Oral vaccine and antibody enhancer for COVID-19
阅读说明：本技术 一种用于covid-19的口服性疫苗及抗体加强剂 (Oral vaccine and antibody enhancer for COVID-19 ) 是由 邝纬阳 宋振洲 林庭匡 于 2021-09-28 设计创作，主要内容包括：本发明涉及一种用于COVID-19的口服性疫苗及抗体加强剂。具体地,本发明提供一种枯草芽孢杆菌,所述的枯草芽孢杆菌表达SARS-CoV-2的核衣壳蛋白和/或SARS-CoV-2的刺突蛋白的受体结合区域。本发明所述的基因工程化的枯草芽孢杆菌的口服性疫苗及抗体加强剂能够用于预防和/或治疗SARS-CoV-2病毒感染或COVID-19。(The invention relates to an oral vaccine and an antibody enhancer for COVID-19. Specifically, the present invention provides a Bacillus subtilis expressing a nucleocapsid protein of SARS-CoV-2 and/or a receptor binding region of a spike protein of SARS-CoV-2. The genetically engineered oral vaccine and antibody booster of Bacillus subtilis can be used for preventing and/or treating SARS-CoV-2 virus infection or COVID-19.)
1. A Bacillus subtilis expressing the nucleocapsid protein of SARS-CoV-2 and/or the receptor binding region of the spike protein of SARS-CoV-2.
2. The bacillus subtilis of claim 1 wherein the strain of bacillus subtilis comprises the bacillus subtilis WB800N strain.
3. A transformant, which comprises Bacillus subtilis containing a gene expressing a nucleocapsid protein of SARS-CoV-2 and/or a receptor binding region of a spike protein of SARS-CoV-2.
4. The transformant according to claim 3, wherein the gene is incorporated or introduced into the Bacillus subtilis.
5. A composition comprising the bacillus subtilis of claim 1 and/or the transformant of claim 3.
6. The composition of claim 5, wherein the composition is a pharmaceutical composition or a vaccine composition.
7. The composition of claim 5, wherein the composition is in the form of an oral formulation.
8. Use of the Bacillus subtilis of claim 1 and/or the transformant of claim 3 for the preparation of a composition for the prevention and/or treatment of SARS-CoV-2 virus infection or COVID-19; and/or as a booster of SARS-CoV-2 antibodies.
9. A method of producing an antibody against the nucleocapsid protein of SARS-CoV-2 and/or against the receptor binding region of the spike protein of SARS-CoV-2 virus, said method comprising the steps of:
orally administering the Bacillus subtilis of claim 1 and/or the transformant of claim 3 to a subject, isolating antibodies against the nucleocapsid protein of SARS-CoV-2 and/or antibodies against the receptor binding region of the spike protein of SARS-CoV-2 virus from the blood, and preventing and/or treating SARS-CoV-2 virus infection or COVID-19.
10. A method for preventing and/or treating SARS-CoV-2 virus infection or COVID-19, comprising orally administering the bacillus subtilis of claim 1 and/or the transformant of claim 3 to the subject to prevent and/or treat SARS-CoV-2 virus infection or COVID-19.
Technical Field
The invention relates to the field of medicines, in particular to an oral vaccine and an antibody enhancer for COVID-19.
Background
The large prevalence of COVID-19(Corona Virus Disease 2019, a novel coronavirus pneumonia) caused by SARS-CoV-2 Virus poses a significant threat to human health. Although various vaccines are currently under development, the efficacy, safety and patient compliance of the vaccines are still problematic, such as low serum antibody levels after vaccine administration, safety of the administered vaccines to drugs, and low patient compliance to the administered vaccines.
Therefore, there is a need in the art to develop an effective, highly safe and patient-friendly vaccine for SARS-CoV-2 virus.
Disclosure of Invention
The present invention aims to provide a vaccine for SARS-CoV-2 virus which is effective, highly safe and well compliant for patients.
In a first aspect of the present invention, there is provided a Bacillus subtilis that expresses the nucleocapsid protein of SARS-CoV-2 and/or the receptor binding region of the spike protein of SARS-CoV-2.
Preferably, the bacillus subtilis is genetically engineered bacillus subtilis.
Preferably, the strain of bacillus subtilis comprises the bacillus subtilis WB800N strain.
Preferably, the nucleotide sequence of the nucleocapsid protein of SARS-CoV-2 is shown as SEQ ID NO. 1.
Preferably, the nucleotide sequence of the receptor binding region of the spike protein of SARS-CoV-2 is shown in SEQ ID NO. 2.
