent No. 7,807,653 (published on 5/2010).

Exemplary compounds useful in the methods provided herein will now be described with reference to illustrative synthetic schemes for their general preparation and the specific examples that follow. One of ordinary skill in the art will recognize that to obtain the various compounds herein, the starting materials can be appropriately selected such that, with or without protection as desired, the ultimately desired substituents will be carried throughout the reaction scheme to yield the desired product. Alternatively, it may be necessary or desirable to replace the ultimately desired substituent with a suitable group that can undergo the entire reaction scheme and be replaced, where appropriate, with the desired substituent. Unless otherwise indicated, the variables are as defined above for formula (I). The reaction may be carried out between the melting point of the solvent and the reflux temperature, and is preferably carried out between 0 ℃ and the reflux temperature of the solvent. Conventional heating or microwave heating may be employed to heat the reaction. The reaction can also be carried out in a closed pressure vessel at a temperature above the normal reflux temperature of the solvent.

Exemplary compounds useful in the methods provided herein will now be described with reference to illustrative synthetic schemes for their general preparation and the specific examples that follow.

Scheme 1

According to scheme 1, the chiral cyclopentanol compound of formula (IV) is prepared by the commercially available or synthetically obtainable formula (III) (wherein R is^aTrityl (triphenylmethyl)) to a symmetrical reduction of the cyclopentenone compound. For example, catalytic chiral catalysts such as methyl-CBS catalysts and borohydride reducing agents such as borane dimethyl sulfide (BMS: BH)₃.Me₂S) produces (S) -2- ((trityloxy) methyl) cyclopent-2-en-1-ol. Benzyl protection of the compound of formula (IV) using benzyl bromide or chloride and a suitable alkali metal hydride base such as NaH, KH or LiH (preferably NaH) in a suitable solvent such as tetrabutylammonium iodide (TBAI) at a temperature in the range of 0 ℃ to room temperature gives the benzyl protected alcohol. Deprotection of the trityl protecting group using trifluoroacetic acid and triethylsilane followed by subsequent Bn protection affords formula (V) (wherein R is^bIs Bn).

Scheme 2

According to scheme 2, formula (V) (wherein R^bOxidation of the carbon-carbon double bond of the compound of Bn) is carried out with an oxidizing agent which provides selective hydroxylation of the carbon-carbon double bond to give the 1, 2-diol compounds of formulae (VIa) and (VIb). Preferably, at ambient temperature, in a solvent mixture such as THF/water The dihydroxylation is achieved using osmium tetroxide as a catalyst and an oxidizing agent such as NMO (N-methylmorpholine-N-oxide). In a suitable solvent such as THF and the like, for example, [ chloro (diphenyl) methyl group is used]Benzene (triphenylmethyl chloride, trityl chloride or (TrCl)), catalyst such as AgNO₃Tertiary organic bases such as pyridine, collidine and the like, according to procedures known to those skilled in the art to achieve trityl protection of alcohol mixtures of compounds of formula (VIa and VIb). Subsequent fluorination by treatment with a fluorinating agent such as DAST in a suitable solvent such as DCM or the like gives formula (VII) (wherein R is^bIs Bn, and R^aA compound which is Trt).

Scheme 3

According to scheme 3, using methods known to those skilled in the art, for formula (VII) (wherein R is^bIs Bn, and R^aTrt) to give a compound of formula (VIII) (wherein R is^cTBS). For example, deprotection of Trt is achieved using trifluoroacetic acid/triethylsilane; TBS protection of the corresponding alcohol was achieved using TBS-Cl/imidazole; realizing the deprotection of Bn under hydrogenolysis conditions; and finally, TBS protection is realized. (VIII) (wherein R is a hydrogen peroxide) with a suitable oxidizing agent such as Dess-Martin periodinane ^cTBS) of an alcohol compound. In a preferred embodiment, the compound of formula (VIII) is treated with Dess-Martin periodinane in a suitable solvent such as dichloromethane and the like at a temperature in the range of about 0 ℃ to about 25 ℃ for a period of about 0.5 hours to 4 hours to provide the compound of formula (IX). The olefin compound of formula (X) is prepared from the compound of formula (IX) using an olefination reagent such as Tebbe reagent or Wittig type reagent such as methyltriphenylphosphonium bromide with a base such as potassium tert-butoxide, potassium tert-amylate, etc. in an organic solvent such as THF, toluene, etc. In a preferred process, the solvent is toluene and the base is potassium tert-amylate.

Scheme 4

According to scheme 4, the compound of formula (IX) (wherein R^cTBS) is reacted as described before in a Wittig type olefination reaction to give the olefinic compound of formula (X). The hydroxylation of the compound of formula (X) is preferably carried out in a suitable solvent with selenium dioxide as oxidant. The reaction is carried out in a suitable solvent such as dichloromethane, chloroform or pyridine or mixtures thereof, in the presence or absence of a hydroperoxide (e.g. hydrogen peroxide) or an alkyl hydroperoxide (e.g. tert-butyl hydroperoxide (TBHP)) at a temperature in the range of about 0 ℃ to 25 ℃ for a period of 2 hours to 24 hours to give compounds of formula (XIa) and (XIb). The compound of formula (XIa) is converted to the compound of formula (XIb) by first protecting the hydroxyl moiety with a p-nitrobenzoic acid (PNBA) protecting group, followed by deprotection with ammonia/MeOH.

In a similar manner, (2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopent-1-one was reacted in a Wittig type olefination reaction as previously described to give (((((1R, 2S) -2- (benzyloxy) -1-fluoro-5-methylenecyclopentyl) methoxy) methyl) benzene. Subsequent hydroxylation using the foregoing conditions affords (3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol.

Scheme 5

According to scheme 5, commercially available or synthetically obtainable formula (XII) (wherein R is^dA compound which is a protecting group such as pivaloyl (Piv), TIPS (triisopropylsilyl), etc.). For example, reduction of a compound of formula (XII) with a reducing agent such as diisobutylaluminum hydride (DIBAL-H) in a suitable solvent such as THF and the like at a temperature of about-70 deg.C affords a compound of formula (XIII) (wherein R is^dIs Piv or TIPS (triisopropylsilyl)). The diol compound of formula (XIV) is prepared by reacting a lactol compound of formula (XIII) with ethynylmagnesium bromide in a suitable solvent such as THF at a temperature in the range of-70 ℃ to 30 ℃. Protecting the propargylic alcohol compound of formula (XIV) by reaction with ethyl chloroformate, a base such as pyridine, and the like, in a suitable solvent such as DCM at a temperature of about 0 deg.C to afford formula (XV) (wherein R is ^eIs CO₂Et).

The propargylic alcohol compound of formula (XIV) is protected by a variety of suitable reagents, including tert-butyl-chloro-dimethyl-silane, in the presence of a base such as imidazole in a suitable organic solvent such as DMF, DCM, and the like, to give a propargylic alcohol compound of formula (XV) (wherein R is^eTBS).

In a similar manner, 2, 3-O-isopropylidene- β -D-ribofuranose was reacted with ethynylmagnesium bromide as previously described to give 1- ((4S, 5R) -5- ((R) -1-hydroxy-2- ((4-methoxyphenyl) diphenylmethoxy) ethyl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) propan-2-yn-1-ol. TBS protection was performed as previously described to give (1R) -1- ((4R, 5R) -5- (1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-ol.

Scheme 6

According to scheme 6, formula (XVI) (wherein R is formula (XVI)) is achieved by reacting a compound of formula (XVI) with 1, 1' -Thiocarbonylimidazole (TCDI) in a suitable solvent such as DCM and the like^dIs TIPS) to the thiocarbonylimidazide derivative compound of formula (XVII) to give the thiocarbonylimidazide compound of formula (XVII). Subsequent Barton radical deoxygenation affords the compound of formula (XVIII). For example, a compound of formula (XVII) is reacted with a free radical initiator such as azobisisobutyric acid in a suitable solvent such as toluene and the like at a temperature in the range of 30 ℃ to 110 ℃ Nitrile (AIBN), etc., tri-n-butyltin hydride to give the desired compound of formula (XVIII). Deprotection of the compound of formula (XVIII) using conditions known to those skilled in the art gives compounds of formula (XIXa) and (XIXb).

Scheme 7

According to scheme 7, the oxidation of formula (XV) (wherein R is as defined above) is carried out using Dess-Martin periodinane conditions as described previously^dIs pivaloyl (Piv), and R^cTBS). Subsequent olefination of the α -hydroxyketone compound using conditions as previously described affords the compound of formula (XX). For example, reaction with bromomethyltriphenylphosphine, a base such as n-BuLi, in a suitable solvent such as THF affords compounds of formula (XX). Epoxidation of the terminal olefin of the compound of formula (XX) with a reagent such as m-CPBA or the like in a suitable solvent such as DCM at a temperature in the range of 0 ℃ to 45 ℃ to give the compound of formula (XXI).

In a similar manner, (1R) -1- ((4R, 5R) -5- (1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-ol was oxidized using Dess-Martin periodinane conditions as described previously to give 1- ((4S, 5R) -5- ((S) -1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-ol -1-ketone. Olefination of 1- ((4S, 5R) -5- ((S) -1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-one under the conditions as described previously gave tert-butyl (((S) -1- ((4R, 5R) -5- (3- ((4-methoxyphenyl) diphenylmethoxy) prop-1-en-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane. Tert-butyl (((S) -1- ((4R, 5R) -5- (3- ((4-methoxyphenyl) diphenylmethoxy) prop-1-en-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane is epoxidized under the conditions as described above to give tert-butyl (((1S) -1- ((4R, 5S) -5- (2- (((4-methoxyphenyl) diphenylmethoxy) methyl) oxiran-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane.

Scheme 8

According to scheme 8, titanocene dichloride (Cp) is used in the presence of Mn/2, 4, 6-collidine HCl or Zn/2, 4, 6-collidine/trimethylsilyl chloride₂TiCl₂) As catalyst, a compound of the formula (XXI) (wherein R is^dIs Piv, and R^cTBS) to give compounds of formulae (XXIIa) and (XXIIb). In the presence of pyridine, lutidine or 2, 4, 6-collidine (collidine), AgNO in a suitable solvent such as DCM or the like₃In the case of (a), DMTr protection is achieved by reaction with 4, 4' -dimethoxytrityl chloride (DMTrCl). Deprotection of the TBS protecting group using conditions known to those skilled in the art provides compounds of formula (XIIIa) and (XIIIb) (where R is^dIs Piv, and R^fDMTr).

In a similar manner tert-butyl (((1S) -1- ((4R, 5S) -5- (2- (((4-methoxyphenyl) diphenylmethoxy) methyl) oxiran-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane is subjected to catalytic free-radical cyclisation as described before to give ((3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ] [1, 3] dioxol-4-yl) methanol.

Scheme 9

According to scheme 9, oxidation of formula (XXIV) (wherein R is^gIs MMTr (monomethoxytrityl), and R^cTBS) to give an aldehyde intermediate. Subsequent oxime formation using conditions known to those skilled in the art affords compounds of formula (XXV). For example, the aldehyde intermediate is reacted with hydroxylamine hydrochloride in a solvent such as pyridine to give an aldoxime compound of formula (XXV). The oxime compound of formula (XXV) is dehydrated using a conventional oxime dehydration method. For example, an oxime compound of formula (XXV) is reacted with 1, 1' -Carbonyldiimidazole (CDI) at a temperature in the range of 0 ℃ to 30 ℃ in a suitable solvent such as ACN or the like to give a nitrile compound of formula (XXVI) (wherein Rg is MMTr (monomethoxytrityl) and Rc is TBS).

In a similar manner, 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione is oxidized using the conditions as described before to give (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane- 1-formaldehyde. The oxime is formed using the conditions as previously described to give (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde oxime. Dehydration of the oxime affords (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile.

Scheme 10

According to scheme 10, a person skilled in the art is employedUnder conditions known to the person or as described hereinbefore, the compound of formula (XXVI) (in which R is^gIs MMTr (monomethoxytrityl) and R^cTBS) to form a cyclic acetal compound of the formula (XXVII) (wherein R is^hA cyclic silyl ether compound represented by Bz (benzoyl)). The compound of formula (XXVIII) is formed in two steps from the compound of formula (XXVII). In the first step, a thiocarbonylimidazole is formed using the conditions described previously, followed by a second radical deoxygenation using the conditions described previously to give a compound of formula (XXVIII) (wherein R is^hA Bz (benzoyl)) compound. Deprotection of the benzoyl protecting group using conditions known to those skilled in the art gives (6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f][1，3，5，2，4]Trioxasidioxin-6 a (6H) -carbonitrile.

Scheme 11

Commercially available or synthetically available nucleobases, modified nucleobases or nucleobase analogs of formula Ring B are protected (and deprotected) using established methods such as those described in T.W.Greene and P.G.M.Wuts, "Protective Groups in Organic Synthesis," 3 rd edition, John Wiley & Sons, 1999.

For example, benzoyl protection of thymine with benzoyl chloride (BzCl), a base such as pyridine, in a solvent such as THF and the like, affords bis-Bz-protected 1, 3-dibenzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione. In solvents such as dioxane, using K₂CO₃To achieve selective deprotection of one of the Bz protecting groups to give 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione.

7H-pyrrolo [2, 3-d ] is achieved under conditions known to those skilled in the art]Selective carbamate protection of exocyclic amino groups of pyrimidin-4-amines. For example, the 7H-pyrrolo [ sic ] reaction in a suitable solvent such as THF and the like[2，3-d]Pyrimidin-4-amine with di-tert-butyl dicarbonate (Boc)₂O) and DMAP to obtain a Tri-BOC protected compound N, N, N-Tri-BOC-7H-pyrrolo [2, 3-d]Pyrimidin-4-amine. NaHCO is used in a suitable solvent such as MeOH₃The selective mild deprotection of one BOC protecting group in the BOC protecting groups is realized by aqueous solution to obtain N, N-Di-BOC-7H-pyrrolo [2, 3-d ]]Pyrimidin-4-amine.

The exocyclic amine of guanine is selectively protected by treatment with, for example, isobutyric anhydride in a suitable solvent such as DMF at a temperature in the range of 30 ℃ to 155 ℃ for a period of about 4 hours to give N- (6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide. Acylation of N- (6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide with an acylating agent selected from the group consisting of an acyl derivative, an acyl halide (such as acetyl chloride, etc.) and an anhydride (such as acetic anhydride, propionic anhydride, etc.) in a suitable solvent such as DMF affords N- (9-acetyl-6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide. 9-acetyl-2-isobutyramido-9H-purin-6-yl diphenylcarbamate is obtained by protecting the 4-oxo moiety of N- (9-acetyl-6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide as a diphenylcarbamate species using, for example, diphenylcarbamoyl chloride. Deprotection of the acetyl protecting group was achieved in EtOH/water at a temperature of about 100 ℃ for a period of about 2 hours to give 2-isobutyramido-9H-purin-6-yl diphenylcarbamate.

According to scheme 11, a compound of formula (XXXIV) (aS well aS formulae (XIa), (XIb), (XIXa), (XIXb), (XXIIIa), (XXIIIb) and (6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f ] f][1，3，5，2，4]Trioxasidioxin-6 a (6H) -carbonitrile) (where PG is a suitable protecting group, and R is^1aIs H, F, CH₂O-DMTr, CN) with ring B (wherein ring B is a nitrogen-linked nucleobase, a modified nucleobase, or a nucleobase analog). For example, triphenylphosphine, a base such as di-tert-butyl azodicarboxylate (DIAD), diethyl azodicarboxylate, or a mixture thereof is used in a solvent such as THF, ACN, dioxane, or a mixture thereof at a temperature in the range of 25 ℃ to 110 ℃Esters (DEAD), etc., to give compounds of formula (XXXV).

Scheme 12

Using the method described in scheme 9, a compound of formula (XXIX) (where Rf is DMTr and ring B is a nitrogen-linked nucleobase, modified nucleobase, or nucleobase analog) is oxidized using conditions as described previously. The oxime formation and dehydration method as described previously gives the cyano compound of formula (XXX).

Scheme 13

According to scheme 13, with triflic anhydride (TfO) in a suitable solvent such as DCM or the like ₂) Pyridine-activated alcohol compounds of formula (XXXI) (wherein R^dIs Piv, and Ring B is a nitrogen-linked nucleobase, modified nucleobase or nucleobase analog, such as 6-chloro-91²-purine, adenine, thymine, uracil and the like, each optionally protected by a suitable protecting group such as Bz, BOC and the like, to give a compound of formula (XXXII). The sulfonate compound of formula (XXXII) is then subjected to nucleophilic substitution reactions using methods known to those skilled in the art to provide a compound of formula (XXXIIII). For example, reaction with tetrabutylammonium fluoride (TBAF) in a suitable solvent such as THF and the like affords compounds of formula (XXXIII) wherein Hal is F. The compound of formula (XXXII) is reacted with LiCl in a solvent such as DMF and the like at a temperature of about 40 ℃ to give a compound of formula (XXXIII) wherein Hal is Cl.

Scheme 14

According to the embodiment of the method of claim 14,prepared from (XXXIII) (wherein R is^dCompound for Piv, Hal is F and ring B is the nucleobase uracil) preparation of 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidin-2 (1H) -one: first with 2, 4, 6-triisopropylbenzenesulfonyl chloride (TPSCl) in a suitable solvent such as acetonitrile or the like in the presence of Dimethylaminopyridine (DMAP); followed by ammonium hydroxide, NH in the presence of a suitable inert organic solvent at a temperature in the range of about 10 ℃ to 50 ℃ ₃·H₂O or strong amines are aminolyzed for 1 to 12 hours. Deprotection of the Piv protecting group using conditions known to those skilled in the art and as described affords 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidin-2 (1H) -one.

Reacting formula (XXXIII) (wherein R is R) in a suitable solvent such as THF at a temperature in the range of about 10 ℃ to 50 ℃ under ammonolysis conditions, for example by reaction with ammonia^dIs Piv, Hal is F, and Ring B is the nucleobase analogue 6-chloro-9. lambda²-purine) for about 1 to 12 hours. Subsequent deprotection of the Piv protecting group affords (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (fluoromethyl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol.

Scheme 15

Deprotection of compounds of formula (XXXV) having protecting Groups is carried out according to established procedures such as those described in T.W.Greene and P.G.M.Wuts, "Protective Groups in Organic Synthesis", 3 rd edition, John Wiley & Sons, 1999, to give compounds of formula (I).

For example, compounds having BOC protecting groups are cleaved under standard acidic conditions (such as TFA, HCl, etc.). Deprotection of TBS was achieved using tetrabutylammonium fluoride (TBAF). At a temperature of-2 ℃ to 100 ℃, preferably 25 ℃ to 80 ℃, with an alcoholic solution of ammonia or an alkali metal alkoxide, preferably Deprotection of Bz is achieved in a solution of ammonia in methanol or a solution of sodium alkoxide in methanol for a period of from 5 minutes to 3 days, preferably from 30 minutes to 4 hours. Deprotection of the benzyl group is achieved under hydrogenolysis conditions. The esters (Piv, CO) are achieved under basic conditions (such as exposure of the ester to a solution of sodium methoxide, NaOH/MeOH, etc. in methanol)₂Et, etc.). Mild detritylation of monomethoxytrityl (MMtr) and 4, 4-dimethoxytrityl (DMTr) is achieved under conditions known to those skilled in the art. For example, an acid such as trichloroacetic acid (TCA), trifluoroacetic acid (TFA), and the like is employed in a suitable solvent such as DCM and the like at room temperature for a period of 1 hour to 3 hours. Deprotection of isobutyl carbamate is achieved under neutral or mildly basic conditions (such as NaOH/MeOH).

Scheme 16

Nucleoside triphosphate compounds of formula (IB) were prepared from nucleoside compounds of formula (I) according to scheme 16 using conditions known to those skilled in the art. For example, reacting a nucleoside of formula (I) with trimethyl phosphate, triethyl phosphate, and the like, phosphoryl chloride, and N-methylimidazole provides the corresponding nucleoside monophosphate intermediate. Subsequent reaction of nucleoside monophosphates with tetrabutylammonium pyrophosphate in a suitable solvent such as DMF and the like affords the triphosphates of formula (IB).

Scheme 17

According to scheme 17, an aryloxyphosphoramidate nucleoside prodrug compound of formula (IC) is prepared by the following procedure: nucleoside compounds of formula (I) are coupled with phosphorochloridates by activation of the imidazolium intermediate with NMI (N-methylimidazole) or by 5' -deprotonation of the nucleoside with isoPrMgCl, t-BuMgCl, etc. followed by substitution with phosphoroamidate. It is to be noted that it is preferable that,these different synthetic methods generally produce diastereoisomers (S) as the phosphorus center_pAnd R_pIsomers) of the compound of formula (IC) in an approximate 1: 1 mixture; wherein R isⁱIs C_1-8An alkyl group.

The compounds of formula (I) may be converted into their corresponding salts using methods known to those of ordinary skill in the art. For example, the amine of formula (I) is treated with trifluoroacetic acid, HCl or citric acid in a solvent such as Et₂O、CH₂Cl₂THF, MeOH, chloroform or isopropanol to provide the corresponding salt forms. Alternatively, the trifluoroacetic acid or formate salt is obtained by reverse phase HPLC purification conditions. Crystalline forms of the pharmaceutically acceptable salts of the compounds of formula (I) may be obtained by recrystallization from polar solvents (including mixtures of polar solvents and aqueous mixtures of polar solvents) or from non-polar solvents (including mixtures of non-polar solvents).

If the compounds according to the invention have at least one chiral center, they can accordingly be present in enantiomeric form. If the compounds have two or more chiral centers, they may additionally exist in diastereomeric forms. It is to be understood that all such isomers and mixtures thereof are encompassed within the scope of the present invention.

The compounds prepared according to the above schemes may be obtained as single forms, such as single enantiomers, by form-specific synthesis or by resolution. Alternatively, the compounds prepared according to the above schemes may be obtained as mixtures of various forms, such as racemic mixtures (1: 1) or non-racemic mixtures (non-1: 1). In the case of obtaining racemic and non-racemic mixtures of enantiomers, the individual enantiomers can be separated using conventional separation methods known to those of ordinary skill in the art, such as chiral chromatography, recrystallization, diastereomeric salt formation, derivatization into diastereomeric adducts, biotransformation, or enzymatic transformation. Where a mixture of regioisomers or a mixture of diastereomers is obtained, the individual isomers may be separated using conventional methods such as chromatography or crystallization, as appropriate.

In some embodiments, altering the substituents on a compound described herein, such as a compound of formula (I), or a pharmaceutically acceptable salt thereof, can result in phosphorus being the chiral center. In some embodiments, the phosphorus may be in the (R) -configuration. In some embodiments, the phosphorus may be in the (S) -configuration. Examples of two configurations are:

in some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be enriched with respect to the (R) or (S) configuration of phosphorus. For example, one of the (R) and (S) configurations for the phosphorus atom may be present in an amount > 50%,. gtoreq.75%,. gtoreq.90%,. gtoreq.95%, or. gtoreq.99% compared to the other of the (R) and (S) configurations for the phosphorus atom.

By neutralizing the charge on the phosphonate moiety of formula (I) or a pharmaceutically acceptable salt thereof, penetration of the cell membrane may be facilitated due to the increased lipophilicity of the compound. Once taken up and harvested within the cell, the groups attached to the phosphorus can be readily removed by esterases, proteases and/or other enzymes. In some embodiments, the group attached to the phosphorus can be removed by simple hydrolysis. Within the cell, the phosphonate thus released may be metabolized by cellular enzymes to a monophosphate or an active diphosphate (e.g., a phosphonodiphosphate). Furthermore, in some embodiments, altering substituents on a compound described herein, such as a compound of formula (I), or a pharmaceutically acceptable salt thereof, can help maintain the efficacy of the compound by reducing undesirable effects.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may act as a chain terminator of a virus and inhibit replication of the virus, wherein the virus may be HBV, HDV and/or HIV. For example, a compound of formula (I) or a pharmaceutically acceptable salt thereof may bind to the DNA strand of a virus (such as HBV, HDV and/or HIV) and no further elongation is observed to occur.

In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may have increased metabolism and/or bloodAnd (4) slurry stability. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be more resistant to hydrolysis and/or enzymatic conversion. For example, a compound of formula (I) or a pharmaceutically acceptable salt thereof may have increased metabolic stability, increased plasma stability, and/or may be more hydrolysis resistant. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may have improved properties. A non-limiting list of exemplary properties includes, but is not limited to, increased biological half-life, increased bioavailability, increased efficacy, sustained in vivo response, increased dosing interval, decreased dosing amount, decreased cytotoxicity, decreased amount required for treatment of a condition, decreased viral load, decreased plasma viral load, increased CD4+ T lymphocyte count, decreased seroconversion time (i.e., no virus detected in the viral serum), increased sustained viral response, decreased morbidity or mortality of clinical outcome, reduction or prevention of opportunistic infections, increased subject compliance, and compatibility with other drugs. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may have a biological half-life of greater than 24 hours. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may have greater antiviral activity (e.g., lower EC in HIV, HBV, and/or HDV replicon assays) as compared to current standard of care ₅₀)。

Pharmaceutical composition

Some embodiments described herein relate to pharmaceutical compositions that can include an effective amount of one or more compounds described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof) and a pharmaceutically acceptable carrier, diluent, excipient, or combination thereof.

In some embodiments, the pharmaceutical composition may comprise a single diastereomer of a compound of formula (I) or a pharmaceutically acceptable salt thereof (e.g., the single diastereomer is present in the pharmaceutical composition at a concentration greater than 99% compared to the total concentration of the other diastereomer). In other embodiments, the pharmaceutical composition may comprise a mixture of diastereomers of the compound of formula (I) or a pharmaceutically acceptable salt thereof. For example, a pharmaceutical composition may comprise a concentration of one diastereomer of > 50%, > 60%, > 70%, > 80%, > 90%, > 95%, or > 98% compared to the total concentration of the other diastereomer. In some embodiments, the pharmaceutical composition comprises a 1: 1 mixture of two diastereomers of the compound of formula (I) or a pharmaceutically acceptable salt thereof.

The term "pharmaceutical composition" refers to a mixture of one or more compounds disclosed herein with other chemical components, such as diluents or carriers. The pharmaceutical composition facilitates administration of the compound to an organism. Pharmaceutical compositions can also be obtained by reacting the compounds with inorganic or organic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. The pharmaceutical composition will generally be adjusted according to the particular intended route of administration. The pharmaceutical composition is suitable for human and/or veterinary use.

The term "physiologically acceptable" defines a carrier, diluent or excipient that does not abrogate the biological activity and properties of the compound.

As used herein, "carrier" refers to a compound that facilitates incorporation of the compound into a cell or tissue. For example, but not limited to, dimethyl sulfoxide (DMSO) is a common carrier that facilitates the uptake of many organic compounds into cells or tissues of a subject.

As used herein, "diluent" refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, diluents may be used to increase the volume of a potent drug that is too small in mass for preparation and/or administration. The diluent may also be a liquid for dissolving the drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution, such as, but not limited to, phosphate buffered saline that mimics the composition of human blood.

As used herein, "excipient" refers to an inert substance added to a pharmaceutical composition to provide, but not limited to, volume, consistency, stability, binding capacity, lubricity, disintegration capacity, and the like to the composition. "diluents" are a class of excipients.

The pharmaceutical compositions described herein may be administered to a human patient as such or in a pharmaceutical composition, which when administered in a pharmaceutical composition, is mixed with other active ingredients (as in combination therapy) or carriers, diluents, excipients or combinations thereof. Suitable formulations depend on the route of administration chosen. Techniques for the formulation and administration of the compounds described herein are known to those skilled in the art.

The pharmaceutical compositions disclosed herein may be prepared in a manner that is itself known (e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes). In addition, the active ingredient is included in an effective amount to achieve its intended purpose. Many of the compounds used in the pharmaceutical combinations disclosed herein can be provided as salts with pharmaceutically compatible counterions.

There are a variety of techniques in the art for administering compounds including, but not limited to, oral delivery, rectal delivery, topical delivery, aerosol delivery, injection delivery, and parenteral delivery, including intramuscular injection, subcutaneous injection, intravenous injection, intramedullary injection, intravesicular injection, direct intraventricular injection, intraperitoneal injection, intranasal injection, and intraocular injection.

The compounds may also be administered in a local rather than systemic manner, for example, by direct injection of the compound into the affected area, usually in the form of a depot or sustained release formulation. In addition, the compounds may be administered targeted to a drug delivery system (e.g., liposomes coated with tissue-specific antibodies). Liposomes can be targeted to and taken up selectively by an organ.

If desired, the compositions may be presented in a pack or dispenser device which may contain one or more unit doses containing the active ingredient. The package may for example comprise a metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The package or dispenser may also be accompanied by a notice regarding the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, wherein the notice is reflective of the agency's approval for the administration of the pharmaceutical to human or veterinary forms. Such notice may be, for example, a label or approved product insert for a prescription drug approved by the U.S. food and drug administration. Compositions comprising the compounds described herein formulated in compatible pharmaceutical carriers can also be prepared, placed in a suitable container and labeled for treatment of a designated condition.

Application method

Some embodiments disclosed herein relate to methods of treating and/or ameliorating a disease or disorder, which may include administering to a subject an effective amount of one or more compounds described herein, such as a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound described herein or a pharmaceutically acceptable salt thereof. Other embodiments disclosed herein relate to methods of treating and/or ameliorating a disease or disorder, which can include administering to a subject identified as having a disease or disorder an effective amount of one or more compounds described herein, such as a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound described herein or a pharmaceutically acceptable salt thereof.

Some embodiments described herein relate to methods of treating HBV and/or HDV infection, which may include administering to a subject identified as having such HBV and/or HDV infection an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for treating HBV and/or HDV infection. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for treating HBV and/or HDV infection.

Some embodiments disclosed herein relate to methods of treating HBV and/or HDV infection, which may include contacting a cell infected with HBV and/or HDV with an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HBV and/or HDV infection, which treatment can comprise contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or a pharmaceutical composition described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein, for treating HBV and/or HDV infection, wherein the use comprises contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or pharmaceutical composition described herein.

Some embodiments disclosed herein relate to methods of inhibiting replication of HBV and/or HDV, which can include contacting a cell infected with HBV and/or HDV with an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for inhibiting replication of HBV and/or HDV, which treatment can comprise contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or a pharmaceutical composition described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof), for inhibiting replication of HBV and/or HDV, wherein the use comprises contacting a cell infected with HBV and/or HDV with an effective amount of the compound and/or a pharmaceutical composition described herein.

In some embodiments, the HBV infection may be an acute HBV infection. In some embodiments, the HBV infection may be a chronic HBV infection.

Some embodiments disclosed herein relate to methods of treating cirrhosis of the liver that develops as a result of HBV and/or HDV infection, which methods can include administering to a subject having cirrhosis of the liver and/or contacting a cell infected with HBV and/or HDV in a subject having cirrhosis of the liver with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for treating liver cirrhosis with an effective amount of the compound and/or a pharmaceutical composition described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein for treating liver cirrhosis.

Some embodiments disclosed herein relate to methods of treating liver cancer, such as hepatocellular carcinoma, that develops as a result of HBV and/or HDV infection, which may include administering to a subject having liver cancer and/or contacting cells infected with HBV and/or HDV in a subject having liver cancer with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for treating a liver cancer, such as hepatocellular carcinoma, with an effective amount of the compound and/or a pharmaceutical composition described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein for the treatment of liver cancer, such as hepatocellular carcinoma.

Some embodiments disclosed herein relate to methods of treating liver failure that develops as a result of HBV and/or HDV infection, which methods can include administering to a subject with liver failure and/or contacting cells infected with HBV and/or HDV in a subject with liver failure with an effective amount of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for treating liver failure with an effective amount of the compound and/or a pharmaceutical composition described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein for treating liver failure.

Various indicators for determining the effectiveness of a method of treating HBV and/or HDV infection are also known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a reduction in viral load as indicated by a reduction in HBV DNA (or load), HBV surface antigen (HBsAg), and HBV e-antigen (HBeAg), a reduction in plasma viral load, a reduction in viral replication, a reduction in seroconversion time (no virus detected in patient serum), an increase in the sustained response rate of the virus to treatment, an improvement in liver function, and/or a reduction in morbidity or mortality of clinical outcome.

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to reduce HBV and/or HDV viral load to undetectable levels, for example, to about 10 to about 50, or about 15 to about 25 international units per mL of serum, or less than about 20 international units per mL of serum. In some embodiments, the effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof is an amount effective to reduce the HBV and/or HDV viral load compared to the HBV and/or HDV viral load prior to providing the compound of formula (I) or a pharmaceutically acceptable salt thereof. In some embodiments, an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof may be an amount that reduces HBV and/or HDV viral load to below about 20 international units per mL of serum. In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to achieve a reduction in HBV and/or HDV viral load in the serum of a subject to an undetectable level and/or in a range of about 1.5-log to about 2.5-log, about 3-log to about 4-log, or greater than about 5-log, as compared to the viral load prior to providing a compound of formula (I), or a pharmaceutically acceptable salt thereof, as described herein. For example, the HBV and/or HDV viral load may be measured prior to providing the compound of formula (I), or a pharmaceutically acceptable salt thereof, and the HBV and/or HDV viral load may be measured again after completion of at least a portion of a treatment regimen utilizing the compound of formula (I), or a pharmaceutically acceptable salt thereof (e.g., 1 month after initiation or completion).

In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt thereof, can cause a reduction in replication of HBV and/or HDV by at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, 75, 100-fold or more relative to the pre-treatment level of the subject, as determined after completion of the treatment regimen or at least a portion of the completion of the treatment regimen (e.g., 1 month after initiation or completion). In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may result in a reduction in replication of HBV and/or HDV in a range of more than 1 fold, about 2 to about 5 fold, about 10 to about 20 fold, about 15 to about 40 fold, or about 50 to about 100 fold relative to the pre-treatment level. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can result in a reduction in HBV and/or HDV replication in a range of more than 0.5log, 1 to 1.5log, 1.5log to 2log, 2log to 2.5log, 2.5 to 3log, 3log to 3.5log, or 3.5 to 4log or more, or can achieve the same reduction as standard care treatment over a shorter period of time, such as over one month, over two months, or over three months, than the reduction achieved by standard care of HBV and/or HDV administered according to standard care.

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to achieve a sustained viral response, e.g., a non-detectable or substantially non-detectable HBV and/or HDV DNA load (e.g., less than about 25, or less than about 15 international units per milliliter of serum) is present in the serum of a subject for a period of at least about one month, at least about two months, at least about three months, at least about four months, at least about five months, or at least about six months after treatment is discontinued.

In some embodiments, an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof can reduce HBV and/or HDV viral load by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% or more compared to the viral load of a subject treated with standard care in an untreated subject or a placebo-treated subject. Methods of detecting HBV and/or HDV viral load are known to those skilled in the art and include immunological based methods such as enzyme linked immunosorbent assay (ELISA), radioimmunoassay, and the like, which detect HBV and/or HDV antibodies and other markers indicative of HBV and/or HDV viral load, and combinations thereof.

Some embodiments described herein relate to methods of inhibiting HIV activity that can include contacting a cell infected with HIV with an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof. Some embodiments described herein relate to methods of inhibiting HIV activity that can include administering to a subject infected with HIV an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof can inhibit viral reverse transcriptase, and thus inhibit transcription of HIV RNA into DNA. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can inhibit HIV integrase. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can inhibit viral encapsidation glycoprotein 120(gp 120).

Some embodiments described herein relate to methods of treating an HIV infection, which may include administering to a subject identified as having the HIV infection an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I), or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HIV infection. Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for treating HIV infection.

Some embodiments disclosed herein relate to methods of treating HIV infection that can include contacting a cell infected with HIV with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for the treatment of HIV infection, which treatment can include contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein, for treating HIV infection, wherein the use comprises contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition.

Some embodiments disclosed herein relate to methods of inhibiting replication of HIV, which can include contacting a cell infected with HIV with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof). Other embodiments described herein relate to the use of a compound described herein (such as a compound of formula (I) or a pharmaceutically acceptable salt thereof) for the manufacture of a medicament for inhibiting replication of HIV, which treatment may comprise contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition. Other embodiments described herein relate to the use of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising an effective amount of a compound described herein (such as a compound of formula (I), or a pharmaceutically acceptable salt thereof), for inhibiting the replication of HIV, wherein the use comprises contacting a cell infected with HIV with an effective amount of the compound and/or pharmaceutical composition.

