Genome engineering of NADPH-increasing biosynthetic pathways

文档序号：1580711 发布日期：2020-01-31 浏览：30次中文

阅读说明：本技术 增加nadph的生物合成途径的基因组工程化 (Genome engineering of NADPH-increasing biosynthetic pathways ) 是由 S·曼彻斯特 B·梅森 A·戈拉诺夫于 2018-05-18 设计创作，主要内容包括：本公开涉及具有改变的NADPH可用性以增加使用NADPH产生的化合物的产生的宿主细胞以及其使用方法。通过以下中的一或多个来改变NADPH可用性：在所述宿主细胞中表达改变的GAPDH,表达变异谷氨酸脱氢酶gdh、天冬氨酸半醛脱氢酶asd、二氢吡啶甲酸还原酶dapB和内消旋-二氨基庚二酸脱氢酶ddh,表达新颖烟酰胺核苷酸转氢酶,表达新颖苏氨酸醛缩酶,以及表达丙酮酸羧化酶或调节丙酮酸羧化酶的所述表达。(The NADPH availability is altered by or more of expressing altered GAPDH in the host cell, expressing variant glutamate dehydrogenase gdh, aspartate semialdehyde dehydrogenase asd, dihydropicolinate reductase dapB, and meso-diaminopimelate dehydrogenase ddh, expressing a novel nicotinamide nucleotide transhydrogenase, expressing a novel threonine aldolase, and expressing pyruvate carboxylase or modulating the expression of pyruvate carboxylase.)

A method of for increasing the ability of a microbial cell to produce a compound that uses NADPH for production, the method comprising altering the available NADPH of the cell.

2. The method of claim 1, wherein the available NADPH is altered by expressing a modified glyceraldehyde-3-phosphate dehydrogenase, GAPDH, in the cell, wherein the modified GAPDH is modified such that its coenzyme is specifically broadened.

3. The method of claim 1, wherein the available NADPH of the cell is altered by expressing in the microbial cell a variant enzyme of or more of the enzymes glutamate dehydrogenase gdh, aspartate semialdehyde dehydrogenase asd, dihydropyridine formate reductase dapB, and meso-diaminopimelate dehydrogenase ddh, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH.

4. The method of claim 2, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to a corresponding naturally occurring GAPDH.

5. The method of any of claims 1-4, wherein the microbial cell is a bacterial cell.

6. The method of claim 5, wherein the bacterial cell is from a bacterium selected from the group consisting of Corynebacterium, Escherichia, Bacillus, or Geobacillus.

7. The method of claim 5, wherein the bacterium is Corynebacterium glutamicum or Escherichia coli.

8. The method of any of claims 1-4, wherein the microbial cell is a yeast cell.

9. The method of claim 8, wherein the yeast cell is a cell from Saccharomyces.

10. The method of claim 4, wherein the naturally occurring GAPDH is gapA.

11. The method of claim 10 wherein the gapA has the amino acid sequence of SEQ ID NO 58.

12. The method of claim 2, wherein the modified GAPDH comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO: 58.

13. The method of claim 2, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 294, 296, 233, 234, 235, 236, 298, and 300.

14. The method of claim 12 or 13, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 37 of SEQ ID NO: 58.

15. The method of claim 14, wherein the modified GAPDH comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

16. The method of claim 14, wherein the threonine at the position corresponding to amino acid 37 of SEQ ID NO 58 has been replaced with lysine.

17. The method of claim 15, wherein the leucine at a position corresponding to amino acid 36 of SEQ ID NO 58 has been replaced with threonine and the threonine at a position corresponding to amino acid 37 of SEQ ID NO 58 has been replaced with lysine.

18. The method of claim 2, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 192 of SEQ ID NO: 58.

19. The method of claim 2, wherein the proline at the position corresponding to amino acid 172 of SEQ ID NO 58 has been replaced with serine.

20. The method of claim 2, wherein the leucine at a position corresponding to amino acid 224 of SEQ ID NO 58 has been replaced with serine.

21. The method of claim 2, wherein the histidine at the position corresponding to amino acid 110 of SEQ ID NO 58 has been replaced with aspartic acid.

22. The method of claim 2, wherein the tyrosine at the position corresponding to amino acid 140 of SEQ ID NO 58 has been replaced with glycine.

23. The method of claim 13, wherein the modified GAPDH is selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

24. The method of any of claims, 1-4, wherein the compound is selected from Table 2.

25. The method of claim 24, wherein the compound is L-lysine or L-threonine.

26, microbial cells comprising a modified GAPDH having a broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the microbial cells increase production of a compound produced using NADPH relative to a corresponding microbial cell lacking the modified GAPDH.

27. The microbial cell of claim 26, wherein the modified GAPDH has increased specificity for NADP relative to the naturally occurring GAPDH.

28. The microbial cell of claim 27, wherein said modified GAPDH comprises an amino acid sequence at least 70% away from SEQ ID NO: 58.

29. The microbial cell of claim 27, wherein the modified GAPDH comprises an amino acid sequence at least 70% from an amino acid sequence selected from the group consisting of SEQ id nos 294, 296, 233, 234, 235, 236, 298, and 300.

30. The microbial cell of claim 27, wherein the modified GAPDH comprises an amino acid sequence at least 70% away from SEQ ID No. 58 and wherein the modified GAPDH comprises a substitution of an amino acid at position 36, 37 or both positions of SEQ ID No. 58.

31. The microbial cell of claim 27, wherein the modified GAPDH is selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

32. The microbial cell of claim 26, wherein said compound is selected from table 2.

33. The microbial cell of claim 32, wherein said compound is L-lysine or L-threonine.

34. The microbial cell of claim 26, wherein said microbial cell is from a bacterium.

35. The microbial cell of claim 34, wherein said bacterium is a corynebacterium, an escherichia, a bacillus, or a geobacillus.

36. The microbial cell of claim 35, wherein said bacterium is corynebacterium glutamicum or escherichia coli.

37. The microbial cell of claim 33, wherein said microbial cell is a yeast cell.

A method of broadening the coenzyme specificity of GAPDH comprising modifying said GAPDH such that the modified GAPDH has dual specificity for the coenzymes NADP and NAD.

39. The method of claim 38, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to NAD.

40. The method of claim 39, wherein the modified GAPDH uses NADP more efficiently than NAD.

41. The method of claim 3, wherein the method comprises a variant enzyme that expresses gdh, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO 42 or 44.

42. The method of claim 3, wherein the method comprises expressing a variant enzyme of asd, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO 30 or 40.

43. The method of claim 3, wherein the method comprises a variant enzyme that expresses dapB, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO 46 or 48.

44. The method of claim 3, wherein the method comprises expressing a variant enzyme of ddh, wherein the ddh enzyme comprises the amino acid sequence of SEQ ID NO 4.

45. The method of claim 3, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182.

46. The method of claim 3, wherein the method comprises a variant enzyme that expresses asd, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, and 130.

47. The method of claim 3, wherein variants of all four enzymes are expressed simultaneously in the microbial cell.

48. microbial cells comprising a variant of or more of the enzymes gdh, asd, dapB and ddh, wherein the variant exhibits bispecific for the coenzymes NADH and NADPH.

49. The method of claim 45, wherein the variant enzyme of gdh comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 144, 150, 162, 166, 170, 174, 178.

50. The method of claim 46, wherein the variant enzyme of asd comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 108 and 118.

51. The method of according to any of claims 1-4, further comprising expressing a threonine aldolase variant enzyme in the microbial cell, wherein the threonine aldolase variant enzyme exhibits a different substrate preference or enzymatic kinetics than the E.coli threonine aldolase ltaE.

52. The method of claim 51, wherein the iso-threonine aldolase promotes threonine production over glycine production.

53. The method of claim 51, wherein said variant threonine aldolase comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

54. The method according to claim 53, wherein the variant threonine aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 196, 206, 220, 224 and 232.

55. The method of claim 51, wherein said compound is L-threonine.

56. The method of claim 7, wherein the bacterium is E.coli and the method further comprises the step of expressing pyc in the E.coli cells.

57. The method of claim 56, wherein the method comprises expressing a variant enzyme of pyc, wherein the variant enzyme of pyc comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, and 289.

58. A microbial cell comprising a multicopy replicating plasmid comprising a thrA gene, thrB gene, and thrC gene each operably linked to or multiple synthetic promoters.

59. The microbial cell of claim 58, wherein the microbial cell is a tdh deletion atdh cell.

60. The microbial cell of claim 58, wherein the multicopy replicating plasmid comprises a sequence at least 70% identical to the thrABC operon sequence of SEQ ID NO: 77.

61. A method for increasing the efficiency of a microbial cell to produce a compound, comprising two or more of

(1) Engineering the glycolytic pathway to produce NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase gapA, making the enzyme bispecific for NADP and NAD; (2) expressing a transhydrogenase which produces NADPH from NADH in the bacterium; (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologues of endogenous gdh, asd, dapB and ddh enzymes that use NADH as a cofactor more efficiently than NADPH; (4) reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of the endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH; (5) reprogramming threonine synthesis by expressing a homolog of endogenous L-threonine aldolase ItA that reduces or reverses the degradation of threonine to glycine; and (6) expressing a heterologous pyruvate carboxylase, pyc, or a homologue thereof, to increase synthesis of oxaloacetate, or to increase expression of endogenous pyc.

62. The method of claim 61, wherein the compound is selected from Table 2.

63. The method of claim 62, wherein said compound is L-threonine.

64. The method of any of claims 61-63, wherein the engineering of the glycolytic pathway to produce NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase gapA such that the enzyme is bispecific for NADP and NAD comprises expressing a gapA variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: 294, 296, 233, 234, 235, 236, 298, and 300.

65. The method of any of claims 61-63, wherein the reprogramming of the DAP-pathway for lysine synthesis by expressing homologs of endogenous gdh, asd, dapB, and ddh enzymes that more efficiently use NADH as a cofactor compared to NADPH comprises or more of:

i) a variant enzyme that expresses gdh comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182;

ii) a variant enzyme expressing asd, said variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128 and 130;

iii) a variant enzyme expressing dapB, the variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 46 and 48; and

iv) expressing a variant enzyme of ddh comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.

66. The method of any of claims 61-63, wherein the reprogramming of the thrABC-pathway for threonine synthesis by expressing homologues of endogenous gdh and asd enzymes that more efficiently use NADH as a cofactor compared to NADPH comprises or more of:

67. The method of any of claims 61-63, wherein the reprogramming of threonine synthesis by expression of a homolog of endogenous L-threonine aldolase ItA that reduces or reverses degradation of threonine to glycine comprises a variant enzyme that expresses ltA comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

68. The method of any of claims 61-63, wherein the expressing a heterologous pyruvate carboxylase pyc or a homologue thereof to increase synthesis of oxaloacetate or to increase expression of endogenous pyc comprises expressing a variant enzyme of pyc comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230 and 232241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 263, 271, 267, 269, 261, 273, 275, 277, 279, 281, 283, 285, 287 and 289.

69. artificial polynucleotides encoding a truncated glyceraldehyde-3-phosphate dehydrogenase gapA gene, wherein said polynucleotides comprise a sequence at least 70% away from the polynucleotide sequence selected from the group consisting of SEQ ID NO:290, 291, 292 and 293.

70. The artificial polynucleotide of claim 69, wherein the polynucleotide comprises a polynucleotide sequence selected from the group consisting of SEQ ID NOs 290, 291, 292, and 293.

71. A vector comprising the artificial polynucleotide of claim 69 or 70 operably linked to a promoter.

72, A recombinant protein fragment of glyceraldehyde-3-phosphate dehydrogenase gapA, wherein said recombinant protein fragment comprises a sequence resulting in at least 70% of the amino acid sequence selected from the group consisting of SEQ ID NO 233, 234, 235, 236 and 298.

73. The recombinant protein fragment according to claim 72, wherein said recombinant protein fragment comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236, and 298.

74. The recombinant protein fragment of claim 72 or 73, wherein said recombinant protein fragment lacks gapA activity.

75. The recombinant protein fragment of claim 74, wherein said recombinant protein fragment enhances the productivity of a compound selected from Table 2 of a microbial cell when said microbial cell comprises another protein having gapA activity.

76. The microbial cell of any of claims 26-36, wherein the microbial cell further comprises step variant threonine aldolase, pyc protein, or both.

Technical Field

The present disclosure is generally directed to microbial engineering methods of increasing NADPH availability in microbial cells.

In particular, the disclosure relates to engineering host cells to increase NADPH availability by expressing or more of altered GAPDH, variant glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropicolinate reductase (dapB), meso-diaminopimelate dehydrogenase (ddh), threonine aldolase (ltaE), pyruvate carboxylase (pyc), and novel nicotinamide nucleotide transhydrogenase in the host cells.

Background

NADPH as an reducing equivalent is associated with many important biological processes for the synthesis of industrially important compounds such as sugars and amino acids like L-lysine and L-threonine, however, it is well known that the normal cellular supply of NADPH may be a limiting factor in the production of compounds produced using NADPH, for example, NADPH may be a limiting factor when producing L-lysine on an industrial scale in corynebacterium glutamicum (c. glutamcum) (Becker et al (2005), "environmental microbiology applications (appl. environ. microbiol.), (71 (12): 8587-.

Therefore, there is a great need in the art for new methods of engineering industrial microorganisms to overcome the limitation of NADPH availability in cells for producing compounds made using NADPH, for example, cells for producing L-lysine or L-threonine.

Disclosure of Invention

The present disclosure relates to at least six strategies to increase the production of L-lysine, L-threonine, L-isoleucine, L-methionine or L-glycine, overcoming limitations on NADPH availability in host cells: (1) engineering the glycolytic pathway to produce NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme Glyceraldehyde-3-phosphate dehydrogenase (gapA), making the enzyme bispecific for NADP and NAD; (2) expressing a transhydrogenase which produces NADPH from NADH in the host cell; (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologues of endogenous gdh, asd, dapB and ddh enzymes that use NADH as a cofactor more efficiently than NADPH; (4) reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of the endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH; (5) reprogramming threonine synthesis by expressing a homologue of an endogenous L-threonine aldolase (ltA) that reduces or reverses the degradation of threonine to glycine; and (6) expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or to increase expression of endogenous pyc.

In certain embodiments, there are provided methods of increasing the ability of a host cell to produce a compound produced using NADPH, the method comprising altering the available NADPH of the cell.

In certain embodiments, host cells are provided comprising a modified GAPDH having broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the host cells increase production of a compound produced using NADPH relative to a corresponding host cell lacking the modified GAPDH.

In certain embodiments, methods for producing L-lysine are provided, comprising culturing a Corynebacterium strain and recovering L-lysine from the cultured Corynebacterium strain or the culture broth, wherein the Corynebacterium strain expresses modified GAPDH using NADP as a coenzyme, and wherein the Corynebacterium strain has an increased L-lysine productivity.

In certain embodiments, methods of broadening the coenzyme specificity of GAPDH are provided, comprising modifying the GAPDH such that the modified GAPDH has dual specificity for the coenzymes NADP and NAD.

In certain embodiments, methods of increasing the efficiency of a host cell to produce a compound produced using NADPH are provided, comprising expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), a variant enzyme, wherein the variant enzyme exhibits bispecific for coenzyme NADH and NADPH.

In certain embodiments, host cells are provided comprising or variants of the enzymes gdh, asd, dapB, and ddh, wherein the variants exhibit bispecific for the coenzymes NADH and NADPH.

In certain embodiments, methods of increasing the efficiency of a host cell to produce a compound produced using NADPH are provided, comprising expressing a novel nicotinamide nucleotide transhydrogenase in said host cell.

In certain embodiments, methods of increasing the efficiency of L-lysine production by a host cell are provided, comprising two or more of:

modifying endogenous GAPDH such that the modified GAPDH has increased specificity for coenzyme NADP relative to a corresponding naturally occurring GAPDH;

expressing in the host cell a variant enzyme of or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB) and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH, and

expressing in said host cell a novel nicotinamide nucleotide transhydrogenase.

In certain embodiments, methods of increasing the efficiency of a host cell to produce a compound produced using NADPH are provided, comprising expressing in the host cell a variant enzyme of the enzymes glutamate dehydrogenase (gdh) and aspartate semialdehyde dehydrogenase (asd), or both, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH.

In certain embodiments, methods for increasing the efficiency of L-threonine production by a host cell are provided, comprising expressing a threonine aldolase variant enzyme in the host cell, wherein the variant enzyme exhibits a different substrate preference or enzymatic kinetics than Escherichia coli threonine aldolase (ltaE).

In certain embodiments, methods of increasing L-threonine production in a host cell are provided, comprising expressing in the host cell a variant enzyme of or more of the enzymes glyceraldehyde 3-phosphate dehydrogenase (gapA), glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), threonine aldolase (ltaE), and pyruvate carboxylase (pyc).

In certain embodiments, host cells are provided comprising a multicopy replicating plasmid comprising a thrA gene, thrB gene, and thrC gene each operably linked to or multiple synthetic promoters.

In certain embodiments, methods of increasing the efficiency of compound production by a host cell are provided, comprising two or more of (1) engineering a glycolytic pathway that produces NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA) to have the enzyme bispecific for NADP and NAD, (2) expressing in the host cell a transhydrogenase that produces NADPH from NADH, (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologs of endogenous gdh, asd, dapB, and ddh enzymes that use NADH as a cofactor more efficiently than NADPH, (4) reprogramming the thrA-pathway for threonine synthesis by expressing homologs of endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH, (5) reprogramming threonine synthesis by expressing homologs of endogenous L-aldolase (ltA) that reduce or reverse threonine to glycine, and (6) expressing heterologous pyruvate carboxylase (pyc) to increase the expression of endogenous oxaloacetate homologues or oxaloacetate synthesis.

In certain embodiments, artificial polynucleotides are provided that encode a truncated glyceraldehyde-3-phosphate dehydrogenase (gapA) gene, wherein said polynucleotides comprise a sequence that is at least 85%, 90%, 95%, or 99% identical to a polynucleotide sequence selected from the group consisting of SEQ ID NOs 290, 291, 292, and 293.

In certain embodiments, a recombinant protein fragment of glyceraldehyde-3-phosphate dehydrogenases (gapA) is provided, wherein said recombinant protein fragment comprises a sequence that is at least 70%, 80%, 90% or 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236 and 298.

In certain embodiments, methods are provided for increasing the efficiency of production of L-lysine or L-threonine by a host cell, comprising increasing the ability of the host cell to produce NADPH.in some aspects , the methods comprise modifying glyceraldehyde-3-phosphate dehydrogenase (GAPDH) such that its coenzyme specificity is broadened.in some cases, the modified GAPDH has increased specificity for coenzyme NADP relative to a corresponding naturally occurring GAPDH.in some aspects, the host cell is a prokaryotic cell.in some aspects, the host cell is a Corynebacterium glutamicum.in , the host cell is a Corynebacterium glutamicum.in , the host cell is E.coli.in , the naturally occurring GAPDH has the amino acid sequence of SEQ ID NO: 58.in , the modified GAPDH comprises an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 58.in some embodiments, the modified GAPDH at the amino acid position corresponding to 37 of SEQ ID NO:58 is substituted with the other amino acid sequence corresponding to SEQ ID NO: 58.in some embodiments, the modified GAPDH comprises a substitution of the amino acid at the amino acid corresponding position of SEQ ID NO: 37, the amino acid corresponding to SEQ ID NO:58, threonine amino acid corresponding to SEQ ID NO: 37, threonine.

In certain embodiments, methods of increasing the efficiency of a host cell to produce L-lysine are provided, comprising reducing the ability of the host cell to utilize NADPH, the methods comprising expressing in the host cell a or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropicolinate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variants exhibit dual specificity for both coenzyme NADH and NADPH, in certain aspects all four enzymes are expressed simultaneously in the host cell. in certain embodiments, methods of increasing the efficiency of a host cell to produce L-threonine are provided, comprising reducing the ability of the host cell to utilize NADPH, the methods comprising expressing in the host cell the enzyme glutamate dehydrogenase (gdh) and aspartate semialdehyde dehydrogenase (asd) a or two enzymes, wherein the variants exhibit specificity for NADH and NADPH, in embodiments, the variants are more effective than NADPH, and the variants comprising at least about 70% of the amino acid sequences of the variants, wherein the variants comprise at least 95% of the amino acid sequences of the variants, 95% of the amino acid sequences of the variants, the variants of the variants comprise at least 95% of the amino acid sequence of the amino acid variants of the other variants, 95% of the amino acid variants, 95% of the variants, 95% of the variants of the amino acid sequences of the variants, or the variants of the variants, wherein the variants of the variants comprise at least 95% of the variants of the amino acid sequence of the variants, 95% of the variants, 95% of the variants, 95% of the variants of the.

In other embodiments, methods for producing L-lysine or L-threonine are provided, comprising culturing a Corynebacterium or Escherichia coli strain and recovering L-lysine or L-threonine from the cultured Corynebacterium or Escherichia coli strain or culture broth, wherein the Corynebacterium or Escherichia coli strain expresses modified GAPDH using NADP as a coenzyme, and wherein L-lysine or L-threonine productivity of the Corynebacterium strain is increased.

In other embodiments, methods are provided for broadening the coenzyme specificity of GAPDH by modifying GAPDH, wherein the modified GAPDH has dual specificity for coenzymes NADP and NAD.

In embodiments, host cells are provided that comprise a modified GAPDH, wherein the modified GAPDH comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:58, and wherein a threonine at a position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with a lysine.

In other embodiments, host cells are provided comprising a modified GAPDH, wherein the modified GAPDH comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:58, and wherein a leucine at a position corresponding to amino acid 36 of SEQ ID NO:58 has been replaced with a threonine and a threonine at a position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with a lysine.

In a further step embodiment, there are provided host cells comprising or variants of the enzymes gdh, asd, dapB, and ddh, wherein the variants exhibit bispecific for the coenzymes NADH and NADPH.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that uses NADPH to produce, the method comprising altering the available NADPH of the cell.

In examples, the disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the available NADPH is altered by expressing a modified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the cell, wherein the modified GAPDH is modified such that its coenzyme is specifically broadened.

In embodiments, the disclosure teaches methods of increasing the ability of a host cell to produce a compound produced using NADPH, wherein the modified GAPDH has increased specificity for the coenzyme NADP relative to the corresponding naturally occurring GAPDH.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the host cell is a corynebacterium.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the host cell is corynebacterium glutamicum.

In examples, the disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the naturally occurring GAPDH is gapA.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound produced using NADPH, wherein gapA has the amino acid sequence of SEQ ID NO: 58.

In embodiments, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that uses NADPH to produce, wherein the modified GAPDH comprises an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 58.

In embodiments, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 37 of SEQ ID NO: 58.

In embodiments, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that is produced using NADPH, wherein the modified GAPDH comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound produced using NADPH, wherein the threonine at the position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with lysine.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound produced using NADPH, wherein the leucine at the position corresponding to amino acid 36 of SEQ ID NO:58 has been replaced with threonine and the threonine at the position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with lysine.

In , the present disclosure teaches methods of enhancing the ability of host cells to produce compounds produced using NADPH, wherein the compounds are selected from the group consisting of polyketides (e.g., picromycin (pikromomycin), erythromycin A (erythromycin A), clarithromycin (clarithromycin), azithromycin (azomycin), Avermectin (Avermectin), ivermectin (ivermectin), spinosad (spinosad), geldanamycin (geldanamycin), macbecin (macbecin), rifamycin (rifamycin), amphotericin (amphotericin), nycin (nystatin), nystatin (phytostatin), pimaricin (pimaricin), monellin (catechin), phytol (vitamin E), phytol (vitamin A), phytol (vitamin E), phytol (vitamin (E), phytol (vitamin (E), phytol (vitamin (E), vitamin (vitamin A), vitamin (vitamin), vitamin (vitamin), vitamin (vitamin), vitamin (E), vitamin (vitamin), vitamin (vitamin), vitamin (E), vitamin (vitamin), vitamin (E), vitamin (vitamin), vitamin (vitamin), vitamin (E), vitamin (vitamin), vitamin (E), vitamin (vitamin), vitamin (vitamin), vitamin (E), vitamin (E), vitamin (E), vitamin.

In examples, the present disclosure teaches methods of increasing the ability of a host cell to produce a compound that uses NADPH for production, wherein the compound is selected from table 2.

In embodiments, the disclosure teaches host cells comprising a modified GAPDH having broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the host cells increase production of a compound produced using NADPH relative to a corresponding host cell lacking the modified GAPDH.

In embodiments, the disclosure teaches host cells comprising a modified GAPDH having a broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the modified GAPDH comprises an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 58.

In embodiments, the disclosure teaches host cells comprising a modified GAPDH having a broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to SEQ ID NO:58 and wherein the modified GAPDH comprises a substitution of an amino acid at position 36, 37 or both positions of SEQ ID NO: 58.

In embodiments, the present disclosure teaches host cells containing modified GAPDH with broadened coenzyme specificity relative to naturally occurring GAPDH, wherein the compound is selected from the group consisting of polyketides (e.g., picromycin, erythromycin A, clarithromycin, azithromycin, avermectin, ivermycin, cinonide, geldanamycin, macbecin, rifamycin, amphotericin, nycin, nystatin, pimaricin, monensin, doxycycline, brapatatin, doracin, mevinocin, uvaricin, tacrolimus, sirolimus, radicicolin, lovastatin, diesel mormomol, xanthomycin, usnic acid and antrocin), catechins (e.g., epicatechin, epigallocatechin, epicatechin gallate, epigallocatechin gallate, epigallocatechin, methionine, quinuclidinol, and picrylenanthrine), farnesyl, picloratadine, farnesyl, and farnesyl, and farnesyl.

In embodiments, the disclosure teaches host cells comprising a modified GAPDH having broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the compound is selected from table 2.

In embodiments, the disclosure teaches host cells comprising a modified GAPDH having broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the modification comprises a substitution of a leucine for a threonine at a position corresponding to amino acid 36 of SEQ ID NO:58 and a substitution of a threonine for a lysine at a position corresponding to amino acid 37 of SEQ ID NO: 58.

In examples, the present disclosure teaches methods of producing L-lysine comprising culturing a corynebacterium strain and recovering L-lysine from the cultured corynebacterium strain or the culture broth, wherein the corynebacterium strain expresses modified GAPDH using NADP as a coenzyme, and wherein the corynebacterium strain has an increased L-lysine productivity.

In embodiments, the disclosure teaches methods of broadening the coenzyme specificity of GAPDH comprising modifying the GAPDH such that the modified GAPDH has dual specificity for the coenzymes NADP and NAD.

In embodiments, the disclosure teaches methods of broadening the coenzyme specificity of GAPDH comprising modifying the GAPDH such that the modified GAPDH has bispecific specificity for coenzymes NADP and NAD, wherein the specificity of the modified GAPDH for coenzyme NADP is increased relative to NAD.

In embodiments, the disclosure teaches methods of broadening the coenzyme specificity of GAPDH comprising modifying the GAPDH such that the modified GAPDH has bispecific for the coenzymes NADP and NAD, wherein the modified GAPDH uses NADP more efficiently than NAD.

In examples, the present disclosure teaches methods of increasing the efficiency of host cells to produce compounds produced using NADPH, comprising a mutase of or more enzymes of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB) and meso-diaminopimelate dehydrogenase (ddh) in said host cells, wherein said mutase exhibits dual specificity for NADH and NADPH, wherein said compounds are selected from the group consisting of polyketides (e.g., picromycin, erythromycin A, clarithromycin, azithromycin, avermectin, ivermectin, ciomycin, cinonide, geldanamycin, meclocycline, pimaricin, monensin, doxycycline, brazinine, doracin, doramelocycline, domycin, amphotericin, nycin, pravastatin, pimaricin, monellin, farnesene, tacrolimus, sirolimus, cerolimus, pravastatin, methionine, lyxin, xanthinotoxin, xanthinosine, patchouli, dorcin, dormitoxan, myricetin, picrin, picroline, docinoleine, docinolein, docinoleine, docinolein, docinoleine, docinolein, docinoleine, docinolein, docinoleine, docinolein, doc.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH comprising expressing in the host cell a variant enzyme of or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH, wherein the compound is selected from table 2.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH comprising expressing in the host cell a variant enzyme of or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzyme exhibits bispecific for both the coenzymes NADH and NADPH, wherein the method comprises expressing the variant enzyme of dapB, wherein the variant enzyme comprises an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 46.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH, comprising expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), a variant enzyme, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH, wherein the variant enzyme of gdh comprises the amino acid sequence of SEQ ID NO: 44.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH comprising expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh) a variant enzyme, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH, wherein the variant enzyme of asd comprises the amino acid sequence of SEQ ID NO: 30.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH comprising expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh) a variant enzyme, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH, wherein the variant enzyme of dapB comprises the amino acid sequence of SEQ ID NO: 48.

In embodiments, the disclosure teaches methods of increasing the efficiency of a host cell to produce a compound produced using NADPH comprising expressing in the host cell or a variant of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzymes exhibit bispecific for the coenzymes NADH and NADPH, wherein variants of all four enzymes are expressed simultaneously in the host cell.

In embodiments, the disclosure teaches host cells comprising or variants of the enzymes gdh, asd, dapB, and ddh, wherein the variants exhibit bispecific for the coenzymes NADH and NADPH.

In examples, the present disclosure teaches methods of increasing the efficiency of L-lysine production by a host cell comprising expressing in the host cell a novel nicotinamide nucleotide transhydrogenase.

In examples, the disclosure teaches methods of increasing the efficiency of L-lysine production by a host cell comprising two or more of (1) modifying endogenous GAPDH such that the modified GAPDH has increased specificity for coenzyme NADP relative to the corresponding naturally occurring GAPDH, (2) expressing in the host cell a variant enzyme of or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzyme exhibits bispecific specificity for coenzymes NADH and NADPH, and (3) expressing in the host cell a novel nicotinamide nucleotide transhydrogenase.

In examples, the disclosure teaches methods of increasing L-lysine, L-threonine, L-isoleucine, L-methionine, or L-glycine production by (1) engineering the glycolytic pathway that produces NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA) to have bispecific for NADP and NAD, (2) expressing a transhydrogenase that produces NADPH from NADH in a host cell, (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologs of endogenous gdh, asd, dapB, and ddh enzymes that use NADH as a cofactor more efficiently than NADPH, (4) reprogramming the ThrA-pathway for threonine synthesis by expressing homologs of endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH, (5) reprogramming the ThrA-pathway for threonine synthesis by expressing homologs of endogenous L-threonine aldolase (lTA) that reduce or reverse threonine degradation to glycine, and increasing the carboxylase (6) expressing homologs of exogenous threonine synthase (pyc) or pyruvate synthesis by increasing the homologs thereof.

Drawings

FIG. 1 shows a bacterial lysine biosynthesis pathway and outlines strategies used in this application to increase L-lysine production in bacteria the efficiency of L-lysine production by a host cell can be increased by or more of (1) modifying endogenous GAPDH such that the modified GAPDH has increased specificity for coenzyme NADP relative to the corresponding naturally occurring GAPDH, thereby generating NADPH, (2) expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzymes exhibit dual specificity for both coenzyme NADH and NADPH, thereby reducing NADPH utilization, and (3) expressing in the host cell a novel nicotinamide nucleotide transhydrogenase, thereby generating NADPH from NADH.

FIG. 2 shows L-lysine productivity in C.glutamicum strains expressing modified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as described in example 1. several C.glutamicum strains were produced, each expressing a gapA enzyme with or more of the following mutations D35G, L36T, T37K and P192S. subsequently the strains were tested for their ability to produce L-lysine compared to the parent strain with native gapA. the introduction of GAPDH with certain mutations conferring altered coenzyme specificity for NADP significantly increased the productivity of L-lysine. T37K and T37K alone significantly increased productivity in 2 backgrounds compared to L36T. strains 7000182994 and 7000184348 each contained T37K and performed better than their respective parent _1 and parent _ 2. strains 7000182999 and 7000184352 each contained T37K and L36T and performed better than their respective parent _1 and parent _ 2.

FIG. 3 shows a strategy for reprogramming the DAP-pathway for lysine synthesis in C.glutamicum by expressing variant gdh, asd, dapB and ddh enzymes that use NADH more efficiently than NADPH. Corynebacterium glutamicum enzyme gdh and dapB have known homologues in Clostridium symbiosum (Clostridium symbolosum) and Escherichia coli (Escherichia coli), respectively, which use NADH more efficiently than NADPH. A genome-wide homology search was performed in the host cells to find variants of C.glutamicum adh and ddh. For each enzyme, a homology search resulted in 9 variants. The known homologues of C.glutamicum gdh and dapB and the 9 variants of C.glutamicum asd and ddh were codon-optimized and cloned into plasmids for expression in C.glutamicum.

FIG. 4 shows a strategy for expressing various combinations of the variants gdh, asd, dapB and ddh enzymes in C.glutamicum copies of each of the different versions of the gdh, asd, dapB and ddh enzymes were cloned in various combinations into plasmids containing the kanamycin-resistant marker gene.

FIGS. 5A-B show the effect of expression of various combinations of different versions of gdh, asd, dapB and ddh enzymes in C.glutamicum. FIG. 5A shows data for two recombinant strains of C.glutamicum 7000186960 and 7000186992, each containing ddh of the protozoase and the same 3 heterologous enzymes gdh, asd and dapB (known versions of gdh and dapB using NADH and variants of asd from Lactobacillus agilis (Lactobacillus agilis)), showing a significant increase in L-lysine productivity compared to the corresponding parental lines 3 and 4. 7000186960 and 7000186992 each contain the same 3 heterologous enzymes gdh, asd and dapB as well as the primase enzyme ddh. Figure 5B shows that heterologous enzymes for gdh and dapB also slightly increased yield in 2 of 3 test backgrounds.

FIG. 6 depicts the assembly of the transformation plasmids of the present disclosure and their integration into a host organism the inserted DNA is generated by combining or more synthetic oligonucleotides in an assembly reaction the DNA insert sequence containing the desired sequence flanks a DNA region homologous to the target region of the genome these homologous regions facilitate genomic integration and upon integration forms a direct repeat region designed for the purpose of circularizing the vector backbone DNA in a subsequent step the assembled plasmids contain the inserted DNA and optionally or more selectable markers.

Figure 7 depicts the procedure for the looping-out of selected regions of DNA from the host strain. The inserted DNA and directly repeated regions of the host genome may "loop out" during the recombination event. The selection marker counter-selected cells contain a deletion of the loop DNA flanked by the direct repeat regions.

FIGS. 8A-B show plasmid design for step for the construction of the E.coli W3110 threonine base strain in E.coli K-12, W3110 using thrLABC regulators (FIG. 8A) or thrABC operon (FIG. 8B).

FIG. 9 shows the bacterial biosynthetic pathways for lysine and threonine and outlines the strategies used in this application to improve the yield and productivity of L-lysine or L-threonine in bacteria. (1) By broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA), which has dual specificity for NADP and NAD, the glycolytic pathway to produce NADPH is engineered, thereby producing NADPH. (2) A transhydrogenase which produces NADPH from NADH is expressed in the host cell, thereby producing NADPH. (3) The DAP-pathway for lysine synthesis is reprogrammed by expressing homologues of endogenous gdh, asd, dapB and ddh enzymes that use NADH as a cofactor more efficiently than NADPH, thereby reducing NADPH utilization. (4) The thrABC-pathway for threonine synthesis is reprogrammed by expressing homologues of the endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH, thereby reducing NADPH utilization. (5) Threonine synthesis is reprogrammed by expressing homologues of the endogenous L-threonine aldolase (ltA) that reduce or reverse threonine degradation to glycine, thereby increasing threonine production per unit of NADPH consumed. (6) Expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or to increase expression of endogenous pyc.

FIGS. 10A-C depict metabolic pathway maps for threonine biosynthesis, which shows expression of a heterologous threonine aldolase library (TA)_lib) Possible scenarios for implementation. FIG. 10A depicts a metabolic pathway profile for threonine biosynthesis, which demonstrates the reaction favored by native E.coli ltaE (conversion of threonine to acetaldehyde and glycine). Figure 10B depicts a partial pathway showing an improved situation in which the transition between threonine and acetaldehyde and glycine is more balanced under expression of a heterologous TA enzyme. Figure 10C depicts a partial pathway demonstrating a preferred situation where acetaldehyde and glycine are converted to threonine in a preferred orientation under expression of a heterologous TA enzyme.

FIGS. 11A-C show the titer (mg/L) of L-threonine produced by E.coli thrABC background strain (W3110pMB085 thrABC. DELTA. tdh; thrABC) when expressing individual genes or combinations of native gapA, gsd, asd, ltaE or variants also tested in Corynebacterium. The titers of wild-type E.coli K12W 3110, W3110 deleted for tdh (tdh _ del) and W3110pMB085 thrLABC. DELTA. tdh (thrLABC) strains are also shown for comparison. FIG. 11A shows the results for gapA. The three gapA variants tested (gapAv5, gapAv7 and gapAv8) all produced significantly higher L-threonine titers relative to controls, including strains expressing additional copies of e. FIG. 11B shows the results of asd. The lactobacillus agilis asd produced significantly higher titers than the same base strain expressing the second copy of the escherichia coli asd. Fig. 11C shows the results for gdh. In this case, clostridium gdh (Csy gdh) was not significantly different from the same base strain expressing the second copy of e.coli gdh, but both strains performed better than the parental strain (thrABC).

FIG. 12 shows the design of the regulatory elements (pMB038 promoter (SEQ ID NO:237) and thrL terminator (SEQ ID NO:238) and backbone (p15A) (SEQ ID NO:239) used to construct plasmids for expression of asd, gdh and ltaE library variants.

FIG. 13 shows the increased L-threonine titer (mg/L) compared to wild-type E.coli K12W 3110 and the circularized p15A plasmid (SEQ ID NO:239) without library variants cloned between pMB038 promoter (SEQ ID NO:237) and terminator (SEQ ID NO: 238); control plasmid) transformed with the parent control strain, threonine base strain THR02(W3110pMB085thrABC Δ tdh), the p15A blank vector. Strains expressing asd-13 (SEQ ID NO:108) and asd-18 (SEQ ID NO:118) had increased titer, but did not differ significantly from the control strain. Seven gdh variants, as determined by student T comparison: gdh _1(SEQ ID NO:136), gdh _8(SEQ ID NO:150), gdh _14(SEQ ID NO:162), gdh _16(SEQ ID NO:166), gdh _18(SEQ ID NO:170), gdh _20(SEQ ID NO:174), and gdh _22(SEQ ID NO:178) all produced significantly higher L-threonine titers. The grey circles and markers indicate that the performance is significantly better than the samples of the control strain.

FIG. 14 shows the increased L-threonine titres (mg/L) produced by strains expressing threonine aldolase (ltaE) library variants compared to wild-type E.coli K12W 3110 and the circularized p15A plasmid (SEQ ID NO:239) transformed with p15A blank vector (parental control strain-threonine base strain THR02(W3110pMB085 thrABC. DELTA. tdh) without library variants cloned between pMB038 promoter (SEQ ID NO:237) and terminator (SEQ ID NO: 238); control plasmid). LTaE-6 (SEQ ID NO:196), LTaE-11 (SEQ ID NO:206), LTaE-18 (SEQ ID NO:220), LTaE-20 (SEQ ID NO:224), and LTa-24 (SEQ ID NO:232) all produced significantly higher L-threonine titers as determined by student T-comparison. The grey circles and markers indicate that the performance is significantly better than the samples of the control strain.

FIG. 15 shows the increased threonine titers produced by strains expressing combinations of Csy _ gdh, gapAv5, or gapAv7 and single asd, gdh, or ltaE library variants, each of which increased in potency when expressed individually, all strains shown were in the pMB085-thrABC tdh deletion background except W3110 for these experiments, the majority of relevant controls were parental strains (Csy _ gdh + p15A (-), gapAv5+ p15A (-) and gapAv7+ p15A (-), respectively (Csy _ gdh, gapAv5, and gapAv7), transformed with blank p15A control plasmids (7000349886, 7000349887, and 7000349885).

FIG. 16 depicts library performance in two plate models for lysine production by C.glutamicum expressing an exogenous gapA allele from an NNK library. The average performance in each model is plotted. Most integrants (grey circles) performed equal to or worse than the parents (black diamonds). Certain gapA alleles produced high titers of lysine in both plate models (black circles).

Detailed Description

Definition of

While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to facilitate explanation of the disclosed subject matter.

Thus, the terms "", " or more" and "at least " are used interchangeably herein, further, reference to " elements" by the indefinite article "" does not exclude the possibility that more than elements are present, unless the context clearly requires the presence of and only elements.

Throughout this specification and the claims, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising", will be interpreted in an open, inclusive sense, i.e., "including (but not limited to)".

Reference throughout this specification to " embodiments" or " embodiments" means that a particular feature, structure, or characteristic described in connection with the embodiments may be included in at least embodiments of the present disclosure.

As used herein, the terms "cellular organism", "microbial organism" or "microorganism" are to be understood in a broad sense, these terms are used interchangeably and include (but may not be limited to) two prokaryotic domains, bacteria and archaea, as well as certain eukaryotic fungi and protists in embodiments, the disclosure refers to "microorganisms" or "cellular organisms" or "microorganisms" of the lists/tables and diagrams present in the disclosure.

The term "prokaryote" is art-recognized and refers to cells that do not contain nuclei or other organelles prokaryotes are generally classified into two domains : bacteria and archaea the definitive differences between archaebacteria and bacterial domain organisms are based on the basic differences in nucleotide base sequences in 16S ribosomal RNA.

The term "archaebacteria" refers to the class of organisms of the muramidase (mendosticus), which are typically found in abnormal environments and are distinguished from the rest of prokaryotes according to several criteria including the number of ribosomal proteins and the lack of muramic acid in the cell wall, based on ssrna analysis, archaebacteria consist of two distinct phylogenetic groups, the kingdom archaebacteria (Crenarchaeota) and archaebacteria (Euryarchaeota), which can be organized into three types based on their physiology, methanogens (methane-producing prokaryotes), extreme halophiles (extreme halophiles) (living organisms in the presence of very high concentrations of salt (NaCl)), and hyperthermophiles (hyperthermophiles) mophiles (living prokaryotes) at extreme temperatures, which are collectively distinct from bacteria (archaebacteria) do not have the properties of the wall, i.e. the archaebacteria prokaryotic lipotropic structures and which are made up by prokaryotic organisms that are predominantly adapted to the phylogenetic environment.

The bacteria include at least 11 different groups of (1) gram-positive (gram +) bacteria present in two subgroups , (1) high G + C groups (Actinomycetes (Actinomycetes), Mycobacterium (Mycobacterium), Micrococcus (Micrococcus), etc.), (2) low G + C groups (Bacillus), Clostridium (Clostridium), Lactobacillus (Lactobacilli), Staphylococcus (Staphylococcus), Streptococcus (Streptococcus), Mycoplasma (Mycoplasma)), (2) Proteobacteria (Proteobacteria), such as Porphyromobacter + Nonopynthesis negative bacteria (including the most "common" gram-negative bacteria), Cyanobacteria (3) Cyanobacteria (Cyanobacter), such as aeromonas (Spirochacterium) and related species; (5) Thermobacter (Thermococcus), Thermococcus (Thermobacter) and Thermobacter (Thermoascus), and (Thermoanaerobacter), and Thermobacter (Thermoascus) (9) are also included in the genera; Thermoanaerobacter (Thermobacter) and Thermoascus (Thermoascus) (8).

A "eukaryote" is any organism whose cells contain a nucleus and other organelles enclosed within membranes. Eukaryotes belong to the eukaryotes or to the eukaryote taxa. A decisive feature that distinguishes eukaryotic cells from prokaryotic cells (the aforementioned bacteria and archaea) is their membrane-bound organelles, in particular the nuclei which contain genetic material and are closed by nuclear envelopes.

The terms "genetically modified host cell", "genetically modified microorganism", "recombinant host cell" and "recombinant strain" are used interchangeably herein and may refer to a microorganism that has been genetically modified. Thus, the term includes microorganisms (e.g., bacteria, yeast cells, fungal cells, etc.) that have been genetically altered, modified, or engineered so that they exhibit an altered, modified, or different genotype and/or phenotype (e.g., when the genetic modification affects the coding nucleic acid sequence of the microorganism) as compared to the naturally occurring microorganism from which it is derived. It is to be understood that the term refers not only to the specific recombinant microorganism in question, but also to the progeny or possible progeny of such a microorganism.

The term "wild-type microorganism" may describe a naturally occurring cell, i.e. a cell which has not been genetically modified.

The term "genetically engineered" may refer to any manipulation of the genome of a microorganism (e.g., by nucleic acid insertion or deletion).

The term "control" or "control host cell" refers to an appropriate comparison host cell for determining the effect of genetic modification or experimental treatment in examples, the control host cell is a wild-type cell in other examples, the control host cell is genetically identical to the host cell genetically modified except for genetic modification, and thus distinct from the treatment host cell in examples, the disclosure teaches the parental strain as a control host cell (e.g., S used as the basis for a strain improvement program)₁Strain) is used.

As used herein, the term "allele" means or any of a plurality of alternative forms of a gene, all involving at least traits or characteristics.

As used herein, the term "locus" (loci) refers to a plurality of loci (loci) that are found at a particular location or site on a chromosome, for example, a gene or genetic marker.

As used herein, the term "genetically linked" refers to two or more traits that are inherited together in high ratios during breeding, making them difficult to separate by crossing.

As used herein, "recombination" or "recombination event" refers to chromosome swapping or independent classification. The term "recombinant" refers to an organism having a novel genetic composition that is produced as a result of a recombination event.

As used herein, the term "phenotype" refers to an observable characteristic of an individual cell, cell culture, organism, or group of organisms resulting from the interaction between the genetic makeup (i.e., genotype) of an individual and the environment.

As used herein, the term "chimeric" or "recombinant" when describing a nucleic acid sequence or protein sequence refers to a nucleic acid or protein sequence that results in the ligation of at least two heterologous polynucleotides or two heterologous polypeptides into a single macromolecule or the rearrangement of or multiple elements of at least native nucleic acid or protein sequences.

Generally, such synthetic nucleotide sequences will comprise at least nucleotide differences when compared to any other naturally occurring nucleotide sequence.

As used herein, the term "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length, or analogs thereof, the term refers to the main structure of a molecule and thus includes double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA, which also includes modified nucleic acids, such as methylated and/or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like.

As used herein, the term "gene" refers to any segment of DNA associated with a biological function. Thus, a gene includes, but is not limited to, coding sequences and/or the regulatory sequences required for expression thereof. Genes may also include, for example, unexpressed DNA segments that form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesis using known or predicted sequence information, and can include sequences designed to have desired parameters.