Preferably, the bacillus subtilis is prepared by the following method:
the receptor binding region of the nucleocapsid protein expressing SARS-CoV-2 and/or the spike protein expressing SARS-CoV-2 is doped or introduced into the Bacillus subtilis to express the receptor binding region of the nucleocapsid protein expressing SARS-CoV-2 and/or the spike protein expressing SARS-CoV-2, thereby obtaining the Bacillus subtilis.
In a second aspect of the present invention, there is provided a transformant comprising Bacillus subtilis containing a gene expressing a nucleocapsid protein of SARS-CoV-2 and/or a receptor binding region of a spike protein of SARS-CoV-2.
Preferably, the gene comprises DNA and/or RNA.
Preferably, said gene is incorporated or introduced into said Bacillus subtilis.
Preferably, the strain of bacillus subtilis comprises the bacillus subtilis WB800N strain.
Preferably, the nucleotide sequence of the gene expressing the nucleocapsid protein of SARS-CoV-2 is shown as SEQ ID NO. 1.
Preferably, the nucleotide sequence of the receptor binding region of the spike protein expressing SARS-CoV-2 is shown in SEQ ID NO. 2.
Preferably, the gene is loaded on a plasmid.
Preferably, the plasmid comprises shuttle vector pHT 01.
Preferably, the nucleotide sequence of the gene expressing the nucleocapsid protein of SARS-CoV-2 is shown as SEQ ID NO. 3.
Preferably, the nucleotide sequence of the receptor binding region of the spike protein expressing SARS-CoV-2 is shown in SEQ ID NO. 4.
Preferably, the transformant is prepared by the following method:
the receptor binding region expressing the nucleocapsid protein of SARS-CoV-2 and/or the spike protein of SARS-CoV-2 is incorporated or introduced into the Bacillus subtilis to obtain a transformant.
In a third aspect of the invention, there is provided a composition comprising a Bacillus subtilis according to the first aspect of the invention and/or a transformant according to the second aspect of the invention.
Preferably, the composition is a pharmaceutical composition or a vaccine composition.
Preferably, the composition further comprises a pharmaceutically, vaccinally acceptable carrier.
Preferably, the composition is in the form of an injection preparation, an external preparation or an oral preparation.
Preferably, the dosage form of the composition is an oral preparation.
Preferably, the composition is in the form of an enteric oral preparation.
Preferably, the composition is in the form of small intestine oral preparation.
Preferably, the composition is in the form of a solid, liquid or semisolid preparation.
Preferably, the composition is in the form of tablets, capsules, powder, injections, powder injections, emulsions, infusion solutions, oral liquids, aerosols, ointments, gels, microspheres and creams.
In a fourth aspect of the invention, there is provided the use of a Bacillus subtilis according to the first aspect of the invention and/or a transformant according to the second aspect of the invention, for the preparation of a composition for the prevention and/or treatment of SARS-CoV-2 virus infection or COVID-19; and/or as a booster of SARS-CoV-2 antibodies.
Preferably, the SARS-CoV-2 antibody comprises an antibody produced by vaccination with a Sinovac-Corona vaccine.
Preferably, the composition is in the form of an injection preparation, an external preparation or an oral preparation.
Preferably, the composition is a pharmaceutical composition or a vaccine composition.
Preferably, the composition further comprises a pharmaceutically, vaccinally acceptable carrier.
Preferably, the dosage form of the composition is an oral preparation.
Preferably, the composition is in the form of an enteric oral preparation.
Preferably, the composition is in the form of small intestine oral preparation.
In a fifth aspect of the present invention, there is provided a method for preparing an antibody against a nucleocapsid protein of SARS-CoV-2 and/or against a receptor binding region of a spike protein of SARS-CoV-2 virus, said method comprising the steps of:
orally administering Bacillus subtilis according to the first aspect of the present invention and/or a transformant according to the second aspect of the present invention to a subject, and isolating antibodies against the nucleocapsid protein of SARS-CoV-2 and/or antibodies against the receptor binding region of the spike protein of SARS-CoV-2 virus from the blood.
Preferably, the method is a non-diagnostic and non-therapeutic method.
Preferably, the subject is a human or a non-human mammal.
Preferably, the non-human mammal is a mouse, dog, cat, cow, sheep, horse, pig.
In a sixth aspect of the present invention, there is provided a method for preventing and/or treating SARS-CoV-2 virus infection or COVID-19, said method comprising the steps of: orally administering to said subject, e.g., a Bacillus subtilis according to the first aspect of the invention and/or a transformant according to the second aspect of the invention, thereby preventing and/or treating SARS-CoV-2 virus infection or COVID-19.
Preferably, the subject is a human or a non-human mammal.
Preferably, the non-human mammal is a mouse, dog, cat, cow, sheep, horse, pig.
Within the scope of the present invention, the above-mentioned technical features of the present invention and those specifically described hereinafter may be combined with each other to constitute new or preferred technical solutions.