In some embodiments described herein, when the infection is caused by HIV, and/or the virus is HIV, the subject has an Opportunistic Infection (OI). OI utilizes a subject with low immune function. In some embodiments described herein, a subject having a CD4+ T lymphocyte count of less than about 200 cells/mL is at increased risk of developing OI. In some embodiments, OI occurs when the CD4+ T lymphocyte count is less than about 500 cells/mL. In some embodiments, OI occurs when the HIV viral load is greater than about 100,000 copies/mL. In some embodiments, the HIV viral load and/or CD4+ T lymphocyte count can be determined by conventional standard of care methods, for example, by an HIV immunoassay detection assay (HIV immunoassay detection assays) for detecting HIV antibodies and/or HIV p24 antigen.

Some embodiments described herein relate to methods of treating an HIV infection-associated OI selected from the group consisting of: candidiasis, bronchitis, pneumonia, esophagitis, invasive cervical cancer, coccidioidomycosis, cryptococcosis, chronic intestinal cryptosporidiosis, cytomegalovirus disease, encephalopathy, herpes simplex, histoplasmosis, chronic intestinal isosporosis, kaposi's sarcoma, lymphoma, mycobacterium avium complex, tuberculosis, pneumocystis carinii (pneumocystis carinii) pneumonia, progressive multifocal leukoencephalopathy, salmonella septicemia, toxoplasmosis of the brain, and wasting syndrome in a subject suffering from one or more of the foregoing conditions, which can comprise providing to the subject an effective amount of a compound or pharmaceutical composition described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof). Some embodiments described herein relate to methods of preventing and treating one or more OI in a subject having an HIV infection, which may include providing to the subject an effective amount of a compound or pharmaceutical composition described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof). Also contemplated are methods for reducing or eliminating one or more OI in a patient having an HIV infection by providing to the subject an effective amount of a compound or pharmaceutical composition described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof). In some embodiments, the method may include slowing or stopping the progression of the OI. In other embodiments, the process of OI may be reversed, and stasis or amelioration of infection is contemplated. In some embodiments, one or more of the following can be treated by contacting a cell infected with HIV with an effective amount of a compound described herein (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof): candidiasis, bronchitis, pneumonia, esophagitis, invasive cervical cancer, coccidioidomycosis, cryptococcosis, chronic intestinal cryptosporidiosis, cytomegalovirus disease, encephalopathy, herpes simplex, histoplasmosis, chronic intestinal isosporosis, kaposi's sarcoma, lymphoma, mycobacterium avium complex, tuberculosis, pneumocystis carinii pneumonia, progressive multifocal leukoencephalopathy, salmonella septicemia, toxoplasmosis of the brain, and wasting syndrome.

Two types of HIV, HIV-1 and HIV-2, have been characterized. HIV-1 is more toxic and more infectious, and has a global prevalence, whereas HIV-2 is less toxic and geographically limited. In some embodiments, an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof, is effective to treat HIV-1. In some embodiments, an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof, is effective to treat HIV-2. In some embodiments, the compounds described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) are effective in treating both genotypes of HIV (HIV-1 and HIV-2).

Various indicators for determining the effectiveness of a method of treating HIV infection are known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a reduction in viral load, a reduction in plasma viral load, an increase in CD4+ T lymphocyte count, a reduction in viral replication, a reduction in seroconversion time (no virus detected in patient serum), an increase in the sustained response rate of the virus to treatment, a reduction in morbidity or mortality in clinical outcome, and/or a reduction in the rate of opportunistic infections. Similarly, successful treatment with an effective amount of a compound or pharmaceutical composition described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) can reduce the incidence of opportunistic infections in HIV-infected subjects.

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to reduce HIV viral titer to undetectable levels, such as to about 10 to about 50, or about 15 to about 25 international units per mL of serum, or less than about 20 international units per mL of serum. In some embodiments, the effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to reduce the HIV viral load compared to the HIV viral load prior to providing the compound of formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, may be an amount that reduces the HIV viral load to less than about 20 international units per mL of serum. In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to achieve a reduction in HIV viral titer in the serum of a subject in the range of about 1.5-log to about 2.5-log, about 3-log to about 4-log, or greater than about 5-log, as compared to the viral load prior to providing a compound of formula (I), or a pharmaceutically acceptable salt thereof, as described herein. For example, the HIV viral load can be measured prior to providing the compound of formula (I) or a pharmaceutically acceptable salt thereof, and again after completion of a treatment regimen utilizing the compound of formula (I) or a pharmaceutically acceptable salt thereof (e.g., 1 month after completion).

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to increase the CD4+ T lymphocyte count from less than about 200 cells/mL to greater than about 1200 cells/mL. In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to increase the CD4+ T lymphocyte count from less than about 200 cells/mL to greater than about 500 cells/mL.

In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt thereof, can result in a reduction in replication of human immunodeficiency virus by at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, 75, 100-fold or more relative to the pre-treatment level of the subject, as determined after completion of the treatment regimen (e.g., 1 month after completion). In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may result in a reduction in replication of human immunodeficiency virus in a range of about 2 to about 5 fold, about 10 to about 20 fold, about 15 to about 40 fold, or about 50 to about 100 fold relative to the pre-treatment level. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof can result in a reduction in human immunodeficiency virus replication in the range of 1 to 1.5log, 1.5log to 2log, 2log to 2.5log, 2.5log to 3log, 3log to 3.5log, or 3.5log to 4log or more, or can achieve the same reduction as standard care treatment over a shorter period of time, e.g., over one month, two months, or three months, than the reduction achieved by standard care treatment, such as treatment comprising a combination of ritonavir and etravirine.

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, is an amount effective to achieve a sustained viral response, e.g., non-detectable or substantially non-detectable HIV RNA (e.g., less than about 25, or less than about 15 international units per milliliter of serum) is present in the serum of the subject for a period of at least about one month, at least about two months, at least about three months, at least about four months, at least about five months, or at least about six months after treatment is discontinued.

In some embodiments, an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, can reduce HIV viral load by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% or more as compared to viral load in an untreated subject or a placebo-treated subject. Methods for detecting HIV viral load are known to those skilled in the art and include immunological based methods such as enzyme linked immunosorbent assays (ELISA), radioimmunoassays, and the like, which detect HIV-1 antibodies and/or HIV-2 antibodies, HIV-1p24 antigen, and other markers indicative of HIV viral load, and combinations thereof.

Subjects clinically diagnosed with HBV, HDV and/or HIV infection include "naive" subjects (e.g., subjects not previously treated for HBV, HDV and/or HIV, in particular those not previously receiving ART for HIV, including ritonavir-based therapies) as well as individuals who have previously failed therapy for HBV, HDV and/or HIV ("treatment failed" subjects). Subjects who have failed therapy include "non-responders" (for HIV, these are by prior treatment with HIV (< 0.5log IU/mL), e.g., subjects with no significant or sufficient reduction in HIV titers with prior ART, including ritonavir or other therapies); and "relapsers" (for HIV, subjects who have previously been treated for HIV, e.g., subjects who have received prior ART with reduced HIV titers but subsequently increased). Further examples of subjects include subjects with acute HBV and/or HDV infection, subjects with chronic HBV and/or HDV, and asymptomatic subjects.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject who has failed therapy with HBV, HDV and/or HIV. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can be provided to a non-responsive subject with HBV, HDV and/or HIV. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a relapsed subject with HBV, HDV and/or HIV. In some embodiments, the subject may be asymptomatic, e.g., the subject may be infected with HBV and/or HDV, but does not exhibit any symptoms of the viral infection. In some embodiments, the subject may be immunocompromised. In some embodiments, the subject has at least one of HIV, HBV, and/or HDV.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject having chronic HBV and/or HDV. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject having acute HBV and/or HDV.

After a period of time, the infectious agent may develop resistance to one or more therapeutic agents. The term "resistant" as used herein refers to a viral strain that exhibits a delayed, attenuated and/or ineffective response to a therapeutic agent. In some cases, viruses sometimes mutate or produce variants that are resistant or partially resistant to certain drugs. For example, after treatment with an antiviral agent, the viral load of a subject infected with a resistant virus may be reduced to a lesser extent than the reduction in viral load exhibited by a subject infected with a non-resistant strain. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject infected with HBV and/or HDV strains that are resistant to one or more different anti-HBV and/or anti-HDV agents (e.g., agents used for routine standard of care). In some embodiments, the development of HBV-resistant and/or HDV strains is delayed when a subject is treated with a compound of formula (I) or a pharmaceutically acceptable salt thereof, compared to the development of HBV and/or HDV strains resistant to other HBV and/or HDV drugs, such as agents used in conventional standard of care. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject infected with an HIV strain that is resistant to one or more different anti-HIV agents (e.g., agents used for routine standard of care). In some embodiments, development of an HIV-resistant strain is delayed when a subject is treated with a compound of formula (I) or a pharmaceutically acceptable salt thereof, compared to development of an HIV strain that is resistant to other HIV drugs, such as agents used in conventional standard of care.

In some embodiments, an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof may be provided to a subject who is contraindicated for other anti-HBV, anti-HDV, and/or anti-HIV drugs. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can be provided to a subject who is highly allergic to an antiviral agent.

Some subjects being treated for HBV, HDV and/or HIV experience viral load rebound. As used herein, the term "viral load rebound" refers to a continuous increase in viral load (such as ≧ 0.5log IU/mL for HIV) beyond a nadir before treatment ends. For HIV, the lowest point is a > 0.5log IU/mL reduction from baseline. In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt thereof, may be provided to a subject experiencing viral load rebound, or may prevent such viral load rebound when used to treat a subject.

Standard of care for the treatment of HBV, HDV and/or HIV has been associated with a variety of side effects (also known as adverse effects). In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can reduce the number and/or severity of side effects observed in subjects treated with standard care for particular viruses such as HBV, HDV and HIV. Examples of side effects of subjects receiving HBV and/or HDV treatment include, but are not limited to, dyspepsia, neuropathy, cough, anorexia, lactic acidosis, lipodystrophy, diarrhea, fatigue, insomnia, rash, fever, malaise, tachycardia, chills, headache, arthralgia, myalgia, apathy, nausea, vomiting, cognitive changes, weakness, and lethargy. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof can reduce the number and/or severity of side effects. For example, the number and/or severity of side effects observed in HIV subjects treated with ART according to standard of care. Examples of side effects in subjects receiving HIV treatment include, but are not limited to, anorexia, lipodystrophy, diarrhea, fatigue, elevated cholesterol and triglycerides, skin rash, insomnia, fever, malaise, tachycardia, chills, headache, arthralgia, myalgia, apathy, nausea, vomiting, cognitive changes, weakness, lethargy, lack of activeness, dysphoria, confusion, depression, major depression, suicidal ideation, anemia, low white cell count, and sparse hair. In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt thereof, may be provided to a subject who has discontinued HBV, HDV, and/or HIV treatment due to one or more adverse reactions or side effects associated with one or more other anti-HBV, anti-HDV, and/or anti-HIV agents (e.g., agents used for routine standard of care).

Table 1 provides some embodiments of the percentage improvement obtained using a compound of formula (I) or a pharmaceutically acceptable salt thereof, compared to standard care for HBV, HDV and/or HIV. Examples include the following: in some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof results in a percentage of non-responders that is 10% less than the percentage of non-responders receiving standard of care. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof results in a number of side effects ranging from about 10% to about 30% less compared to the number of side effects experienced by a subject receiving standard of care; and in some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, results in a severity of 25% less side effects such as one of those described herein) than the severity of the same side effects experienced by subjects receiving standard of care. Methods for quantifying the severity of side effects are known to those skilled in the art.

TABLE 1

As used herein, "subject" refers to an animal that is the subject of treatment, observation, or experiment. "animals" include cold and warm blooded vertebrates and invertebrates, such as fish, shellfish, reptiles, and in particular mammals. "mammal" includes, but is not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cattle, horses, primates such as monkeys, chimpanzees, and apes, and specifically humans. In some embodiments, the subject is a human.

As used herein, the term "treatment" or "therapeutic" does not necessarily refer to a complete cure or elimination of a disease or disorder. Any degree of alleviation of any undesired signs or symptoms of a disease or disorder may be considered treatment. In addition, treatment may include behaviors that may worsen the overall health or aesthetic perception of the patient.

The terms "therapeutically effective amount" and "effective amount" are used to indicate the amount of active compound or agent that elicits the indicated biological or pharmaceutical response. For example, an effective amount of a compound can be that amount necessary to prevent, alleviate or ameliorate symptoms of a disease or prolong the survival of the subject being treated. The response can occur in a tissue, system, animal or human, and includes alleviation of signs or symptoms of the disease being treated. Determination of an effective amount is well within the ability of those skilled in the art in view of the disclosure provided herein. The effective amount of a compound disclosed herein required as a dose will depend on the route of administration, the type of animal (including human) being treated, and the physical characteristics of the particular animal under consideration. The dosage can be adjusted to achieve the desired effect, but will depend on a variety of factors, such as body weight, diet, concurrent medication, and other factors that will be recognized by those skilled in the medical arts.

It will be apparent to those skilled in the art that useful in vivo dosages to be administered and the particular mode of administration will vary depending upon the age, weight, severity of the affliction and the type of mammal being treated, the particular compound employed and the particular use for which it is to be used. Determination of an effective dosage level (i.e., the dosage level required to achieve a desired effect) can be accomplished by one of skill in the art using routine methods (e.g., human clinical trials and in vitro studies).

The range of dosages can be varied widely, depending on the desired effect and the indication of the treatment. Alternatively, the dose may be based on and calculated from the surface area of the patient, as will be appreciated by those skilled in the art. Although the exact dose will be determined on an individual drug basis, in most cases some generalizations of the dose may be made. The daily dosage regimen for an adult patient may be, for example, an oral dose of between 0.01mg and 3000mg, preferably between 1mg and 700mg (e.g., 5 to 200mg) of each active ingredient. The dose may be a single dose or a series of two or more doses administered over the course of one or more days, depending on the needs of the subject. In some embodiments, the compound will be administered for a continuous treatment cycle, e.g., one or more weeks, or months or years. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof is administered less frequently than the frequency of administration of the agent in standard care. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered once daily. For example, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered once daily to a subject having an HIV infection. In some embodiments, the total time of a treatment regimen with a compound of formula (I), or a pharmaceutically acceptable salt thereof, may be less than the total time of a treatment regimen with standard of care.

Where human doses of the compounds have been established for at least some conditions, those same doses may be used, or doses between about 0.1% and 500%, more preferably between about 25% and 250% of the established human dose. In the case where no human dose is established (as in the case of newly discovered pharmaceutical compositions), a suitable human dose may be based on ED₅₀Or ID₅₀Values or other suitable values derived from in vitro or in vivo studies obtained by toxicity studies and efficacy studies in animals are inferred.

In the case of administration of pharmaceutically acceptable salts, the dosage can be calculated as the free base. As will be appreciated by those skilled in the art, in certain circumstances it may be desirable to administer the compounds disclosed herein in amounts exceeding, or even well exceeding, the preferred dosage ranges described above in order to effectively and positively treat, inter alia, an invasive disease or infection.

The dose and interval can be adjusted individually to provide plasma levels of the active moiety sufficient to maintain the modulating effect or the lowest effective concentration (MEC,). The MEC for each compound will vary, but can be estimated from in vitro data. The dose required to achieve MEC will depend on the individual characteristics and the route of administration. However, HPLC assays or bioassays may be used to determine plasma concentrations. Dosage intervals may also be determined using MEC values. The composition should be administered using a regimen that maintains plasma levels above MEC for a period of 10% to 90%, preferably 30% to 90%, most preferably 50% to 90%. In the case of topical administration or selective uptake, the effective local concentration of the drug may not be related to the plasma concentration.

It should be noted that the attending physician will know how and when to terminate, interrupt or adjust administration due to toxicity or organ dysfunction. Conversely, if the clinical response is inadequate (excluding toxicity), the attending physician will also know to adjust the treatment to higher levels. The size of the dose administered in controlling the condition of interest will vary with the severity of the condition to be treated and the route of administration. The severity of the condition can be assessed, for example, in part, by standard prognostic assessment methods. In addition, the dose and possibly the frequency of dosing will also vary according to the age, weight and response of the individual patient. Procedures comparable to those discussed above may be used in veterinary medicine.

Known methods can be used to assess the efficacy and toxicity of the compounds disclosed herein. For example, toxicology of a particular compound or subset of compounds sharing certain chemical moieties can be established by determining in vitro toxicity to a cell line (such as a mammalian cell line, and preferably a human cell line). The results of such studies will generally predict toxicity in animals (such as mammals, or more specifically humans). Alternatively, known methods can be used to determine the toxicity of a particular compound in animal models (such as mice, rats, rabbits, or monkeys). The efficacy of a particular compound can be determined using a variety of accepted methods, such as in vitro methods, animal models, or human clinical trials. When selecting a model to determine efficacy, one of skill in the art can select an appropriate model, dosage, route of administration, and/or regimen by guidance of the state of the art.

Combination therapy

In some embodiments, a compound disclosed herein, such as a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with one or more additional agents. Examples of additional agents that may be used in combination with a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be agents currently used in conventional standard care for the treatment of HIV, HBV and/or HDV. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used with one, two, three, or more additional agents described herein.

In some embodiments, when the infection is caused by HBV, and/or HIV, the additional therapeutic agent may be an antiretroviral therapy (ART) agent such as a non-nucleoside reverse transcriptase inhibitor (NNRTI), Nucleoside Reverse Transcriptase Inhibitor (NRTI), polymerase inhibitor, Protease Inhibitor (PI), fusion/entry inhibitor, interferon, viral maturation inhibitor, capsid assembly modulator, FXR agonist, TNF/cyclophilin inhibitor, TLR agonist, vaccine, siRNA or ASO covalent closed circular dna (cccdna) inhibitor, gene silencer, HBx inhibitor, surface antigen (sAg) secretion inhibitor (e.g., HBsAg), other HBV antiviral compounds, other HDV antiviral compounds, and/or other HIV antiviral compounds, or a pharmaceutically acceptable salt of any of the foregoing.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with agents currently used in the conventional standards of care treatment. For example, to treat HBV and/or HDV, the compounds disclosed herein may be used in combination with interferon therapy.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may replace agents currently used in the conventional standards of care treatment. For example, for the treatment of HIV, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in place of a conventional ART inhibitor.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, the NNRTI can inhibit HBV and/or HDV reverse transcriptase. Examples of suitable NNRTIs include, but are not limited to, delavirdine EfavirenzEtravirineNevirapineRilpivirinedoravirine and a pharmaceutically acceptable salt of any of the foregoing, and/or a combination thereof. A non-limiting list of exemplary NNRTIs includes the compounds numbered 1001-1006 in figure 1.

In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound of formula (I) or a pharmaceutically acceptable salt thereof, may be combined with a Nucleoside Reverse Transcriptase Inhibitor (NRTI) groupCan be used together. In some embodiments, the NRTI may inhibit HBV and/or HDV reverse transcriptase. Examples of suitable NRTI include, but are not limited to, abacavirAdefovir dipivoxilAmidovir, Alicitabine, censvudine and didanosineElvucitabine and emtricitabineEntecavirLamivudineLacivir, stampridine and stavudineTenofovir disoproxil (including) Tenofovir alafenamide, zalcitabineZidovudineAnd pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary NRTI's includes the compounds numbered 2001-2017 in FIG. 2.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may In combination with protease inhibitors. In some embodiments, the protease inhibitor can inhibit HBV and/or HDV protease, e.g., NS 3/4A. A non-limiting list of exemplary protease inhibitors includes the following: amprenavirAnadipivirAtazanavirBosai douweiDarunavirFusavir Gezopvir, indinavirLopinavirNelfinavirRitonavirSaquinavir CimivirTelaprevirDanoprevir and tipranavirABT-450(paritaprevir), BILN-2061 (Ciluevir), BI-201335(faldaprevir), GS-9256, vedroprevir (GS-9451), IDX-320, ACH-1625(sovaprevir), ACH-2684, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary protease inhibitors includes compounds numbered 3001-3010 in FIG. 3A and 3011-3023 in FIG. 3B.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an HIV fusion/entry inhibitor. In some embodiments, the HIV fusion/entry inhibitor may prevent HIV from entering CD4+ T lymphocytes. In some embodiments, fusion/entry inhibitors (also known as CCR5 antagonists) can prevent HIV cells from entering the desired proteins on CD4+ T lymphocytes. Suitable fusion/entry inhibitors include, but are not limited to, enfuvirdine Malaweto capsuleRivarol, cericivirroc, fostemavir, ibalizumab, PRO140, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary HIV fusion/entry inhibitors includes the compounds numbered 4001-4007 in figure 4A.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an HBV and/or HDV fusion/entry inhibitor. In some embodiments, the fusion/entry inhibitor can prevent HBV and/or HDV from entering hepatocytes. In some embodiments, the HBV and/or HDV fusion/entry inhibitor may prevent HBV and/or HDV cells from entering the desired proteins on hepatocytes. In some embodiments, the HBV and/or HDV fusion/entry inhibitor may bind to a sodium taurocholate cotransporter polypeptide. Examples of suitable HBV and/or HDV fusion/entry inhibitors include, but are not limited to, myrcludex B, cyclosporin a, ezetimibe, and SCYX1454139, HBIG, Ma18/7, KR127, 17.1.41/19.79.5, heparin, suramin, SALP, taurine derivatives, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary HBV and/or HDV fusion/entry inhibitors includes compounds numbered 4008 and 4019 in FIG. 4B.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an HIV integrase chain transfer inhibitor (INSTI). In some embodiments, the INSTI may block HIV integrase. Examples of INSTI include, but are not limited to, dolutegravir (A), (B), (C), and a) and C), and C)) EtivagivLetegravirBI 224436, globoid nan A, cabotegravir, bictegravir, MK-2048, and a pharmaceutically acceptable salt of any of the foregoing, and/or a combination thereof. A non-limiting list of exemplary HIV INSTI's includes compounds numbered 5001-5008 in FIG. 5.

In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with other antiviral compounds. Examples of other antiviral compounds include, but are not limited to, Bevirimat (bevirimat), BIT225, calanolide A, hydroxycarbamide, miltefosine, Serelicil, blue algae antiviral protein (cyanovirin-N), Gravessin (griffithsin), scytovirin, BCX4430, favila, GS-5734, mecitabine (mericitabine), MK-608 (7-deaza-2' -C-methyladenosine), NITD008, moroxydine, ribavirin, talivirin, ribavirin (triazavirin), ARB-1467, ARB-1740, ARC-520, ARC-521, ALN-HBV, TG1050, Tre, AT-61, AT-130, BCX4430, favila, Abiravir (umifovir), bucindovir disoproxil (bridovir), FGI 104, FGI 106, FGI, and pharmaceutically acceptable salts of any of the foregoing, And/or combinations thereof. A non-limiting list of exemplary other antiviral compounds includes compounds numbered 6001-6010 in FIG. 6A and 6011-6033 in FIG. 6B. Additional examples of other antiviral compounds include, but are not limited to, abzymes, enzymes, proteins, or antibodies. Additional examples of other antiviral compounds include, but are not limited to, ceragenins, including CSA-54, diarylpyrimidines, synergistic enhancers, and zinc finger protein transcription factors, as well as pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a viral maturation inhibitor. In some embodiments, the viral maturation inhibitor can inhibit the maturation of HBV and/or HDV. Examples of viral maturation inhibitors include, but are not limited to, bevimirat, BMS-955176, MPC-9055, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary viral maturation inhibitors includes the compounds numbered 7001-7003 in FIG. 7.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a capsid assembly modulator. In some embodiments, the capsid assembly modulator can stabilize the capsid. In some embodiments, the capsid assembly modulator can promote excessive capsid assembly. In some embodiments, the capsid assembly modulator can induce the formation of a non-capsid polymer of the capsid peptide. In some embodiments, the capsid assembly modulator can misdirect capsid assembly (e.g., reduce capsid stability). In some embodiments, the capsid assembly modulator can bind to HBV and/or HDV core proteins. Examples of capsid assembly modulators include, but are not limited to, NVR-3-778, AB-423, GLS-4, Bayer 41-4109, HAP-1, AT-1, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary capsid assembly modulators includes compounds numbered 8001 and 8006 of FIG. 8.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an FXR agonist. Examples of FXR agonists include, but are not limited to: cafestol; chenodeoxycholic acid; cholic acid; obeticholic acid; ursodeoxycholic acid; fexaramine;

a pharmaceutically acceptable salt of any of the foregoing, and/or a combination thereof. An additional non-limiting list of exemplary FXR agonists includes the compounds numbered 9001-9006 in figure 9.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereofSalts, or pharmaceutical compositions comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a cyclophilin/TNF inhibitor. Examples of cyclophilin/TNF inhibitors include, but are not limited to, infliximabAdalimumabTuzuzumabGollimumabEtanerceptThalidomideLenalidomidePomalidomideCyclosporin A, NIM811, Alisporivir (DEB-025), SCY-635, DEB-064, CRV-431, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary TNF/cyclophilin inhibitors includes the compounds numbered 10001-10014 in figure 10.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a TLR agonist. Examples of TLR agonists include, but are not limited to, GS-9620, ARB-1598, ANA-975, RG-7795(ANA-773), MEDI-9197, PF-3512676, IMO-2055, isatoribine, tremelimumab, SM360320, AZD-8848, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary TLR agonists includes the compounds numbered 11001 and 11013 in figure 11.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a polymerase inhibitor. Examples of polymerase inhibitors include, but are not limited to, telbivudine, beclabuvir, dasabuvir, deleobuvir, filibuvir, setrobuvir, sofosbuvir, radalbuvir, RG7128(mericitabine), PSI-7851, INX-189, PSI-352938, PSI-661, GS-6620, IDX-184, TMC649128, setrobivir, lomibuvir, nesbuvir, GS-9190(tegobuvir), VX-497(merimepodib), ribavirin, acyclovir, atevirpine, famciclovir, acyclovir, valganciclovir, cidofovir, JK-05, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary polymerase inhibitors includes compounds numbered 12001-12030 in FIG. 12.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a vaccine. Examples of vaccines include, but are not limited toABX-203, INO-1800, and pharmaceutically acceptable salts of any of the foregoing, and/or combinations thereof. A non-limiting list of exemplary vaccines includes those numbered 13001-13003 in FIG. 13.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an interferon. Examples of interferons include, but are not limited to, alpha-interferon, beta-interferon, delta-interferon, omega-interferon, tau interferon, x-interferon, consensus interferon, and sialic acid-interferon. Specific non-limiting examples include interferon alpha 1A, interferon alpha 1B, interferon alpha 2A, or a combination thereofInterferon alpha 2B, pegylated interferon alpha 2a (Roche), recombinant interferon alpha 2a (Roche), inhaled interferon alpha 2b (Aradigm), pegylated interferon alpha 2b (Human Genome Sciences/Novartis，Schering), recombinant interferon alpha 2b (Schering), pegylated interferon alpha 2b ( Schering, Viraferoneg, Schering), interferon beta-1 a (Serono, Inc. and Pfizer), consensus interferon alpha (alpha: (alpha.), (II,) and (III,) orValeant Pharmaceutical)。

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an siRNA or an ASO cccDNA inhibitor. In some embodiments, the siRNA or ASO cccDNA inhibitor can prevent cccDNA formation, eliminate existing cccDNA, disrupt existing cccDNA, and/or transcriptionally silence cccDNA.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a gene silencing agent. In some embodiments, the gene silencing agent reduces transcription of one or more target genes. In some embodiments, the gene silencing agent reduces translation of one or more genes of interest. In some embodiments, the gene silencing agent can be an oligonucleotide, a ribozyme, an siRNA, a morpholine, or a combination of any of the foregoing.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an HBx inhibitor. HBx is a polypeptide encoded by a hepatotropic virus that contributes to viral infection. In some embodiments, the HBx inhibitor reduces HBx transactivation activity. In some embodiments, the HBx inhibitor prevents or reduces binding of HBx to a mammalian cellular protein. In some embodiments, the HBx inhibitor reduces HBx arrest or reduces recruitment of kinases.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with an HBsAg secretion inhibitor. HBV and HDV surface antigens are proteins present on both new HBV particles and subviral particles. Subviral particles are non-infectious and are secreted in significant excess to infectious virus, potentially depleting the subject's immune system. In some embodiments, the HBsAg secretion inhibitor may reduce immune failure in the subject due to the surface antigen. In some embodiments, the HBsAg secretion inhibitor may promote an immune response to HBV and/or HDV in a subject.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a covalent closed circular dna (cccdna) inhibitor. In some embodiments, the cccDNA inhibitor can bind directly to cccDNA, can inhibit the conversion of relaxed circular dna (rcdna) to cccDNA, can reduce or silence the transcription of cccDNA, and/or can promote the elimination of existing cccDNA.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, may be used in combination with a compound of formula (I) or a pharmaceutically acceptable salt thereof described in PCT publication No. WO 2017/156262, filed 3/9 in 2017.

Some embodiments described herein relate to methods of treating HBV and/or HDV infection, which may include contacting a cell infected with HBV and/or HDV with an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of treating HBV and/or HDV infection, which may comprise administering to a subject having HBV and/or HDV infection an effective amount of a compound of formula (I), (ii) or a pharmaceutically acceptable salt thereof, in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of inhibiting replication of HBV and/or HDV, which may comprise contacting a cell infected with HBV and/or HDV with an effective amount of a compound of formula (I), (ii) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of inhibiting replication of HBV and/or HDV, which may comprise administering to a subject infected with HBV and/or HDV an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Examples of additional agents include those described herein, such as polymerase inhibitors, Protease Inhibitors (PI), fusion/entry inhibitors, interferons, FXR agonists, TLR agonists, viral maturation inhibitors, capsid assembly modulators, cyclophilin/TNF inhibitors, vaccines, siRNA or ASO cccDNA inhibitors, gene silencing agents, HBx inhibitors, HBsAg secretion inhibitors, and another antiviral compound, or a pharmaceutically acceptable salt of any of the foregoing.

Some embodiments described herein relate to methods of treating an HIV infection that can include contacting a cell infected with HIV infection with an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of treating an HIV infection that can include administering to a subject having an HIV infection an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of inhibiting replication of HIV that can include contacting a cell infected with HIV with an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof, in combination with one or more additional agents, such as those described herein. Other embodiments described herein relate to methods of inhibiting replication of HIV that can include administering to a subject infected with HIV an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents, such as those described herein. Examples of additional agents include those described herein, such as antiretroviral therapy (ART) agents, such as non-nucleoside reverse transcriptase inhibitors (NNRTIs), Nucleoside Reverse Transcriptase Inhibitors (NRTIs), Protease Inhibitors (PIs), fusion/entry inhibitors (also known as CCR5 antagonists), integrase chain transfer inhibitors (INSTI), and HIV other antiretroviral therapy compounds, or pharmaceutically acceptable salts of any of the foregoing.

In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered with one or more additional agents in a single pharmaceutical composition. In some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered with one or more additional agents in two or more separate pharmaceutical compositions. For example, a compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered in one pharmaceutical composition and at least one of the additional agents may be administered in a second pharmaceutical composition. If at least two additional agents are present, one or more of the additional agents may be in a first pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, and at least one of the other additional agents may be in a second pharmaceutical composition.

When using a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, and one or more additional agents, the amount administered and the dosing regimen are within the knowledge of one skilled in the art. For example, when standard of care treatment is conducted using art-recognized amounts and dosing regimens, a compound of formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof, may be administered in addition to the treatment, using an effective amount or dosing regimen as described herein, or in place of one of the agents of the combination therapy.

The order of administration of the compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents may vary. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered prior to all additional agents. In other embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered prior to the at least one additional agent. In other embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered concurrently with one or more additional agents. In other embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered after administration of at least one additional agent. In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof may be administered after all additional agents are administered.

In some embodiments, the combination of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts and prodrugs of any of the foregoing, can result in an additive effect. In some embodiments, the combination of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts and prodrugs of any of the foregoing, can result in a synergistic effect. In some embodiments, the combination of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts and prodrugs of any of the foregoing, can result in a strong synergistic effect. In some embodiments, the combination of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts and prodrugs of any of the foregoing, is not antagonistic.

As used herein, the term "antagonistic" means that the activity of the combination of compounds is lower compared to the sum of the compounds in combination when the activity of each compound is determined separately (i.e., as a single compound). As used herein, the term "synergistic effect" means that the combined activity of the compounds is greater than the sum of the individual activities of the compounds in combination when the activity of each compound is determined individually. As used herein, the term "additive effect" means that the combined activity of the compounds is about equal to the sum of the individual activities of the compounds in combination when the activity of each compound is determined individually.

A potential advantage of utilizing a compound of formula (I), or a pharmaceutically acceptable salt thereof, in combination with one or more additional agents of fig. 1-13, including a pharmaceutically acceptable salt of any of the foregoing, can be a reduction in the amount of the one or more compounds of fig. 1-13, including a pharmaceutically acceptable salt of any of the foregoing, required to effectively treat a condition disclosed herein, e.g., HBV, HDV and/or HIV, as compared to the amount required to achieve the same therapeutic effect when the one or more compounds of fig. 1-13, including a pharmaceutically acceptable salt of any of the foregoing, is administered without the compound of formula (I), or a pharmaceutically acceptable salt thereof. For example, when administered as a monotherapy, the amount of one or more compounds of fig. 1-13 (including pharmaceutically acceptable salts of any of the foregoing) required to achieve the same viral load may be less than the amount of the compound of fig. 1-13 (including pharmaceutically acceptable salts of any of the foregoing). Another potential advantage of using a compound of formula (I) or a pharmaceutically acceptable salt thereof in combination with one or more additional agents in figures 1-13, including a pharmaceutically acceptable salt of any of the foregoing, is that the use of two or more compounds with different mechanisms of action may result in a higher barrier against the development of resistant viral strains than would result if one compound were administered as monotherapy.

Additional advantages of utilizing a compound of formula (I), or a pharmaceutically acceptable salt thereof, in combination with one or more additional agents of fig. 1-13, including a pharmaceutically acceptable salt of any of the foregoing, may include a reduction to no cross-resistance between the compound of formula (I), or a pharmaceutically acceptable salt thereof, and one or more additional agents of fig. 1-13, including a pharmaceutically acceptable salt of any of the foregoing; different pathways for clearance of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts of any of the foregoing; there is little overlapping toxicity between the compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts of any of the foregoing; has little to no significant effect on cytochrome P450; there is little to no pharmacokinetic interaction between the compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more additional agents in figures 1-13, including pharmaceutically acceptable salts of any of the foregoing; a greater percentage of subjects achieving a sustained viral response than when the compound is administered as a monotherapy, and/or a reduction in the treatment time for a sustained viral response than when the compound is administered as a monotherapy.

Examples

The following specific examples are provided to further illustrate the various embodiments described herein.

In obtaining the compounds described in the examples below and the corresponding analytical data, the following experimental and analytical protocols were followed, unless otherwise indicated.

Unless otherwise indicated, the reaction mixture was magnetically stirred at room temperature (r.t.) under a nitrogen atmosphere. Where the solutions are "dried", they are usually passed over a medium such as Na₂SO₄Or MgSO 2₄Such as a desiccant. In thatIn the case of "concentrating" the mixture, solution and extract, they are usually concentrated under reduced pressure on a rotary evaporator.

Using a pre-packed column on silica gel (SiO)₂) Normal phase silica gel chromatography (FCC) was performed.

Preparative reverse phase high performance liquid chromatography (RP HPLC) was performed on a Gilson 281/215HPLC with either an xtate Prep RP18 column (5. mu.M, 25X 150mm) or a YMC-Actus Triart C18 column (5. mu.M, 30X 100mm) and the mobile phase of 1% ACN in 0.225% FA was held for 1min, then a gradient of 1% -23% ACN over 9min, followed by 2min at 95% ACN with a flow rate of 25 mL/min.

Mass Spectra (MS) were obtained on an Agilent G1969A LCMS-TOF. Mobile phase: 0.1% FA (formic acid) in water (solvent a) and 0.1% FA in ACN (solvent B); elution gradient: 0% -30% (solvent B) over 3 minutes and held at 30% for 1 minute at a flow rate of 1 mL/min; column: xbridge Shield RP 185 um, 2.1 × 50mm, ion source: an ESI source; ion mode: positive;

Spraying gas: nitrogen gas; flow of drying gas (N2): 51/min; the pressure of the sprayer is as follows: 30 psig; gas temperature: 325 ℃; capillary voltage: 3.5 KV; fragmentation voltage: 50V.