As used herein, the terms "homology", "substantially similar" and "substantially corresponding" are used interchangeably herein and may refer to nucleic acid fragments that have a change in or more nucleotide bases that does not affect the ability of the nucleic acid fragment to mediate Gene expression or produce a phenotype, these terms may also refer to modifications of the nucleic acid fragments of the present disclosure, such as the deletion or insertion of or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the original unmodified fragment, thus, it is understood that the present disclosure may encompass more than a particular sequence as will be appreciated by those skilled in the art, these terms may describe the relationship between the genes found in species, subspecies, cultivars or cultivars and the corresponding or related genes in another 2 species, subspecies, cultivars or cultivars, such as the Scientific or cultivars of the equivalent or homologous family as found in the experimental procedures known to be found in the art (e.g. homology, and other related sequences identified by the methods as known in the use of the methods of the contemporary Scientific, e.g. the methods of identifying the relevant proteins found in the present invention, e.7, e.g. the methods including the methods of homology, e.g. milfoil, e, e.g. the relevant to obtain homology, e.g. the relevant sequences identified by the methods of the relevant proteins (e.g. milbrussenberg, e, e.g. albugmenters, e, e.g. the methods of the relevant proteins (e.g. albugmenters, e, e.g. the methods of the present invention, e.g. the relevant proteins, e, e.g. the methods of the relevant proteins, e.

As used herein, the term "variant enzyme" or "variant" refers to enzymes that have a different amino acid sequence compared to the parent enzyme in the organism in which the variant is expressed, but that catalyze the same or similar ability to catalyze a reaction as the parent enzyme.

As used herein, the term "endogenous" or "endogenous gene" refers to a gene that occurs naturally in the genome of a host cell at the location where the gene is found naturally. In the context of the present disclosure, operably linked to an endogenous gene means that the heterologous promoter sequence is inserted genetically into the existing gene, at a location where the gene naturally occurs. An endogenous gene as described herein can include an allele of a naturally occurring gene that has been mutated according to any method of the present disclosure.

As used herein, the term "exogenous" is used interchangeably with the term "heterologous" and refers to material from sources that is different from the natural source.

As used herein, the term "nucleotide change" may refer to, for example, a nucleotide substitution, deletion, and/or insertion, as is well understood in the art. For example, mutations contain changes that can produce silent substitutions, additions or deletions, but do not alter the properties or activity of the encoded protein or the manner in which the protein is made.

As used herein, the term "protein modification" may refer to, for example, amino acid substitutions, amino acid modifications, deletions, and/or insertions, as are well understood in the art.

Similarly, the portion of a polypeptide can be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, etc., up to a full-length polypeptide.

Variant polynucleotides also encompass sequences that may be derived from mutagenesis and recombinogenic procedures, such as DNA shuffling. Strategies for such DNA shuffling are known in the art. See, e.g., Schlemmer (Stemmer) (1994), journal of the national academy of sciences (PNAS) 91: 10747-10751; st mercer (1994) Nature 370: 389-391; chemerin (Crameri) et al (1997) Nature Biotech (Nature Biotech.) 15: 436-; moore et al (1997) journal of molecular biology (J.mol.biol.) 272: 336-347; zhang (Zhang) et al (1997) Proc. Natl. Acad. Sci. USA 94: 4504-; kaimeriy et al (1998) Nature 391: 288-291; and U.S. Pat. nos. 5,605,793 and 5,837,458.

For PCR amplification of the polynucleotides disclosed herein, oligonucleotide primers used in PCR reactions can be designed to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in sabeluk (Sambrook) et al (2001), "molecular cloning: experimental guidelines (Molecular Cloning: A Laboratory Manual) (3 rd edition, Cold Spring Harbor Laboratory Press, Plainview, N.Y.). See also Innis (Innis) et al (1990) PCR protocols: instructions for Methods and Applications (PCR Protocols: AGuides to Methods and Applications) (Academic Press, New York (New York)); ennes and Gilford (Gelfand) 1995 PCR Strategies (PCR Strategies) (academic Press, New York); and Insense and Gilfen (1999) handbook of PCR Methods Manual (academic Press, New York). Known PCR methods can include, but are not limited to, methods using pair primers, nested primers, single specific primers, degenerate primers, gene specific primers, vector specific primers, partially mismatched primers, and the like.

As used herein, the term "primer" can refer to an oligonucleotide that is capable of binding to an amplification target when placed under conditions that induce synthesis of a primer extension product, i.e., in the presence of nucleotides and a polymerizing agent (e.g., DNA polymerase) and at a suitable temperature and pH, thereby allowing the DNA polymerase to adhere, thereby serving as a point of initiation of DNA synthesis, (amplification) primer is preferably single-stranded for maximum amplification efficiency.

As used herein, a "promoter" or "promoter polynucleotide" can refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.A promoter sequence is composed of contiguous and more distal upstream elements, the latter of which can be generally referred to as an enhancer.thus, an enhancer may be a DNA sequence that stimulates promoter activity and may be an inherent element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter.

As used herein, the phrases "recombinant construct", "expression construct", "chimeric construct", "construct" and "recombinant DNA construct" are used interchangeably herein recombinant constructs comprise an artificial combination of nucleic acid fragments, such as regulatory and coding sequences not found in nature . for example, chimeric constructs may comprise regulatory sequences and coding sequences derived from different sources, or recombinant constructs derived from sources such as but arranged in a manner different from that found in nature. in the case of , chimeric constructs comprising multiple coding sequences may be either a promoter and a coding sequence (such as gapA/transhydrogenase/gdh, asd, dapB and/or ddh genes). in the case of , each coding sequence in chimeric constructs comprising multiple coding sequences may be under the control of an independent regulatory sequence or functionally linked to an independent regulatory sequence. such constructs described herein may be used alone or may be used in combination with a vector such as those skilled in the art, if a vector is used, the choice of such vector may be useful in methods for transformation of cells, such as a vector for expression of a DNA, a DNA vector may be used in the field of a method for transformation of cells, may be used in the field of a method for expression of a genetic transformation of such a host cell, a vector, may be used to obtain a genomic DNA, or may be used in a vector for the analysis of a DNA expression of a genomic DNA, a genomic DNA, a genomic DNA, a.

"operably linked" or "functionally linked" in this context may mean that the sequential arrangement of a promoter polynucleotide according to the present disclosure with another oligonucleotide or polynucleotide (e.g., gapA/transhydrogenase/gdh, asd, dapB, and/or ddh genes) results in transcription of the other polynucleotide (e.g., gapA/transhydrogenase/gdh, asd, dapB, and/or ddh genes.) in other words, "operably linked" or "functionally linked" may mean that the promoter controls transcription of genes adjacent to or downstream or 3' of the promoter (e.g., gapA/transhydrogenase/gdh, asd, dapB, and/or ddh genes).

As used herein, the term "product of interest" or "biomolecule" refers to any product produced by a microorganism in a feedstock, in cases the product of interest may be a small molecule, an enzyme, a peptide, an amino acid, an organic acid, a synthetic compound, a fuel, ethanol, etc., for example, the product or biomolecule of interest may be any primary or secondary extracellular metabolite, the primary metabolite may be, inter alia, ethanol, citric acid, lactic acid, glutamic acid, glutamate, lysine, threonine, tryptophan and other amino acids, vitamins, polysaccharides, etc., the secondary metabolite may be, inter alia, an antibiotic compound, such as penicillin, or an immunosuppressive agent, such as cyclosporin A (cyclosporine A), a plant hormone, such as gibberellins, a statin, such as lovastatin, a fungicide, such as griseofulvin, etc.

The carbon source may comprise various organic compounds in various forms, including but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, and the like, these include, for example, various monosaccharides, such as glucose, dextrose (D-glucose), maltose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinates, lactates, acetates, ethanol, and the like, or mixtures thereof.

The term "feedstock" may be defined as a raw material or a mixture of raw materials that is supplied to a microorganism or a fermentation process, from which other products can be produced. For example, a carbon source, such as biomass or a carbon compound derived from biomass, can be a feedstock for a microorganism to produce a product of interest (e.g., small molecules, peptides, synthetic compounds, fuels, ethanol, etc.) in a fermentation process. However, the feedstock may contain nutrients other than a carbon source.

The term "volumetric productivity" or "production rate" can be defined as the amount of product formed per volume of medium per unit time. Volumetric productivity may be reported in grams per liter per hour (g/L/h).

To describe productivity as an intrinsic parameter of the microorganism rather than an intrinsic parameter of the fermentation process, productivity may be further defined herein as the step of as specific productivity in grams of product per gram of dry cell weight (CDW) per hour (g/g CDW/h)₆₀₀The specific productivity can also be expressed in grams of product per liter of medium per hour per Optical Density (OD) of the 600nm broth (g/L/h/OD).

The term "yield" can be defined as the amount of product obtained per unit weight of starting material and can be expressed in grams of product per gram of substrate (g/g). Yield may be expressed as a percentage of the theoretical yield. "theoretical yield" is defined as the maximum amount of product that can be produced, based on a given amount of substrate, as specified by the stoichiometry of the metabolic pathway used to make the product.

The term "potency" or "potency" may be defined as the concentration of a solution or the concentration of a substance in a solution. For example, the titer of a product of interest (e.g., a small molecule, a peptide, a synthetic compound, a fuel, ethanol, etc.) in a fermentation broth can be described as grams of product of interest per liter of solution in the fermentation broth (g/L).

The term "total titer" can be defined as the sum of all products of interest produced in a process, including, but not limited to, the product of interest in solution, the product of interest in the gas phase (if applicable), and any product of interest removed from the process and recovered relative to the initial volume in the process or the operating volume in the process.

As used herein, the term "HTP gene design library" or "library" refers to a collection of gene perturbations in accordance with the present disclosure in some embodiments of , a library of the present disclosure may be represented as i) a collection of sequence information in a database or other computer file, ii) a collection of genetic constructs encoding the aforementioned series of genetic elements, or iii) a host cell strain comprising the genetic elements.

Generation of a pool of genetic diversity for NADPH-increasing genetic engineering and use of HTP microbiological engineering platforms

As used herein, the term gene design refers to the reconstruction or alteration of the genome of a host organism by identifying and selecting the best variant of a particular gene, portion of a gene, promoter, stop codon, 5'UTR, 3' UTR or other DNA sequence to design and produce new superior host cells.

In examples, step in the gene design methods of the present disclosure is to obtain an initial population of gene diversity pools with a variety of sequence variations, whereby the population can reconstitute a new host genome.

Utilizing a diversity pool from an existing wild-type strain

Thus, a diversity pool can be a given number n of wild-type microorganisms used for analysis, wherein the microbial genome represents a "diversity pool".

In some embodiments , the pool of diversity can be the result of existing diversity in natural genetic variations among the wild-type microorganisms.

Use of diversity pools from existing industrial strain variants

In other embodiments of the disclosure, the diversity pool is a strain variant produced during traditional strain improvement (e.g., or multiple host organism strains produced via random mutation and selected for increased yield over the years).

In particular aspects, the diversity pool can be the original parental microbial strain (S)₁) Which have a "baseline" gene sequence (S) at a specific time point₁Gen₁) (ii) a Followed by any number of subsequent progeny strains (S)₂、S₃、S₄、S₅Etc. can be summarized as S_2-n) Derived/developed from said S₁Strain and relative to S₁Has a different genome (S)_2-nGen_2-n)。

Generation of diversity pools by mutagenesis

In examples, mutations of interest in a given diversity pool cell population can be artificially generated using any means of mutating a strain (including mutagenic chemicals or radiation the term "mutagenesis" is used herein to refer to methods of inducing or more genetic modifications in cellular nucleic acid material.

The term "genetic modification" refers to any alteration of DNA. Representative genetic modifications include nucleotide insertions, deletions, substitutions, and combinations thereof, and can be as small as a single base or as large as tens of thousands of bases. Thus, the term "genetic modification" encompasses inversions of nucleotide sequences and other chromosomal rearrangements whereby the position or orientation of DNA comprising a chromosomal region is altered. Chromosomal rearrangements may comprise either intrachromosomal rearrangements or interchromosomal rearrangements.

In embodiments, the mutagenesis method used in the presently claimed subject matter is substantially random, such that genetic modification can occur at any available nucleotide position within the nucleic acid material to be mutagenized.

The methods of the present disclosure may use any mutagen, including (but not limited to): ultraviolet light, X-ray radiation, gamma radiation, N-ethyl-N-nitrosourea (ENU), Methyl Nitrosourea (MNU), Procarbazine (PRC), Triethylenemelamine (TEM), acrylamide monomer (AA), chlorambucil (chlorombucil, CHL), Melphalan (MLP), Cyclophosphamide (CPP), diethyl sulfate (DES), Ethyl Methanesulfonate (EMS), Methyl Methanesulfonate (MMS), 6-mercaptopurine (6-mercaptopridine, 6-MP), mitomycin-C (MMC), N-methyl-N' -nitro-N-nitrosoguanidine (MNNG),³H₂O and carbamates (UR) (see, e.g., Linchick (Rinchik), 1991; Mark (Marker) et al, 1997; and Lassel (Russell), 1990). Other mutagens are well known to those skilled in the art and include http:// www.iephb.nw.ru/. about spirov/hazard/mutageHtml.

The term "mutagenesis" also encompasses methods for altering (e.g., by targeted mutation) or modulating cellular function, thereby enhancing the rate, quality, or extent of mutagenesis. For example, a cell can be altered or regulated, thereby rendering it dysfunctional or defective in DNA repair, mutagen metabolism, mutagen sensitivity, genomic stability, or a combination thereof. Thus, interference with gene function that generally maintains genomic stability can be used to enhance mutagenesis. Representative targets for interference include, but are not limited to, DNA ligase I (Bentley et al, 2002) and casein kinase I (U.S. Pat. No. 6,060,296).

In examples, site-directed mutagenesis (e.g., using a commercially available kit such as the Transformer site-directed mutagenesis kit (Clontech)) is used to generate multiple variations in the overall nucleic acid sequence in order to generate a nucleic acid encoding a lyase of the disclosure.

The frequency of genetic modification after exposure to or more mutagens can be adjusted by varying the treatment dose and/or number of repetitions and can be tailored to the specific application.

Thus, in examples, "mutagenesis" as used herein encompasses all techniques known in the art for inducing mutations, including error-prone PCR mutagenesis, oligonucleotide-directed mutagenesis, site-directed mutagenesis, and iterative sequence recombination using any of the techniques described herein.

General description of NADPH-increasing Gene design

The present disclosure provides methods for producing a microorganism (e.g., a bacterium) capable of increasing production of a biomolecule or product of interest generally, methods for producing a microorganism for producing any biomolecule as provided herein may require genetic modification of a host microorganism by introducing or more genes of interest into the host microorganism to produce a genomically engineered strain of the microorganism, culturing the engineered strain under conditions suitable for production of the biomolecule or product of interest, and selecting the engineered strain if the engineered strain produces an increased amount of the biomolecule or product of interest.

The exemplary workflows of the examples disclosed herein require the identification of the target gene, the obtaining or synthesis of the nucleic acid (e.g., DNA) of the target gene and cloning of the obtained or synthesized target gene into a suitable vector any method known in the art and/or provided herein may be used to assemble or clone the target gene into a suitable vector, the vector may be any vector known in the art and/or provided herein that is compatible with the host microorganism to be utilized once the vector containing the target gene is assembled, the vector may be introduced into the host microorganism using any method known in the art and/or provided herein, the host microorganism may be any host microorganism provided herein once introduced into the host microorganism, the genetically modified host may be selected and the insertion of the target gene may be evaluated for the insertion of the target gene, the target gene may be engineered to be inserted into a specific location in the genome of the host microorganism under conditions of , the target gene is inserted into a site that facilitates expression of the target gene, but is not integrated by the target gene, or is not integrated into the target gene, the host microorganism, the promoter.

The insertion can be assessed using any method known in the art, for example, amplification and/or sequencing of the genome or portion thereof of the genetically modified microorganism at in some cases, the methods provided herein further require removal or circularization of the selectable marker by counter-selection as described herein.

The method may include the steps of (a) evaluating the ability of a genetically modified strain to produce a biomolecule or product of interest after evaluating the insertion of a gene of interest and optionally removing a selectable marker, (b) amplifying the strain prior to the evaluating, the optional step may be amplifying the strain, (c) amplifying the genetically modified strain may require culturing the genetically modified strain in a growth medium suitable for amplification in a well in a plate or a multi-well plate, (c) evaluating the strain may require culturing the genetically modified strain on a plate or in a well in a multi-well plate comprising a growth medium/condition designed to mimic the actual conditions under which the biomolecule or product of interest is produced, (c) in cases, the growth medium in this step is suitable for producing the biomolecule or product of interest derived from metabolic processing of glucose, (c) if the genetically modified strain has or predicts the biomolecule or product of interest that produces a desired or threshold production rate or yield as determined from the evaluating step, then selecting this strain and cooling for storage, (c) predicting how the strain will perform the method in a large scale fermentation based on measuring the results of the strain.

In cases, the genetically modified strain having or predicted to produce the desired or threshold production rate or yield of the biomolecule or product of interest is transferred to or grown in a larger culture under conditions (e.g., fermentation conditions) for production of the biomolecule or product of interest.

In examples, a biomolecule or product of interest is derived from glucose and its metabolic processing by a microorganism, such that the methods provided herein require the production of a strain of microorganism that can produce increased amounts of the biomolecule or product of interest derived from the metabolic processing of glucose by the strain in some examples, the methods provided herein require the introduction of or more genes of interest involved in lysine biosynthesis in some examples, the methods provided herein require the introduction of or more genes of interest involved in the production of NADPH in a host cell in other examples, the methods provided herein require the introduction of or more genes of interest involved in reducing the utilization of NADPH by a host cell in some examples the genes of interest are gapA genes such that the gapA gene is introduced into a host microorganism in the methods provided herein.

In other embodiments, the target gene is a nicotinamide nucleotide transhydrogenase gene, such that the nicotinamide nucleotide transhydrogenase gene is introduced into the host microorganism in the methods provided herein.

In many organisms tricarboxylic acid (TCA) cycle intermediates can be regenerated directly from pyruvate, for example, pyruvate carboxylase (pyc), found in bacteria but not in E.coli, mediates the formation of oxaloacetate by carboxylation of pyruvate with carboxybiotin.

In other embodiments, the target gene is a pyruvate carboxylase gene such that in the methods provided herein the pyruvate carboxylase (PYC) gene is introduced into a host microorganism the PYC gene may be heterologous to the host microorganism in certain embodiments, the PYC gene is selected from the sequences disclosed in U.S. Pat. No. 6,171,833 and U.S. Pat. No. 6,171,833 in embodiments, the PYC gene is derived from Rhizobium phaseoloides (R.etli.) in embodiments, the PYC gene is derived from Corynebacterium in embodiments, the target organism is Escherichia coli in embodiments, the target organism is Corynebacterium in embodiments, the heterologous variant of PYC is expressed in host cells lacking endogenous PYC in embodiments, the heterologous variant of PYC is expressed in host cells with endogenous PYC in embodiments, the expression of PYC is increased in embodiments, the expression of endogenous PYC is increased by genetic modification of the locus comprising the PYC promoter operably linked to the PYC promoter in embodiments, the promoter is operably linked to a strong promoter of the PYC promoter, the promoter is operably linked to the native promoter of Corynebacterium glutamicum, the promoter is increased in 3648, the expression of the promoter is increased by the native promoter of Corynebacterium glutamicum, the promoter is operably linked to the promoter of Corynebacterium glutamicum, and the promoter is increased in the promoter of Corynebacterium glutamicum, which is operably linked to the promoter.

In other embodiments, the target gene is or more of the gdh, asd, dapB, or ddh genes, such that the gdh, asd, dapB, or ddh genes are introduced into the host microorganism in the methods provided herein. or more of the gdh, asd, dapB, or ddh genes can be heterologous genes in the host microorganism.

In certain embodiments, both the gapA gene and the nicotinamide nucleotide transhydrogenase gene are introduced into the host microorganism in the methods provided herein.

In other embodiments, a nicotinamide nucleotide transhydrogenase gene and or more genes selected from gdh, asd, dapB, and ddh are introduced into the host microorganism in the methods provided herein.

In other embodiments, the gapA, nicotinamide nucleotide transhydrogenase gene, and or more genes selected from gdh, asd, dapB, and ddh are introduced simultaneously into the host microorganism in the methods provided herein.

In examples, the gapA gene and/or nicotinamide nucleotide transhydrogenase gene and/or or more genes selected from gdh, asd, dapB, and ddh and/or the TA gene and/or the pyc gene are introduced into the host microorganism to increase the amount of NADPH in the host microorganism.

In examples the host strain is a bacterial strain modified by insertion of a thrLABC regulator, such as the thrLABC regulator of E.coli K-12 strain W3110(SEQ ID NO. 76). in examples the host strain is a bacterial strain modified by insertion of a thrABC regulator, such as the thrLABC regulator of E.coli K-12 strain W3110(SEQ ID NO:77) modified by deletion of the thrL leader sequence.in examples the host strain is a bacterial strain modified by deletion of the bacterial genomic region encoding L-threonine 3-dehydrogenase (tdh) or a homologue thereof.

Microbial genetic engineering using NADPH-increasing libraries

In embodiments, the disclosed microbial genome engineering methods utilize a gapA gene and/or nicotinamide nucleotide transhydrogenase gene and/or or a library of genes and/or TA genes and/or pyc genes selected from gdh, asd, dapB, and ddh, the gapA gene can be selected based on its ability to use NAD as a cofactor.in certain embodiments, the coenzyme specificity of gapA is broadened accordingly in aspects gapA has a dual specificity for NAD and NADH.in aspects gapA is more preferred to use NADH than NAD in other aspects gapA is equally preferred for NAD and NADH.in aspects nicotinamide nucleotide transhydrogenase gene can be selected based on its ability to convert NADH to NADPH.gdh, asd, dapB, or ddh can be selected based on its ability to broaden NADPH as a cofactor.in aspects, gdh, dapB, and/or NADPH are more preferred to use NADPH, serine, and serine.

In cases, the microorganism is engineered with a gapA library, a nicotinamide nucleotide transhydrogenase library, a gdh, asd, dapB and/or ddh and/or TA library and/or a pyc library or any combination of these libraries in embodiments, the library contains a plurality of chimeric construct inserts such that each insert in the library comprises a gapA gene, a nicotinamide nucleotide transhydrogenase gene and or more genes selected from gdh, asd, dapB and ddh and/or a TA gene and/or a pyc gene.

In certain embodiments, each gapA gene or nicotinamide nucleotide transhydrogenase gene or or more genes selected from gdh, asd, dapB and ddh as provided herein for use in the methods provided herein are under the control of the native promoter or any promoter polynucleotide provided herein or functionally linked thereto "promoter polynucleotide" or "promoter" or "polynucleotide having promoter activity" may mean that the polynucleotide, preferably the Deoxyribonucleotide (DNA) construct or nucleic acid, preferably the deoxyribonucleic acid (DNA) construct or constructs, in embodiments, comprising the gapA gene and/or nicotinamide nucleotide transhydrogenase gene and/or the promoter selected from gdh, asd, dapB and ddh, or or more genes selected from gdh, asd, dapB and ddh, and/or the pyc gene, when functionally linked to the polynucleotide to be transcribed, determines the transcription start point and frequency of the coding polynucleotide or gene and/or genes selected from gdh, asd, dapB and/or pyc gene and/or genes selected from gdh and/or from gdh genes and/or pyc genes, whereby the strength of expression of the affected control polynucleotide is achieved, preferably the polynucleotide, preferably the Deoxyribonucleotide (DNA) construct or constructs comprising the gapA gene and/or nicotinamide nucleotide transhydrogenase gene and/or gene or genes selected from gdh under the same promoter in embodiments, in which the same or chimeric gene library of gdh gene or chimeric gene of gdh 355635 or chimeric gene and/or chimeric gene of gdh comprises the same promoter or chimeric gene under the same promoter of gdh gene and/or chimeric gene of gdh gene under the same promoter or chimeric gene of gdh gene and/or chimeric gene of the same promoter selected from gdh gene of gdh gene and/or chimeric gene of the same promoter of the target gene of gdh gene of the same promoter or chimeric gene of the same promoter of gdh gene of the same promoter of the target gene of the same or chimeric gene of the gdh gene of the promoter of the gdh 35 or chimeric gene of the gdh and/or chimeric gene of the same or of the promoter.

Starter ladder

In examples, the present disclosure teaches methods of selecting promoters with optimal expression characteristics to regulate expression of or more enzymes in a host microorganism and to produce beneficial effects on overall host strain productivity.

Promoters regulate the rate of gene transcription and may affect transcription in a variety of ways. For example, a constitutive promoter directs transcription of its associated gene at a constant rate regardless of internal or external cellular conditions, while a regulatable promoter increases or decreases the rate of gene transcription depending on internal and/or external cellular conditions, such as growth rate, temperature, response to specific environmental chemicals, and the like. Promoters can be isolated from their normal cellular context and engineered to regulate the expression of virtually any gene, thereby enabling efficient alteration of cell growth, product yield, and/or other phenotypes of interest.

For example, in embodiments, the present disclosure teaches methods of identifying or more promoters and/or producing or more variants of promoters in a host cell that exhibit -series expression intensities or superior regulatory properties.

For example, in embodiments, the promoter ladder is generated by identifying a native, or wild-type promoter that exhibits a -series expression intensity in response to a stimulus.

In other embodiments, the disclosure teaches the production of promoter ladders exhibiting an series expression profile spanning different conditions, for example, in embodiments, the disclosure teaches the production of promoter ladders having expression peak profiles at different stages throughout the fermentation.

In embodiments, the promoter ladders of the present disclosure are designed to perturb gene expression in a predictable manner across the series of consecutive responses.in embodiments, the continuous nature of the promoter ladders confers additional predictive power to the strain improvement program.in embodiments, for example, the crossover promoter or termination sequences of a selected metabolic pathway can generate a host cell performance curve that identifies an optimal expression rate or profile, strains are generated in which the targeted gene is no longer a limiting factor for a specific response or gene cascade, while also avoiding unnecessary over-expression or misexpression under inappropriate circumstances.in embodiments, the promoter ladders are generated by identifying native, native or wild-type promoters that exhibit the desired profile.in other embodiments, the promoter ladders are generated by mutating naturally occurring promoters to derive multiple mutant promoter sequences.in these mutant promoters, the effect of each on target gene expression is tested.in embodiments, the edited promoters are tested for expression activity under multiple conditions, whereby the activity of each promoter variant is recorded and characterized and the ladder data is organized into a library of highly expressed variants based on the top of the edited promoter ladder (e.g., the promoter ladder is stored near the top of the promoter ladder).

In examples, the disclosure teaches a promoter ladder that is a combination of an identified naturally occurring promoter and a mutant variant promoter.

In examples, the disclosure teaches methods of identifying native, native or wild-type promoters that meet two criteria, 1) representative of a constitutive promoter ladder, and 2) can be encoded by short DNA sequences, ideally less than 100 base pairs in examples, the constitutive promoters of the disclosure exhibit constant gene expression across two selected growth conditions (typically compared between conditions experienced during industrial cultivation) in examples, the promoters of the disclosure will consist of a core promoter of about 60 base pairs and a 5' UTR between 26 and 40 base pairs in length.

In embodiments, or more of the previously identified naturally occurring promoter sequences are selected for gene editing in embodiments, the native promoter is edited by any of the mutation methods described above in other embodiments, the promoters of the present disclosure are edited by synthesizing new promoter variants with the desired sequence.

The entire disclosures of the following applications are incorporated herein by reference: U.S. application No. 15/396,230 (U.S. publication No. US 2017/0159045 a 1); PCT/US2016/065465(WO 2017/100377A 1); U.S. application No. 15/140,296 (US 2017/0316353 a 1); PCT/US2017/029725(WO 2017/189784A 1); PCT/US2016/065464(WO 2017/100376A 2); U.S. provisional application No. 62/431,409; U.S. provisional application No. 62/264,232; and U.S. provisional application No. 62/368,786.

A non-exhaustive list of promoters of the present disclosure is provided in Table 1 below every of the promoter sequences may be referred to as heterologous promoters or heterologous promoter polynucleotides.

TABLE 1. selected promoter sequences of the present disclosure.

SEQ ID No.	Promoter abbreviation	Promoter name
			59	P1	Pcg0007_lib_39
60	P2	Pcg0007
			61	P3	Pcg1860
62	P4	Pcg0755
			63	P5	Pcg0007_265
64	P6	Pcg3381
			65	P7	Pcg0007_119
66	P8	Pcg3121

In embodiments, the promoters of the present disclosure exhibit sequence identity with at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% of the promoters from the above table.

In some cases , the promoter ladder may be used for genes selected from a gapA library, a nicotinamide nucleotide transhydrogenase library, a gdh, asd, dapB and/or ddh and/or TA library and/or a pyc library or any combination of these libraries before in embodiments the use of the promoter ladder comprises modulating the expression of genes selected from a gapA library, a nicotinamide nucleotide transhydrogenase library, a gdh, asd, dapB and/or ddh and/or TA library and/or a pyc library or any combination of these libraries in embodiments the use of the promoter ladder comprises fine-tuning the expression of genes selected from a gapA library, a nicotinamide nucleotide transhydrogenase library, a gpB, aspB and/or ddh and/or a pyc library or any combination of these libraries after engineering, the expression of genes selected from a gapA library, a promoter ladder provided herein may be used to effectively screen or assess the production of a promoter ladder from glucose and wherein the level of expression of genes selected from a host and/or genes of a host may be altered in an iterative manner that the expression of genes selected from a gapA library and/or a host molecule of genes of interest and/or genes of a promoter ladder may be used to achieve a level of genes that is optimal for expression of genes selected from a host that is effective for the production of genes and/or expression of genes of interest in a host that is optimal for the host that is found in a microorganism.

Glyceraldehyde-3-phosphate dehydrogenase library

In certain embodiments, provided herein are libraries of gapA genes for use in the methods provided herein. a library of gapA genes may comprise or more gapA genes each gapA gene in the library may be a native or mutated form of a gapA gene. the mutated form may comprise any gapA gene selected from insertions, deletions, Single Nucleotide Polymorphisms (SNPs) or translocations or a plurality of mutated. the gapA gene in the library may be a gapA gene. the gapA gene may be any gapA gene from prokaryotic cells known in the art (i.e., bacteria and/or archaea). the gapA gene may be any gapA gene from eukaryotic cells known in the art (e.g., fungi). the gapA gene may be considered to comprise NAD and/or NADH dependent gaph activity.) the gapA gene used herein may be any protein from Streptomyces (e.g. Bacillus) such as escherichia coli (e.g. Saccharomyces cerevisiae), e.g. Saccharomyces cerevisiae (e.g. Bacillus sp), Streptomyces sp. (e.g. Saccharomyces sp.: Streptomyces) or any combination thereof, e.g. Streptomyces sp).

In embodiments, the gapA enzymes of the disclosure exhibit at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% sequence identity to the gapA enzymes provided herein to .

Each gapA gene in the library of gapA genes can be present in a chimeric construct such that the gene can flank or more regulatory sequences and/or sequences that are homologous to sequences present in the genome of the host cell.

Nicotinamide nucleotide transhydrogenase library

In certain embodiments, provided herein is a library of nicotinamide nucleotide transhydrogenase genes for use in the methods provided herein, the library of nicotinamide nucleotide transhydrogenase genes can comprise or a plurality of nicotinamide nucleotide transhydrogenase genes each of which can be a native or mutated form of a transhydrogenase gene, the mutated form can comprise or a plurality of mutations selected from insertions, deletions, Single Nucleotide Polymorphisms (SNPs), or translocations, each of which can be a transhydrogenase gene, the nicotinamide nucleotide transhydrogenase gene can be any transhydrogenase gene from prokaryotic cells known in the art (i.e., bacteria and/or archaea), the nicotinamide nucleotide transhydrogenase gene can be any transhydrogenase gene from eukaryotic cells known in the art (e.g., fungi), the nicotinamide nucleotide transhydrogenase can be any enzyme that converts NADPH to NADPH.

In embodiments, the nicotinamide nucleotide transhydrogenase of the disclosure exhibits sequence identity of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% to the transhydrogenase provided herein.

Each nicotinamide nucleotide transhydrogenase gene in the library of nicotinamide nucleotide transhydrogenase genes can be functionally linked to or under the control of its native promoter or a mutated form of its native promoter.

gdh, asd, dapB and/or ddh libraries

In certain embodiments, provided herein are libraries of gdh, asd, dapB, and ddh genes for use in the methods provided herein. the library of gdh, asd, dapB, and ddh genes may comprise or more gdh, asd, dapB, and ddh genes each of the gdh, asd, dapB, or ddh genes in the library may be a native or mutant form of the gdh, asd, dapB, or ddh genes, respectively.

In some embodiments, the library of asd, dapB, or ddh genes comprises asd, dapB, or ddh genes, respectively, from any strain/species/subspecies of Mycobacterium (e.g., Mycobacterium smegmatis), Streptomyces (e.g., Streptomyces coelicolor), Zymomonas (e.g., Zymomonas mobilis), Synechocystis (e.g., Synechocystis PCC6803), Bifidobacterium (e.g., Bifidobacterium longum), Escherichia (e.g., Escherichia coli), Bacillus (e.g., Bacillus subtilis), Corynebacterium (e.g., Corynebacterium glutamicum), Saccharomyces (e.g., Saccharomyces cerevisiae), or a combination thereof.

In embodiments, the asd, dapB, or ddh enzymes of the present disclosure exhibit at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% sequence identity to the asd, dapB, or ddh enzymes provided herein, respectively, of .

Each asd, dapB, or ddh gene in the library may be functionally linked to or under the control of its native promoter or a mutated form of its native promoter.

TA library

In certain embodiments, provided herein is a library of TA genes for use in the methods provided herein, the library of TA genes can comprise or more TA genes each of which can be a native or mutated form of the respective TA gene, the mutated form can comprise or more mutations selected from insertions, deletions, Single Nucleotide Polymorphisms (SNPs), or translocations.

In some embodiments, the library of TA genes respectively comprises TA genes from any strain/species/subspecies of Mycobacterium (e.g., Mycobacterium smegmatis), Streptomyces (e.g., Streptomyces coelicolor), Zymomonas (e.g., Zymomonas mobilis), Synechocystis (e.g., Synechocystis PCC6803), Bifidobacterium (e.g., Bifidobacterium longum), Escherichia (e.g., E.coli), Bacillus (e.g., Bacillus subtilis), Corynebacterium (e.g., Corynebacterium glutamicum), Saccharomyces (e.g., Saccharomyces cerevisiae), or combinations thereof.

In embodiments, the TA enzyme of the present disclosure exhibits at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% sequence identity to the TA enzyme provided herein to .

Each TA gene in the library of TA genes can be present in a chimeric construct such that the gene can flank or more regulatory sequences and/or sequences that are homologous to sequences present in the genome of the host cell.

Pyc library

In certain embodiments, provided herein is a library of pyc genes for use in the methods provided herein, the library of pyc genes may comprise or a plurality of pyc genes each of which may be a native or mutant form of the pyc gene, respectively, the mutant form may comprise or more mutations selected from insertions, deletions, Single Nucleotide Polymorphisms (SNPs), or translocations.

In some embodiments, the library of pyc genes respectively comprises pyc genes from any strain/species/subspecies of Mycobacterium (e.g., Mycobacterium smegmatis), Streptomyces (e.g., Streptomyces coelicolor), Zymomonas (e.g., Zymomonas mobilis), Synechocystis (e.g., Synechocystis PCC6803), Bifidobacterium (e.g., Bifidobacterium longum), Bacillus (e.g., Bacillus subtilis), Corynebacterium (e.g., Corynebacterium glutamicum), Saccharomyces (e.g., Saccharomyces cerevisiae), or a combination thereof.

In embodiments, the pyc enzymes of the present disclosure exhibit -identity to the sequences of the respective pyc enzymes provided herein of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75%.

Each pyc gene in the library of pyc genes may be present in a chimeric construct such that the gene may flank or more regulatory sequences and/or sequences that are homologous to sequences present in the genome of the host cell.

Generation of mutant forms of the gapA Gene

As provided herein, the gapA gene used in the methods provided herein can be a mutated form of the gene from which it is derived. The mutant gene may be mutated in any manner known in the art or provided herein.

In embodiments, the disclosure teaches mutating a population of cells by introducing, deleting, or replacing selected portions of genomic DNA thus, in embodiments, the disclosure teaches methods for mutations targeted to a particular locus (e.g., gapA). in other embodiments, the disclosure teaches selectively editing a region of DNA of interest using gene editing techniques such as ZFNs, TALENS, or CRISPR.

In embodiments, the disclosure teaches mutating a selected DNA region (e.g., the gapA gene) outside of the host organism, for example, in embodiments, the disclosure teaches mutating the native gapA gene.

In embodiments, the selected region of DNA is generated in vitro by gene shuffling of natural variants or by gene shuffling with synthetic oligonucleotides, plasmid-plasmid recombination, viral plasmid recombination, or virus-virus recombination.

In embodiments, the generation of mutations in a selected gene region containing the gapA gene is accomplished using "reassembly PCR". briefly, oligonucleotide primers (oligonucleotides) are synthesized for PCR amplification of a segment of a nucleic acid sequence of interest (e.g., the gapA gene) such that the sequence of the oligonucleotide overlaps the junction of the two segments.A length of the overlap region is typically about 10 to 100 nucleotides. the segments are each amplified with sets of such primers.A PCR product is then "reassembled" according to an assembly protocol. briefly, in the assembly protocol, the PCR product is first purified to be free of primers by, for example, gel electrophoresis or size exclusion chromatography.A purified product is mixed at and subjected to about 1-10 cycles of denaturation, re-binding, and extension in the absence of additional primers ("self priming") in the presence of deoxynucleoside triphosphates (dNTPs) and appropriate buffer salts.

In embodiments of the disclosure, a region of mutated gapA DNA, such as discussed above, is enriched for mutant sequences in order to more efficiently sample a variety of mutation profiles, i.e., possible combinations of mutations, in embodiments, mutant sequences are identified by the mutS protein affinity matrix (Wagner et al, Nucleic Acids research (Nucleic Acids Res.) (23 (19):3944-3948 (1995); Su (Su) et al, Proc. Natl.Acad.Sci. (U.S.A.) (Proc. Natl.Acad.Sci.), 83:5057-5061(1986)), where the step of in vitro amplification of affinity purified material is preferably performed prior to the assembly reaction, and this material is then placed into an assembly or reassembly PCR reaction.

In examples, the mutated gapA DNA region is found in nature.

Generating mutant forms of the nicotinamide nucleotide transhydrogenase Gene

As provided herein, a nicotinamide nucleotide transhydrogenase gene for use in the methods provided herein can be a mutated form of the gene from which it is derived. The mutant gene may be mutated in any manner known in the art or provided herein.

In some embodiments , the disclosure teaches mutating a population of cells by introducing, deleting, or replacing selected portions of genomic DNA thus in some embodiments , the disclosure teaches methods for targeting a particular locus (e.g., nicotinamide nucleotide transhydrogenase) for mutation.

In examples, the disclosure teaches mutating a selected DNA region (e.g., a nicotinamide nucleotide transhydrogenase gene) outside of the host organism for example, in examples, the disclosure teaches mutating a native nicotinamide nucleotide transhydrogenase gene.

In certain embodiments, generating a mutation in a selected gene region comprising a nicotinamide nucleotide transhydrogenase gene is accomplished using "reassembly PCR".

In embodiments, such as the above discussed mutant nicotinamide nucleotide transhydrogenase DNA region enrichment of mutant sequences, in order to more effectively sample a variety of mutation profiles, i.e., possible combinations of mutations embodiments, the mutant sequences are identified by a mutS protein affinity matrix, wherein preferably in vitro amplification of affinity purified material prior to assembly reaction is performed.

In examples, the mutant nicotinamide nucleotide transhydrogenase DNA region is found in nature.

Generation of mutant forms of the gdh, asd, dapB and/or ddh genes

As provided herein, a gdh, asd, dapB, or ddh gene used in the methods provided herein can be a mutated form of the gene from which it is derived. The mutant gene may be mutated in any manner known in the art or provided herein.

In embodiments, the disclosure teaches mutating a population of cells by introducing, deleting or replacing selected portions of genomic DNA thus, in embodiments, the disclosure teaches methods for targeting specific loci (e.g., gdh, asd, dapB or ddh) for mutation.

In embodiments, the disclosure teaches mutating a selected DNA region (e.g., gdh, asd, dapB, or ddh gene) in vitro of a host organism for example, in embodiments, the disclosure teaches mutating a native gdh, asd, dapB, or ddh gene.

In certain embodiments, generating a mutation in a selected gene region comprising a nicotinamide nucleotide transhydrogenase gene is accomplished using "reassembly PCR".

In embodiments, mutant gdh, asd, dapB and/or ddh DNA regions such as those discussed above are enriched for mutant sequences in order to more efficiently sample a variety of mutant profiles, i.e., possible combinations of mutations in embodiments, mutant sequences are identified by a mutS protein affinity matrix, wherein preferably a step of in vitro amplification of an affinity purification material is performed prior to the assembly reaction.

In examples, naturally occurring variants of Corynebacterium glutamicum ddh are found in nature, including but not limited to, the naturally occurring variants of Corynebacterium glutamicum ddh, such as, but not limited to, the naturally occurring variants of Corynebacterium glutamicum ddh, Escherichia coli, Micrococcus, Achromobacterium denitrificans, Micrococcus luteus, Brevibacterium faecalis, and Carnobacterium, in certain examples, naturally occurring variants of Corynebacterium glutamicum asd are found in bacteria including, but not limited to, Methanococcus jannaschii, Corynebacterium vulgaris, Pseudomonas sp, Bacillus subtilis, and Corynebacterium glutamicum, in certain examples, naturally occurring variants of Corynebacterium glutamicum asd are found in Bacillus thermophilus, Bacillus subtilis, and Bacillus subtilis, in certain examples, but not limited to, naturally occurring variants of Corynebacterium glutamicum sp, Bacillus subtilis, and/Bacillus subtilis, in certain examples, but not limited to, Bacillus subtilis, and Bacillus subtilis, and Bacillus subtilis, and Bacillus subtilis, including, Bacillus subtilis, and Bacillus subtilis, including, and Bacillus subtilis.

Generation of mutant forms of the TA Gene

As provided herein, the TA gene used in the methods provided herein can be a mutated form of the gene from which it is derived. The mutant gene may be mutated in any manner known in the art or provided herein.

In embodiments, the disclosure teaches mutating a population of cells by introducing, deleting, or replacing selected portions of genomic DNA thus, in embodiments, the disclosure teaches methods for targeting mutations at a particular locus (e.g., TA). in other embodiments, the disclosure teaches selectively editing a region of DNA of interest using gene editing techniques such as ZFN, TALENS, or CRISPR.

In embodiments, the disclosure teaches mutating a selected DNA region (e.g., a TA gene) in vitro of a host organism, for example, in embodiments, the disclosure teaches mutating a native TA gene.

In certain embodiments, generating a mutation in a selected gene region comprising a nicotinamide nucleotide transhydrogenase gene is accomplished using "reassembly PCR".

In embodiments, the mutant TA DNA region (such as discussed above) is enriched for mutant sequences in order to more efficiently sample a variety of mutant profiles, i.e., possible combinations of mutations in embodiments, the mutant sequences are identified by a mutS protein affinity matrix, wherein preferably an in vitro amplification step of an affinity purification material is performed prior to the assembly reaction.

In in some embodiments, naturally occurring variants of C.glutamicum TA are found in nature, in certain embodiments, naturally occurring variants of C.glutamicum TA are found in bacteria including, but not limited to, Actinomyces oralis, Archaeoglobus thermophilus, Bacillus faecalis, Methanorthe umbellatus, Micromegasphaera nucleatum, Achromobacter denitrificans, Micrococcus luteus, Brevibacterium faecalis, and Carnobacterium.

Generation of mutant forms of the pyc Gene

As provided herein, the pyc gene used in the methods provided herein can be a mutated form of the gene from which it is derived. The mutant gene may be mutated in any manner known in the art or provided herein.

In examples, the disclosure teaches mutating a selected DNA region (e.g., pyc gene) outside of the host organism, for example, in examples, the disclosure teaches mutating a native pyc gene.

In certain embodiments, generating a mutation in a selected gene region comprising a nicotinamide nucleotide transhydrogenase gene is accomplished using "reassembly PCR".

In embodiments, a mutant pyc DNA region such as discussed above is enriched for mutant sequences in order to more efficiently sample a variety of mutant profiles, i.e., possible combinations of mutations in embodiments, the mutant sequences are identified by a mutS protein affinity matrix, wherein preferably an in vitro amplification step of an affinity purification material is performed prior to the assembly reaction.

In some embodiments, a mutated or variant pyc DNA region is found in nature, in some embodiments, naturally occurring variants of C.glutamicum pyc are found in bacteria including, but not limited to, Actinomyces oralis, Archaeoglobus thermophilus, Bacillus coprinus, Methanobacterium chidonoides, Micromegasphaera nucleatum, Achromobacter denitrificans, Micrococcus luteus, Brevibacterium faecalis, and Carnobacterium.

Generation of libraries containing the gapA Gene

In some embodiments , the disclosure teaches insertion and/or substitution and/or deletion of a DNA segment comprising a gapA gene of a host organism in some aspects , the methods taught herein comprise constructing an oligonucleotide of interest (i.e., a gapA segment) that can be incorporated into the genome of a host organism in some embodiments , the gapA DNA segment of the disclosure can be obtained via any method known in the art, including replication or cleavage from a known template, mutation, or DNA synthesis in some embodiments , the disclosure relates to commercially available gene synthesis products for generating DNA sequences (e.g., GeneArt^TM、GeneMaker^TM、GenScript^TM、Anagen^TM、Blue Heron^TM、Entelechon^TMKino corporation (Genosys, Inc.) or Qiagen^TM) And (4) compatibility.

In embodiments, the gapA DNA segment is designed to incorporate a glucose gapA DNA segment into a selected DNA region of the host organism (e.g., with added useful GAPDH activity).

In some examples, the gapA gene used in the methods of the invention can be fragmented into oligonucleotides using any enzymatic or chemical synthesis method known in the art, oligonucleotides can be synthesized on solid supports such as Controlled Pore Glass (CPG), polystyrene beads, or membranes composed of thermoplastic polymers that can contain CPG, oligonucleotides can also be synthesized on arrays, on parallel microscale using microfluidics (field (Tian), et al, "molecular biosystems" (mol. biosystems.), 5, 714-722(2009)), or known techniques that provide a combination of both (see Jacobson, et al, U.S. patent application No. 2011/0172127).

Synthesis on arrays or by microfluidics is advantageous over conventional solid support synthesis in that costs are reduced by reducing the use of reagents. The scale required for gene synthesis is low and therefore the scale of oligonucleotide products synthesized from arrays or by microfluidics is acceptable. However, the quality of the synthesized oligonucleotides is lower than when synthesized using solid supports (see Tian (Tian) (Tian), see below; see also Staehler et al, U.S. patent application No. 2010/0216648).