Drawings
FIG. 1 is a reference diagram of a plasmid for constructing S protein of SARS-CoV-2.
FIG. 2 is a Western blot of genetically engineered Bacillus subtilis expressing the N and S protein expression of SARS-CoV-2.
FIG. 3 is spores of wild Bacillus stained with Anti-SRBD-AF488 and genetically engineered Bacillus spores expressing the S protein.
FIG. 4 is a S-western blot of genetically engineered Bacillus subtilis spores.
FIG. 5 is an immunostaining of wild-type Bacillus subtilis and genetically engineered Bacillus subtilis spores containing the S protein.
FIG. 6 is a flow cytometric analysis of wild type Bacillus subtilis and genetically engineered Bacillus subtilis spores.
FIG. 7 is a serum anti-S protein antibody from genetically engineered Bacillus subtilis spores expressing N and S proteins after gavage in mice.
Detailed Description
The present invention develops a Bacillus subtilis which expresses the nucleocapsid protein of SARS-CoV-2 and/or the receptor binding region of the spike protein of SARS-CoV-2. The genetically engineered bacillus subtilis oral administration of the invention can be used for preventing and/or treating SARS-CoV-2 virus infection or COVID-19. In addition, the genetically engineered Bacillus subtilis of the present invention can be also used as a booster of SARS-CoV-2 antibody, thereby improving the treatment effect of SARS-CoV-2.
Term(s) for
As used herein, the terms "comprising," "including," and "containing" are used interchangeably and include not only open-ended definitions, but also semi-closed and closed-ended definitions. In other words, the term includes "consisting of … …", "consisting essentially of … …".
As used herein, the terms "Spike protein" and "Spike protein" are used interchangeably.
As used herein, the term "receptor binding domain" is used interchangeably with "RBD".
As used herein, the term "Bacillus Subtilis WB 800N" is used interchangeably with "Bacillus Subtilis WB 800N".
In the present invention, the term "prevention" refers to a method of preventing the onset of a disease and/or its attendant symptoms or protecting a subject from acquiring a disease.
"treatment" as used herein includes delaying and stopping the progression of the disease, or eliminating the disease, and does not require 100% inhibition, elimination, or reversal.
Bacillus subtilis
The invention provides a bacillus subtilis which expresses a nucleocapsid protein of SARS-CoV-2 and/or a receptor binding region of a spike protein of SARS-CoV-2.
Preferably, the strain of bacillus subtilis comprises the bacillus subtilis WB800N strain.
In a preferred embodiment of the invention, the nucleotide sequence of the nucleocapsid protein of SARS-CoV-2 is shown in SEQ ID NO: 1:
SEQ ID NO:1：
ATGTCAGACAATGGCCCTCAAAACCAGAGAAACGCTCCCCGTATAACTTTTGGAGGACCGTCGGATTCAACAGGTAGCAATCAGAATGGCGAGAGATCTGGCGCAAGGAGTAAACAGCGGAGACCCCAGGGATTACCCAATAATACAGCCTCATGGTTTACTGCCCTAACTCAGCATGGCAAAGAAGATCTTAAGTTTCCTCGGGGTCAAGGCGTACCCATAAATACAAATTCTTCCCCGGATGATCAAATCGGATACTATCGCAGGGCGACTAGACGCATCAGAGGCGGCGATGGCAAGATGAAGGATCTGAGTCCCAGATGGTATTTTTATTATTTGGGAACAGGACCCGAGGCAGGATTACCGTATGGAGCAAACAAGGATGGGATTATTTGGGTGGCTACGGAAGGAGCATTAAATACTCCGAAGGATCACATTGGTACTCGGAACCCGGCAAACAATGCTGCTATTGTCCTTCAATTACCACAAGGCACGACCTTACCGAAAGGCTTTTACGCGGAAGGTTCCCGCGGCGGCTCTCAGGCAAGCTCACGTTCATCATCCAGATCTCGTAATAGCAGCCGGAACTCAACACCCGGAAGTTCGAGAGGGACAAGCCCTGCGCGAATGGCAGGAAACGGTGGCGACGCCGCGCTCGCCTTGTTGCTTTTGGATCGGTTGAATCAGCTTGAGTCAAAAATGTCTGGAAAGGGGCAACAACAACAAGGTCAAACAGTGACGAAAAAATCAGCTGCGGAAGCGTCAAAAAAACCCCGTCAAAAACGCACGGCTACAAAGGCGTATAACGTAACACAAGCATTTGGAAGAAGGGGGCCGGAACAAACGCAAGGTAATTTTGGAGATCAAGAACTGATTAGGCAGGGCACAGACTATAAACACTGGCCGCAGATCGCACAGTTTGCGCCCAGCGCGTCGGCATTTTTCGGCATGTCGCGTATTGGAATGGAGGTCACACCCAGCGGCACATGGCTTACGTATACCGGCGCGATCAAGCTCGACGATAAAGATCCTAACTTTAAAGATCAGGTAATACTGTTGAACAAGCATATAGACGCTTACAAAACGTTTCCCCCTACAGAACCTAAAAAAGATAAAAAAAAAAAAGCGGATGAGACCCAAGCGTTACCCCAGAGACAGAAGAAACAACAAACAGTGACACTGTTACCAGCCGCAGATCTGGATGATTTTAGCAAACAGTTACAACAGTCTATGTCTTCCGCTGATTCAACACAAGCGTAA(SEQ ID NO:1)。