Nuclear Magnetic Resonance (NMR) spectra were obtained on a Bruker 400MHz or Varian 400MHz spectrometer. The definition of multiplicity is as follows: s is singlet, d is doublet, t is triplet, q is quartet, m is multiplet, br is broad. It will be appreciated that for compounds containing exchangeable protons, the protons may or may not be visible in the NMR spectrum, depending on the choice of solvent used to perform the NMR spectrum and the concentration of the compound in solution.

Chemical names were generated using ChemDraw Ultra 12.0, ChemDraw Ultra 14.0(Cambridge soft corp., Cambridge, MA) or ACD/name10.01 (Advanced Chemistry).

The compounds designated R or S are enantiomerically pure compounds with an undefined absolute configuration.

Intermediate 1: (1R, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropyl) silane First siliconAlkyl) oxy) methyl) cyclopent-1-ol and (1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) - 3- (((triisopropylsilyl) oxy) methyl) cyclopent-1-ol 。

Step A: (4S, 5R) -4- ((triisopropylsilyl) oxy) -5- (((triisopropylsilyl) oxy) Methyl) dihydrofuran-2 (3H) -one. The title compound was prepared according to the procedure described in PCT publication No. WO 2015/056213 (published on 23/4/2015).

And B: (4S, 5R) -4- ((triisopropylsilyl) oxy) -5- (((triisopropylsilyl) oxy) Methyl) tetrahydrofuran-2-ol. At-70 ℃ and N₂Next, DIBAL-H (diisobutylaluminum hydride) solution (1M, 56.21mL) was added dropwise over 1 hour to a solution of (4S, 5R) -4- ((triisopropylsilyl) oxy) -5- (((triisopropylsilyl) oxy) methyl) dihydrofuran-2 (3H) -one (10g, 22.48mmol) in THF (tetrahydrofuran) (100 mL). The temperature was kept below-55 ℃. The reaction mixture was stirred at-70 ℃ for a further 2 hours. The reaction mixture was quenched slowly with MeOH (methanol) (50mL) and diluted with EA (ethyl acetate) (100 mL). The inorganic material was filtered and the filter cake was washed with EA (100mL x 3). The filtrate was concentrated in vacuo to give a colorless oil. Purification (FCC, SiO)₂PE/EA-100/1 to 20/1) to give the title compound (8.2g, 81.63% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝5.61-5.30(m，1H)，4.77-4.50(m，1H)，4.33(m，1H)，4.20-4.02(m，1H)，3.87-3.59(m，2H)，3.44(m，1H)，2.24-2.01(m，1H)，1.16-1.03(m，42H)。

And C: (2R, 3S) -1, 3-bis ((triisopropylsilyl) oxy) hept-6-yne-2, 5-diol . At-70 ℃ and N₂Next, (4S, 5R) -4- ((triisopropylsilyl) oxy) -5- (((triisopropylsilyl) oxy) methyl) tetrahydrofuran-2-ol (8) was added over 0.5 hour04g, 17.99mmol) in THF (80mL) was added dropwise a solution of magnesium bromo (ethynyl) (0.5M, 107.94 mL). The temperature was kept below-55 ℃. The reaction mixture was allowed to warm to 30 ℃ and stirred at 30 ℃ for a further 2 hours. Reacting with saturated NH₄The Cl solution (50mL) was quenched slowly and then diluted with EA (100 mL). The organic layer was washed with brine (50 mL). Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂PE/EA-100/1 to 20/1) to give the title compound (3.1g, 36.44% yield).¹H NMR(400MHz，CDCl₃)δ＝4.69-4.70(m，1H)，4.13-4.14(m，1H)，3.83-3.85(m，2H)，3.27-3.29(m，1H)，2.73-2.74(m，1H)，2.44-2.45(m，1H)，2.09(s，1H)，2.04-2.09(m，2H)，1.05-1.09(m，42H)。

Step D: ((5S, 6R) -6-hydroxy-5, 7-bis ((triisopropylsilyl) oxy) hept-1-yn-3-yl) carbonic acid Ethyl ester. To a mixture of (2R, 3S) -1, 3-bis ((triisopropylsilyl) oxy) hept-6-yne-2, 5-diol (1g, 2.11mmol) and pyridine (501.85mg, 6.34mmol, 512.09. mu.L) in CH₂Cl₂To the mixture in (10mL) was added ethyl chloroformate (900mg, 8.29mmol, 789.47. mu.L), and the mixture was stirred at 0 ℃ for 2 hours. The reaction was quenched with saturated NaHCO₃The solution (20mL) was quenched slowly and then extracted with DCM (dichloromethane) (30 mL). The organic layer was washed with brine (50mL) and dried over anhydrous Na ₂SO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂PE/EA-100/1 to 20/1) to give the title compound as a colorless oil (800mg, 69.42% yield).¹H NMR(400MHz，CDCl₃)δ＝5.48-5.50(m，1H)，4.20-4.25(m，3H)，3.74-3.77(m，3H)，2.45-2.52(s，2H)，1.30-1.31(m，2H)，1.01-1.10(m，3H)，1.05-1.07(m，42H)。LCMS；ESI-MS：m/z567.20[M+Na]⁺。

Step E: o- ((6R, 7S) -9-ethynyl-3, 3-diisopropyl-2-methyl-11-oxo-7- ((triisopropylmethyl) Silyl) oxy) -4, 10, 12-trioxa-3-silatetradecan-6-yl) 1H-imidazole-1-thiocarboxylate. To ((5S, 6R) -6-hydroxy-)To a solution of ethyl 5, 7-bis ((triisopropylsilyl) oxy) hept-1-yn-3-yl) carbonate (28.00g, 51.38mmol) in DCM (250mL) was added TCDI (1, 1' -thiocarbonyldiimidazole) (91.57g, 513.85 mmol). The mixture was stirred at 25 ℃ for 12 hours. The reaction was quenched with water (200mL) and washed with brine (50mL) over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂PE/EA-20/1 to 5/1) to give the title compound (10.4g, 30.90% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝8.33(d，J＝5.60Hz，1H)，7.61(d，J＝8.40Hz，1H)，7.10-6.94(m，1H)，5.75-5.64(m，1H)，5.47-5.35(dd，J＝8.40Hz，J＝5.20Hz，1H)，4.73-4.51(m，1H)，4.31-4.18(m，2H)，4.18-4.09(m，1H)，3.94(dd，J＝7.00，10.60Hz，1H)，2.56-2.57(m，1H)，2.49-2.07(m，2H)，1.39-1.31(m，3H)，1.14-0.98(m，42H)。LCMS：ESI-MS：m/z 655.40[M+1]⁺。

Step F: ((3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) Alkyl) oxy) methyl) cyclopentyl) carbonic acid ethyl ester. To a solution of O- ((6R, 7S) -9-ethynyl-3, 3-diisopropyl-2-methyl-11-oxo-7- ((triisopropylsilyl) oxy) -4, 10, 12-trioxa-3-silatetradecan-6-yl) 1H-imidazole-1-thioformate (6.00g, 9.16mmol) in toluene (100mL) at 25 ℃ were added AIBN (azobisisobutyronitrile) (752.04mg, 4.58mmol) and tri-n-butyltin hydride (10.66g, 36.64mmol, 9.69 mL). The mixture was stirred at 105 ℃ for 3 hours under N2. The reaction was slowly quenched with a solution of KF (1.0M, 100mL) and then extracted with EA (100 mL). The organic layer was washed with brine (100mL) and dried over anhydrous Na ₂SO₄Drying, filtering, and concentrating under reduced pressure. Purification (FCC, SiO)₂PE/EA-300/1 to 100/1) to give the title compound (3.7g, 76.37% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝5.27(br，d，J＝3.4Hz，3H)，4.49-4.35(m，1H)，4.15-4.09(m，1H)，3.84-3.72(m，2H)，3.71-3.52(m，2H)，2.53-2.39(m，1H)，2.22(br，d，J＝6.8Hz，1H)，1.35-1.31(m，3H)，1.06-0.94(m，42H)。

Step G: (1R, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) Silyl) oxy) methyl) cyclopent-1-ol and (1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- ((triisopropylsilyl) oxy) methyl) cyclopent-1-ol. To a solution of ethyl ((3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) carbonate (900mg, 1.70mmol) in EtOH (ethanol) (3mL) was added NaOEt (289.49mg, 4.25 mmol). The mixture was stirred at 25 ℃ for 1 hour. The reaction mixture was concentrated under reduced pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate ═ 100/1 to 5/1 to give (1R, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopent-1-ol (230mg, 29.59% yield) as a colorless oil:¹H NMR(400MHz，CDCl₃) δ 5.43(s, 1H), 5.18(s, 1H), 4.56(s, 1H), 4.37(dd, J5.40, 10.00Hz, 1H), 3.65(dd, J5.40, 10.40Hz, 1H), 3.48-3.33(m, 1H), 3.09(d, J11.00 Hz, 1H), 2.88(s, 1H), 2.08-1.94(m, 2H), 1.17-1.05(m, 42H); and (1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopent-1-ol (95mg, 12.22% yield) as a colorless oil: ¹H NMR(400MHz，CDCl₃) δ ═ 5.28(s, 1H), 5.11(s, 1H), 4.58(d, J ═ 7.60Hz, 1H), 4.54-4.48(m, 1H), 3.87-3.81(m, 1H), 3.84(dd, J ═ 4.40, 9.80Hz, 1H), 3.76-3.69(m, 1H), 2.62(s, 1H), 2.15(d, J ═ 7.80Hz, 1H), 1.99-1.94(m, 1H), 1.10-1.01(m, 42H); and 80mg of the mixture of the title compounds.

Intermediate 2: (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Silyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol。

Method A：

Step A.2- (hydroxymethyl) cyclopent-2-en-1-one. To cyclopent-2-en-1-one (10g, 121.80mmol, 10.20mL) in CHCl₃To a solution in a mixture of (150mL) and MeOH (100mL) was added HCHO (13.05g, 160.78mmol, 11.97 mL). Then Me2PPh (phenyl dimethyl phosphine) (841.33mg, 6.09mmol) in CHCl₃(100mL) was added to the mixture. The mixture was stirred at 25 ℃ for 1 hour. The resulting mixture was concentrated in vacuo. The purification (of the FCC,40gflash column on silica eluting with a gradient of 10% to 70% ethyl acetate/petroleum ether at a rate of 40mL/min) afforded the title compound (24g, 87.87% yield) as a white solid. The reaction was carried out in two batches. ¹H-NMR(400MHz，CDCl₃)，δ＝7.51(dd，J＝1.2，2.5Hz，1H)，4.32-4.19(m，2H)，3.09(br s，1H)，2.58(td，J＝2.0，4.4Hz，2H)，2.42-2.30(m，2H)。

Step B.2- ((trityloxy) methyl) cyclopent-2-en-1-one. To a solution of 2- (hydroxymethyl) cyclopent-2-en-1-one (2g, 17.84mmol) in DCM (20mL) were added DMAP (4-dimethylaminopyridine) (392.24mg, 3.21mmol), TrtCl (triphenylchloromethane) (5.22g, 18.73mmol) and Et₃N (2.71g, 26.76mmol, 3.72 mL). The mixture was stirred at 25 ℃ for 16 hours. By addition of H₂The reaction mixture was quenched with O (50mL) and then extracted with DCM (50 mL). The combined organic layers were washed with brine (100mL) over anhydrous MgSO₄Dried and filtered. The filtrate was concentrated under reduced pressure. The purification (of the FCC,12gflash column on silica eluting with a gradient of 5% to 30% ethyl acetate/petroleum ether at a rate of 40mL/min) afforded the title compound (4.8g, 75.92% yield) as a white solid.¹H-NMR(400MHz，CDCl₃)，δ7.79(t，J＝1.8Hz，1H)，7.51-7.37(m，6H)，7.32-7.16(m，9H)，3.87(q，J＝2.6Hz，2H)，2.72-2.55(m，2H)，2.47-2.31(m，2H)ESI-MS：m/z 377.0[M+Na]⁺。

Step C. (S) -2- ((trityloxy) methyl) cyclopent-2-en-1-ol. At 0 ℃ adding BH₃-Me₂S (borane dimethyl sulfide) (10M, 5.64mL, 2 equiv.) was dissolved in DCM (35 mL). Reacting (3aR) -1-methyl-3, 3-diphenyl-3 a, 4, 5, 6-tetrahydropyrrolo [1, 2-c][1，3，2]Oxazaborolidine (1M, 5.64mL) was added to the above solution and stirred for 1 hour. Thereafter, a solution of 2- ((trityloxy) methyl) cyclopent-2-en-1-one (10g, 28.21mmol) in DCM (75mL) was added dropwise at 0 ℃ over 2 hours. Subjecting the reaction mixture to hydrogenation with H ₂O (100mL) was quenched and then extracted with DCM (2X 100 mL). The combined organic layers were washed with H₂O (200mL) wash over MgSO₄Dried and filtered. The resulting solution was concentrated under reduced pressure. The purification (of the FCC,40gflash column on silica eluting with a gradient of 5% to 15% ethyl acetate/petroleum ether at 30mL/min) afforded the title compound (48g, 79.55%) as a colorless oil. The reaction was carried out in 6 batches.¹H-NMR(400MHz，CDCl₃)，δ7.47-7.46(m，2H)，7.44(d，J＝0.7Hz，3H)，7.33-7.20(m，10H)，5.94-5.76(m，1H)，4.78(br d，J＝6.6Hz，1H)，3.88-3.76(m，2H)，2.60-2.43(m，1H)，2.35-2.19(m，2H)，2.14(br s，1H)，1.85-1.73(m，1H)。ESI-MS：m/z 379.1[M+Na]⁺。

Step D. (S) - ((((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methanetriyl) triphenyl. A solution of (S) -2- ((trityloxy) methyl) cyclopent-2-en-1-ol (46g, 129.05mmol) in DMF (dimethylformamide) (460mL) was treated with NaH (8.26g, 206.48mmol, 60% purity) and TBAI (tetrabutylammonium iodide) (23.83g, 64.52mmol) at 0 deg.C and stirred at 0 deg.C for 1 h. Benzyl bromide (BnBr) (26.49g, 154.86mmol, 18.39mL) was added at 0 ℃. The reaction mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was quenched with water (300mL) and extracted with EA (3X 300 mL). The organic layer was washed with brine/water (V/V250 mL/250 mL). Thereafter, the organic layer was passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. The purification (of the FCC,40gsilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 2% -10% at a rate of 35mL/min, to give (S) - ((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methanetriyl) triphenyl (110g, 95.44% yield) as a colorless oil. The reaction was carried out in 2 batches. ¹H-NMR(400MHz，CDCl₃)，δ＝7.50-7.48(m，2H)，7.48-7.46(m，3H)，7.39-7.16(m，15H)，6.02(d，J＝0.9Hz，1H)，4.72-4.64(m，1H)，4.57(s，1H)，4.53-4.47(m，1H)，3.85-3.77(m，1H)，3.73-3.65(m，1H)，2.57-2.45(m，1H)，2.38-2.26(m，1H)，2.25-2.15(m，1H)，1.93(tdd，J＝4.0，9.0，13.2Hz，1H)。LCMS：ESI-MS：m/z 469.1[M+Na]⁺。

Step E. (S) - (5- (benzyloxy) cyclopent-1-en-1-yl) methanol. A solution of (S) - ((((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methanetriyl) triphenyl (15g, 33.59mmol) in DCM (47mL) was treated with triethylsilane (Et₃SiH) (6.86g, 59.03mmol, 9.43mL) and trifluoroacetic acid (TFA) (3.83g, 33.59mmol, 2.49mL) and the mixture was stirred at 0 deg.C for 0.5 h. Additional TFA (1.91g, 16.79mmol, 1.24mL) was then added and stirred at 0 ℃ for 0.5 h. The reaction mixture was washed with saturated NaHCO₃The solution (300mL) was washed and then extracted with DCM (200mL)And (6) taking. The combined organic layers were washed with brine (300mL) over anhydrous MgSO₄Dried, filtered and concentrated under reduced pressure. The purification (of the FCC,12gflash column on silica eluting with a gradient of 0% to 30% ethyl acetate/petroleum ether at 30mL/min) to give (S) - (5- (benzyloxy) cyclopent-1-en-1-yl) methanol (15g, 57.21% yield) as a colorless oil. The reaction was carried out in 4 batches.¹H NMR(400MHz，CDCl₃)δ7.38-7.18(m，5H)，5.94-5.73(m，1H)，4.71-4.66(m，1H)，4.62(d，J＝11.7Hz，1H)，4.47(d，J＝11.7Hz，1H)，4.32-4.20(m，2H)，2.55-2.42(m，1H)，2.34-2.17(m，2H)，2.14(br，s，1H)，1.96-1.86(m，1H)。ESI-MS：m/z 226.8[M+Na]⁺。

Step F. (S) - ((((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methyl) benzene. To a solution of (S) - (5- (benzyloxy) cyclopent-1-en-1-yl) methanol (30g, 146.87mmol) in Dimethylformamide (DMF) (300mL) at 0 deg.C were added NaH (8.81g, 220.30mmol, 60% purity) and TBAI (27.12g, 73.43 mmol). The mixture was stirred at 0 ℃ for 1 h, then BnBr (37.68g, 220.30mmol, 26.17mL) was added at 0 ℃. The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was quenched with water (50mL) and extracted with EA (100 mL). The organic layer was washed with water/brine (V/V200 mL/200mL) and dried over anhydrous Na ₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (80gFlash column on silica eluting with a gradient of 0% to 30% ethyl acetate/petroleum ether at a rate of 40mL/min) to purify the residue to give (S) - (((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methyl) benzene (50g, crudeProduct) as a colorless oil. 1H NMR (400MHz, CDCl)₃)δ＝7.37-7.23(m，10H)，5.93(d，J＝1.1Hz，1H)，4.70-4.64(m，1H)，4.61-4.53(m，2H)，4.52-4.46(m，2H)，4.25-4.10(m，2H)，2.55-2.44(m，1H)，2.34-2.25(m，1H)，2.25-2.14(m，1H)，1.98-1.87(m，1H)。ESI-MS：m/z 317.0[M+Na]⁺。

Step G. (1S, 2S, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol and (1R, 2R, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol. OsO is added at 25 DEG C₄A sample of (0.1M, 254.77mL) and N-methyl-morpholine-N-oxide (NMO) (12.93g, 110.40mmol, 11.65mL) was added sequentially to (S) - (((5- (benzyloxy) cyclopent-1-en-1-yl) methoxy) methyl) benzene (25g, 84.92mmol) in THF (400mL) and H₂O (62 mL). After stirring for 16 hours at 25 ℃ by addition of Na₂SO₃(200g)、H₂The reaction was quenched with O (500mL) and EtOAc (1000 mL). The organic phase was separated and the aqueous phase was extracted with EtOAc (500 mL). The combined organic extracts were passed over anhydrous Na₂SO₄Dried, filtered and evaporated under reduced pressure. By flash chromatography on silica gel (40gSilica flash column, eluent ethyl acetate/petroleum ether gradient 0% -30% at 30mL/min) to afford (1S, 2S, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol and (1R, 2R, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol (50g, 89.64% yield) as a yellow oil. The reaction was carried out in 2 batches. ¹H NMR(400MHz，CDCl₃)δ7.39-7.32(m，4H)，7.31-7.23(m，6H)，4.59-4.51(m，3H)，4.61(s，1H)，4.47-4.39(m，1H)，4.14(br d，J＝2.6Hz，1H)，3.88-3.85(m，1H)，3.84(d，J＝9.5Hz，1H)，3.71(d，J＝9.7Hz，1H)，3.10(s，1H)，1.66-1.55(m，3H)，1.70-1.52(m，1H)。ESI-MS：m/z 351.0[M+Na]⁺。

Step H. (1R, 2S, 5S) -2- (benzyloxy) -1- ((benzyloxy) methyl) -5- (trityloxy) cyclopent-1-one- Alcohol(s). To a solution of (1S, 2S, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol and (1R, 2R, 5S) -5- (benzyloxy) -1- ((benzyloxy) methyl) cyclopentane-1, 2-diol (25g, 76.13mmol) in DCM (250mL) was added AgNO₃(25.86g, 152.25mmol) and 2, 4, 6-trimethylpyridine (27.67g, 228.38mmol, 30.18mL) and [ chloro (diphenyl) methyl]Benzene (25.47g, 91.35 mmol). The mixture was stirred at 25 ℃ for 1.5 hours. The reaction mixture was quenched with water (500mL) and extracted with DCM (500mL), and the organic layer was extracted with 10% acetic acid (AcOH) (500mL) and saturated NaHCO₃The solution (500mL) was washed. Thereafter, the organic layer was passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (40gSilica flash column, eluent ethyl acetate/petroleum ether gradient 0% -15% at 35mL/min) to afford (1R, 2S, 5S) -2- (benzyloxy) -1- ((benzyloxy) methyl) -5- (trityloxy) cyclopent-1-ol (60g, 55.93% yield, 81% purity) as a yellow oil. The reaction was carried out in 2 batches.¹H NMR(400MHz，CDCl₃)δ＝7.46-7.23(m，25H)，4.52(s，2H)，4.43(s，2H)，4.06(t，J＝6.9Hz，1H)，3.90-3.81(m，1H)，3.22(s，2H)，1.99-1.87(m，1H)，1.44-1.33(m，3H)。LCMS：MS：m/z 593.2[M+Na]⁺。

Step I. ((((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) )-2-fluorocyclopentyl) oxy) methane Triyl) triphenyl(s). To a solution of (1R, 2S, 5S) -2- (benzyloxy) -1- ((benzyloxy) methyl) -5- (trityloxy) cyclopent-1-ol (10g, 17.52mmol) in DCM (73mL) was added diethylaminosulfur trifluoride (DAST) (7.06g, 43.80mmol, 5.79 mL). Will be provided withThe mixture was stirred at-15 ℃ for 1.5 hours. The reaction mixture was washed with saturated NaHCO₃The solution (600mL) was washed and extracted with DCM (200 mL). The resulting solution was washed with brine (200mL) and Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (120gThe residue was purified on a silica flash column eluting with a gradient of 0% to 5% ethyl acetate/petroleum ether at a rate of 25mL/min to give (((((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentyl) oxy) methanetriyl) triphenyl (3.6g, 11.24% yield, 94% purity) as a yellow oil. The reaction was carried out in 3 batches.¹H NMR(400MHz，CDCl₃)δ7.54-7.19(m，25H)，4.50-4.45(m，4H)，4.16-4.12(m，2H)，3.54-3.46(m，1H)，3.32-3.22(m，1H)，2.03-1.95(m，1H)，1.38-1.31(m，3H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-177.68(s，1F)；LCMS：ESI-MS，m/z 595.1[M+Na]⁺。

Step J. (1S, 2S, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-ol. A solution of (((((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentyl) oxy) methanetriyl) triphenyl (3.5g, 6.11mmol) in DCM (10mL) was treated with Et₃SiH (1.25g, 10.76mmol, 1.72mL) and TFA (696.81mg, 6.11mmol, 452.48. mu.L). The mixture was stirred at 0 ℃ for 0.5 h. Additional TFA (348.41mg, 3.06mmol, 226.24. mu.L) was then added and stirred at 0 ℃ for 0.5 h. The reaction mixture was washed with saturated NaHCO ₃The solution (100mL) was washed and then extracted with DCM (2X 100 mL). The combined organic layers were washed with brine (100mL) over anhydrous MgSO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (12gSilica flash column, eluent ethyl acetate/petroleum ether gradient 0% -30% at 30mL/min) to afford (1S, 2S, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-ol (3g, 74.29% yield, 100% purity) as a colorless oil. The reaction was carried out in two batches.¹H NMR(400MHz，CDCl₃)δ＝7.40-7.18(m，10H)，4.96(d，J＝6.3Hz，1H)，4.57-4.50(m，3H)，4.49-4.43(m，1H)，4.04-3.85(m，2H)，3.83-3.62(m，2H)，2.08-1.87(m，2H)，1.61-1.44(m，2H)。LCMS：ESI-MS：m/z 352.9[M+Na]⁺。

Step K: ((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentyl) oxy) (tert-butyl) Radical) dimethylsilane. To a solution of (1S, 2S, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-ol (3.0g, 9.08mmol) in DMF (10mL) was added imidazole (3.71g, 54.48mmol) and tert-butyldimethylsilyl chloride (TBSCl) (3.42g, 22.70 mmol). The mixture was stirred at 25 ℃ for 12 hours. Will react with H₂O (50mL) was quenched and extracted with EA (50mL × 2). Subjecting the organic layer to anhydrous Na₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate 100/1 to 10/1 to give (((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentyl) oxy) (tert-butyl) dimethylsilane (3.96g, 98.08% yield) as a colorless oil. LCMS: ESI-MS: m/z 445.2, [ M + H ] ]⁺，467.1[M+Na]⁺。

Step L: (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2-fluoro-2- (hydroxymethyl) cyclopenta- 1-alcohols. To a solution of (((1S, 2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentyl) oxy) (tert-butyl) dimethylsilane (2.0g, 4.50mmol) in MeOH (100mL) was added Pd/C (1.5g, 10% pure) and acetic acid (HOAc) (675.27mg, 11.24mmol, 643.11 μ L). The suspension is degassed under vacuum and treated with H₂And purging for several times. At H₂Mixing under balloon (15psi)The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was filtered off and the filtrate was concentrated under reduced pressure. By column chromatography (SiO)₂The residue was purified with Petroleum Ether (PE)/ethyl acetate 100/1 to 5/1) to give (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2-fluoro-2- (hydroxymethyl) cyclopent-1-ol (1.1g, 92.49% yield) as a yellow oil.¹H NMR(400MHz，CD₃OD)δ＝4.29-4.10(m，2H)，3.91-3.67(m，2H)，2.28-2.13(m，1H)，2.11-1.97(m，1H)，1.65(dddd，J＝1.8，7.4，12.6，18.1Hz，1H)，1.53-1.38(m，1H)，1.00-0.84(m，9H)，0.07--0.07(m，6H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-185.71(br，dd，J＝15.8，28.2Hz，1F)。

Step M: (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) Alkyl) oxy) methyl) -2-fluorocyclopentan-1-ol. To a solution of (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2-fluoro-2- (hydroxymethyl) cyclopent-1-ol (1.1g, 4.16mmol) in DMF (5mL) was added imidazole (1.13g, 16.64mmol) and TBSCl (940.55mg, 6.24 mmol). The mixture was stirred at 25 ℃ for 12 hours. Will react with H ₂O (5mL) quench. The resulting solution was extracted with Ethyl Acetate (EA) (2X 50 mL). Subjecting the organic layer to anhydrous Na₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate from 100/1 to 10/1) to give (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) oxy) methyl) -2-fluorocyclopentan-1-ol (0.912g, 57.89% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝4.43-4.20(m，1H)，4.20-3.96(m，2H)，3.05(br，s，1H)，2.37-2.17(m，1H)，2.04-1.93(m，1H)，1.80-1.66(m，1H)，1.60-1.40(m，1H)，1.37-1.22(m，1H)，1.02-0.83(m，18H)，0.25-0.01(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-179.49(s，1F)。

And step N: (2S, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) Yl) oxy) methyl2-fluorocyclopentan-1-one. To a solution of (1S, 2R, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) oxy) methyl) -2-fluorocyclopentan-1-ol (760mg, 2.01mmol) in DCM (15mL) was added 1, 1, 1-triacetoxy-1, 1-dihydro-1, 2-phenyliodoxy-3 (1H) -one (Dess-Martin periodinane/or DMP) (1.70g, 4.01 mmol). The mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was concentrated under low pressure. The residue was stirred in EA/PE (10mL, 10/1) and filtered off. The filtrate was concentrated under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate from 100/0 to 30/1) to give (2S, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) oxy) methyl) -2-fluorocyclopentan-1-one (0.750g, 99.21% yield) as a colorless oil. ¹H NMR(400MHz，CDCl₃)δ＝4.54-4.42(m，1H)，3.84-3.70(m，2H)，2.60-2.44(m，1H)，2.27-2.09(m，2H)，2.09-1.92(m，1H)，0.88(d，J＝4.5Hz，18H)，0.15-0.05(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-182.78(s，1F)。

Step O: tert-butyl (((1S, 2S) -2- ((tert-butyldimethylsilyl) oxy) -1-fluoro-5-methylene ring Pentyl) methoxy) dimethylsilane. To a solution of methyl (triphenyl) phosphonium bromide (2.13g, 5.97mmol) in toluene (5mL) was added potassium 2-methylbutan-2-olate (3.02g, 5.97mmol, 3.47mL, 25% purity) and stirred at 25 ℃ for 1 hour. A solution of (2S, 3S) -3- ((tert-butyldimethylsilyl) oxy) -2- (((tert-butyldimethylsilyl) oxy) methyl) -2-fluorocyclopentan-1-one (750mg, 1.99mmol) in toluene (4mL) was then added and the mixture was stirred at 25 ℃ for 4 hours. The reaction mixture was washed with saturated NH₄Aqueous Cl (30mL) was quenched and extracted with EA (50mL × 2). Subjecting the obtained solution to anhydrous Na₂SO₄Dried and concentrated under low pressure. Purification (FCC, SiO)₂PE) gave tert-butyl (((1S, 2S) -2- ((tert-butyldimethylsilyl) oxy) -1-fluoro-5-methylenecyclopentyl) methoxy) dimethylsilane (686mg, 91.95% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ5.30-5.24(m，1H)，5.16(td，J＝2.1，4.3Hz，1H)，4.22(td，J＝5.9，11.1Hz，1H)，3.82-3.58(m，2H)，2.64-2.47(m，1H)，2.21-2.16(m，1H)，2.07-1.97(m，1H)，1.88-1.68(m，1H)，0.93-0.83(m，18H)，0.14-0.00(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ-182.77(s，1F)。

Step P: (1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Alkyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol and (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) Oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol. To CH at 25 ℃₃To a solution of COOH (6.73mg, 112.10. mu. mol, 6.41. mu.L) in DCM (3mL) was added selenium dioxide (12.44mg, 112.10. mu. mol) and 2-hydroperoxy-2-methylpropane (5.5M, 407.62. mu.L) and stirred at 25 ℃ for 30 minutes. A solution of tert-butyl (((1S, 2S) -2- ((tert-butyldimethylsilyl) oxy) -1-fluoro-5-methylenecyclopentyl) methoxy) dimethylsilane (420mg, 1.12mmol) in DCM (2mL) was added and stirred for 72 h. The reaction was diluted with DCM (5mL) and 1.0g of silica gel was added. The resulting mixture was concentrated under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate ═ 200/1 to 20/1) to give (1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (98mg, 22.38% yield) as a colorless oil:¹H NMR(400MHz，CDCl₃)δ5.54-5.45(m，2H)，4.74(br，t，J＝5.8Hz，1H)，4.43(td，J＝5.4，7.7Hz，1H)，3.86-3.57(m，2H)，2.21-2.07(m，1H)，1.89-1.74(m，1H)，0.89(d，J＝3.0Hz，18H)，0.18--0.05(m，12H)；¹⁹F NMR(376MHz，CDCl₃) δ — 167.29(s, 1F); and (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (50mg, 11.84% yield) as a colorless oil: ¹H NMR(400MHz，CDCl₃)δ＝5.62(dd，J＝1.1，3.3Hz，1H)，5.49(dd，J＝1.8，2.6Hz，1H)，4.47-4.35(m，1H)，4.33(br d，J＝9.7Hz，1H)，3.67(dd，J＝11.7，13.2Hz，1H)，3.54-3.39(m，1H)，2.76(d，J＝11.2Hz，1H)，2.13-2.00(m，1H)，1.97-1.82(m，1H)，0.89(d，J＝3.1Hz，18H)，0.15--0.04(m，12H)；¹⁹F NMR(376MHz，CDCl₃)δ＝-167.63(br，1F)。

Method B：

(1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol。

Step A: (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Alkyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl 4-nitrobenzoate. To a solution of (1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (product of Process A, step P, 185mg, 473.53. mu. mol) and P-nitrobenzoic acid (PNBA) (126.62mg, 757.66. mu. mol) in THF (2mL) at 0 deg.C was added diisopropyl azodicarboxylate (DIAD) (287.26mg, 1.42mmol, 276.21. mu.L) and triphenylphosphine (PPh)₃) (372.60mg, 1.42 mmol). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under reduced pressure. By column chromatography (SiO)₂PE/EA ═ 100/1 to 70/1) to give (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl 4-nitrobenzoate (150mg, 58.68% yield) as a colorless oil. LCMS: ESI-MS: m/z 562.2[ M + Na ] ]⁺。

And B: (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Alkyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol. (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl 4-nitrobenzoate (75mg, 138.94. mu. mol) was reacted with NH₃(7M, 2mL in CH₃In OH). The mixture was stirred at 25 ℃ for 1 hour. The reaction mixture was concentrated under reduced pressure. By column chromatography (SiO)₂PE/EA ═ 100/1 to 70/1) to give (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (51mg, 46.98% yield) as a colorless oil.