Since the first description of the conventional four-step phosphoramidite chemistry in the eighties of the twentieth century, considerable progress has been made (see, e.g., Sietzchal (Sierzchala) et al, J.Am.chem.Soc.). 125,13427 13441(2003), which uses peroxy anions to deprotect, Hayakawa et al, United states patent No. 6,040,439, which concerns alternative protecting groups, Azalevian (Azhayev) et al, Tetrahedron (Tetrahedron) 57,4977 and 4986(2001), which concerns universal vectors; Kozlova et al, Nucleosides, Nucleotides and Nucleic Acids (Nucleotides, and Nucleic Acids (Nucleic Acids, and Nucleic Acids) (2005, 24(5-7),1037 (1041), which concerns the synthesis of large pore Nucleic Acids (CPmHAO) by using modified oligonucleotides (CPHAO) et al, 18,3813-3821(1990) which relates to improved derivatization).

Regardless of the type of synthesis, the resulting oligonucleotides can then form smaller building blocks for the longer polynucleotides (i.e., the gapA gene) in examples, the smaller oligonucleotides can be linked at using protocols known in the art, such as Polymerase Chain Assembly (PCA), Ligase Chain Reaction (LCR), and thermodynamic equilibrium inside-out synthesis (TBIO) (see zaar (Czar) et al, Trends in Biotechnology, 27, 63-71 (2009)).

Another methods of synthesizing larger double-stranded DNA fragments is by top-strand PCR (TSP) combining smaller oligonucleotides.

In the methods of TSP, the smaller sets of oligonucleotides that are to be combined to form the desired full-length product have a base length of between 40-200 and overlap one another by at least about 15-20 bases_m) The th and the last oligonucleotide building blocks in the assembly should contain binding sites for forward and reverse amplification primers, in examples, the end sequences of the th and the last oligonucleotides contain complementary identical sequences to allow the use of universal primers.

Production of a library comprising nicotinamide nucleotide transhydrogenase Gene

In some embodiments , the disclosure teaches insertion and/or substitution and/or deletion of a DNA segment of a host organism comprising a nicotinamide nucleotide transhydrogenase gene in some , the methods taught herein include construction of an oligonucleotide of interest (i.e., a nicotinamide nucleotide transhydrogenase segment) that can be incorporated into the genome of the host organism in some embodiments , the nicotinamide nucleotide transhydrogenase DNA segment of the disclosure can be obtained via any method known in the art, including replication or cleavage from known templates, mutation, or DNA synthesis in some embodiments , the disclosure produces a DNA sequence from commercially available gene synthesis for productionProducts (e.g. GeneArt)^TM、GeneMaker^TM、GenScript^TM、Anagen^TM、Blue Heron^TM、Entelechon^TMKino corporation or Qiagen^TM) And (4) compatibility.

In some embodiments, the nicotinamide nucleotide transhydrogenase DNA segment is designed to incorporate the nicotinamide nucleotide transhydrogenase DNA segment into a selected DNA region of the host organism (e.g., to add useful transhydrogenase activity).

In examples, the nicotinamide nucleotide transhydrogenase gene used in the methods of the invention can be fragmented and synthesized into oligonucleotides using any enzymatic or chemical synthesis method known in the art.

Since the first description of the traditional four-step phosphoramidite chemistry in the eighties of the twentieth century, considerable progress has been made (see, e.g., Ser. Chaler et al, J. Am. chem. Soc., 125,13427-13441(2003), which uses peroxy anions to deprotect, Alexander et al, U.S. Pat. No. 6,040,439, which concerns alternative protecting groups; ApogeWis. et al, tetrahedron 57,4977-4986(2001), which concerns universal vectors; Couzlovir et al, nucleosides, nucleotides and nucleic acids, 24(5-7),1037-1041(2005), which concerns the synthesis of longer oligonucleotides by using macroporous CPGs, and Hadan et al, nucleic acid research, 18,3813-3821(1990), which concerns improved derivatizations).

Regardless of the type of synthesis, the resulting oligonucleotide can then form smaller building blocks for longer polynucleotides (i.e., nicotinamide nucleotide transhydrogenase gene). in examples, smaller oligonucleotides can be ligated at using protocols known in the art, such as Polymerase Chain Assembly (PCA), Ligase Chain Reaction (LCR), and thermodynamic equilibrium inside-out synthesis (TBIO).

Another methods of synthesizing larger double-stranded DNA fragments are by top-strand PCR (TSP) combining smaller oligonucleotides in the methods of TSP, where the smaller sets of oligonucleotides to be combined to form the desired full-length product have a base length of between 40-200 and overlap each other by at least about 15-20 bases_m) The th and the last oligonucleotide building blocks in the assembly should contain binding sites for forward and reverse amplification primers, in examples, the end sequences of the th and the last oligonucleotides contain complementary identical sequences to allow the use of universal primers.

Modulation of pyruvate carboxylase

The pyruvate carboxylase can be expressed in a host cell from an expression vector comprising a nucleic acid fragment comprising a nucleotide sequence encoding the pyruvate carboxylase. Alternatively, the nucleic acid fragment comprising the nucleotide sequence encoding pyruvate carboxylase may be integrated into the chromosome of the host. Nucleic acid sequences, whether heterologous or endogenous to the host cell, can be introduced into the bacterial chromosome using, for example, homologous recombination. First, a gene of interest and a gene encoding a drug resistance marker are inserted into a cell containing the gene of interest to be insertedThe gene and the drug resistance marker can be introduced into the bacterium via transformation, either as a linearized DNA piece made from any cloning vector or as part of a proprietary recombinant suicide vector that cannot replicate in a bacterial host^-The host is used to increase the frequency of obtaining the desired recombinant. Clones were subsequently verified using PCR and primers that amplify DNA across the insert region. The PCR products from non-recombinant clones are small in size and contain only the chromosomal region where the insertion event will occur, whereas the PCR products from recombinant clones are large in size and contain this chromosomal region plus the inserted gene and drug resistance.

In preferred embodiments, a host cell, preferably E.coli, C.glutamicum, B.flavum, or B.lactofermentum, is transformed with a nucleic acid fragment comprising a pyruvate carboxylase gene, preferably a gene isolated from Rhizobium phaseoli (R.etli) or P.fluorescens (P.fluoroscens), more preferably a pyc gene from Rhizobium phaseoli, such that the gene is transcribed and expressed in the host cell to increase the production of oxaloacetate, and therefore the production of downstream metabolites of interest, relative to a comparable wild-type cell.

Metabolically engineered cells of the present disclosure overexpress pyruvate carboxylase, in other words, metabolically engineered cells express pyruvate carboxylase at levels higher than pyruvate carboxylase levels expressed in comparable wild-type cells this comparison can be performed in many ways by those skilled in the art and under comparable growth conditions for example, pyruvate carboxylase activity can be quantified and compared using the methods of pehn (Payne) and Morris (Morris) (journal of general microbiology (j. gen. microbiol.), 59,97-101 (1969): a metabolically engineered cell overexpressing pyruvate carboxylase in this analysis will yield greater activity than a wild-type cell additionally or alternatively, the amount of pyruvate carboxylase can be quantified and compared by preparing a protein extract from a cell, subjecting it to SDS-PAGE, transferring it to western blotting, then detecting the pyruvate carboxylase protein using a detection kit, commercially available from, for example, Pierce Chemical Company (Pierce Company) (polnhui, inc. for purposes), and for detection of pyruvate carboxylase in non-western blotting, Mo, and the protein may be detected using a detection kit.

Generation of libraries comprising gdh, asd, dapB and/or ddh genes

In embodiments, the disclosure teaches the insertion and/or substitution and/or deletion of a DNA segment comprising a gdh, asd, dapB, and/or ddh gene of a host organism in aspects, the methods taught herein include constructing an oligonucleotide of interest (i.e., a gdh, asd, dapB, and/or ddh segment) that can be incorporated into the genome of a host organism in embodiments, the gdh, asd, dapB, and/or ddh DNA segment of the disclosure can be obtained via any method known in the art, including replication or cleavage from a known template, mutation, or DNA synthesis^TM、GeneMaker^TM、GenScript^TM、Anagen^TM、BlueHeron^TM、Entelechon^TMKino corporation or Qiagen^TM) And (4) compatibility.

In embodiments, the gdh, asd, dapB, and/or ddh DNA segments are designed to incorporate or more glucose gdh, asd, dapB, and/or ddh DNA segments into a selected DNA region of the host organism (e.g., addition of or more useful glutamate dehydrogenase, aspartate semialdehyde dehydrogenase, dihydropicolinate reductase, and/or meso-diaminopimelate dehydrogenase activities). in certain embodiments, the selected DNA region is a neutral integration site.

In some examples, the gdh, asd, dapB, and/or ddh genes used in the methods of the invention can be fragmented and synthesized into oligonucleotides using any enzymatic or chemical synthesis method known in the art.

Regardless of the type of synthesis, the resulting oligonucleotides can then form smaller building blocks for longer polynucleotides (i.e., gdh, asd, dapB, and/or ddh genes). in some embodiments of , the smaller oligonucleotides can be ligated at using protocols known in the art, such as Polymerase Chain Assembly (PCA), Ligase Chain Reaction (LCR), and thermodynamic equilibrium inside-out synthesis (TBIO).

Production of a library comprising Threonine Aldolase (TA) genes

In some embodiments the disclosure teaches insertion and/or substitution and/or deletion of a DNA segment of a host organism comprising a TA gene in some aspects the methods taught herein include construction of an oligonucleotide of interest (i.e., a TA segment) that can be incorporated into the genome of a host organism in some embodiments the TA DNA segment of the disclosure can be obtained via any method known in the art including replication or cleavage from a known template, mutation or DNA synthesis in some embodiments the disclosure is related to commercially available gene synthesis products for generating DNA sequences (e.g., GeneArt^TM、GeneMaker^TM、GenScript^TM、Anagen^TM、Blue Heron^TM、Entelechon^TMKino corporation or Qiagen^TM) And (4) compatibility.

In embodiments, the TA DNA segment is designed to incorporate or more TA DNA segments into a selected DNA region of the host organism (e.g., with added threonine aldolase activity.) in certain embodiments, the selected DNA region is a neutral integration site.

In some examples, the TA genes used in the methods of the invention can be fragmented into oligonucleotides using any enzymatic or chemical synthesis method known in the art.

Regardless of the type of synthesis, the resulting oligonucleotide can then form smaller building blocks for longer polynucleotides (i.e., the TA gene). in some examples, the smaller oligonucleotides can be ligated at using protocols known in the art, such as Polymerase Chain Assembly (PCA), Ligase Chain Reaction (LCR), and thermodynamic equilibrium inside-out synthesis (TBIO).

Generation of libraries comprising the pyc Gene

In some embodiments , the disclosure teaches insertion and/or substitution and/or deletion of a DNA segment of a host organism comprising a pyc gene in some aspects , the methods taught herein include construction of an oligonucleotide of interest (i.e., a pyc segment) that can be incorporated into the genome of a host organism in some aspects , the pyc DNA segment of the disclosure can be obtained via any method known in the art, including replication or cleavage from a known template, mutation, or DNA synthesis in some embodiments , the disclosure is related to commercially available gene synthesis products for generating DNA sequences (e.g., GeneArt^TM、GeneMaker^TM、GenScript^TM、Anagen^TM、Blue Heron^TM、Entelechon^TMKino corporation or Qiagen^TM) And (4) compatibility.

In some embodiments, the pyc DNA segment is designed to incorporate or more glucose pyc DNA segments into a selected DNA region of the host organism (e.g., to add or more useful genes having pyruvate carboxylase activity.) in some embodiments, the selected DNA region is a neutral integration site.

In examples, the pyc gene used in the methods of the invention can be fragmented into oligonucleotides using any enzymatic or chemical synthesis method known in the art.

Regardless of the type of synthesis, the resulting oligonucleotide can then form smaller building blocks for longer polynucleotides (i.e., pyc genes). in some examples, the smaller oligonucleotides can be ligated at using protocols known in the art, such as Polymerase Chain Assembly (PCA), Ligase Chain Reaction (LCR), and thermodynamic equilibrium inside-out synthesis (TBIO).

Assembling/cloning plasmid

In examples, the disclosure teaches methods for constructing a vector capable of inserting a desired gapA gene and/or nicotinamide nucleotide transhydrogenase and/or gdh, asd, dapB and/or ddh gene and/or TA gene and/or pyc gene DNA segment into the genome of a host organism in examples, the disclosure teaches methods for cloning a vector comprising inserted DNA (e.g., gapA gene and/or nicotinamide nucleotide transhydrogenase and/or gdh, asd, dapB and/or ddh gene and/or TA gene and/or pyc gene), homology arms, and at least selectable markers (see FIG. 6).

In the embodiments, the disclosure is compatible with any vector suitable for transformation into a host organism, in the embodiments, the disclosure teaches the use of a shuttle vector that is compatible with the host cell in the embodiments, the shuttle vector used in the methods provided herein is a shuttle vector that is compatible with E.coli and/or Corynebacterium host cellsA shuttle vector used in the methods provided herein may comprise a marker for selection and/or counter-selection as described herein.A marker may be any marker known in the art and/or provided herein.A shuttle vector may further comprise any regulatory sequences and/or sequences suitable for assembly of the shuttle vector as known in the art.A shuttle vector may further comprise any origin of replication required for propagation in a host cell as provided herein (e.g., E.coli or C.glutamicum). A regulatory sequence may be any regulatory sequence known in the art or provided herein, e.g., a promoter, initiation, termination, signal, secretion and/or termination sequences for the genetic machinery of the host cell

A carrier).

In examples, the Assembly/Cloning methods of the present disclosure may employ at least of the following Assembly strategies I) type II conventional clones, II) type II S mediated or "gold (Golden Gate)" clones (see, e.g., Engler (Engler, C.), CDZ (R.Kandzia) and Mary John (S.Marillonnet), 2008, " pot step exact Cloning method with high throughput capacity (A One pot, One step, precision Cloning method with high throughput approach)," public book One (PLos One) 3: E3647; Kotna, I., and Long well (T.Nagai), 2008, "high throughput single-tube recombination of crude PCR products using DNA inhibitors and gold type restriction enzymes (A-high throughput PCR) and DNA Cloning, DNA design, PCR products by PCR technology (PCR) and DNA Cloning engineering, E.7. Cloning engineering, DNA Cloning, E.7. coli, DNA Cloning, engineering, DNA Cloning, and Cloning, and Cloning, and CloningScience library integrated book [ 6: e19722) ]; iii)

Recombining; iv)Cloning, exonuclease-mediated assembly (Aslandis and De Jong, 1990, "Ligation-independent cloning of PCR products (LIC-PCR))", "nucleic acid Research (nucleic acids Research, Vol. 18, No. 206069); v) homologous recombination; vi) non-homologous end joining; or a combination thereof. A modular IIS-based assembly strategy is disclosed in PCT publication WO 2011/154147, the disclosure of which is incorporated herein by reference.

In examples, the present disclosure teaches cloning vectors with at least selectable markers various selectable marker genes are known in the art, which typically encode antibiotic resistance functions to select under selective pressure in prokaryotic cells (e.g. for ampicillin (ampicilin), kanamycin (kanamycin), tetracycline (tetracycline), chloramphenicol (chlorempheycol), hygromycin (zeocin), spectinomycin/streptomycin) or eukaryotic cells (e.g. geneticin (geneticin), neomycin (neomycin), hygromycin (hygromycin), puromycin (puromycin), blasticidin (blasticidin), other marker systems allow for the screening and identification of desired or undesired cells, such as the blue/white system used in bacteria for the development of X-gal or fluorescent homogenesis reporters (e.g. in green transduced cells), the presence of a selectable marker gene, or a selectable marker gene, which typically is used in Bacterial screening systems for the development of a selectable marker genes for the expression of X-gal or fluorescent homogentisin cells, the "select marker gene system" which is used in Bacterial production of a marker genes, which is commonly referred to the development of the "marker genes for the development of a" and negative expression of the selectable marker genes of the host genes, "the selectable marker genes" usually used in Bacterial infection "include the development of prokaryotic gene, the" 40152 ", the production of" 1, the expression of the "1, the" gene, the "selection system, the" and the "gene expression of the" gene, the "1, the expression of the" and the "of the" gene, the "of.

In some embodiments of , the vector in which the DNA segment of interest is cloned comprises a promoter the promoter polynucleotide can be used to overexpress or underexpress gapA and/or nicotinamide nucleotide transhydrogenase and/or gdh, asd, dapB and/or ddh and/or TA and/or pyc in the host microorganism.

In examples, each strain produced that contains a heterologous gapA gene and/or nicotinamide nucleotide transhydrogenase gene and/or or more of the gdh, asd, dapB, and ddh genes and/or the TA gene is cultured and analyzed according to or multiple criteria of the present disclosure (e.g., the productivity of the biomolecule or product of interest). data from each host strain analyzed is associated with and recorded for future use in a specific gapA gene or nicotinamide nucleotide transhydrogenase gene or gdh, asd, dapB, and/or ddh gene and/or the TA gene and/or pyc gene or gapA/nicotinamide nucleotide transhydrogenase/gdh, asd, dapB, and/or ddh gene/TA/pyc combination.

In examples, the strains within the diversity pool are determined with reference to a "reference strain". In examples, the reference strain is a wild-type strain.

The concept of this is to be noted is the difference between the parental strain and the reference strain the parental strain is the background for the current rounds of genomic engineering the reference strain is the control strain used to facilitate comparisons in each plate, especially between plates, and is typically the "base strain" as mentioned above, but the more descriptive term is the "reference strain" since the base strain (e.g. the wild-type or industrial strain used to benchmark the overall performance) is not the "base" in the sense that it is the target of mutagenesis in the strain improvement of the designated rounds.

In summary, the base/reference strains are typically used to benchmark the performance of the constructed strains, while the parental strains are used to benchmark the performance of specific genetic changes in the context of the relevant genes.

In examples, the disclosure teaches the use of vectors for cloning gapA genes and/or nicotinamide nucleotide transhydrogenase and/or gdh, asd, dapB and/or ddh genes and/or TA genes and/or pyc genes under start and/or stop codon variants such that the cloned genes utilize the start and/or stop codon variants. for example, typical stop codons for Saccharomyces cerevisiae and mammals are UAA and UGA. typical stop codons for monocots are UGA, respectively, whereas insects and E.coli usually use UAA as stop codon (Dalphin et al (1996), nucleic acid research (Nucl. acids Res.)24: 216-218).

Codon optimization

In examples, disclosed methods are provided that include codon optimization of or more genes expressed by a host organism, methods for optimizing codons to improve expression in a variety of hosts are known in the art and described in the literature (see U.S. patent application publication No. 2007/0292918, which is incorporated herein by reference in its entirety.) optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host can be prepared (see also Murray et al (1989), nucleic acid research (Nucl. acids Res.) 17:477-508), for example, to increase translation rates or to produce recombinant RNA transcripts with desirable properties, such as longer half-lives than transcripts produced from non-optimized sequences.

In examples, the gapA/nicotinamide nucleotide transhydrogenase/gdh, asd, dapB, and/or ddh gene/TA gene/pyc gene or polynucleotide provided herein comprises molecular codons optimized for translation in a host cell provided herein, e.g., Escherichia coli and/or Corynebacterium glutamicum the gene or polynucleotide may be an isolated, synthetic, or recombinant nucleic acid codon optimized gapA/nicotinamide nucleotide transhydrogenase/gdh, asd, dapB, and/or ddh/TA/pyc gene or polynucleotide provided herein may be selected from SEQ ID NOs 1-50, 67-74, 79-231, and 232 the codon optimized gapA/nicotinamide nucleotide transhydrogenase/gdh, asd, dapB, and/or ddh/TA/pyc gene or polynucleotide provided herein may use methods known in the art for producing codon optimized polynucleotides, e.g., Kinmitt Gene of Kinset (Genript)^TMGene design System or DNA2.0

Expression optimization techniques.

Thus, optimization can address any of the vast number of sequence features of any particular gene.As specific examples, rare codon-induced translational pauses can cause a reduction in protein expression.

Alternate translation initiation may include synthetic polynucleotide sequences that inadvertently contain a motif capable of acting as a Ribosome Binding Site (RBS). The sites may initiate translation of the truncated protein from internal sites within the gene. methods to reduce the likelihood of producing a truncated protein that may be difficult to remove during purification include excluding putative internal RBS sequences from optimized polynucleotide sequences.

Repeat-induced polymerase slippage refers to nucleotide sequence repeats that have been shown to cause DNA polymerase slippage or stalls, causing frame-shifting mutations.

Interference with secondary structure also results in reduced expression of heterologous proteins. Secondary structure can isolate the RBS sequence or start codon and has been associated with a reduction in protein expression. Stem-loop structures may also be associated with transcriptional pauses and attenuations. The optimized polynucleotide sequence may contain minimal secondary structure in the RBS of the nucleotide sequence and the coding region of the gene to achieve improved transcription and translation.

For example, the optimization procedure may begin with the identification of the desired amino acid sequence to be expressed by the host. Candidate polynucleotide or DNA sequences can be designed from the amino acid sequences. During design of the synthetic DNA sequence, the codon usage frequency can be compared to the codon usage of the host expression organism and rare host codons can be removed from the synthetic sequence. In addition, synthetic candidate DNA sequences may be modified to remove undesirable enzymatic restriction sites and to add or remove any desired signal sequences, linkers, or untranslated regions. Synthetic DNA sequences can be analyzed for the presence of secondary structures such as G/C repeats and stem-loop structures that may interfere with the translation process.

Transformation of host cells

In examples, the vectors of the disclosure may be introduced into host cells using any of techniques including transformation, transfection, transduction, viral infection, gene gun or Ti-mediated gene transfer specific Methods include calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation (Davis (L.), Dibner (M.), Batten (Battey, I.),1986 "Basic Methods in molecular Biology", other transformation Methods include, for example, lithium acetate transformation and electroporation, see, for example, Jetz (Gietz) et al, Nucleic acid research (Nucleic Acids Res.) 27:69-74(1992), Ito (Ito) et al, J.Bacterol. J.163: 163: 168(1983) and Methods in Guicke. cell engineering et al, J.Bacterol.63182 (1983) and Methods in Beijing et al, cell engineering Methods in Beijing et al, and Methods in Beijing et al, cell engineering Methods (199187).

In embodiments, the present disclosure teaches high throughput transformation of cells using a 96-well plate robotics platform and liquid handling machine known in the art.

In examples, the present disclosure teaches screening of transformed cells with or more selectable markers in such examples, cells transformed with a vector containing a kanamycin resistance marker (KanR) are plated on media containing an effective amount of kanamycin antibiotic.

Loop-out of selected sequence

In examples, the disclosure teaches methods for circularizing selected regions of DNA from a host organism as described in "medium Cellular Engineering by Genome Editing and Gene Silencing" 2014 (Bacterial Cellular Engineering and Gene Silencing "), in international journal of molecular science (int. j. mol. sci.)15(2), 2773. french 2793. in examples, the disclosure teaches that selection markers are circularized from positive transformants. circularization deletion techniques are known in the art and described in (tel (teal) et al, Excision of" Unstable Artificial Gene-Specific inverted repeat sequences "mediates traceless Gene Deletions in e coli (Excision of Specific Gene-Specific indirect repeat sequences mediated recombination in Escherichia coli) (expression of alternative of Specific genes-related sequences — discovery of selected regions in Escherichia coli) 1868, in a single-use homologous recombination technique as described in 368. examples, and methods for achieving this, such as the use of the homology-recombination methods mentioned in 3683.

First, an circularized vector is inserted into a selected region of interest within the genome of a host organism (e.g., by homologous recombination, CRISPR, or other gene editing techniques). in embodiments, single reciprocal homologous recombination is used between a circular plasmid or vector and the host cell genome to circularize the circular plasmid or vector, as depicted in fig. 6. the inserted vector can use sequence design that is a direct repeat of an existing or adjacently introduced host sequence, such that the direct repeat flanks a DNA region that is predetermined to circularize and delete. insertion, cells containing the circularized plasmid or vector can be counter-selected for deletion of the selected region (see, e.g., fig. 7; lack of resistance to the selection gene).

Host microorganism

Although the genome engineering methods provided herein are exemplified with industrial microbial cell cultures, they can be applied to any organism that can identify a desired trait in a population of genetic mutants.

Thus, as used herein, the term "microorganism" should be understood in the sense of breadth , which includes, but is not limited to, two prokaryotic domains, bacteria and archaea, as well as certain eukaryotic fungi and protists.

Suitable host cells include, but are not limited to, bacterial cells, algal cells, plant cells, fungal cells, insect cells and mammalian cells in exemplary embodiments, suitable host cells include E.coli (e.g., Shuffle)^TMCompetent E.coli, obtained from New England BioLabs (New England BioLabs, Ipswich, Mass.) by Itverwich, Mass.).

Other suitable host organisms for the present disclosure include microorganisms of the genus Corynebacterium in the examples, preferred Corynebacterium strains/species include Corynebacterium valium (C. efficiens), the deposit mode strain is DSM44549, Corynebacterium glutamicum, the deposit mode strain is ATCC13032, and Corynebacterium ammoniagenes (C. ammoniagenes), the deposit mode strain is ATCC 6871. in the examples, the preferred host of the present disclosure is Corynebacterium glutamicum. in the examples, the present disclosure teaches host cells of the genus Shigella (Shigella), including Shigella flexneri, Shigella dysenteriae (Shigella dysenteriae), Shigella boydii (Shigella boydii), and Shigella sonnei.

Suitable host strains of the genus Corynebacterium (in particular, Corynebacterium glutamicum species) are in particular the known wild-type strains: corynebacterium glutamicum ATCC13032, Corynebacterium acetoacidophilum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium molasses ATCC17965, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869, and Brevibacterium lactofermentum ATCC 14020; and L-amino acid-producing mutants or strains prepared therefrom, such as L-lysine-producing strains: corynebacterium glutamicum FERM-P1709, Brevibacterium flavum FERM-P1708, Brevibacterium lactofermentum FERM-P1712, Corynebacterium glutamicum FERM-P6463, Corynebacterium glutamicum FERM-P6464, Corynebacterium glutamicum DM58-1, Corynebacterium glutamicum DG52-5, Corynebacterium glutamicum DSM5714 and Corynebacterium glutamicum DSM 12866.

representatives of species Corynebacterium glutamicum are also known in the art as Corynebacterium thermoaminogenes, e.g.strain FERM BP-1539.

In some embodiments , the host cells of the present disclosure are eukaryotic cells suitable eukaryotic host cells include, but are not limited to, fungal cells, algal cells, insect cells, animal cells, and plant cells suitable fungal host cells include, but are not limited to, ascomycetes (ascomycetes), basidiomycetes (Basidiomycota), deuteromycetes (Deuteromycota), zygomycetes (Zygomycota), imperfect Fungi (fungitosis), certain preferred fungal host cells include yeast cells and filamentous fungal cells suitable filamentous fungal host cells include, for example, any filamentous form of Fungi (eucatina) and oomycete (Oomycota) subplanta (see, for example, hoxos (haksworth), et al, the berk, berbysche and bismuty's Dictionary, the british, 8, the International version of the strain, the university of kokushiki, enchi, encystic polysaccharide, encystein, and other forms of Fungi, which are incorporated by way of the publication in other forms of Fungi, including cellulose, cellulose.

In certain illustrative but non-limiting embodiments, the filamentous fungal host cell may be a cell of the following species: the genus gossypium (Achlya), Acremonium (Acremonium), Aspergillus (Aspergillus), Aureobasidium (Aureobasidium), Cladosporium (Bjerkandra), Ceriporiopsis (Ceriporiopsis), Cephalosporium (Cephalanopsis), Chrysosporium (Chrysosporium), Cochlosporium (Cochliobolus), Corynascus (Corynebacterium), Sclerotium (Cryptosporium), Cryptosporidium (Cryptococcus), Coprinus (Coprinus), Coriolus (Coriolus), Dibotrya (Diplodia), Endothia (Endothia), Fusarium (Fusarium), Gibberella (Gibberella), Gliocladium (Gliocladium), Hypocrea (Hypocrea), myceliophyces (Rhizophora), Rhizophora (Rhizoctoniella), Rhizophora (Rhizophora), Rhizopus (Rhizopus), Rhizopus (Rhizopus, Schizophyllum (Schizophyllum), zygospora (Scytalidium), sporothrix (Sporotrichum), Talaromyces (Talaromyces), Thermoascus (Thermoascus), Thielavia (Thielavia), trametes (Tramates), torturomyces (Tolypocladium), Trichoderma (Trichoderma), Verticillium (Verticillium), podophyllum (Volvariella), or a sexual or non-sexual form thereof, as well as synonyms or taxonomic equivalents thereof.

Suitable yeast host cells include, but are not limited to, Candida (Candida), Hansenula (Hansenula), Saccharomyces (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces), Pichia (Pichia), Kluyveromyces (Kluyveromyces), and Yarrowia (Yarrowia). in , the yeast cells are Hansenula polymorpha (Hansenula polymorpha), Saccharomyces cerevisiae (Saccharomyces cerevisiae), Saccharomyces carlsbergensis, Saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces cerevisiae (Saccharomyces nonbyensis), Saccharomyces Kluyveromyces (Saccharomyces kluyveryveri), Schizosaccharomyces pombe (Schizosaccharomyces pombe), Pichia pastoris (Pichia pastoris), Pichia pastoris (Pichia pastoris) or Pichia pastoris).

In certain embodiments, the host cell is an alga, such as Chlamydomonas (e.g., Chlamydomonas reinhardtii (c.reinhardtii)) and schiemium (Phormidium) (schinophyta ATCC 29409).

In other examples, the host cell is a prokaryotic cell suitable prokaryotic cells include gram-positive, gram-negative and gram-variant bacterial cells host cells may be, but are not limited to, Agrobacterium, Alicyclobacillus, Candida, Neobaena, Echizomia, Acinetobacter, Acidothermus, Arthrobacter, Azotobacter, Bacillus, Bifidobacterium, Brevibacterium, Butyrosporum, Butyrum, Buchnera, Micrococcus, Thermomyces, Pseudomonas, Lactobacillus, Escherichia, Lactobacillus, Escherichia, Lactobacillus, Escherichia, and Bacillus, and Escherichia, or Escherichia, or Escherichia, Pseudomonas sp.

In some embodiments , the host strain is a bacterial host strain in some embodiments , the bacterial host strain is an industrial strain.

In examples , the bacterial host cell is agrobacterium species (e.g., actinobacillus agrobacterium (a.radiobacter), agrobacterium rhizogenes (a.rhizogenes), agrobacterium suspensor (a.rubi)), arthrobacter species (e.g., arthrobacter chrysogenum (a.aureococcus), arthrobacter citrobacter (a.citrobacter), arthrobacter globiformis (a.globoformis), arthrobacter schizophyllum (a.hydrocarbutamiculus), arthrobacter myosori (a.mycorrhiza), arthrobacter nicotiana (a.nicotianae), arthrobacter paraffineus (a.paraffineus, agrobacterium roseus), arthrobacter thiocola (a.sualuta), bacillus coagulans species (a.ureus), bacillus sp.yuensis (E), bacillus sp.streptomyces sp), bacillus sp.bacillus sp (e.endophyticus (b.endophyticus) (E), bacillus subtilis sp), bacillus subtilis c, bacillus subtilis sp (e.endophyticus (E), bacillus subtilis sp (e.endophyticus) (E), bacillus subtilis sp), bacillus subtilis sp.endophyticus (e.c), bacillus subtilis sp.endophyticus (e.bacillus subtilis), bacillus subtilis sp), bacillus subtilis sp.bacillus subtilis), bacillus subtilis sp (e.bacillus subtilis), bacillus subtilis, bacillus coli (e.bacillus subtilis), bacillus subtilis sp (e.bacillus subtilis), bacillus subtilis sp.bacillus subtilis, bacillus subtilis), bacillus subtilis sp.bacillus subtilis, bacillus coli (e.bacillus coli (e.c, bacillus coli (e.sp), bacillus subtilis).

In various embodiments, strains (including prokaryotic and eukaryotic strains) that can be used in the practice of the present disclosure are readily available to the public from a variety of Culture collections, such as the American Type Culture Collection (ATCC), the German Collection of microorganisms (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, DSM), the Netherlands Collection of microorganisms (CBS), and the American Collection of Agricultural research cultures (Agricuic research service Collection), the Northern regional research Center (NRRL)).

In examples, the disclosed methods are also applicable to multicellular organisms, for example, the platform may be used to improve the performance of crops organisms, organisms may comprise plants such as the sub-order Gramineae (Gramineae), the sub-family non-proceideae (Fetucoideae), the sub-family considerably (Poacoideae), the genus Agrostis (Agrostis), the genus ladder (philum), the genus podophyllum (Dactylis), the genus sorghum (sorglum), the genus Setaria (Setaria), the genus Zea (Zea), the genus rice (Oryza), the genus Triticum (trizacum), the genus Secale (Secale), the genus Avena (Avena), the genus Hordeum (Hordeum), the genus Saccharum (Saccharum), the genus praecox (Poa), the genus fescue (fescuora), the genus aspora (stephania), the genus stephanium (cynomolgus), the genus myoaeae (Coix), the genus alisma (maize), the family Zea, the family allium, the family Zea, the family allium, the family Zea, the family allium, the species may include, the species allium, the species of Zea, the species sinaethiopicea, the species of the genus, the species of arabidophyllum, the genus, the.

Escherichia coli host cell

As mentioned above, e.coli host cells may be used in embodiments of the disclosure.

Suitable host strains of E.coli species include, for example, Enterotoxigenic E.coli (ETEC), Enteropathogenic E.coli (EPEC), Enteroinvasive E.coli (EIEC), Enterohemorrhagic E.coli (EHEC), Uropathogenic E.coli (UPEC), Verotoxin-producing E.coli (Verotoxin-producing E.coli), E.coli O157: H7, E.coli O104: H4, E.coli O121, E.coli O104: H21, E.coli K1, and E.coli NC101. in embodiments, the present disclosure teaches the genomic engineering of E.coli K12, E.coli B and E.coli C.

In examples, the disclosure teaches genome engineering of strains of E.coli, NCTC 12757, NCTC 12779, NCTC 12790, NCTC 12796, NCTC 12811, ATCC 11229, ATCC 25922, ATCC 8739, DSM 30083, BC 5849, BC 8265, BC 8267, BC 8268, BC 8270, BC 8271, BC 8272, BC 8273, BC8276, BC 8277, BC 8278, BC 8279, BC 8312, BC 8317, BC 8319, BC 8320, BC 8321, BC 8322, BC 8326, BC 27, BC 8331, BC 8335, BC 8338, BC 8341, BC 8344, BC 8345, BC 8346, BC8347, BC 8348, BC 8863 and 8864.

In some embodiments, the disclosure teaches Vibrotoxin pathogenic E.coli (VTEC), e.g., strains BC4734 (O: H), BC 4735(O157: H-), BC 4736, BC 4737(n.d.), BC 4738(O157: H), BC 4945 (O: H-), BC 4946(O157: H), BC 4947(O111: H-), BC 4948(O157: H), BC 4949 (O), BC5579(O157: H), BC 5580(O157: H), BC 5582 (O: H), BC 5643 (O: H), BC 44(O128), BC 45 (O: H-), BC 46 (O: H-), BC 5647(O101: H), BC 5648(O103: H), BC 5850 (O: H), BC 5851 (O: H-), BC 5852 (O: 78H), BC 7854 (7854: 7854, BC 157) or BC 7854 (78H-7854, BC 157), BC 78H-O-7854, BC 78H-7854, BC 157, BC 78H-O-78H-7854, BC 157, BC 78H, BC 157, BC 7854, BC 157, BC 78H-O-78H, BC 7854, BC 78H-78H, BC 7846, BC 78H, BC 7854, BC 78H, BC 157, BC 78H, BC 5854, BC 78H, BC 157, BC 78H, BC 7854, BC 78H, BC 54, BC 78H, BC 54, BC 157, BC 78H, BC 54, BC 78H, BC 54, BC 78H, BC 54, BC 157, BC 78H, BC 54, BC 78H, BC 54, BC 78H, BC 54, BC.

In some embodiments, the disclosure teaches enteroinvasive E.coli (EIEC), such as strains BC 8246(O152: K-: H-), BC 8247(O124: K (72): H3), BC 8248(O124), BC 8249(O112), BC 8250(O136: K (78): H-), BC 8251(O124: H-), BC 8252(O144: K-: H-), BC 8253(O143: K: H-), BC 8254(O143), BC 8255(O112), BC 8256(O28a. e), BC 8257(O124: H-), BC 8258(O143), BC 8259(O167: K-: H5), BC 8260(O128a. c.: H35), BC 8261(O164), BC 8262(O164: K-: H-), BC 82164 (O164: H-), BC 8263 (O) and BC 8264).

In embodiments, the disclosure teaches enterotoxigenic E.coli (ETEC), such as strains BC 5581(O78: H11), BC 5583(O2: K1), BC 8221(O118), BC 8222(O148: H-), BC 8223(O111), BC 8224(O110: H-), BC 8225(O148), BC 8226(O118), BC 8227(O25: H42), BC 8229(O6), BC 8231(O153: H45), BC 8232(O9), BC 8233(O148), BC 8234(O128), BC 8235(O118), BC 8237(O111), BC 8238(O110: H17), BC 8240(O148), BC 8241(O6H16), BC 8243(O153), BC 8244(O15: H-) (O20), BC 8269 (O125153: 8338), BC 8234 (O8338: H8348), BC 8234: 8348, BC 8234 (O9638) and BC 8219 (O8348).

In embodiments, the disclosure teaches enteropathogen escherichia coli (EPEC), for example strains BC 7567(O86), BC 7568(O128), BC 7571(O114), BC 7572(O119), BC 7573(O125), BC 7574(O124), BC 7576(O127a), BC 7577(O126), BC 7578(O142), BC 7579(O26), BC 7580(OK26), BC 7581(O142), BC 7582(O55), BC 7583(O158), BC 7584(O-), BC 7585(O-), BC 7586(O-), BC8330, BC 8550(O26), BC 8551(O55), BC 8552(O158), BC 8553(O26), 8554(O158), 8555 (O27), 8556(O128), 8557(OK 29), 8558 (O8690), 858690 (O86158), 858690 (O8670), 858690 (O8670), 8570 (O8690), 8570, 8520, 8570, O162, 8570, O162, O160, O162, O160, O162, O.

Cell fermentation and culture

In some embodiments , the disclosure teaches culturing in an inducible medium for activating a promoter in some embodiments , the disclosure teaches having a selective agent, including a selective agent for transformants (e.g., an antibiotic) or a medium that selects an organism suitable for growth under inhibitory conditions (e.g., high ethanol conditions), in some embodiments , the disclosure teaches growing a cell culture in a medium optimized for cell growth.

The biomolecules or products of interest produced by the methods provided herein can be any commercial product for glucose production.in cases, the biomolecules or products of interest are small molecules, amino acids, organic acids, or alcohols.

Culture conditions (e.g., temperature, pH, etc.) are those suitable for use In conjunction with host Cells selected for Expression, and are readily apparent to those skilled In The art, as mentioned, many references are available for culturing and producing many Cells, including Cells of bacterial, Plant, Animal (including Mammalian) and archaebacterial origin, see, for example, Subruke (Sambrook), Osubel (Ausubel) (all references) and Berger (Berger), Molecular Cloning technical Guide (Guide to Molecular Cloning technologies) (see, for example, Cell Culture, see, for example, The In vitro Culture of Cells of microorganisms, Inc. (see, The catalog of Cell Culture, Inc. (see, Inc.) (see, Inc., of Cell Culture of Animal Cells, Inc., see, Inc. of Japan, Cell Culture of animals, Inc., Cell Culture, see, Cell Culture of animals, Inc., and Cell Culture of general Press, Inc. (cited In The same), and Cell Culture of animals, Cell Culture, see, Cell Culture, Cell, see, catalog, see, U.7, U.S.S.S.S.7, U.A.A.7, and D.A. (cited In The introduction, J.7, J.A.A.A.A.A. for example, and A. Culture of Animal Culture of Cell Culture, Inc., see, C. and C.7, Cell Culture, J.A.A.A.A.A. and C. and C.7, J.A. and C. 2, J.A. published by The Methods, D.A. and C. 2, D. and D.A. 2, D.A. published In The Methods of Cell Culture, D. and C. and D. 2, D.A. 2, D. and D.A. 2, D.A. and C. and D.A. 2, D.A. and D.A. for Cell Culture of Animal, D.A. and C. The same, e.A. and C. The same, D.A. The same, see, U.A. and C. and A. In The same, U.A. published, D.A. published, D. published, D.A. and C. and D.A. published In The same, D.A. and A. for Cell Culture of Cell, D. and D.A. and D. and C. about Cell, D.A. about Cell Culture of Cell, D. and D.A. about Cell Culture of Cell, D.A. and D.A. The same, K. and D.A. The same, D.A. and C. The same, K. and C. about.

The medium or fermentation medium to be used must meet the requirements of the respective strain in a suitable manner. A description of the media used for the various microorganisms is found in the handbook of Methods for general Bacteriology (Manual of Methods for general Bacteriology) of the American Society of Bacteriology (American Society for Bacteriology), Columbia, Wash, USA, 1981. The terms medium and fermentation medium are interchangeable.

In examples, the disclosure teaches that the produced microorganisms can be cultured continuously, as described for example in WO05/021772, or discontinuously in a batch process (batch culture) or fed batch repeat process, to produce the desired organic compounds an overview of the general properties of known culture methods is available in the textbook of Schimiel (Chmiel) (Biotech Advance 1: introduction in bioprocess technology (Biopro β technik.1: Einff ü hrung in diee Bioverfahrenshintechnik) (Gustaff Fisher publication (Gustav Fischer Verlag), Stuttgart (Stuttgart),1991)) or the textbook of Storhas (Storhas) (bioreactor and peripheral facilities (Bioretore and periphipe Einrichung) (Viinrichung), Braunworkutsung (Virentzigg), Braunworkutsung (Windes), 1994)).

In embodiments, the cells of the disclosure are grown under batch or continuous fermentation conditions. closed systems, where the composition of the medium is set at the beginning of the fermentation and no manual changes are made during the fermentation. variations of batch systems are fed-batch fermentations, which may also be used in the present invention.

Methods for regulating nutrients and growth factors in continuous fermentation processes and techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.

For example, a non-limiting list of carbon sources for the cultures of the present disclosure includes sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, molasses, sucrose-containing solutions from sugar beet or sugar cane processing, starch hydrolysates, and cellulose; oils and fats such as soybean oil, sunflower oil, peanut oil and coconut butter; fatty acids such as palmitic acid, stearic acid and linoleic acid; alcohols such as glycerol, methanol and ethanol; and organic acids such as acetic acid or lactic acid.

A non-limiting list of nitrogen sources for the cultures of the present disclosure includes organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal, and urea; or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources may be used individually or as a mixture.

A non-limiting list of possible phosphorus sources for the cultures of the present disclosure includes phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. The culture medium may additionally comprise salts required for growth, for example in the form of chlorides, or metal (e.g. sodium, potassium, magnesium, calcium and iron) sulfates, for example magnesium sulfate or iron sulfate. Finally, essential growth factors, such as amino acids, for example homoserine, and vitamins, for example thiamine, biotin or pantothenic acid, can be used in addition to the substances mentioned above.

In the cases, the pH of the culture can be controlled by any suitable means using any acid or base or buffer salt, including but not limited to sodium hydroxide, potassium hydroxide, ammonia or ammonia water, or an acidic compound such as phosphoric acid or sulfuric acid in the cases, the pH is typically adjusted to a value of 6.0 to 8.5, preferably 6.5 to 8.

In some of the embodiments, the cultures of the disclosure can include an anti-foaming agent, such as a fatty acid polyglycol ester in some of the embodiments, the cultures of the disclosure are conditioned by the addition of a suitable selective substance (e.g., an antibiotic) to stabilize the plasmids in the cultures.

In examples, the culture is carried out under aerobic conditions, in order to maintain these conditions, oxygen or an oxygen-containing gas mixture, for example air, is introduced into the culture, it is likewise possible to use a liquid rich in hydrogen peroxide, when appropriate, the fermentation is carried out under high pressure, for example at a high pressure of from 0.03 to 0.2MPa, the temperature of the culture is generally from 20 ℃ to 45 ℃ and preferably from 25 ℃ to 40 ℃, particularly preferably from 30 ℃ to 37 ℃.

In examples, the culture was performed under anaerobic conditions.

Screening

In embodiments, the present disclosure teaches high throughput initial screening in other embodiments, the present disclosure also teaches robust tank-based performance data validation.

In examples, high throughput screening methods are designed to predict the performance of strains in a bioreactor As previously described, culture conditions are selected that are appropriate for the organism and reflect bioreactor conditions individual colonies are picked and transferred to 96-well plates and incubated for an appropriate amount of time.

In examples, tank-based performance verification was used to confirm performance of isolated strains using high throughput screening.

Product recovery and quantitation

Methods of screening for the production of products of interest are known to those of skill in the art and are discussed throughout the specification.such methods can be used when screening strains of the present disclosure. the biomolecules or products of interest produced by the methods provided herein can be any commercial product of glucose production.in cases, the biomolecules or products of interest are amino acids, organic acids, or alcohols.

In embodiments, the disclosure teaches methods of improving strains designed to produce non-secreted intracellular products for example, the disclosure teaches methods of increasing the stability, yield, efficiency, or overall desirability of cell culture, thereby producing intracellular enzymes, oils, pharmaceuticals, or other valuable small molecules or peptides.

For example, in embodiments, the cells of the present disclosure may be harvested using centrifugation, filtration, sedimentation, or other methods the harvested cells are then disrupted using any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of a cell lysing agent, or other methods well known to those of skill in the art.

The resulting product of interest (e.g., a polypeptide) can be recovered/isolated and optionally purified using any of a variety of methods known in the art, for example, the product polypeptide can be isolated from the nutrient medium using conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, chromatography (e.g., ion exchange, affinity, hydrophobic interaction, chromatographic focusing, and size exclusion), or precipitation.

In addition to the above-mentioned references, various purification methods are well known in the art, including, for example, the purification methods described in: sandana (Sandana) (1997), "Bioseparation of Proteins", academic Press Ltd; bolago (Bollag) et al (1996), "Protein Methods" (2 nd edition, Willi-Rich, N.Y.; walk (Walker) (1996), "The Handbook of Protein Protocols Handbook", hama press, new jersey; harris (Harris) and Angal (1990), "protein purification applications: practical methods (Protein purification applications: A Practical Approach), Oxford IRL Press, Oxford, England; harris and anguel, protein purification method: practical methods, oxford IRL press, oxford, uk; scopus (Scopes) (1993), "protein purification: principles and practices (Protein Purification: Principles and Practice), 3 rd edition, Springgol Press, N.Y.; jensen (Janson) and lyden (Ryden) (1998), "protein purification: principles, High Resolution Methods and applications (Protein Purification: Principles, High Resolution Methods and applications), second edition, willi-VCH, new york; and walk (Walker) (1998), "Protein Protocols on CD-ROM" (Protein Protocols on CD-ROM), suma press, new jersey, all incorporated herein by reference.

In in some embodiments, the disclosure teaches methods of improving strains designed to produce secreted products, for example, the disclosure teaches methods of increasing the stability, yield, efficiency, or overall desirability of cell cultures, thereby producing valuable small molecules or peptides.