preferably, the nucleotide sequence of the receptor binding region of the spike protein of SARS-CoV-2 is shown in SEQ ID NO: 2:
SEQ ID NO:2：
AATATCACGAATTTGTGCCCATTTGGCGAAGTATTCAACGCAACGAGATTTGCCTCCGTTTATGCGTGGAACCGGAAGAGAATCTCAAATTGTGTCGCGGATTATAGCGTCCTGTATAATTCAGCGTCATTCTCCACCTTTAAGTGCTACGGCGTGTCACCAACGAAATTGAATGATCTGTGTTTCACTAATGTATATGCAGATAGCTTTGTGATCCGCGGCGACGAAGTCAGACAAATTGCGCCAGGCCAAACGGGAAAAATCGCAGATTATAATTATAAACTTCCTGATGACTTCACGGGATGTGTAATTGCATGGAACTCTAATAACCTTGATTCGAAAGTCGGAGGAAATTATAACTATCTGTATAGACTGTTCCGCAAGAGCAATCTCAAGCCTTTCGAACGCGATATCTCGACGGAGATTTATCAAGCCGGCAGCACCCCGTGTAACGGTGTTGAAGGCTTCAATTGCTATTTCCCGCTGCAGAGCTATGGCTTTCAACCGACGAACGGGGTTGGCTACCAGCCCTACCGCGTCGTGGTTCTGTCCTTCGAATTACTCCATGCCCCGGCTACGGTTTAATGAAA(SEQ ID NO:2)。
transformant
Transformants (transformants) are bacterial cells or other recipient cells that have acquired a new genetic marker after incorporation or introduction of foreign DNA. The transformed recipient bacterium is called transformant.
The present invention provides a transformant comprising Bacillus subtilis containing a gene expressing a nucleocapsid protein of SARS-CoV-2 and/or a receptor binding region of a spike protein of SARS-CoV-2.
Preferably, the gene comprises DNA and/or RNA.
Preferably, said gene is incorporated or introduced into said Bacillus subtilis.
Preferably, the strain of bacillus subtilis comprises the bacillus subtilis WB800N strain.
Preferably, the nucleotide sequence of the gene expressing the nucleocapsid protein of SARS-CoV-2 is as shown in SEQ ID NO:1 above.
Preferably, the nucleotide sequence of the receptor binding region of the spike protein expressing SARS-CoV-2 is as shown in SEQ ID NO:2 above.
Preferably, the gene is loaded on a plasmid.
Preferably, the plasmid comprises shuttle vector pHT 01.
Preferably, the nucleotide sequence of the gene expressing the nucleocapsid protein of SARS-CoV-2 is shown as SEQ ID NO. 3.
Preferably, the nucleotide sequence of the receptor binding region of the spike protein expressing SARS-CoV-2 is shown in SEQ ID NO. 4.
Composition comprising a metal oxide and a metal oxide
The present invention provides a composition which can be used for preventing and/or treating SARS-CoV-2 virus infection or COVID-19.
Typically, the composition is a pharmaceutical composition or a vaccine composition.
The composition of the invention can also comprise a pharmaceutically and vaccinally acceptable carrier.
In the present invention, the dosage form of the composition includes (but is not limited to) oral preparation, injection, and external preparation.
Typically, the dosage forms of the compositions include (but are not limited to): tablet, capsule, powder, injection, powder for injection, emulsion, infusion solution, oral liquid, aerosol, unguent, gel, microsphere, and cream.
The term "pharmaceutically, vaccinally acceptable carrier" refers to: one or more compatible solid, semi-solid, liquid or gel fillers which are suitable for human or animal use and must be of sufficient purity and sufficiently low toxicity. By "compatible" is meant that the components of the pharmaceutical composition and the active ingredient of the drug are blended with each other and not significantly detract from the efficacy of the drug.
It is to be understood that, in the present invention, the carrier is not particularly limited and may be selected from materials commonly used in the art, or prepared by a conventional method, or commercially available. Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, transdermal enhancers, colorants, flavors, stabilizers, antioxidants, preservatives, bacteriostats, pyrogen-free water, etc.