Intermediate 3: (3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl)-3-fluoro-2-methylenecyclopent-1-ol。

Step A: (2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-one. Dess-Martin periodinane (3.72g, 8.78mmol) was added to a solution of (1S, 2S, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-ol (intermediate 2, product of step J, 1.45g, 4.39mmol) in DCM (20 mL). The resulting mixture was stirred at 28 ℃ for 2 hours. The reaction mixture was washed with water (2X 100 mL). The resulting organic layer was separated and washed with saturated sodium bicarbonate solution (150mL) and brine (80mL), and dried over anhydrous sodium sulfate. The resulting solution was concentrated under low pressure. By flash chromatography on silica gel ( 12gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 0% to 10% at a rate of 20mL/min) to purify the residue to give (2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-one (1.29g, 89.51% yield) as a colorless oil. ESI-MS: m/z 351.0[ M + Na ]]⁺。

And B: ((((1R, 2S) -2- (benzyloxy) -1-fluoro-5-methylenecyclopentyl) methoxy) methyl) benzene. To methyl (triphenyl) phosphonium bromide (2.77g, 7.77 m) at 25 deg.Cmol) to a solution in toluene (16mL) was added potassium 2-methylbutan-2-olate (3.92g, 7.77mmol, 4.51mL, 25% purity) and stirred at 25 ℃ for 1 hour. A solution of (2R, 3S) -3- (benzyloxy) -2- ((benzyloxy) methyl) -2-fluorocyclopentan-1-one (850.00mg, 2.59mmol) in toluene (6mL) was added at 0 deg.C and stirred at 25 deg.C for an additional 2 h. Reacting with saturated NH₄Aqueous Cl (50mL) was quenched and extracted with EA (20mL × 2). The organic layer was washed with brine (50 mL). Subjecting the organic layer to anhydrous Na₂SO₄Drying and concentrating under low pressure. By flash chromatography on silica gel (12gThe residue was purified on a silica flash column eluting with ethyl acetate/petroleum ether at a gradient of 0% to 20% and a rate of 20mL/min to give (((((1R, 2S) -2- (benzyloxy) -1-fluoro-5-methylenecyclopentyl) methoxy) methyl) benzene (798mg, 94.45% yield) as a colorless oil. ¹H NMR(400MHz，CDCl₃)δ＝7.36-7.23(m，10H)，5.34-5.28(m，1H)，5.22-5.17(m，1H)，4.67-4.58(m，4H)，4.18-4.13(m，1H)，3.90-3.80(m，2H)，2.53-2.44(m，2H)，2.02-1.92(m，1H)，1.90-1.79(m，1H)。LCMS：ESI-MS：m/z 349.1[M+Na]⁺。

And C: (3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol。

At 25 ℃ to SeO₂(13.26mg, 119.48. mu. mol) to a solution in DCM (4mL) was added tert-butyl hydroperoxide (TBHP) (5.5M, 434.49. mu.L) and CH₃COOH (4.78mg, 79.66. mu. mol, 4.56. mu.L) and stirred at 25 ℃ for 30 minutes. A solution of ((((1R, 2S) -2- (benzyloxy) -1-fluoro-5-methylenecyclopentyl) methoxy) methyl) benzene (260.00mg, 796.56. mu. mol) in DCM (2mL) was added and stirred for 50 h. The reaction mixture was diluted with DCM (6mL) and 2g silica gel was added. The mixture was concentrated under low pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 30/1-8/1) to give (3R, 4S) -4- (benzyloxy) -3-((benzyloxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (0.115g, 42.16% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝7.41-7.18(m，10H)，5.74-5.47(m，2H)，4.84-4.55(m，5H)，4.41-4.23(m，1H)，3.93-3.43(m，3H)，2.38-2.17(m，1H)，1.98-1.86(m，1H)。LCMS：ESI-MS：m/z 365.1[M+Na]⁺。

Intermediate 4, N-Di-BOC-7H-pyrrolo [2, 3-d]Pyrimidin-4-amines。

Step A: n, N, N-Tri-BOC-7H-pyrrolo [2, 3-d]Pyrimidin-4-amines. To 7H-pyrrolo [2, 3-d]To a solution of pyrimidin-4-amine (500mg, 3.73mmol) in THF (10mL) was added 4-Dimethylaminopyridine (DMAP) (45.54mg, 372.75. mu. mol) and di-tert-butyl dicarbonate (Boc)₂O) (4.07g, 18.64mmol, 4.28 mL). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure. The residue was dissolved in EA (10 mL). The resulting solution was washed with 0.5N HCl (10mL) and brine (10mL) and concentrated under low pressure. By flash chromatography on silica gel ( 12gFlash column on silica eluting with ethyl acetate/petroleum ether at 25mL/min gradient from 0% to 30% to yield the title compound (0.68g, 41.99% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.85(s，1H)，7.90(d，J＝4.3Hz，1H)，6.63(d，J＝4.0Hz，1H)，1.70(s，9H)，1.42-1.31(m，18H)。LCMS：ESI-MS：m/z 435.2，[M+H]⁺；457.1[M+Na]⁺。

And B: n, N-Di-BOC-7H-pyrrolo [2, 3-d]Pyrimidin-4-amines. To N, N, N-Tri-BOC-7H-pyrrolo [2, 3-d]Pyrimidin-4-amine (0.650g, 1.50 mmo)l) solution in MeOH (20mL) saturated NaHCO was added₃Aqueous solution (10mL) and stirred at 50 ℃ for 1 hour. The reaction mixture was diluted with water (10mL) and extracted with EA (10mL × 3). The organic layer was washed with brine (10mL) and dried over anhydrous Na₂SO₄Dried, filtered and concentrated under low pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether with gradient of 0% -30%, speed of 20mL/min) to purify the residue to obtain N, N-Di-BOC-7H-pyrrolo [2, 3-d ]]Pyrimidin-4-amine (366mg, 73.17% yield) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.65(s，1H)，7.55(d，J＝3.5Hz，1H)，6.49(d，J＝3.5Hz，1H)，1.46-1.27(m，18H)。

Intermediate 5: 2-isobutyramido-9H-purin-6-yl diphenylcarbamate。

Step A: n- (6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide. At 30 ℃ and N₂Next, isobutyric anhydride (14.13g, 89.33mmol, 14.81mL) was added in one portion to a solution of 2-amino-1, 9-dihydro-6H-purin-6-one (5g, 33.08mmol) in DMF (50 mL). The reaction mixture was stirred at 155 ℃ for 4 hours. The reaction mixture was cooled to room temperature and the precipitate was filtered to give a white solid. The filter cake was washed with EtOH/H ₂O (1: 1, 50 mL. times.3) was washed and dried under reduced pressure. N- (6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (13.7g, 2 lots, 61.93mmol, 93.59% yield) was obtained as a white solid.¹H NMR(400MHz，DMSO)δ＝13.26(br，1H)，12.06(br，1H)，11.52(br，1H)，8.01(s，1H)，2.78-2.71(m，1H)，1.12-1.10(m，6H)。

Step B: n- (9-acetyl-6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide. At 30 ℃ and N₂Next, to a solution of N- (6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (3.6g, 16.27mmol) in DMF (20mL) was added acetyl acetate (4.32g, 42.31mmol, 3.96mL) all at once. The reaction mixture was stirred at 100 ℃ for 2 hours. The solvent was completely removed by evaporation under reduced pressure to give a white solid. The residue was suspended in EtOH (20mL), filtered, and the precipitate was washed with EtOH (5mL x 3) to give a white solid. N- (9-acetyl-6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (2.9g, 11.02mmol, 67.69% yield) was obtained as a white solid.¹H NMR(400MHz，DMSO)δ＝12.28(br，1H)，11.72(br，1H)，8.46(s，1H)，2.83-2.74(m，4H)，1.15(s，3H)，1.13(s，3H)。

And C: 9-acetyl-2-isobutyramido-9H-purin-6-yl diphenylcarbamate. At 25 ℃ and N₂Next, to a suspension of N- (9-acetyl-6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (2.9g, 11.02mmol) in pyridine (60mL) was added N, N-diisopropylethylamine (Hunig's base or DIPEA or DIEA) (2.85g, 22.03mmol, 3.84mL) in one portion. After addition of diphenylcarbamoyl chloride (2.81g, 12.12mmol), the reaction mixture was stirred at 25 ℃ for 2 hours. Water (4mL) was added to the reaction mixture, and the resulting mixture was stirred for 10 minutes. The solvent was completely removed by evaporation under reduced pressure to give a brown solid. The crude product was used directly in the next step without further purification. 9-acetyl-2-isobutyramido-9H-purin-6-yl diphenylcarbamate (6g, crude) was obtained as a brown solid.

Step D: 2-isobutyramido-9H-purin-6-yl diphenylcarbamate. 9-acetyl-2-isobutyramido-9H-purin-6-yldiphenyl carbamate (5.05g, 11.02mmol) in EtOH (40mL) and H₂The mixture in O (40mL) was stirred at 100 ℃ for 2 hours. The reaction was cooled to room temperature and the precipitate was filtered to give a brown solid. The residue was suspended in EtOH (30mL), filtered, and the filter cake was washed with EtOH (10mL x 3) to give a white solid. To obtain 2-isobutyramido-9H-purin-6-yl diphenylCarbamate (3.9g, 9.37mmol, 84.98% yield) as a white solid.¹H NMR(400MHz，DMSO)δ＝10.59(br，1H)，8.43(s，1H)，7.48-7.30(m，11H)，2.80-7.77(m，1H)，1.09(s，3H)，1.07(s，3H)。

Intermediate 6: 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione。

Step A: 1, 3-dibenzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione. At 30 ℃ and N₂Next, 5-methylpyrimidine-2, 4(1H, 3H) -dione (5g, 39.65mmol) was added to CH₃To a solution in CN (100mL) was added pyridine (14.70g, 185.84mmol, 15.00mL) in portions. After addition of benzoyl chloride (BzCl) (19.51g, 138.76mmol, 16.12mL), the reaction mixture was stirred at 30 ℃ for 12 h. The solvent was removed in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate 3: 1 to 1: 1) to give 1, 3-dibenzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione (25g, 2 lots, 74.78mmol, 94.30% yield) as a light yellow solid. LCMS: ESI-MS: 357.0[ M + Na ] M/z ]⁺。

And B: 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione. At 30 ℃ and N₂Next, to a solution of 1, 3-dibenzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione (6g, 17.95mmol) in dioxane (40mL) was added K in one portion₂CO₃(0.5M, 17.95 mL). The reaction mixture was stirred at 30 ℃ for 1 hour. The dioxane was removed under reduced pressure. The residue was purified by recrystallization from acetonitrile (5mL) and water (50mL) to give 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione (3.8g, 16.51mmol, 91.97% yield, 100% purity) as a white solid.¹H NMR(400MHz，CDCl₃)δ＝11.40(bs，1H)，7.94(br，d，J＝7.6Hz，2H)，7.77-7.76(m，1H)，7.62-7.54(m，3H)，1.82(s，3H)。LCMS：ESI-MS：m/z＝252.9[M+Na]⁺。

Intermediate 7 ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2- Methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate。

Step A: (4S, 5R) -4-hydroxy-5- (hydroxymethyl) dihydrofuran-2 (3H) -one. To (4S, 5R) -5- (hydroxymethyl) tetrahydrofuran-2, 4-diol (35g, 260.94mmol) in H at 0 deg.C₂Br was added to a solution in O (400mL)₂(125.10g, 782.82mmol, 40.36mL) and stirred at 25 ℃ for 16 h. By adding Na at 0 deg.C₂SO₃(solid) to quench the reaction, a clear yellow solution was obtained, which was concentrated under reduced pressure at 35 ℃ to remove the solvent. The residue was dissolved in EtOH (500mL) and Na was used ₂SO₃The (solid) was adjusted to pH 7 and then filtered. The filtrate was concentrated in vacuo. The residue was dissolved in DCM/EtOH (900mL/300mL) and stirred at 25 ℃ for 30 min and filtered. The filtrate was concentrated in vacuo to give crude (4S, 5R) -4-hydroxy-5- (hydroxymethyl) dihydrofuran-2 (3H) -one (126g, 953.72mmol, 91.37% yield) as a colorless oil. (4 batches).¹H NMR(400MHz，D₂O)δ＝4.53-4.45(m，2H)，3.85-3.76(m，1H)，3.75-3.65(m，1H)，2.98(dd，J＝7.0，18.6Hz，1H)，2.58-2.45(m，1H)。

And B: (2R, 3S) -5-oxo-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate. To a solution of (4S, 5R) -4-hydroxy-5- (hydroxymethyl) dihydrofuran-2 (3H) -one (20g, 151.38mmol) in pyridine (60mL) was added 2, 2-dimethylpropionyl chloride (41.98g, 348.18mmol, 42.84mL) dropwise at 0 ℃. The mixture was stirred at 45 ℃ for 12 hours. The reaction mixture was quenched with MeOH (40 mL). The reaction mixture was concentrated under reduced pressure. The residue was dissolved in EA (100mL) and the resulting solution was taken up with H₂O (100mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By column chromatographyThe residue was purified (PE/EA from 35/1 to 5/1) to give (2R, 3S) -5-oxo-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate (35g, 116.53mmol, 76.98% yield) as a white solid. 1H NMR (400MHz, CDCl) ₃)δ＝5.25(td，J＝1.7，7.4Hz，1H)，4.63(dt，J＝1.4，3.1Hz，1H)，4.41-4.34(m，1H)，4.31-4.24(m，1H)，3.02(dd，J＝7.6，18.9Hz，1H)，2.61(dd，J＝1.8，18.7Hz，1H)，1.22-1.18(m，18H)。

And C: (2R, 3S) -5-hydroxy-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate. To a solution of (2R, 3S) -5-oxo-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate (10g, 33.29mmol) in THF (100mL) at-60 deg.C was added diisobutylaluminum hydride (DIBAL-H, DIBAL) (1M, 99.88mL, 3 equiv.) and stirred at-60 deg.C for 3 hours. The reaction was quenched with MeOH (50mL) at-30 deg.C and diluted with EA (100 mL). The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography (PE/EA ═ 30/1 to 3/1) to give (2R, 3S) -5-hydroxy-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate (4.2g, 13.89mmol, 41.72% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝5.59-5.65(m，1H)，5.12-5.23(m，1H)，4.38-4.39(m，1H)，4.13-4.24(m，2H)，2.33-2.39(m，1H)，2.04-2.07(m，1H)，1.19-1.26(m，18H)。LCMS：ESI-MS：m/z＝604.3[2M+H]⁺。

Step D: (2R, 3S) -2, 5-dihydroxyhept-6-yne-1, 3-diylbis (2, 2-dimethylpropionate). To a solution of (2R, 3S) -5-hydroxy-2- ((pivaloyloxy) methyl) tetrahydrofuran-3-yl pivalate (4.2g, 13.89mmol) in THF (40mL) was added dropwise bromoethynylmagnesium (0.5M, 83.34mL) at-78 deg.C. The mixture was stirred at 25 ℃ for 2 hours. By addition of saturated NH₄The reaction mixture was quenched with Cl solution (50mL) to reach pH 7. The resulting mixture was extracted with EA (30mL) and washed with brine (2 x 30 mL). The combined organic layers were passed over anhydrous Na ₂SO₄Dried, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (PE/EA: 15/1 to 3/1) to give (2R, 3S) -2, 5-dihydroxyheptanone-6-alkynyl-1, 3-diylbis (2, 2-dimethylpropionate) (4g, 12.18mmol, 87.69% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝5.03-5.11(m，1H)，4.34-4.56(m，1H)，4.21-4.25(m，1H)，4.11-4.16(m，1H)，3.94-3.99(m，1H)，2.95-3.02(br，s，1H)，2.46-2.49(dd，J＝6.15，2.13Hz，1H)，1.98-2.25(m，3H)，1.20-1.23(m，18H)。LCMS：ESI-MS：m/z＝351.1[M+Na]⁺。

Step E: (2R, 3S) -5- ((tert-butyldimethylsilyl) oxy) -2-hydroxyhept-6-yne-1, 3-diylbis (2, 2-Dimethylpropionate). To a solution of (2R, 3S) -2, 5-dihydroxyhept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (4g, 12.18mmol) in DMF (6mL) were added imidazole (2.49g, 36.54mmol) and tert-butyl-chloro-dimethyl-silane (2.75g, 18.27mmol, 2.24mL) and stirred at 25 ℃ for 12 h. The reaction mixture was quenched with MeOH (10mL) and extracted with EA (30 mL). The resulting solution was washed with brine (15mL x 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (PE/EA ═ 35/1 to 3/1) to give (2R, 3S) -5- ((tert-butyldimethylsilyl) oxy) -2-hydroxyhept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (2.5g, 5.65mmol, 46.37% yield) as a yellow oil.¹H NMR(400MHz，CDCl₃)δ＝5.03-5.15(m，1H)，4.40-4.53(m，1H)，4.06-4.17(m，2H)，3.96-4.01(m，1H)，2.73-2.91(m，1H)，2.42-2.45(dd，J＝11.04，2.26Hz，1H)，2.02-2.20(m，2H)，1.19-1.27(m，18H)，0.89-0.91(m，9H)，0.09-0.19(m，6H)。LCMS：ESI-MS：m/z＝465.1[M+Na]⁺。

Step F: (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-oxohept-6-yne-1, 3-diylbis (2, 2-dimethyl propionate). To a solution of (2R, 3S) -5- ((tert-butyldimethylsilyl) oxy) -2-hydroxyhept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (16g, 36.15mmol) in DCM (100mL) at 0 deg.C was added Dess-Martin periodinane (45.99g, 108.44mmol, 33.57mL) with stirring at 25 deg.CStirring for 2 hours. By addition of saturated NaHCO₃And Na₂The reaction mixture was quenched with a solution of SO3 (1: 1, 100 mL). The resulting solution was washed with brine (100mL x 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. The residue was purified by silica gel column (PE/EA ═ 250/1 to 20/1) to give (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-oxohept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (15g, 34.04mmol, 94.18% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝5.24-5.10(m，1H)，4.53-4.40(m，1H)，4.23-3.98(m，1H)，3.00-2.86(m，1H)，2.79-2.64(m，1H)，2.41-2.27(m，1H)，2.24-2.00(m，2H)，1.24-1.02(m，18H)，0.88-0.70(m，9H)，0.15-0.07(m，6H)。LCMS：ESI-MS：m/z＝463.2[M+Na]⁺。

Step G: (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-methylenehept-6-yne-1, 3-diylbis (2, 2-Dimethylpropionate). At 0 ℃ and N₂Next, n-BuLi (2.5M, 680.82. mu.L) was added dropwise to a solution of bromomethyltriphenylphosphine (648.55mg, 1.82mmol) in THF (2.5 mL). The mixture was stirred at 0 ℃ for 0.5 h. A solution of (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-oxohept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (0.5g, 1.13mmol) in THF (2.5mL) was added dropwise at 0 ℃. Reacting with saturated NH ₄Cl solution (2mL) was quenched slowly. The resulting mixture was extracted with EA (20mL × 2). The combined organic phases were washed with brine (20mL) over anhydrous Na₂SO₄Drying and filtering. The filtrate was concentrated in vacuo to give a black oil. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate from 100/1 to 20/1) to give (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-methylenehept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (0.3g, 683.88 μmol, 60.27% yield) as a colorless oil.¹H-NMR(400MHz，CDCl₃)δ＝5.33(dd，J＝4.2，9.3Hz，1H)，5.17-5.01(m，2H)，4.54-4.43(m，2H)，4.33(ddd，J＝2.1，6.0，8.3Hz，1H)，2.34-2.27(m，1H)，2.08-1.89(m，2H)，1.19-0.99(m，18H)，0.84-0.70(m，9H)，0.02(d，J＝13.0Hz，6H)。LCMS：ESI-MS：m/z＝461.2[M+Na]⁺。

Step H: (1S) -3- ((tert-butyldimethylsilyl) oxy) -1- ((R) -2- ((pivaloyloxy) methyl) Oxiran-2-yl) pent-4-yn-1-yl pivalate. To a solution of (3S) -5- ((tert-butyldimethylsilyl) oxy) -2-methylenehept-6-yn-1, 3-diylbis (2, 2-dimethylpropionate) (1.3g, 2.96mmol) in DCM (20mL) was added m-chloroperoxybenzoic acid (m-CPBA) (1.80g, 8.89mmol, 85% purity) at 0 ℃. The mixture was stirred at 45 ℃ for 12 hours. The reaction mixture was diluted with DCM (15mL) and saturated NaHCO₃The solution (10mL) was quenched. The organic phase was washed with brine (20mL) over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (PE/EA ═ 70/1 to 20/1) to give (1S) -3- ((tert-butyldimethylsilyl) oxy) -1- ((R) -2- ((pivaloyloxy) methyl) oxiran-2-yl) pent-4-yn-1-yl pivalate (1g, 2.20mmol, 74.2% yield) as a colorless oil. ¹H NMR(400MHz，CDCl₃)δ＝5.22-5.07(m，1H)，4.48-4.38(m，1H)，4.36-4.28(m，1H)，4.27-4.19(m，1H)，2.88-2.72(m，2H)，2.47-2.40(m，1H)，2.13-2.04(m，2H)，1.26-1.18(m，18H)，0.93-0.85(m，9H)，0.12(d，J＝10.0Hz，6H)。LCMS：ESI-MS：m/z＝455.2[M+H]⁺。

Step I: ((1S, 3R, 5S) -3- ((tert-butyldimethylsilyl) oxy) -1- (hydroxymethyl) -2-methylene- 5- (pivaloyloxy) cyclopentyl) methyl pivalate. Under Ar, Zn (2.59g, 39.59mmol) and Cp₂TiCl₂A mixture of (3.28g, 13.19mmol, 3 equiv.) in THF (70mL) was stirred at 25 deg.C for 1 hour. Under Ar, a solution of (1S) -3- ((tert-butyldimethylsilyl) oxy) -1- ((R) -2- ((pivaloyloxy) methyl) oxiran-2-yl) pent-4-yn-1-yl pivalate (2g, 4.40mmol) in THF (90mL) was added and the mixture was stirred at 25 ℃ for 16 h. The mixture was washed with saturated NH₄The Cl solution (50mL) was quenched and stirred for 2 hours. The resulting solution was extracted with EA (60mL 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (12gFlash column on silica eluting with ethyl acetate/petroleum ether gradient 0% to 6.7% at 35mL/min to afford ((1S, 3R, 5S) -3- ((tert-butyldimethylsilyl) oxy) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.55g, 1.20mmol, 13.69% yield) as a colorless oil;¹H NMR(400MHz，CDCl₃)δ＝5.33(d，J＝2.0Hz，1H)，5.15-5.13(m，1H)，5.12(d，J＝2.2Hz，1H)，4.51-4.41(m，1H)，4.14-4.01(m，2H)，3.76(s，2H)，2.54-2.44(m，1H)，1.76-1.66(m，1H)，1.20-1.16(m，12H)，0.93-0.87(m，12H)，0.12-0.06(m，9H)；LCMS：ESI-MS：m/z＝479.3[M+H]+; and ((1R, 3R, 5S) -3- ((tert-butyldimethylsilyl) oxy) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (1.8g, 3.94mmol, 44.80% yield) as a colorless oil.

Step J: ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyl di Methylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of ((1S, 3R, 5S) -3- ((tert-butyldimethylsilyl) oxy) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (1.1g, 2.41mmol) in DCM (12mL) was added AgNO₃(818.32mg, 4.82mmol, 810.21. mu.L), 2, 4, 6-trimethylpyridine (collidine) (583.76mg, 4.82mmol, 636.60. mu.L) and 4, 4' -dimethoxytrityl chloride (DMTrCl) (1.22g, 3.61 mmol). The mixture was stirred at 25 ℃ for 2 hours. The mixture was quenched with MeOH (1mL) and the solvent was removed at low pressure. By flash chromatography on silica gel (4gThe residue was purified on a silica flash column eluting with ethyl acetate/petroleum ether in a gradient of 0% to 5% at a rate of 22mL/min to give ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyldimethylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (1.38g, 1.82mmol, 75.48% yield, 100% purity) as a white foam. ¹H NMR(400MHz，CDCl₃)δ＝7.27-7.43(m，7H)，7.17-7.24(m，2H)，6.78-6.81(m，4H)，5.26-5.45(m，2H)，5.04-5.08(dd，J＝9.16，6.40Hz，1H)，4.45-4.50(m，1H)，4.24-4.26(d，J＝11.04Hz，1H)，3.95-4.01(m，1H)，3.78(s，6H)，3.37-3.39(d，J＝9.03Hz，1H)，3.21-3.23(d，J＝9.29Hz，1H)，2.34-2.40(dt，J＝12.55，6.53Hz，1H)，1.66-1.73(dt，J＝12.05，8.91Hz，1H)，1.06-1.14(m，9H)，0.89-1.04(m，18H)，0.05-0.12(m，6H)。LCMS：ESI-MS：m/z＝781.4[M+Na]⁺。

Step K: ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-ylidene Methyl-5- (pivaloyloxy) cyclopentyl) methyl pivalate. ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyldimethylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (1.38g, 1.82mmol) was treated with tetra-n-butylammonium fluoride (TBAF) (1M, 5.45mL) at 25 ℃ for 1.5 hours. The mixture was extracted with EA (50mL) and washed with brine (50 mL). Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (12gSilica fast column with eluent gradient of 3-17%% ethyl acetate/petroleum ether, speed 35mL/min) to give ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.989g, 1.49mmol, 81.84% yield, 97% purity) as a colorless oil.¹H-NMR(400MHz，CDCl₃)，δ＝7.40-7.39(m，2H)，7.29-7.21(m，7H)，6.82-6.80(m，4H)，5.47-5.42(m，2H)，5.15-5.11(m，1H)，4.53-4.47(m，2H)，4.22-4.06(m，2H)，3.78(s，6H)，3.42-3.32(m，2H)，2.49-2.42(m，1H)，1.80-1.71(m，1H)，1.14(s，9H)，0.97(s，9H)。LCMS：ESI-MS：m/z＝667.2[M+Na]⁺。

Intermediate 8.1- ((4S, 5R) -5- ((S) -1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1- Yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-one 。

Step A: 1- ((4S, 5R) -5- ((R) -1-hydroxy-2- ((4-methoxyphenyl) diphenylmethoxy) ethyl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-ol. Dried 2, 3-O-isopropylidene- β -D-ribofuranose (prepared according to Mandal, Sukhendu B.and Achari, base Synthetic Communications, 23(9), 1239-44; 1993) (7.6g, 16mmol) was dissolved in 160mL of a 0.5M solution of ethynylmagnesium bromide in THF and allowed to stand at room temperature overnight. To react with NH₄The Cl solution was quenched and the product was extracted with EtOAc. Passing the organic layer through NaSO₄Dried, evaporated and purified by column chromatography using a gradient of 10% to 40% EtOAc in hexanes. 7.47g of the title compound (93.7%) were obtained as a single isomer.¹H-NMR(dmso-d6)δ：7.44-7.40(m，4H)，7.38-7.28(m，8H)，6.84-6.82(m，2H)，5.87(s，1H)，4.42-4.40(d，1H)，4.18-3.90(m，3H)，3.65(s，3H)，3.21(s，1H)，3.08-2.98(m，2H)，1.22(s，3H)，1.18(s，3H)。

Step B. (1R) -1- ((4R, 5R) -5- (1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) - 2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-ol. To a solution of 1- ((4S, 5R) -5- ((R) -1-hydroxy-2- ((4-methoxyphenyl) diphenylmethoxy) ethyl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-ol (7.3g, 15mmol) in anhydrous DMF (100mL) was added imidazole (1.5g, 22.5mmol) and TBSCl (3.4g, 22 mmol). The reaction mixture was left at room temperature overnight, quenched with water, and the product extracted with EtOAc. Passing the organic layer through NaSO ₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO2, gradient using 0% to 25% EtOAc in hexanes) gave the title compound (7.8g, 86%).¹H-NMR(DMSO-d₆)δ：7.45-7.41(m，4H)，7.36-7.24(m，8H)，6.88-6.82(m，2H)，5.30(br.s，1H)，4.80(s，1H)，4.20-3.95(m，3H)，3.70(s，3H)，3.36(s，1H)，3.05-2.95(m，2H)，1.38(s，3H)，1.18(s，3H)，0.90(s，9H)，0.10(s，6H)。

Step C.1- ((4S, 5R) -5- ((S) -1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) - 2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-one. Will be provided with(A solution of 1R) -1- ((4R, 5R) -5- (1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-ol (7.8g, 13mmol) and Dess-Martin periodinane (8.3g, 20mmol) in DCM (70mL) was stirred at room temperature overnight. The reaction mixture was washed with Na₂S₂O₃And NaHCO₃Quenched and extracted with EtOAc. Passing the organic phase through NaSO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂Gradient 0% to 25% EtOAc in hexanes) to give the title compound (6.6g, 85%).¹H-NMR(dmso-d6)δ：7.40-7.20(m，12H)，6.88-6.81(m，2H)，4.60(d，1H)，4.47(s，1H)，4.36-4.31(m，1H)，3.68(s，3H)，3.19(s，1H)，1.98(s，1H)，1.25(s，3H)，1.10(s，3H)，0.87(s，9H)，0.00(s，6H)。

Intermediate 9.(6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f][1， 3，5，2，4]Trioxasidiocin-6 a (6H) -carbonitrile。

Step A: tert-butyl (((S) -1- ((4R, 5R) -5- (3- ((4-methoxyphenyl) diphenylmethoxy) propane-1-) En-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane. To a suspension of methyltriphenylphosphonium bromide (3.69g, 10.3mmol) in THF (12mL, 0.87M) cooled to 0 deg.C was added dropwise n-butyllithium (n-BuLi) (2.5M hexane, 3.8mL, 9.49 mmol). After 30 minutes at 0 ℃, a solution of 1- ((4S, 5R) -5- ((S) -1- ((tert-butyldimethylsilyl) oxy) prop-2-yn-1-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) -2- ((4-methoxyphenyl) diphenylmethoxy) ethan-1-one (intermediate 8, 1.07g, 1.88mmol) in THF (18.8mL, 0.100M) was added dropwise via cannula. The heterogeneous yellow solution was stirred at room temperature overnight. The now brown heterogeneous solution was cooled to 0 ℃, quenched with MeOH and brine, and extracted with EtOAc. The organic layer was dried (Na)₂SO₄) Filtered and concentrated in vacuo to give a yellow oil. Purification (FCC, SiO)₂0% -15% EtOAc/hexanes) gave tert-butyl ((((S) -1- ((4R, 5R) -5- (3- ((4-methoxyphenyl) diphenylmethoxy) prop-1-en-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane as a colorless oil (0.97g, 91%).¹H NMR(400MHz，CDCl₃)：δ7.46-7.20(m，12H)，6.83-6.81(m，2H)，5.42(d，J＝0.8，1H)，4.76(d，J＝6.0，1H)，4.22(dd，J＝7.2，2.0，1H)，3.92(dd，J＝7.2，5.6，1H)，3.79(s，3H)，3.67(d，J＝12，1H)，3.59(d，J＝12，1H)，2.36(d，J＝2.0，1H)，1.43(s，3H)，1.37(s，3H)，0.76(s，9H)，0.06(s，3H)，-0.05(s，3H)。

Step B. tert-butyl (((1S) -1- ((4R, 5S) -5- (2- (((4-methoxyphenyl) diphenylmethoxy) methyl) Oxiran-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane. To a solution of tert-butyl (((S) -1- ((4R, 5R) -5- (3- ((4-methoxyphenyl) diphenylmethoxy) prop-1-en-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane (4.74g, 7.92mmol) cooled to 0 ℃ in CH₂Cl₂To the solution in (58mL, 0.15M) was added 3-chloroperbenzoic acid (2.13g, 9.50mmol) in one portion. The colorless solution was stirred at room temperature overnight. The reaction mixture was washed with NaHCO₃Quench (saturated aqueous) and separate the two layers and extract the aqueous layer with EtOAc. The combined organic extracts were dried (Na)₂SO₄) Filtered and concentrated in vacuo to give a crude yellow oil. Purification (FCC, SiO2, 0% -15% EtOAc/hexanes) afforded tert-butyl (((1S) -1- ((4R, 5S) -5- (2- (((4-methoxyphenyl) diphenylmethoxy) methyl) oxiran-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane, the primary epoxide (2.93g, 60%) (as a colorless oil) and the secondary epoxide (1.38g, 28%) (as a colorless oil). Primary epoxides:¹H NMR(400MHz，CDCl₃)：δ7.47-7.44(m，4H)，7.35-7.21(m，8H)，6.84-6.82(m，2H)，4.83(d，J＝5.6，1H)，4.38(dd，J＝6.4，2.0，1H)，3.96(t，J＝6.0，1H)，3.79(s，3H)，3.61(d，J＝11，1H)，3.18(d，J＝5.2，1H)，3.12(d，J＝10，1H)，2.78(d，J＝5.2，1H)，2.32(d，J＝1.6，1H)，1.44(s，3H)，1.40(s，3H)，0.78(s，9H)，0.00(s，6H)。

step C. ((3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxybenzene) Yl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole- 4-yl) methanol. The RBFs (Note: all RBFs used were vacuum dried using a heat gun under argon and cooled under Ar (g) flow THF was degassed) was charged with bis (cyclopentadienyl) titanium (IV) dichloride (Cp)₂TiCl₂) (2.41g, 9.40mmol) and dry stirred for 5-10 minutes, then evacuated and filled with Ar (g). This process was repeated 3 times, taking care not to disturb the solids. Degassed THF (63mL, 0.15M) was added and the resulting Cp₂TiCl₂The THF solution of (a) was evacuated, refilled with Ar, and the process was repeated 3 times. Zinc (1.84g, 28.2mmol) was then added and the resulting heterogeneous solution was degassed once or twice again. The resulting dark green solution was stirred for 1 hour. A solution of tert-butyl (((1S) -1- ((4R, 5S) -5- (2- (((4-methoxyphenyl) diphenylmethoxy) methyl) oxiran-2-yl) -2, 2-dimethyl-1, 3-dioxolan-4-yl) prop-2-yn-1-yl) oxy) dimethylsilane (1.93g, 3.13mmol) in degassed THF (31.3mL, 0.10M) was added in a gentle stream via a cannula, followed by 2 flushes. After the addition of the starting material, the resulting dark blue solution was degassed a final time and stirred for 24 hours, during which time it became a very dark blue solution. To the darkened blue solution cooled to 0 deg.C was added 50mL of saturated NH ₄Aqueous Cl and stirred vigorously at room temperature overnight. The reaction mixture was filtered and concentrated in vacuo to remove the organic layer, and extracted with EtOAc (2-3 times) over Na₂SO₄Dried, filtered and concentrated in vacuo to give a yellow foamy oil. The crude oil ((3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d [ -d ] H][1，3]Dioxol-4-yl) methanol was used in the next step without further purification.¹H NMR(400MHz，CDCl₃)：δ7.38-7.36(m，4H)，7.29-7.19(m，8H)，6.83-6.80(m，2H)，5.29(d，J＝2.0，1H)，4.90(d，J＝2.8，1H)，4.84(m，1H)，4.58(t，J＝5.6，1H)，4.45(d，J＝5.6，1H)，3.79(s，3H)，3.77(dd，J＝9.6，4.8，1H)，3.65(dd，J＝9.6，9.6，1H)，3.29(d，J＝8.4，1H)，3.16(d，J＝8.4，1H)，2.36(dd，J＝9.6，4.8，1H)，1.44(s，3H)，1.32(s，3H)，0.95(s，9H)，0.15(s，3H)，0.12(s，3H)。

Step D. (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxybenzene) Yl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole- 4-Formaldehyde. To ((3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ] cooled to 0 deg.C][1，3]Dioxolen-4-yl) methanol (1.93g, 3.13mmol) in CH₂Cl₂To a colorless solution (31.3mL, 0.10M) was added Dess-Martin periodinane (1.68g, 3.76 mmol). The reaction mixture was stirred at room temperature for 2 hours and then passed Filtration was performed with 10mL of 0.4M NaHCO₃/0.4M NaS₂O₃Washing with CH₂Cl₂Back extraction and drying (Na)₂SO₄) And concentrated in vacuo to give a crude oil. Purification (FCC, SiO2, 10% EtOAc in hexanes) afforded (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d [ -d][1，3]Dioxol-4-carbaldehyde as a colorless oil. The colorless oil was used in the next step (1.92g, 3.13 mmol).

Step E. (E) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) Yl) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxol-4-carbaldehyde oxime. To (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]To a solution of dioxole-4-carbaldehyde (1.92g, 3.13mmol) in pyridine (pyr) (31mL, 0.10M) was added hydroxylamine hydrochloride (0.87g, 12.5mmol) in one portion and stirred overnight. The reaction mixture was concentrated in vacuo and concentrated in EtOAc/H₂And (4) distributing among the O. The aqueous layer was extracted with EtOAc (2 times) and the combined organic extracts were dried (Na) ₂SO₄) Filtered and concentrated in vacuo to give a pale yellow oilA compound (I) is provided. Purification (FCC, SiO)₂0% -20% EtOAc/hexanes) to give (E) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d [ -d][1，3]Dioxol-4-carbaldehyde oxime as a colorless oil (1.97g, 3.13 mmol).

Step F. (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxybenzene) Yl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole- 4-carbonitriles. To (E) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ] cooled to 0 deg.C][1，3]To a solution of dioxol-4-carbaldehyde oxime (1.97g, 3.13mmol) in Acetonitrile (ACN) (31.3mL, 0.10M) was added 1, 1' -Carbonyldiimidazole (CDI) (0.761g, 4.70mmol) in one portion. The reaction mixture was stirred at room temperature overnight. The volume was then reduced to about 1/2 of the initial volume and the reaction mixture was heated to 35 ℃ to accelerate the reaction. After heating for 2 hours, the reaction mixture was cooled and concentrated in vacuo and concentrated in EtOAc/3-4mL H ₂And (4) distributing among the O. The aqueous layer was extracted with EtOAc and dried (Na)₂5O₄) Filtered and concentrated in vacuo to give a crude oil. Purification (FCC, SiO)₂0% -10% EtOAc/hexanes) to give (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole-4-carbonitrile as a colorless oil (1.29g, 67% in 4 steps).

Step G. (3aR, 4S, 6S, 6aS) -6-hydroxy-4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole-4-carbonitrile. To the cooled to 0 deg.C (3aR, 4S, 6S, 6aR) -6- ((tert-butyldimethylsilyl) oxy) -4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ℃][1，3]TBAF (1.0M THF, 3.16mL, 3.16mmol) was added dropwise to a solution of dioxole-4-carbonitrile (1.29g, 2.11mmol) in THF (21mL, 0.10M). The reaction mixture was stirred at room temperature for 1.5 hours. The reaction mixture was quenched with silica gel, filtered and concentrated in vacuo to give a crude oil. Purification (FCC, SiO) ₂0% -50% EtOAc/hexanes) to afford (3aR, 4S, 6S, 6aS) -6-hydroxy-4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d [ -d][1，3]Dioxole-4-carbonitrile as a colorless oil (0.957g, 91%).¹H NMR(400MHz，CDCl₃)：δ7.41-7.23(m，12H)，6.84(m，2H)，5.64(s，1H)，5.59(s，1H)，4.47(t，J＝5.2，1H)，4.42(d，J＝5.2，1H)，4.38(m，1H)，3.81(s，3H)，3.31(d，J＝9.6，1H)，3.12(d，J＝9.6，1H)，2.32(d，J＝12，1H)，1.47(s，3H)，1.33(s，3H)。

Step H. (3aR, 4S, 6S, 6aR) -6-cyano-6- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d][1，3]Dioxole-4-benzoic acid esters. To the solution cooled to 0 deg.C of (3aR, 4S, 6S, 6aS) -6-hydroxy-4- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ℃][1，3]Dioxole-4-carbonitrile (0.957g, 1.93mmol) was added dropwise benzoyl chloride (0.268mL, 2.31mmol) to a colorless solution of DMAP (0.047g, 0.385mmol) in THF (7.7mL, 0.25M) and Triethylamine (TEA) (2.69mL, 19.3 mmol). The heterogeneous solution was stirred vigorously at room temperature overnight. The reaction mixture was washed with NaHCO₃Quench (saturated aqueous) and extract the aqueous layer with EtOAc. The combined organic extracts were dried (NaSO)₄) Filtered and concentrated in vacuo to give a crude oil. Purification (FCC, SiO)₂0% -25% EtOAc/hexanes) to afford (3aR, 4S, 6S, 6aR) -6-cyano-6- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d [ -d ][1，3]Dioxol-4-benzoate as a white foamy solid (0.917g, 79%).