In examples, secreted or non-secreted products produced by the cells of the disclosure can be detected and/or purified using immunological methods in example methods, antibodies raised against product molecules (e.g., against insulin polypeptide or immunogenic fragments thereof) using conventional methods are immobilized on beads, mixed with cell culture medium under conditions that allow for endoglucanase binding, and precipitated.

In other related embodiments, immunochromatography as disclosed in U.S. Pat. No. 5,591,645, U.S. Pat. No. 4,855,240, U.S. Pat. No. 4,435,504, U.S. Pat. No. 4,980,298, and Severen Paek et al, "Development of immunochromatography rapid analysis at Step " (Development of Rapid on-Step Immunochromatographic assay), "Methods, 22, 53-60, 2000," is used, which is incorporated herein by reference for every , general immunochromatography detects a sample by using two antibodies. antibodies are present in a test solution, or at portions at the ends of a test strip made of a porous membrane in a substantially rectangular shape, where a test solution is dropped.

In examples, the screening methods of the present disclosure are based on photometric detection techniques (absorbance, fluorescence). for example, in examples, detection can be based on the presence of a fluorophore detection agent, such as GFP bound to an antibody.

In examples, the product recovery method allowed quantitative determination of the effect on the performance of each candidate gapA/transhydrogenase/gdh, asd, dapB and/or ddh gene combination in examples, the product recovery method allowed quantitative determination of the effect on the performance of each candidate gapA/transhydrogenase/gdh, asd, dapB and/or ddh gene combination, thereby allowing comparison of each combination and selection of the best combination.

A non-limiting list of products produced and recovered via the methods and organisms of the present disclosure is provided in table 2.

Table 2: products of the disclosure (referred to as products of interest, produced compounds, etc.)

One skilled in the art will recognize that the methods of the present disclosure are compatible with host cells that produce any desired biomolecule product of interest.

Selection criteria and goals

In some embodiments, the method comprises selecting a host cell that expresses a heterologous gapA/nicotinamide nucleotide transhydrogenase/threonine aldolase/pyruvate carboxylase/gdh, asd, dapB, and/or ddh, and selecting the host cell for expression in the host cell based on the selected host cell.

In other embodiments, the program goal may be to optimize the efficiency of synthesis of commercial strains in terms of end product yield per input (e.g., total amount of ethanol produced per pound of sucrose). in other embodiments, the program goal may be to optimize the rate of synthesis, as measured, for example, by the rate of batch completion or the yield of a continuous culture system.in embodiments, the program goal is to optimize the end product yield and/or rate of production of a biomolecule or product of interest.

For example, selecting strains according to reaction saturation single batch maximum yield is suitable for identifying strains with high single batch yield.across the series of temperatures and conditions, selection based on yield consistency is suitable for identifying strains with enhanced stability and reliability.

In embodiments, the selection criteria for the initial phase and tank-based verification will be the same.

Sequencing

In embodiments, the disclosure teaches whole genome sequencing of the organisms described herein in other embodiments, the disclosure also teaches sequencing of plasmids, PCR products, and other oligonucleotides as quality control for the methods of the disclosure.

In examples, the disclosure may be used in methods of the disclosure with any high throughput technology for nucleic acid sequencing.in examples, the disclosure teaches whole genome sequencing.in other examples, the disclosure teaches amplicon sequencing ultra-deep sequencing to identify genetic variations.in examples, the disclosure also teaches novel library preparation methods including tagging (see WO/2016/073690). DNA sequencing techniques include classical dideoxy sequencing reactions using labeled terminators or primers and gel isolation in thick sheets or capillaries (Sanger method), sequencing-by-synthesis, pyrosequencing using reversibly blocked labeled nucleotides, 454 sequencing, allele-specific hybridization to a library of labeled oligonucleotide probes, sequencing-by-synthesis using allele-specific hybridization to a library of labeled clones followed by ligation, incorporation of labeled nucleotides during the polymerization step, real-time monitoring of labeled nucleotides, sequencing by polymerase clones (polony sequencing), and Lionne sequencing.

Such SOLiD surfaces may comprise non-porous surfaces (such as Solesa sequencing (Solexa sequencing), e.g., Bentley (Bentley) et al, Nature, 456:53-59(2008), or comprehensive genomic sequencing (Complete Genomics sequencing), e.g., Del Maruz (Drmanac), science, 327:78-81(2010)), pore arrays that may comprise beads or particle-bound templates (such as sequencing with 454, e.g., Margulis (Margulies) et al, Nature, 437:376 (2005) or Ion-Torrent sequencing (Ion Torrer sequencing), U.S. patent publication 2010/0137143 or 2010/0304982)), micromachined beads (such as sequencing with SMRT, e.g., sequencing with Ed (Eid) et al, 2009: 376 (2005)) or Ion-Torrent sequencing) or micromachined beads (14813, or 14852)), or micromachined beads (1481, e.g., with Sorty polymerase (1481, 120: 1414)).

In another embodiments, the methods of the present disclosure comprise amplifying the separated molecules before or after spatial separation of the molecules on the solid surfaceEmulsion-based amplification, such as emulsion PCR, or rolling circle amplification. Also taught is solisa-based sequencing, in which individual template molecules on a solid surface are spatially separated, subsequently amplified in parallel by bridge PCR to form separate clonal populations or clusters, and then sequenced, as in torley et al (cited above) and manufacturer's instructions (e.g., TruSeq)^TMSample preparation kits and data sheets, described in enlightening company (Illumina, Inc.), San Diego, Calif., 2010), and further steps as described in U.S. Pat. Nos. 6,090,592, 6,300,070, 7,115,400, and EP0972081B1, all incorporated herein by reference.

In embodiments, the individual molecules disposed on and amplified on the solid surface form a density of at least 10 per square centimeter⁵Individual clusters, or with a density of at least 5 x 10 per square centimeter⁵Or a density of at least 10 per square centimeter⁶In embodiments, sequencing chemistries with relatively high error rates were used in such embodiments, the average quality score generated by such chemistries is a monotonically decreasing function of sequence read length in embodiments, such a decrease corresponds to 0.5% of sequence reads having at least errors in positions 1-75, 1% of sequence reads having at least errors in positions 76-100, and 2% of sequence reads having at least errors in positions 101-125.

Sequence variants

In embodiments, the modified GAPDH comprises an amino acid sequence sharing at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the amino acid sequence of SEQ ID No. 58 in embodiments, the modified GAPDH comprises an amino acid sequence sharing at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the amino acid sequence of SEQ ID No. 294, 76%, 78%, 79%, 80%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the amino acid sequence of SEQ ID No. 76, 76%, 80%, 82%, 80%, 76%, 80%, 76%, 95%, 80%, 95%, 76%, or 100% of the modified GAPDH, 95%, 76%, 80%, 76%, or 100% of the variant, 95%, 76%, or 100% of the sequence of the variant of the modified GAPDH, 95%, or 100% of the variant of the sequence of the.

In examples the gdh variant enzyme comprises an amino acid sequence sharing at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence selected from the group consisting of 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180 and 182 amino acid sequence in the amino acid sequence group consisting of 132, 134, 152, 78%, 79, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with the amino acid sequence selected from the group consisting of 80, 82, 84, 86, 88, 90, 92, 94, 96, 98%, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 130, 80%, 84%, 75%, 84%, 75%, 84%, 75%, 84%, 78%, 84.

In embodiments, the multicopy replicating plasmid comprises a sequence at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identical to to the thrABC operon sequence of SEQ ID NO. 77 in embodiments, the recombinant protein fragment of gapA comprises a sequence at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identical to to the amino acid sequence selected from the group consisting of SEQ ID NO. 233, 234, 235, 236, and 298.

Examples of the invention

The following examples are provided to illustrate various embodiments of the present invention and are not intended to limit the disclosure in any way. Those skilled in the art will recognize variations therefrom and other uses which are within the spirit of the invention as defined by the scope of the claims.

These examples show methods of increasing production of a product of interest in a host cell, which are limited by the availability of NADPH. The methods taught by the present disclosure can be used to increase the production of any product of interest in a metabolic pathway that is dependent on NADPH availability. For example, the present disclosure provides methods for increasing the production of amino acids, such as L-lysine or L-threonine, which are two products of interest whose production is limited by the availability of NADPH in the cell.

These strategies are (1) engineering the glycolytic pathway for NADPH production by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA) to have dual specificity for NADP and NAD by broadening the enzyme's coenzyme specificity, (2) expressing a transhydrogenase that produces NADPH from NADH in the host cell, (3) reprogramming the synthesis of Aspartate Semialdehyde (ASA) as a precursor for lysine, threonine, isoleucine and methionine by expressing a homolog of the endogenous gdh and/or asd enzyme that uses NADH as a cofactor more efficiently than NADPH, (4) reprogramming the DAP-pathway for lysine synthesis by expressing a homolog of endogenous dapB and/or ddh enzyme that uses NADH as a cofactor more efficiently than NADPH, as a cofactor, as a target for lysine synthesis, (5) reprogramming the degradation of glycine to glycine by expressing reduced or reversed NADH, as a cofactor, and (ItA) increasing the synthesis of the target threonine by expressing a homolog of pyruvate in the case of the endogenous pyruvate carboxylase, and () increasing the synthesis of pyruvate in the target organisms.

The following content profiles are provided merely to aid the reader. This summary is not intended to limit the scope of the examples or disclosure of this application.

TABLE 3 table of contents of the examples section

Example 1: broadening of coenzyme-specific-lysine of glyceraldehyde 3-phosphate dehydrogenase (GAPDH)

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is enzymes involved in the central carbon metabolic pathway the most common form of GAPDH is the NAD-dependent enzyme gapA found in all organisms studied to date, which is encoded by the gapA gene and converts glyceraldehyde-3-phosphate into glycerate-1, 3-bisphosphate the amino acid sequence of the gapA enzyme from corynebacterium glutamicum is as follows:

MTIRVGINGFGRIGRNFFRAILERSDDLEVVAVNDLTDNKTLSTLLKFDSIMGRLGQEVEYDDDSITVGGKRIAVYAERDPKNLDWAAHNVDIVIESTGFFTDANAAKAHIEAGAKKVIISAPASNEDATFVYGVNHESYDPENHNVISGASCTTNCLAPMAKVLNDKFGIENGLMTTVHAYTGDQRLHDAPHRDLRRARAAAVNIVPTSTGAAKAVALVLPELKGKLDGYALRVPVITGSATDLTFNTKSEVTVESINAAIKEAAVGEFGETLAYSEEPLVSTDIVHDSHGSIFDAGLTKVSGNTVKVVSWYDNEWGYTCQLLRLTELVASKL(SEQ ID NO:58)。

as shown in FIG. 1, the gapA enzyme uses NAD as a coenzyme, converting glyceraldehyde-3-phosphate to glycerate-1, 3-bisphosphate during this process NAD is converted to NADH. As further indicated in FIG. 1 at step , the glycolytic pathway is added to the biosynthetic pathway leading to L-lysine production in bacteria however, as discussed above, a key factor in the biotechnological production of L-lysine under C.glutamicum is the adequate supply of NADPH. thus, increasing the production of NADPH in C.glutamicum should increase the production of L-lysine way to achieve this goal would be to change the coenzyme specificity of C.glutamicum gapA so that the modified enzyme uses NADP as a cofactor, resulting in a greater amount of NADPH produced in the cell.

Previous studies have shown that mutations in c.glutamicum gapA at D35G, L36T, T37K and P192S cause specific changes in the coenzyme of the enzyme (from NAD to NADP) (bowman di (bomaded R.R.) et al (2014), metabolic engineering (meta. eng.), 25: 30-37.) several strains of c.glutamicum were produced, each strain expressing a gapA enzyme with or more of the above, as shown in table 4 below.

The test strain was tested for its ability to produce L-lysine compared to a reference strain with native gapA. It was found that the T37K mutation alone or in combination with the L36T mutation leads to a specific broadening of the coenzyme of C.glutamicum gapA, such that the modified enzyme shows a preference for both NAD and NADP, and that the expression of the modified enzyme in C.glutamicum significantly increases the lysine productivity (FIG. 2). The construction of the mutant strain of Corynebacterium glutamicum gapA (T37K and L36T/T37K) is described below.

The gapA gene was amplified by PCR using a commercially available oligonucleotide using chromosomal DNA of Corynebacterium glutamicum (ATCC 13032) as a template. The PCR fragments were assembled into Corynebacterium cloning vectors and mutagenized using standard site-directed mutagenesis techniques. The vector was initially transformed into E.coli using standard heat shock transformation techniques in order to identify correctly assembled cloning and amplification vector DNA for transformation of Corynebacterium.

The clones which have been verified are transformed into C.glutamicum host cells by electroporation. The number of Colony Forming Units (CFU) per microgram of DNA was determined for each transformation as a function of insert size. The genomic integration of corynebacterium was also analyzed as a function of the length of the homology arms and the results indicated that the shorter arms had lower efficiency.

The coryneform bacterium culture identified as having successfully integrated the insertion cassette was cultured on a kanamycin-containing medium for counter selection to loop out the kanamycin-resistant selection gene.

To further verify the loop-out event, colonies exhibiting kanamycin resistance were cultured and analyzed by sequencing.

In two different lysine-producing background strains, parental _2 and parental _1, several mutant strains were produced by the above method. Table 4 describes the actual specific mutations introduced into each parent strain.

Table 4: gapA mutants

Each strain newly produced and its parental strain were tested for lysine production in small scale cultures (e.g., 96-well plates) designed to assess product titer performance small scale cultures were performed using media from industrial scale cultures product titers were optically measured with carbon depletion (i.e., representing a single batch yield) using standard colorimetric assays briefly, a concentrated assay mixture was prepared and added to the fermentation samples such that the final concentration of reagents was 160mM sodium phosphate buffer, 0.2mM Amplex Red (Amplex Red), 0.2U/mL horseradish peroxidase and 0.005U/mL lysine oxidase.

The introduction of GAPDH with certain mutations conferring altered coenzyme specificity for NADP significantly increased lysine productivity (fig. 2). Strains 7000182994 and 7000184348 each contained T37K and performed better than their respective parent _1 and parent _ 2. Strains 7000182999 and 7000184352 each contained T37K and L36T and performed better than their respective parent _1 and parent _ 2. Strains 7000182997 and 7000184349 each contained P192S. Strains 7000182998 and 7000184347 each contained L36T.

Example 2: construction of threonine-producing basic Strain of Escherichia coli K-12 Strain W3110

As with lysine (and methionine, isoleucine and glycine) , the initial steps leading to the threonine synthesis pathway include the conversion of oxaloacetate to aspartate using glutamate regenerated from 2-ketoglutarate by glutamate dehydrogenase (gdh), followed by conversion of aspartate to aspartyl phosphate and subsequent reduction of aspartyl phosphate to aspartate semialdehyde by the enzyme aspartate semialdehyde dehydrogenase (asd), which steps are common to lysine, threonine, isoleucine and methionine biosynthesis, threonine formation requires three additional steps in addition to conversion of aspartyl phosphate to ASA via asd, namely (1) conversion of ASA to homoserine by a bifunctional aspartokinase/homoserine dehydrogenase (thrA), (2) conversion of homoserine to L-homoserine phosphate by homoserine kinase (thrB), and finally (3) conversion of L-homoserine phosphate to NADP by threonine synthase (thrC), which three steps operate independently of NADP/NADH.

The threonine base strain was produced in two steps, first by overexpression of the native E.coli thrLABC regulator (SEQ ID NO:76), consisting of thrL (a leader sequence rich in threonine and isoleucine codons followed by a functional transcription terminator to prevent transcription of the enzyme-encoding gene in the operon), thrA (bifunctional aspartate kinase/homoserine dehydrogenase 1), thrB (homoserine kinase) and thrC (threonine synthase). The polynucleotide was amplified from W3110 genomic DNA by PCR using commercially available oligonucleotides.ThrLABC operon was inserted into a multicopy copy pUC19 vector, SEQ ID NO:78, under the control of the synthetic promoter pMB085 (FIG. 8A; SEQ ID NO: 75). in order to alleviate the attenuation of expression, variants of this plasmid were constructed in which the thrL sequence was removed (FIG. 8; SEQ ID NO: 8B: 84) to catalyze the production of threonine by threonine synthase promoter, threonine kinase-3-t-3 (SEQ ID NO: t-3) to generate threonine by deletion of the threonine synthase promoter region encoding threonine-3-threonine-encoding threonine-producing threonine kinase (SEQ ID NO: 7).

To evaluate threonine production in the resulting W3110 threonine base strains W3110 pMB085thrLABC Δ tdh (THR 01; 7000336113) and W3110 pMB085thrABC Δ tdh (THR 02; 7000341282), each strain and its parent (W3110; 7000284155) were tested for threonine production in small-scale cultures (e.g., 96-well plates) designed to evaluate product titer performance. Small scale (300. mu.l) cultures were grown in TPM1 medium. TPM1 medium contains per liter: glucose, 50 g; yeast extract, 2 g; MgSO (MgSO)₄.7H₂O，2g；KH₂PO₄，4g；(NH₄)2SO₄14 g; betaine, 1 g; l-methionine, 0.149 g; l-lysine, 0.164 g; trace metal solution, 5 ml; and CaCO₃And 30 g. The trace metal solution contains per liter: FeSO₄.7H₂O，10g；CaCl₂，1.35g；ZnSO₄.7H₂O，2.25g；MnSO₄.4H₂O，0.5g；CuSO₄.5H₂O，1g；(NH₄)6Mo₇O₂₄.4H₂O，0.106g；Na₂B₄O₇.10H₂O, 0.23 g; 35% HCl, 10 ml. The final pH was adjusted to 7.2 by addition of 4N KOH. Chloramphenitol (35. mu.g/ml), kanamycin (40. mu.g/ml) and ampicillin (50. mu.g/ml) were added to the medium as required. Cultures were grown in a humidified (80% humidity) INFORS HT Multitron Pro thermostatted shaking incubator at 37 ℃ for approximately 36 hours with constant agitation at 1000 rpm.

In samples of cell-free medium, threonine titers were determined using AccQ-Tag (Waters Corp.) front-end column derivatization and analysis techniques for peptide and protein hydrolysate amino acids.Waters AccQ-Fluor reagents were used to derivatize amino acids present in the samples then these derivatives were separated by reverse phase HPLC and quantified by fluorescence detection the biomass estimates for each sample were determined by measuring Optical Density (OD) at a wavelength of 660nm using a Tecan M1000 plate spectrophotometer, and the final glucose concentration was determined by standard colorimetric analysis briefly, a concentrated assay mixture was prepared with reagents of 175mM sodium phosphate buffer pH 7.0, 0.2mM Ampere fluorescent Red (Chemodex CDX-A0022), 16U/mL glucose oxidase from Aspergillus niger (Sigma G7141) and 0.2U/mL horseradish peroxidase (VWR 0417. 25000) to react black 25000- Dark at room temperature for 30 minutes and optical density was measured using a Tecan M1000 plate spectrophotometer at 560nm wavelength. The above culture conditions and measurements were used to calculate titers and to estimate the yields and productivity of the strains described in the examples below.

Example 3: broadening of coenzyme-specific threonine of glyceraldehyde 3-phosphate dehydrogenase (GAPDH)

The base strain described in example 2 was used in the following example experiment.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is enzymes involved in the central carbon metabolic pathway GAPDH is the NAD-dependent enzyme gapA, the most common form of which is found in all organisms studied to date, which is encoded by the gapA gene and converts glyceraldehyde-3-phosphate to glycerate-1, 3-bisphosphate.

As shown in FIG. 9, the gapA enzyme uses NAD as a coenzyme, converting glyceraldehyde-3-phosphate to glycerate-1, 3-bisphosphate during this process NAD is converted to NADH. As shown by the further steps in FIGS. 9 and 10A-C, the glycolytic pathway is added to the biosynthetic pathway leading to L-threonine production in bacteria, however, as discussed above, a key factor in the biotechnological production of L-threonine under E.coli is the adequate supply of NADPH. thus, increasing the production of NADPH in E.coli should increase the production of L-threonine. ways to achieve this goal would be to alter the coenzyme specificity of gapA such that the modified enzyme uses NADP as a cofactor, resulting in greater amounts of NADPH being produced in the cell.

Previous studies have shown that D35G, L36T, T37K and P192S mutations in C.glutamicum gapA cause specific changes in the enzyme coenzyme (from NAD to NADP) (Bomandi et al (2014), "Metabolic engineering", 25: 30-37). The amino acid sequence of the gapA enzyme from C.glutamicum is as follows:

here, several strains of E.coli were produced, each expressing a variant of the heterologous (C.glutamicum) gapA enzyme with of the above mutations gapAv5(SEQ ID NO:69), gapAv7(SEQ ID NO:71) or gapAv8(SEQ ID NO:73), as shown in Table 5 below.

Table 5: mutant and native gapA variants tested in this study

The test strain was tested for its ability to produce L-threonine in comparison with a reference strain (W3110 thrABC. DELTA. tdh) having the native E.coli gapA (SEQ ID NO: 67). It was found that expression of all three variants gapAv5(SEQ ID NO:69), gapAv7(SEQ ID NO:71) and gapAv8(SEQ ID NO:73) independently caused a significant increase in threonine titer (FIG. 11A). The construction of the E.coli gapA mutant strain is described below.

The gapA variant (gapAv5(SEQ ID NO:69), gapAv7(SEQ ID NO:71) or gapAv8(SEQ ID NO:73)) was amplified from a Corynebacterium cloning vector by PCR using commercially available oligonucleotides, native E.coli gapA was amplified from W3110 genomic DNA, the PCR fragment was assembled into an E.coli cloning vector into a modified pUC19 vector (encoding the polynucleotide sequences provided in SEQ ID NO:70, 72 and 74) and initially transformed into NEB 10- β E.coli cells using standard heat shock transformation techniques in order to identify correctly assembled cloning and amplification vector DNA for transformation into E.coli W3110 threonine base strains THR01 and THR 02.

Each newly produced strain and its parent strain were tested for threonine production in small-scale cultures (e.g., 96-well plates) as described above.

The introduction of GAPDH with certain mutations conferring altered coenzyme specificity for NADP significantly increased threonine titers (fig. 11A). Strains 7000342726(gapAv5), 7000342720(gapAv7) and 7000342727(gapAv8) all performed better than their parent strain (7000341282) and the parent expressing the second copy of E.coli gapA (7000342723).

Table 6: threonine productivity of gapA variants

Strain ID		Potency of the drug	STDEV
				7000342726	gapAv5	19.04	8.33
7000342720	gapAv7	15.47	9.45
				7000342727	gapAv8	8.73	4.18
7000342723	Ec_gapA	0.79	1.37
				7000341282	thrABC	0.79	1.37
7000284155	W3110	0	0

Example 4: reprogramming the DAP-pathway for lysine synthesis by using a variant enzyme with cofactor specificity for NADH

The biosynthetic pathway leading to L-lysine production in bacteria is called the Diaminopimelate (DAP) -pathway (fig. 1). the initial steps leading to the DAP-pathway include conversion of oxaloacetate to aspartate using glutamate regenerated from 2-ketoglutarate by glutamate dehydrogenase (gdh) then aspartate to aspartyl phosphate and subsequent reduction of aspartyl phosphate to Aspartate Semialdehyde (ASA) by the enzyme aspartate semialdehyde dehydrogenase (asd). these steps are common to lysine, threonine, isoleucine and methionine biosynthesis. the -directed step leading to lysine biosynthesis is conversion of ASA to dihydropyridinate (DHDP) under the catalysis of the dihydropyridinate synthase.

However, NADPH is the limiting factor in L-lysine production from glucose in C.glutamicum on an industrial scale (Becker et al (2005), [ Appl. environ. Microbiol.), 71(12): 87 8596.) thus, increasing NADPH production in C.glutamicum should increase L-lysine production this objective will be achieved by reducing NADPH utilization by naturally occurring homologues of C.glutamicum enzymes gdh, asd, dapB and ddh, which are more efficiently used as cofactors than NADPH.

Corynebacterium glutamicum gdh and dapB have known homologues in Clostridium symbiosum (Li Leley K.S.) (1991), & Biochemical and biophysics Acta (Biochim Biophys Acta), 1080, (3):191-197) and Escherichia coli (Reddy S.G.) (1995), & Biochemical (Biochemistry), 34(11):3492-3501), which use NADH as a cofactor more efficiently than NADPH.

Table 7: sources and sequences of pathway homologs

Known homologues of C.glutamicum gdh and dapB and 9 variants of C.glutamicum asd and ddh were codon optimised for expression in C.glutamicum As shown in FIG. 4, copies of each of the two versions of gdh and dapB and copies of each of the ten versions of asd and ddh were cloned in various combinations into plasmids containing the kanamycin resistance marker gene, the combinations of enzymes tested in this example are outlined in Table 7.

Each asd-gdh-dapB-ddh combination was cloned into a plasmid (SEQ ID NO: 51.) FIG. 4 shows the cassette arrangement of exemplary asd-gdh-dapB-ddh test combinations.the regulatory sequences are SEQ ID NOS: 52-57 the final cassette of each test combination can be represented from the 5 'to the 3' end as follows:

it should be noted that the reverse complement sequence orientation of the dapB and ddh alleles is the result of the arrangement of the expression cassettes and is not meant to be intended to elicit silencing of the alleles.

Table 8: combinations of pathway homologs

Each plasmid was initially transformed into E.coli using standard heat shock transformation techniques in order to identify correctly assembled cloning and amplification vector DNA for transformation of Corynebacterium.

To further verify the loop-out event, colonies exhibiting kanamycin resistance were cultured and analyzed by sequencing.

All four enzymes are expressed simultaneously in C.glutamicum.

Each newly produced strain and its parental strain are tested for lysine production in small scale cultures (e.g., 96-well plates) designed to assess product titer performance using media from industrial scale cultures small scale cultures are performed using standard colorimetric assays, with product titers being optically measured in the case of carbon depletion (i.e., representing single batch production). briefly, a concentrated assay mixture is prepared and added to the fermentation samples such that the final concentration of reagents is 160mM sodium phosphate buffer, 0.2mM aprenflurane, 0.2U/mL horseradish peroxidase and 0.005U/mL lysine oxidase. the reaction is allowed to proceed to endpoint and optical density is measured using a dique (Tecan) M1000 plate spectrometer at 560nm wavelength the experimental results are presented in table 9 and summarized in fig. 5A and 5B.

Two recombinant strains of C.glutamicum 7000186960 and 7000186992, each containing the protozyme of C.glutamicum ddh and the same 3 heterologous enzymes of gdh, asd and dapB (known versions of Clostridium symbiosum gdh using NADH and of E.coli dapB and variants of asd from Lactobacillus agilis), showed significantly improved L-lysine productivity compared to the corresponding parental-parental _3 and parental _4 strains (FIG. 5A). Data on the effect of the combination of different enzymes are presented in table 9, and the enzyme combinations significantly improved compared to the parent are highlighted in bold.

Table 9: data on combinations of homologs

Two versions of the 4 gene cassette were introduced into C.glutamicum parent-6 and lysine production was monitored. The 4 genes were selected based on their use as replacement cofactors NADH, but not NADPH. The 4 gene cassette v1 (strain 263254) contained aspartate-semialdehyde dehydrogenase (asd) from Corynebacterium glutamicum (SEQ ID NO:39), glutamate dehydrogenase (gdh) from Clostridium symbiosum (SEQ ID NO:43), 4-hydroxy-tetrahydrodipicolinate reductase (dapB) from Escherichia coli (SEQ ID NO:47) and meso-diaminopimelate D-dehydrogenase (ddh) from Corynebacterium glutamicum (SEQ ID NO: 3). Thus, the 4-gene cassette v1 (strain 263254) encodes an aspartate-semialdehyde dehydrogenase (asd) from Corynebacterium glutamicum (SEQ ID NO:40), a glutamate dehydrogenase (gdh) from Clostridium symbiosum (SEQ ID NO:44), a 4-hydroxy-tetrahydrodipicolinate reductase (dapB) from Escherichia coli (SEQ ID NO:48) and a meso-diaminopimelate D-dehydrogenase (ddh) from Corynebacterium glutamicum (SEQ ID NO: 4).

The 4 gene cassette v2 (strain 263264) contained aspartate-semialdehyde dehydrogenase (asd) from Lactobacillus agilis (SEQ ID NO:29), glutamate dehydrogenase (gdh) from Clostridium symbiosum (SEQ ID NO:43), 4-hydroxy-tetrahydrodipicolinate reductase (dapB) from Escherichia coli (SEQ ID NO:47) and meso-diaminopimelate D-dehydrogenase (ddh) from Corynebacterium glutamicum (SEQ ID NO: 3). Thus, the 4-gene cassette v2 (strain 263264) encodes aspartate-semialdehyde dehydrogenase (asd) from Lactobacillus agilis (SEQ ID NO:30), glutamate dehydrogenase (gdh) from Clostridium symbiosum (SEQ ID NO:44), 4-hydroxy-tetrahydrodipicolinate reductase (dapB) from Escherichia coli (SEQ ID NO:48) and meso-diaminopimelate D-dehydrogenase (ddh) from Corynebacterium glutamicum (SEQ ID NO: 4).

The 4 gene cassette significantly improved lysine production in plate model 9. The data are summarized in table 10.

Table 10: enhancing lysine production

Gene cassette	Bacterial strains	Potency mM (95% CI)	Increase relative to parent%
				Is free of	Parent _6	6.45+/-0.9	n/a
Box v1	263254	12.41+/-0.9	92.4
				Box v2	263264	9.33+/-1.1	44.7

Example 5: reprogramming the threonine biosynthetic pathway by using a variant enzyme with cofactor specificity for NADH

The base strain described in example 2 was used in the following example experiment.

The biosynthetic pathway leading to L-threonine production in bacteria is called the thrABC pathway (fig. 9) as lysine (and methionine, isoleucine and glycine) , the initial steps towards the threonine synthetic pathway include conversion of oxaloacetate to aspartate using glutamate regenerated from 2-ketoglutarate by glutamate dehydrogenase (gdh), then aspartate to aspartyl phosphate, followed by reduction of aspartyl phosphate to Aspartate Semialdehyde (ASA) by the enzyme aspartate semialdehyde dehydrogenase (asd), which steps are common to lysine, threonine, isoleucine and methionine biosynthesis.

As shown in FIG. 9, NADPH is required as a coenzyme for each of the native E.coli enzymes gdh and asd, however, NADPH is , a limiting factor in L-threonine production from glucose in E.coli on an industrial scale (Becker et al (2005), "environmental microbiology applications, 71(12): 8587-.

Coli enzyme gdh has known homologues in Clostridium symbiosum (Leide et al (1991), "journal of biochemistry and biophysics", 1080(3):191-197), which homologues use NADH as a cofactor more efficiently than NADPH. such homologues of E.coli asd are unknown. to investigate whether additional gdh homologues with stronger NADH preference and novel asd homologues with NADH preference can be identified, a whole genome homology search was conducted on an internal metagenomics library developed from environmental samples. a search consisted of a BlastP analysis of the library using Lactobacillus agilis asd (asd _ lag; SEQ ID 30) and the protein sequence of Clostridia (Clostridides) gdh (gdh _ csy; SEQ ID: 44.) searching hundreds of sequences for homology searches, but applying step filtering and selection criteria to achieve a selection of approximately twelve sequence subsets of twenty-four sequences of each enzyme from a < 70% homology of the query sequence.

TABLE 11 summary of parts and polynucleotide sequences used in construction of multiple copies of the threonine operon expression vector for production of threonine base strains

Part type	Part name	SEQ ID
			Promoters	pMB085	75
Insert (Gene)	thrLABC	76
			Insert (Gene)	thrABC	77
Framework	pUC19 vector	78

Table 12: sources and sequences of pathway homologs

The Open Reading Frames (ORFs) of E.coli gdh (Clostridiales gdh; SEQ ID NO:134), a known homologue of Lactobacillus agilis asd (SEQ ID NO: 80) and 24 variants of the enzyme were amplified by PCR using commercially available oligonucleotides and cloned into a p 15A-based multicopy plasmid sequence (SEQ ID NO:239) containing regulatory sequences, the promoter pMB038(SEQ ID NO:237) and a transcription terminator (SEQ ID NO:238), as shown in FIG. 12, version 26 of asd and version 26 of gdh each copies were cloned in a dicistronic cassette in various combinations into a p 15A-based multicopy plasmid backbone (SEQ ID NO: 239).

The verified clones were transformed into E.coli basic strain cells by electroporation. Each newly produced strain and its parent strain were tested for threonine production in small-scale culture as described above. The results of the experiment are presented in table 13. Alleles asd-13 (SEQ ID NO:108) and asd-18 (SEQ ID NO:118) performed better, but did not differ significantly from the control. Alleles gdh _1(SEQ ID NO:136), ghd _8(SEQ ID NO:150), gdh _14(SEQ ID NO:162), gdh _16(SEQ ID NO:166), gdh _18(SEQ ID NO:170), gdh _20(SEQ ID NO:174) and gdh _22(SEQ ID NO:178) each increased threonine compared to W3110 and the control strain (FIG. 13). Not all strains were successfully constructed and tested. Replicate samples that showed poor/no growth and statistical outliers were not shown in fig. 13, but are represented in table 13.

TABLE 13 summary of Titers of strains overexpressing the asd and gdh variants

Example 6: improvement of threonine titer by using variant threonine aldolases with different substrate preferences and enzyme kinetics the base strain described in example 2 was used in the following example experiments.

This example demonstrates methods for increasing L-threonine production in bacterial host cells using heterologous threonine aldolase genes in E.coli threonine aldolase (ltaE) opposes the accumulation of threonine by converting L-threonine to acetaldehyde and glycine however, there are different substrate specificities and enzyme kinetics within the broader taxonomic family of Threonine Aldolases (TA). The example shows strategies to improve threonine production by allowing the addition or replacement of the ltaE gene with heterologous TA's with different substrate preferences or enzyme kinetics, using the different substrate preferences found between TA.

Aldolase donor components (nucleophiles) are reversibly aldolized to acceptor components. Coli threonine aldolase (ltaE) catalyzes the cleavage of L-allo-threonine and L-threonine to glycine and acetaldehyde (fig. 10A). In E.coli, ltaE opposes the accumulation of threonine by converting L-threonine to glycine. However, there are different substrate specificities within a broader class of families of threonine aldolase genes (TAs). TA has been described (Fisco et al, 2015) with substrate preferences (e.g., serine, alanine) and kinetics that promote L-threonine formation.

To investigate whether homologues of e.coli ltaE with substrate preference or enzyme kinetics that promote threonine production could be identified, a genome-wide homology search was performed on an internal metagenomic library developed from environmental samples, the search consisted of performing BlastP analysis on the library using protein sequences from e.sakazakii threonine aldolase (Csa _ ltaE; SEQ ID NO:183), which is a enzyme that has been reported to be preferred for glycine (fisceae, 2015) homology searches to retrieve hundreds of sequences, but applying steps of filtering and selection criteria to arrive at a library of twenty-four sequences.

The Open Reading Frame (ORF) of the threonine aldolase of Enterobacter sakazakii was codon-optimized for E.coli (SEQ ID NO:183) and synthesized as a gBlock gene fragment (IDT). The 24 ltaE variants were amplified by PCR using commercially available oligonucleotides and cloned into a p 15A-based multicopy plasmid sequence (SEQ ID NO:239) containing the promoter pMB038(SEQ ID NO:237) and the native E.coli thrL transcription terminator (SEQ ID NO:238), as shown in FIG. 12.

Each plasmid was initially transformed into chemically competent NEB 10- β E.coli cells using standard heat shock transformation techniques in order to identify correctly assembled cloning and amplification vector DNA for transformation into the E.coli threonine base strain.

TABLE 14 summary of Titers of strains overexpressing the ltaE variants

Example 7: expression of a combination of modified or variant gapA, gdh, asd and ltaE enzymes in E.coli to increase L-threonine production

The base strain described in example 2 was used in the following example experiment.

or more of the above strategies can be used in combination to further increase NADPH production in E.coli, and thus, increase L-threonine production.

Various combinations of gapA, gsd, asd, ltaE were introduced into the E.coli thrABC Δ tdh background described in example 2 in cases, as described above, using commercially available oligonucleotides, these combinations were cloned into and transformed on the same modified pUC19 vector containing pMB085-thrABC, added as polycistrons downstream of the thrABC operon, and driven by the pMB085 promoter when multiple genes were added in tandem, including the following Ribosome Binding Site (RBS) linkers RBS1(agctggtggaatat (SEQ ID NO: 306); after thrC), RBS2(aggaggttgt (SEQ ID NO: 307); between genes 1 and 2) and 3(tgacacctattg (SEQ ID NO: 308); between genes 2 and 3) these linking sequences were included at the tail of the oligonucleotides and introduced during PCR amplification of the genes when the combination of gapA, gsd, asd, thaE, thrABC represents a titre that is higher than that of the polytope, when the combination of gapA, gsd, asae, thaE, thrABC 15mg and 15 mg/15 mg of the polytopic observed for the combinations.

TABLE 15 summary of Titers of strains co-expressing thrABC and combinations of gapA, asd, gdh and ltaE on pUC19 plasmid

In addition to the above combinations of genes expressed as polycistronic on the pUC19 plasmid, three of the above strains (7000342721, 7000342726 and 7000342720; Csy _ gdh (SEQ ID NO:44), gapAv5(SEQ ID NO:69) and gapAv7(SEQ ID NO:71), respectively, were transformed with the p15A plasmid (SEQ ID NO:239) or the blank p15A vector control (e.g., Csy _ gdh + p15A (-)) expressing the individual library variants of asd, gdh and ltaE (described and tested above), the summary of these strains and their performance (threonine titer) is shown in Table 16, except for W3110, all of these strains are in the pMB 085-thraTtdBCh deletion background, for these experiments most of the relevant controls are maintained by the p15 control plasmid(s) (5, Csb 7000349887 and 7000349885; Csdh _ gcdhy _ gch + deletion) as compared to the high titer of the individual library expression of these plasmids, or the higher titer of the relevant plasmids found by the expression of the plasmid vector of the plasmid of the above strains (pAgdh # ep 15, the invention) (3615, the strain) and the plasmid of the strain of the plasmid of the strain of the plasmid of the invention, the strain, the invention, and the invention, are shown in the invention, or the invention, and the invention, and the invention are shown in Table 16, and the invention are shown in the invention, and.

TABLE 16 summary of titers of strains expressing combinations of Csy _ gdh, gapAv5, or gapAv7 and asd, gdh, or ltaE library variants

Example 8: catalase expressing NADPH production from NADH

A key factor in the biotechnological production of L-lysine in C.glutamicum is the adequate supply of NADPH. As shown in FIG. 1, membrane-integrated nicotinamide nucleotide transhydrogenase can drive NADP via oxidation of NADH⁺Thus expressing transhydrogenase is an effective strategy of species to increase cellular NADPH production in C.glutamicum and thus L-lysine production.

Example 9: expressing pyruvate carboxylase

Pyruvate carboxylate is an important anaplerotic enzyme of species that supplements oxaloacetate consumed by lysine and glutamate production during growth or in industrial fermentations.

Pyruvate carboxylase genes have been cloned and sequenced from each of the following bacteria: rhizobium japonicum (Rhizobium etli) (Dengen (Dunn, F.F.)) et al, J.Bacteriol. (J.Bacteriol.) -178: 5960-, pyruvate carboxylase activity was measured in Microbiology (Microbiology) 143:1095-1103 (1997).

Studies have shown that the yield and productivity of the aspartate family of amino acids is critically dependent on the carbon flux of anaplerotic pathways (Vallino, J.J.) and Stephanopoulos (G.), "Biotechnology & bioengineering" (Biotechnol. Bioeng.) "41: 633-646 (1993)). Based on metabolite equilibrium, lysine production rates less than or equal to the oxaloacetate synthesis rate can be shown via a anaplerotic pathway.

The pyruvate-carboxylase gene of C.glutamicum may be replaced by mutants or variants, whereby preferably pyruvate-carboxylase expression is 2 to 20 times higher than its expression in the C.glutamicum basic strain.

A promoter ladder may be used to regulate or fine-tune expression, in such cases, by testing for promoter elements of varying strength in combination with various pyc variants or mutants, it may be determined that the combination of a promoter that produces the best gene activity with the pyc gene, thereby increasing production of the desired compound, such as L-threonine.

Example 10: expression of a combination of modified gapA, transhydrogenase and modified gdh, asd, dapB and ddh enzymes in C.glutamicum or E.coli to increase L-lysine or L-threonine production

or more of the above strategies can be used in combination to further increase the production of NADPH in C.glutamicum or E.coli, and thus increase the production of L-lysine or L-threonine.

Example 11: identification of novel glyceraldehyde 3-phosphate dehydrogenase (GAPDH) alleles

An NNK library of the gapA gene was generated using gapAv9(D35G, L36T, T37K, P192S) (SEQ ID NO:303) as the starting sequence. Each mutagenized gene was individually introduced as a second copy of gapA at the neutral integration locus (between cg1504 and cg 1505) in C.glutamicum with an endogenous gapA allele under the control of the native gapA promoter. More than 1200 gapA integrants were screened in two different plate assays to identify alleles that increased lysine titer. Some integrants showed increased lysine expression (black circles) compared to the parental strain (black diamonds) (fig. 14).

Several truncated gapA sequences caused lysine expression increase. The native gapA sequence is underlined. The remaining amino acids are the artifact of frame shift mutations.

Table 17: GapA truncation increases lysine expression

TABLE 18 List of new mutations in the gapA Gene resulting from lysine

Sequences of the disclosure having an identifier of SEQ ID NO

Numbered examples of the present disclosure

The present disclosure sets forth the following numbered embodiments notwithstanding the appended clauses.

Increasing production of compounds produced using NADPH

A method of for increasing the ability of a host cell to produce a compound that uses NADPH for production, the method comprising altering the available NADPH of the cell.

2. The method of clause 1, wherein the available NADPH is altered by expressing a modified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the cell, wherein the modified GAPDH is modified such that its coenzyme is specifically broadened.

3. The method of clause 2, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to the corresponding naturally occurring GAPDH.

4. The method of clause 3, wherein the naturally occurring GAPDH is gapA.

5. The method of clause 4, wherein the gapA has the amino acid sequence of SEQ ID NO: 58.

6. The method of clause of clauses 2 to 5, wherein the modified GAPDH comprises an amino acid sequence sharing at least 70% sequence identity with the amino acid sequence of SEQ ID NO: 58.

7. The method of clause of clauses 2-5, wherein the modified GAPDH comprises an amino acid sequence sharing at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ id nos 294, 296, 233, 234, 235, 236, 298, and 300.

8. The method of any of clauses 2-7, , wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 37 of SEQ ID NO: 58.

9. The method of any of clauses 2-8, wherein the modified GAPDH comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

10. The method of clause 8 or 9, wherein the residue of the modified GAPDH at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

11. The method of clause 9, wherein the residue of the modified GAPDH at the position corresponding to amino acid 36 of SEQ ID NO:58 is threonine and the residue of the modified GAPDH at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

12. The method of any of clauses 2-11, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 192 of SEQ ID NO: 58.

13. The method of clause 12, wherein the residue of the modified GAPDH at the position corresponding to amino acid 192 of SEQ ID NO:58 is serine.

14. The method of any of clauses 2-13, wherein the residue of the modified GAPDH at the position corresponding to amino acid 224 of SEQ ID NO:58 is serine.

15. The method of any of clauses 2-14, wherein the residue of the modified GAPDH at the position corresponding to amino acid 110 of SEQ ID NO:58 is aspartic acid.

16. The method of any of clauses 2-15, wherein the residue of the modified GAPDH at the position corresponding to amino acid 140 of SEQ ID NO:58 is glycine.

17. The method of clause of clauses 2-5, wherein the modified GAPDH comprises an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ id nos 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

18. The method of clause of clauses 1-17, wherein the compound is selected from table 2.

19. The method of clause 18, wherein the compound is lysine.

20. The method of clause 18, wherein the compound is threonine.

21. The method of clause of clauses 1-20, wherein the host cell is a prokaryotic cell.

22. The method of clause 21, wherein the host cell is from a genus selected from the group consisting of Agrobacterium (Agrobacterium), Alicyclobacillus (Alicyclobacillus), Candida (Anabaena), Ecklonia (Anacosmus), Ascophyllum (Anacethylis), Acinetobacter (Acinetobacter), Acidothermus (Acidothermus), Arthrobacter (Arthrobacter), Azotobacter (Azobacter), Bacillus (Bacillus), Bifidobacterium (Bifidobacterium), Brevibacterium (Brevibacterium), Clostridium (Butyrylibrio), Brevibacterium (Butyrrhiza), Micrococcus (Buchnera), Micrococcus (Camptobacter), Campylobacter (Campylobacter), Clostridium (Clostridium), Corynebacterium (Corynebacterium), Thielavia (Chromaticum), Enterococcus (Cocculus), Pseudomonas (Escherichia), Lactobacillus (Salmonella), Pseudomonas (Escherichia), Lactobacillus (Salmonella), Pseudomonas (Bacillus), Lactobacillus (Escherichia), Lactobacillus (Bacillus), Bacillus (Bacillus) and Bacillus (Bacillus) are strains).

23. The method of clause 22, wherein the host cell is corynebacterium glutamicum.

24. The method of clause 22, wherein the host cell is e.

25. The method of clause of clauses 1-20, wherein the host cell is a eukaryotic cell.

26. The method of clause 25, wherein the host cell is from a genus selected from the group consisting of: gossypium (Achlya), Acremonium (Acremonium), Aspergillus (Aspergillus), Aureobasidium (Aureobasidium), Cladosporium (Bjerkandra), Ceriporiopsis (Ceriporiopsis), Cephalosporium (Cephalanopsis), Chrysosporium (Chrysosporium), Cochlosporium (Cochliobolus), Corynascus (Corynebacterium), Sclerotium (Cryptosporium), Cryptosporidium (Cryptocococcus), Coprinus (Coprinus), Coriolus (Coriolus), Diplodia (Diplodia), Endothia (Endothia), Fusarium (Fusarium), Gibberella (Gibberella), Schizochytrium (Gliocladium), Hypocrea (Hypocrea), Rhizophora (Rhizophora), Rhizopus (Rhizopus), Rhizopus (Rhizopus), Rhizopus (Rhizopus), Rhizopus, Sporotrichum (Sporotrichum), Talaromyces (Talaromyces), Thermoascus (Thermoascus), Thielavia (Thielavia), trametes (Tracates), Tolypocladium (Tolypocladium), Trichoderma (Trichoderma), Verticillium (Verticillium), and Volvariella (Volvariella).

Host cell comprising modified GAPDH

host cells comprising a modified GAPDH having broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the host cell has increased production of a compound produced using NADPH relative to a corresponding host cell lacking the modified GAPDH.

28. The host cell of clause 27, wherein the available NADPH is altered by expressing a modified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the cell, wherein the modified GAPDH is modified such that its coenzyme is specifically broadened.

29. The host cell of clause 27 or 28, wherein the modified GAPDH has increased specificity for a coenzyme NADP relative to the corresponding naturally occurring GAPDH.