Typically, liquid dosage forms may contain, in addition to the active pharmaceutical ingredient, inert diluents commonly employed in the art such as water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, especially cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of such materials and the like. In addition to these inert diluents, the compositions may also contain adjuvants such as wetting agents, emulsifying and suspending agents and the like
The pharmaceutical preparation should be compatible with the mode of administration. The agents of the invention may also be used with (including before, during or after) other co-therapeutic agents. In using the pharmaceutical compositions, a safe and effective amount of the drug, typically at least about 10 micrograms/kg body weight, and in most cases no more than about 8 mg/kg body weight, preferably from about 10 micrograms/kg body weight to about 1 mg/kg body weight, is administered to a subject in need thereof (e.g., a human or non-human mammal). Of course, the particular dosage will depend upon such factors as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.
Use of
The present invention also provides the use of the Bacillus subtilis according to the present invention and/or the transformant according to the present invention for the preparation of a composition for the prevention and/or treatment of SARS-CoV-2 virus infection or COVID-19; and/or as a booster of SARS-CoV-2 antibodies.
The present invention also provides a method for preparing an antibody against a nucleocapsid protein of SARS-CoV-2 and/or against a receptor binding region of a spike protein of SARS-CoV-2 virus, said method comprising the steps of:
the Bacillus subtilis according to the present invention and/or the transformant according to the present invention are orally administered to a subject, and an antibody against a receptor binding region of the spike protein of SARS-CoV-2 virus is isolated from blood.
Preferably, the method is a non-diagnostic and non-therapeutic method.
Preferably, the subject is a human or a non-human mammal.
Preferably, the non-human mammal is a mouse, dog, cat, cow, sheep, horse, pig.
The present invention also provides a method for preventing and/or treating SARS-CoV-2 virus infection or COVID-19, the method comprising the steps of: orally administering to said subject a Bacillus subtilis according to the invention and/or a transformant according to the invention, thereby preventing and/or treating SARS-CoV-2 virus infection or COVID-19.
The main technical effects of the invention comprise:
the invention develops a genetically engineered bacillus subtilis which expresses a receptor binding region of a nucleocapsid protein of SARS-CoV-2 and a spike protein of SARS-CoV-2, the genetically engineered bacillus subtilis can be used for preventing and treating SARS-CoV-2 virus infection or COVID-19 by oral administration, and has the advantages of low oral administration cost, high safety, convenient administration and high patient compliance. In addition, the genetically engineered Bacillus subtilis of the present invention can be also used as a booster of SARS-CoV-2 antibody, thereby improving the treatment effect of SARS-CoV-2.
The invention will be further illustrated with reference to the following specific examples. It should be understood that the following specific examples are provided to illustrate the detailed embodiments and specific procedures, but the scope of the present invention is not limited to these examples.
Examples
The N protein of SARS-CoV-2 is the nucleocapsid protein of SARS-CoV-2.
The S protein of SARS-CoV-2 is RBD (receptor binding region) of Spike protein (Spike) of SARS-CoV-2.
The genetic engineering bacillus subtilis for expressing N and S proteins of SARS-CoV-2 is called genetic engineering bacillus subtilis for short.
Example 1
1.1 preparation of genetically engineered Bacillus subtilis expressing N and S proteins of SARS-CoV-2
Bacillus Subtilis WB800N (Bacillus Subtilis WB800N) strain was used for the study. The bacteria were transformed with a plasmid encoding the S/N protein of the SARS-CoV-2 virus. Sporulation of bacillus subtilis is induced from vegetative cells using diffosporium seeds and further treated with lysosomes to remove vegetative cells.
The expression construct comprising the full-length CotC cascade from bacillus subtilis, the peptide linker region and the RBD (receptor binding region) from the nucleocapsid protein or Spike protein (Spike) of SARS-CoV-2 was codon optimized for bacillus subtilis, further cloned into the shuttle vector pHT01 of escherichia coli (e. Escherichia coli strain DH5 alpha (NEB) for cloning and expressing SARS
Construction of the N and S proteins of SARS-CoV-2 plasmids were transformed into Bacillus subtilis strain WB800N (MoBiTec) for N and S protein expression. The DNA sequence of the plasmid was confirmed by Sanger sequencing.