Step I. (1S, 3S, 4R, 5R) -3-cyano-4, 5-dihydroxy3- (hydroxymethyl) -2-methylenecyclopentanecarboxylic acid Esters. To this charge (3aR, 4S, 6S, 6aR) -6-cyano-6- (((4-methoxyphenyl) diphenylmethoxy) methyl) -2, 2-dimethyl-5-methylenetetrahydro-4H-cyclopenta [ d ] at 0 ℃ with good stirring][1，3]Dioxole-4-benzoate (0.100g, 0.166mmol) in a Round Bottom Flask (RBF) was added TFA: h₂O (2.66 mL: 2.66mL, 0.031M). After 2.5 hours at room temperature, the reaction mixture was co-evaporated with 2mL each of toluene and EtOH and the process was repeated. The crude oil thus obtained was taken up in EtOH and stirred at 0 ℃ and quenched with 0.50g of a resin bound amine base (about 10 equivalents). The reaction mixture was stirred at room temperature for 5 minutes, filtered and rinsed with EtOH, concentrated in vacuo to give a yellow oil. Purification (FCC, SiO)₂3% to 10% MeOH in DCM) to give (1S, 3S, 4R, 5R) -3-cyano-4, 5-dihydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl benzoate as a colorless oil (0.0391g, 81%).¹H NMR(400MHz，CDCl₃)：δ8.02(d，J＝8.0，1H)，7.49(t，J＝7.6，1H)，7.36(t，J＝8.00，2H)，5.60(m，1H)，5.55(s，1H)，5.48(s，1H)，4.82(d，J＝7.2，1H)，4.47(m，1H)，4.40(m，1H)，4.31(m，1H)，4.01(m，1H)，3.91(dd，J＝11.6，5.2，1H)，3.77(dd，J＝11.6，5.2，1H)。

Step J. (6aS, 8S, 9S, 9aR) -6 a-cyano-9-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydro-cyclo Penta [ f ]][1，3，5，2，4]Trioxadisilylon-8-benzoic acid ester. To a colorless solution of (1S, 3S, 4R, 5R) -3-cyano-4, 5-dihydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl benzoate (0.352g, 1.22mmol) in pyridine (4mL, 0.3M) cooled to 0 deg.C was added 1, 1, 3, 3-tetraisopropyl-1, 3-dichlorodisiloxane (0.438mL, 1.33mmol) dropwise. The reaction mixture was slowly warmed to room temperature over 20 minutes. The reaction mixture was stirred at room temperature overnight. Removal of pyridine under reduced pressure in H₂Partition between O and EtOAc. The organic layer was washed with NaHCO₃Washed (saturated aqueous solution) and dried (Na)₂SO₄) Filtered and concentrated in vacuo to give a colorless oil. Purification (FCC, Si)O2, 0% -15% 5CV, 15% 2CV, 15% -30% 5CV) to give (6aS, 8S, 9S, 9aR) -6 a-cyano-9-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f][1，3，5，2，4]Trioxasidosin-8-benzoate as a colorless oil (0.287g, 44%).¹H NMR(400MHz，CDCl₃)：δ8.15(d，J＝6.8，1H)，7.61(t，J＝6.8，1H)，7.48(t，J＝7.2，2H)，5，64-5.59(m，3H)，4.46(m，1H)，4.36(m，1H)，4.16(d，J＝11，1H)，3.96(d，J＝11，1H)，1.15-1.07(m，29H)。

Step K. (6aS, 8S, 9S, 9aR) -9- ((1H-imidazol-1-thiocarbonyl) oxy) -6 a-cyano-2, 2, 4, 4-tetrakis Isopropyl-7-methylenehexahydrocyclopenta [ f][1，3，5，2，4]Trioxadisilylon-8-benzoic acid ester. Reacting (6aS, 8S, 9S, 9aR) -6 a-cyano-9-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f ][1，3，5，2，4]A solution of trioxasidiocin-8-benzoate (0.0306g, 0.0575mmol) in 1, 1' -thiocarbonyldiimidazole (0.051g, 0.287mmol) and 4- (dimethylamino) pyridine (0.015g, 0.017mmol) in dichloroethane (0.6mL, 0.1M) was heated at reflux for 30 minutes, cooled to 0 deg.C, and 1-2mL of MeOH was added with stirring. The reaction mixture was concentrated in vacuo to remove most of the solvent, diluted with EtOAc, and washed with H₂And O washing. The aqueous layer was extracted with EtOAc and the combined organic extracts were dried (Na)₂SO₄) Filtered and concentrated in vacuo to give a yellow oil. Purification (0% -30% EtOAc/hexanes) afforded (6aS, 8S, 9S, 9aR) -9- ((1H-imidazol-1-thiocarbonyl) oxy) -6 a-cyano-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f][1，3，5，2，4]Trioxasidosin-8-benzoate as a colorless oil (0.033g, 89%).¹H NMR(400MHz，CDCl₃)：δ8.49(s，1H)，7.91(m，2H)，7.85(bs，1H)，7.57(m，1H)，7.40(m，1H)，7.06(m，1H)，6.49(t，J＝4.0，1H)，6.18(m，1H)，5.71(s，1H)，5.63(s，1H)，4.63(d，J＝4.0，1H)，4.25(d，J＝11，1H)，4.10(d，J＝11，1H)，1.11-1.03(m，28H)。

Step L. (6aS, 8R, 9aS) -6 a-cyano-2, 2, 4,4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f][1， 3，5，2，4]Trioxadisilylon-8-benzoic acid ester. Reacting (6aS, 8S, 9S, 9aR) -9- ((1H-imidazole-1-thiocarbonyl) oxy) -6 a-cyano-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f][1，3，5，2，4]A solution of trioxasidioxin-8-benzoate (0.259g, 0.403mmol) in toluene (tol) containing Azobisisobutyronitrile (AIBN) (0.020g, 0.121mmol) and tributyltin hydride (0.324mL, 1.21mmol) was heated at reflux for 1.3 hours and cooled to room temperature and concentrated in vacuo to give a crude oil. Purification (FCC, SiO2, 0% -10% EtOAc/hexanes) afforded (6aS, 8R, 9aS) -6 a-cyano-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f [ -f ] ][1，3，5，2，4]Trioxasidiocin-8-benzoate as a colorless oil (0.208g, quantitative yield).¹H NMR(400MHz，CDCl₃)：δ8.09-8.07(m，2H)，7.60-7.56(m，1H)，7.47-7.44(m，2H)，5.70(m，1H)，5.65-5.64(m，1H)，5.55(m，1H)，4.25(dd，J＝12，6.4，1H)，4.17(d，J＝12，1H)，4.10(d，J＝12，1H)，2.77-2.71(m，1H)，2.31-2.23(m，1H)，1.14-1.04(m，28H)。

Step M. (6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f][1，3， 5，2，4]Trioxasidiocin-6 a (6H) -carbonitrile. To (6aS, 8R, 9aS) -6 a-cyano-2, 2, 4, 4-tetraisopropyl-7-methylenehexahydrocyclopenta [ f ] cooled to 0 deg.C][1，3，5，2，4]Trioxadisilylon-8-benzoate (0.127g, 0.245mmol) in MeOH (6.5mL, 0.037M) NaOMe/MeOH (0.44M, 0.14mL, 0.061mmol) was added dropwise. The reaction mixture was stirred at room temperature for 6 hours. Reacting the mixture with NH₄Quenched with Cl (saturated aqueous), extracted with EtOAc and dried (Na)₂SO₄) Filtered and concentrated in vacuo to give the title compound as a white residue. This crude product was mixed with the crude oil (0.0132g) obtained from the previous batch. Purification (FCC, SiO)₂23% EtOAc/hexanes) to give (6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f][1，3，5，2，4]Trioxasidiocin-6 a(6H) -carbonitrile (0.069g, 62%).¹H NMR(400MHz，CDCl₃)：δ5.61-5.60(m，1H)，5.48(d，J＝2.0，1H)，4.45-4.37(m，1H)，4.15(dd，J＝11，6.0，1H)，4.12(d，J＝12，1H)，3.98(d，J＝12，1H)，2.53(m，1H)，2.01(m，1H)，1.70(d，J＝8，1H)，1.13-1.03(m，28H)。

Intermediate 10, N-Di-BOC-6-chloro-9H-purin-2-amine。

According to Porcheddu et al, European Journal of Organic Chemistry (2008) 34: 5786-5797 the title compound is prepared.

Example 1: (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2-fluoro-2- (hydroxy)Methyl) -3-methylenecyclopent-1-ol.

Step A: n, N-Di-BOC-7- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidin-4-amines. To (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 2, 250mg, 639.91. mu. mol) and N, N-Di-BOC-7H-pyrrolo [2, 3-d) at 0 deg.C]To a solution of pyrimidin-4-amine (intermediate 4, 288.86mg, 863.88. mu. mol) in THF (6mL) was added PPh₃(503.53mg, 1.92mmol, 3 equiv.) then a solution of DIAD (388.19mg, 1.92mmol, 373.26. mu.L, 3 equiv.) is added. The mixture was stirred at 25 ℃ for 12 hours. The reaction was diluted with EA (10mL) and 1.5g of silica gel was added. The resulting mixture was concentrated under low pressure. By flash chromatography on silica gel (；4gPurifying the residue on a silica flash column eluent ethyl acetate/petroleum ether at a gradient of 0% to 30% and a rate of 18mL/min) to yield N, N-Di-BOC-7- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -7H-pyrrolo [2, 3-d ]Pyrimidin-4-amine (320mg, 70.73% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝8.74(s，1H)，7.22(d，J＝3.8Hz，1H)，6.41(d，J＝3.8Hz，1H)，5.94(br，s，1H)，5.52(br，d，J＝3.3Hz，1H)，5.05(br，s，1H)，4.61(br，d，J＝6.5Hz，1H)，4.11-3.83(m，2H)，2.48-2.27(m，2H)，1.44(s，18H)，0.98-0.89(m，18H)，0.24-0.04(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-165.66ppm LCMS：ESI-MS：m/z 707.20[M+1]⁺，729.20[M+Na]⁺。

And B: n, N-Di-BOC- (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2- Fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol. Reacting N, N-Di-BOC-7- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -7H-pyrrolo [2, 3-d]A solution of pyrimidin-4-amine (300mg, 424.31. mu. mol) in THF (1mL) was treated with TBAF (1M, 848.62. mu.L). The mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was diluted with EA (20 mL). The resulting solution was washed with water (20mL x 2) and dried over anhydrous Na₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 100/1 to 1/2) to yield N, N-Di-BOC- (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (185mg, 91.12% yield) as a colorless oil. LCMS: ESI-MS: m/z 479.2, [ M +1 ]]⁺，501.2[M+Na]⁺。

And C: (1S, 2S, 4S) -4- (4-amino-7H-Pyrrolo [2, 3-d]Pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) 3-methylene cyclopent-1-ol. To N, N-Di-BOC- (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d) ]To a solution of pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (180mg, 376.17 μmol) in DCM (2mL) was added TFA (770.00mg, 6.75mmol, 0.5 mL). The mixture was stirred at 25 ℃ for 4 hours. The reaction mixture was diluted with DCM (5mL) and silica gel (500mg) was added and concentrated under low pressure. By column chromatography (SiO)₂DCM/MeOH 100/1 to 10/1) to give the crude title compound; and purified by Prep-HPLC (column: Xitinate C18150 × 25mm × 5 um; mobile phase: [ water (0.225% FA) -ACN)](ii) a B%: 1% -23% for 9 min) to obtain (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (37mg, 34.88% yield, 98.69% purity) as a white solid and another crude desired product (9.0mg) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.06(s，1H)，7.11(d，J＝3.5Hz，1H)，6.58(d，J＝3.8Hz，1H)，5.87(br，d，J＝2.8Hz，1H)，5.58(t，J＝3.3Hz，1H)，5.11-5.00(m，1H)，4.49(q，J＝4.9Hz，1H)，4.02-3.76(m，2H)，2.44-2.24(m，2H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-168.82ppm(s，1F)。LCMS：ESI-MS：m/z 279.1[M+1]⁺。

Example 2: 2-amino-7- ((1S, 3R, 4S) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -3, 7-bis Hydrogen-4H-pyrrolo [2, 3-d]Pyrimidin-4-ones。

Step A: 4-chloro-7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((tris) Isopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidin-2-amines . To (1R, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl at 0 deg.C) Cyclopentan-1-ol (intermediate 1, 450mg, 985.01. mu. mol) and 4-chloro-7H-pyrrolo [2, 3-d ]]To a solution of pyrimidin-2-amine (332.11mg, 1.97mmol) in THF (10mL) was added PPh₃(775.06mg, 2.96mmol) and DIAD (597.53mg, 2.96mmol, 574.55. mu.L). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column on silica eluting with a gradient of 0% to 5% ethyl acetate/petroleum ether at a rate of 20mL/min) to purify the residue to give the title compound (350mg, 2 lots, 576.21 μmol, 29.25% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝6.88-6.84(m，1H)，6.41-6.37(m，1H)，5.89-5.72(m，1H)，5.14(s，1H)，4.88(s，1H)，4.70(s，1H)，4.58(s，1H)，3.91-3.82(m，1H)，3.82-3.73(m，1H)，2.80(s，1H)，2.30-2.15(m，2H)，1.13-1.09(m，36H)，0.96-0.81(m，6H)。LCMS：ESI-MS：m/z＝607.10[M+H]⁺。

And B: 2-amino-7- ((1S, 3R, 4S) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -3, 7-bis Hydrogen-4H-pyrrolo [2, 3-d]Pyrimidin-4-ones. Reacting 4-chloro-7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidin-2-amine (400mg, 658.53. mu. mol) was treated with HCl solution (10mL, 6M) and THF (10mL) and stirred at 80 ℃ for 12 hours. The mixture was diluted with MeOH and purified by reaction with saturated NaHCO ₃The aqueous solution treatment adjusted the pH to 7. The solution was filtered and concentrated under reduced pressure. By column chromatography (SiO)₂DCM/MeOH 20/1 to 10/1) and the residue was purified by Prep-HPLC (column: YMC-Actus Triart C18100 x 30mm x 5 um; mobile phase: [ Water (0.05% HCl) -ACN](ii) a B%: 0% -30%, 10 min) to give the title compound (45.2mg, 163.60 μmol, 24.84% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ：6.95(d，J＝3.5Hz，1H)，6.56(d，J＝3.5Hz，1H)，5.52(t，J＝9.20Hz，1H)，5.37(s，1H)，4.41-4.35(m，1H)，3.95(dd，J＝3.4，10.7Hz，1H)，3.85(dd，J＝5.3，10.5Hz，1H)，2.73(s，1H)，2.33-2.20(m，2H)LCMS：ESI-MS：m/z＝276.90[M+H]⁺。

Example 3: 1- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine Pyridine-2, 4(1H, 3H) -diones。

Step A: 3-benzoyl-1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione And 3-benzoyl-2- (((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethyl-methyl) Silyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) oxy) -5-methylpyrimidin-4 (3H) -one. To a solution of (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 2, 200mg, 511.93. mu. mol) and 3-benzoyl-5-methyl-1H-pyrimidine-2, 4-dione (185.32mg, 804.97. mu. mol) in THF (5mL) at 0 deg.C was added PPh ₃(421.62mg, 1.61mmol) and bis (1, 1-dimethylethyl) azodicarboxylate (DBAD) (370.70mg, 1.61 mmol). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was diluted with EA (10mL) and 1.0g of silica gel was added. The mixture was concentrated under low pressure. By flash chromatography on silica gel (4g*2DioxygenSilica flash column, eluent ethyl acetate/petroleum ether gradient 0% -40%, speed 20mL/min) to purify the residue to give 3-benzoyl-1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (188mg, 60.91% yield) as a white solid;¹H NMR(400MHz，CDCl₃)δ＝7.92(d，J＝7.3Hz，2H)，7.75-7.58(m，1H)，7.58-7.45(m，2H)，7.05(d，J＝1.0Hz，1H)，5.67(br，s，1H)，5.64(br，d，J＝3.0Hz，1H)，5.34(t，J＝2.9Hz，1H)，4.39(q，J＝4.2Hz，1H)，3.82(d，J＝14.1Hz，2H)，2.39-2.15(m，1H)，2.00(ddd，J＝4.4，9.2，13.2Hz，1H)，1.93(s，3H)，0.90(d，J＝19.3Hz，18H)，0.17-0.05(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-163.92ppm；LCMS：ESI-MS：m/z 625.1[M+Na]⁺(ii) a And 3-benzoyl-2- (((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) oxy) -5-methylpyrimidin-4 (3H) -one (155mg, crude) as a colorless oil:¹H NMR(400MHz，CDCl₃)δ＝7.81(d，J＝7.3Hz，2H)，7.73-7.63(m，1H)，7.62(d，J＝0.8Hz，1H)，7.54-7.47(m，2H)，5.94(br，t，J＝5.9Hz，1H)，5.46(br，s，1H)，5.36(br，s，1H)，4.22-4.13(m，1H)，3.52-3.30(m，2H)，2.27(br，s，1H)，2.07-1.98(m，3H)，1.71(br s，1H)，0.83(d，J＝10.8Hz，18H)，0.04--0.06(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-168.52ppm。LCMS：ESI-MS：m/z 625.1[M+Na]⁺。

and B: 1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethyl) Silyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione . 3-benzoyl-1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (70mg, 116.11)μ mol) in MeOH (0.2mL) with NH₃MeOH (7M, 2 mL). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate 10/1 to 112) to give 1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (0.051g, 88.06% yield, 100% purity) as a white solid.¹H NMR(400MHz，CDCl₃)δ＝8.06(s，1H)，6.94(s，1H)，5.70-5.49(m，2H)，5.33-5.12(m，1H)，4.41(q，J＝4.4Hz，1H)，3.90-3.80(m，2H)，2.31-2.18(m，1H)，2.08-1.95(m，1H)，1.90(s，3H)，0.91(d，J＝8.8Hz，18H)，0.13-0.08(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-164.18ppm。LCMS：ESI-MS：m/z 499.3[M+H]⁺。

And C: 1- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine Pyridine-2, 4(1H, 3H) -diones. A solution of 1- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (190mg, 380.93. mu. mol) in THF (0.2mL) was treated with TBAF (1M, 3.80 mL). The mixture was stirred at 25 ℃ for 1 hour. The reaction mixture was concentrated under low pressure. By column chromatography (SiO) ₂EA/acetone 20/1 to 2/1) to give 1- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (75mg, 71.40% yield, 98.01% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.35(s，1H)，5.66-5.55(m，2H)，5.28(t，J＝3.0Hz，1H)，4.38(q，J＝5.0Hz，1H)，3.93-3.73(m，2H)，2.29-2.10(m，2H)，1.85(s，3H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-168.28ppm。LCMS：ESI-MS：m/z271.1[M+H]⁺。

Example 4: 2-amino-9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl)-2-methylenecyclopentyl) - 1, 9-dihydro-6H-purin-6-ones。

Step A: 9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethyl) Silyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -2-isobutyramido-9H-purin-6-yl diphenylamino Formic acid esters. To a solution of (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 2, 140mg, 358.35. mu. mol) and 2-isobutyramidoyl-9H-purin-6-yl diphenylcarbamate (prepared according to Milecki et al, Journal of laboratory Compounds and Radiopharmaceuticals (2001) 44: 763-₃(281.97mg, 1.08mmol) and then DIAD (217.39mg, 1.08mmol, 209.03. mu.L) was added dropwise. The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure. By column chromatography (SiO) ₂PE/EA ═ 100/1 to 10/1) to give 9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -2-isobutyramido-9H-purin-6-yl diphenylcarbamate (272mg, crude) as a white solid.¹H NMR(400MHz，CDCl₃)δ＝7.98-7.89(m，2H)，7.51-7.31(m，8H)，7.26-7.20(m，2H)，5.67(br d，J＝2.0Hz，1H)，5.63-5.56(m，1H)，5.14(br s，1H)，4.63(q，J＝4.7Hz，1H)，4.15-4.01(m，1H)，3.87(t，J＝12.3Hz，1H)，2.99(br s，1H)，2.51(br d，J＝7.8Hz，1H)，2.40-2.28(m，1H)，1.29-1.28(m，6H)，0.92(d，J＝7.3Hz，18H)，0.33--0.13(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-165.80(s，1F)。LCMS：ESI-MS：m/z 789.4[M+H]⁺。

And B: n- (9- ((1)S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -6-oxo- 6, 9-dihydro-1H-purin-2-yl) isobutyramide. 9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -2-isobutyramidoyl-9H-purin-6-yl diphenylcarbamate (135mg, 171.08. mu. mol) was treated with TBAF (1M, 1.71 mL). In N₂The mixture was stirred at 25 ℃ for 2 hours under an atmosphere. (the reaction was carried out in two batches). The reaction mixture was concentrated under reduced pressure. By column chromatography (SiO)₂DCM/MeOH 40/1 to 10/1) to give N- (9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (0.051g, 40.39% yield, 99% purity) as a colorless oil. ¹H NMR(400MHz，CD₃OD)δ＝7.99(s，1H)，5.75-5.69(m，1H)，5.66(br，d，J＝3.5Hz，1H)，5.24(d，J＝2.6Hz，1H)，4.56-4.46(m，1H)，3.99-3.82(m，2H)，2.72(td，J＝6.9，13.8Hz，1H)，2.46-2.36(m，2H)，1.22(d，J＝6.8Hz，6H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-168.90(s，1F)。LCMS：ESI-MS：m/z 366.1[M+H]⁺。

And C: 2-amino-9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-ones. A solution of N- (9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -6-oxo-6, 9-dihydro-1H-purin-2-yl) isobutyramide (51mg, 139.59 μmol) in MeOH (0.5mL) was treated with NH₃MeOH (7M, 510.00. mu.L) and the mixture was stirred at 25 ℃ for 2 h. The reaction mixture was concentrated under reduced pressure. The residue was triturated with DCM (10mL) and filtered off. The filter cake was dissolved in water (20mL) and the aqueous phase was back-extracted with EA (10 mL). The aqueous phase was lyophilized to give 2-amino-9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-one (32.3mg, 78.01% yield, 99.55% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.75(s，1H)，5.60(d，J＝3.3Hz，1H)，5.60-5.53(m，1H)，5.23-5.14(m，1H)，4.50(q，J＝5.0Hz，1H)，4.07-3.92(m，1H)，3.93-3.76(m，1H)，2.52-2.40(m，1H)，2.40-2.27(m，1H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-169.02(s，1F)。LCMS：ESI-MS：m/z 296.1[M+H]⁺。

Example 5: 2-amino-9- ((1R, 3R, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) - 1, 9-dihydro-6H-purin-6-ones。

Step A: 6- (benzyloxy) -9- ((3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylene Cyclopentyl) -9H-purin-2-amine. To (3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 3, 160.00mg, 467.29. mu. mol) and PPh at 0 deg.C ₃(367.69mg, 1.40mmol, 3 equiv.) and 6-benzyloxy-9H-purin-2-amine (169.10mg, 700.94. mu. mol) in dry THF (5mL) was added DIAD (283.47mg, 1.40mmol, 272.57. mu.L). After the addition, the reaction was stirred at 25 ℃ for 12 hours. The reaction mixture was quenched with water (10mL) and extracted with EA (10mL × 2). The organic layer was washed with brine (10mL) and dried over anhydrous Na₂SO₄Drying, filtering, and concentrating under low pressure. By column chromatography (SiO)₂The residue was purified with petroleum ether/ethyl acetate 100/1 to 1/1) to give 6- (benzyloxy) -9- ((3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-2-amine (0.057g, 21.17% yield, 98.15% purity) as a white solid.¹H NMR(400MHz，CDCl₃)δ＝7.65(d，J＝16.6Hz，1H)，7.50(d，J＝7.0Hz，2H)，7.42-7.27(m，10H)，5.63-5.46(m，4H)，5.24-5.08(m，1H)，4.81(s，2H)，4.73-4.59(m，4H)，4.41(br，dd，J＝5.5，9.5Hz，1H)，4.39-4.32(m，1H)，4.29-4.19(m，1H)，4.09-3.87(m，2H)，2.73-2.53(m，1H)，2.32-2.16(m，1H)。¹⁹F NMR(377MHz，CDCl₃)δ＝-147.42(s，1F)，-149.82(s，1F)。LCMS：ESI-MS：m/z 566.3[M+H]⁺。

And B: 2-amino-9- ((1R, 3R, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-ones. To a solution of 6- (benzyloxy) -9- ((3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-2-amine (40.00mg, 70.72. mu. mol) in DCM (2mL) at-78 deg.C was added BCl₃(1M, 636.45. mu.L). The mixture was stirred at-78 ℃ for 2 hours. The reaction is performed with 1M NH₃Quenching with MeOH (5 mL). The reaction mixture was concentrated under low pressure. By column chromatography (SiO) ₂DCM/MeOH 100/1 to 5/1) and the residue was purified by Prep-HPLC (column: waters Xbridge 150 × 255 u; mobile phase: [ Water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% to 25%, 6 min) to give 2-amino-9- ((1R, 3R, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-one as a white solid (0.005g, 23.85% yield, 99.58% purity).¹H NMR(400MHz，CD₃OD)δ＝7.82(s，1H)，5.67-5.58(m，1H)，5.49(br，s，1H)，5.12(d，J＝3.5Hz，1H)，4.42-4.34(m，1H)，4.12-4.02(m，2H)，2.74-2.66(m，1H)，2.23-2.14(m，1H)。¹⁹F NMR(377MHz，CD₃OD)δ＝-154.86(s，1F)。LCMS：ESI-MS：m/z 296.1[M+H]⁺。

Example 6: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol。

Step A: n, N-Di-BOC-9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) Butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine. To (1R, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) at 0 deg.CYl) oxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 2, product of Process A, step P, 50.00mg, 127.98 μmol) and a (64.38mg, 191.97 μmol) in THF (1mL) were added PPh₃(100.71mg, 383.95. mu. mol), followed by the addition of DIAD (77.64mg, 383.95. mu. mol, 74.65. mu.L) in THF (0.3 mL). The mixture was stirred at 25 ℃ for 12 hours. The reaction was quenched with water (10mL) and extracted with EA (15 mL). Subjecting the organic layer to anhydrous Na ₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 100/1 to 3/1) to afford N, N-Di-BOC-9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (42mg, 46.35% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝8.81(s，1H)，8.11(s，1H)，5.81-5.71(m，1H)，5.61-5.56(m，1H)，5.12(br s，1H)，4.71-4.62(m，1H)，4.05-3.95(m，1H)，3.88(t，J＝12.0Hz，1H)，2.60-2.47(m，1H)，2.39(dt，J＝3.6，8.7Hz，1H)，1.45(s，18H)，0.93(d，J＝7.5Hz，18H)，0.22-0.02(m，12H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-165.83(s，1F)。

And B: n, N-Di-BOC- (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) - 3-methylenecyclopent-1-ol. N, N-Di-BOC-9- ((1S, 3S, 4S) -4- ((tert-butyldimethylsilyl) oxy) -3- (((tert-butyldimethylsilyl) oxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (42.00mg, 59.32. mu. mol) was dissolved in THF (0.2mL) and TBAF (1M, 118.64. mu.L) was added. The mixture was stirred at 25 ℃ for 30 minutes. The reaction was diluted with EA (10mL) and the reaction mixture was washed with brine (5mL × 2). Subjecting the organic layer to anhydrous Na₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 100/1 to 0/1) to give N, N-Di-BOC- (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (22mg, 76.96% yield, 99.5% purity) as a pale yellow oil A compound (I) is provided.¹H NMR(400MHz，CDCl₃)δ＝8.76(s，1H)，8.14(s，1H)，5.82-5.64(m，2H)，5.17(br，s，1H)，4.73-4.53(m，1H)，4.30(br，s，1H)，4.23-4.14(m，1H)，4.08-3.97(m，1H)，2.86-2.63(m，1H)，2.86-2.63(m，1H)，2.57-2.46(m，1H)，1.50-1.46(m，18H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-164.14(s，1F)。

And C: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol. To a solution of N, N-Di-BOC- (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (220mg, 458.81 μmol) in DCM (3mL) was added TFA (0.2 mL). The mixture was stirred at 25 ℃ for 1 hour. The reaction mixture was concentrated under low pressure. The residue was dissolved in MeOH (10 mL). By adding 2 drops of NH₃MeOH (7.0M) adjusted the resulting solution to pH 7-8. 300mg of silica gel was added, and the mixture was concentrated under reduced pressure. By column chromatography (SiO)₂DCM/MeOH 40/1 to 5/1) purified the residue to give about 130mg of crude product as a yellow oil, which was purified by Prep-HPLC (column: waters Xbridge 150 × 255 u; mobile phase: [ Water (10mM NH)₄HCO₃)-ACN](ii) a B%: 3% -23%, 6.2 min) to give (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (90mg, 70.24% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.18-8.15(m，2H)，5.80-5.75(m，1H)，5.67-5.66(m，1H)，5.22-5.21(m，1H)，4.56-4.52(m，1H)，4.13-4.05(m，1H)，3.94-3.87(m，1H)，2.57-2.46(m，1H)，2.45-2.42(m，1H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-168.30(s，1F)。LCMS：ESI-MS：m/z 279.8[M+1]⁺。

Example 7: (1S, 2R, 4R) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol。

Step A: n, N-Di-BOC-9- ((1R, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-ylidene Methylcyclopentyl) -9H-purin-6-amine and N, N-Di-BOC-9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) formazan 3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine. To (3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopent-1-ol (intermediate 3, 470.00mg, 1.37mmol) and PPh at 0 deg.C₃(1.08g, 4.12mmol) and tert-butyl N-tert-butoxycarbonyl-N- (9H-purin-6-yl) carbamate (690.49mg, 2.06mmol) in dry THF (8mL) was added a solution of DIAD (832.69mg, 4.12mmol, 800.66. mu.L) in THF (2mL) and stirred at 25 ℃ for 12H. The reaction mixture was quenched with water (2mL) and extracted with EA (15mL × 2). The organic layer was washed with brine (10 mL). Subjecting the organic layer to anhydrous Na₂SO₄Dried and concentrated under low pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 100/1 to 1/1) to give two pure isomers which are purified again by Prep-TLC (toluene/EA 5/1) to give N, N-Di-BOC-9- ((1R, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (210mg, 22.26% yield, 96% purity) as a white solid:¹H NMR(400MHz，CDCl₃)δ＝8.84(s，1H)，8.18(s，1H)7.41-7.20(m，10H)，5.79(br，s，1H)，5.66(br，s，1H)，5.26-5.08(m，1H)，4.76-4.60(m，4H)，4.36-4.21(m，1H)，4.20-4.05(m，1H)，3.92(br，dd，J＝10.2，18.2Hz，1H)，2.85-2.67(m，1H)，2.35-2.17(m，1H)，1.46(s，18H)。¹⁹F NMR(376MHz，CDCl₃)δ＝-149.82(s，1F)；LCMS：ESI-MS：m/z 660.2[M+H]⁺(ii) a And N, N-Di-BOC-9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (255mg, 23.85%) as a white solid: ¹H NMR(400MHz，CDCl₃)δ＝8.75(s，1H)，7.97(s，1H)，7.39-7.28(m，10H)，5.79(br，s，1H)，5.66(br s，1H)，5.18(br，s，1H)，5.11-4.94(m，1H)，4.73-4.54(m，4H)，4.43(br，d，J＝9.8Hz，1H)，4.10-3.80(m，2H)，2.75-2.56(m，1H)，2.38-2.24(m，1H)，1.65-1.48(m，18H)；¹⁹F NMR(376MHz，CDCl₃)δ＝-147.36(s，1F)；LCMS：ESI-MS：m/z 660.2[M+H]⁺。

And B: 9- ((1R, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) - 9H-purin-6-amines. In a similar manner to example 1 step C, N-Di-BOC-9- ((1R, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine was used instead of N, N-Di-BOC- (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol.