30. The host cell of clause 29, wherein the naturally occurring GAPDH is gapA.

31. The host cell of clause 30, wherein the gapA has the amino acid sequence of SEQ ID NO: 58.

32. The host cell of any of clauses of clauses 27 to 31, wherein the modified GAPDH comprises an amino acid sequence sharing at least 70% sequence identity with the amino acid sequence of SEQ id no: 58.

33. The host cell of any clause 27-31, wherein the modified GAPDH comprises an amino acid sequence sharing at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 294, 296, 233, 234, 235, 236, 298, and 300.

34. The host cell of any clause 27-33, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 37 of SEQ ID NO: 58.

35. The host cell of any clause 27-34, wherein the modified GAPDH comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

36. The host cell of clause 34 or 35, wherein the residue of the modified GAPDH at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

37. The host cell of clause 35, wherein the residue of the modified GAPDH at the position corresponding to amino acid 36 of SEQ ID NO:58 is threonine and the residue of the modified GAPDH at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

38. The host cell of any clause 27-37, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 192 of SEQ ID NO: 58.

39. The host cell of clause 38, wherein the residue of the modified GAPDH at the position corresponding to amino acid 192 of SEQ ID NO:58 is serine.

40. The host cell of any clause 27-39, wherein the residue of the modified GAPDH at the position corresponding to amino acid 224 of SEQ ID NO:58 is serine.

41. The host cell of any of clauses of clauses 27-40, wherein the residue of the modified GAPDH at the position corresponding to amino acid 110 of SEQ ID NO:58 is aspartic acid.

42. The host cell of any clause 27-41, wherein the residue of the modified GAPDH at the position corresponding to amino acid 140 of SEQ ID NO:58 is glycine.

43. The host cell of any clause 27-31, wherein the modified GAPDH comprises an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

44. The host cell of clause of any of clauses 27 to 43, wherein the compound is selected from table 2.

45. The host cell of clause 44, wherein the compound is lysine.

46. The host cell of clause 44, wherein the compound is threonine.

47. The host cell of any clause 27-46, wherein the host cell is a prokaryotic cell.

48. The host cell of clause 47, wherein the host cell is from a genus selected from the group consisting of Agrobacterium, Alicyclobacillus, Candida, Pleurocystis, Acinetobacter, Acidothermus, Arthrobacter, Azotobacter, Bacillus, Bifidobacterium, Brevibacterium, butyric acid Vibrio, Buhnella, Pinna, Campylobacter, Clostridium, Corynebacterium, Thiobacillus, fecal coccus, Escherichia, enterococcus, Enterobacter, Erwinia, Clostridium, faecalibacterium, Francisella, Flavobacterium, Geobacillus, Haemophilus, Spirulina, Klebsiella, Lactobacillus, lactococcus, Clavibacterium, Micrococcus, Microbacterium, Medinium, Methylobacterium, Mycobacterium, Neisseria, Pantoea, Pseudomonas, Chlorococcus, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Sclerotium, Streptococcus, Yersinia, Pyrococcus, Thermoascus, Thermococcus, , Thermococcus, Thermoascus, and Thermoascus.

49. The host cell of clause 48, wherein the host cell is corynebacterium glutamicum.

50. The host cell of clause 48, wherein the host cell is e.

51. The host cell of any clause 27 to 46, wherein the host cell is a eukaryotic cell.

52. The host cell of clause 51, wherein the host cell is from a genus selected from the group consisting of: gossypium, Acremonium, Aspergillus, Aureobasidium, Byssochlamus, Ceriporiopsis, Cephalosporium, Chrysosporium, Courospora, Cladosporium, Cryptotheca, Coprinus, Coriolus, Chroospora, Neurospora, Fusarium, Gibberella, Gliocladium, Humus, Hypocrea, myceliophthora, Mucor, Neurospora, Podospora, Phlebia, Ruminochytrix, Rhizomucor, Rhizopus, Schizobium, Convolvulus, Sporothrix, Talaromyces, Thermoascus, Thielavia, trametes, Trichosporon, Trichoderma, Verticillium, and Microchaeta.

Method for producing L-lysine in corynebacterium

53. A method for producing L-lysine, comprising culturing a Corynebacterium strain and recovering L-lysine from the cultured Corynebacterium strain or culture broth, wherein the Corynebacterium strain expresses modified GAPDH using NADP as a coenzyme, and wherein L-lysine productivity of the Corynebacterium strain is increased.

Method for broadening coenzyme specificity of GAPDH

methods of broadening the coenzyme specificity of GAPDH, comprising modifying said GAPDH such that the modified GAPDH is bispecific for the coenzymes NADP and NAD.

55. The method of clause 54, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to NAD.

56. The method of clauses 54 or 55, wherein the modified GAPDH uses NADP more efficiently than NAD.

Method for increasing efficiency of producing compound produced using NADPH

57, A method of increasing the efficiency of a host cell to produce a compound produced using NADPH, comprising expressing in the host cell or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh), a variant enzyme, wherein the variant enzyme exhibits bispecific for the coenzymes NADH and NADPH.

58. The method of clause 57, wherein the compound is selected from table 2.

59. The method of clauses 57 or 58, wherein the variant enzyme uses NADH more efficiently than NADPH.

60. The method of any of clauses of clauses 57-59, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with the amino acid sequence of SEQ ID No. 42 or 44.

61. The method of any of clauses of clauses 57-60, wherein the method comprises a variant enzyme that expresses an asd, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with the amino acid sequence of SEQ ID No. 30 or 40.

62. The method of any one of clauses 57-61 and , wherein the method comprises a variant enzyme that expresses dapB, wherein the variant enzyme comprises an amino acid sequence sharing at least 70% sequence identity with the amino acid sequence of SEQ ID No. 46 or 48.

63. The method of any of clauses of clauses 57-62, wherein the method comprises expressing a variant enzyme of ddh, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with the amino acid sequence of SEQ ID No. 4.

64. The method of clause of clauses 57-63, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182.

65. The method of clause of clauses 57-63, wherein the method comprises a variant enzyme that expresses an asd, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, and 130.

66. The method of any of clauses 57-63, , wherein the method comprises expressing a variant enzyme of gdh, and comprises expressing a variant enzyme of asd, comprises expressing a variant enzyme of dapB, comprises expressing a variant enzyme of ddh.

67. The method of clause of clauses 57-66, wherein the compound is selected from table 2.

68. The method of clause 68, wherein the compound is lysine.

69. The method of clause 68, wherein the compound is threonine.

70. The method of any of clauses of clauses 57-69, wherein the host cell is a prokaryotic cell.

71. The method of clause 70, wherein the host cell is from a genus selected from the group consisting of agrobacterium, alicyclobacillus, candida, echinococcus, acinetobacter, acidothermus, arthrobacter, azotobacter, bacillus, bifidobacterium, brevibacterium, butyrosporium, buchnera, cuscuta, campylobacter, clostridium, corynebacterium, sulforaphite, coprococcus, escherichia, enterococcus, enterobacter, erwinia, clostridium, copribacterium, franciscensis, flavobacterium, geobacillus, haemophilus, helicobacter, klebsiella, lactobacillus, lactococcus, muddy bacillus, micrococcus, microbacterium, mesorhizobium, methylobacter, mycobacterium, nei, pantoea, pseudomonas, chlorococcum, rhodobacter, rhodopseudomonas, rhodospirillum, streptomyces, streptococcus thermophilus, yersinia, rhodobacter, yarrowia, rhodobacter.

72. The method of clause 71, wherein the host cell is corynebacterium glutamicum.

73. The method of clause 71, wherein the host cell is e.

74. The method of any of clauses 57-69, , wherein the host cell is a eukaryotic cell.

75. The method of clause 74, wherein the host cell is from a genus selected from the group consisting of: gossypium, Acremonium, Aspergillus, Aureobasidium, Byssochlamus, Ceriporiopsis, Cephalosporium, Chrysosporium, Courospora, Cladosporium, Cryptotheca, Coprinus, Coriolus, Chroospora, Neurospora, Fusarium, Gibberella, Gliocladium, Humus, Hypocrea, myceliophthora, Mucor, Neurospora, Podospora, Phlebia, Ruminochytrix, Rhizomucor, Rhizopus, Schizobium, Convolvulus, Sporothrix, Talaromyces, Thermoascus, Thielavia, trametes, Trichosporon, Trichoderma, Verticillium, and Microchaeta.

Host cell comprising a variant of gdh, asd, dapB or ddh

76. host cells comprising a variant of or more of the enzymes gdh, asd, dapB and ddh, wherein the variant exhibits bispecific for the coenzymes NADH and NADPH.

Methods of using novel nicotinamide nucleotide transhydrogenases

77. A method for increasing the efficiency of a host cell to produce a compound produced using NADPH, comprising expressing in said host cell a novel nicotinamide nucleotide transhydrogenase.

Method for improving L-lysine production efficiency through strategy

78. A method of increasing the efficiency of L-lysine production by a host cell, comprising two or more of:

(1) modifying endogenous GAPDH such that the modified GAPDH has increased specificity for coenzyme NADP relative to the corresponding naturally occurring GAPDH, (2) expressing in the host cell a variant enzyme of or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB) and meso-diaminopimelate dehydrogenase (ddh), wherein the variant enzyme exhibits bispecific properties for the coenzymes NADH and NADPH, and (3) expressing in the host cell a novel nicotinamide nucleotide transhydrogenase.

Methods of using gdh and/or asd

79. A method of increasing the efficiency of a host cell to produce a compound produced using NADPH, comprising expressing in the host cell a variant enzyme of or both of the enzymes glutamate dehydrogenase (gdh) and aspartate semialdehyde dehydrogenase (asd), wherein the variant enzyme exhibits bispecific to the coenzymes NADH and NADPH.

80. The method of clause 79, wherein the variant enzyme uses NADH more efficiently than NADPH.

81. The method of clause 79 or 80, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182.

82. The method of clause 81, wherein the variant enzyme of gdh comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 144, 150, 162, 166, 170, 174, and 178.

83. The method of clause of clauses 79-82, wherein the method comprises a variant enzyme that expresses asd, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, and 130.

84. The method of clause 83, wherein the variant enzyme of asd comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 108 and 118.

Method for increasing efficiency of producing L-threonine using threonine aldolase

85. A method for increasing the efficiency of L-threonine production by a host cell, comprising expressing in the host cell a threonine aldolase variant enzyme, wherein the variant enzyme exhibits a different substrate preference or enzymatic kinetics than the E.coli threonine aldolase (ltaE).

86. The method of clause 85, wherein the variant enzyme promotes threonine production over glycine production.

87. The method of clause 85 or 86, wherein the method comprises a variant enzyme that expresses a threonine aldolase, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

88. The method of clause 87, wherein the variant enzyme comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 196, 206, 220, 224, and 232.

89. The method of any of clauses of clauses 85 to 88, wherein the host cell is a prokaryotic cell.

90. The method of clause 89, wherein the host cell is from a genus selected from the group consisting of Agrobacterium, Alicyclobacillus, Candida, Pleurocystis, Acinetobacter, Acidothermus, Arthrobacter, Azotobacter, Bacillus, Bifidobacterium, Brevibacterium, butyric acid Vibrio, Buhnella, Trupenam, Campylobacter, Clostridium, Corynebacterium, Thiobacillus, fecal coccus, Escherichia, enterococcus, Enterobacter, Erwinia, Clostridium, fecal Bacillus, Francisella, Flavobacterium, Geobacillus, Haemophilus, Spirulina, Klebsiella, Lactobacillus, lactococcus, Clavibacterium, Micrococcus, Microbacterium, Medinium, Methylobacterium, Mycobacterium, Neisseria, Pantoea, Pseudomonas, Chlorococcus, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Sclerotium, Streptomyces, Streptococcus, Thermus, Yersinia, Pyrococcus, Thermomyces, , Thermomyces, and Thermomyces.

91. The method of clause 90, wherein the host cell is corynebacterium glutamicum.

92. The method of clause 90, wherein the host cell is e.

93. The method of any of clauses of clauses 85 to 88, wherein the host cell is a eukaryotic cell.

94. The method of clause 93, wherein the host cell is from a genus selected from the group consisting of: gossypium, Acremonium, Aspergillus, Aureobasidium, Byssochlamus, Ceriporiopsis, Cephalosporium, Chrysosporium, Courospora, Cladosporium, Cryptotheca, Coprinus, Coriolus, Chroospora, Neurospora, Fusarium, Gibberella, Gliocladium, Humus, Hypocrea, myceliophthora, Mucor, Neurospora, Podospora, Phlebia, Ruminochytrix, Rhizomucor, Rhizopus, Schizobium, Convolvulus, Sporothrix, Talaromyces, Thermoascus, Thielavia, trametes, Trichosporon, Trichoderma, Verticillium, and Microchaeta.

Method for improving L-threonine production efficiency by mutant enzyme

95. A method of increasing L-threonine production in a host cell, comprising expressing in the host cell or more of the enzymes glyceraldehyde 3-phosphate dehydrogenase (gapA), glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), threonine aldolase (ltaE) and pyruvate carboxylase (pyc) a variant enzyme.

96. The method of clause 95, wherein the variant enzyme of gdh or the variant enzyme of asd exhibits bispecific for the coenzymes NADH and NADPH.

97. The method of clause 95, wherein the variant enzyme of gapA, the variant enzyme of gdh, or the variant enzyme of asd uses NADH more efficiently than NADPH.

98. The method of any of clauses of clauses 95 to 97, wherein the variant enzyme of the threonine aldolase promotes threonine production over glycine production.

99. The method of clause of clauses 95-98, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182.

100. The method of clause 99, wherein the variant enzyme of gdh comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 144, 150, 162, 166, 170, 174, and 178.

101. The method of clause of clauses 95-100, wherein the method comprises a variant enzyme that expresses asd, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, and 130.

102. The method of clause 101, wherein the variant enzyme of asd comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 108 and 118.

103. The method of clause of clauses 95-102, wherein the method comprises a variant enzyme that expresses a threonine aldolase, wherein the variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

104. The method of clause 103, wherein the variant enzyme of threonine aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 196, 206, 220, 224, and 232.

105. The method of clause of clauses 95-104, wherein the method comprises a gapA-expressing variant enzyme, wherein the gapA variant enzyme comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

106. The method of clause of clauses 95-105, wherein the method comprises expressing a gapA variant enzyme, wherein the gapA variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with the amino acid sequence of SEQ ID NO: 58.

107. The method of clause of clauses 95-105, wherein the method comprises a gapA-expressing variant enzyme, wherein the gapA variant enzyme comprises an amino acid sequence that shares at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs 294, 296, 233, 234, 235, 236, 298, and 300.

108. The method of clauses 106 or 107, wherein the variant enzyme of gapA comprises an amino acid substitution at the position corresponding to amino acid 37 of SEQ ID NO: 58.

109. The method of clauses 106 or 107, wherein the variant enzyme of gapA comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

110. The method of clause 108 or 109, wherein the residue of the variant enzyme of gapA at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

111. The method of clause 109, wherein the residue of the variant enzyme of gapA at the position corresponding to amino acid 36 of SEQ ID NO:58 is threonine and the residue of the variant enzyme of gapA at the position corresponding to amino acid 37 of SEQ ID NO:58 is lysine.

112. The method of clause of clauses 106-111, wherein the variant enzyme of gapA comprises an amino acid substitution at the position corresponding to amino acid 192 of SEQ ID NO: 58.

113. The method of clause 112, wherein the residue of the gapA variant enzyme at the position corresponding to amino acid 192 of SEQ ID NO:58 is serine.

114. The method of clause of clauses 106-113, wherein the residue of the variant enzyme of gapA at the position corresponding to amino acid 224 of SEQ ID NO:58 is serine.

115. The method of clause of clauses 106-114, wherein the residue of the gapA variant enzyme at the position corresponding to amino acid 110 of SEQ ID NO:58 is aspartic acid.

116. The method of clause of clauses 106-115, wherein the residue of the gapA variant enzyme at the position corresponding to amino acid 140 of SEQ ID NO:58 is glycine.

117. The method of clause of clauses 95-105, wherein the method comprises a variant enzyme that expresses gapA, wherein the variant enzyme of gapA comprises an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

Threonine basic strains

118, host cells comprising a multicopy replicating plasmid comprising a thrA gene, thrB gene, and thrC gene each operably linked to or multiple synthetic promoters.

119. The host cell of clause 118, wherein the host cell is a tdh deleted (Δ tdh) cell.

120. The host cell of clause 118 or 119, wherein the multicopy replicating plasmid comprises a sequence at least 70% identical to the thrABC operon sequence of SEQ ID NO: 77.

Methods for increasing the efficiency of compound production by strategies comprising threonine aldolase and pyruvate carboxylase

121, A method of increasing the efficiency of a host cell to produce a compound, comprising two or more of:

(1) engineering the glycolytic pathway to produce NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA), making the enzyme bispecific for NADP and NAD; (2) expressing a transhydrogenase which produces NADPH from NADH in the host cell; (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologues of endogenous gdh, asd, dapB and ddh enzymes that use NADH as a cofactor more efficiently than NADPH; (4) reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of the endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH; (5) reprogramming threonine synthesis by expressing a homologue of an endogenous L-threonine aldolase (ItA) that reduces or reverses the degradation of threonine to glycine; and (6) expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or to increase expression of endogenous pyc.

122. The method of clause 121, wherein the NADPH-producing glycolytic pathway is engineered to comprise a variant enzyme that expresses gapA comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 294, 296, 233, 234, 235, 236, 298, and 300 by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA), making the enzyme bispecific for NADP and NAD.

123. The method of clause 121 or 122, wherein the DAP-pathway for lysine synthesis is reprogrammed to comprise or more of the following by expressing homologs of endogenous gdh, asd, dapB, and ddh enzymes that more efficiently use NADH as a cofactor compared to NADPH:

iii) a variant enzyme expressing dapB, the variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 46 and 48; and

iv) expressing a variant enzyme of ddh comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.

124. The method of clause of clauses 121-123, wherein the reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH comprises or more of:

125. The method of clause of clauses 121-124, wherein the reprogramming of threonine synthesis by expressing a homolog of an endogenous L-threonine aldolase (ItA) that reduces or reverses degradation of threonine to glycine comprises expressing a variant enzyme of ltA comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

126. The method of clause of clauses 121-125, wherein the expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or increasing expression of endogenous pyc comprises expressing a variant enzyme of pyc comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230 and 232241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 263, 265, 267, 269, 273, 275, 277, 279, 281, 283, 285, 287, and 289.

Novel gapA variant-polynucleotides

127, artificial polynucleotides encoding a truncated glyceraldehyde-3-phosphate dehydrogenase (gapA) gene, wherein said polynucleotides comprise a sequence at least 85%, 90%, 95% or 99% identical to a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 290, 291, 292 and 293.

128. The artificial polynucleotide of clause 127, wherein the polynucleotide comprises a polynucleotide sequence selected from the group consisting of SEQ ID NOs 290, 291, 292, and 293.

129, , comprising the artificial polynucleotide of clause 127 or 128 operably linked to a promoter.

Novel gapA variant proteins

A recombinant protein fragment of glyceraldehyde-3-phosphate dehydrogenase (gapA), wherein said recombinant protein fragment comprises a sequence at least 70%, 80%, 90% or 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236 and 298.

131. The recombinant protein fragment of clause 130, wherein the recombinant protein fragment comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236, and 298.

132. The recombinant protein fragment of clause 130 or 131, wherein the recombinant protein fragment lacks gapA activity.

133. The recombinant protein fragment of clause of any of clauses 130 to 133, wherein the recombinant protein fragment enhances the productivity of a compound selected from table 2 of the host cell when the host cell comprises another protein having gapA activity.

OTHER EMBODIMENTS

134, a method of increasing the ability of a microbial cell to produce a compound that uses NADPH to produce, the method comprising altering the available NADPH of the cell.

135. The method of claim 134, wherein the available NADPH is altered by expressing a modified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the cell, wherein the modified GAPDH is modified such that its coenzyme is specifically broadened.

136. The method of claim 134, wherein the available NADPH of the cell is altered by expressing or more of the enzymes glutamate dehydrogenase (gdh), aspartate semialdehyde dehydrogenase (asd), dihydropyridine formate reductase (dapB), and meso-diaminopimelate dehydrogenase (ddh) in the microbial cell, wherein the variant enzymes exhibit dual specificity for the coenzymes NADH and NADPH.

137. The method of claim 135, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to the corresponding naturally occurring GAPDH.

138. The method of any of technical aspects of technical aspects 134 to 137, wherein the microbial cells are bacterial cells.

139. The method of claim 138, wherein the bacterial cell is from a bacterium selected from the group consisting of corynebacterium, escherichia, bacillus, or geobacillus.

140. The method of claim 138, wherein the bacterium is corynebacterium glutamicum or escherichia coli.

141. The method of any of technical aspects of technical aspects 134 to 137, wherein the microbial cells are yeast cells.

142. The method of claim 141, wherein the yeast cell is a cell from the genus saccharomyces.

143. The method of claim 137, wherein the naturally occurring GAPDH is gapA.

144. The method of claim 143, wherein said gapA has the amino acid sequence of SEQ ID NO 58.

145. The method of claim 134, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID NO: 58.

146. The method of claim 134, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 294, 296, 233, 234, 235, 236, 298, and 300.

147. The method of claim 145 or 146, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 37 of SEQ ID NO: 58.

148. The method of claim 147, wherein the modified GAPDH comprises amino acid substitutions at positions corresponding to amino acids 36 and 37 of SEQ ID NO: 58.

149. The method of claim 147, wherein the threonine at the position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with lysine.

150. The method of claim 148, wherein the leucine at a position corresponding to amino acid 36 of SEQ ID NO:58 has been replaced with threonine and the threonine at a position corresponding to amino acid 37 of SEQ ID NO:58 has been replaced with lysine.

151. The method of claim 135, wherein the modified GAPDH comprises an amino acid substitution at a position corresponding to amino acid 192 of SEQ ID NO: 58.

152. The method of claim 135, wherein the proline at the position corresponding to amino acid 172 of SEQ ID NO:58 has been replaced with serine.

153. The method of claim 135, wherein the leucine at a position corresponding to amino acid 224 of SEQ ID NO:58 has been replaced with serine.

154. The method of claim 135, wherein the histidine at the position corresponding to amino acid 110 of SEQ ID NO:58 has been replaced with aspartic acid.

155. The method of claim 135, wherein the tyrosine at the position corresponding to amino acid 140 of SEQ ID NO:58 has been replaced with glycine.

156. The method of claim 146, wherein the modified GAPDH is selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

157. The method of any one of technical embodiments of technical embodiments 134 to 137, wherein the compound is selected from table 2.

158. The method of claim 157, wherein the compound is L-lysine or L-threonine.

159, microbial cells comprising a modified GAPDH having a broadened coenzyme specificity relative to a naturally occurring GAPDH, wherein the microbial cells increase production of a compound produced using NADPH relative to a corresponding microbial cell lacking the modified GAPDH.

160. The microbial cell of claim 159, wherein the modified GAPDH has increased specificity for NADP relative to the naturally occurring GAPDH.

161. The microbial cell of claim 160, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to SEQ ID NO: 58.

162. The microbial cell of claim 160, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to an amino acid sequence selected from the group consisting of SEQ id nos 294, 296, 233, 234, 235, 236, 298, and 300.

163. The microbial cell of claim 160, wherein the modified GAPDH comprises an amino acid sequence at least 70% identical to SEQ ID NO:58 and wherein the modified GAPDH comprises a substitution of an amino acid at position 36, 37 or both positions of SEQ ID NO: 58.

164. The microbial cell of claim 160, wherein the modified GAPDH is selected from the group consisting of SEQ ID NOs 69, 71, 73, 303, 294, 296, 233, 234, 235, 236, 298, and 300.

165. The microbial cell of claim 159, wherein the compound is selected from table 2.

166. The microbial cell of claim 165, wherein the compound is L-lysine or L-threonine.

167. The microbial cell of claim 159, wherein the microbial cell is from a bacterium.

168. The microbial cell of claim 167, wherein the bacterium is a coryneform bacterium, Escherichia bacterium, Bacillus bacterium, or Geobacillus bacterium.

169. The microbial cell of claim 168, wherein the bacterium is corynebacterium glutamicum or escherichia coli.

170. The microbial cell of claim 165, wherein the microbial cell is a yeast cell.

171, A method of broadening the coenzyme specificity of GAPDH comprising modifying said GAPDH such that the modified GAPDH has dual specificity for the coenzymes NADP and NAD.

172. The method of claim 171, wherein the modified GAPDH has increased specificity for coenzyme NADP relative to NAD.

173. The method of claim 172, wherein the modified GAPDH uses NADP more efficiently than NAD.

174. The method of claim 136, wherein the method comprises a variant enzyme that expresses gdh, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID No. 42 or 44.

175. The method of claim 136, wherein the method comprises expressing a variant enzyme of an asd, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID No. 30 or 40.

176. The method of claim 136, wherein the method comprises a variant enzyme that expresses dapB, wherein the variant enzyme comprises an amino acid sequence at least 70% identical to the amino acid sequence of SEQ ID NO. 46 or 48.

177. The method of claim 136, wherein the method comprises expressing a variant enzyme of ddh, wherein the ddh enzyme comprises the amino acid sequence of SEQ ID No. 4.

178. The method of claim 136, wherein the method comprises a gdh-expressing variant enzyme, wherein the variant enzyme comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, and 182.

179. The method of claim 136, wherein the method comprises a variant enzyme that expresses asd, wherein the variant enzyme comprises an amino acid sequence at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, and 130.

180. The method of claim 136, wherein variants of all four enzymes are expressed simultaneously in the microbial cell.

181, microbial cells comprising a variant of or more of the enzymes gdh, asd, dapB and ddh, wherein said variant exhibits bispecific properties against the coenzymes NADH and NADPH.

182. The method of claim 178, wherein the variant enzyme of gdh comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 144, 150, 162, 166, 170, 174, 178.

183. The method of claim 179, wherein the variant enzyme of asd comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 108 and 118.

184. The method of any of technical schemes 134 to 137, , further step comprising expressing in the microbial cell a threonine aldolase variant enzyme, wherein the threonine aldolase variant enzyme exhibits a different substrate preference or enzymatic kinetics than the e.

185. The method of claim 184, wherein the iso-threonine aldolase promotes threonine production over glycine production.

186. The method of claim 184, wherein said variant threonine aldolase comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

187. The method of claim 186, wherein said variant threonine aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 196, 206, 220, 224, and 232.

188. The method of claim 184, wherein said compound is L-threonine.

189. The method of claim 140, wherein said bacterium is escherichia coli and said method further comprising the step of expressing pyc in said escherichia coli cells.

190. The method of claim 189, wherein the method comprises expressing a variant enzyme of pyc, wherein the variant enzyme of pyc comprises an amino acid sequence that is at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, and 289.

191, microbial cells comprising a multicopy replicating plasmid comprising a thrA gene, thrB gene, and thrC gene each operably linked to or multiple synthetic promoters.

192. The microbial cell of claim 191, wherein the microbial cell is a tdh deleted (Δ tdh) cell.

193. The microbial cell of claim 191, wherein the multicopy replicating plasmid comprises a sequence at least 70% identical to the thrABC operon sequence of SEQ ID NO: 77.

194, a method of increasing the efficiency of a microbial cell to produce a compound, comprising two or more of:

(1) engineering the glycolytic pathway to produce NADPH by broadening the coenzyme specificity of the endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA), making the enzyme bispecific for NADP and NAD; (2) expressing a transhydrogenase which produces NADPH from NADH in the bacterium; (3) reprogramming the DAP-pathway for lysine synthesis by expressing homologues of endogenous gdh, asd, dapB and ddh enzymes that use NADH as a cofactor more efficiently than NADPH; (4) reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of the endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH; (5) reprogramming threonine synthesis by expressing a homologue of an endogenous L-threonine aldolase (ItA) that reduces or reverses the degradation of threonine to glycine; and (6) expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or to increase expression of endogenous pyc.

195. The method of claim 194, wherein the compound is selected from table 2.

196. The method of claim 195, wherein said compound is L-threonine.

197. The method of any of claims 194-196, wherein the NADPH-producing glycolytic pathway is engineered to comprise a gapA-expressing variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ id nos 294, 296, 233, 234, 235, 236, 298, and 300 by broadening the coenzyme specificity of an endogenous glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (gapA), making the enzyme bispecific for NADP and NAD.

198. The method of any of claims 194 to 196, wherein the reprogramming of the DAP-pathway for lysine synthesis by expressing homologues of endogenous gdh, asd, dapB, and ddh enzymes that use NADH as a cofactor more efficiently than NADPH comprises or more of:

iii) a variant enzyme expressing dapB, the variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 46 and 48; and

iv) expressing a variant enzyme of ddh comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.

199. The method of any of claims 194 to 196, wherein the reprogramming the thrABC-pathway for threonine synthesis by expressing homologues of endogenous gdh and asd enzymes that use NADH as a cofactor more efficiently than NADPH comprises or more of:

200. The method of any of claims 194-196, wherein the reprogramming of threonine synthesis by expression of a homolog of an endogenous L-threonine aldolase (ItA) that reduces or reverses degradation of threonine to glycine comprises a variant enzyme that expresses ltA, the variant enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, and 232.

201. The method of any of claims 194 to 196, wherein the expressing a heterologous pyruvate carboxylase (pyc) or a homologue thereof to increase synthesis of oxaloacetate, or increasing expression of endogenous pyc comprises expressing a variant enzyme of pyc comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230 and 232241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287 and 289.

202, artificial polynucleotides encoding a truncated glyceraldehyde-3-phosphate dehydrogenase (gapA) gene, wherein said polynucleotides comprise a sequence at least 70% identical to a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 290, 291, 292, and 293.

203. The artificial polynucleotide of claim 202, wherein the polynucleotide comprises a polynucleotide sequence selected from the group consisting of SEQ ID NOs 290, 291, 292, and 293.

204, , comprising the artificial polynucleotide of clause 202 or 203 operably linked to a promoter.

A recombinant protein fragment of the 205, glyceraldehyde-3-phosphate dehydrogenase (gapA), wherein said recombinant protein fragment comprises a sequence at least 70% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236, and 298.

206. The recombinant protein fragment of claim 205, wherein the recombinant protein fragment comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 233, 234, 235, 236, and 298.

207. The recombinant protein fragment of claims 205 or 206, wherein said recombinant protein fragment lacks gapA activity.

208. The recombinant protein fragment of claim 207, wherein the recombinant protein fragment enhances the productivity of a compound selected from table 2 of a microbial cell when the microbial cell comprises another protein having gapA activity.

209. The microbial cell of any of claims 159-169 or , wherein the microbial cell further comprises step an iso-threonine aldolase, a pyc protein, or both.

Incorporation by reference

All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entirety for all purposes.

However, a reference to any reference, article, publication, patent publication, or patent application cited herein is not, and should not be taken as, an acknowledgment or any form of suggestion that it forms part of the common general knowledge in any country in the world. Specifically, the following applications are incorporated herein by reference in their entirety: united states application No. 15/396,230 filed on 30/12/2016; international application No. PCT/US2016/065465, filed 2016, 12, 7, 2016; united states application No. 15/140,296 filed on 2016, 4, 27; united states provisional application No. 62/368,786 filed 2016, 7, 29; and U.S. provisional application No. 62/264,232 filed on 7/12/2015.

Sequence listing

<110> Zimmergen Inc. (Zymeergen Inc.)

S. Manchester (Manchester, Shawn)

<120> genome engineering of NADPH-increasing biosynthetic pathway

<130>ZYMR-011/01WO 327574-2057

<150>US 62/508,589

<151>2017-05-19

<160>308

<170>PatentIn version 3.5

<210>1

<211>969

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from Actinomyces oralis

<400>1

atgattcgcg ttgcgatcaa tggatatggc aacctgggac ggggtgtcga acaagcgatt 60

acgaagaacg cggacatgga agtcgcggtc gtgtttacgc gccgcgaccc agctacggtg 120

actacccagg gcgcccccgt cgcccatgtt gatgacatgg ccgcttgggc cgataaagtg 180

gatgtctgtc ttaactgcgg cggatcagcg accgacttga ttgaacaaac gcccgctgcg 240

gcagctcttt tcaacaccgt agattcgttc gatacgcatg cccggattcc tgagcatttc 300

gccgcggtgg acgccgcagc gaaggcatca ggccatgtgg cgttgatttc agcgggctgg 360

gacccaggac ttttttccat gctccgggtc ctcggcgaag cagtcctccc agacggtgct 420

accacgacct tctggggccc cggagtttcg cagggtcatt cagacgctct gcgtcgcatc 480

gacggtgtgg tagatgcgaa acaatacact cggccagtcg aggcaacggtggctgccgtc 540

aaggcaggag atgatgttga gctcactacg cgctcaatgc acactcgtga ctgctatgta 600

gttgcggagg aaggcgcaga tcttgcccgg atcgagcggg agatcgttga gatgcccaat 660

tacttcgctg attacgatac taccgttact ttcattactg ccgaggaact tgccgcggag 720

cacgcgggta ttccgcatgg aggatcggta attcggcgtg gccataccag cgaaggagtg 780

gccgaaaccg tgtcgtttga gctgcaattg ggctctaacc ccgaatttac gggatcagtc 840

ctggttgcta cggcgcgtgc tgtcgcacgg cttgctgccc ggggcgaaac tggtgcccgg 900

acggtttttg acgttactct tgccgacttg tctccgacta gccccgagga gctccgtgct 960

cactacctg 969

<210>2

<211>323

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from Actinomyces oralis

<400>2

Met Ile Arg Val Ala Ile Asn Gly Tyr Gly Asn Leu Gly Arg Gly Val

1 5 10 15

Glu Gln Ala Ile Thr Lys Asn Ala Asp Met Glu Val Ala Val Val Phe

20 25 30

Thr Arg Arg Asp Pro Ala Thr Val Thr Thr Gln Gly Ala Pro Val Ala

35 40 45

His Val Asp Asp Met Ala Ala Trp Ala Asp Lys Val Asp Val Cys Leu

50 55 60

Asn Cys Gly Gly Ser Ala Thr Asp Leu Ile Glu Gln Thr Pro Ala Ala

65 70 75 80

Ala Ala Leu Phe Asn Thr Val Asp Ser Phe Asp Thr His Ala Arg Ile

85 90 95

Pro Glu His Phe Ala Ala Val Asp Ala Ala Ala Lys Ala Ser Gly His

100 105 110

Val Ala Leu Ile Ser Ala Gly Trp Asp Pro Gly Leu Phe Ser Met Leu

115 120 125

Arg Val Leu Gly Glu Ala Val Leu Pro Asp Gly Ala Thr Thr Thr Phe

130 135 140

Trp Gly Pro Gly Val Ser Gln Gly His Ser Asp Ala Leu Arg Arg Ile

145 150 155 160

Asp Gly Val Val Asp Ala Lys Gln Tyr Thr Arg Pro Val Glu Ala Thr

165 170 175

Val Ala Ala Val Lys Ala Gly Asp Asp Val Glu Leu Thr Thr Arg Ser

180 185 190

Met His Thr Arg Asp Cys Tyr Val Val Ala Glu Glu Gly Ala Asp Leu

195 200 205

Ala Arg Ile Glu Arg Glu Ile Val Glu Met Pro Asn Tyr Phe Ala Asp

210 215 220

Tyr Asp Thr Thr Val Thr Phe Ile Thr Ala Glu Glu Leu Ala Ala Glu

225 230 235 240

His Ala Gly Ile Pro His Gly Gly Ser Val Ile Arg Arg Gly His Thr

245 250 255

Ser Glu Gly Val Ala Glu Thr Val Ser Phe Glu Leu Gln Leu Gly Ser

260 265 270

Asn Pro Glu Phe Thr Gly Ser Val Leu Val Ala Thr Ala Arg Ala Val

275 280 285

Ala Arg Leu Ala Ala Arg Gly Glu Thr Gly Ala Arg Thr Val Phe Asp

290 295 300

Val Thr Leu Ala Asp Leu Ser Pro Thr Ser Pro Glu Glu Leu Arg Ala

305 310 315 320

His Tyr Leu

<210>3

<211>960

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from Corynebacterium glutamicum

<400>3

atgacgaaca tccgtgtagc aatcgtcgga tacggtaatc tgggacgcag cgtagaaaaa 60

ctcatcgcca agcaaccaga catggatctt gttggaattt tctcgcgccg ggcgactctc 120

gatacgaaga cccccgtctt cgatgtggcg gacgttgata aacatgccga tgatgtcgat 180

gtactctttt tgtgcatggg atctgcaacg gatatcccgg agcaagcccc caagttcgct 240

caatttgcct gtacggtgga cacgtacgat aatcatcgtg atatcccccg gcatcgccaa 300

gttatgaatg aagctgcaac cgcagcaggc aatgtagcgt tggtttctac gggctgggac 360

ccaggcatgt tttcgattaa tcgtgtttat gccgctgctg ttttggccga gcaccagcaa 420

cacacgtttt ggggtccagg acttagccag ggccatagcg atgcccttcg ccgcatcccg 480

ggtgttcaaa aggctgttca gtacacgttg ccttctgaag atgcgcttga aaaagcacgg 540

cgcggcgagg ccggagattt gaccggcaag caaacgcata aacgccagtg cttcgttgtg 600

gccgacgcgg ccgaccatga gcgcatcgag aacgatattc ggactatgcc cgattacttc 660

gtaggctatg aggtggaagt caatttcatc gatgaagcaa ccttcgactc tgaacatacg 720

ggtatgcccc acggcggtca cgtgatcacg actggcgaca ctggcggttt taaccacacc 780

gttgagtata ttctcaagct ggaccgtaat cccgacttca ctgcgtcctc tcaaatcgcg 840

ttcggccgtg cagcgcaccg catgaaacaa caaggccaat caggtgcctt taccgttctg 900

gaagttgccc catatttgtt gagcccggaa aacttggacg acttgattgc ccgggatgtg 960

<210>4

<211>320

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from Corynebacterium glutamicum

<400>4

Met Thr Asn Ile Arg Val Ala Ile Val Gly Tyr Gly Asn Leu Gly Arg

1 5 10 15

Ser Val Glu Lys Leu Ile Ala Lys Gln Pro Asp Met Asp Leu Val Gly

20 25 30

Ile Phe Ser Arg Arg Ala Thr Leu Asp Thr Lys Thr Pro Val Phe Asp

35 40 45

Val Ala Asp Val Asp Lys His Ala Asp Asp Val Asp Val Leu Phe Leu

50 55 60

Cys Met Gly Ser Ala Thr Asp Ile Pro Glu Gln Ala Pro Lys Phe Ala

65 70 75 80

Gln Phe Ala Cys Thr Val Asp Thr Tyr Asp Asn His Arg Asp Ile Pro

85 90 95

Arg His Arg Gln Val Met Asn Glu Ala Ala Thr Ala Ala Gly Asn Val

100 105 110

Ala Leu Val Ser Thr Gly Trp Asp Pro Gly Met Phe Ser Ile Asn Arg

115 120 125

Val Tyr Ala Ala Ala Val Leu Ala Glu His Gln Gln His Thr Phe Trp

130 135 140

Gly Pro Gly Leu Ser Gln Gly His Ser Asp Ala Leu Arg Arg Ile Pro

145 150 155 160

Gly ValGln Lys Ala Val Gln Tyr Thr Leu Pro Ser Glu Asp Ala Leu

165 170 175

Glu Lys Ala Arg Arg Gly Glu Ala Gly Asp Leu Thr Gly Lys Gln Thr

180 185 190

His Lys Arg Gln Cys Phe Val Val Ala Asp Ala Ala Asp His Glu Arg

195 200 205

Ile Glu Asn Asp Ile Arg Thr Met Pro Asp Tyr Phe Val Gly Tyr Glu

210 215 220

Val Glu Val Asn Phe Ile Asp Glu Ala Thr Phe Asp Ser Glu His Thr

225 230 235 240

Gly Met Pro His Gly Gly His Val Ile Thr Thr Gly Asp Thr Gly Gly

245 250 255

Phe Asn His Thr Val Glu Tyr Ile Leu Lys Leu Asp Arg Asn Pro Asp

260 265 270

Phe Thr Ala Ser Ser Gln Ile Ala Phe Gly Arg Ala Ala His Arg Met

275 280 285

Lys Gln Gln Gly Gln Ser Gly Ala Phe Thr Val Leu Glu Val Ala Pro

290 295 300

Tyr Leu Leu Ser Pro Glu Asn Leu Asp Asp Leu Ile Ala Arg Asp Val

305 310 315 320

<210>5

<211>993

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from hyperthermophilic archaea

<400>5

atgaaaaaaa tcaacgtcgg aattattggt tacggtaacg tcggacgggg tgtgaagcaa 60

gctctcgaga aaaacgcaga catgaaactg gtcgctatcc tgactcgtcg cccagagcgg 120

gtacggaagg aaatcaaaga cgtgcatgtt ttccggactg atgaatcgtt gccgaaatcc 180

tttgaaatcg acgtggcggt cttgtgtggt ggatccaaga aagacatgcc aatccaaggt 240

ccaaaatttg cggccaaata caacaccgtt gatagcttcg acacccatgc cgacatccct 300

agctatttca agaaaatgga ttcaatcgct aaaaaacatg gtaatgtgtc tatcatctca 360

gcgggatggg atcccggtat tttcagcctg gagcgtgtcc ttggcggcgc ttttctgccg 420

gaatctaagc ggtatacgtt ttggggcaag ggtgtgtctc tcggtcactc tgatgctgct 480

cgccgcgtga aaggtgtctc tgatgctatt caatacacca ttccgattga gaaggctatt 540

caacgcatcc gtgcgggaga tgcgccagac tttagcaaaa cggaaatgca caagcgcgtt 600

gtttacgttg tccctgaaga gggtgccgac cttaagaaaa tccggaagga aattaccgag 660

atgccaaagt attttgaagg atatgatacg gaggtcattt ttatcactga gaaagaaatg 720

aaaaaacact ccacgtttcc ccacggcggc tttgtcttca ctagcggtgt aacgggagat 780

tctaaccgtc aaatcctcga atataaatgc cagctcgaga acaatagcga gttcactgcg 840

tctgtccttg tagcgtgcgc acgcgctgcg tatcgtctga atgagaaagg ctaccgtggt 900

gcttttacct ttttggactt tcccttgtcg tttcttatcg agtcggagtt tagcgcgtgc 960

ttcgaaagcc gcgcccggcg caatccctct cct 993

<210>6

<211>331

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from hyperthermophilic archaea

<400>6

Met Lys Lys Ile Asn Val Gly Ile Ile Gly Tyr Gly Asn Val Gly Arg

1 5 10 15

Gly Val Lys Gln Ala Leu Glu Lys Asn Ala Asp Met Lys Leu Val Ala

20 25 30

Ile Leu Thr Arg Arg Pro Glu Arg Val Arg Lys Glu Ile Lys Asp Val

35 40 45

His Val Phe Arg Thr Asp Glu Ser Leu Pro Lys Ser Phe Glu Ile Asp

50 55 60

Val Ala Val Leu Cys Gly Gly Ser Lys Lys Asp Met Pro Ile Gln Gly

65 70 75 80

Pro Lys Phe Ala Ala Lys Tyr Asn Thr Val Asp Ser Phe Asp Thr His

85 90 95

Ala Asp Ile Pro Ser Tyr Phe Lys Lys Met Asp Ser Ile Ala Lys Lys

100 105 110

His Gly Asn Val Ser Ile Ile Ser Ala Gly Trp Asp Pro Gly Ile Phe

115 120 125

Ser Leu Glu Arg Val Leu Gly Gly Ala Phe Leu Pro Glu Ser Lys Arg

130 135 140

Tyr Thr Phe Trp Gly Lys Gly Val Ser Leu Gly His Ser Asp Ala Ala

145 150 155 160

Arg Arg Val Lys Gly Val Ser Asp Ala Ile Gln Tyr Thr Ile Pro Ile

165 170 175

Glu Lys Ala Ile Gln Arg Ile Arg Ala Gly Asp Ala Pro Asp Phe Ser

180 185 190

Lys Thr Glu Met His Lys Arg Val Val Tyr Val Val Pro Glu Glu Gly

195 200 205

Ala Asp Leu Lys Lys Ile Arg Lys Glu Ile Thr Glu Met Pro Lys Tyr

210 215 220

Phe Glu Gly Tyr Asp Thr Glu Val Ile Phe Ile Thr Glu Lys Glu Met

225 230 235 240

Lys Lys His Ser Thr Phe Pro His Gly Gly Phe Val Phe Thr Ser Gly

245 250 255

Val Thr Gly Asp Ser Asn Arg Gln Ile Leu Glu Tyr Lys Cys Gln Leu

260 265 270

Glu Asn Asn Ser Glu Phe Thr Ala Ser Val Leu Val Ala Cys Ala Arg

275 280 285

Ala Ala Tyr Arg Leu Asn Glu Lys Gly Tyr Arg Gly Ala Phe Thr Phe

290 295 300

Leu Asp Phe Pro Leu Ser Phe Leu Ile Glu Ser Glu Phe Ser Ala Cys

305 310 315 320

Phe Glu Ser Arg Ala Arg Arg Asn Pro Ser Pro

325 330

<210>7

<211>978

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from coprinus

<400>7

atgatcaaaa tcggcatcgt gggctacgga aacctgggac gtggtgtgga atgcgcggtc 60

catcattcgc aggatatgga attggcggga gttttcacgc ggcgcaatcc ggagacggtt 120

aaaactcaca ccgacgttcc tgtgtatgat atggagaaac tgtacgacat gcagggcgac 180

attgatgtcc tcgtgctgtg cggaggctcc gctaatgatc tgccgaagca gacggttgag 240

ttggcacagt atttcaatgt tgtagactct ttcgatactc atgccaaaat ccccgagcat 300

ttctctaatg ttaatcaaag cagcgagaaa ggtaaacata tttcgattat ttcagtaggc 360

tgggatcctg gattgttctc cctcaatcgg ctgtatggac aagcaattctgccgaatgga 420

aacgactaca ctttttgggg taaaggagtt tcacagggac attctgatgc gatccggcgt 480

atcgcaggcg ttaaagacgc gcgccagtac acgatccccg tggacgccgc gttggagagc 540

gttcgcaatg gagaaaatcc gaccctcacc actcgggaga agcacactcg ggagtgtttc 600

gttgtcgctg aagacggcgc tgaccttaaa gtgatcgaag aaacgatcaa gaccatgcca 660

aactattttg ctgactatga cacgactgtt catttcatct cggaggaaga gctgatgcgg 720

gatcatcaag gaattccgca tggtggcgtc gtacttcgca gcggaaccac gggctttgac 780

tatgagaaca agcacgtaat cgaatacaaa ctcactctgg attcgaaccc cgagttcacc 840

tcctctgttc tcgttgcata tgctcgggcc gcttatcgta tgcaccaaga gggccaatgc 900

ggttgtaaaa ctgtatttga tattgccccg gcataccttc acgttgaatc cggagaggaa 960

ttgcgtaaga aactcttg 978

<210>8

<211>326

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from coprinus

<400>8

Met Ile Lys Ile Gly Ile Val Gly Tyr Gly Asn Leu Gly Arg Gly Val

1 5 10 15

Glu Cys Ala Val His His Ser Gln Asp Met Glu Leu Ala Gly Val Phe

20 25 30

Thr Arg Arg Asn Pro Glu Thr Val Lys Thr His Thr AspVal Pro Val

35 40 45

Tyr Asp Met Glu Lys Leu Tyr Asp Met Gln Gly Asp Ile Asp Val Leu

50 55 60

Val Leu Cys Gly Gly Ser Ala Asn Asp Leu Pro Lys Gln Thr Val Glu

65 70 75 80

Leu Ala Gln Tyr Phe Asn Val Val Asp Ser Phe Asp Thr His Ala Lys

85 90 95

Ile Pro Glu His Phe Ser Asn Val Asn Gln Ser Ser Glu Lys Gly Lys

100 105 110

His Ile Ser Ile Ile Ser Val Gly Trp Asp Pro Gly Leu Phe Ser Leu

115 120 125

Asn Arg Leu Tyr Gly Gln Ala Ile Leu Pro Asn Gly Asn Asp Tyr Thr

130 135 140

Phe Trp Gly Lys Gly Val Ser Gln Gly His Ser Asp Ala Ile Arg Arg

145 150 155 160

Ile Ala Gly Val Lys Asp Ala Arg Gln Tyr Thr Ile Pro Val Asp Ala

165 170 175

Ala Leu Glu Ser Val Arg Asn Gly Glu Asn Pro Thr Leu Thr Thr Arg

180 185 190

Glu Lys His Thr Arg Glu Cys Phe Val Val Ala Glu Asp Gly Ala Asp

195 200 205

Leu Lys Val Ile Glu Glu Thr Ile Lys Thr Met Pro Asn Tyr Phe Ala

210 215 220

Asp Tyr Asp Thr Thr Val His Phe Ile Ser Glu Glu Glu Leu Met Arg

225 230 235 240

Asp His Gln Gly Ile Pro His Gly Gly Val Val Leu Arg Ser Gly Thr

245 250 255

Thr Gly Phe Asp Tyr Glu Asn Lys His Val Ile Glu Tyr Lys Leu Thr

260 265 270

Leu Asp Ser Asn Pro Glu Phe Thr Ser Ser Val Leu Val Ala Tyr Ala

275 280 285

Arg Ala Ala Tyr Arg Met His Gln Glu Gly Gln Cys Gly Cys Lys Thr

290 295 300

Val Phe Asp Ile Ala Pro Ala Tyr Leu His Val Glu Ser Gly Glu Glu

305 310 315 320

Leu Arg Lys Lys Leu Leu

325

<210>9

<211>981

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from methanotheileria chikura