The sequencing results of the nucleocapsid protein construction plasmid of pHT01-SARS-CoV-2 transformed into Bacillus subtilis strain WB800N and the RBD construction plasmid of pHT01-SARS-CoV-2 Spike protein are shown below:
the nucleotide sequence of pHT 01-nucleocapsid protein is shown in SEQ ID NO: 3:
SEQ ID NO:3：
wherein: and (3) CotC: non-blackened underline
Peptide linker region: blackened italic
Nucleocapsid protein nucleotides of SARS-CoV-2: black and underlined
The nucleotide sequence of RBD of pHT01-Spike protein is shown in SEQ ID NO: 4:
SEQ ID NO:4：
wherein: and (3) CotC: non-blackened underline
Peptide linker region: blackened italic
RBD nucleotide sequence of spike protein of SARS-CoV-2: the black is underlined.
A reference schematic diagram of the construction plasmid for the S protein of SARS-CoV-2 is shown in FIG. 1.
1.2 Induction of N and S proteins of SARS-CoV-2 from genetically engineered Bacillus subtilis
The B.subtilis transformants will be grown at 37 ℃ at 200rpm until the OD600 value reaches 1.0 in 2XLB supplemented with chloramphenicol (5. mu.g/mL). The cultures were induced with 1mM IPTG final concentration and further induced at 37 ℃ for 12h at 200 rpm. The culture was collected and centrifuged at 4,200rpm for 15 min. The cell pellet was washed with 1 Xphosphate buffered saline (PBS, pH7.4) and resuspended in 1/2 volumes of DifcosporationMedium (DSM) (8g nutrient broth, 0.1% KCl, 1mM MgSO 2)4And 10. mu.M MnCl2Dissolving in 1L distilled water, adding 0.5mM CaCl2And 1. mu.M FeSO4). Cells were grown at 37 ℃ and 200rpm for 24 hours. Cells were lysed by lysozyme (0.1mg/mL) at 37 ℃ for 1h, centrifuged at 10,000rpm for 15 minutes, and then washed three times with 1 xPBS. Spores from transformed Bacillus subtilis were washed with PBS, lysed with lysis buffer (PBS + 1% Triton and complete protease inhibitor), then denatured at 100 ℃ for 10min, and then centrifuged at 14,800g for 15 min. BCA assay was performed to determine protein concentration. RBD and 10. mu.g spore lysate of 100ng spike protein (spike protein) standard will be analyzed in SDS-PAGE and then subjected to Western blot examination with RBD and nucleocapsid protein monoclonal antibodies directed against spike protein.
1.3. Co-culture of human monocytes and intestinal HT-29 cells
To mimic the mucosal region of the gut, human monocytes and HT-29 cells of the gut were used in vitroA co-cultivation system. Human monocytes were prepared from fresh human buffy coats of healthy volunteers for purification of primary human macrophages. Peripheral Blood Mononuclear Cells (PBMC) will be separated by centrifugation at 1800rpm for 25min at Ficoll density (1.082 g/ml). After erythrocyte lysis, CD 14-specific MACS beads (miltenyi biotec) will be used to enrich for CD14+ monocytes. To induce macrophage differentiation, CD14+ monocytes will be cultured for 6-7 days in RPMI1640 medium containing L-glutamine, 10% FCS, 1% penicillin-streptomycin, 1% sodium pyruvate, 1% Glutamax (GIBCO), and GM-CSF (25ng/mL) at a cell culture density of 1.5X105/cm2。
Human intestinal epithelial HT-29 cells were cultured in 24-well plates until confluent, and then washed with PBS at 37 ℃ to prevent cell detachment. Monocyte suspension (5X 10)5/ml) was added to HT-29 cells in the plate. Epithelial cell-monocyte co-cultures were incubated with or without wild-type bacillus subtilis/genetically engineered bacillus subtilis. The concentration of proinflammatory factors (IL-1, IL-6, IL-8, IL-12, interferon-gamma (IFN. gamma.) and TNF. alpha.) in culture supernatants or mouse sera was quantified by Bio-plex200System (Bio-Rad) Bio-plex human cytokine/chemokine multiplex assay.
1.4. In vitro cell isolation and production of DCs
Monocytes will be plated at 2X 10 in 24 well plates6The mixture was plated at a density of 24-well plates at 37 ℃ and 5% CO2Adhesion was carried out for 45 minutes under the conditions. Nonadherent cells can be removed by flushing the wells 2 to 3 times with a gentle flow of medium. Monocytes were then cultured in the presence of two cytokines: granulocyte macrophage colony stimulating factor (50ng/ml) and IL-4(40ng/ml) at 37 ℃ and 5% CO2Culturing under the condition. On day 3, 50% of the medium will be replaced with fresh medium and cytokines. The DCs were then collected and washed on day 6. Cell maturation was induced by wild bacillus subtilis/genetically engineered bacillus subtilis for 48 hours. Lipopolysaccharide (LPS) (0.1g/ml) will be used as a positive control. After harvesting the cells, the supernatant of the DCs culture was collected and stored at-80 ℃ for cytokine detection.