And C: (1S, 2R, 4R) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol. To a solution of 9- ((1R, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (29.00mg, 63.11. mu. mol) in DCM (1mL) at-78 deg.C was added BCl₃(1M, 189.33. mu.L). The mixture was stirred at-78 ℃ for 1 hour. Pour reactant into dilute NH₃In MeOH (ca. 1M, 5mL) and concentrated under low pressure. By column chromatography (SiO)₂DCM/MeOH 100/1 to 20/1) to give (1S, 2R, 4R) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (5mg, 29% yield) as a white solid. ¹H NMR(400MHz，CD₃OD)δ＝8.22(s，1H)，8.21-8.15(m，1H)，5.79-5.50(m，2H)，5.23-5.00(m，1H)，4.45-4.34(m，1H)，4.19-4.00(m，2H)，2.84-2.72(m，1H)，2.30-2.15(m，1H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-154.89(s，1F)。LCMS：ESI-MS：m/z 280.1[M+H]⁺。

Example 8: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol。

Step A: 9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) - 9H-purin-6-amines. To a solution of N, N-Di-BOC-9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (product B of example 7, step a, 330.00mg, 500.19 μmol) in DCM (4mL) was added TFA (1mL) at 0 ℃. The mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was diluted with DCM (2mL) and 500mg silica gel was added and concentrated under reduced pressure. By flash chromatography on silica gel (4gSilica flash column, eluent DCM/MeOH at gradient 0% to 5% at 20mL/min) to purify the residue to give 9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (216mg, 93.98% yield) as a white solid.¹H NMR(400MHz，CDCl₃)δ＝8.83-8.15(m，1H)，8.07-7.75(m，1H)，7.62-7.14(m，10H)，6.03-5.50(m，4H)，5.34-5.08(m，1H)，4.84-4.60(m，4H)，4.52-4.34(m，1H)，4.06-3.76(m，2H)，2.66(ddd，J＝2.8，8.5，13.6Hz，1H)，2.41-2.21(m，1H)。¹⁹F NMR(377MHz，CDCl₃)δ＝-147.23(s，1F)。

And B: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylene ring Pen-1-ol. To a solution of 9- ((1S, 3R, 4S) -4- (benzyloxy) -3- ((benzyloxy) methyl) -3-fluoro-2-methylenecyclopentyl) -9H-purin-6-amine (60.00mg, 130.57. mu. mol) in DCM (2mL) at-78 deg.C was added BCl ₃(1M, 783.44. mu.L) and stirred at-78 ℃ for 1 hour. The reaction mixture was poured into NH₃in/MeOH (about 1.0M, 3mL) and concentrated under low pressure. By column chromatography (SiO)₂DCM/MeOH 100/1 to 10/1) pureThe residue was digested to give (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (25mg, 68.56% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.20(s，1H)，8.07(s，1H)，5.75(br，s，1H)，5.64(dd，J＝2.6，5.1Hz，1H)，5.10(dd，J＝2.0，4.5Hz，1H)，4.59-4.49(m，1H)，4.09-3.90(m，2H)，2.49-2.42(m，2H)。¹⁹F NMR(377MHz，CDCl₃)δ＝-147.23(s，1F)。LCMS：ESI-MS：m/z 280.1[M+H]⁺。

Example 9: (1S, 2R, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2- (hydroxymethyl) -3- Methylene cyclopent-1-ols。

Step A: 4-chloro-7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((tris) Isopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidines. To (1R, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopent-1-ol (intermediate 1, 470mg, 1.03mmol) and 4-chloro-7H-pyrrolo [2, 3-d ] at 25 deg.C]To a solution of pyrimidine (315.98mg, 2.06mmol) in THF (10mL) was added PPh3(809.51mg, 3.09mmol) and DIAD (624.09mg, 3.09mmol, 600.09. mu.L). The reaction mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under reduced pressure. Purification (FCC, SiO) ₂Eluent is ethyl acetate/petroleum ether with the gradient of 0 percent to 30 percent, and the speed is 18mL/min), so as to obtain 4-chloro-7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d ] of]Pyrimidine (412mg, 67.60% yield) as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝8.61(s，1H)，7.27-7.25(m，1H)，6.64-6.55(m，1H)，6.04-5.92(m，1H)，5.14(t，J＝2.2Hz，1H)，4.64(t，J＝2.2Hz，1H)，4.59(br，s，1H)，3.90-3.79(m，2H)，2.81(br，s，1H)，2.34-2.23(m，2H)，1.19-0.98(m，42H)。LCMS：ESI-MS：m/z 592.1[M+1]⁺。

And B: 7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropyl) silyl Silyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidin-4-amines. To 4-chloro-7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Solution of pyrimidine (250mg, 422.01. mu. mol) in dioxane (1mL) was added NH₃·H₂O (16.25g, 267.17mmol, 17.86mL, 28% purity). The mixture was stirred at 100 ℃ for 12 hours. The reaction mixture was concentrated under reduced pressure. Purification (FCC, SiO)₂Petroleum ether/ethyl acetate 1001 to 2/1) gave 7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Pyrimidin-4-amine (0.198g, 40.94% yield) as a colorless oil. ¹H NMR(400MHz，CD₃OD)δ＝8.06(s，1H)，7.03(d，J＝3.4Hz，1H)，6.60-6.57(m，1H)，5.87(br，dd，J＝7.9，10.4Hz，1H)，5.21-5.13(m，1H)，4.70-4.66(m，2H)，3.92-3.86(m，2H)，2.82(br，s，1H)，2.42-2.29(m，1H)，2.29-2.18(m，1H)，1.21-1.05(m，42H)。LCMS：ESI-MS：m/z 573.2[M+1]⁺。

And C: (1S, 2R, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2- (hydroxymethyl) -3-ylidene Methylcyclopentan-1-ol. To 7- ((1S, 3R, 4S) -2-methylene-4- ((triisopropylsilyl) oxy) -3- (((triisopropylsilyl) oxy) methyl) cyclopentyl) -7H-pyrrolo [2, 3-d]Solution of pyrimidin-4-amine (190mg, 331.61 μmol) in MeOH (6mL) added NH₄F (245.63mg, 6.63 mmol). The mixture was stirred at 80 ℃ for 12 hours. The reaction mixture was cooled and the resulting solid was filtered off. The filtrate was concentrated under reduced pressure. Purification (FCC, SiO)₂100/1 to 10/1 DCM/MeOH) and separated by SFC (column: DAICEL CHIRALPAK AD-H (250mm 30mm, 5 um); mobile phase:[0.1％NH₃.H₂O，MeOH](ii) a B%: 30% -30%, min, RT 4.488 min) to give (1S, 2R, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol (32mg, 37.07% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.04(s，1H)，7.12(d，J＝3.7Hz，1H)，6.58(d，J＝3.7Hz，1H)，5.90-5.71(m，1H)，5.19(br，s，1H)，4.65(t，J＝2.2Hz，1H)，4.46-4.30(m，1H)，3.89-3.66(m，2H)，2.70(br s，1H)，2.42-2.28(m，1H)，2.28-2.15(m，1H)。LCMS：ESI-MS：m/z 261.1[M+1]⁺。

Example 10: 2-amino-9- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylene ring Pentyl) -1, 9-dihydro-6H-purin-6-one。

Step A: ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6- ((diphenylbenzene) Hydroxycarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) Methyl pivalate. At 25 ℃ and N₂Next, to a solution of ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 900mg, 1.40mmol) and 2-isobutyramido-9H-purin-6-yl diphenylcarbamate (intermediate 5, 871.88mg, 2.09mmol) in THF (20mL) and dioxane (20mL) was added PPh in one portion₃(1.10g, 4.19 mmol). After dropwise addition of DIAD (846.73mg, 4.19mmol, 814.17. mu.L) at 25 ℃ the reaction mixture was stirred at 25 ℃ for 12 h. The solvent was removed in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate 5/1 to 3/1). To give ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6- ((diphenylcarbamoyl) oxy)) -2-isobutyramido-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (900mg, 819.59 μmol, 58.72% yield, 95% purity) as a light yellow foam.¹H NMR(400MHz，CDCl₃)δ＝8.63(s，1H)，7.95(s，1H)，7.41-7.35(m，12H)，7.29-7.23(m，7H)，6.83-6.81(m，4H)，5.61(d，J＝2.8Hz，1H)，5.43-5.36(m，2H)，5.24(br d，J＝11.6Hz，1H)，4.85(d，J＝2.4Hz，1H)，4.45(d，J＝11.8Hz，1H)，3.79(m，6H)，3.46(d，J＝8.8Hz，1H)，3.31(d，J＝9.0Hz，1H)，3.01-2.95(m，2H)，2.22-2.15(m，1H)，1.28-1.26(m，6H)，1.23(s，9H)，1.01(s，9H)。LCMS：ESI-MS：m/z＝1043.5[M+H]⁺。

And B: ((1S, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-) 9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. At 0 ℃ and N₂Next, to a solution of ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (200.00mg, 191.72 μmol) in DCM (2mL) was added TFA (154.00mg, 1.35mmol, 0.1mL) in one portion. The reaction mixture was stirred at 0 ℃ for 20 minutes. The reaction mixture was poured into saturated NaHCO₃In aqueous solution, to adjust it to a pH > 8. The mixture was extracted with EA (30mL x 3). Subjecting the obtained solution to anhydrous Na₂SO₄And (5) drying. The solvent was removed in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 3/1 to 1/1). ((1S, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (320mg, 3 lots, 414.66 μmol, 72.10% yield, 96% purity) was obtained as a light yellow foam. LCMS: ESI-MS: 741.4[ M + H ] M/z]⁺。

And C: ((1R, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-) 9-Yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivaloyl Acid esters. At 0 ℃ and N₂Next, to a solution of ((1S, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (170mg, 229.47. mu. mol) and pyridine (181.51mg, 2.29mmol, 185.21. mu.L) in DCM (2mL) was added dropwise trifluoromethyl sulfonic anhydride (Tf)₂O or trifluoromethanesulfonic anhydride) (97.11mg, 344.20. mu. mol, 56.79. mu.L). The reaction mixture was stirred at 0 ℃ for 1 hour. The solvent was removed in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 1/2 to 0/1). ((1R, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (140mg, 96.23 μmol, 41.94% yield, 60% purity) was obtained as a light yellow oil. LCMS: ESI-MS: 873.3[ M + H ] M/z]⁺。

Step D: ((1S, 3S, 5S) -1- (fluoromethyl) -3- (2-isobutanoylamino-6-oxo-1, 6-dihydro-9H-purine-) 9-Yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. At 25 ℃ and N₂Next, TBAF (1M, 3.2mL) was added in one portion to a solution of ((1R, 3S, 5S) -3- (6- ((diphenylcarbamoyl) oxy) -2-isobutyramido-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (320mg, 366.59. mu. mol) in THF (0.5 mL). The reaction mixture was stirred at 25 ℃ for 12 hours. The solvent was removed in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 1/2 to 0/1). ((1S, 3S, 5S) -1- (fluoromethyl) -3- (2-isobutanoylamino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (100mg, 182.61. mu. mol, 49.81% yield) was obtained as a light yellow foam. LCMS: ESI-MS: 548.2[ M + H ] M/z]⁺。

Step E: 2-amino-9- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl 1, 9-dihydro-6H-purin-6-one. At 25 ℃ and N₂Next, to a solution of ((1S, 3S, 5S) -1- (fluoromethyl) -3- (2-isobutanoylamino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (100mg, 182.61. mu. mol) in MeOH (5mL) was added NaOH (1M, 1.00 mL). The reaction mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was adjusted to pH 6-7 with 1.0m hcl solution and the solvent was removed in vacuo to give 300mg of crude product as a yellow oil. By prep-HPLC (column: Waters Xbridge 150 x 255 u; mobile phase: [ water (10mM NH) ₄HCO₃)-ACN](ii) a B%: 0% -23%, 6 min) to purify 470mg of crude product. 2-amino-9- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-one (47.9mg, 96% purity, 54.8% yield) was obtained as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.79(s，1H)，5.59-5.54(m，1H)，5.23(d，J＝2.8Hz，1H)，4.82(d，J＝2.4Hz，1H)，4.77-4.47(m，2H)，4.40(d，J＝3.0Hz，1H)，3.79(s，2H)，2.54(ddd，J＝4.8，11.0，13.0Hz，1H)，2.24(dd，J＝8.2，12.8Hz，1H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-232.9。LCMS：ESI-MS：m/z＝310.1[M+H]⁺。

Example 11: 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylene ring Pentyl) pyrimidin-2 (1H) -ones。

Step A: ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl))-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalic acid Esters. To ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) at 0 ℃)Methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 0.0516g, 80.03. mu. mol), PPh₃(41.98mg, 160.05. mu. mol) and 3-benzoyl-1H-pyrimidine-2, 4-dione (25.95mg, 120.04. mu. mol) in THF (1mL) was added DIAD (32.36mg, 160.05. mu. mol, 31.12. mu.L). The mixture was stirred at 25 ℃ for 12 hours. The solvent was removed under reduced pressure to give a residue. By flash chromatography on silica gel ( ；4gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 4% to 25%, rate of 20 mL/min). ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.026g, 30.84 μmol, 38.54% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.00-7.91(m，1H)，7.91-7.84(m，1H)，7.71-7.61(m，1H)，7.57-7.48(m，2H)，7.43-7.35(m，2H)，7.34-7.28(m，3H)，7.25-7.17(m，4H)，6.84-6.77(m，5H)，5.88(d，J＝8.2Hz，1H)，5.73-5.62(m，2H)，5.30-5.25(m，1H)，5.14(s，1H)，4.43-4.31(m，2H)，3.81(d，J＝2.8Hz，1H)，3.78(d，J＝0.8Hz，6H)，3.31(s，1H)，2.26-2.13(m，1H)，1.87-1.85(m，1H)，1.22-1.17(m，9H)，0.97-0.92(m，9H)。LCMS：ESI-MS：m/z＝865.5[M+Na]⁺。

And B: ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.026g, 30.84 μmol) in DCM (0.5mL) was added2, 2-Dichloroacetic acid (39.77mg, 308.43. mu. mol, 25.33. mu.L) was added. The mixture was stirred at 0 ℃ for 0.5 h. The mixture was washed with saturated NaHCO₃Aqueous solution (1mL) was quenched and extracted with DCM (5mL × 2). The combined organic layers were washed with brine (5mL) and dried over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel ( 4gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 15% to 30% at a rate of 20 mL/min). ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.01g, 18.50. mu. mol, 59.97% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝7.97-7.91(m，2H)，7.71-7.63(m，1H)，7.56-7.49(m，2H)，7.33(d，J＝8.2Hz，1H)，5.92-5.87(m，1H)，5.70(s，1H)，5.40(d，J＝2.6Hz，1H)，5.32-5.28(m，1H)，5.14(d，J＝2.2Hz，1H)，4.38(d，J＝11.6Hz，1H)，4.22(d，J＝11.6Hz，1H)，3.74-3.68(m，1H)，3.65-3.59(m，1H)，2.31(dd，J＝8.2，12.6Hz，1H)，2.25-2.14(m，1H)，1.26-1.23(m，9H)，1.22-1.18(m，9H)。LCMS：ESI-MS：m/z＝563.2[M+Na]⁺。

And C: ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2- Methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate. To a solution of ((1S, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.08g, 147.98. mu. mol) in DCM (0.5mL) at 0 deg.C was added pyridine (117.05mg, 1.48mmol, 119.44. mu.L) and Tf₂O (83.50mg, 295.97. mu. mol, 48.83. mu.L, 2 equiv.). The mixture was stirred at 0 ℃ for 1 hour.The mixture was washed with saturated NaHCO₃The solution was quenched (5mL) and extracted with DCM (5mL × 2). The combined organic layers were washed with brine (5mL) and dried over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. The crude product was used in the next step without purification. ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.09g, crude) was obtained as a brown oil. LCMS: ESI-MS: 673.1[ M + H ] M/z ]⁺，695.1[M+Na]⁺。

Step D: ((1S, 3S, 5S) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) -2- Methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.09g, 133.80 μmol) in THF (1mL) was added TBAF (1M, 401.39 μ L). The mixture was stirred at 60 ℃ for 3 hours. The mixture was diluted with EA (5mL) and H₂O (5mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 0% -1% MeOH/DCM, speed 20mL/min) purify the residue. ((1S, 3S, 5S) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.035g, 79.82. mu. mol, 59.66% yield) was obtained as a white foam. LCMS: ESI-MS: m/z is 461.1[ M + Na ]]⁺。

Step E: ((1S, 3S, 5S) -3- (4-amino-2-oxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) - 2-methylene group-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To ((1S, 3S, 5S) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.035g, 79.82. mu. mol) in CH₃DMAP (19.50mg, 159.64. mu. mol) and Et were added to a solution of CN (0.4mL)₃N (16.15mg, 159.64. mu. mol, 22.22. mu.L) and 2, 4, 6-triisopropylbenzenesulfonyl chloride (48.35mg, 159.64. mu. mol). The mixture was stirred at 25 ℃ for 0.5 hour. Reacting NH₃·H₂O (413.64mg, 10.39mmol, 454.55. mu.L, 28% purity) was added to the mixture, which was stirred at 25 ℃ for 1.5 hours. The mixture was diluted with EA (5mL) and NH₄Cl (3mL × 3) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 0% -3.2% MeOH/DCM, rate 20 mL/min). Methyl ((1S, 3S, 5S) -3- (4-amino-2-oxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) pivalate (0.025g, 57.14 μmol, 71.59% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝7.13(d，J＝7.4Hz，1H)，6.04(d，J＝6.6Hz，1H)，5.69(s，1H)，5.30-5.27(m，1H)，5.17(s，1H)，4.89(s，1H)，4.61-4.42(m，2H)，4.28-4.20(m，1H)，2.83(td，J＝6.9，13.8Hz，1H)，2.15(d，J＝7.4Hz，1H)，1.21(s，9H)，1.18(s，9H)。LCMS：ESI-MS：m/z＝438.1[M+H]⁺。

Step F: 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl Yl) pyrimidin-2 (1H) -ones. To ((1S, 3S, 5S) -3- (4-amino-2-oxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.078g, 178.28. mu. mol) in MeOH (MeOH)1mL) was added NaOH (1M, 1.56 mL). The mixture was stirred at 25 ℃ for 12 hours. The mixture was neutralized with HCl solution (1mL, 1M) and the solvent was removed under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 3% -18% MeOH/DCM, rate 20 mL/min). By Prep-HPLC (column: Waters Xbridge 150 x 255 u; mobile phase: [ water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% -25%, 6 min) further purifying the product. 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidin-2 (1H) -one (0.018g, 66.85. mu. mol, 37.49% yield, 100% purity) was obtained as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.58(d，J＝7.3Hz，1H)，5.88(d，J＝7.3Hz，1H)，5.74(s，1H)，5.23(d，J＝3.0Hz，1H)，4.75-4.58(m，1H)，4.57-4.40(m，1H)，4.31(d，J＝2.8Hz，1H)，3.78-3.64(m，2H)，2.24-2.07(m，2H)。LCMS：ESI-MS：m/z＝270.2[M+H]⁺，539.3[2M+H]⁺。

Example 12: 1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) - 5-methylpyrimidine-2, 4(1H, 3H) -diones。

Step A: ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1 (2H) - 1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl New valeric acid ester. At 25 ℃ and N₂To ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (neo)Valeryloxy) cyclopentyl) methyl pivalate (intermediate 7, 500mg, 775.44 μmol) and a solution of 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione (intermediate 6, 267.78mg, 1.16mmol) in THF (10mL) were added PPh in one portion₃(508.47mg, 1.94 mmol). After dropwise addition of DIAD (392.00mg, 1.94mmol, 376.93. mu.L) at 0 ℃ the reaction mixture was stirred at 25 ℃ for 12 h. The reaction mixture was concentrated under low pressure. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 10/1 to 3/1). ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (200mg, 233.37 μmol, 30.10% yield) was obtained as a light yellow foam.¹H NMR(400MHz，CDCl₃)δ＝7.94(d，J＝8Hz，2H)，7.70(m，1H)，7.53-7.51(m，2H)，7.38-7.36(m，2H)，7.30-7.25(m，7H)，7.24(s，1H)，6.83-6.81(m，4H)，5.71(s，1H)，5.57(s，1H)，5.28(s，1H)，5.10(s，1H)，4.41(s，2H)，3.78(s，6H)，3.58-3.29(m，2H)，2.19-2.16(d，J＝10Hz，2H)，1.98(s，3H)，1.20(s，9H)，0.96(s，9H)。LCMS：ESI-MS：m/z＝879.5[M+Na]⁺。

And B: ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1 (2H) - 1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate . At 0 ℃ and N₂Next, to a solution of ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (90.00mg, 105.02 μmol) in DCM (1mL) was added TFA (77.00mg, 675.30 μmol, 0.05mL) in one portion. The reaction mixture was stirred at 0 ℃ for 1 hour. The reaction mixture was poured into saturated NaHCO₃Aqueous solution (10mL) and extracted with EA (20mL × 3). The combined organic phases were washed with brine (10mL) and Na₂SO₄Dried and concentrated in vacuo to give a yellow oil. By silica gel column chromatography (petroleum ether/ethyl acetate ═ 3)/1 to 2/1) purification of the residue. ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (33mg, 59.50. mu. mol, 56.66% yield, 100% purity) was obtained as a light yellow oil. LCMS: ESI-MS: 577.2[ M + Na ] M/z]⁺。

And C: ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1 (2H) - 2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalic acid Esters. At 0 ℃ and N₂Next, Tf was added dropwise to a solution of ((1S, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (200mg, 360.60. mu. mol) and pyridine (285.23mg, 3.61mmol, 291.06. mu.L) in DCM (5mL)₂O (203.48mg, 721.20. mu. mol, 118.99. mu.L). The reaction mixture was stirred at 0 ℃ for 1 hour. The reaction mixture was concentrated under low pressure. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate 3: 1 to 2: 1). ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (220mg, 320.38. mu. mol, 88.85% yield) was obtained as a light yellow foam. LCMS: ESI-MS: m/z 709.2[ M + Na]⁺。

Step D: ((1S, 3S, 5S) -1- (fluoromethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1 (2H) - 2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. At 25 ℃ and N₂Next, a solution of ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (210mg, 305.81. mu. mol) in THF (1mL) was treated with TBAF (1M, 4 mL). The reaction mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure. By passing The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 2/1 to 1/1). ((1S, 3S, 5S) -1- (fluoromethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (95mg, 178.45. mu. mol, 58.35% yield, 85% purity) was obtained as a light yellow oil. LCMS: ESI-MS: 453.2[ M + H ] M/z]⁺。

Step E: 1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methyl Pyrimidine-2, 4(1H, 3H) -diones. At 25 ℃ and N₂Next, to a solution of ((1S, 3S, 5S) -1- (fluoromethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (95mg, 209.94. mu. mol) in MeOH (5mL) was added NaOH (1M, 945.82. mu.L). The reaction mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was adjusted to pH 6-7 by addition of 1.0M HCl solution. The resulting mixture was concentrated in vacuo to give 200mg of crude product as a pale yellow solid. By Prep-HPLC (column: Waters Xbridge 150 x 255 u; mobile phase: [ water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% -27%, 6 min) to obtain 500mg of crude product as a white solid. By SFC (column: DAICEL CHIRALPAK IC (250 mm. about.30 mm, 5 um); mobile phase: [ 0.1% NH ] ₃H₂O IPA](ii) a B%: 45% -45%, min) the solid was purified again. 1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (52.7mg, 98% purity) was obtained as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.40(d，J＝1.2Hz，1H)，5.68(br，dd，J＝8.4，11.0Hz，1H)，5.26(d，J＝3.0Hz，1H)，4.96(d，J＝2.6Hz，1H)，4.72-4.41(m，2H)，4.31(d，J＝3.4Hz，1H)，3.79-3.67(m，2H)，2.25-2.21(m，1H)，2.12-2.09(m，1H)，1.86(d，J＝1.0Hz，3H)。¹⁹F NMR(376MHz，CD₃OD)δ＝-232.41。LCMS：ESI-MS：m/z＝285.1[M+H]⁺。

Example 13: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (fluoromethyl) -2- (hydroxymethyl) -3- Methylene cyclopent-1-ols。

Step A: ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6-chloro-9H-) Purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 0.989g, 1.53mmol), 6-chloro-9H-purine (711.19mg, 4.60mmol), and PPh3(61.02mg, 232.63. mu. mol) in THF (15mL) at 0 deg.C was slowly added dropwise a solution of DIAD (930.47mg, 4.60mmol, 894.68. mu.L) in THF (15 mL). The mixture was stirred at 0 ℃ for 3 hours and then at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether with gradient 5% -26% at 22mL/min) to give ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6-chloro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.760g, 972.70 μmol, 63.42% yield) as a colorless oil. ¹H NMR(400MHz，CDCl₃)δ＝8.78-8.75(m，1H)，8.20(s，1H)，7.42-7.37(m，2H)，7.33-7.27(m，6H)，7.26-7.20(m，1H)，6.83(d，J＝8.4Hz，4H)，6.38-6.27(m，1H)，5.64(t，J＝9.2Hz，1H)，5.55(d，J＝2.6Hz，1H)，5.46(dd，J＝3.6，5.4Hz，1H)，4.83(d，J＝2.2Hz，1H)，4.64(d，J＝11.5Hz，1H)，4.42(d，J＝11.7Hz，1H)，3.80(s，6H)，3.39(s，2H)，2.81-2.69(m，1H)，2.34(ddd，J＝3.6，8.4，13.7Hz，1H)，1.28(d，J＝6.4Hz，9H)，1.19(s，9H)。LCMS：ESI-MS：m/z＝781.3[M+H]⁺。

And B: ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyl) Oxy) cyclopentyl) methyl pivalate. To a solution of ((1S, 3S, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (6-chloro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.736g, 941.98. mu. mol) in DCM (20mL) at 0 deg.C was added TFA (770.00mg, 6.75mmol, 0.5mL) and Et₃SiH (1.46g, 12.52mmol, 2 mL). The mixture was stirred at 0 ℃ for 0.5 h. The mixture was quenched with pyridine (1mL) and the reaction mixture was concentrated under low pressure. By flash chromatography on silica gel (4gThe residue was purified on silica flash column eluting with ethyl acetate/petroleum ether in a gradient of 10% to 45% at a rate of 22mL/min to give ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.3g, 626.35 μmol, 66.49% yield, 100% purity) as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.74(s，1H)，8.23(s，1H)，5.75-5.65(m，1H)，5.49(d，J＝3.8Hz，1H)，5.38(d，J＝2.5Hz，1H)，4.84(d，J＝2.0Hz，1H)，4.56-4.47(m，1H)，4.46-4.38(m，1H)，3.82-3.60(m，2H)，2.88(ddd，J＝5.0，11.0，13.9Hz，1H)，2.41(ddd，J＝1.5，8.0，13.9Hz，1H)，1.27(s，9H)，1.24(s，9H)。LCMS：ESI-MS：m/z＝479.1[M+H]⁺。

And C: ((1R, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate . To ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.272g, 567) was added at 0 ℃.89 μmol) in DCM (3mL) was added Tf₂O (240.33mg, 851.83. mu. mol, 140.55. mu.L) and pyridine (224.60mg, 2.84mmol, 229.18. mu.L). The mixture was stirred at 0 ℃ for 2 hours. The mixture was diluted with DCM (5mL) and NaHCO₃(5mL × 2) washing. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gThe residue was purified on silica flash column eluting with ethyl acetate/petroleum ether in a gradient of 3% to 19% at a rate of 22mL/min to give ((1R, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.235g, 384.60umol, 67.72% yield) as a colorless oil. LCMS: ESI-MS: 611.1[ M + H ] M/z]⁺。

Step D: ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyl) Oxy) cyclopentyl) pivalic acid methyl ester. To a solution of ((1R, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.235g, 384.60 μmol) in THF (2mL) was added TBAF (1M, 1.15 mL). The mixture was stirred at 25 ℃ for 12 hours. The mixture was diluted with EA (5mL) and saturated NH ₄Cl solution (3 mL). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether at gradient 5% -20%, speed 22mL/min) purification residue. With SThe product was analyzed by FC (ES5716-281-P1_ G2) and passed through SFC (column: OJ (250mm 30mm, 5 um); mobile phase: [ 0.1% NH ]₃H₂O ETOH](ii) a B%: from 20% to 20%, min, RT ═ 1.492 minutes) was further isolated to give ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.083g, 150.14 μmol, 39.04% yield, 87% purity) as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.77-8.72(m，1H)，8.22(s，1H)，5.75-5.62(m，1H)，5.51(d，J＝3.1Hz，1H)，5.39-5.22(m，1H)，4.88(s，1H)，4.72-4.64(m，1H)，4.61-4.51(m，1H)，4.42(s，2H)，2.92-2.81(m，1H)，2.42(dd，J＝7.8，13.8Hz，1H)，1.26(d，J＝10.8Hz，18H)。LCMS：ESI-MS：m/z＝481.1[M+H]⁺。

Step E: ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyl) Acyloxy) cyclopentyl) methyl pivalate. To a solution of ((1S, 3S, 5S) -3- (6-chloro-9H-purin-9-yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.083g, 172.57. mu. mol) in THF (1mL) was added NH₃A solution of THF (88.17mg, 5.18mmol, 7M, 15 mL). The mixture was stirred at 25 ℃ for 12 hours. The reaction mixture was concentrated under low pressure to give ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (fluoromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.053g, 114.84 μmol, 66.54% yield) as a white solid. ¹H NMR(400MHz，CDCl₃)δ＝8.32(s，1H)，7.84(s，1H)，5.67-5.56(m，1H)，5.69-5.55(m，2H)，5.47(d，J＝3.5Hz，1H)，5.32-5.22(m，2H)，4.88(s，1H)，4.68-4.57(m，1H)，4.44-4.29(m，2H)，2.78(ddd，J＝5.2，11.1，14.1Hz，1H)，2.36(dd，J＝8.2，13.9Hz，1H)，1.23(d，J＝6.6Hz，18H)。LCMS：ESI-MS：m/z＝462.3[M+H]⁺。

Step F: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (fluoromethyl) -2- (hydroxymethyl) -3-methylene Cyclopentan-1-ol. To ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (fluoromethyl)To a solution of yl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.053g, 114.84 μmol) in MeOH (0.5mL) was added CH₃ONa (18.61mg, 344.51. mu. mol). The mixture was stirred at 85 ℃ for 12 hours. The solvent was removed at low pressure. By column chromatography (SiO)₂DCM/MeOH 30/1 to 15/1) and the residue was purified by Prep-HPLC (column: phenomenex kinex Kinetex XB-C18150 mm × 30mm, 5 μm; mobile phase: [ Water (10mM NH)₄HCO₃)-ACN](ii) a B%: 1% -28%, 8min) to give (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (fluoromethyl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol (0.023g, 78.42 μmol, 68.29% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.22(s，1H)，8.16(s，1H)，5.73(t，J＝9.0Hz，1H)，5.25(s，1H)，4.72-4.55(m，1H)，4.71-4.55(m，1H)，4.53-4.37(m，2H)，3.85(s，2H)，2.73-2.55(m，1H)，2.40-2.21(m，1H)。LCMS：ESI-MS：m/z＝293.9[M+H]⁺。

Example 14: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (chloromethyl) -2- (hydroxymethyl) -3- Methylene cyclopent-1-ols。

Step A: n, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxy) Phenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate . To ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 1.1g, 1.71mmol), tert-butyl N-t-butoxycarbonyl-N- (9H-purin-6-yl) carbamate (1.72g, 5.12mmol) and PPh at 0 deg.C₃(61.02mg, 232.63. mu. mol) in THF (15mL) was slowly added dropwise a solution of DIAD (1.03g, 5.12mmol, 995.08. mu.L) in THF (15 mL). The mixture was stirred at 0 ℃ for 3 hours and then at 25 ℃ for 12 hours. Removing solvent under low pressureAnd (3) preparing. By flash chromatography on silica gel (40gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 5% to 26% at a rate of 35 mL/min). N, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.895g, 902.32. mu. mol, 52.89% yield, 97% purity) was obtained as a colorless oil.¹H NMR(400MHz，CDCl₃)δ＝8.87(s，1H)，8.14(s，1H)，7.43-7.37(m，2H)，7.33-7.29(m，2H)，7.33-7.29(m，1H)，7.28(d，J＝1.8Hz，3H)，7.24(d，J＝7.1Hz，1H)，6.83(dd，J＝1.4，8.9Hz，4H)，5.67(t，J＝9.0Hz，1H)，5.53(d，J＝2.6Hz，1H)，5.46(dd，J＝3.4，5.4Hz，1H)，4.81(d，J＝2.4Hz，1H)，4.63(d，J＝11.5Hz，1H)，4.41(d，J＝11.7Hz，1H)，3.80(s，6H)，3.42-3.32(m，2H)，2.80-2.67(m，1H)，2.39-2.27(m，1H)，1.45(s，18H)，1.19(s，9H)，1.06-1.00(m，9H)。LCMS：ESI-MS：m/z＝962.5[M+H]⁺。

And B: n, N-Di-BOC ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene 5- (pivaloyloxy) cyclopentyl) methyl pivalate as the base . To a solution of N, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.775g, 805.50 μmol) in DCM (5mL) was added TFA (765.06mg, 6.71mmol, 496.79 μ L) at 0 ℃. The mixture was stirred at 0 ℃ for 5 hours. The mixture was washed with saturated NaHCO₃Aqueous solution (5mL) was quenched and extracted with DCM (5mL × 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (12gSilica flash column, eluent 10% -45% ethyl acetate/petroleum ether gradient at 35 mL/min). N, N-Di-BOC ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.19g, 287.98. mu. mol, 35.75% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.84(s，1H)，8.16(s，1H)，5.71(dd，J＝8.2，10.9Hz，1H)，5.50(d，J＝3.8Hz，1H)，5.35(d，J＝2.8Hz，1H)，4.81(d，J＝2.3Hz，1H)，4.57-4.48(m，1H)，4.46-4.39(m，1H)，3.82-3.74(m，1H)，3.70-3.63(m，1H)，2.88(ddd，J＝5.1，11.0，13.9Hz，1H)，2.41(dd，J＝8.5，13.3Hz，1H)，1.47(s，18H)，1.28(s，9H)，1.25(s，9H)。LCMS：ESI-MS：m/z＝660.3[M+H]⁺。

And C: n, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -2-methylene-5- (neopentyl) Acyloxy) -1- ((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate. To a solution of N, N-Di-BOC ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.220g, 333.45. mu. mol) in DCM (1.1mL) was added pyridine (263.76mg, 3.33mmol, 269.14. mu.L) and Tf ₂O (188.16mg, 666.90. mu. mol, 110.03. mu.L). The mixture was stirred at 0 ℃ for 2 hours. The mixture was diluted with DCM (2mL) and NaHCO₃(3mL × 2) washing. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (；4gSilica fast column with eluent gradient of 5-19%Ethyl acetate/petroleum ether at a rate of 20 mL/min). N, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.175g, 221.01. mu. mol, 66.28% yield) was obtained as a light oil. LCMS: ESI-MS: 792.5[ M + H ] M/z]⁺。

Step D: n, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-ylidene Methyl-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of N, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -2-methylene-5- (pivaloyloxy) -1- (((((trifluoromethyl) sulfonyl) oxy) methyl) cyclopentyl) methyl pivalate (0.175g, 221.01. mu. mol) in DMF (1.5mL) was added LiCl (37.47mg, 884.03. mu. mol, 18.10. mu.L). The mixture was stirred at 40 ℃ for 2 hours. The mixture was diluted with EA (5mL) and H ₂O (5mL × 2) wash. Subjecting the organic layer to Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 3% to 30% at a rate of 40 mL/min). N, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.06g, 88.47umol, 40.03% yield) was obtained as a light oil.¹H NMR(400MHz，CDCl₃)δ＝8.82(s，1H)，8.16(s，1H)，5.76-5.64(m，1H)，5.39(d，J＝4.2Hz，1H)，5.31(s，1H)，4.88(s，1H)，4.60(d，J＝11.2Hz，1H)，4.42(d，J＝11.2Hz，1H)，3.90-3.71(m，2H)，2.87-2.72(m，1H)，2.52-2.33(m，1H)，1.53-1.44(m，18H)，1.33-1.28(m，9H)，1.22(s，9H)。LCMS：ESI-MS：m/z＝700.5[M+Na]⁺。

Step E: ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-methylene-5- (neopentyl) benzene Acyloxy) cyclopentyl) methyl pivalate. N, N-Di-BOC- ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.045g, 66.35. mu. mol) was dissolved in a solution of TFA (154.00mg, 1.35mmol, 0.1mL) in DCM (0.5mL), and the mixture was stirred at 25 ℃ for 3 hours. The mixture was washed with saturated NaHCO₃The solution was quenched (3mL) and extracted with DCM (5mL × 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4.0gFlash column over silica, eluent 0% -6% MeOH/DCM at 20 mL/min). ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.025g, 52.30. mu. mol, 78.83% yield) was obtained as a white solid. ¹H NMR(400MHz，CDCl₃)δ＝8.30(s，1H)，7.87(s，1H)，5.70(s，2H)，5.62(dd，J＝8.3，11.1Hz，1H)，5.36(d，J＝3.7Hz，1H)，5.31-5.27(m，1H)，4.91(d，J＝2.2Hz，1H)，4.57(d，J＝11.5Hz，1H)，4.40(d，J＝11.2Hz，1H)，3.91-3.68(m，2H)，2.72(ddd，J＝4.9，11.5，14.1Hz，1H)，2.39(dd，J＝7.7，14.6Hz，1H)，1.28(s，9H)，1.21(s，9H)。

LCMS：ESI-MS：m/z＝478.4[M+H]⁺。

Step F: (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (chloromethyl) -2- (hydroxymethyl) -3-methylene Cyclopentan-1-ol. To a solution of ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (0.045g, 94.15. mu. mol) in MeOH (0.5mL) was added CH₃ONa (10.17mg, 188.29. mu. mol). Will be mixed withThe mixture was stirred at 25 ℃ for 12 hours. The solvent was removed at low pressure. By column chromatography (SiO)₂DCM/MeOH 30/1 to 20/1) purified the residue. By Prep-HPLC (column: Waters Xbridge 150. mu. 255. mu.; mobile phase: [ water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% -30%, 6 min) further purifying the crude product. To give (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (chloromethyl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol (0.0124g, 39.63. mu. mol, 42.10% yield, 99% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.22(s，1H)，8.17(s，1H)，5.80-5.68(m，1H)，5.28(d，J＝2.8Hz，1H)，4.83(d，J＝2.3Hz，1H)，4.34(d，J＝3.3Hz，1H)，3.94-3.84(m，3H)，3.84-3.76(m，1H)，2.62(ddd，J＝4.5，10.9，13.2Hz，1H)，2.33(dd，J＝8.9，12.2Hz，1H)。LCMS：ESI-MS：m/z＝309.9[M+H]⁺。

Example 15: (1S, 3S, 5S) -5-hydroxy-1- (hydroxymethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine Pyridin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile。