<400>9

atggaaaagc tccgcattgg catcgtagga tacggaaatg ttggccgggc tgtggagctg 60

tctcttcgcc aaaacccgga tatgatggcc gcagtcgtct tgacccgccg tgacccccgt 120

ggtattcgga cgctcacgcc cggtttgatg gcctcttcga ttgaggaggc tgaacggtac 180

gcttcagagg tcgacgtggc cgtactctgt ggcggtagcg ctacggacct tccagttcaa 240

ggaccggcta tggcgtcaat tttcaacact gtagattcct acgacaatca tccgcgcatc 300

ccagaatact ttgcagcagt agattctgcg gcacgccgtg gccgtcggac cgcaatcgtg 360

agcaccggtt gggatcccgg tctgttctcg ttgatccgcc tgcttgagga ggccgttttg 420

cccgaaggca ctgattatac gttttggggc cctggagtgt cccaaggaca ttctgacgct 480

gtacggcggg tcgaaggagt gcgtgatgcg cgccaatata ctatccctat cgaggacacc 540

gtggctcgcg tgcgttccgg cgaggcaccc tccctcagca cccgggaacg ccatcttcgt 600

cgttgctacg tggtggccga agagggagcc gaccccggtg agatccgtga gaaaattcgg 660

tcaatgccta attattttgc agattatgat accaaggtct cgtttatttc gcaggaagag 720

atggaacgca gccacaaccg gatgccacat ggtggtttcg ttatgcgtgc gggaaagacc 780

gccgacggaa cgggtcacgt ccttgagttc cgtcttaaat tggactctaa ccccgctttc 840

accgcatccg tgttgttggc ttatgcacgt gcagcatatc ggctgcacca agaaggcgca 900

attggcgcac ggaccgtatt tgatgtaccg ccagcgcatc tgtctcctaa aacgccagag 960

gagattcgtc gttccatgct t 981

<210>10

<211>327

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from methanotheileria chikura

<400>10

Met Glu Lys Leu Arg Ile Gly Ile Val Gly Tyr Gly Asn Val Gly Arg

1 5 10 15

Ala Val Glu Leu Ser Leu Arg Gln Asn Pro Asp Met Met Ala Ala Val

20 25 30

Val Leu Thr Arg Arg Asp Pro Arg Gly Ile Arg Thr Leu Thr Pro Gly

35 40 45

Leu Met Ala Ser Ser Ile Glu Glu Ala Glu Arg Tyr Ala Ser Glu Val

50 55 60

Asp Val Ala Val Leu Cys Gly Gly Ser Ala Thr Asp Leu Pro Val Gln

65 70 75 80

Gly Pro Ala Met Ala Ser Ile Phe Asn Thr Val Asp Ser Tyr Asp Asn

85 90 95

His Pro Arg Ile Pro Glu Tyr Phe Ala Ala Val Asp Ser Ala Ala Arg

100 105 110

Arg Gly Arg Arg Thr Ala Ile Val Ser Thr Gly Trp Asp Pro Gly Leu

115 120 125

Phe Ser Leu Ile Arg Leu Leu Glu GluAla Val Leu Pro Glu Gly Thr

130 135 140

Asp Tyr Thr Phe Trp Gly Pro Gly Val Ser Gln Gly His Ser Asp Ala

145 150 155 160

Val Arg Arg Val Glu Gly Val Arg Asp Ala Arg Gln Tyr Thr Ile Pro

165 170 175

Ile Glu Asp Thr Val Ala Arg Val Arg Ser Gly Glu Ala Pro Ser Leu

180 185 190

Ser Thr Arg Glu Arg His Leu Arg Arg Cys Tyr Val Val Ala Glu Glu

195 200 205

Gly Ala Asp Pro Gly Glu Ile Arg Glu Lys Ile Arg Ser Met Pro Asn

210 215 220

Tyr Phe Ala Asp Tyr Asp Thr Lys Val Ser Phe Ile Ser Gln Glu Glu

225 230 235 240

Met Glu Arg Ser His Asn Arg Met Pro His Gly Gly Phe Val Met Arg

245 250 255

Ala Gly Lys Thr Ala Asp Gly Thr Gly His Val Leu Glu Phe Arg Leu

260 265 270

Lys Leu Asp Ser Asn Pro Ala Phe Thr Ala Ser Val Leu Leu Ala Tyr

275 280 285

Ala Arg Ala Ala Tyr Arg Leu His Gln Glu GlyAla Ile Gly Ala Arg

290 295 300

Thr Val Phe Asp Val Pro Pro Ala His Leu Ser Pro Lys Thr Pro Glu

305 310 315 320

Glu Ile Arg Arg Ser Met Leu

325

<210>11

<211>972

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized ddh from megasphaera micracella

<400>11

atggacaaaa ttcgcattgg tatcgtggga tacggcaacc tgggtcgggg agcggaggct 60

tcggtcaagc tccagccgga tatggagctg atcggtgttt tctctcggcg gaagggaatt 120

aagactgtgt cgggagtgcc tgcatatact atggacgaga tgctcaactt taagggtaaa 180

atcgatgtta tgattttgtg tggaggatcg gcaacggacc tgatcgaaca gacccctgcg 240

gtggcagccc actttacctg tattgactcc tttgatactc accctcggat taccgaacac 300

tttaataacg tagataaagc ggctaaagca gcaggtaccg ccgccctgat ttcatgtggt 360

tgggacccag gaatgttttc tcttcaacgt gttttcgcgg aagcaatttt gccccaaggc 420

aagtcttata cgttctgggg ccggggagtg tctcagggcc attcggacgc cattcggcgg 480

atcgatggag tcgtcgacgc gcggcagtat actgtaccaa aagataaata cctgaatgcc 540

atccgtaatg gtgaaatgcc cgaggtcact ggacaggagg cgcatctgcg tgactgctac 600

gttgtcgctg cggagggcgc agataaagct cggatcgaga acgaaattaa gaccatgaaa 660

aactattttg tgggatacga aaccgtagta cacttcattt cacaggagga actggaccgg 720

gatcacaagg gcattccgca cggtggtttc gtacttcgca gcggcgagtc gacccccggt 780

accaaacatg tggtggaata tcgcctccag ttggattcca acccggagtt tactggttct 840

gtgcttacgg cgtatgctcg cggccttaac cgcttggcta agcataaagc caccggagct 900

ttcacggtgt tcgatattcc tcccgcgtgg attagcgtac attctgacga ggagctgcgg 960

gcacactcac tg 972

<210>12

<211>324

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized ddh from megasphaera micracella

<400>12

Met Asp Lys Ile Arg Ile Gly Ile Val Gly Tyr Gly Asn Leu Gly Arg

1 5 10 15

Gly Ala Glu Ala Ser Val Lys Leu Gln Pro Asp Met Glu Leu Ile Gly

20 25 30

Val Phe Ser Arg Arg Lys Gly Ile Lys Thr Val Ser Gly Val Pro Ala

35 40 45

Tyr Thr Met Asp Glu Met Leu Asn Phe Lys Gly Lys Ile Asp Val Met

50 55 60

Ile Leu Cys Gly Gly SerAla Thr Asp Leu Ile Glu Gln Thr Pro Ala

65 70 75 80

Val Ala Ala His Phe Thr Cys Ile Asp Ser Phe Asp Thr His Pro Arg

85 90 95

Ile Thr Glu His Phe Asn Asn Val Asp Lys Ala Ala Lys Ala Ala Gly

100 105 110

Thr Ala Ala Leu Ile Ser Cys Gly Trp Asp Pro Gly Met Phe Ser Leu

115 120 125

Gln Arg Val Phe Ala Glu Ala Ile Leu Pro Gln Gly Lys Ser Tyr Thr

130 135 140

Phe Trp Gly Arg Gly Val Ser Gln Gly His Ser Asp Ala Ile Arg Arg

145 150 155 160

Ile Asp Gly Val Val Asp Ala Arg Gln Tyr Thr Val Pro Lys Asp Lys

165 170 175

Tyr Leu Asn Ala Ile Arg Asn Gly Glu Met Pro Glu Val Thr Gly Gln

180 185 190

Glu Ala His Leu Arg Asp Cys Tyr Val Val Ala Ala Glu Gly Ala Asp

195 200 205

Lys Ala Arg Ile Glu Asn Glu Ile Lys Thr Met Lys Asn Tyr Phe Val

210 215 220

Gly Tyr Glu Thr Val Val His Phe Ile Ser Gln Glu Glu Leu Asp Arg

225 230 235 240

Asp His Lys Gly Ile Pro His Gly Gly Phe Val Leu Arg Ser Gly Glu

245 250 255

Ser Thr Pro Gly Thr Lys His Val Val Glu Tyr Arg Leu Gln Leu Asp

260 265 270

Ser Asn Pro Glu Phe Thr Gly Ser Val Leu Thr Ala Tyr Ala Arg Gly

275 280 285

Leu Asn Arg Leu Ala Lys His Lys Ala Thr Gly Ala Phe Thr Val Phe

290 295 300

Asp Ile Pro Pro Ala Trp Ile Ser Val His Ser Asp Glu Glu Leu Arg

305 310 315 320

Ala His Ser Leu

<210>13

<211>1002

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from Achromobacter denitrificans

<400>13

atgggtcttg ataacaatgc acgcacggcc atccgtatcg gtatcgttgg atacggcaac 60

cttggacgtg gtgtggaagc ggcagtcgcc cgcaattcgg atatggcagt tgccggaatt 120

tacacgcggc gtgaccctgc ccaaattgaa cccatgggcg cgggagtgcc agtgcacgcc 180

atggactcgc tccctggtca taaaggttcg attgatgttc tggtactttg cggaggctca 240

aaagatgatc tgccgcgcca atcccccgag ttggccgctc actttagcct ggttgattcc 300

tttgacaccc atgctcggat cccagagcac ttcgctgcgg ttgacgcggc ggcgcaagca 360

ggacgtacga cggcactgat ttctgcaggt tgggacccgg gaatgttttc catcaatcgg 420

gtaatgggcg aggccctctt gccggatggc gccacctata cgttctgggg caagggactc 480

tcccagggcc actctgatgc ggtgcgtcgg gttccgggcg tagctggcgg tgtgcagtat 540

actatccccg tggacgaagc ggtagctcag gtacggtccg gtttgcgtcc tgccctcacc 600

acgcgggaaa aacaccggcg cgaatgcttc gttgtactcg aagcgggagc agacgcctcg 660

gccgtgcgta agacgattgt tacgatgccc cattattttg atgagtatga caccactgta 720

cactttatcg gcgccgagga attggctcgg gaacacggcg ccatgccgca cggcggattt 780

gtcatccgct caggtaatac ctctcaggaa aacaaacagg taatcgagta tcgtctccaa 840

ctcgactcta accctgaatt taccagctct gtcctcgtcg catatgcacg tgccgtacat 900

cgtatgcaac aggccggtca gtggggctgc aagacggtat ttgatgttgc gccaggcctg 960

ctgtctccgc gctcggcggc cgaactccgc gctcaacttc tt 1002

<210>14

<211>334

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from Achromobacter denitrificans

<400>14

Met Gly Leu Asp Asn Asn AlaArg Thr Ala Ile Arg Ile Gly Ile Val

1 5 10 15

Gly Tyr Gly Asn Leu Gly Arg Gly Val Glu Ala Ala Val Ala Arg Asn

20 25 30

Ser Asp Met Ala Val Ala Gly Ile Tyr Thr Arg Arg Asp Pro Ala Gln

35 40 45

Ile Glu Pro Met Gly Ala Gly Val Pro Val His Ala Met Asp Ser Leu

50 55 60

Pro Gly His Lys Gly Ser Ile Asp Val Leu Val Leu Cys Gly Gly Ser

65 70 75 80

Lys Asp Asp Leu Pro Arg Gln Ser Pro Glu Leu Ala Ala His Phe Ser

85 90 95

Leu Val Asp Ser Phe Asp Thr His Ala Arg Ile Pro Glu His Phe Ala

100 105 110

Ala Val Asp Ala Ala Ala Gln Ala Gly Arg Thr Thr Ala Leu Ile Ser

115 120 125

Ala Gly Trp Asp Pro Gly Met Phe Ser Ile Asn Arg Val Met Gly Glu

130 135 140

Ala Leu Leu Pro Asp Gly Ala Thr Tyr Thr Phe Trp Gly Lys Gly Leu

145 150 155 160

Ser Gln Gly His Ser Asp Ala Val Arg Arg Val Pro Gly Val Ala Gly

165 170 175

Gly Val Gln Tyr Thr Ile Pro Val Asp Glu Ala Val Ala Gln Val Arg

180 185 190

Ser Gly Leu Arg Pro Ala Leu Thr Thr Arg Glu Lys His Arg Arg Glu

195 200 205

Cys Phe Val Val Leu Glu Ala Gly Ala Asp Ala Ser Ala Val Arg Lys

210 215 220

Thr Ile Val Thr Met Pro His Tyr Phe Asp Glu Tyr Asp Thr Thr Val

225 230 235 240

His Phe Ile Gly Ala Glu Glu Leu Ala Arg Glu His Gly Ala Met Pro

245 250 255

His Gly Gly Phe Val Ile Arg Ser Gly Asn Thr Ser Gln Glu Asn Lys

260 265 270

Gln Val Ile Glu Tyr Arg Leu Gln Leu Asp Ser Asn Pro Glu Phe Thr

275 280 285

Ser Ser Val Leu Val Ala Tyr Ala Arg Ala Val His Arg Met Gln Gln

290 295 300

Ala Gly Gln Trp Gly Cys Lys Thr Val Phe Asp Val Ala Pro Gly Leu

305 310 315 320

Leu Ser Pro Arg Ser Ala Ala Glu Leu Arg Ala Gln Leu Leu

325 330

<210>15

<211>957

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from Micrococcus luteus

<400>15

atgaccattc gcgcgggaat tgtaggatat ggaaacctgg gtcgctctgt agaaaaactt 60

gttaaactgc agccggacat ggaacttgtt ggcatttttt cccggcggac tggactcgac 120

acggataccc cagtacttcc tgcggaacgt gcggccgagc acgcgggtga gattgatgtg 180

ctttttctgt gccttggaag cgcgactgat attccagagc aagcggccgg ttacgcacgc 240

cacttcacga ccgttgatac gtatgataac catcaactga tcccacggca tcggtctgaa 300

atggatgctg cggcccggga gggcggccac gtagcgatga tctcaactgg atgggaccca 360

ggactttttt ctgtcaatcg ggtccttgga gccgcccttt ttccgcagcc ccagcaaaat 420

actttttggg gcaagggcct ctcacaaggt cactcggatg cagtgcggcg ggtgccgggt 480

gtacggcgtg gcgttcagta cactattccg tcagaggaag cgattgcaga ggcccgggct 540

ggtcgcggtg cagagattac tggtgcgtcg gctcatgttc gggagtgtta cgtcgttgca 600

gacgaggcag atcatgctgc tatcactgag gcgatcacca ccatgccgga ttactttgcc 660

ccctatgaga cgaccgtaca ctttatttcg gaggaagaat ttgagcggga tcatcagggt 720

atgccacacg gaggccacgt tgtcacgtct ggtgacttgg gaggctctcg ctctgcggta 780

gaatttgtcc tcgaactcga atctaatcct gactttaccg cagcagccca ggtagcctat 840

ggccgggccg ccgctcgcct taaggcccag ggtgagactg gcgctcgtac ggtacttgag 900

gtcgctccct atcttctgtc accgacgggt ttggatgagc tgattcgccg cgacgtg 957

<210>16

<211>319

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from Micrococcus luteus

<400>16

Met Thr Ile Arg Ala Gly Ile Val Gly Tyr Gly Asn Leu Gly Arg Ser

1 5 10 15

Val Glu Lys Leu Val Lys Leu Gln Pro Asp Met Glu Leu Val Gly Ile

20 25 30

Phe Ser Arg Arg Thr Gly Leu Asp Thr Asp Thr Pro Val Leu Pro Ala

35 40 45

Glu Arg Ala Ala Glu His Ala Gly Glu Ile Asp Val Leu Phe Leu Cys

50 55 60

Leu Gly Ser Ala Thr Asp Ile Pro Glu Gln Ala Ala Gly Tyr Ala Arg

65 70 75 80

His Phe Thr Thr Val Asp Thr Tyr Asp Asn His Gln Leu Ile Pro Arg

85 90 95

His Arg Ser Glu Met Asp Ala Ala Ala Arg Glu Gly Gly His Val Ala

100 105 110

Met Ile Ser Thr Gly Trp Asp Pro Gly Leu Phe Ser Val Asn Arg Val

115 120 125

Leu Gly Ala Ala Leu Phe Pro Gln Pro Gln Gln Asn Thr Phe Trp Gly

130 135 140

Lys Gly Leu Ser Gln Gly His Ser Asp Ala Val Arg Arg Val Pro Gly

145 150 155 160

Val Arg Arg Gly Val Gln Tyr Thr Ile Pro Ser Glu Glu Ala Ile Ala

165 170 175

Glu Ala Arg Ala Gly Arg Gly Ala Glu Ile Thr Gly Ala Ser Ala His

180 185 190

Val Arg Glu Cys Tyr Val Val Ala Asp Glu Ala Asp His Ala Ala Ile

195 200 205

Thr Glu Ala Ile Thr Thr Met Pro Asp Tyr Phe Ala Pro Tyr Glu Thr

210 215 220

Thr Val His Phe Ile Ser Glu Glu Glu Phe Glu Arg Asp His Gln Gly

225 230 235 240

Met Pro His Gly Gly His Val Val Thr Ser Gly Asp Leu Gly Gly Ser

245 250 255

Arg Ser Ala Val Glu Phe Val Leu Glu Leu Glu Ser Asn Pro Asp Phe

260 265 270

Thr Ala Ala Ala Gln Val Ala Tyr Gly Arg Ala Ala Ala Arg Leu Lys

275 280 285

Ala Gln Gly Glu Thr Gly Ala Arg Thr Val Leu Glu Val Ala Pro Tyr

290 295 300

Leu Leu Ser Pro Thr Gly Leu Asp Glu Leu Ile Arg Arg Asp Val

305 310 315

<210>17

<211>981

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from Brevibacterium faecalis

<400>17

atgaccgttc atcgtattgg catcgtagga tatggaaacc tcggacgtgg agtagagatc 60

gcgaccagct tgcaggaaga catgcaactc gttggtgtct tcacgcgccg cgacccttca 120

acggtaagca ccgttcatgc tcagacgcca gtacgctcaa tcgacgccct tgaggagatg 180

caagacgaaa ttgatgtgct cgttctttgt ggtggatcac gtaccgacct tcctgaacag 240

acgccccagt tggctgaacg gtttactgtg gttgattcgt ttgacaccca cgcgcggatt 300

cctgagcatt tcgccaaagt tgatgcagcg gcgcgcgctg ctggaaccac cgccctgatt 360

tccactggct gggatccagg cttgttttcg atcaatcgtg tatatggcga agcaatcctt 420

gcgactggaa ctacctacac cttttggggt cggggacttt cccagggcca ctccgatgct 480

gtacggcggg tcgatggcgt agctgctgcc gtacagtaca ctgtaccgag ccaagaagcg 540

attgctcggg tgcgggccgg cgaacagccc acgctgtcga cgcgggaaaa acacacccgg 600

gaatgtttcg tcgttttgga ggatggcgcg gatgctgaga ctgtccgcga ggagatcgta 660

accatgcccc actattttga accttatgac actaccgtaa ccttcctgtc tgcagaggaa 720

ctggcgcgcg atcaccaggg catgccgcac ggcggttttg tgattcggtc aggagagtca 780

agcccaggca ctacccagac tattgaatac cggcttcagg aagactctaa cccggaattt 840

actgcgtcgg tccttgtcgc atatactcgt gctgccgccc ggctcgcagc cgccggcgaa 900

catggtgcta agactccttt cgacgttgcc ccgggccttc tgtccccgaa gtcgcccgaa 960

cagctgcgcg ccgagctcct g 981

<210>18

<211>327

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from Brevibacterium faecalis

<400>18

Met Thr Val His Arg Ile Gly Ile Val Gly Tyr Gly Asn Leu Gly Arg

1 5 10 15

Gly Val Glu Ile Ala Thr Ser Leu Gln Glu Asp Met Gln Leu Val Gly

20 25 30

Val Phe Thr Arg Arg Asp Pro Ser Thr Val Ser Thr Val His Ala Gln

35 40 45

Thr Pro Val Arg Ser Ile Asp Ala Leu Glu Glu Met Gln Asp Glu Ile

50 55 60

Asp Val Leu Val Leu Cys Gly Gly Ser Arg Thr Asp Leu Pro Glu Gln

65 70 75 80

Thr Pro Gln Leu Ala Glu Arg Phe Thr Val Val Asp Ser Phe Asp Thr

85 90 95

His Ala Arg Ile Pro Glu His Phe Ala Lys Val Asp Ala Ala Ala Arg

100 105 110

Ala Ala Gly Thr Thr Ala Leu Ile Ser Thr Gly Trp Asp Pro Gly Leu

115 120 125

Phe Ser Ile Asn Arg Val Tyr Gly Glu Ala Ile Leu Ala Thr Gly Thr

130 135 140

Thr Tyr Thr Phe Trp Gly Arg Gly Leu Ser Gln Gly His Ser Asp Ala

145 150 155 160

Val Arg Arg Val Asp Gly Val Ala Ala Ala Val Gln Tyr Thr Val Pro

165 170 175

Ser Gln Glu Ala Ile Ala Arg Val Arg Ala Gly Glu Gln Pro Thr Leu

180 185 190

Ser Thr Arg Glu Lys His Thr Arg Glu Cys Phe Val Val Leu Glu Asp

195 200 205

Gly Ala Asp Ala Glu Thr Val Arg Glu Glu Ile Val Thr Met Pro His

210 215 220

Tyr Phe Glu Pro Tyr Asp Thr Thr Val Thr Phe Leu Ser Ala Glu Glu

225 230 235 240

Leu Ala Arg Asp His Gln Gly Met Pro His Gly Gly Phe Val Ile Arg

245 250 255

Ser Gly Glu Ser Ser Pro Gly Thr Thr Gln Thr Ile Glu Tyr Arg Leu

260 265 270

Gln Glu Asp Ser Asn Pro Glu Phe Thr Ala Ser Val Leu Val Ala Tyr

275 280 285

Thr Arg Ala Ala Ala Arg Leu Ala Ala Ala Gly Glu His Gly Ala Lys

290 295 300

Thr Pro Phe Asp Val Ala Pro Gly Leu Leu Ser Pro Lys Ser Pro Glu

305 310 315 320

Gln Leu Arg Ala Glu Leu Leu

325

<210>19

<211>975

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized ddh from carnivorous bacillus

<400>19

atgactaaca agattcggat tggtcttgtg ggttacggta acatcggaaa gggcgtcgaa 60

ttggcgctgg aagagtttcc tgacatggaa ggcattgcgg tcttcactcg tcggaatccc 120

gaagatctcg attcaaagct caaagctatc tctttggacc acattcttga ttaccaggaa 180

gatctggacg ttttgatcct ttgcggcgga agcgccaccg atttgcctgg tcagggtcct 240

gctcttgcaa agcatttctc tacgattgac tcctacgata atcacaatca aattcctgaa 300

tatttcgaaa ctatggacca atctgcaaag gcaggcaaga acatttcaat tatctcggtc 360

ggctgggatc cgggactgtt ctcactgaat cgggccgttt tcgagtccat ccttccggcg 420

ggagagactt acactttttg gggcaaagga ctgtcccagg gccactccga cgccattcgt 480

cggattgatg gcgtcaagtt tggcgttcaa tacaccattc ccgtcgaaac cgcactggag 540

gaagtacggt ctggatcgaa tccgaccctt tccactcggg agaagcacaa acgtgtgtgc 600

tacgttgtag cggaagcggg ctccgaccag aatttgattg aggaaacgat taaaaccatg 660

ccggactact tcgagccgta cgacacgacc gtccatttca tcgacgagaa aacgttcaag 720

gaggagcatc agaaaatgcc acatggtggc ttcgtgatcc gtactgcaac ttcagctacg 780

ggcaacaagc agaaagctga gttccagctc gaattggagt ccaatgcaga attcacttct 840

tcaatcctcg ttgcgtacgc tcgtgccgcc tacaagttta agaaagatgg caagtctggc 900

gctctttcgg tgctggatgt ccctccggca tacctgtctc caaagtcggc agcgcagctc 960

cgcaaggagc tcctg 975

<210>20

<211>325

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized ddh from carnivorous bacillus

<400>20

Met Thr Asn Lys Ile Arg Ile Gly Leu Val Gly Tyr Gly Asn Ile Gly

1 5 10 15

Lys Gly Val Glu Leu Ala Leu Glu Glu Phe Pro Asp Met Glu Gly Ile

20 25 30

Ala Val Phe Thr Arg Arg Asn Pro Glu Asp Leu Asp Ser Lys Leu Lys

35 40 45

Ala Ile Ser Leu Asp His Ile Leu Asp Tyr Gln Glu Asp Leu Asp Val

50 55 60

Leu Ile Leu Cys Gly Gly Ser Ala Thr Asp Leu Pro Gly Gln Gly Pro

65 70 75 80

Ala Leu Ala Lys His Phe Ser Thr Ile Asp Ser Tyr Asp Asn His Asn

85 90 95

Gln Ile Pro Glu Tyr Phe Glu Thr Met Asp Gln Ser Ala Lys Ala Gly

100 105 110

Lys Asn Ile Ser Ile Ile Ser Val Gly Trp Asp Pro Gly Leu Phe Ser

115 120 125

Leu Asn Arg Ala Val Phe Glu Ser Ile Leu Pro Ala Gly Glu Thr Tyr

130 135 140

Thr Phe Trp Gly Lys Gly Leu Ser Gln Gly His Ser Asp Ala Ile Arg

145 150 155 160

Arg Ile Asp Gly Val Lys Phe Gly Val Gln Tyr Thr Ile Pro Val Glu

165 170 175

Thr Ala Leu Glu Glu Val Arg Ser Gly Ser Asn Pro Thr Leu Ser Thr

180 185 190

Arg Glu Lys His Lys Arg Val Cys Tyr Val Val Ala Glu Ala Gly Ser

195 200 205

Asp Gln Asn Leu Ile Glu Glu Thr Ile Lys Thr Met Pro Asp Tyr Phe

210 215 220

Glu Pro Tyr Asp Thr Thr Val His Phe Ile Asp Glu Lys Thr Phe Lys

225 230 235 240

Glu Glu His Gln Lys Met Pro His Gly Gly Phe Val Ile Arg Thr Ala

245 250 255

Thr Ser Ala Thr Gly Asn Lys Gln Lys Ala Glu Phe Gln Leu Glu Leu

260 265 270

Glu Ser Asn Ala Glu Phe Thr Ser Ser Ile Leu Val Ala Tyr Ala Arg

275 280 285

Ala Ala Tyr Lys Phe Lys Lys Asp Gly Lys Ser Gly Ala Leu Ser Val

290 295 300

Leu Asp Val Pro Pro Ala Tyr Leu Ser Pro Lys Ser Ala Ala Gln Leu

305 310 315 320

Arg Lys Glu Leu Leu

325

<210>21

<211>1062

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized asd from Methanococcus jannaschii

<400>21

atgtccaagg gagaaaaaat gaagatcaag gttggcgtat tgggtgctac cggatcggtt 60

ggccaacgct ttgtgcagct gcttgcagac caccccatgt tcgaattgac tgctctggca 120

gcaagcgaac ggtccgcggg taaaaaatac aaagatgctt gttactggtt tcaagatcgg 180

gacattccag aaaatattaa ggatatggtt gtaattccga cggatccgaa gcacgaagaa 240

ttcgaagacg ttgatattgt ttttagcgcg ctgccctcgg atctggctaa aaaattcgaa 300

cccgaattcg cgaaagaagg aaagctgatc ttcagcaacg catcagccta tcgtatggag 360

gaagatgtgc cgcttgtaat tccagaggta aacgctgatc acctcgaatt gattgaaatt 420

cagcgcgaga agcggggttg ggacggagcc attatcacta acccaaactg ttcaaccatt 480

tgcgccgtaa tcacccttaa gccaattatg gacaaattcg gtcttgaagc ggtgtttatc 540

gctaccatgc aggctgtatc gggcgcagga tacaacggtg tcccgagcat ggctattctg 600

gataacttga ttccctttat taagaatgag gaggagaaga tgcagactga atcgcttaag 660

ttgctgggca cgcttaagga tggaaaagtg gaactcgcta acttcaaaat cagcgcatca 720

tgcaatcgtg tggctgtgat cgacggccac accgaatcga tcttcgtgaa gaccaaggag 780

ggtgcggaac ctgaggaaat taaagaagtg atggacaaat ttgatcctct taaagacctt 840

aaccttccga cgtatgccaa accaatcgta attcgcgaag agatcgatcg cccacagcca 900

cgtcttgacc gcaatgaggg taatggcatg tctattgtcg ttggtcgtat ccgtaaagat 960

ccgatttttg atgttaagta caccgccctg gaacataaca ctatccgtgg cgccgcgggc 1020

gcatcagtgt tgaatgcgga gtatttcgta aagaaataca tc 1062

<210>22

<211>354

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized asd from Methanococcus jannaschii

<400>22

Met Ser Lys Gly Glu Lys Met Lys Ile Lys Val Gly Val Leu Gly Ala

1 5 10 15

Thr Gly Ser Val Gly Gln Arg Phe Val Gln Leu Leu Ala Asp His Pro

20 25 30

Met Phe Glu Leu Thr Ala Leu Ala Ala Ser Glu Arg Ser Ala Gly Lys

35 40 45

Lys Tyr Lys Asp Ala Cys Tyr Trp Phe Gln Asp Arg Asp Ile Pro Glu

50 55 60

Asn Ile Lys Asp Met Val Val Ile Pro Thr Asp Pro Lys His Glu Glu

65 70 75 80

Phe Glu Asp Val Asp Ile Val Phe Ser Ala Leu Pro Ser Asp Leu Ala

85 90 95

Lys Lys Phe Glu Pro Glu Phe Ala Lys Glu Gly Lys Leu Ile Phe Ser

100 105 110

Asn Ala Ser Ala Tyr Arg Met Glu Glu Asp Val Pro Leu Val Ile Pro

115 120 125

Glu Val Asn Ala Asp His Leu Glu Leu Ile Glu Ile Gln Arg Glu Lys

130 135 140

Arg Gly Trp Asp Gly Ala Ile Ile Thr Asn Pro Asn Cys Ser Thr Ile

145 150 155 160

Cys Ala Val Ile Thr Leu Lys Pro Ile Met Asp Lys Phe Gly Leu Glu

165 170 175

Ala Val Phe Ile Ala Thr Met Gln Ala Val Ser Gly Ala Gly Tyr Asn

180 185 190

Gly Val Pro Ser Met Ala Ile Leu Asp Asn Leu Ile Pro Phe Ile Lys

195 200 205

Asn Glu Glu Glu Lys Met Gln Thr Glu Ser Leu Lys Leu Leu Gly Thr

210 215 220

Leu Lys Asp Gly Lys Val Glu Leu AlaAsn Phe Lys Ile Ser Ala Ser

225 230 235 240

Cys Asn Arg Val Ala Val Ile Asp Gly His Thr Glu Ser Ile Phe Val

245 250 255

Lys Thr Lys Glu Gly Ala Glu Pro Glu Glu Ile Lys Glu Val Met Asp

260 265 270

Lys Phe Asp Pro Leu Lys Asp Leu Asn Leu Pro Thr Tyr Ala Lys Pro

275 280 285

Ile Val Ile Arg Glu Glu Ile Asp Arg Pro Gln Pro Arg Leu Asp Arg

290 295 300

Asn Glu Gly Asn Gly Met Ser Ile Val Val Gly Arg Ile Arg Lys Asp

305 310 315 320

Pro Ile Phe Asp Val Lys Tyr Thr Ala Leu Glu His Asn Thr Ile Arg

325 330 335

Gly Ala Ala Gly Ala Ser Val Leu Asn Ala Glu Tyr Phe Val Lys Lys

340 345 350

Tyr Ile

<210>23

<211>1047

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from B.putrescentiae

<400>23

atgcagacgc ggatcgaggt aggaattctt ggagcgactg gtatggtcgg tcagcacttt 60

atcaaatttt tgcaaggcca cccttggttc gatctcaagt ggctgggtgc ttcagaccgc 120

tccgccggta aacagtacaa agacgcgatg acctggcatc ttgctggagg aaccccagat 180

tcagtcgctg gtctcaccgt cgaagaatgc aaacccggca atgccccccg tctgcttttc 240

agcgctatgg acgctggagt tgcgaccgat attgaacgtg cgtttgcgca ggcgggtcat 300

gtggttgtct cgaatagccg caaccaccgg atggagcaag acgttccttt gatggtgcct 360

gagattaacc cagatcatct gaagctggta ccgggacaac aacgcgcgcg gggatggaaa 420

ggacagattg tcacgaaccc gaattgctct acgatcggtc tggtgatggg tctcggtcca 480

atgaaacagt tcggcattac gaagatcctt gttaccacga tgcaggctat ttcaggcgca 540

ggatacccag gagtagcatc catggatatt atgggtaacg ttgtccccta catcggctct 600

gaagaggaaa agatggagat ggaaactcaa aaaattatgg gtgatttcgc gggcgatcgc 660

atcgtgccgc ttgcagcaaa ggtctcggcc cactgcaatc gggtaggcgt tgttgacggc 720

catacggaaa ctgtgtcagt cgaattctct atgaaaccaa cggaggcaga tttgcgccat 780

gcgatcgaat cctttactgc agtgccccag gaacgcaagc tcccgagcgc accaggacgt 840

ccggttatct atatgaagga agccaaccgg ccccaacctc gtaaggatgc tgaacgggag 900

cgtggcatgg cagcgtttgt tggtcgcctc cgggcatgcc cggtactgga ttataaattt 960

gtggtcctgt cccacaatac gattcgcggc gcagcaggcg cagcagtctt gaatgccgaa 1020

ctcatgcact cagagggaat gttggat 1047

<210>24

<211>349

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from B.putrescentiae

<400>24

Met Gln Thr Arg Ile Glu Val Gly Ile Leu Gly Ala Thr Gly Met Val

1 5 10 15

Gly Gln His Phe Ile Lys Phe Leu Gln Gly His Pro Trp Phe Asp Leu

20 25 30

Lys Trp Leu Gly Ala Ser Asp Arg Ser Ala Gly Lys Gln Tyr Lys Asp

35 40 45

Ala Met Thr Trp His Leu Ala Gly Gly Thr Pro Asp Ser Val Ala Gly

50 55 60

Leu Thr Val Glu Glu Cys Lys Pro Gly Asn Ala Pro Arg Leu Leu Phe

65 70 75 80

Ser Ala Met Asp Ala Gly Val Ala Thr Asp Ile Glu Arg Ala Phe Ala

85 90 95

Gln Ala Gly His Val Val Val Ser Asn Ser Arg Asn His Arg Met Glu

100 105 110

Gln Asp Val Pro Leu Met Val Pro Glu Ile Asn Pro Asp His Leu Lys

115 120 125

Leu Val Pro Gly Gln Gln Arg Ala Arg Gly Trp Lys Gly Gln Ile Val

130 135 140

Thr Asn Pro Asn Cys Ser Thr Ile Gly Leu Val Met Gly Leu Gly Pro

145 150 155 160

Met Lys Gln Phe Gly Ile Thr Lys Ile Leu Val Thr Thr Met Gln Ala

165 170 175

Ile Ser Gly Ala Gly Tyr Pro Gly Val Ala Ser Met Asp Ile Met Gly

180 185 190

Asn Val Val Pro Tyr Ile Gly Ser Glu Glu Glu Lys Met Glu Met Glu

195 200 205

Thr Gln Lys Ile Met Gly Asp Phe Ala Gly Asp Arg Ile Val Pro Leu

210 215 220

Ala Ala Lys Val Ser Ala His Cys Asn Arg Val Gly Val Val Asp Gly

225 230 235 240

His Thr Glu Thr Val Ser Val Glu Phe Ser Met Lys Pro Thr Glu Ala

245 250 255

Asp Leu Arg His Ala Ile Glu Ser Phe Thr Ala Val Pro Gln Glu Arg

260 265 270

Lys Leu Pro Ser Ala Pro Gly Arg Pro Val Ile Tyr Met Lys Glu Ala

275 280 285

Asn Arg Pro Gln Pro Arg Lys Asp Ala Glu Arg Glu Arg Gly Met Ala

290 295 300

Ala Phe Val Gly Arg Leu Arg Ala Cys Pro Val Leu Asp Tyr Lys Phe

305 310 315 320

Val Val Leu Ser His Asn Thr Ile Arg Gly Ala Ala Gly Ala Ala Val

325 330 335

Leu Asn Ala Glu Leu Met His Ser Glu Gly Met Leu Asp

340 345

<210>25

<211>1032

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from internal Alkaline lake bacteria

<400>25

atggcagtgc gggtaggtgt attgggcgct acgggagcag tgggtcaacg gcttatccag 60

ctcctcgagc ctcaccctga attcgaaatt gctgctctca ccgcgtcgga gtcttccgct 120

ggtaaaactt atcgtcaggc ggcgaaatgg cgcgtagact ccccaatccc tgacgacgtc 180

gcagagatga ccgtaagcgc aacggatccc gatgaggttc cggatgacgt agatttgctg 240

ttcagcagct tgccgtcaag cgtcggcgaa caggtagagc ccgctttttg cgaagccgga 300

tacgtgatgt cgtccaattc ttctaatgct cgtatggcgg atgacgtccc acttgttatc 360

ccagaggtaa atgctgaaca tattgatctt cttgaggtcc aacgcgatga acgtggatgg 420

gatggcgcga tggtaaaaaa ccctaattgt tcaactatta cctttgtccc aactcttgcg 480

gcccttgagc agtttggcct ggaggaagtc cacgttgcaa cgctgcaagc ggtgtccggt 540

gcaggttatg atggagtctc ctccatggag atcattgaca atgcaattcc ttatattgga 600

tcggaagaag agaaactgga aacggaatct cgtaagctcc tgggagaatt tgacggcgct 660

gaactgtcgc ataactcagt tgaagtcgca gcttcgtgca accgtatccc gaccattgac 720

ggacacttgg agaacgtgtg ggttgagacc gaagacgacc ttacgcccga agatgccgcg 780

gatgcaatgc gcgcgtatcc atcgttggag cttcgttcat ctccggacca gctgattcat 840

gtctttgatg aaccagaccg cccgcaaccg cggatggacc ggactttggg agacggaatg 900

gcaatcgcgg ctggtggttt gcgtgaatcg actttcgacc ttcaatacaa ttgcttggct 960

cataacacca tccggggtgc agcgggagcc tcggttctga acggagagct gttgttggac 1020

caaggttata tt 1032

<210>26

<211>344

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from internal Alkaline lake bacteria

<400>26

Met Ala Val Arg Val Gly Val Leu Gly Ala Thr Gly Ala Val Gly Gln

1 5 10 15

Arg Leu Ile Gln Leu Leu Glu Pro His Pro Glu Phe Glu Ile Ala Ala

20 25 30

Leu Thr Ala Ser Glu Ser Ser Ala Gly Lys Thr Tyr Arg Gln Ala Ala

35 40 45

Lys Trp Arg Val Asp Ser Pro Ile Pro Asp Asp Val Ala Glu Met Thr

50 55 60

Val Ser Ala Thr Asp Pro Asp Glu Val Pro Asp Asp Val Asp Leu Leu

65 70 75 80

Phe Ser Ser Leu Pro Ser Ser Val Gly Glu Gln Val Glu Pro Ala Phe

85 90 95

Cys Glu Ala Gly Tyr Val Met Ser Ser Asn Ser Ser Asn Ala Arg Met

100 105 110

Ala Asp Asp Val Pro Leu Val Ile Pro Glu Val Asn Ala Glu His Ile

115 120 125

Asp Leu Leu Glu Val Gln Arg Asp Glu Arg Gly Trp Asp Gly Ala Met

130 135 140

Val Lys Asn Pro Asn Cys Ser Thr Ile Thr Phe Val Pro Thr Leu Ala

145 150 155 160

Ala Leu Glu Gln Phe Gly Leu Glu Glu Val His Val Ala Thr Leu Gln

165 170 175

Ala Val Ser Gly Ala Gly Tyr Asp Gly Val Ser Ser Met Glu Ile Ile

180 185 190

Asp Asn Ala Ile Pro Tyr Ile Gly Ser Glu Glu Glu Lys Leu Glu Thr

195 200 205

Glu Ser Arg Lys Leu Leu Gly Glu Phe Asp Gly Ala Glu Leu Ser His

210 215 220

Asn Ser Val Glu Val Ala Ala Ser Cys Asn Arg Ile Pro Thr Ile Asp

225 230 235 240

Gly His Leu Glu Asn Val Trp Val Glu Thr Glu Asp Asp Leu Thr Pro

245 250 255

Glu Asp Ala Ala Asp Ala Met Arg Ala Tyr Pro Ser Leu Glu Leu Arg

260 265 270

Ser Ser Pro Asp Gln Leu Ile His Val Phe Asp Glu Pro Asp Arg Pro

275 280 285

Gln Pro Arg Met Asp Arg Thr Leu Gly Asp Gly Met Ala Ile Ala Ala

290 295 300

Gly Gly Leu Arg Glu Ser Thr Phe Asp Leu Gln Tyr Asn Cys Leu Ala

305 310 315 320

His Asn Thr Ile Arg Gly Ala Ala Gly Ala Ser Val Leu Asn Gly Glu

325 330 335

Leu Leu Leu Asp Gln Gly Tyr Ile

340

<210>27

<211>1047

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from thermophilic photosynthetic Lvyara

<400>27

atggccacta ttccagtcgc cgttctgggt gccacgggtg ccgtgggtca acggttcatt 60

cagttgcttg agggtcaccc gctttttcag gtagttgccc tgactggcag cgagcgttcc 120

gctggtaaaa aataccacga ggtgtgtcgt tgggttttgg atactcctat gcccgcagcg 180

gttgcaaacc tgacggtact ggatgcagac gcagacctcc ccgcacagct cgtgttctcc 240

gcgctcccgt ctaccgtcgc cggcccgatc gaacaacgtc ttgctgctgc tggtcatatc 300

gtgtgctcca acgcttcgaa ccatcgtatg gagccagatg tgccactcat tattcccgaa 360

gtcaacccgg accatcttgc cttgattccc gttcaacgcc gccgccgtgg ttggtccggt 420

gctattgtta ccaacccaaa ctgcacttcc acgccggcga cgatggtgtt gcgccctttg 480

ctcgatacct ttggagtccg gcgcatgctt ttggtgtcaa tgcaagccct ctctggagcc 540

ggctacccag gtgtgccctc atacgatgta gttgataacg tgatccccta catcggtgga 600

gaagaaccaa aactcgagat tgagccgcag aaaatgctgg gacgtctgga aggagaaacg 660

attgttccag caggcttcac gacttccgca cactgcaatc gggtccctgt gctcgaaggc 720

cacctggttt gtctctcgat cgagcttgaa cggaaagccg accctgccga gatcgcgacg 780

gtgctcagca atttccgtgc actccctcag gaattgcggc tgccgactgc gccagagcag 840

cctatcattg tacgtcacga acccgaccgt cctcaaccgc gccgcgaccg tgatgctgga 900

cggggaatgg ccaccgtagt aggtcgcatt cggccctgca gcctttttga cattaagttg 960

atcgcattgt cacataacac catccggggc gccgccggag cgagcatcct gaacgccgag 1020

cttatgcatg cccaaggttg gctggcg 1047

<210>28

<211>349

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from thermophilic photosynthetic Lvyara