The concentration of (IL-1, IL-12, IL-10, IFN-. gamma.and TNF-. alpha.) was determined by Bio-plex human cytokine/chemokine multiplex analysis by the Bio-plex200System (Bio-Rad).
Flow cytometric analysis of DCs
On day 8, DCs (dendritic cells) were collected, washed and labeled with fluorochrome-conjugated antibodies. After labeling, the cell suspension was washed and resuspended for flow cytometry analysis. FITC, PE and PE-cyanin5.1(PC5) -conjugated isotype controls and CD11c-APC, CD14-FITC, CD40-PerCP, CD80-FITC, CD83-PE, CD86-PE and HLA-DR-APC antibodies. DCs normalized the mean fluorescence intensity of the different CD markers to the mean fluorescence intensity of the RPMI-treated negative control to relative fluorescence intensity by standard forward and side scatter curves for large cells.
1.6. Immunization protocols
1.6.1 the immunomodulatory activity of different combinations of wild Bacillus subtilis/genetically engineered Bacillus subtilis was first studied and compared using the in vitro experiments described above. The wild Bacillus subtilis/genetically engineered Bacillus subtilis used in subsequent animal studies was based on the results of in vitro experiments.
Using BALB/mice, 8-week old mice will be inoculated with spores of wild bacillus subtilis or genetically engineered bacillus subtilis by the gavage (p.o.) route.
Group 1: wild non-immunized group
Group 2: 1.0X 1010Genetic engineering of individual spores of Bacillus subtilis
Mice were gavaged with stainless steel round-headed intubation and contained 1X1010A suspension of individual spores (0.5 ml aliquots). 30min before spore administration, mice were gavaged with 0.5ml of 0.1M sodium bicarbonate solution. Blood will be collected three days prior to the immunization schedule and after the third dose, and individual blood samples from each mouse group will be tested for antibody responses.
1.6.2 serology of antibodies
Mice were bled under general anesthesia for ELISA analysis and sera were frozen for future testing. The targeted antigen is SARS-CoV-2N and S protein. To determine the titer of antibodies in mouse sera, ELISA plates were coated with antigen, typically 0.1 ng/well. Serum supernatants, serially diluted in PBS containing 1% HSA, were added to the plate-coated wells and incubated for 1h at room temperature. Goat anti-mouse IgM or IgG was conjugated to alkaline phosphatase (southern Biotechnology, Birmingham, AL, USA) as a secondary antibody. Antibody titer was defined as the highest serum dilution with absorbance 0.1 or higher than that of normal serum samples. The reaction titer was determined positive by ELISA if the reactivity titer increased from undetectable pretreatment to at least 1:40 post-vaccination, or if 8 times the pretreatment could be detected.
1.6.3 isolation and activation of splenocytes
After the last immunization, the mice will be sacrificed and spleens will be aseptically collected for splenocyte isolation. Spleen RPMI-1640 (supplemented with 10% heat-inactivated fetal bovine serum, 25mM HEPES, 2mM L-glutamine, 1mM sodium pyruvate, 100IU/ml penicillin and 100mg/ml streptomycin) and a 5ml syringe equipped with a 26G needle were used to obtain a single cell suspension of spleen cells. Spleen cell suspensions will be centrifuged at 300 Xg for 5 minutes. RBCs used 3ml of 0.84% sterile NH4Cl was cleaved for 2 min. Cells were washed with RPMI-1640 to remove lysed erythrocytes and NH4And (4) Cl. Spleen cell (2X 10)5/ml) will be incubated for 48 hours in the absence or presence of purified recombinant SARS-CoV-2S and N proteins. A sample of the supernatant containing the released cytokines will then be collected and stored at-80 ℃. Levels of IL-1, IL-6, IL-10, IL-17, IFN- γ, and TNF- α secreted by cells stimulated by SARS-CoV-2S and N proteins cytokine/chemokine multiplex assays were performed by Bio-plex human from Bio-plex200System (Bio-Rad).
1.7 clinical trials
Volunteers were randomly divided into an unvaccinated group and a vaccinated group.
For volunteers not vaccinated with the other vaccine groups, volunteers orally administered 1 pill containing 1x10 on days 0, 14 and 28, respectively10CFU genetically engineered Bacillus subtilis spore capsules were tested on days 0, 27 and 42 for blood.
Will for vaccination of other vaccine groupsVolunteers, who were blood tested 4 months after vaccination with the Sinovac-Corona vaccine (counted as day 0), were given 1 oral dose containing 1X1010Blood tests were performed 14 days after the capsules of CFU genetically engineered Bacillus subtilis spores.
MAGLUMI SARS-CoV-2 neutralizing antibody test was performed on blood samples to quantitatively determine the neutralizing antibody titer against SARS-CoV-2 in volunteers with a detection limit of 0.003. mu.g/mL.