Step A: ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1 (2H) - 1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl New valeric acid ester. At 25 ℃ and N₂Next, to a solution of ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 120mg, 186.11. mu. mol) and 3-benzoyl-5-methylpyrimidine-2, 4(1H, 3H) -dione (intermediate 6, 64.27mg, 279.16. mu. mol) in THF (3mL) was added PPh₃(122.03mg, 465.27. mu. mol). After dropwise addition of DIAD (94.08mg, 465.27. mu. mol, 90.46. mu.L) at 0 ℃ the reaction mixture was stirred at 25 ℃ for a further 12 h. The solvent was removed in vacuo to give a yellow oilA compound (I) is provided. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 10/1 to 3/1). ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (100mg, 61.44% yield, 98% purity) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝7.93-7.91(m，2H)，7.68-7.60(m，1H)，7.55-7.44(m，2H)，7.49-7.37(m，2H)，7.31-7.26(m，7H)，7.15(d，J＝1.0Hz，1H)，6.84(d，J＝8.8Hz，4H)，5.78-5.75(m，1H)，5.56(br，d，J＝4.0Hz，1H)，5.12(dd，J＝2.3，19.6Hz，2H)，4.11-4.02(m，2H)，3.80-3.77(m，6H)，3.60-3.58(m，1H)，3.29(d，J＝9.0Hz，1H)，2.63(s，3H)，2.45-2.43(m，1H)，2.24(br，dd，J＝8.8，13.1Hz，1H)，1.13(s，9H)，1.03(s，9H)。LCMS：ESI-MS：m/z＝879.3[M+Na]⁺。

And B: 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione. At 25 ℃ and N ₂Next, to a solution of ((1R, 3S, 5S) -3- (3-benzoyl-5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (4.4g, 5.13mmol) in MeOH (90mL) was added NaOH solution (4M, 44.00 mL). The reaction mixture was stirred at 60 ℃ for 4 hours. The reaction mixture was adjusted to a pH of about 8 with 4MHCl solution. The resulting mixture was extracted with EA (70mL x 3). The combined organic phases were washed with brine (50mL) over anhydrous Na₂SO₄Dried and concentrated in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (DCM/MeOH 50/1 to 20/1). 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (3g, 5.13mmol, 99.94% yield) was obtained as a white foam. LCMS: ESI-MS: 607.1[ M + Na ] M/z]⁺。

And C: 1- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyl) Dimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -bis Ketones. At 20 ℃ and N₂Next, to a solution of 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (3g, 5.13mmol) and 1-imidazole (1.05g, 15.39mmol) in DMF (9mL) was added TBSCl (928.06mg, 6.16mmol, 754.52. mu.L). The reaction mixture was stirred at 20 ℃ for 12 hours. The reaction was poured into water (50mL) and extracted with EA (70mL × 3). The combined organic phases were washed with brine (50mL) over anhydrous Na₂SO₄Dried and concentrated in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 3/1 to 1/1). 1- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (3.3g, 4.58mmol, 89.26% yield, 97% purity) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.37(br，s，1H)，7.44-7.43(m，2H)，7.36-7.32(m，7H)，7.12(d，J＝1.2Hz，1H)，6.91-6.88(m，4H)，5.93-5.89(m，1H)，4.93(m，2H)，4.58(br d，J＝2.5Hz，1H)，3.86(s，6H)，3.82(d，J＝10.2Hz，1H)，3.68(d，J＝8.8Hz，1H)，3.54(d，J＝10.2Hz，1H)，3.34(s，1H)，3.18(d，J＝8.6Hz，1H)，2.38-2.31(m，2H)，1.50(s，3H)，0.87(s，9H)，0.06(s，3H)，0.00(s，3H)。LCMS：ESI-MS：m/z＝721.3[M+Na]⁺。

Step D: 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) - 5-methylpyrimidine-2, 4(1H, 3H) -diones. At 20 ℃ and N₂Then, to 1- ((1S, 3R, 4S) -3- ((bis (4-methoxybenzene)To a solution of the group) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (3.3g, 4.72mmol) and collidine (1.43g, 11.80mmol, 1.56mL) in DCE (60mL) was added AgNO₃(2.01g, 11.80mmol, 1.99 mL). After addition of 4, 4' -dimethoxytrityl chloride (DMTrCl) (3.20g, 9.44mmol), the reaction mixture was stirred at 60 ℃ for 4 h. The reaction mixture was poured into water (50mL) and the inorganic material was filtered off. The filtrate was separated and the aqueous phase was extracted with DCM (70mL × 2). The combined organic phases were washed with brine (50mL) over anhydrous Na₂SO₄Dried and concentrated in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 5/1 to 2/1). 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (3.3g, 3.26mmol, 69.10% yield, 99% purity) was obtained as a light yellow foam. ¹H NMR(400MHz，CDCl₃)δ＝8.12(s，1H)，7.50-7.03(m，18H)，6.74-6.60(m，8H)，6.42(s，1H)，5.68(br s，1H)，4.93(br s，1H)，4.66(m，1H)，4.09-4.02(m，2H)，3.99(br d，J＝9.9Hz，1H)，3.86-3.83(m，1H)，3.76-3.69(m，12H)，3.43-3.41(m，1H)，2.72(br，d，J＝8.8Hz，1H)，1.90-1.84(m，1H)，1.45(s，3H)，0.83(s，9H)，0.01(m，6H)。LCMS：ESI-MS：m/z＝1024.8[M+Na]⁺。

Step E: 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -bis Ketones. 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (700mg, 699.11. mu. mol) was added to TBAF (1M, 20mL) and AcOH (882.00mg, 14. mu.mol)69mmol, 840. mu.L) is stirred at 50 ℃ for 12 hours. TEA (5mL) was added to the reaction mixture. The resulting mixture was concentrated in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate 1: 1 to 0: 1). 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (1g, 2 lots, 1.08mmol, 77.40% yield, 96% purity) was obtained as a light yellow foam.¹H NMR(400MHz，CDCl₃)δ＝11.21(br，s，1H)，7.41(m，2H)，7.29-7.19(m，12H)，7.07(m，4H)，6.88-6.78(m，8H)，6.44(s，1H)，5.40(m，1H)，4.83(d，J＝2.3Hz，1H)，4.68(m，2H)，4.00-3.96(m，2H)，3.92-3.84(m，2H)，3.71(s，12H)，2.86(br d，J＝9.0Hz，1H)，1.80-1.75(m，1H)，1.43(s，3H)。

LCMS：ESI-MS：m/z＝909.8[M+Na]⁺。

The method comprises the following steps: f (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxybenzene) Yl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene ring Pentane-1-carbaldehyde. To a solution of 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (100mg, 112.74 μmol) in DCM (2mL) and TEA (34.22mg, 338.21 μmol, 47.07 μ L) was added DMP (143.45mg, 338.21 μmol, 104.71 μ L) in one portion at 20 ℃. The reaction mixture was stirred at 20 ℃ for 4 hours. The reaction mixture was diluted with DCM (20mL) and poured over saturated Na₂S₂O₃Solution (5mL) and saturated NaHCO₃To the solution (5mL) and stirred for 5 min. The organic phase was separated and washed with brine (5mL) and over anhydrous Na₂SO₄And (5) drying. The solvent was removed in vacuo to give a pale yellow foam. To obtain (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methylYl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde (120mg, crude) as a pale yellow foam, which was used directly in the next step without further purification. LCMS: ESI-MS: 907.4[ M + Na ] M/z ]⁺。

Step G: (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) Methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl)-2-methylenecyclopentane-1-methyl Aldoxime. At 20 ℃ and N₂Next, NH was added in one portion to a solution of (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde (110mg, 124.29. mu. mol) in pyridine (1mL)₂OH HCl (17.27mg, 248.59. mu. mol). The reaction mixture was stirred at 20 ℃ for 12 hours. The solvent was removed under low pressure and the residue was diluted with EA (20mL), washed with water (5mL) and brine (5 mL). Passing the organic phase over anhydrous Na₂SO₄Dried and concentrated in vacuo to give a yellow foam. To give (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde oxime (85mg, 94.44 μmol, 75.98% yield) as a light yellow foam which was used directly in the next step without further purification. LCMS: ESI-MS: 922.8[ M + Na ] M/z ]⁺。

Step H: (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxybenzene) Yl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylene ring Pentane-1-carbonitrile. At 20 ℃ and N₂Next, to a solution of (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde oxime (800mg, 888.87. mu. mol) in ACN (10mL)CDI (288.26mg, 1.78mmol) was added in one portion. The reaction mixture was stirred at 30 ℃ for 36 hours. The reaction mixture was diluted with EA (100mL) and the resulting solution was washed with water (30mL), brine (30mL) and over anhydrous Na₂SO₄And (5) drying. The resulting solution was concentrated in vacuo to give a yellow oil. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate 2/1 to 1/1). To give (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (500mg, 63.14% yield, 99% purity) as a light yellow foam. LCMS: ESI-MS: 904.5[ M + Na ] M/z ]⁺。

Step I: (1S, 3S, 5S) -5-hydroxy-1- (hydroxymethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine- 1(2H) -yl) -2-methylenecyclopentane-1-carbonitrile. To a solution of (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (400mg, 453.51 μmol) in DCM (4mL) was added TFA (616.00mg, 5.40mmol, 0.4mL) at 20 ℃ and stirred for 2 hours at 20 ℃. The solvent was removed in vacuo. The residue was dissolved in acetonitrile (20mL) and saturated NaHCO was used₃The solution was adjusted to pH 8. The resulting mixture was concentrated in vacuo to give 600mg of crude product as a yellow oil. 900mg of the crude product was purified by silica gel column chromatography (DCM/MeOH-15/1 to 10/1). To give (1S, 3S, 5S) -5-hydroxy-1- (hydroxymethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (152.2mg, 97.75% purity, 80.7% yield) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.34(s，1H)，5.64-5.58(m，2H)，5.23(s，1H)，4.43(d，J＝3.8Hz，1H)，3.87-3.84(m，1H)，3.79-3.86(m，1H)，2.34-2.29(m，1H)，2.28-2.18(m，1H)，1.86(s，3H)。LCMS：ESI-MS：m/z＝278.1[M+H]⁺。

Example 16: (1S, 3S, 5S) -3- (4-amino-2-oxoPyrimidin-1 (2H) -yl) -5-hydroxy-1- (hydroxymethyl) 2-methylenecyclopentane-1-carbonitrile 。

Step A: ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalic acid Esters. To ((1S, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, 3g, 4.65mmol), PPh at 0 deg.C₃(2.44g, 9.31mmol) and 3-benzoyl-1H-pyrimidine-2, 4-dione (1.51g, 6.98mmol) in THF (60mL) was added DIAD (1.88g, 9.31mmol, 1.81 mL). The mixture was stirred at 25 ℃ for 12 hours. The solvent was removed under reduced pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 6% to 23% at a rate of 20 mL/min). ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (3.3g, 3.91mmol, 84.14% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝7.99-7.90(m，2H)，7.69-7.63(m，1H)，7.57-7.49(m，2H)，7.43-7.36(m，2H)，7.27(s，7H)，7.06(d，J＝8.2Hz，1H)，6.86(d，J＝8.8Hz，4H)，5.70(t，J＝9.0Hz，1H)，5.48(d，J＝8.0Hz，2H)，5.23(d，J＝2.2Hz，1H)，5.11(d，J＝2.0Hz，1H)，4.27(d，J＝11.0Hz，1H)，4.11-4.05(m，1H)，3.82(s，6H)，3.47-3.37(m，2H)，2.25-2.18(m，1H)，2.13(dd，J＝4.8，10.4Hz，1H)，1.16(s，9H)，1.09(s，9H)。LCMS：ESI-MS：m/z＝865.5[M+Na]⁺。

And B: 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione. To a solution of ((1R, 3S, 5S) -3- (3-benzoyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (1.73g, 2.05mmol) in MeOH (40mL) was added NaOH (4M, 7.70 mL). The mixture was stirred at 60 ℃ for 12 hours. The reaction mixture was neutralized with HCl solution (1M) and extracted with EA (20mL × 3). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 0% -2% MeOH/DCM at 20 mL/min). 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.793g, 1.39mmol, 67.71% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.95(s，1H)，7.40(d，J＝7.6Hz，2H)，7.35-7.28(m，6H)，7.27-7.21(m，1H)，6.89(d，J＝8.0Hz，1H)，6.86(d，J＝8.6Hz，4H)，5.78-5.62(m，1H)，5.48(d，J＝8.0Hz，1H)，4.93(d，J＝2.6Hz，1H)，4.86(d，J＝2.0Hz，1H)，4.56(d，J＝3.6Hz，1H)，3.83-3.76(m，8H)，3.41(d，J＝9.2Hz，1H)，3.24(d，J＝9.2Hz，1H)，2.25(dd，J＝8.8，12.2Hz，1H)，1.96-1.80(m，1H)。LCMS：ESI-MS：m/z＝593.1[M+Na]⁺。

And C: 1- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-, (((tert-butyl) Dimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione . To a solution of 1- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.793g, 1.39mmol) in DMF (1.8mL) at 0 ℃ were added imidazole (283.82mg, 4.17mmol) and TBSCl (314.18mg, 2.08mmol, 255.43 μ L). The mixture was stirred at 25 ℃ for 2 hours. The mixture was diluted with EA (15mL) and H₂O (10mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 0% -1% MeOH/DCM, speed 20mL/min) purify the residue. 1- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.825g, 1.20mmol, 86.68% yield) was obtained as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.40(s，1H)，7.42-7.35(m，2H)，7.33-7.27(m，4H)，7.26-7.19(m，3H)，7.04(d，J＝8.0Hz，1H)，6.84(d，J＝8.8Hz，4H)，5.86-5.72(m，1H)，5.42(dd，J＝2.3，8.0Hz，1H)，4.97(d，J＝2.8Hz，1H)，4.88(d，J＝2.2Hz，1H)，4.45-4.39(m，1H)，3.83-3.80(m，6H)，3.76(d，J＝10.0Hz，1H)，3.70-3.64(m，1H)，3.46(d，J＝8.8Hz，1H)，3.21(dd，J＝3.1，5.4Hz，2H)，2.33-2.23(m，1H)，2.04-1.98(m，1H)，0.84(s，9H)，0.03(s，3H)，-0.01(s，3H)。LCMS：ESI-MS：m/z＝707.2[M+Na]⁺。

Step D: 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxyYl) methyl) -2-methylene cyclopentyl) Pyrimidine-2, 4(1H, 3H) -diones . To a solution of 1- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.1g, 146.01. mu. mol) in Dichloroethane (DCE) (0.3mL) was added AgNO₃(49.61mg, 292.02. mu. mol, 49.11L), collidine (35.39mg, 292.02. mu. mol, 38.59. mu.L) and 1- [ chloro- (4-methoxyphenyl) -phenyl-methyl]-4-methoxy-benzene (74.21mg, 219.01 μmol). The mixture was stirred at 50 ℃ for 1 hour. The mixture was quenched with MeOH (2mL) and the solvent was removed at low pressure. By flash chromatography on silica gel (4gSilica flash column, eluent ethyl acetate/petroleum ether at a gradient of 15% to 45% at a rate of 20 mL/min). 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.108g, 107.21. mu. mol, 73.42% yield, 98% purity) was obtained as a white foam.¹H NMR(400MHz，CD₃OD)δ＝7.48(d，J＝7.0Hz，2H)，7.35(dd，J＝9.0，13.8Hz，4H)，7.30-7.21(m，6H)，7.19-7.18(m，1H)，7.15(d，J＝8.0Hz，2H)，7.09(dd，J＝6.0，8.8Hz，4H)，6.85-6.70(m，8H)，5.38(s，1H)，5.11(d，J＝8.0Hz，1H)，4.94(d，J＝2.2Hz，1H)，4.92-4.90(m，1H)，4.20(t，J＝6.8Hz，1H)，4.07(s，1H)，3.96(d，J＝9.8Hz，1H)，3.76(dd，J＝2.4，6.8Hz，12H)，3.54(d，J＝9.6Hz，1H)，3.06(d，J＝9.6Hz，1H)，2.09-2.03(m，1H)，1.28(d，J＝5.8Hz，1H)，0.89(s，9H)，0.07(d，J＝4.2Hz，6H)。

Step E: 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione. 1- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.1g, 101.29. mu. mol) was treated with TBAF (2M, 3 mL). [ use of TBAF in CH₃COOH (176.40mg, 2.94mmol, 168.00. mu.L) neutralization]. The reaction mixture was stirred at 50 ℃ for 12 hours. The mixture was diluted with EA (5mL) and H₂O (5mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 0% -2% MeOH/DCM at 20 mL/min). 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.06g, 68.73 μmol, 67.85% yield) was obtained as a white foam.¹H NMR(400MHz，CD₃OD)δ＝7.53(d，J＝7.0Hz，2H)，7.40(dd，J＝8.8，13.8Hz，4H)，7.35-7.27(m，5H)，7.20-7.09(m，8H)，6.93-6.77(m，8H)，5.59(s，1H)，5.32(s，1H)，5.08(d，J＝8.0Hz，1H)，4.96(d，J＝1.8Hz，1H)，4.83(d，J＝2.0Hz，1H)，4.23(dd，J＝6.0，8.5Hz，1H)，4.03-3.90(m，2H)，3.86-3.74(m，12H)，3.61(d，J＝9.6Hz，1H)，3.19(d，J＝9.6Hz，1H)，2.13-2.06(m，1H)，1.37-1.30(m，1H)。LCMS：ESI-MS：m/z＝895.3[M+Na]⁺。

Step F: (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxybenzene) Yl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1- Formaldehyde (I). To a solution of 1- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidine-2, 4(1H, 3H) -dione (0.06g, 68.73 μmol) in DCM (0.7mL) was added DMP (58.30mg, 137.46 μmol, 42.56 μ L). The mixture was stirred at 25 ℃ for 1 hour. The mixture was washed with saturated NaHCO₃Solution (1mL) and saturated Na₂S₂O₃The solution (1mL) was quenched. The mixture was extracted with DCM (10mL × 2) and the combined organic layers were washed with brine (10 mL). Subjecting the obtained solution to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure to give the residue (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde (0.06g, crude) as a white foam. LCMS: ESI-MS: 893.8[ M + Na ] M/z]⁺。

Step G: (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) Methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde oxime . To a solution of (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde (60mg, 68.89 μmol) in pyridine (0.7mL) was added hydroxylamine hydrochloride (9.57mg, 137.78 μmol). The mixture was stirred at 25 ℃ for 0.5 hour. The reaction mixture was concentrated under reduced pressure. The residue is washed with H₂O (5mL) was diluted and extracted with EA (5mL × 2). The combined organic layers were washed with brine (15mL) and Na₂SO₄Dried, filtered and concentrated under reduced pressure to give crude product (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbaldehyde oxime (60mg, crude product) as a brown foam. LCMS: ESI-MS: 908.3[ M + Na ] M/z]⁺。

Step H: (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxybenzene) Yl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1- Nitrile (A) to methyl cyanide. To a solution of (E) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carboxaldoxime (0.71g, 801.36. mu. mol) in CH ₃To a solution of CDI (259.88mg, 1.60mmol) in CN (8mL) was added. The mixture was stirred at 45 ℃ for 16 hours. The mixture was diluted with EA (20mL) and H₂O (15mL × 2) wash. The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (12gSilica flash column, eluent 17% -62% ethyl acetate/petroleum ether gradient at 30 mL/min). To give (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (0.57g, 656.70 μmol, 81.95% yield) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.51(d，J＝7.5Hz，2H)，7.44-7.37(m，4H)，7.34(d，J＝8.8Hz，2H)，7.30-7.18(m，10H)，7.00(d，J＝8.0Hz，1H)，6.80(ddd，J＝2.8，4.1，9.0Hz，8H)，5.55(s，1H)，5.44(d，J＝8.0Hz，1H)，5.21-5.11(m，2H)，4.05(t，J＝3.5Hz，1H)，3.77(d，J＝1.0Hz，6H)，3.72(d，J＝9.3Hz，6H)，3.41-3.35(m，1H)，3.29(s，1H)，1.06-0.97(m，1H)，0.95-0.84(m，1H)。LCMS：ESI-MS：m/z＝890.3[M+Na]⁺。

Step I: (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5- (bis (4-methoxyphenyl) (phenyl group) Methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylenecyclopentane-1-carbonitrile. To (1S, 3S, 5S) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (0.57g, 656.70. mu. mol) in CH ₃Et was added to a solution of CN (3mL)₃N (132.90mg, 1.31mmol, 182.81. mu.L), DMAP (160.46mg, 1.31mmol) and 2, 4, 6-triisopropylbenzenesulfonyl chloride (397.77mg, 1.31 mmol). The mixture was stirred at 25 ℃ for 0.5 hour. Reacting NH₃·H₂O (1.82g, 14.54mmol, 2mL, 28% purity, 22.14 equivalents) was added to the mixture and the reaction mixture was stirred at 25 ℃ for 1.5 h. The mixture was diluted with EA (30mL) and saturated NH₄Cl solution (15mL 4) was washed. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (20gFlash column over silica, eluent 0% -3.2% MeOH/DCM at 30 mL/min). To give (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylenecyclopentane-1-carbonitrile (0.439g, 496.22 μmol, 75.56% yield, 98% purity) as a white foam.¹H NMR(400MHz，METHANOL-d₄)δ＝7.51(d，J＝7.3Hz，2H)，7.43-7.37(m，4H)，7.34(d，J＝8.8Hz，2H)，7.30-7.16(m，10H)，7.01(d，J＝7.5Hz，1H)，6.84-6.75(m，8H)，5.64(d，J＝7.3Hz，1H)，5.48(d，J＝1.5Hz，1H)，5.18(s，1H)，5.02(s，1H)，4.07-4.03(m，1H)，3.77(d，J＝1.8Hz，6H)，3.72(d，J＝8.5Hz，6H)，3.41-3.33(m，2H)，1.16-1.09(m，1H)，1.01-0.90(m，1H)。LCMS：ESI-MS：m/z＝867.2[M+H]⁺。

Step J: the ratio of (1S, 3S,5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5-hydroxy-1- (hydroxymethyl) -2- Methylene cyclopentane-1-carbonitrile. To a solution of (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5- (bis (4-methoxyphenyl) (phenyl) methoxy) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylenecyclopentane-1-carbonitrile (389.00mg, 448.68 μmol) in DCM (2mL) was added TFA (7.67g, 13.46mmol, 4.98mL, 20% purity). The mixture was stirred at 25 ℃ for 0.5 hour. The mixture is treated with NH ₃Quench (7M in MeOH, 1mL) and remove the solvent under reduced pressure. By flash chromatography on silica gel (4gFlash column over silica, eluent 5% -17% MeOH/DCM, speed 20mL/min) purify the residue. By Pre-HPLC (column: Waters Xbridge 150 x 255 u; mobile phase: [ water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% -25%, 6 min) further purifying the crude product. To give (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (0.0998g, 376.73. mu. mol, 83.96% yield, 99% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝7.54(d，J＝7.3Hz，1H)，5.88(d，J＝7.3Hz，1H)，5.63(t，J＝9.2Hz，1H)，5.55(d，J＝2.3Hz，1H)，5.15(s，1H)，4.43(d，J＝3.5Hz，1H)，3.90-3.83(m，1H)，3.80-3.73(m，1H)，2.40-2.28(m，1H)，2.25-2.16(m，1H)。LCMS：ESI-MS：m/z＝263.1154[M+H]⁺。

Example 17: (1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylene Cyclopentane-1-carbonitrile。

Step A: ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyl di Methylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. At 30 ℃ and N₂Next, to a solution of ((1R, 3R, 5S) -3- ((tert-butyldimethylsilyl) oxy) -1- (hydroxymethyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (intermediate 7, product of step I, 8.8g, 19.27mmol) in DCM (90mL) was added AgNO in one portion ₃(6.55g, 38.54mmol, 6.48mL) and collidine (4.67g, 38.54mmol, 5.09 mL). 1- [ chloro- (4-methoxyphenyl) -phenyl-methyl at 30 DEG C]-4-methoxy-benzene (9.79g, 28.90mmol) was added to the mixture. The reaction mixture was stirred at 30 ℃ for 1 hour. Inorganic material was removed by filtration and the filter cake was washed with DCM (100mL × 2). The filtrate was washed with water (50mL x 2) and brine (50 mL). Passing the organic phase over anhydrous Na₂SO₄Dried, filtered and concentrated in vacuo. By flash chromatography on silica gel (80gThe residue was purified on silica flash column eluting with ethyl acetate/petroleum ether in a gradient of 0% to 7% to give ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyldimethylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (10.2g, 12.63mmol, 65.55% yield, 94% purity) as a yellow oil.¹H-NMR(400MHz，CDCl₃)δ＝7.40-7.15(m，9H)，6.85-6.75(d，J＝8.8Hz，4H)，5.30-5.22(d，J＝2Hz，1H)，5.15-5.05(dd，J＝6.4，8Hz，1H)，5.00-4.95(d，J＝2.8Hz，1H)，4.50-4.40(m，1H)，4.30-4.20(q，J＝10.8Hz，2H)，3.80(s，6H)，3.04(s，2H)，2.50-2.40(m，1H)，1.75-1.62(m，1H)，1.20-1.00(m，18H)，0.95-0.85(m，9H)，0.10-0.04(d，J＝10Hz，6H)。LCMS：ESI-MS：m/z＝781.40[M+Na]⁺。

And B: ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-ylidene Methyl-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a mixture of ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((tert-butyldimethylsilyl) oxy) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (17.9g, 23.58mmol) in THF (230mL) was added TBAF (1M, 35.37mL) at 30 ℃. The reaction mixture was stirred at 30 ℃ for 1 hour. The solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate ═ 5/1 to 4/1) to give ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (14g, 21.28mmol, 90.23% yield, 98% purity) as a yellow oil. ¹H NMR(400MHz，CDCl3)δ＝7.40-7.15(m，9H)，6.85-6.75(d，J＝8.8Hz，4H)，5.50-5.45(d，J＝1.6Hz，1H)，5.20-5.08(m，2H)，4.55-4.40(m，2H)，4.20-4.13(d，J＝11.2Hz，1H)，3.80(s，6H)，3.10-3.03(dd，J＝8.8，14Hz，2H)，2.46-2.41(m，1H)，1.78-1.68(m，1H)，1.20-1.00(m，18H)。LCMS：ESI-MS：m/z＝667.20[M+Na]⁺。

And C: n, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxy) Phenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate. To a solution of ((1R, 3R, 5S) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-hydroxy-2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (9g, 13.96mmol) in THF (180mL) at 30 deg.C was added PPh₃(9.52g, 36.29mmol) and N, N-Di-BOC-9H-purin-6-amine (14.00g, 41.75mmol), then DIAD (7.34g, 36.29mmol, 7.06mL) was added dropwise at 0 ℃. The mixture was stirred at 30 ℃ for 12 hours. The solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate ═ 4/1) to give N, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivaloylThe acid ester (15g, 10.76mmol, 77.07% yield, 69% purity) was a yellow oil.¹H NMR(400MHz，CDCl₃)δ＝8.77(s，1H)，7.79(s，1H)，7.45-7.20(m，16H)，6.85-6.78(d，J＝8.8Hz，6H)，6.376(s，4H)，5.80-5.70(m，1H)，5.55-5.45(m，1H)，5.22(s，1H)，4.40-4.33(m，2H)，4.28-4.21(d，J＝10.8Hz，1H)，3.79(s，9H)，3.45(s，2H)，2.54-2.36(m，2H)，2.32-2.23(m，2H)，1.50-1.40(m，27H)，1.30-1.17(m，57H)，1.10(s，11H)。LCMS：ESI-MS：m/z＝962.50[M+H]⁺。

Step D: (9- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester . To a solution of N, N-Di-BOC- ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-5- (pivaloyloxy) cyclopentyl) methyl pivalate (10g, 10.39mmol) in MeOH (150mL) was added NaOH solution (4M, 33.33mL) and stirred at 25 ℃ for 12 hours. Addition of H₂O (100mL) and the mixture was extracted with EA (200mL 4). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (80gFlash column on silica eluting with MeOH/DCM gradient 0% to 3% at 60mL/min) to give tert-butyl (9- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (3.7g, 5.33mmol, 51.28% yield) as a white foam. LCMS: ESI-MS: 694.3[ M + H ] M/z]⁺。

Step E: (9- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyl) Dimethylsilyl) oxy) silylYl) -4-hydroxy-2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester Esters. To a solution of tert-butyl (9- ((1S, 3S, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (3.5g, 5.04mmol) in DMF (7mL) at 0 ℃ was added imidazole (1.03g, 15.13mmol) and tert-butyl-chloro-dimethyl-silane (1.14g, 7.57mmol, 927.26 μ L). The mixture was stirred at 25 ℃ for 2 hours. The mixture was diluted with EA (50mL) and H ₂O (50mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (20gSilica flash column, eluent MeOH/DCM at gradient 0% to 2% and rate 35mL/min) to purify the residue to give tert-butyl (9- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (3.7g, 4.21mmol, 83.50% yield, 92% purity) as a white foam. LCMS: ESI-MS: 808.5[ M + H ] M/z]⁺。

Step F: (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) - 9H-purin-6-yl) carbamic acid tert-butyl ester. To a solution of tert-butyl (9- ((1S, 3R, 4S) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -4-hydroxy-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (4.7g, 5.82mmol) in DCE (13mL) was added AgNO₃(1.98g, 11.63mmol, 1.96mL), collidine (1.41g, 11.63mmol, 1.54mL) and 1- [ chloro- (4-methoxyphenyl) -phenyl-methyl ]-4-methoxy-benzene (2.96g, 8.72)mmol). The mixture was stirred at 50 ℃ for 2 hours. The mixture was quenched with MeOH (10mL) and the solvent was removed at low pressure. By flash chromatography on silica gel (40gSilica flash column, eluent ethyl acetate/petroleum ether with gradient 8% -30% and speed 40mL/min) to purify the residue to give tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (5.8g, 5.12mmol, 88.01% yield, 98% purity) as a white foam.¹H NMR(400MHz，CDCl₃)δ＝8.67(s，1H)，8.08(s，1H)，7.64(s，1H)，7.48-7.42(m，2H)，7.32(dd，J＝8.8，13.2Hz，4H)，7.25-7.17(m，7H)，7.17-7.07(m，5H)，6.79-6.65(m，8H)，5.57(t，J＝6.9Hz，1H)，5.04(s，1H)，4.76(d，J＝1.8Hz，1H)，4.27-4.17(m，2H)，4.01(d，J＝9.5Hz，1H)，3.77(d，J＝2.0Hz，6H)，3.74-3.69(m，6H)，3.54(d，J＝9.5Hz，1H)，3.05-2.99(m，1H)，2.12-2.06(m，1H)，1.56(s，9H)，1.50-1.40(m，1H)，0.99-0.86(m，9H)，0.10(d，J＝5.3Hz，6H)。LCMS：ESI-MS：m/z＝1110.6[M+H]⁺。

Step G: (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester Esters. Tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (((tert-butyldimethylsilyl) oxy) methyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (4.4g, 3.96mmol, 1 eq) was treated with TBAF (1.5M, 40mL, 15.14 eq) and stirred at 50 ℃ for 3 hours. The mixture was diluted with EA (40mL) and By H₂O (30mL × 2) wash. Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (40gSilica flash column, eluent ethyl acetate/petroleum ether with gradient 20% -55% speed 40mL/min) to purify the residue to give tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (2.8g, 2.70mmol, 68.10% yield, 96% purity) as a white foam.¹H NMR(400MHz，CD₃OD)δ＝8.45(s，1H)，7.86(s，1H)，7.43(dd，J＝1.4，8.0Hz，2H)，7.32-7.17(m，12H)，7.15-7.08(m，4H)，6.79-6.66(m，8H)，5.41(d，J＝4.4Hz，1H)，5.06(d，J＝1.5Hz，1H)，4.97(d，J＝1.5Hz，1H)，4.28(dd，J＝6.0，9.0Hz，1H)，4.15-4.12(m，1H)，4.08-4.05(m，1H)，3.76(d，J＝2.4Hz，6H)，3.72(d，J＝3.3Hz，6H)，3.48(d，J＝9.5Hz，1H)，3.35-3.32(m，1H)，2.21(td，J＝8.7，13.9Hz，1H)，1.76-1.64(m，1H)，1.59(s，9H)。LCMS：ESI-MS：m/z＝996.4[M+H]⁺。

Step H: (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester. To a solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.4g, 401.55 μmol) in DCM (4mL) was added DMP (340.62mg, 803.09 μmol, 248.63 μ L). The mixture was stirred at 25 ℃ for 1 hour. The mixture was washed with saturated NaHCO ₃Solution (5mL) and saturated Na₂S₂O₃Solution (5mL) quenchingAnd (6) extinguishing. The reaction mixture was extracted with DCM (20mL × 2). The combined organic layers were washed with brine (10mL) and dried over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure to give crude tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.39g, crude) as a yellow foam. LCMS: ESI-MS: 994.5[ M + H ] M/z]⁺。

Step I: (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3- ((E) - (hydroxyimino) methyl) -2-methylenecyclopentyl) -9H-purine-6- Yl) carbamic acid tert-butyl ester. To a solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.39g, 392.30. mu. mol) in pyridine (4mL) was added NH₂OH HCl (54.52mg, 784.60. mu. mol). The mixture was stirred at 25 ℃ for 0.5 hour. The reaction mixture was concentrated under reduced pressure. The residue is washed with H ₂O (5mL) was diluted and extracted with EA (5mL × 2). The combined organic layers were washed with brine (10mL) and dried over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure to give tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((E) - (hydroxyimino) methyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.39g, crude) as a yellow foam. LCMS: ESI-MS: 1009.4[ M + H ] M/z]⁺。

Step J: (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3-cyano-2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester. To (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- ((E) - (hydroxyimino) methyl) -2-methylenecyclohPentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester (0.45g, 445.92. mu. mol) in CH₃To a stirred solution of CDI (144.61mg, 891.84. mu. mol) in CN (4mL) was added. The mixture was stirred at 25 ℃ for 12 hours. The mixture was diluted with EA (5mL) and H₂O (5mL × 2) wash. The combined organic layers were passed over anhydrous Na ₂SO₄Dried, filtered and concentrated under reduced pressure. By column chromatography (SiO)₂Petroleum ether/ethyl acetate 5/1 to 2/1) and purified by Prep-HPLC (column: waters Xbridge 150 × 255 u; mobile phase: [ Water (10mM NH)₄HCO₃)-ACN](ii) a B%: 70% -100%, 6 min) to give tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-cyano-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.34g, 336.18 μmol, 75.39% yield, 98% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.14(s，1H)，8.06(s，1H)，7.55(d，J＝7.3Hz，2H)，7.46-7.40(m，4H)，7.37(d，J＝9.0Hz，2H)，7.31-7.15(m，10H)，6.84-6.75(m，8H)，5.62(s，1H)，5.49(br t，J＝8.4Hz，1H)，4.97(s，1H)，4.59(br，s，1H)，4.41(t，J＝4.0Hz，1H)，3.76(s，6H)，3.72(d，J＝2.0Hz，6H)，3.67(d，J＝9.9Hz，1H)，3.39(d，J＝9.9Hz，1H)，1.70(ddd，J＝4.7，8.7，13.9Hz，1H)，1.56(s，9H)，1.23-1.15(m，1H)。LCMS：ESI-MS：m/z＝991.5[M+H]⁺。

Step K: (1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylene ring Pentane-1-carbonitrile. To a solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-cyano-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.34g, 343.04 μmol) in DCM (3mL) was added TFA (4.62g, 8.10mmol, 3mL, 20% purity). The mixture was stirred at 25 ℃ for 2 hours. The mixture is treated with NH₃Quench (7M in MeOH, 2mL) and remove the solvent under reduced pressure. By column chromatography (SiO) ₂DCM/MeOH 30/1 to 15/1) and purifying the residue, andby Prep-HPLC (column: Waters Xbridge 150 x 255 u; mobile phase: [ water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% to 30%, 6 min) to give (1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (0.062g, 216.56 μmol, 63.13% yield, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.20(s，1H)，8.16(s，1H)，5.85-5.72(m，1H)，5.58(d，J＝1.8Hz，1H)，5.06(s，1H)，4.57(br，J＝3.1Hz，1H)，4.11(d，J＝11.5Hz，1H)，3.87(d，J＝11.5Hz，1H)，2.80(ddd，J＝4.5，10.8，13.3Hz，1H)，2.39(ddd，J＝1.7，8.2，13.5Hz，1H)。LCMS：ESI-MS：m/z＝287.1294[M+H]⁺。

Example 18: (1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile。

Step A: n, N-Di-BOC- (6aS, 8S, 9aS) -8- (2-amino-6-chloro-9H-purin-9-yl) -2, 2, 4, 4- Tetraisopropyl-7-methylenetetrahydrocyclopenta [ f)][1，3，5，2，4]Trioxasidiocin-6 a (6H) -carbonitrile. To (6aS, 8R, 9aS) -8-hydroxy-2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f][1，3，5，2，4]Trioxadisilyloxin-6 a (6H) -carbonitrile (intermediate 9, 0.054g, 0.131mmol), N-Di-BOC-6-chloro-9H-purin-2-amine (intermediate 10, 0.145g, 0.393mmol) and triphenylphosphine (0.103g, 0.393mmol) in THF (1.3mL, 0.1M) was added diisopropyl azodicarboxylate (0.080mL, 0.393 mmol). The reaction mixture was heated at reflux for 1 hour 10 minutes, then cooled and concentrated in vacuo to give an orange oil. The two batches were combined and purified (FCC, SiO2, 0% -30% EtOAc/hexanes) to give N, N-Di-BOC- (6aS, 8S, 9aS) -8- (2-amino-6-chloro-9H-purin-9-yl) -2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f ][1，3，5，2，4]Trioxadisilicin-6a (6H) -carbonitrile as a foamy white solid (0.108 g).