<400>28

Met Ala Thr Ile Pro Val Ala Val Leu Gly Ala Thr Gly Ala Val Gly

1 5 10 15

Gln Arg Phe Ile Gln Leu Leu Glu Gly His Pro Leu Phe Gln Val Val

20 25 30

Ala Leu Thr Gly Ser Glu Arg Ser Ala Gly Lys Lys Tyr His Glu Val

35 40 45

Cys Arg Trp Val Leu Asp Thr Pro Met Pro Ala Ala Val Ala Asn Leu

50 55 60

Thr Val Leu Asp Ala Asp Ala Asp Leu Pro Ala Gln Leu Val Phe Ser

65 70 75 80

Ala Leu Pro Ser Thr Val Ala Gly Pro Ile Glu Gln Arg Leu Ala Ala

85 90 95

Ala Gly His Ile Val Cys Ser Asn Ala Ser Asn His Arg Met Glu Pro

100 105 110

Asp Val Pro Leu Ile Ile Pro Glu Val Asn Pro Asp His Leu Ala Leu

115 120 125

Ile Pro Val Gln Arg Arg Arg Arg Gly Trp Ser Gly Ala Ile Val Thr

130 135 140

Asn Pro Asn Cys Thr Ser Thr Pro Ala Thr Met Val Leu Arg Pro Leu

145 150 155 160

Leu Asp Thr Phe Gly Val Arg Arg Met Leu Leu Val Ser Met Gln Ala

165 170 175

Leu Ser Gly Ala Gly Tyr Pro Gly Val Pro Ser Tyr Asp Val Val Asp

180 185 190

Asn Val Ile Pro Tyr Ile Gly Gly Glu Glu Pro Lys Leu Glu Ile Glu

195 200 205

Pro Gln Lys Met Leu Gly Arg Leu Glu Gly Glu Thr Ile Val Pro Ala

210 215 220

Gly Phe Thr Thr Ser Ala His Cys Asn Arg Val Pro Val Leu Glu Gly

225 230 235 240

His Leu Val Cys Leu Ser Ile Glu Leu Glu Arg Lys Ala Asp Pro Ala

245 250 255

Glu Ile Ala Thr Val Leu Ser Asn Phe Arg Ala Leu Pro Gln Glu Leu

260 265 270

Arg Leu Pro Thr Ala Pro Glu Gln Pro Ile Ile Val Arg His Glu Pro

275 280 285

Asp Arg Pro Gln Pro Arg Arg Asp Arg Asp Ala Gly Arg Gly Met Ala

290 295 300

Thr Val Val Gly Arg Ile Arg Pro Cys Ser Leu Phe Asp Ile Lys Leu

305 310 315 320

Ile Ala Leu Ser His Asn Thr Ile Arg Gly Ala Ala Gly Ala Ser Ile

325 330 335

Leu Asn Ala Glu Leu Met His Ala Gln Gly Trp Leu Ala

340 345

<210>29

<211>1089

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from Lactobacillus agilis

<400>29

atggatgaaa aactccgtgc cggtgttctg ggcgccacgg gtatggtagg acagcggttc 60

gtagcgatgt tggagaatca cccgtggttc gaagtaacca ctcttgcagc ttcgccgcgc 120

tcagcaggta aaacgtacgc acaggctgtg gatggccggt ggaaaatgga aactcccatt 180

ccagaggccg tcaaggatct caagattctt gatgtatcgg aagttgagaa agtcgcagct 240

caagtcgatt ttgtgttttc cgcagtttct atgtccaaag acaagattaa agcgattgaa 300

gaagcctacg cgaaaaccga aactccggta gtatcgaaca attcggcgca ccgttggacc 360

ccagatgttc ctatggtcgt gcccgaaatt aacccggagc atttcaaggt aattgattac 420

cagcggaaac ggctcggcac gaagcgcggc ttcattgccg ttaagccgaa ctgttctatc 480

cagagctacg ccccggctct cagcgcatgg ttgaaattcg aaccgtacga ggtaatcgct 540

tcaacttatc aggctatctc gggagctggt aagaacttcg acgactggcc ggagatgaag 600

ggaaacatca tcccttttat ttctggcgag gaggaaaaat cagagaagga gcccctcaag 660

atctggggac aacttgacga agctaaggga gagatcgtcc cagccactag ccctgttatt 720

acgagccaat gtattcgggt cccgatcctt tacggacaca ccgcgaccgt ctttgttaaa 780

ttcaagcaga acccaacgaa agaggaactg gtagctgctt tggaatcata tcagggactg 840

cctcaatcct tgaatttgcc gtctacccct aagcaattta ttcagtatct cagcgaagac 900

gaccgtccgc aggttgcgaa ggacgttaac tttgagaatg gtatgggtat ctctattggc 960

cgccttcgta aagattcggt ttacgattgg aagttcgtag gactctcgca caacaccgcg 1020

cgtggcgccg caggaggcgg cgtcctttcg gccgaattgc tgacggctca gggctatatt 1080

accaaaaag 1089

<210>30

<211>363

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from Lactobacillus agilis

<400>30

Met Asp Glu Lys Leu Arg Ala Gly Val Leu Gly Ala Thr Gly Met Val

1 5 10 15

Gly Gln Arg Phe Val Ala Met Leu Glu Asn His Pro Trp Phe Glu Val

20 25 30

Thr Thr Leu Ala Ala Ser Pro Arg Ser Ala Gly Lys Thr Tyr Ala Gln

35 40 45

Ala Val Asp Gly Arg Trp Lys Met Glu Thr Pro Ile Pro Glu Ala Val

50 55 60

Lys Asp Leu Lys Ile Leu Asp Val Ser Glu Val Glu Lys Val Ala Ala

65 70 75 80

Gln Val Asp Phe Val Phe Ser Ala Val Ser Met Ser Lys Asp Lys Ile

85 90 95

Lys Ala Ile Glu Glu Ala Tyr Ala Lys Thr Glu Thr Pro Val Val Ser

100 105 110

Asn Asn Ser Ala His Arg Trp Thr Pro Asp Val Pro Met Val Val Pro

115 120 125

Glu Ile Asn Pro Glu His Phe Lys Val Ile Asp Tyr Gln Arg Lys Arg

130 135 140

Leu Gly Thr Lys Arg Gly Phe Ile Ala Val Lys Pro Asn Cys Ser Ile

145 150 155 160

Gln Ser Tyr Ala Pro Ala Leu Ser Ala Trp Leu Lys Phe Glu Pro Tyr

165 170 175

Glu Val Ile Ala Ser Thr Tyr Gln Ala Ile Ser Gly Ala Gly Lys Asn

180 185 190

Phe Asp Asp Trp Pro Glu Met Lys Gly Asn Ile Ile Pro Phe Ile Ser

195 200 205

Gly Glu Glu Glu Lys Ser Glu Lys Glu Pro Leu Lys Ile Trp Gly Gln

210 215 220

Leu Asp Glu Ala Lys Gly Glu Ile Val Pro Ala Thr Ser Pro Val Ile

225 230 235 240

Thr Ser Gln Cys Ile Arg Val Pro Ile Leu Tyr Gly His Thr Ala Thr

245 250 255

Val Phe Val Lys Phe Lys Gln Asn Pro Thr Lys Glu Glu Leu Val Ala

260 265 270

Ala Leu Glu Ser Tyr Gln Gly Leu Pro Gln Ser Leu Asn Leu Pro Ser

275 280 285

Thr Pro Lys Gln Phe Ile Gln Tyr Leu Ser Glu Asp Asp Arg Pro Gln

290 295 300

Val Ala Lys Asp Val Asn Phe Glu Asn Gly Met Gly Ile Ser Ile Gly

305 310 315 320

Arg Leu Arg Lys Asp Ser Val Tyr Asp Trp Lys Phe Val Gly Leu Ser

325 330 335

His Asn Thr Ala Arg Gly Ala Ala Gly Gly Gly Val Leu Ser Ala Glu

340 345 350

Leu Leu Thr Ala Gln Gly Tyr Ile Thr Lys Lys

355 360

<210>31

<211>1092

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from Bifidobacterium gallicum

<400>31

atgtccgaga aactgaaggt aggaattatt ggagcgaccg gcatggtggg tcagcggttc 60

gtgactctgt tggataatca cccatggttt gaggtcacca ccttggctgc ctcagcacac 120

tcggccggaa aaacctacga gcaggccgtt ggtggccggt ggaagatgga gacgcctatg 180

ccggcggcgg tgaaggacat gattgtccgg gatgccaagg atgtggagag cgtggctgca 240

gacgtggact tcgtgttctc tgcagtgaac atgccgaagg acgagatccg tgccttggag 300

gagcgctacg ccaagacgga gactcccgtt gtatcaaaca actcggccca ccgttggacg 360

ccagacgtac ccatggtagt ccccgagatt aatcccgaac attatgaagt aatcaagtac 420

cagcgggctc gtcttggtac tacgcgtggc ttcatcgccg tgaaaccaaa ctgctccatc 480

caggcatata cgccggcact cgccgcgtgg cgggagttcg aaccgcgtga agtcgtggta 540

tctacttacc aagcgatttc tggtgctggt aagactttcg cggactggcc agaaatggaa 600

ggcaatatca tccctttcat tagcggtgaa gaggagaagt ccgagcggga accactgcgg 660

gtatttggcc acgtcgatga gagcaagggt cagattgtcc cctttgatgg tccactccgt 720

atcacgtcgc agtgtatccg tgtacccgta ttgaatggtc acactgctac tgtttttatc 780

aacttcggca aaaaaccatc taaggatgaa ctcatcgacc gtcttgtgaa ctacacgtcg 840

gaggcgagcc gtcttggtct ccctcacgct cccaaacagt tcatccaata tctgactgag 900

gatgatcgtc cgcaggtacg tttggacgtt gattacgagg gcggtatggg agtttccatc 960

ggtcgcctgc gcgaggacac gctcttcgac ttcaaattcg tgggactcgc tcataacacg 1020

ctgcgtggag ccgcaggtgg agcacttgaa tccgcagaaa tgttgaaagc actcggatat 1080

atttcggcga aa 1092

<210>32

<211>364

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from Bifidobacterium gallicum

<400>32

Met Ser Glu Lys Leu Lys Val Gly Ile Ile Gly Ala Thr Gly Met Val

1 5 10 15

Gly Gln Arg Phe Val Thr Leu Leu Asp Asn His Pro Trp Phe Glu Val

20 25 30

Thr Thr Leu Ala Ala Ser Ala His Ser Ala Gly Lys Thr Tyr Glu Gln

35 40 45

Ala Val Gly Gly Arg Trp Lys Met Glu Thr Pro Met Pro Ala Ala Val

50 55 60

Lys Asp Met Ile Val Arg Asp Ala Lys Asp Val Glu Ser Val Ala Ala

65 70 75 80

Asp Val Asp Phe Val Phe Ser Ala Val Asn Met Pro Lys Asp Glu Ile

85 90 95

Arg Ala Leu Glu Glu Arg Tyr Ala Lys Thr Glu Thr Pro Val Val Ser

100 105 110

Asn Asn Ser Ala His Arg Trp Thr Pro Asp Val Pro Met Val Val Pro

115 120 125

Glu Ile Asn Pro Glu His Tyr Glu Val Ile Lys Tyr Gln Arg Ala Arg

130 135 140

Leu Gly Thr Thr Arg Gly Phe Ile Ala Val Lys Pro Asn Cys Ser Ile

145 150 155 160

Gln Ala Tyr Thr Pro Ala Leu Ala Ala Trp Arg Glu Phe Glu Pro Arg

165 170 175

Glu Val Val Val Ser Thr Tyr Gln Ala Ile Ser Gly Ala Gly Lys Thr

180 185 190

Phe Ala Asp Trp Pro Glu Met Glu Gly Asn Ile Ile Pro Phe Ile Ser

195 200 205

Gly Glu Glu Glu Lys Ser Glu Arg Glu Pro Leu Arg Val Phe Gly His

210 215 220

Val Asp Glu Ser Lys Gly Gln Ile Val Pro Phe Asp Gly Pro Leu Arg

225 230 235 240

Ile Thr Ser Gln Cys Ile Arg Val Pro Val Leu Asn Gly His Thr Ala

245 250 255

Thr Val Phe Ile Asn Phe Gly Lys Lys Pro Ser Lys Asp Glu Leu Ile

260 265 270

Asp Arg Leu Val Asn Tyr Thr Ser Glu Ala Ser Arg Leu Gly Leu Pro

275 280 285

His Ala Pro Lys Gln Phe Ile Gln Tyr Leu Thr Glu Asp Asp Arg Pro

290 295 300

Gln Val Arg Leu Asp Val Asp Tyr Glu Gly Gly Met Gly Val Ser Ile

305 310 315 320

Gly Arg Leu Arg Glu Asp Thr Leu Phe Asp Phe Lys Phe Val Gly Leu

325 330 335

Ala His Asn Thr Leu Arg Gly Ala Ala Gly Gly Ala Leu Glu Ser Ala

340 345 350

Glu Met Leu Lys Ala Leu Gly Tyr Ile Ser Ala Lys

355360

<210>33

<211>1059

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from bacterial Bifidobacterium

<400>33

atgaagcaat tcaatgtggg aattttggga gcaacgggtg cagttggcca gaaattcatc 60

aatctcctcc agggtcatcc ttggttcacg attacggctc tcggagcatc cgaacgttcc 120

gcgggaaaat cctacgctga agcagttaat tggattgaag ccgttgagtt gcctgacgca 180

attgcctcta tgacggtcac tgattgctct cccgcaagca tgaaaggcgt tgatttcgtg 240

ttttctggtt tggacgcgtc tgtagcgacc gaacttgagg gcgatctcgc tcgggctggt 300

attcccgtga tctcaaatgc taagaactat cgcactcacc cgcatgtccc ccttctggta 360

ccagaggtga acgcgaccca caccgagatg attaaggcac aagattttga tccttccggc 420

cgtggcttta tcgtaacgaa tccaaattgt gtcgcggttc ctctcgtgat ggcgctcaag 480

cctctcatgg acgcgtacgg tatccaggca gtcgccctca cgactatgca atcggtgtct 540

ggtgctggtt accccggagt cgcctctttg gacatcctgg gaaatgtgat cccatttatt 600

tccggcgagg agccgaaaat cgccgcggag cctatgaaat tgttgggccg gctgggagga 660

gaccaaaccg tcaccgaggc ccgtttccct attgacgcta ccgcaactcg tgtgcctacc 720

atcgagggac atcttttgag cgtgaagatt aagttcgaac aaaagccagc gtctgctgac 780

gaaattaagg ctgtgctccg taactggaag cacgaggttt caggtttgga tcttccgtct 840

tctccgcgta ctgcgctcaa agtttacgat gacgatcggt ttccacaacc acgcaaaaac 900

gcttacaacg agaacggaat gcaagtcggc gtgggtcgtg tgcgtatgct cgagtttttt 960

gacgcgggtc ttgttgcatt gggccataat acgtgtcggg gtgcggctgg cgtagctatc 1020

ttgaacgctg agctgctggt aaaacagggt ttcatccaa 1059

<210>34

<211>353

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from bacterial Bifidobacterium

<400>34

Met Lys Gln Phe Asn Val Gly Ile Leu Gly Ala Thr Gly Ala Val Gly

1 5 10 15

Gln Lys Phe Ile Asn Leu Leu Gln Gly His Pro Trp Phe Thr Ile Thr

20 25 30

Ala Leu Gly Ala Ser Glu Arg Ser Ala Gly Lys Ser Tyr Ala Glu Ala

35 40 45

Val Asn Trp Ile Glu Ala Val Glu Leu Pro Asp Ala Ile Ala Ser Met

50 55 60

Thr Val Thr Asp Cys Ser Pro Ala Ser Met Lys Gly Val Asp Phe Val

65 70 75 80

Phe Ser Gly Leu Asp Ala Ser Val Ala Thr Glu Leu Glu Gly Asp Leu

85 90 95

Ala Arg Ala Gly Ile Pro Val Ile Ser Asn Ala Lys Asn Tyr Arg Thr

100 105 110

His Pro His Val Pro Leu Leu Val Pro Glu Val Asn Ala Thr His Thr

115 120 125

Glu Met Ile Lys Ala Gln Asp Phe Asp Pro Ser Gly Arg Gly Phe Ile

130 135 140

Val Thr Asn Pro Asn Cys Val Ala Val Pro Leu Val Met Ala Leu Lys

145 150 155 160

Pro Leu Met Asp Ala Tyr Gly Ile Gln Ala Val Ala Leu Thr Thr Met

165 170 175

Gln Ser Val Ser Gly Ala Gly Tyr Pro Gly Val Ala Ser Leu Asp Ile

180 185 190

Leu Gly Asn Val Ile Pro Phe Ile Ser Gly Glu Glu Pro Lys Ile Ala

195 200 205

Ala Glu Pro Met Lys Leu Leu Gly Arg Leu Gly Gly Asp Gln Thr Val

210 215 220

Thr Glu Ala Arg Phe Pro Ile Asp Ala Thr Ala Thr Arg Val Pro Thr

225 230 235 240

Ile Glu Gly His Leu Leu Ser Val Lys Ile Lys Phe Glu Gln Lys Pro

245 250 255

Ala Ser Ala Asp Glu Ile Lys Ala Val Leu Arg Asn Trp Lys His Glu

260 265 270

Val Ser Gly Leu Asp Leu Pro Ser Ser Pro Arg Thr Ala Leu Lys Val

275 280 285

Tyr Asp Asp Asp Arg Phe Pro Gln Pro Arg Lys Asn Ala Tyr Asn Glu

290 295 300

Asn Gly Met Gln Val Gly Val Gly Arg Val Arg Met Leu Glu Phe Phe

305 310 315 320

Asp Ala Gly Leu Val Ala Leu Gly His Asn Thr Cys Arg Gly Ala Ala

325 330 335

Gly Val Ala Ile Leu Asn Ala Glu Leu Leu Val Lys Gln Gly Phe Ile

340 345 350

Gln

<210>35

<211>1086

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from Myxococcus hancei

<400>35

atggctcgtt tgcgtgctgc gttgatcggc gcgacgggac tcgccggtca acagttcatt 60

gcggccctca aagaccaccc ttttattgaa ttgactggac tggcagcgtc gccacggtcg 120

gcgggcaaaa cgtacgctga agccctcaag actgcatcag gtatgactgc atggttcgta 180

ccagaacccc tgccagccgg cattgctggt atgaaagttg ttgcgggaga cgccctcgag 240

gcgaaagatt atgaccttgt tttctctgct gtagaagcgg acgtagcccg cgagcttgag 300

ccaaaactgg cgaaagacat tccagtattt tcggctgcta gcgcgttccg ctacgaagat 360

gacgtaccac tgcttatccc ccccgttaac gccgcacacg cgcctctgat tcgtgaacag 420

cagcgtcgtc gtggttggaa aggttatgtt gttccaatcc caaattgcac gaccaccggc 480

cttgcggtta cgctcgcgcc tcttgtcgag cggtttggag tcaaggctgt cttgatgacc 540

tcacttcaag caatgagcgg agcgggacgg tctcctggcg tgatcggcat ggacattctt 600

gataacgtga ttccgtatat ccccaaagag gaacataaag tagaagtgga gactaagaaa 660

attcttggtg ctcttcgtcc tggtggcgaa ggccttacgc cccacgatat ccgcgtctca 720

tgcacctgca ctcgggtcgc ggtcatggaa ggccatactg aatcagtttt tgtttctctg 780

gaaaaaaaag ctactgttgc agaggttacc caagcgttgc gtgaatggca gggcgcggaa 840

cttgcacgga aattgccgtc cgccgcaccg cgttggattg aagtgcttga tgaccccttc 900

cgcccacaac cgcgtcttga ccgggacacg cacggtggaa tggctaccac ggtgggtcgg 960

attcgtgagg acggtgtttt ggagaacgga tttaagtacg ttttggtttc tcacaacact 1020

aaaatgggag ctgctcgcgg cgcgattttg gtagcagaac tgcttcgggc tcaaggcttg 1080

cttgga 1086

<210>36

<211>362

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from Myxococcus hancei

<400>36

Met Ala Arg Leu Arg Ala Ala Leu Ile Gly Ala Thr Gly Leu Ala Gly

1 5 10 15

Gln Gln Phe Ile Ala Ala Leu Lys Asp His Pro Phe Ile Glu Leu Thr

20 25 30

Gly Leu Ala Ala Ser Pro Arg Ser Ala Gly Lys Thr Tyr Ala Glu Ala

35 40 45

Leu Lys Thr Ala Ser Gly Met Thr Ala Trp Phe Val Pro Glu Pro Leu

50 55 60

Pro Ala Gly Ile Ala Gly Met Lys Val Val Ala Gly Asp Ala Leu Glu

65 70 75 80

Ala Lys Asp Tyr Asp Leu Val Phe Ser Ala Val Glu Ala Asp Val Ala

85 90 95

Arg Glu Leu Glu Pro Lys Leu Ala Lys Asp Ile Pro Val Phe Ser Ala

100 105 110

Ala Ser Ala Phe Arg Tyr Glu Asp Asp Val Pro Leu Leu Ile Pro Pro

115 120 125

Val Asn Ala Ala His Ala Pro Leu Ile Arg Glu Gln Gln Arg Arg Arg

130 135 140

Gly Trp Lys Gly Tyr Val Val Pro Ile Pro Asn Cys Thr Thr Thr Gly

145 150 155 160

Leu Ala Val Thr Leu Ala Pro Leu Val Glu Arg Phe Gly Val Lys Ala

165 170 175

Val Leu Met Thr Ser Leu Gln Ala Met Ser Gly Ala Gly Arg Ser Pro

180 185 190

Gly Val Ile Gly Met Asp Ile Leu Asp Asn Val Ile Pro Tyr Ile Pro

195 200 205

Lys Glu Glu His Lys Val Glu Val Glu Thr Lys Lys Ile Leu Gly Ala

210 215 220

Leu Arg Pro Gly Gly Glu Gly Leu Thr Pro His Asp Ile Arg Val Ser

225 230 235 240

Cys Thr Cys Thr Arg Val Ala Val Met Glu Gly His Thr Glu Ser Val

245 250 255

Phe Val Ser Leu Glu Lys Lys Ala Thr Val Ala Glu Val Thr Gln Ala

260 265 270

Leu Arg Glu Trp Gln Gly Ala Glu Leu Ala Arg Lys Leu Pro Ser Ala

275 280 285

Ala Pro Arg Trp Ile Glu Val Leu Asp Asp Pro Phe Arg Pro Gln Pro

290 295 300

Arg Leu Asp Arg Asp Thr His Gly Gly Met Ala Thr Thr Val Gly Arg

305 310 315 320

Ile Arg Glu Asp Gly Val Leu Glu Asn Gly Phe Lys Tyr Val Leu Val

325 330 335

Ser His Asn Thr Lys Met Gly Ala Ala Arg Gly Ala Ile Leu Val Ala

340 345 350

Glu Leu Leu Arg Ala Gln Gly Leu Leu Gly

355 360

<210>37

<211>1083

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from Paenibacillus azotobacter

<400>37

atgacggaga aattgcgtgc tggcatcgtc ggcggaactg gaatggtcgg ccagcgcttt 60

attgcgcttc ttgagaatca cccttggttt caggtaaccg ctattgccgc tagcgccaac 120

tctgcgggta aaacgtatga ggaatccgta aaaggccggt ggaagctctc tacgccaatg 180

cctgaaagcg tcaagcacat tccagtgcag gacgcgtcac gtgtcgagga agtagccgca 240

ggcgtggatt tgatcttttg cgcggtcgat atgaaaaaga atgaaatcca ggcactcgag 300

gaagcctatg ccaaagcggg tgtccccgtc atcagcaaca actccgcaca tcggtggact 360

ccagacgttc cgatggtcgt tccagaaatc aacccagaac acctggaggt cattgcagct 420

cagcggaaacgcctgggaac cgaaactggc ttcattgcgg taaagcctaa ttgcagcatc 480

cagtcttatg ttccaatgct gaacgcactt cggggcttta agcctactca agttgtcgca 540

tccacttatc aggcgatttc tggtgccggt aaaacgttca cggattggcc cgaaatgctg 600

gacaacgtaa tcccttacat tggaggtgag gaggaaaaaa gcgaacaaga gccgcttcgc 660

atttggggta ctgtagagga tggccaaatt gttaaagcct ccgcacccca tattacgacg 720

caatgcatcc gggtaccagt gactgacggt cacctggcca ctgttttcgt tagcttcgag 780

aataaaccct caaaggaaga cattctcgaa tcctggaaaa attacaaggg tcggccgcaa 840

gagcttgaac ttccgtcagc acccaaacaa ttcatcactt acttcgaaga ggaaaatcgg 900

ccacagacca acctcgaccg cgacatcgaa aatggaatgg gcatttccgc tggccgcctc 960

cgggaggata gcctttatga ctttaaattc gttggactct cacataacac tctgcgcgga 1020

gctgctggtg gtgcggtact gatcgcagag ttgctcaagg cagagggcta cattactaag 1080

cgc 1083

<210>38

<211>361

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from Paenibacillus azotobacter

<400>38

Met Thr Glu Lys Leu Arg Ala Gly Ile Val Gly Gly Thr Gly Met Val

1 5 10 15

Gly Gln Arg Phe Ile Ala Leu Leu Glu Asn His Pro Trp Phe Gln Val

20 25 30

Thr Ala Ile Ala Ala Ser Ala Asn Ser Ala Gly Lys Thr Tyr Glu Glu

35 40 45

Ser Val Lys Gly Arg Trp Lys Leu Ser Thr Pro Met Pro Glu Ser Val

50 55 60

Lys His Ile Pro Val Gln Asp Ala Ser Arg Val Glu Glu Val Ala Ala

65 70 75 80

Gly Val Asp Leu Ile Phe Cys Ala Val Asp Met Lys Lys Asn Glu Ile

85 90 95

Gln Ala Leu Glu Glu Ala Tyr Ala Lys Ala Gly Val Pro Val Ile Ser

100 105 110

Asn Asn Ser Ala His Arg Trp Thr Pro Asp Val Pro Met Val Val Pro

115 120 125

Glu Ile Asn Pro Glu His Leu Glu Val Ile Ala Ala Gln Arg Lys Arg

130 135 140

Leu Gly Thr Glu Thr Gly Phe Ile Ala Val Lys Pro Asn Cys Ser Ile

145 150 155 160

Gln Ser Tyr Val Pro Met Leu Asn Ala Leu Arg Gly Phe Lys Pro Thr

165 170 175

Gln Val Val Ala Ser Thr Tyr Gln Ala Ile Ser Gly Ala Gly Lys Thr

180 185 190

Phe Thr Asp Trp Pro Glu Met Leu Asp Asn Val Ile Pro Tyr Ile Gly

195 200 205

Gly Glu Glu Glu Lys Ser Glu Gln Glu Pro Leu Arg Ile Trp Gly Thr

210 215 220

Val Glu Asp Gly Gln Ile Val Lys Ala Ser Ala Pro His Ile Thr Thr

225 230 235 240

Gln Cys Ile Arg Val Pro Val Thr Asp Gly His Leu Ala Thr Val Phe

245 250 255

Val Ser Phe Glu Asn Lys Pro Ser Lys Glu Asp Ile Leu Glu Ser Trp

260 265 270

Lys Asn Tyr Lys Gly Arg Pro Gln Glu Leu Glu Leu Pro Ser Ala Pro

275 280 285

Lys Gln Phe Ile Thr Tyr Phe Glu Glu Glu Asn Arg Pro Gln Thr Asn

290 295 300

Leu Asp Arg Asp Ile Glu Asn Gly Met Gly Ile Ser Ala Gly Arg Leu

305 310 315 320

Arg Glu Asp Ser Leu Tyr Asp Phe Lys Phe Val Gly Leu Ser His Asn

325 330 335

Thr Leu Arg Gly Ala Ala Gly Gly Ala Val Leu Ile Ala Glu Leu Leu

340345 350

Lys Ala Glu Gly Tyr Ile Thr Lys Arg

355 360

<210>39

<211>1032

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized asd from Corynebacterium glutamicum

<400>39

atgaccacta tcgcggtcgt tggagcaacg ggacaagtag gacaggtgat gcggacgctt 60

ctggaagaac gtaattttcc tgccgatacg gtccggttct ttgcgtcgcc gcggagcgcc 120

ggtcggaaga tcgagttccg gggtaccgaa attgaggtag aggacatcac ccaagcgacc 180

gaggagtctc tcaaagatat tgatgtagca cttttttctg caggcggtac cgcgtcgaag 240

caatatgctc ctctgttcgc ggctgcgggt gcgacggtgg tggacaattc ttcggcctgg 300

cggaaagatg atgaagtacc gttgattgtc tctgaagtaa atccttcgga caaagattct 360

ctcgtgaagg gtatcattgc gaaccctaac tgtaccacca tggctgcaat gcctgtactg 420

aaaccacttc atgatgccgc aggtcttgta aagcttcatg tctcctcgta tcaagcggta 480

tccggtagcg gtctcgcagg cgtcgaaacc ctcgcaaaac aggtcgctgc tgttggtgac 540

cataacgtcg agttcgtcca cgacggtcag gccgccgacg caggagatgt tggcccatac 600

gtcagcccca tcgcttataa tgttttgccc ttcgcaggta acctggttga cgacggaacc 660

tttgagaccg acgaggagca aaaactgcgc aatgaaagcc gtaagatcct cggactgccg 720

gacttgaaag tttccggtac gtgtgtacgt gttcccgtgt ttactggaca taccttgact 780

atccatgctg agttcgataa agcaattacc gtggaccaag ctcaggagat cctcggagca 840

gcgtcgggag taaagttggt agacgtaccg actcctctgg cggctgcggg tattgatgag 900

tcgcttgtag gacgcattcg ccaagactcg acggtggatg acaaccgcgg actcgttctc 960

gtggtatctg gcgacaatct tcggaagggc gcggctttga ataccatcca gatcgccgag 1020

cttctggtaa ag 1032

<210>40

<211>344

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized asd from Corynebacterium glutamicum

<400>40

Met Thr Thr Ile Ala Val Val Gly Ala Thr Gly Gln Val Gly Gln Val

1 5 10 15

Met Arg Thr Leu Leu Glu Glu Arg Asn Phe Pro Ala Asp Thr Val Arg

20 25 30

Phe Phe Ala Ser Pro Arg Ser Ala Gly Arg Lys Ile Glu Phe Arg Gly

35 40 45

Thr Glu Ile Glu Val Glu Asp Ile Thr Gln Ala Thr Glu Glu Ser Leu

50 55 60

Lys Asp Ile Asp Val Ala Leu Phe Ser Ala Gly Gly Thr Ala Ser Lys

65 70 75 80

Gln Tyr Ala Pro Leu Phe Ala Ala Ala Gly Ala Thr Val Val Asp Asn

85 90 95

Ser Ser Ala Trp Arg Lys Asp Asp Glu Val Pro Leu Ile Val Ser Glu

100 105 110

Val Asn Pro Ser Asp Lys Asp Ser Leu Val Lys Gly Ile Ile Ala Asn

115 120 125

Pro Asn Cys Thr Thr Met Ala Ala Met Pro Val Leu Lys Pro Leu His

130 135 140

Asp Ala Ala Gly Leu Val Lys Leu His Val Ser Ser Tyr Gln Ala Val

145 150 155 160

Ser Gly Ser Gly Leu Ala Gly Val Glu Thr Leu Ala Lys Gln Val Ala

165 170 175

Ala Val Gly Asp His Asn Val Glu Phe Val His Asp Gly Gln Ala Ala

180 185 190

Asp Ala Gly Asp Val Gly Pro Tyr Val Ser Pro Ile Ala Tyr Asn Val

195 200 205

Leu Pro Phe Ala Gly Asn Leu Val Asp Asp Gly Thr Phe Glu Thr Asp

210 215 220

Glu Glu Gln Lys Leu Arg Asn Glu Ser Arg Lys Ile Leu Gly Leu Pro

225 230 235 240

Asp Leu Lys Val Ser Gly Thr Cys Val Arg Val Pro Val Phe Thr Gly

245 250 255

His Thr Leu Thr Ile His Ala Glu Phe Asp Lys Ala Ile Thr Val Asp

260 265 270

Gln Ala Gln Glu Ile Leu Gly Ala Ala Ser Gly Val Lys Leu Val Asp

275 280 285

Val Pro Thr Pro Leu Ala Ala Ala Gly Ile Asp Glu Ser Leu Val Gly

290 295 300

Arg Ile Arg Gln Asp Ser Thr Val Asp Asp Asn Arg Gly Leu Val Leu

305 310 315 320

Val Val Ser Gly Asp Asn Leu Arg Lys Gly Ala Ala Leu Asn Thr Ile

325 330 335

Gln Ile Ala Glu Leu Leu Val Lys

340

<210>41

<211>1341

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized gdh from Corynebacterium glutamicum

<400>41

atgactgtag atgaacaggt ttctaactac tacgacatgc ttctcaaacg taatgctgga 60

gagcccgaat ttcatcaggc ggttgctgaa gtgcttgaat ccctcaagat tgttcttgaa 120

aaagatccgc actacgcgga ctatggcctc atccagcggc tgtgtgaacc tgaacgtcaa 180

ctgatcttcc gtgtgccgtg ggtagatgat cagggacaag tgcacgtcaa ccgcggtttt 240

cgtgtacagt ttaattcggc gctcggtccc tacaaaggcg gattgcgttt ccaccctagc 300

gtcaatcttg gcatcgtcaa gtttttgggt ttcgaacaaa tttttaagaa ttcccttacc 360

ggactgccta tcggaggcgg aaagggcggt tcggattttg accctaaagg caagagcgat 420

ctcgaaatca tgcggttttg tcagtctttt atgaccgaac tgcatcgtca catcggcgaa 480

tatcgcgatg tcccggcggg tgatatcggc gtgggtggtc gtgagatcgg atacctcttt 540

ggtcattatc gtcggatggc gaatcagcac gaatcgggag tccttaccgg caaaggtctg 600

acttggggcg gcagcctggt tcggaccgaa gccacgggat acggttgtgt ctatttcgta 660

tcggagatga tcaaagcaaa aggcgagtca atctcgggac agaagattat cgtatccgga 720

tcgggaaatg ttgctaccta tgccattgag aaagctcaag agctgggcgc gacggtgatc 780

ggcttctcgg attcctcagg ctgggtgcat actccgaatg gtgtggacgt ggctaaactt 840

cgcgaaatca aggaagtacg tcgcgcacgc gtaagcgttt atgccgatga agtggaggga 900

gcaacctacc ataccgatgg atccatctgg gatcttaagt gtgacatcgc acttccttgc 960

gctacgcaaa atgaactgaa cggagagaat gcgaaaacgc tggccgataa tggttgccgc 1020

ttcgtcgcgg agggcgctaa catgccgagc accccggagg ccgtcgaagt ttttcgggag 1080

cgcgacatcc ggttcggccc cggcaaagcg gctaatgctg gcggagtggc aacgtcagcg 1140

ttggagatgc agcagaacgc atcccgggac tcatggagct tcgaatacac cgacgaacgc 1200

ctccaggtca ttatgaagaa catttttaag acgtgtgcgg aaaccgcagc cgagtatggc 1260

cacgagaacg attacgtcgt cggagcaaac attgcaggat ttaagaaagt tgctgatgcg 1320

atgctcgccc aaggtgtgat c 1341

<210>42

<211>447

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized gdh from Corynebacterium glutamicum

<400>42

Met Thr Val Asp Glu Gln Val Ser Asn Tyr Tyr Asp Met Leu Leu Lys

1 5 10 15

Arg Asn Ala Gly Glu Pro Glu Phe His Gln Ala Val Ala Glu Val Leu

20 25 30

Glu Ser Leu Lys Ile Val Leu Glu Lys Asp Pro His Tyr Ala Asp Tyr

35 40 45

Gly Leu Ile Gln Arg Leu Cys Glu Pro Glu Arg Gln Leu Ile Phe Arg

50 55 60

Val Pro Trp Val Asp Asp Gln Gly Gln Val His Val Asn Arg Gly Phe

65 70 75 80

Arg Val Gln Phe Asn Ser Ala Leu Gly Pro Tyr Lys Gly Gly Leu Arg

85 90 95

Phe His Pro Ser Val Asn Leu Gly Ile Val Lys Phe Leu Gly Phe Glu

100 105 110

Gln Ile Phe Lys Asn Ser Leu Thr Gly Leu Pro Ile Gly Gly Gly Lys

115 120 125

Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Leu Glu Ile Met

130 135 140

Arg Phe Cys Gln Ser Phe Met Thr Glu Leu His Arg His Ile Gly Glu

145 150 155 160

Tyr Arg Asp Val Pro Ala Gly Asp Ile Gly Val Gly Gly Arg Glu Ile

165 170 175

Gly Tyr Leu Phe Gly His Tyr Arg Arg Met Ala Asn Gln His Glu Ser

180 185 190

Gly Val Leu Thr Gly Lys Gly Leu Thr Trp Gly Gly Ser Leu Val Arg

195 200 205

Thr Glu Ala Thr Gly Tyr Gly Cys Val Tyr Phe Val Ser Glu Met Ile

210 215 220

Lys Ala Lys Gly Glu Ser Ile Ser Gly Gln Lys Ile Ile Val Ser Gly

225 230 235 240

Ser Gly Asn Val Ala Thr Tyr Ala Ile Glu Lys Ala Gln Glu Leu Gly

245 250 255

Ala Thr Val Ile Gly Phe Ser Asp Ser Ser Gly Trp Val His Thr Pro

260 265 270

Asn Gly Val Asp Val Ala Lys Leu Arg Glu Ile Lys Glu Val Arg Arg

275 280 285

Ala Arg Val Ser Val Tyr Ala Asp Glu Val Glu Gly Ala Thr Tyr His

290 295 300

Thr Asp Gly Ser Ile Trp Asp Leu Lys Cys Asp Ile Ala Leu Pro Cys

305 310 315 320

Ala Thr Gln Asn Glu Leu Asn Gly Glu Asn Ala Lys Thr Leu Ala Asp

325 330 335

Asn Gly Cys Arg Phe Val Ala Glu Gly Ala Asn Met Pro Ser Thr Pro

340 345 350

Glu Ala Val Glu Val Phe Arg Glu Arg Asp Ile Arg Phe Gly Pro Gly

355 360 365

Lys Ala Ala Asn Ala Gly Gly Val Ala Thr Ser Ala Leu Glu Met Gln

370 375 380

Gln Asn Ala Ser Arg Asp Ser Trp Ser Phe Glu Tyr Thr Asp Glu Arg

385 390 395 400

Leu Gln Val Ile Met Lys Asn Ile Phe Lys Thr Cys Ala Glu Thr Ala

405 410 415

Ala Glu Tyr Gly His Glu Asn Asp Tyr Val Val Gly Ala Asn Ile Ala

420 425 430

Gly Phe Lys Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Ile

435 440 445

<210>43

<211>1350

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized gdh from C.symbiosis

<400>43

atgtccaagt acgttgaccg cgtcattgct gaagtcgaga aaaagtacgc cgacgaaccg 60

gaattcgttc aaaccgttga agaggtactc tcttcactcg gcccagtagt cgacgcacac 120

cccgagtatg aagaggttgc gctcttggag cgtatggtca ttccagaacg tgtcattgag 180

tttcgcgtcc cgtgggagga tgacaatggt aaagtacatg tgaatactgg ttaccgcgtc 240

caatttaatg gcgcgatcgg cccttataaa ggtggcttgc gcttcgcccc ttcggtcaac 300

ctttccatta tgaaatttct cggcttcgag caagcattca aagattccct gaccacgctt 360

cctatgggag gagcaaaagg cggttcagac ttcgacccaa acggaaaatc cgatcgcgaa 420

gtaatgcgct tctgccaggc gttcatgact gagttgtatc ggcatattgg tcccgatatc 480

gacgtgcctg ctggtgactt gggcgttggt gcgcgtgaaa ttggttacat gtacggacaa 540

taccggaaga tcgtcggcgg attctacaat ggcgtcctga ccggtaaagc ccggtcattc 600

ggtggaagct tggtccggcc cgaagcaact ggttacggat cggtgtatta tgtggaggct 660

gtgatgaaac atgaaaatga cacgcttgta ggtaaaactg ttgcactggc aggttttggt 720

aacgttgcat ggggtgcagc taagaagctc gcggagttgg gtgcgaaagc agtaactttg 780

tctggcccgg atggctatat ctacgacccc gagggtatca ctaccgagga aaagatcaat 840

tacatgcttg aaatgcgggc gtctggacgt aacaaggtac aggattacgc agacaagttt 900

ggagtgcaat tctttccggg tgaaaagcct tggggccaaa aagttgacat tattatgcct 960

tgtgcaactc agaatgatgt tgacctggaa caggctaaaa agatcgtggc gaacaacgtg 1020

aagtactaca tcgaagtagc caacatgcct actactaatg aagcattgcg gtttcttatg 1080

cagcaaccta acatggtagt cgcccccagc aaggctgtga acgcaggtgg agtactggta 1140

tcgggtttcg agatgtcaca aaattccgaa cgtctgtcat ggaccgccga agaagtcgat 1200

agcaaactgc atcaggtgat gactgacatt catgacggtt cagccgccgc agctgaacgc 1260

tacggacttg gttacaatct tgtcgcaggt gctaatatcg taggttttca gaagatcgcc 1320

gatgccatga tggctcaagg aatcgcttgg 1350

<210>44

<211>450

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized gdh from C.symbiosis

<400>44

Met Ser Lys Tyr Val Asp Arg Val Ile Ala Glu Val Glu Lys Lys Tyr

1 5 10 15

Ala Asp Glu Pro Glu Phe Val Gln Thr Val Glu Glu Val Leu Ser Ser

20 25 30

Leu Gly Pro Val Val Asp Ala His Pro Glu Tyr Glu Glu Val Ala Leu

35 40 45

Leu Glu Arg Met Val Ile Pro Glu Arg Val Ile Glu Phe Arg Val Pro

50 55 60

Trp Glu Asp Asp Asn Gly Lys Val His Val Asn Thr Gly Tyr Arg Val

65 70 75 80

Gln Phe Asn Gly Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe Ala

85 90 95

Pro Ser Val Asn Leu Ser Ile Met Lys Phe Leu Gly Phe Glu Gln Ala

100 105 110

Phe Lys Asp Ser Leu Thr Thr Leu Pro Met Gly Gly Ala Lys Gly Gly

115 120 125

Ser Asp Phe Asp Pro Asn Gly Lys Ser Asp Arg Glu Val Met Arg Phe

130 135 140

Cys Gln Ala Phe Met Thr Glu Leu Tyr Arg His Ile Gly Pro Asp Ile

145 150 155 160

Asp Val Pro Ala Gly Asp Leu Gly Val Gly Ala Arg Glu Ile Gly Tyr

165 170 175

Met Tyr Gly Gln Tyr Arg Lys Ile Val Gly Gly Phe Tyr Asn Gly Val

180185 190

Leu Thr Gly Lys Ala Arg Ser Phe Gly Gly Ser Leu Val Arg Pro Glu

195 200 205

Ala Thr Gly Tyr Gly Ser Val Tyr Tyr Val Glu Ala Val Met Lys His

210 215 220

Glu Asn Asp Thr Leu Val Gly Lys Thr Val Ala Leu Ala Gly Phe Gly

225 230 235 240

Asn Val Ala Trp Gly Ala Ala Lys Lys Leu Ala Glu Leu Gly Ala Lys

245 250 255

Ala Val Thr Leu Ser Gly Pro Asp Gly Tyr Ile Tyr Asp Pro Glu Gly

260 265 270

Ile Thr Thr Glu Glu Lys Ile Asn Tyr Met Leu Glu Met Arg Ala Ser

275 280 285

Gly Arg Asn Lys Val Gln Asp Tyr Ala Asp Lys Phe Gly Val Gln Phe

290 295 300

Phe Pro Gly Glu Lys Pro Trp Gly Gln Lys Val Asp Ile Ile Met Pro

305 310 315 320

Cys Ala Thr Gln Asn Asp Val Asp Leu Glu Gln Ala Lys Lys Ile Val

325 330 335

Ala Asn Asn Val Lys Tyr Tyr Ile Glu Val Ala Asn Met Pro Thr Thr

340345 350

Asn Glu Ala Leu Arg Phe Leu Met Gln Gln Pro Asn Met Val Val Ala

355 360 365

Pro Ser Lys Ala Val Asn Ala Gly Gly Val Leu Val Ser Gly Phe Glu

370 375 380

Met Ser Gln Asn Ser Glu Arg Leu Ser Trp Thr Ala Glu Glu Val Asp

385 390 395 400

Ser Lys Leu His Gln Val Met Thr Asp Ile His Asp Gly Ser Ala Ala

405 410 415

Ala Ala Glu Arg Tyr Gly Leu Gly Tyr Asn Leu Val Ala Gly Ala Asn

420 425 430

Ile Val Gly Phe Gln Lys Ile Ala Asp Ala Met Met Ala Gln Gly Ile

435 440 445

Ala Trp

450

<210>45

<211>744

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized dapB from Corynebacterium glutamicum

<400>45

atgggcatta aagttggagt gctgggagct aagggccggg taggtcagac gatcgtggca 60

gcagtgaacg aatcagacga tctcgagttg gtagcagaaa tcggtgtgga tgacgatctg 120

tctctgctcg tagacaacgg cgcggaggtc gttgttgact tcactacgcc taatgcggtg 180

atgggaaact tggagttctg tatcaacaac ggaatctccg cagtagtagg aaccaccgga 240

tttgatgatg cacgcctcga acaagtacgg gactggctgg aaggtaagga caacgtcgga 300

gtcttgattg cccctaactt tgcgatttca gcagtgctta ccatggtgtt ctctaaacag 360

gcggcgcgct ttttcgaatc cgcagaagtt atcgaacttc accacccgaa taaacttgac 420

gccccttctg gcactgcgat tcatactgct caaggtattg cagcggctcg taaagaggca 480

ggtatggatg cacagcccga tgcaactgag caagcccttg agggtagccg tggcgcgtct 540

gttgatggta ttccggtaca tgccgttcgc atgtcaggca tggtcgcaca tgaacaagta 600

atctttggca cgcaaggcca aacgcttact attaaacaag atagctacga tcgtaactct 660

ttcgcgccgg gtgttttggt tggagtccgc aatatcgcac agcatcccgg attggtggtt 720

ggccttgagc attaccttgg attg 744

<210>46

<211>248

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized dapB from Corynebacterium glutamicum

<400>46

Met Gly Ile Lys Val Gly Val Leu Gly Ala Lys Gly Arg Val Gly Gln

1 5 10 15

Thr Ile Val Ala Ala Val Asn Glu Ser Asp Asp Leu Glu Leu Val Ala

20 2530

Glu Ile Gly Val Asp Asp Asp Leu Ser Leu Leu Val Asp Asn Gly Ala

35 40 45

Glu Val Val Val Asp Phe Thr Thr Pro Asn Ala Val Met Gly Asn Leu

50 55 60

Glu Phe Cys Ile Asn Asn Gly Ile Ser Ala Val Val Gly Thr Thr Gly

65 70 75 80

Phe Asp Asp Ala Arg Leu Glu Gln Val Arg Asp Trp Leu Glu Gly Lys

85 90 95

Asp Asn Val Gly Val Leu Ile Ala Pro Asn Phe Ala Ile Ser Ala Val

100 105 110

Leu Thr Met Val Phe Ser Lys Gln Ala Ala Arg Phe Phe Glu Ser Ala

115 120 125

Glu Val Ile Glu Leu His His Pro Asn Lys Leu Asp Ala Pro Ser Gly

130 135 140

Thr Ala Ile His Thr Ala Gln Gly Ile Ala Ala Ala Arg Lys Glu Ala

145 150 155 160

Gly Met Asp Ala Gln Pro Asp Ala Thr Glu Gln Ala Leu Glu Gly Ser

165 170 175

Arg Gly Ala Ser Val Asp Gly Ile Pro Val His Ala Val Arg Met Ser

180 185 190

Gly Met Val Ala His Glu Gln Val Ile Phe Gly Thr Gln Gly Gln Thr

195 200 205

Leu Thr Ile Lys Gln Asp Ser Tyr Asp Arg Asn Ser Phe Ala Pro Gly

210 215 220

Val Leu Val Gly Val Arg Asn Ile Ala Gln His Pro Gly Leu Val Val

225 230 235 240

Gly Leu Glu His Tyr Leu Gly Leu

245

<210>47

<211>819

<212>DNA

<213> Artificial sequence

<220>

<223> codon-optimized dapB derived from Escherichia coli

<400>47

atgcacgacg caaacattcg ggtcgccatt gcgggagctg gaggacgtat gggacgccag 60

ctcatccagg cggcgcttgc cctcgaaggc gtgcaattgg gagcagctct ggaacgcgag 120

ggctcttcac tcttgggctc tgatgccggc gagctggctg gtgccggcaa aacgggcgta 180

acggtccagt cttctctcga cgccgtaaag gatgattttg atgtgtttat tgactttacg 240

cgcccggagg gaactctgaa ccatctggca ttctgccggc agcatggtaa gggcatggtt 300

atcggaacca ccggatttga tgaggctgga aaacaggcga ttcgggatgc cgctgccgat 360

attgctatcg tattcgcagc aaacttcagc gtaggcgtta acgttatgct caaactgctg 420

gagaaggcag ctaaggtgat gggtgactat acggacattg agattattga agctcatcat 480

cgtcacaaag tagacgctcc ttcaggaacc gcgctggcaa tgggcgaagc aattgctcat 540

gcgttggaca aagacctcaa agactgcgcg gtgtattcac gggagggaca tactggtgaa 600

cgtgttcctg gtacgattgg ttttgccacc gtccgtgcag gcgacattgt gggagaacat 660

acggccatgt tcgcagacat cggtgaacgt cttgagatca cccacaaggc tagctcgcgg 720

atgacgttcg caaacggagc ggttcggtcc gccctgtggc tgtctggcaa agaatctgga 780

ctcttcgaca tgcgggacgt gttggacctt aacaatttg 819

<210>48

<211>273

<212>PRT

<213> Artificial sequence

<220>

<223> codon-optimized dapB derived from Escherichia coli

<400>48

Met His Asp Ala Asn Ile Arg Val Ala Ile Ala Gly Ala Gly Gly Arg

1 5 10 15

Met Gly Arg Gln Leu Ile Gln Ala Ala Leu Ala Leu Glu Gly Val Gln

20 25 30

Leu Gly Ala Ala Leu Glu Arg Glu Gly Ser Ser Leu Leu Gly Ser Asp

35 40 45

Ala Gly Glu Leu Ala Gly Ala Gly Lys Thr Gly Val Thr Val Gln Ser

50 55 60

Ser Leu Asp Ala Val Lys Asp Asp Phe Asp Val Phe Ile AspPhe Thr

65 70 75 80

Arg Pro Glu Gly Thr Leu Asn His Leu Ala Phe Cys Arg Gln His Gly

85 90 95

Lys Gly Met Val Ile Gly Thr Thr Gly Phe Asp Glu Ala Gly Lys Gln

100 105 110

Ala Ile Arg Asp Ala Ala Ala Asp Ile Ala Ile Val Phe Ala Ala Asn

115 120 125

Phe Ser Val Gly Val Asn Val Met Leu Lys Leu Leu Glu Lys Ala Ala

130 135 140

Lys Val Met Gly Asp Tyr Thr Asp Ile Glu Ile Ile Glu Ala His His

145 150 155 160

Arg His Lys Val Asp Ala Pro Ser Gly Thr Ala Leu Ala Met Gly Glu

165 170 175

Ala Ile Ala His Ala Leu Asp Lys Asp Leu Lys Asp Cys Ala Val Tyr

180 185 190

Ser Arg Glu Gly His Thr Gly Glu Arg Val Pro Gly Thr Ile Gly Phe

195 200 205

Ala Thr Val Arg Ala Gly Asp Ile Val Gly Glu His Thr Ala Met Phe

210 215 220

Ala Asp Ile Gly Glu Arg Leu Glu Ile Thr His Lys Ala Ser Ser Arg

225 230 235 240

Met Thr Phe Ala Asn Gly Ala Val Arg Ser Ala Leu Trp Leu Ser Gly

245 250 255

Lys Glu Ser Gly Leu Phe Asp Met Arg Asp Val Leu Asp Leu Asn Asn

260 265 270

Leu

<210>49

<211>1266

<212>DNA

<213> Artificial sequence

<220>

<223> codon optimized aspK from Corynebacterium glutamicum

<400>49

atggccctgg tcgtacagaa atatggcggt tcctcgcttg agagtgcgga acgcattaga 60

aacgtcgctg aacggatcgt tgccaccaag aaggctggaa atgatgtcgt ggttgtctgc 120

tccgcaatgg gagacaccac ggatgaactt ctagaacttg cagcggcagt gaatcccgtt 180

ccgccagctc gtgaaatgga tatgctcctg actgctggtg agcgtatttc taacgctctc 240

gtcgccatgg ctattgagtc ccttggcgca gaagctcaat ctttcactgg ctctcaggct 300

ggtgtgctca ccaccgagcg ccacggaaac gcacgcattg ttgacgtcac accgggtcgt 360

gtgcgtgaag cactcgatga gggcaagatc tgcattgttg ctggttttca gggtgttaat 420

aaagaaaccc gcgatgtcac cacgttgggt cgtggtggtt ctgacaccac tgcagttgcg 480

ttggcagctg ctttgaacgc tgatgtgtgt gagatttact cggacgttga cggtgtgtat 540

accgctgacc cgcgcatcgt tcctaatgca cagaagctgg aaaagctcag cttcgaagaa 600

atgctggaac ttgctgctgt tggctccaag attttggtgc tgcgcagtgt tgaatacgct 660

cgtgcattca atgtgccact tcgcgtacgc tcgtcttata gtaatgatcc cggcactttg 720

attgccggct ctatggagga tattcctgtg gaagaagcag tccttaccgg tgtcgcaacc 780

gacaagtccg aagccaaagt aaccgttctg ggtatttccg ataagccagg cgagactgcc 840

aaggttttcc gtgcgttggc tgatgcagaa atcaacattg acatggttct gcagaacgtc 900

ttctctgtgg aagacggcac caccgacatc acgttcacct gccctcgcgc tgacggacgc 960

cgtgcgatgg agatcttgaa gaagcttcag gttcagggca actggaccaa tgtgctttac 1020

gacgaccagg tcggcaaagt ctccctcgtg ggtgctggca tgaagtctca cccaggtgtt 1080

accgcagagt tcatggaagc tctgcgcgat gtcaacgtga acatcgaatt gatttccacc 1140

tctgagatcc gcatttccgt gctgatccgt gaagatgatc tggatgctgc tgcacgtgca 1200

ttgcatgagc agttccagct gggcggcgaa gacgaagccg tcgtttatgc aggcaccgga 1260

cgctaa 1266

<210>50

<211>421

<212>PRT

<213> Artificial sequence

<220>

<223> codon optimized aspK from Corynebacterium glutamicum

<400>50

Met Ala Leu Val Val Gln Lys Tyr Gly Gly Ser Ser Leu Glu Ser Ala

1 5 1015

Glu Arg Ile Arg Asn Val Ala Glu Arg Ile Val Ala Thr Lys Lys Ala

20 25 30

Gly Asn Asp Val Val Val Val Cys Ser Ala Met Gly Asp Thr Thr Asp

35 40 45

Glu Leu Leu Glu Leu Ala Ala Ala Val Asn Pro Val Pro Pro Ala Arg

50 55 60

Glu Met Asp Met Leu Leu Thr Ala Gly Glu Arg Ile Ser Asn Ala Leu

65 70 75 80

Val Ala Met Ala Ile Glu Ser Leu Gly Ala Glu Ala Gln Ser Phe Thr

85 90 95

Gly Ser Gln Ala Gly Val Leu Thr Thr Glu Arg His Gly Asn Ala Arg

100 105 110

Ile Val Asp Val Thr Pro Gly Arg Val Arg Glu Ala Leu Asp Glu Gly

115 120 125

Lys Ile Cys Ile Val Ala Gly Phe Gln Gly Val Asn Lys Glu Thr Arg

130 135 140

Asp Val Thr Thr Leu Gly Arg Gly Gly Ser Asp Thr Thr Ala Val Ala

145 150 155 160

Leu Ala Ala Ala Leu Asn Ala Asp Val Cys Glu Ile Tyr Ser Asp Val

165 170 175

Asp Gly Val Tyr Thr Ala Asp Pro Arg Ile Val Pro Asn Ala Gln Lys

180 185 190

Leu Glu Lys Leu Ser Phe Glu Glu Met Leu Glu Leu Ala Ala Val Gly

195 200 205

Ser Lys Ile Leu Val Leu Arg Ser Val Glu Tyr Ala Arg Ala Phe Asn

210 215 220

Val Pro Leu Arg Val Arg Ser Ser Tyr Ser Asn Asp Pro Gly Thr Leu

225 230 235 240

Ile Ala Gly Ser Met Glu Asp Ile Pro Val Glu Glu Ala Val Leu Thr

245 250 255

Gly Val Ala Thr Asp Lys Ser Glu Ala Lys Val Thr Val Leu Gly Ile

260 265 270

Ser Asp Lys Pro Gly Glu Thr Ala Lys Val Phe Arg Ala Leu Ala Asp

275 280 285

Ala Glu Ile Asn Ile Asp Met Val Leu Gln Asn Val Phe Ser Val Glu

290 295 300

Asp Gly Thr Thr Asp Ile Thr Phe Thr Cys Pro Arg Ala Asp Gly Arg

305 310 315 320

Arg Ala Met Glu Ile Leu Lys Lys Leu Gln Val Gln Gly Asn Trp Thr

325 330 335

Asn Val Leu Tyr Asp Asp Gln Val Gly Lys Val Ser Leu Val Gly Ala

340 345 350

Gly Met Lys Ser His Pro Gly Val Thr Ala Glu Phe Met Glu Ala Leu

355 360 365

Arg Asp Val Asn Val Asn Ile Glu Leu Ile Ser Thr Ser Glu Ile Arg

370 375 380

Ile Ser Val Leu Ile Arg Glu Asp Asp Leu Asp Ala Ala Ala Arg Ala

385 390 395 400

Leu His Glu Gln Phe Gln Leu Gly Gly Glu Asp Glu Ala Val Val Tyr

405 410 415

Ala Gly Thr Gly Arg

420

<210>51

<211>9972

<212>DNA

<213> Artificial sequence

<220>

<223> plasmid backbone sequence

<400>51

gtctgctcac aaatctcagc gaccgcattg atgaaggaaa tcttggtggc caagaacgca 60

ttcgcggaaa ctttcaccag ctcagcggta gcaagatcag tgaccaaaaa cggcgtatca 120

gcagcaatcg cggtggcgta aacctcccga gcgatcgcct ctgctgtcgc cacctcacgc 180

acacccacca cgatgcggtc cggagtgatg gtgtctttga ccgcgtagcc ctcacgcaag 240

aactccggat tccacgcgat ctccacgtgc gaaccaggct tgaccagaga atcagcaagc 300

tcctgcaact gctcagcggt accaaccgga accgtagact tgccgaaaat aatgtgctcg 360

ccctcaagca gcggcaccaa atcctcaaca acctgacgaa catacgtcag atccgccgca 420

taagtaccct tctgctgagg agtacccacg cccaagaaat gcacctgcgc gaaagccgca 480

gcctccgcat aaccagtagt gaagttcagg cgaccatttt ccagattgcg ctccaaaacc 540

tcaggcaaac ccggctcaaa aaatgggacc ttgctgtcct tcaacgacgc aatctttacc 600

tcatcgacat cgacaccaag aacctcatgg ccaagctcag ccatgcaggc cgcgtgcgta 660

gcgccaaggt aacccgtacc aatcactgtc atccgcatgt agggtgattc ctttcaatga 720

agagtggact ggagattatc tcaacacgtt ttgatacagc ccgcgaccgg aacacatgat 780

tgcttacttg ttggggaaat tcaggtacgc cttcgaagga gtaggaccac gctgcccctg 840

atacttcgaa ccaagcttgc cggaaccata cggagtctcc gcaggggaac tcatctggaa 900

caaagccaac tgccccacct tcatacccgg ccacaacgtg atcggcagat tagccacatt 960

ggacaactcc aacgtgatgt aaccgctaaa accaggatca atgaaaccag cagtagagtg 1020

cgtcaacagt ccaagacgac caagagacga cttgccctcc aaacgaccag ccagatgcgc 1080

aggcaaagtg aacttttcca gcgtggacgc cagcacaaac tcacccggat gcagcacaaa 1140

gccctcgccg tcctcaacct caacaaggct ggtcagctca tcctgattca acttagggtc 1200

aatgtgggtg tacttagagt tattgaaaac ccggaagtag cggtccatgc ggacatcgac 1260

actcgacggc tgaatcagct cagcgtcgaa aggttcaatt cccaagtcgc ctgcgtcaat 1320

tgatttacga atgtcacgat ctgaaagaag cacgtcaacc agtgtagcgt tcagcgttca 1380

gggttgggcc acgggttgct gcgatgaggt tcctggggcg cgtggtgctg tcgctgattt 1440

ttatcgtgct agccttattc tcggccctta attaagcgcc accttttaca ctgccggtgt 1500

agttcaatgg tagaactcct gcttcccaag caggcggcgc gggttcgatt cccgtcaccg 1560

gctccaaata agcccctgac ctctcaatac gcaatgaagg tcaagggctt aattctatgg 1620

aaactacaaa aagtacccac ttaaatacac gctttaaatc ccctcacgat gcgatcatca 1680

gcccttttac atttttagaa aaagctttgc agttttccat cgcagccgaa aaccgctcca 1740

gtgcgaaatt gcacactaca tcacaccgaa cactcgacga catctttaat tttcaacata 1800

tccccacccc cagaaattat tcaccactta cacttcacat actcaccaat gcataaccca 1860

aaaagcgtta gatgaaactc cccacccgaa tccacaagaa ctcgggtgcc ctcagtttca 1920

cataccccta agcgcaacac tgtgcgagct ttccgccagt aggccaagca ccctttcgat 1980

taaccccgac aaacttttaa ggcaagccta aattaggtaa accttaaaca gtcgccattg 2040

aagaaattga tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgtat 2100

tatggaaacg tctgtatcgg ataagtagcg aggagtgttc gttaaaaatg gccctggtcg 2160

tacagaaata tggcggttcc tcgcttgaga gtgcggaacg cattagaaac gtcgctgaac 2220

ggatcgttgc caccaagaag gctggaaatg atgtcgtggt tgtctgctcc gcaatgggag 2280

acaccacgga tgaacttcta gaacttgcag cggcagtgaa tcccgttccg ccagctcgtg 2340

aaatggatat gctcctgact gctggtgagc gtatttctaa cgctctcgtc gccatggcta 2400

ttgagtccct tggcgcagaa gctcaatctt tcactggctc tcaggctggt gtgctcacca 2460

ccgagcgcca cggaaacgca cgcattgttg acgtcacacc gggtcgtgtg cgtgaagcac 2520

tcgatgaggg caagatctgc attgttgctg gttttcaggg tgttaataaa gaaacccgcg 2580

atgtcaccac gttgggtcgt ggtggttctg acaccactgc agttgcgttg gcagctgctt 2640

tgaacgctga tgtgtgtgag atttactcgg acgttgacgg tgtgtatacc gctgacccgc 2700

gcatcgttcc taatgcacag aagctggaaa agctcagctt cgaagaaatg ctggaacttg 2760

ctgctgttgg ctccaagatt ttggtgctgc gcagtgttga atacgctcgt gcattcaatg 2820

tgccacttcg cgtacgctcg tcttatagta atgatcccgg cactttgatt gccggctcta 2880

tggaggatat tcctgtggaa gaagcagtcc ttaccggtgt cgcaaccgac aagtccgaag 2940

ccaaagtaac cgttctgggt atttccgata agccaggcga gactgccaag gttttccgtg 3000

cgttggctga tgcagaaatc aacattgaca tggttctgca gaacgtctcc tctgtggaag 3060

acggcaccac cgacatcttg ttcacctgcc ctcgcgctga cggacgccgt gcgatggaga 3120

tcttgaagaa gcttcaggtt cagggcaact ggaccaatgt gctttacgac gaccaggtcg 3180

gcaaagtctc cctcgtgggt gctggcatga agtctcaccc aggtgttacc gcagagttca 3240

tggaagctct gcgcgatgtc aacgtgaaca tcgaattgat ttccacctct gagatccgca 3300

tttccgtgct gatccgtgaa gatgatctgg atgctgctgc acgtgcattg catgagcagt 3360

tccagctggg cggcgaagac gaagccgtcg tttatgcagg caccggacgc taatagagtt 3420

ttaaaggagt agttttacaa tgtccaaggg agaaaaaatg aagatcaagg ttggcgtatt 3480

gggtgctacc ggatcggttg gccaacgctt tgtgcagctg cttgcagaccaccccatgtt 3540

cgaattgact gctctggcag caagcgaacg gtccgcgggt aaaaaataca aagatgcttg 3600

ttactggttt caagatcggg acattccaga aaatattaag gatatggttg taattccgac 3660

ggatccgaag cacgaagaat tcgaagacgt tgatattgtt tttagcgcgc tgccctcgga 3720

tctggctaaa aaattcgaac ccgaattcgc gaaagaagga aagctgatct tcagcaacgc 3780

atcagcctat cgtatggagg aagatgtgcc gcttgtaatt ccagaggtaa acgctgatca 3840

cctcgaattg attgaaattc agcgcgagaa gcggggttgg gacggagcca ttatcactaa 3900

cccaaactgt tcaaccattt gcgccgtaat cacccttaag ccaattatgg acaaattcgg 3960

tcttgaagcg gtgtttatcg ctaccatgca ggctgtatcg ggcgcaggat acaacggtgt 4020

cccgagcatg gctattctgg ataacttgat tccctttatt aagaatgagg aggagaagat 4080

gcagactgaa tcgcttaagt tgctgggcac gcttaaggat ggaaaagtgg aactcgctaa 4140

cttcaaaatc agcgcatcat gcaatcgtgt ggctgtgatc gacggccaca ccgaatcgat 4200

cttcgtgaag accaaggagg gtgcggaacc tgaggaaatt aaagaagtga tggacaaatt 4260

tgatcctctt aaagacctta accttccgac gtatgccaaa ccaatcgtaa ttcgcgaaga 4320

gatcgatcgc ccacagccac gtcttgaccg caatgagggt aatggcatgt ctattgtcgt 4380

tggtcgtatc cgtaaagatc cgatttttga tgttaagtac accgccctgg aacataacac 4440

tatccgtggc gccgcgggcg catcagtgtt gaatgcggag tatttcgtaa agaaatacat 4500

ctaggcattt ttagtacgtg caataaccac tctggttttt ccagggtggt tttttgatgc 4560

cctttttgga gtcttcaact gcttagcttt gacctgcaca aatagttgca aattgtccca 4620

catacacata aagtagcttg cgtatttaaa attatgaacc taaggggttt agcaatgact 4680

gtagatgaac aggtttctaa ctactacgac atgcttctca aacgtaatgc tggagagccc 4740

gaatttcatc aggcggttgc tgaagtgctt gaatccctca agattgttct tgaaaaagat 4800

ccgcactacg cggactatgg cctcatccag cggctgtgtg aacctgaacg tcaactgatc 4860

ttccgtgtgc cgtgggtaga tgatcaggga caagtgcacg tcaaccgcgg ttttcgtgta 4920

cagtttaatt cggcgctcgg tccctacaaa ggcggattgc gtttccaccc tagcgtcaat 4980

cttggcatcg tcaagttttt gggtttcgaa caaattttta agaattccct taccggactg 5040

cctatcggag gcggaaaggg cggttcggat tttgacccta aaggcaagag cgatctcgaa 5100

atcatgcggt tttgtcagtc ttttatgacc gaactgcatc gtcacatcgg cgaatatcgc 5160

gatgtcccgg cgggtgatat cggcgtgggt ggtcgtgaga tcggatacct ctttggtcat 5220

tatcgtcgga tggcgaatca gcacgaatcg ggagtcctta ccggcaaagg tctgacttgg 5280

ggcggcagcc tggttcggac cgaagccacg ggatacggtt gtgtctattt cgtatcggag 5340

atgatcaaag caaaaggcga gtcaatctcg ggacagaaga ttatcgtatc cggatcggga 5400

aatgttgcta cctatgccat tgagaaagct caagagctgg gcgcgacggt gatcggcttc 5460

tcggattcct caggctgggt gcatactccg aatggtgtgg acgtggctaa acttcgcgaa 5520

atcaaggaag tacgtcgcgc acgcgtaagc gtttatgccg atgaagtgga gggagcaacc 5580

taccataccg atggatccat ctgggatctt aagtgtgaca tcgcacttcc ttgcgctacg 5640

caaaatgaac tgaacggaga gaatgcgaaa acgctggccg ataatggttg ccgcttcgtc 5700

gcggagggcg ctaacatgcc gagcaccccg gaggccgtcg aagtttttcg ggagcgcgac 5760

atccggttcg gccccggcaa agcggctaat gctggcggag tggcaacgtc agcgttggag 5820

atgcagcaga acgcatcccg ggactcatgg agcttcgaat acaccgacga acgcctccag 5880

gtcattatga agaacatttt taagacgtgt gcggaaaccg cagccgagta tggccacgag 5940

aacgattacg tcgtcggagc aaacattgca ggatttaaga aagttgctga tgcgatgctc 6000

gcccaaggtg tgatctaggc ttttcgacgt ctcctccggc gaaacccaaa aaaggaaccc 6060

tcacagttcg tgagggttcc ttttactatt gtctacaatc caaggtaatg ctcaaggcca 6120

accaccaatc cgggatgctg tgcgatattg cggactccaa ccaaaacacc cggcgcgaaa 6180

gagttacgat cgtagctatc ttgtttaata gtaagcgttt ggccttgcgt gccaaagatt 6240

acttgttcat gtgcgaccat gcctgacatg cgaacggcat gtaccggaat accatcaaca 6300

gacgcgccac ggctaccctc aagggcttgc tcagttgcat cgggctgtgc atccatacct 6360

gcctctttac gagccgctgc aataccttga gcagtatgaa tcgcagtgcc agaaggggcg 6420

tcaagtttat tcgggtggtg aagttcgata acttctgcgg attcgaaaaa gcgcgccgcc 6480

tgtttagaga acaccatggt aagcactgct gaaatcgcaa agttaggggc aatcaagact 6540

ccgacgttgt ccttaccttc cagccagtcc cgtacttgtt cgaggcgtgc atcatcaaat 6600

ccggtggttc ctactactgc ggagattccg ttgttgatac agaactccaa gtttcccatc 6660

accgcattag gcgtagtgaa gtcaacaacg acctccgcgc cgttgtctac gagcagagac 6720

agatcgtcat ccacaccgat ttctgctacc aactcgagat cgtctgattc gttcactgct 6780

gccacgatcg tctgacctac ccggccctta gctcccagca ctccaacttt aatgcccatt 6840

gtaaaactac tcctttaaaa ctctacacat cccgggcaat caagtcgtcc aagttttccg 6900

ggctcaacaa atatggggca acttccagaa cggtaaaggc acctgattgg ccttgttgtt 6960

tcatgcggtg cgctgcacgg ccgaacgcga tttgagagga cgcagtgaag tcgggattac 7020

ggtccagctt gagaatatac tcaacggtgt ggttaaaacc gccagtgtcg ccagtcgtga 7080

tcacgtgacc gccgtggggc atacccgtat gttcagagtc gaaggttgct tcatcgatga 7140

aattgacttc cacctcatag cctacgaagt aatcgggcat agtccgaata tcgttctcga 7200

tgcgctcatg gtcggccgcg tcggccacaa cgaagcactg gcgtttatgc gtttgcttgc 7260

cggtcaaatc tccggcctcg ccgcgccgtg ctttttcaag cgcatcttca gaaggcaacg 7320

tgtactgaac agccttttga acacccggga tgcggcgaag ggcatcgcta tggccctggc 7380

taagtcctgg accccaaaac gtgtgttgct ggtgctcggc caaaacagca gcggcataaa 7440

cacgattaat cgaaaacatg cctgggtccc agcccgtaga aaccaacgct acattgcctg 7500

ctgcggttgc agcttcattc ataacttggc gatgccgggg gatatcacga tgattatcgt 7560

acgtgtccac cgtacaggca aattgagcga acttgggggc ttgctccggg atatccgttg 7620

cagatcccat gcacaaaaag agtacatcga catcatcggc atgtttatca acgtccgcca 7680

catcgaagac gggggtcttc gtatcgagag tcgcccggcg cgagaaaatt ccaacaagat 7740

ccatgtctgg ttgcttggcg atgagttttt ctacgctgcg tcccagatta ccgtatccga 7800

cgattgctac acggatgttc gtcattttta acgaacactc ctcgctactt atccgataca 7860

gacgtttcca taatacacgc ttaggtcccc acgtagtacc acacacaacg cgagaaacgg 7920

caagaatttt aaaaacaaac aaccttcaac gcgctaacaa gcatcttccc actctcgtta 7980

ccggagtttc tcacatgtct cacaagtttt cccgccgcgc tttcgcagta ctgaccgctg 8040

ccgcgatttc cacttccgct ttcgcaacca ctgctccgtc tgcgattgca gaaccagttt 8100

ccatagtcac caccgcagac gattctagcg tcgcaacttc agaaaactcc cttgactggg 8160

gtttcaagtc ttcctggcgc acctatgtca ccggaccttg gactggtgga accgttgacg 8220

caactggcgg tgcaactgtc aacgaagatg gaacctacaa cttcaccctc ggaactggct 8280

ccacttacga catcgacacc gagaagggcc agctgaacta cgaaggaact gttgccttcg 8340

ccagtgacgc tcacggcttc aacatcacct tgtccaaccc gcagatcacc gtcgagggcg 8400

acactgcaac tttgagcgcc gagctgtctg acaatgccgc tccagaagag acctccacta 8460

ctcgcgttga tgtcgctgag ttcgagctga ctgctcctgc ggtttcagaa accgatgcaa 8520

acaccactta cacttggatc gatgtttccg gcactttcct agaatccctg ccgcctgaag 8580

aattgagccg ttacgcaggc caggaagcgg atgcgctgag cttctccatc accgtggaca 8640

aggcttcaga gaacccttcc gatgatgttg ctaccggatc ttcctccagc ttcctctcca 8700

ccatcttgaa cttccttcag cagctggcga gcccactact caagctcttc ggttcgcttt 8760

cttcctaaat aatcagtaat gccccaccag atctggtggg gcattttgtt ttaggagcag 8820

accacgtttg gtgaaggatc gtaaaccgtg gtgacggttt ctctggtgat ttcgttgcca 8880

gaaagatcgc tgatgattcg ggtgtcggag gtggtaaatc ctggtgcacc ggttgatggc 8940

acacaatctgaacccgatac tcgaactgtg ttgggctggg tggtggacca acgtccgttg 9000

ttgatggatt ccacggaggt ggtgtccaca cccatgatgc gcacggtcac gtttgaggcg 9060

tcggcagagg tgctgatcat gacggggtat ggggagttgt tgcggaattg aaggtcgatg 9120

gcaccatcga aaatagtagc ttcacgtccg gctgggtagc gggaaatgta gtagctgtgc 9180

ggggtgtgcg tgatgtcttc cagacctgcg aagtagtacg cgttgtacaa ggtggtggcg 9240

aactgactga tgccaccgcc gactgcggtg tcggaacgac cattcaaaat gatgccggaa 9300

tcaacaaagc cttgggctgc gccacgtggg ccggtgtagt tgttgaggga gaacgtatcg 9360

ccaggtgaaa cgactgcgcc gtcgaccatt tgcgcggtga ggcggatgtt tgttccggag 9420

gcagcagaga agccgccggt ggtgaactcg cccatgacct cattgaaggt agcgttttgg 9480

gcgtcggtgg cggtgaatgt tgctggggtg tcctcataga cagcgtcgat ggtgcggggg 9540

ccatcgccgg tgaggttgtt gggcagatcg gccagggttt cttcccagtt gattccgtgt 9600

ccggtgactt ctggggtgac tacgcgggag cctgaggaga aactgatttg agcgttggtg 9660

ggctcgatct ctgtttcttt gaggccttcg gccagcattg ctgtggctgc ttctgcattg 9720

atgtcgacgc ggatggtgcc gttttcttct gggaaactca ccacttcacc catgcgctcg 9780

acggggatgg tgccttcaat tccgtcatcg cctcggacga cgaaggggct agatacggct 9840

ttagctccgg cgccttctgc aagttcatcg atggtgtctt ggctgatcgc agcgggaaca 9900

acgtatggct cggcttctac gccctctggg ttgagccagt tttctgtgac tgcttgttcc 9960

aaaacggtgc gg 9972

<210>52

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>52

tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgtat tatggaaacg 60

tctgtatcgg ataagtagcg aggagtgttc gttaaaa 97

<210>53

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>53

tagagtttta aaggagtagt tttaca 26

<210>54

<211>173

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>54

taggcatttt tagtacgtgc aataaccact ctggtttttc cagggtggtt ttttgatgcc 60

ctttttggag tcttcaactg cttagctttg acctgcacaa atagttgcaa attgtcccac 120

atacacataa agtagcttgc gtatttaaaa ttatgaacct aaggggttta gca 173

<210>55

<211>80

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>55

taggcttttc gacgtctcct ccggcgaaac ccaaaaaagg aaccctcaca gttcgtgagg 60

gttcctttta ctattgtcta 80

<210>56

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>56

tgtaaaacta ctcctttaaa actcta 26

<210>57

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> promoter sequence

<400>57

ttttaacgaa cactcctcgc tacttatccg atacagacgt ttccataata cacgcttagg 60

tccccacgta gtaccacaca caacgcgaga aacggca 97

<210>58

<211>334

<212>PRT

<213> Corynebacterium glutamicum

<400>58

Met Thr Ile Arg Val Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Asn

1 5 10 15

Phe Phe Arg Ala Ile Leu Glu Arg Ser Asp Asp Leu Glu Val Val Ala

20 25 30

Val Asn Asp Leu Thr Asp Asn Lys Thr Leu Ser Thr Leu Leu Lys Phe

35 40 45

Asp Ser Ile Met Gly Arg Leu Gly Gln Glu Val Glu Tyr Asp Asp Asp

50 55 60

Ser Ile Thr Val Gly Gly Lys Arg Ile Ala Val Tyr Ala Glu Arg Asp

65 70 75 80

Pro Lys Asn Leu Asp Trp Ala Ala His Asn Val Asp Ile Val Ile Glu

85 90 95

Ser Thr Gly Phe Phe Thr Asp Ala Asn Ala Ala Lys Ala His Ile Glu

100 105 110

Ala Gly Ala Lys Lys Val Ile Ile Ser Ala Pro Ala Ser Asn Glu Asp

115 120 125

Ala Thr Phe Val Tyr Gly Val Asn His Glu Ser Tyr Asp Pro Glu Asn

130 135 140

His Asn Val Ile Ser Gly Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro

145 150 155 160

Met Ala Lys Val Leu Asn Asp Lys Phe Gly Ile Glu Asn Gly Leu Met

165 170 175

Thr Thr Val His Ala Tyr Thr Gly Asp Gln Arg Leu His Asp Ala Pro

180 185 190

His Arg Asp Leu Arg Arg Ala Arg Ala Ala Ala Val Asn Ile Val Pro

195 200 205

Thr Ser Thr Gly Ala Ala Lys Ala Val Ala Leu Val Leu Pro Glu Leu

210 215 220

Lys Gly Lys Leu Asp Gly Tyr Ala Leu Arg Val Pro Val Ile Thr Gly

225 230 235 240

Ser Ala Thr Asp Leu Thr Phe Asn Thr Lys Ser Glu Val Thr Val Glu

245 250 255

Ser Ile Asn Ala Ala Ile Lys Glu Ala Ala Val Gly Glu Phe Gly Glu

260 265 270

Thr Leu Ala Tyr Ser Glu Glu Pro Leu Val Ser Thr Asp Ile Val His

275 280 285

Asp Ser His Gly Ser Ile Phe Asp Ala Gly Leu Thr Lys Val Ser Gly

290 295 300

Asn Thr Val Lys Val Val Ser Trp Tyr Asp Asn Glu Trp Gly Tyr Thr

305 310 315 320

Cys Gln Leu Leu Arg Leu Thr Glu Leu Val Ala Ser Lys Leu

325 330

<210>59

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P1 derived from Pcg0007_ lib _39

<400>59

tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgtat tatggaaacg 60

tctgtatcgg ataagtagcg aggagtgttc gttaaaa 97

<210>60

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P2 derived from Pcg0007

<400>60

tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgtaa gatggaaacg 60

tctgtatcgg ataagtagcg aggagtgttc gttaaaa 97

<210>61

<211>93

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P3 derived from Pcg1860

<400>61

cttagctttg acctgcacaa atagttgcaa attgtcccac atacacataa agtagcttgc 60

gtatttaaaa ttatgaacct aaggggttta gca 93

<210>62

<211>98

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P4 derived from Pcg0755

<400>62

aataaattta taccacacag tctattgcaa tagaccaagc tgttcagtag ggtgcatggg 60

agaagaattt cctaataaaa actcttaagg acctccaa 98

<210>63

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P5 derived from Pcg0007_265

<400>63

tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgtac gctggaaacg 60

tctgtatcgg ataagtagcg aggagtgttc gttaaaa 97

<210>64

<211>86

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P6 derived from Pcg3381

<400>64

cgccggataa atgaattgat tattttaggc tcccagggat taagtctagg gtggaatgca 60

gaaatatttc ctacggaagg tccgtt 86

<210>65

<211>97

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P7 derived from Pcg0007_119

<400>65

tgccgtttct cgcgttgtgt gtggtactac gtggggacct aagcgtgttg catggaaacg 60

tctgtatcgg ataagtagcg aggagtgttc gttaaaa 97

<210>66

<211>87

<212>DNA

<213> Artificial sequence

<220>

<223> expression promoter P8 derived from Pcg312

<400>66

gtggctaaaa cttttggaaa cttaagttac ctttaatcgg aaacttattg aattcgggtg 60

aggcaactgc aactctggac ttaaagc 87

<210>67

<211>331

<212>PRT

<213> Escherichia coli

<400>67

Met Thr Ile Lys Val Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Ile

1 5 10 15

Val Phe Arg Ala Ala Gln Lys Arg Ser Asp Ile Glu Ile Val Ala Ile

20 25 30

Asn Asp Leu Leu Asp Ala Asp Tyr Met Ala Tyr Met Leu Lys Tyr Asp

35 40 45

Ser Thr His Gly Arg Phe Asp Gly Thr Val Glu Val Lys Asp Gly His

50 55 60

Leu Ile Val Asn Gly Lys Lys Ile Arg Val Thr Ala Glu Arg Asp Pro

65 70 75 80

Ala Asn Leu Lys Trp Asp Glu Val Gly Val Asp Val Val Ala Glu Ala

85 90 95

Thr Gly Leu Phe Leu Thr Asp Glu Thr Ala Arg Lys His Ile Thr Ala

100 105 110

Gly Ala Lys Lys Val Val Met Thr Gly Pro Ser Lys Asp Asn Thr Pro

115 120 125

Met Phe Val Lys Gly Ala Asn Phe Asp Lys Tyr Ala Gly Gln Asp Ile

130 135 140

Val Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Leu Ala Lys

145 150 155 160

Val Ile Asn Asp Asn Phe Gly Ile Ile Glu Gly Leu Met Thr Thr Val

165 170 175

His Ala Thr Thr Ala Thr Gln Lys Thr Val Asp Gly Pro Ser His Lys

180 185 190

Asp Trp Arg Gly Gly Arg Gly Ala Ser Gln Asn Ile Ile Pro Ser Ser

195 200 205

Thr Gly Ala Ala Lys Ala Val Gly Lys Val Leu Pro Glu Leu Asn Gly

210 215 220

Lys Leu Thr Gly Met Ala Phe Arg Val Pro Thr Pro Asn Val Ser Val

225 230 235 240

Val Asp Leu Thr Val Arg Leu Glu Lys Ala Ala Thr Tyr Glu Gln Ile

245 250 255

Lys Ala Ala Val Lys Ala Ala Ala Glu Gly Glu Met Lys Gly Val Leu

260 265 270

Gly Tyr Thr Glu Asp Asp Val Val Ser Thr Asp Phe Asn Gly Glu Val

275 280 285

Cys Thr Ser Val Phe Asp Ala Lys Ala Gly Ile Ala Leu Asn Asp Asn

290 295 300

Phe Val Lys Leu Val Ser Trp Tyr Asp Asn Glu Thr Gly Tyr Ser Asn

305 310 315 320

Lys Val Leu Asp Leu Ile Ala His Ile Ser Lys

325 330

<210>68

<211>996

<212>DNA

<213> Escherichia coli

<400>68

atgactatca aagtaggtat caacggtttt ggccgtatcg gtcgcattgt tttccgtgct 60

gctcagaaac gttctgacat cgagatcgtt gcaatcaacg acctgttaga cgctgattac 120

atggcataca tgctgaaata tgactccact cacggccgtt tcgacggtac cgttgaagtg 180

aaagacggtc atctgatcgt taacggtaaa aaaatccgtg ttaccgctga acgtgatccg 240

gctaacctga aatgggacga agttggtgtt gacgttgtcg ctgaagcaac tggtctgttc 300

ctgactgacg aaactgctcg taaacacatc accgctggtg cgaagaaagt ggttatgact 360

ggtccgtcta aagacaacac tccgatgttc gttaaaggcg ctaacttcga caaatatgct 420

ggccaggaca tcgtttccaa cgcttcctgc accaccaact gcctggctcc gctggctaaa 480

gttatcaacg ataacttcgg catcatcgaa ggtctgatga ccaccgttca cgctactacc 540

gctactcaga aaaccgttga tggcccgtct cacaaagact ggcgcggcgg ccgcggcgct 600

tcccagaaca tcatcccgtc ctctaccggt gctgctaaag ctgtaggtaa agtactgcca 660

gaactgaatg gcaaactgac tggtatggcg ttccgcgttc cgaccccgaa cgtatctgta 720

gttgacctga ccgttcgtct ggaaaaagct gcaacttacg agcagatcaa agctgccgtt 780

aaagctgctg ctgaaggcga aatgaaaggc gttctgggct acaccgaaga tgacgtagta 840

tctaccgatt tcaacggcga agtttgcact tccgtgttcg atgctaaagc tggtatcgct 900

ctgaacgaca acttcgtgaa actggtatcc tggtacgaca acgaaaccgg ttactccaac 960

aaagttctgg acctgatcgc tcacatctcc aaataa 996

<210>69

<211>334

<212>PRT

<213> Artificial sequence

<220>

<223> D35G L36T mutant gapAv5 from Corynebacterium glutamicum

<400>69

Met Thr Ile Arg Val Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Asn

1 5 1015

Phe Phe Arg Ala Ile Leu Glu Arg Ser Asp Asp Leu Glu Val Val Ala

20 25 30

Val Asn Gly Thr Thr Asp Asn Lys Thr Leu Ser Thr Leu Leu Lys Phe

35 40 45

Asp Ser Ile Met Gly Arg Leu Gly Gln Glu Val Glu Tyr Asp Asp Asp

50 55 60

Ser Ile Thr Val Gly Gly Lys Arg Ile Ala Val Tyr Ala Glu Arg Asp

65 70 75 80

Pro Lys Asn Leu Asp Trp Ala Ala His Asn Val Asp Ile Val Ile Glu

85 90 95

Ser Thr Gly Phe Phe Thr Asp Ala Asn Ala Ala Lys Ala His Ile Glu

100 105 110

Ala Gly Ala Lys Lys Val Ile Ile Ser Ala Pro Ala Ser Asn Glu Asp

115 120 125

Ala Thr Phe Val Tyr Gly Val Asn His Glu Ser Tyr Asp Pro Glu Asn

130 135 140

His Asn Val Ile Ser Gly Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro

145 150 155 160

Met Ala Lys Val Leu Asn Asp Lys Phe Gly Ile Glu Asn Gly Leu Met

165 170 175

Thr Thr Val His Ala Tyr Thr Gly Asp Gln Arg Leu His Asp Ala Pro

180 185 190

His Arg Asp Leu Arg Arg Ala Arg Ala Ala Ala Val Asn Ile Val Pro

195 200 205

Thr Ser Thr Gly Ala Ala Lys Ala Val Ala Leu Val Leu Pro Glu Leu

210 215 220

Lys Gly Lys Leu Asp Gly Tyr Ala Leu Arg Val Pro Val Ile Thr Gly

225 230 235 240

Ser Ala Thr Asp Leu Thr Phe Asn Thr Lys Ser Glu Val Thr Val Glu

245 250 255

Ser Ile Asn Ala Ala Ile Lys Glu Ala Ala Val Gly Glu Phe Gly Glu

260 265 270

Thr Leu Ala Tyr Ser Glu Glu Pro Leu Val Ser Thr Asp Ile Val His

275 280 285

Asp Ser His Gly Ser Ile Phe Asp Ala Gly Leu Thr Lys Val Ser Gly

290 295 300

Asn Thr Val Lys Val Val Ser Trp Tyr Asp Asn Glu Trp Gly Tyr Thr

305 310 315 320

Cys Gln Leu Leu Arg Leu Thr Glu Leu Val Ala Ser Lys Leu

325 330

<210>70

<211>1005

<212>DNA

<213> Artificial sequence

<220>

<223> D35G L36T mutant gapAv5 from Corynebacterium glutamicum

<400>70

atgaccattc gtgttggtat taacggattt ggccgtatcg gacgtaactt cttccgcgca 60

attctggagc gcagcgacga tctcgaggta gttgcagtca acggcaccac cgacaacaag 120

accctttcca cccttctcaa gttcgactcc atcatgggcc gccttggcca ggaagttgaa 180

tacgacgatg actccatcac cgttggtggc aagcgcatcg ctgtttacgc agagcgcgat 240

ccaaagaacc tggactgggc tgcacacaac gttgacatcg tgatcgagtc caccggcttc 300

ttcaccgatg caaacgcggc taaggctcac atcgaagcag gtgccaagaa ggtcatcatc 360

tccgcaccag caagcaacga agacgcaacc ttcgtttacg gtgtgaacca cgagtcctac 420

gatcctgaga accacaacgt gatctccggc gcatcttgca ccaccaactg cctcgcacca 480

atggcaaagg tcctgaacga caagttcggc atcgagaacg gtctcatgac caccgttcac 540

gcatacaccg gcgaccagcg cctgcacgat gcacctcacc gcgacctgcg tcgtgcacgt 600

gcagcagcag tcaacatcgt tcctacctcc accggtgcag ctaaggctgt tgctctggtt 660

ctcccagagc tcaagggcaa gcttgacggc tacgcacttc gcgttccagt tatcaccggt 720

tccgcaaccg acctgacctt caacaccaag tctgaggtca ccgttgagtc catcaacgct 780

gcaatcaagg aagctgcagt cggcgagttc ggcgagaccc tggcttactc cgaagagcca 840

ctggtttcca ccgacatcgt ccacgattcc cacggctcca tcttcgacgc tggcctgacc 900

aaggtctccg gcaacaccgt caaggttgtt tcctggtacg acaacgagtg gggctacacc 960

tgccagctcc tgcgtctgac cgagctcgta gcttccaagc tctaa 1005

<210>71

<211>334

<212>PRT

<213> Artificial sequence

<220>

<223> L36T T37K mutant gapAv7 from Corynebacterium glutamicum

<400>71

Met Thr Ile Arg Val Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Asn

1 5 10 15

Phe Phe Arg Ala Ile Leu Glu Arg Ser Asp Asp Leu Glu Val Val Ala

20 25 30

Val Asn Asp Thr Lys Asp Asn Lys Thr Leu Ser Thr Leu Leu Lys Phe

35 40 45

Asp Ser Ile Met Gly Arg Leu Gly Gln Glu Val Glu Tyr Asp Asp Asp

50 55 60

Ser Ile Thr Val Gly Gly Lys Arg Ile Ala Val Tyr Ala Glu Arg Asp

65 70 75 80

Pro Lys Asn Leu Asp Trp Ala Ala His Asn Val Asp Ile Val Ile Glu

85 90 95

Ser Thr Gly Phe Phe Thr Asp Ala Asn Ala Ala Lys Ala His Ile Glu

100 105 110

Ala Gly Ala Lys Lys Val Ile Ile Ser Ala Pro Ala Ser Asn Glu Asp

115 120 125

Ala Thr Phe Val Tyr Gly Val Asn His Glu Ser Tyr Asp Pro Glu Asn

130 135 140

His Asn Val Ile Ser Gly Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro

145 150 155 160

Met Ala Lys Val Leu Asn Asp Lys Phe Gly Ile Glu Asn Gly Leu Met

165 170 175

Thr Thr Val His Ala Tyr Thr Gly Asp Gln Arg Leu His Asp Ala Pro

180 185 190

His Arg Asp Leu Arg Arg Ala Arg Ala Ala Ala Val Asn Ile Val Pro

195 200 205

Thr Ser Thr Gly Ala Ala Lys Ala Val Ala Leu Val Leu Pro Glu Leu

210 215 220

Lys Gly Lys Leu Asp Gly Tyr Ala Leu Arg Val Pro Val Ile Thr Gly

225 230 235 240

Ser Ala Thr Asp Leu Thr Phe Asn Thr Lys Ser Glu Val Thr Val Glu

245 250 255

Ser Ile Asn Ala Ala Ile Lys Glu Ala Ala Val Gly Glu Phe Gly Glu

260 265 270

Thr Leu Ala Tyr Ser Glu Glu Pro Leu Val Ser Thr Asp Ile Val His

275 280 285

Asp Ser His Gly Ser Ile Phe Asp Ala Gly Leu Thr Lys Val Ser Gly

290 295 300

Asn Thr Val Lys Val Val Ser Trp Tyr Asp Asn Glu Trp Gly Tyr Thr

305 310 315 320

Cys Gln Leu Leu Arg Leu Thr Glu Leu Val Ala Ser Lys Leu

325 330

<210>72

<211>1005

<212>DNA

<213> Artificial sequence

<220>

<223> L36T T37K mutant gapAv7 from Corynebacterium glutamicum

<400>72

atgaccattc gtgttggtat taacggattt ggccgtatcg gacgtaactt cttccgcgca 60

attctggagc gcagcgacga tctcgaggta gttgcagtca acgacaccaa ggacaacaag 120