And B: (1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -5-hydroxy-1- (hydroxy) Methyl) -2-methylenecyclopentane-1-carbonitrile. To the flask was charged N, N-Di-BOC- (6aS, 8S, 9aS) -8- (2-amino-6-chloro-9H-purin-9-yl) -2, 2, 4, 4-tetraisopropyl-7-methylenetetrahydrocyclopenta [ f ] cooled to 0 deg.C][1，3，5，2，4]Trioxadisilyloxin-6 a (6H) -carbonitrile (0.108g, 0.141mmol) in a round-bottomed flask was added TFA/H dropwise₂O (1.25 mL: 1.25mL, 0.0566M). The colorless solution was stirred at room temperature for 48 hours, then coevaporated with EtOH (3 times), concentrated in vacuo and taken up in THF. To this solution was added TBAF (1 eq) at 0 ℃, followed by stirring at room temperature. After 2 hours another equivalent of TBAF was added, then after 1 hour concentrated in vacuo to give a viscous yellow oil. In reverse phase HPLC Phenomenex Synergyi 4 micron Hydro-RP 80A 250X 21.2mm (0% -50% acetonitrile in triethylammonium acetate (TEAA) buffer H₂O solution with TEAA buffer) to give (1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile as a white solid (0.0277 g, 59% over 2 steps). ¹H NMR(400MHz，CDCl₃)：δ7.77(s，1H)，5.64(m，1H)，5.56(d，J＝2.8，1H)，5.53(m，1H)，5.08(d，J＝2.8，1H)，4.01(d，J＝12，1H)，3.82(d，J＝12，1H)，2.66(m，1H)，2.34(m，1H)。MS，m/Z 302.95[M+1]⁺。

Example 19: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-ylidene Methylcyclopentan-1-ol。

Step A: (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylene ringPentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester. To a solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (product of example 17, step G, 0.4G, 401.55 μmol) in DCM (4mL) was added DMP (340.62mg, 803.09 μmol, 248.63 μ L). The mixture was stirred at 25 ℃ for 1 hour. The reaction mixture was filtered and purified by addition of saturated NaHCO₃Solution and saturated Na₂SO₃The solution was quenched (1: 1, 5 mL). The resulting solution was washed with brine (2mL x 5). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂Petroleum ether/ethyl acetate 10/1 to 1/1) gave tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (388mg, 390.29 μmol, 97.20% yield) as a white foam. LCMS: ESI-MS: 994.5[ M + H ] M/z ]⁺。

And B: (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -3-ethynyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester. At 25 ℃ and N₂Down to K₂CO₃(187.68mg, 1.36mmol) in MeCN 1-dimethoxyphosphoryl propan-2-one (75.19mg, 452.65. mu. mol, 62.14. mu.L) and TosN were added₃(89.27mg, 452.65. mu. mol) the mixture was stirred at 25 ℃ for 2 hours. A solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.225g, 226.33. mu. mol) in MeOH (0.3mL) and MeCN (0.3mL) was added. The mixture was stirred at 25 ℃ for 48 hours. Subjecting the mixture to hydrogenation with H₂O (3mL) was quenched and extracted with EA (5 mL). Subjecting the organic layer to anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂Petroleum etherEthyl acetate 20/1 to 2/1) to give tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-ethynyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (100mg, 96.96 μmol, 42.84% yield, 96% purity) as a white foam. LCMS: ESI-MS: 990.5[ M + H ] M/z ]⁺。

And C: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylene Cyclopentan-1-ol. To a solution of tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-ethynyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (100mg, 101.00 μmol) in DCM (0.6mL) at 25 ℃ were added TFA (770.00mg, 6.75mmol, 0.5mL) and DCM (0.1mL) (V_TFA∶V_DCM5: 1). The mixture was stirred at 25 ℃ for 2 hours. By NH₃MeOH (7M) solution the mixture was neutralized to pH 7. The resulting solution was concentrated under reduced pressure. By flash chromatography on silica gel (SiO)₂DCM/MeOH 30/1 to 10/1) and the residue was purified by Prep-HPLC (column: xbridge BEH C18, 250 × 50mm, 10 μm; mobile phase: [ Water (10mM NH)₄HCO₃)-ACN](ii) a B%: 0% to 30%, 9 min) to give (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (33.1mg, 100% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.24(s，1H)，8.18(s，1H)，5.80-5.73(m，1H)，5.51(d，J＝2.5Hz，1H)，4.99(d，J＝2.5Hz，1H)，4.45-4.42(m，1H)，3.98(d，J＝11.3Hz，1H)，3.82(d，J＝11.0Hz，1H)，2.72-2.62(m，2H)，2.41(ddd，J＝3.0，8.4，13.2Hz，1H)。LCMS：ESI-MS：m/z＝285.9[M+H]⁺。

Example 20: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2- (hydroxymethyl) -3-methylene-2-ethane Alkenyl cyclopent-1-ols。

Step A: (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxy-phenyl) Phenyl) (phenyl) methoxy) methyl) -2-methylene-3-vinylcyclopentyl) -9H-purin-6-yl) carbamic acid tert-butyl ester. To a solution of methyl (triphenyl) phosphonium bromide (280.28mg, 784.60 μmol) in toluene (0.5mL) at 25 deg.C was added potassium 2-methyl-2-butoxide (396.19mg, 784.60 μmol, 455.39 μ L, 25% purity), and stirred at 25 deg.C for 1 hour. Then, a solution of tert-butyl (9- ((1S, 3S, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -3-formyl-2-methylenecyclopentyl) -9H-purin-6-yl) carbamate (0.26g, 261.53 μmol) in toluene (0.5mL) was added to the mixture, and the mixture was stirred at 25 ℃ for 4 hours. The mixture was washed with saturated NH₄The Cl solution (5mL) was quenched and extracted with EA (5mL × 2). The combined organic layers were passed over anhydrous Na₂SO₄Dried, filtered and concentrated under reduced pressure. By flash chromatography on silica gel (；4gSilica flash column, eluent ethyl acetate/petroleum ether with gradient 20% -40% at 20mL/min) to purify the residue to give tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-3-vinylcyclopentyl) -9H-purin-6-yl) carbamate (0.18g, 177.79 μmol, 67.98% yield, 98% purity) as a white foam. ¹H NMR(400MHz，CD₃OD)δ＝8.44(s，1H)，7.86(s，1H)，7.45(d，J＝7.3Hz，2H)，7.31-7.08(m，16H)，6.79-6.64(m，8H)，6.58(dd，J＝10.6，17.6Hz，1H)，5.42(d，J＝10.8Hz，1H)，5.31(br d，J＝6.0Hz，1H)，5.23(d，J＝17.2Hz，1H)，5.07(s，1H)，4.81(s，1H)，4.28(dd，J＝5.2，9.6Hz，1H)，3.75(dd，J＝6.0，7.9Hz，12H)，3.60(d，J＝9.7Hz，1H)，3.22(d，J＝9.7Hz，1H)，1.96-1.83(m，1H)，1.69(br，d，J＝13.2Hz，1H)，1.59(s，9H)。LCMS：ESI-MS：m/z＝992.4[M+H]⁺。

And B: (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2- (hydroxymethyl) -3-methylene-2-vinyl Cyclopentan-1-ol. To a solution of tert-butyl (9- ((1S, 3R, 4S) -4- (bis (4-methoxyphenyl) (phenyl) methoxy) -3- ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -2-methylene-3-vinylcyclopentyl) -9H-purin-6-yl) carbamate (0.4g, 403.16 μmol) in DCM (2mL) was added TFA (7.00g, 12.28mmol, 4.55mL, 20% purity). The mixture was stirred at 25 ℃ for 8 hours. The mixture is treated with NH₃Quench (7M in MeOH, 4mL) and remove the solvent under reduced pressure. By column chromatography (SiO)₂DCM/MeOH 30/1 to 15/1) to give (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2- (hydroxymethyl) -3-methylene-2-vinylcyclopentan-1-ol (0.09g, 310.11 μmol, 76.92% yield, 99% purity) as a white solid.¹H NMR(400MHz，CD₃OD)δ＝8.33(s，1H)，8.26(s，1H)，6.06(dd，J＝10.9，17.5Hz，1H)，5.72-5.60(m，1H)，5.35-5.22(m，3H)，5.06(d，J＝2.2Hz，1H)，4.57(t，J＝6.2Hz，1H)，3.80(d，J＝2.0Hz，2H)，2.49-2.39(m，1H)，2.27(ddd，J＝6.5，8.4，13.3Hz，1H)。LCMS：ESI-MS：m/z＝287.9[M+H]⁺。

Example 21: synthesis of nucleoside 5' -triphosphates。

Anhydrous nucleoside (0.05mmol) was dissolved in anhydrous PO (OMe)₃(1 mL). N-methylimidazole (0.009mL, 0.11mmol) was added followed by POCl₃(0.009mL, 0.11 mmol). The reaction mixture was stirred at room temperature for 20-40 minutes. The reaction was monitored by LCMS (by appearance of the corresponding 5' -monophosphate nucleoside). After completion of the reaction, tetrabutylammonium pyrophosphate (150mg) was added followed by DMF (0.5mL) to give a homogeneous solution. The reaction mixture was stirred at room temperature for 1.5 hours, then diluted with water (10 mL). Purification (HiLoad 16/10 column with Q Sepharose high Performance: to The separation was carried out by a linear gradient of ON (buffer A) to 1N (buffer B) NaCl in 50mM TRIS buffer (pH 7.5). Elution of triphosphate with 75% -80% buffer B. The corresponding fractions were concentrated. Desalting was achieved by RP HPLC on a Synergy 4 micron Hydro-RP column (Phenominex). Elution was performed using a linear gradient of 0% to 30% acetonitrile in 10mM triethylammonium acetate buffer (pH 7.5). The corresponding fractions were combined, concentrated and lyophilized 3 times to remove excess buffer to provide the desired nucleoside 5' -triphosphate.

Example 22: ((1R, 3S, 5S) -3- (4-amino-7H-pyrrolo [2, 3-d)]Pyrimidin-7-yl) -5-hydroxy-2-ylidene Methylcyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2R, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d ] pyrimidin-7-yl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol as the nucleoside starting material.

EXAMPLE 23 ((1R, 3S, 5S) -3- (2-amino-4-oxo-3, 4-dihydro-7H-pyrrolo [2, 3-d)]Pyrimidine- 7-yl) -5-hydroxy-2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 12 using 2-amino-7- ((1S, 3R, 4S) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -3, 7-dihydro-4H-pyrrolo [2, 3-d ] pyrimidin-4-one (example 2) as the nucleoside starting material.

EXAMPLE 24 ((1S, 3S, 5S) -1-fluoro-5-hydroxy-3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine-1) (2H) -yl) -2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using 1- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (example 3) as the nucleoside starting material.

EXAMPLE 25 ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -1-fluoro-5-) Hydroxy-2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using 2-amino-9- ((1S, 3S, 4S) -3-fluoro-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-one (example 4) as the nucleoside starting material.

EXAMPLE 26 ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-fluoro-5-hydroxy-2-methylenecyclopentyl Yl) Methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 6) as the nucleoside starting material.

Example 27: ((1S, 3S, 5S) -3- (4-amino-7H-pyrrolo [2, 3-d) ]Pyrimidin-7-yl) -1-fluoro-5-hydroxy 2-methylenecyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2S, 4S) -4- (4-amino-7H-pyrrolo [2, 3-d ] pyrimidin-7-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 1) as the nucleoside starting material.

EXAMPLE 28 ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -1- (fluoromethyl) 5-hydroxy-2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using 2-amino-9- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -1, 9-dihydro-6H-purin-6-one (example 10) as the nucleoside starting material.

EXAMPLE 29 ((1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -1- (fluoromethyl) -5-hydroxy 2-methylenecyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using 4-amino-1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) pyrimidin-2 (1H) -one (example 11) as the nucleoside starting material.

EXAMPLE 30 ((1S, 3S, 5S) -1- (fluoromethyl) -5-hydroxy-3- (5-methyl-2, 4-dioxo-3, 4-dihydro Pyrimidin-1 (2H) -yl) -2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using 1- ((1S, 3S, 4S) -3- (fluoromethyl) -4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -5-methylpyrimidine-2, 4(1H, 3H) -dione (example 12) as the nucleoside starting material.

EXAMPLE 31 ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (chloromethyl) -5-hydroxy-2-methylene Cyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (chloromethyl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 14) as the nucleoside starting material.

EXAMPLE 32 ((1S, 3S, 5S) -1-cyano-5-hydroxy-3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine- 1(2H) -yl) -2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in analogy to example 21 using (1S, 3S, 5S) -5-hydroxy-1- (hydroxymethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (example 15) as the nucleoside starting material.

EXAMPLE 33 ((1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -1-cyano-5-hydroxy-2-) Methylene cyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (example 16) as the nucleoside starting material.

EXAMPLE 34 ((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-cyano-5-hydroxy-2-methylenecycloh Pentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (example 17) as the nucleoside starting material.

EXAMPLE 35 ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -1-cyano- 5-hydroxy-2-methylenecyclopentyl) methyltetrahydrotriphosphate。

The title compound was prepared in analogy to example 21 using (1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (example 18) as the nucleoside starting material.

EXAMPLE 36 ((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-ethynyl-5-hydroxy-2-methylene) Cyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 19) as the nucleoside starting material.

Example 37 (a)1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -5-hydroxy-2-methylene-1-vinyl Cyclopentyl) methyl tetrahydrotriphosphate。

The title compound was prepared in a similar manner to example 21 using (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2- (hydroxymethyl) -3-methylene-2-vinylcyclopentan-1-ol (example 20) as the nucleoside starting material.

TABLE 1

EXAMPLE 38((((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-ethynyl-5-hydroxy-2-methylene) Cyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

(E) -N' - (9- ((1S, 3R, 4S) -3-ethynyl-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) Yl) -9H-purin-6-Yl) -N, N-Dimethylmethacmidine. To a room temperature solution of (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 19, 11.6mg, 0.0419mmol) in MeOH (1.0mL) was added N, N-dimethylformamide dimethyl acetal (0.1mL, 89.4mg, 0.75 mmol). The reaction mixture was purged with Ar and stirred at room temperature for 16 hours. Evaporation of the solvent gave the title compound which was further dried under high vacuum overnight. Mixing the crude product (E) -N ' - (9- ((1S, 3R, 4S) -3-ethynyl-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) -N, N-dimethylformamidine was used in the next step without further purification.

Step B. ((((1R, 3S, 5S) -3- (6- (((E) - (dimethylamino) methylene) amino) -9H-purine-9- 1-ethynyl-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester. (E) -N' - (9- ((1S, 3R, 4S) -3-ethynyl-4-hydroxy-3- (hydroxymethyl) -2-methylenecyclopentyl) -9H-purin-6-yl) -N, N-dimethylformamidine was dissolved in anhydrous THF (1.0mL) and N-methylimidazole (NMI) (30mg, 29. mu.L, 0.36mmol) was added at room temperature. Isopropyl (2S) -2- ((chloro (phenoxy) phosphoryl) amino) propionate (45mg, 0.22mmol) was then added to the reaction mixture, and the reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated at 35 ℃ under reduced pressure and then dried under high vacuum. The title compound is obtained as a mixture of isomers at the phosphorus center (R)_pAnd S_p) Separation: the crude product, isopropyl (((((1R, 3S, 5S) -3- (6- (((E) - (dimethylamino) methylene) amino) -9H-purin-9-yl) -1-ethynyl-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alaninate was used in the next step without further purification.

Step C. ((((1R, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-ethynyl-5-hydroxy-2-methylene) Cyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester. A solution of (((((1R, 3S, 5S) -3- (6- (((E) - (dimethylamino) methylene) amino) -9H-purin-9-yl) -1-ethynyl-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester and 0.377M TFA in MeOH-H₂The solution in O (2.0mL) was stirred at room temperature for 16 h. The reaction mixture was concentrated under reduced pressure. Purification (FCC, SiO)₂MeOH/DCM, 0% to 20%) and preparative HPLC (CH)₃CN-H₂O, 5% to 95%, including 0.1% formic acid) to give the title compound as a mixture of isomers at the phosphorus center (R)_pAnd S_p) As a white fluffy solid (4.4 mg).³¹P NMR(400MHz，CDCl₃)：δ3.36，3.13。MS，m/Z 555.6(M+1)⁺。

EXAMPLE 39((((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-fluoro-5-hydroxy-2-methylenecycloh Pentyl) methoxy) (phenoxy) phosphoryl) -L-alanine neopentyl ester。

Step A: n, N-Di-BOC- (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) - 3-methylenecyclopent-1-ol. The title compound is prepared in analogy to (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 6).

And B: n, N-Di-BOC- ((((1S, 3S, 5S) -3- (6-oxy-9H-purin-9-yl) -1-fluoro-5-hydroxy-2- Methylene cyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine ester. To a solution of N, N-Di-BOC- (1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2-fluoro-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (1.0 eq) in anhydrous THF was added isoPrMgCl (isopropylmagnesium chloride) (1.0M in THF, 1.5 eq), followed by the appropriate phosphorochloridate (2.0 eq) dissolved in anhydrous THF (3 mL). The reaction mixture was stirred for 5 hours, quenched with water, and extracted with ethyl acetate. The organic layer was dried (Na)₂SO₄) Filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂2% to 15% MeOH/DCM) to give the title compound as a mixture of isomers at the phosphorus center (R)_pAnd S_p): n, N-Di-BOC- ((((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-fluoro-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine ester (13%). MS (M-1) 651.3.

Step C. ((((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1-fluoro-5-hydroxy-2-methylenecyclopent-yl) Yl) methoxy) (phenoxy) phosphoryl) -L-alanine neopentyl ester. N, N-Di-BOC- (((1S, 3S, 5) at room temperature S) -3- (6-amino-9H-purin-9-yl) -1-fluoro-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine ester was treated with a mixture of acetonitrile and HCl/dioxane 9: 1(v/v) for 9 hours. The reaction mixture was concentrated under reduced pressure. Purification (reverse phase HPLC, Phenomenex Synergi 4 μm Hydro-RP 80A 250X 21.2cm, gradient 25% to 95% acetonitrile in water, 10mM TEAA) gave the title compound as a mixture of isomers at the phosphorus center (R. sup. th. isomer)_pAnd S_p)。P³¹-NMR(CD₃OD)δδppm δ3.44，3.77。MS[M-1]578.2。

EXAMPLE 40((((1S, 3S, 5S) -3- (6-amino-9H-purin-9-yl) -1- (fluoromethyl) -5-hydroxy-2-ylidene) Methylcyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

(1S, 2S, 4S) -4- (6-amino-9H-purin-9-yl) -2- (chloromethyl) -2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 13, 11mg, 0.037mmol) was dissolved in a mixture of anhydrous acetonitrile (0.9mL) and N-methylimidazole (0.1 mL). Isopropyl (2S) -2- ((chloro (phenoxy) phosphoryl) amino) propionate (prepared according to j.med.chem.2014, 57, 1531-. The reaction mixture was heated to 60 ℃ for 4 hours and then continued at 40 ℃ for another 48 hours. The reaction mixture was diluted with ethyl acetate (30 mL). The organic phase was washed with 10% citric acid, brine and dried (Na) ₂SO₄) Filtered and concentrated under reduced pressure. Purification (FCC, SiO)₂2% to 10% MeOH in DCM) and then further purified (elution on a Synergy 4 micron Hydro-RP column (Phenominex) using a linear gradient of 30% to 100% acetonitrile in 10mM triethylammonium acetate buffer (ph7.5) to give the title compound as a mixture of isomers at the phosphorus center (R) as_pAnd S_p) The total yield was 10%. P³¹-NMR(CD₃OD)δδppm δ3.06，3.31。MS[M-1]564.6。

Example 41 ((((1S, 3S, 5S) -1-cyano-5-hydroxy-3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidine Pyridin-1 (2H) -yl) -2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

In a similar manner to example 38, step B, (1S, 3S, 5S) -5-hydroxy-1- (hydroxymethyl) -3- (5-methyl-2, 4-dioxo-3, 4-dihydropyrimidin-1 (2H) -yl) -2-methylenecyclopentane-1-carbonitrile (example 15) was used in step B to prepare a mixture (R) as the phosphorus-centered isomer_pAnd S_p) The title compound of (1).³¹P NMR(400MHz，CDCl₃)：δ3.20，3.01。MS，m/Z 547.1[M+1]⁺。

EXAMPLE 42 ((1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -1-cyano-5-hydroxy-) 2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

In a similar manner to example 38, (1S, 3S, 5S) -3- (4-amino-2-oxopyrimidin-1 (2H) -yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (example 16) was used in step A instead of (1S, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylenecyclopent-1-ol (example 19) to prepare a mixture (R, 2R, 4S) -4- (6-amino-9H-purin-9-yl) -2-ethynyl-2- (hydroxymethyl) -3-methylenecyclopent-1-ol as the phosphorus central isomer _pAnd S_p) The title compound of (1).³¹P NMR(400MHz，CDCl₃)：δ3.12，2.95。MS，m/Z 532.0(M+1)⁺。

EXAMPLE 43 ((R) - ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) - 1-cyano-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

To a suspension of (1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -5-hydroxy-1- (hydroxymethyl) -2-methylenecyclopentane-1-carbonitrile (example 18, 0.016g, 0.053mmol) in THF (1.0mL, 0.05M) cooled to 0 deg.C was added dropwise magnesium tert-butylchloride (1.0M THF, 0.12mL, 0.12 mmol). The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was then cooled to 0 ℃ and a solution of isopropyl (chloro (phenoxy) phosphoryl) -L-alaninate (30mg, 0.1mmol) in THF (0.13mL) was added dropwise. The reaction mixture was stirred at room temperature for 2 hours, then concentrated in vacuo to afford a white solid. Purification (reverse phase HPLC, Phenomenex Synergyi 4 micron Hydro-RP 80A 250X 21.2mm, 0% -99% in 25 min, H in acetonitrile and TEAA buffer₂O solution with TEAA buffer) gave two isomers (at the phosphorus center): ((R) ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -1-cyano-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-isopropyl propionate: ¹H NMR(400MHz，CDCl₃)：δ7.80(s，1H)，7.30-7.10(m，5H)，5.60(m，1H)，5.53(m，1H)，5.08(m，1H)，4.98(sept，J＝6.0，1H)，4.89(dd，J＝11，4.8，1H)，4.59(d，J＝3.6，1H)，4.42(dd，J＝10，3.6，1H)，3.99(dq，J＝8.8，7.6，1H)，2.84(dd，J＝13，3.6，1H)，2.31(dd，J＝13，8.0，1H)，1.39(m，3H)，1.23(m，6H)。³¹P NMR(400MHz，CDCl₃)：δ4.05。MS，m/Z 572.10[M+1]⁺(ii) a And (isopropyl ((S) - ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) -1-cyano-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alaninate (example 44).

EXAMPLE 44 ((S) - ((1S, 3S, 5S) -3- (2-amino-6-oxo-1, 6-dihydro-9H-purin-9-yl) - 1-cyano-5-hydroxy-2-methylenecyclopentyl) methoxy) (phenoxy) phosphoryl) -L-alanine isopropyl ester。

The title compound was isolated as the other isomer (pure but not stereochemically known) from example 43 (at the phosphorus center).¹H NMR(400MHz，CDCl₃)：δ7.80(s，1H)，7.42-7.22(m，5H)，5.61-5.54(m，2H)，5.15-5.11(m，2H)，5.02(sept，J＝6.0，1H)，4.39(d，J＝4.0，1H)，4.27(dd，J＝11，4，1H)，3.97(dq，J＝10，7.2，1H)，2.90(dd，J＝14，4.0，1H)，2.22(dd，J＝14，8.4，1H)，1.36(m，3H)，1.23(m，6H)。³¹P NMR(400MHz，CDCl₃)：δ3.72。MS，m/Z 572.10[M+1]⁺。

Biological assay

Example A. Single cycle HIV assay

CEM human T lymphocytes (ATCC, Manassas, Va.) were seeded 24 hours prior to infection in assay medium (MEM supplemented with 10% FBS, 1% penicillin/streptomycin (all from Mediatech, Manassas, Va.) and 1% DMSO (Sigma-Aldrich, St Louis, Mo)) at 5X 10⁵One cell/mL (5X 10)⁴Individual cells/well) were seeded in white 96-well plates. The compounds were added to the cells in stepwise dilutions and incubated at 37 ℃ with 5% CO₂The mixture was incubated overnight. The following day, cells were infected with VSV-G pseudotyped HIV NL4-3, where the env and nef portions are genes replaced with Renilla-luciferase, and infected cells were treated at 37 ℃ with 5% CO ₂The mixture was incubated for 72 hours. The virus inoculum was titrated to achieve approximately 100 times the background Renilla-luciferase signal. By adding 100ul of the composition to the infected cellsReagents (Promega, Madison, WI) were used to measure antiviral activity. After 10 min incubation at room temperature, luminescence was measured on a Victor X3 multi-label plate reader (Perkin Elmer, Waltham, MA). By adding 100. mu.LReagents (Promega, Madison, WI) and incubation for 10 minutes at room temperature were used to determine cytotoxicity of uninfected parallel cultures. Luminescence was measured on a Victor X3 multiple-label plate reader.

Example B inhibition of HIV reverse transcriptase

Recombinant full-length HIV-1 reverse transcriptase (HIVrt) was purchased from Abcam, cat No. ab 63979. The last 385 nucleotide region of the HCV antigenome complementary to the 5 'untranslated region (c 5' UTR) was synthesized using T7 RNA polymerase Megascript kit from Ambion (cat # AM 1333). DNA oligonucleotides were used as internal initiation primers and purchased from IDT. Unless otherwise indicated, reaction samples consisting of 20nM c 5' UTR RNA, 100nM DNA primer and 1nM HIVrt in the presence of 50mM Tris pH 7.5, 100mM KCl, 4mM Dithiothreitol (DTT) and 12.5mM MgCl₂Are mixed together in the buffer solution of (a). At 30 ℃ by adding a final volume of 50. mu.L of 0.1. mu.M adenosine triphosphate (dATP), 0.1. mu.M cytidine triphosphate (dCTP), 1. mu.M guanosine triphosphate (dGTP) and 0.32. mu.M triphosphate ³H-thymidine (³H-TTP) to initiate the reaction. After 40 minutes of incubation, the reaction was stopped by adding 60 μ L of frozen 20% (weight/volume) trichloroacetic acid and 500 μ MATP to precipitate the nucleic acid. After incubation for 1 hour at 4 ℃, the samples were filtered on multi-sieve BV 1.2- μm 96-well plates (Millipore). mu.L of Microscint-20(Perkin Elmer) was added to the wells and the counts in the samples were determined by a Trilux Microbeta microplate scintillation reader (Wallac).

All data were analyzed using GraphPad Prism. By fitting the data to the formula Y ═ Min + (% Max-% Min)/(1+ ×/IC)₅₀) To calculate the concentration (IC) of the compound that decreases the enzyme catalytic rate by 50%_5o) Where Y corresponds to the relative enzyme activity percentage,% Min is the residual relative activity at the saturation compound concentration,% Max is the relative maximum enzyme activity, and X corresponds to the compound concentration. Hypothesis competitive inhibition relative to native dNTP binding K was calculated using the Cheng-Prusoff equation_i：K_i＝IC₅₀/(1+[dNTP]/K_m) Wherein [ dNTP]Is the concentration of native dNTPs and K_mIs the apparent K of dNTP_m. Standard HIVrt RNA-dependent DNA polymerization (RdDp) assay for IC determination₅₀The value is obtained.

Example C.inhibition of HBV polymerase

Recombinant full-length HBV polymerase (HBVpol) was expressed in SF9 cells and purified based on Lanford et al (Nucleotide priming and reverse transcriptase activity of hepatitis B virus polymerase expressed in insect cells in expressed in cells in the absence of HBV (Lanford et al, J Virol.1995; 69 (7): 4431-4439). The last 385 nucleotide region of the HCV antigenome complementary to the 5 'untranslated region (c 5' UTR) was synthesized using T7 RNA polymerase Megascript kit from Ambion (cat # AM 1333). DNA oligonucleotides were used as internal initiation primers and purchased from IDT. Unless otherwise indicated, reaction samples consisting of 50nM c 5' UTR RNA, 500nM DNA primer and 1uL HIVrt in the presence of 50mM Tris pH7.5, 100mM KCl, 4mM Dithiothreitol (DTT), 10% DMSO and 12.5mM MgCl ₂Are mixed together in the buffer solution of (a). At 30 ℃ by adding a final volume of 50. mu.L of 46nM adenosine triphosphate (dATP), 17nM cytidine triphosphate (dCTP), 57nM guanosine triphosphate (dGTP) and 0.32. mu.M triphosphate³H-thymidine (³H-TTP) to initiate the reaction. After 120 minutes of incubation, the reaction was stopped by adding 60 μ L of frozen 20% (w/v) trichloroacetic acid with 500 μ M ATP to precipitate the nucleic acids. After incubation for 1 hour at 4 ℃, the samples were filtered on multi-sieve BV 1.2- μm 96-well plates (Millipore). mu.L of Microscint-20(Perkin Elmer) was added to the wells and the counts in the samples were determined by a Trilux Microbeta microplate scintillation reader (Wallac).

All data were analyzed using GraphPad Prism. By fitting the data to the formula Y ═ Min + (% Max-% Min)/(1+ ×/IC)₅₀) To calculate the concentration (IC) of the compound that decreases the enzyme catalytic rate by 50%_5o) Where Y corresponds to the relative enzyme activity percentage,% Min is the residual relative activity at the saturation compound concentration,% Max is the relative maximum enzyme activity, and X corresponds to the compound concentration. The Cheng-Prusoff method was hypothesized to be used for competitive inhibition of native dNTP bindingProgram calculation K_i：K_i＝IC₅₀/(1+[dNTP]/K_m) Wherein [ dNTP]Is the concentration of native dNTPs and K _mIs the apparent K of dNTP_m. Standard HBVpol RNA-dependent DNA polymerization (RdDp) assay for IC determination₅₀The value is obtained.

Example D.Hepg2.117 inhibition of HBV in cells

HepG2.117 cells (using less than 25 passages) were cultured in DMEM/F1250/50 medium (Corning, REF 10-092-CM) with 10% FBS (Corning REF 35-011-CV), 250ug/mL G418 sulfate (Corning, REF 30-234-CI), 2ug/mL tetracycline (TEKNOVA, Cat. T3325) and 1X penicillin/streptomycin (Corning, 30-002-CI) (Corning, 30-002-CI). For each assay, cells were inoculated into assay medium: DMEM/F1250/50 (Corning, REF 10-092-CM), 2% Tet-System approved FBS (Clontech, Cat. 631106) and 1 penicillin/streptomycin (Corning, 30-002-CI).

Determination of anti-HBV Activity

50% inhibitory concentration (EC) of compounds in HepG2.117 cells was performed by the following procedure₅₀) And (4) determining. On the first day, cells were washed twice with PBS after trypsinizing the cells. The cells were then washed once with assay medium. Cells were seeded in Biocoat patch-coated flat bottom 96-well plates at 30,000-35,000 cells/100 μ L/well. Test compounds were dissolved in 100% DMSO to reach the final test concentration required of 100 x. Each compound was then serially diluted (1: 3) to up to 9 different concentrations. Compounds dissolved in 100% DMSO were diluted to compounds dissolved in 10% DMSO by 1: 10 dilution in assay medium. At 37 deg.C, 5% CO ₂After incubation of the cells in the incubator for 4 hours, 10uL of test compound diluted in assay medium was added to the cell plate. The final DMSO concentration was 1%. Cells were incubated at 37 ℃ for 96 hours.

Antiviral activity was measured using a real-time quantitative polymerase chain reaction (RT qPCR) assay that directly measures the HBV viral DNA copy number from hepg2.117 cell supernatants. HBV core primers and probes used in qPCR: coreThe heart forward primer is 5'-CTGTGCCTTGGGTGGCTTT-3' (seq. id. No. 1); the core reverse primer is 5'-AAGGAAAGAAGTCAGAAGGCAAAA-3' (seq. id. No. 2); the core probe was 5 '/FAM/AGCTCCAAA/ZEN/TCCTTTATAAGGGTCGATGTCCATG/31 ABKFQ/-3' (SEQ. ID. NO. 3). The core forward and reverse probes were used at a final concentration of 1 μ M, and the core probe was used at a final concentration of 0.5 μ M. mu.L of 2 × Quanta Perfecta qPCR Toughmix ROX, 0.1. mu.L of 200X primer/probe mix, 4.0. mu.L of HepG2.117 cell supernatant (or control well standard) and 5.9. mu.L of dH were used₂O set up RT qPCR assay with total reagent volume of 20 μ L/well. Standards were prepared by diluting the HBV DNA plasmid Psi Check at a ratio of 1: 5 in 10mM TE buffer at 6 concentrations of 1E6, 0.2E6, 0.04E6, 0.008E6, 0.0016E6, 0.00032E6 viral DNA copy number. RT qPCR (Applied Biosystems and "Quant Studio 6 Flex" from Life Technology) was run as follows: for each cycle, 5 minutes at 95 ℃, then 15 minutes at 95 ℃ and 20 minutes at 60 ℃, for a total of 40 cycles.

HBV viral DNA copy number was normalized to the level observed in the absence of inhibitor, which was defined as 100%. EC (EC)₅₀Is defined as the concentration of compound at which the HBV viral DNA copy number from hepg2.117 cells is reduced by 50% relative to its level in the absence of compound.

Determination of cytotoxicity in HepG2 cells

Measurement of Cell Cytotoxicity (CC) against HepG2 cells using a luminescent cell viability assay₅₀) The number of viable cells in the culture was determined in a quantification based on the presence of Adenosine Triphosphate (ATP) after a 4 day incubation period. On the first day, HepG2 cells were seeded at 15,000/100 uL/well in assay media containing DEME (Corning, REF 10-013-CV), 3% FBS (Coning REF 35-011-CV), 1X penicillin/streptomycin (Coming, 30-002-CI) and 1X non-essential amino acids in Biocoat patch 96-well flat-bottom plates. Prior to compound administration, cells were incubated at 37 ℃ with 5% CO₂Incubate in the incubator for 4 hours. Compound dilution and dosing procedures were the same as outlined for determining anti-HBV activity. After the incubation had been carried out for 96 hours,cell viability was normalized to the level observed in the absence of inhibitor, which was defined as 100%. The lack of cytotoxic effect on HepG2 cells was defined as 50% Cytotoxic Concentration (CC) ₅₀)＞100μM。

TABLE 2

Example numbering	HIV EC50(uM)	HBV EC50(uM)
			1	NT	0.0109
2	＞33.3333	＞10
			3	＞33.3333	＞10
4	0.0356	＜0.0009
			5	＞33.3333	2.4722
6	2.6836	0.0617
			7	＞33.3333	＞10
8	NT	NT
			9	＞33.33	7.4104
10	0.6621	0.166
			11	0.9106	9.1782
12	＞33.33	＞10
			13	5.0227	＞5.5298
14	1.0784	3.4464
			15	＞33.3333	＞10
16	5.8324	＞10
			17	2.2094	＞10
18	0.1203	0.0466
			19	0.0665	＞10
20	0.5475	＞10

TABLE 3

TABLE 4

Moreover, while the foregoing has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be appreciated by those skilled in the art that various modifications may be made without departing from the spirit of the disclosure. Therefore, it should be clearly understood that the forms disclosed herein are illustrative only and are not intended to limit the scope of the present disclosure, but also to cover all modifications and alternatives falling within the true scope and spirit of the present invention.