1.8. Statistical analysis
Statistical analysis and significance analysis will be performed using graphpadpism software version 5.0 (graphpadpsoftware, san diego, CA, USA), as measured by student's t-test or one-way analysis of variance (ANOVA) of paired samples. In all comparisons, p <0.05 would be considered statistically significant.
2. Results of the experiment
2.1 Induction of the N and S proteins of SARS-CoV-2 from genetically engineered Bacillus subtilis
The N and S protein expression of SARS-CoV-2 of engineered Bacillus subtilis was confirmed by Western blotting of Bacillus subtilis lysates and staining of spores with RBD-AF488 against S protein, as shown in FIGS. 2 and 3.
2.2 characterization of spores
Spore characteristics were also confirmed by western blotting and immunostaining, as shown in fig. 4 and 5. The stained spores were further characterized by flow cytometry, and the results of flow cytometry analysis are shown in fig. 6.
2.3 animal experiments
Mice were gavaged with bacillus subtilis spores expressing N-protein and S-protein (First log) for 3 treatment courses beginning on day 0, and after day 98, with bacillus subtilis spores expressing S-protein (Second log) for an additional 3 consecutive days, once a day, and the content of IgM and IgG antibodies against S-protein in mouse serum was shown in fig. 7.
It can be seen that, after oral administration of spores of Bacillus subtilis expressing N-protein and S-protein, high amounts of IgM and IgG antibodies, which are S-protein antibodies to SARS-CoV-2, were produced in serum, indicating that Bacillus subtilis expressing N-protein and S-protein can be orally used as a vaccine for SARS-CoV-2 infection.
2.4 human cytokine/chemokine multiplex assay results
Human cytokine/chemokine multiplex assay determination concentrations of IL-1, IL-12, IL-10, IFN- γ and TNF- α were significantly elevated in human monocyte and intestinal HT-29 epithelial cell co-cultures and DCs induced by wild Bacillus subtilis/genetically engineered Bacillus subtilis, and in splenocytes isolated after mouse immunization in the presence of purified recombinant SARS-CoV-2S and N protein activation.
2.5 results of clinical trials
For volunteers who were not vaccinated with the other vaccine groups, the content of antibody SARS-CoV-2 in blood at days 0, 27 and 42 after oral administration of the capsule of genetically engineered Bacillus subtilis spores was as shown in Table 1 below:
TABLE 1 content of antibody SARS-CoV-2 neutralizing antibody in blood on days 0, 27 and 42 after oral administration of capsules of genetically engineered Bacillus subtilis spores in volunteers who were not inoculated with other vaccine groups
Volunteers
Day 0
Day 27
Day 42
Male (65 years old)
<0.003μg/ml
0.016μg/ml
0.037μg/ml
Female (58 years old)
<0.003μg/ml
0.003μg/ml
0.034μg/ml
Female (48 years old)
<0.003μg/ml
<0.003μg/ml
0.022μg/ml
Male (54 years old)
<0.003μg/ml
0.003μg/ml
0.050μg/ml
Male (71 years old)
<0.003μg/ml
<0.003μg/ml
0.042μg/ml
For volunteers vaccinated with the other vaccine groups, the content of antibody SARS-CoV-2 neutralizing antibody in blood 4 months after the vaccination with the Sinovac-Corona vaccine (counted as day 0) and 14 days after the oral administration of the capsule of genetically engineered bacillus subtilis spores was as shown in table 2 below:
TABLE 2 antibodies in blood of volunteers vaccinated with the other vaccine groups 4 months after vaccination with Sinovac-Corona vaccine (counted as day 0) and 14 days after oral administration of capsules of genetically engineered Bacillus subtilis spores
Content of SARS-CoV-2 neutralizing antibody
Volunteers
Day 0
Day 14
Male (58 years old)
0.08μg/ml
0.082μg/ml
Male (58 years old)
0.108μg/ml
0.194μg/ml
Male (55 years old)
0.073μg/ml
0.090μg/ml
As can be seen from tables 1 and 2, the genetically engineered Bacillus subtilis orally expressing the N and S proteins of SARS-CoV-2 was able to produce the antibody SARS-CoV-2 neutralizing antibody, thereby treating SARS-CoV-2, indicating that the Bacillus subtilis expressing the N and S proteins was able to be orally used as a vaccine for SARS-CoV-2 infection.
While the invention has been described in terms of a preferred embodiment, it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention.
Sequence listing
<110> applicant's name Aselen cytokine Co., Ltd
<120> an oral vaccine and antibody booster for COVID-19
<130> GWGC210906DI-LQ
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1260
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgtcagaca atggccctca aaaccagaga aacgctcccc gtataacttt tggaggaccg 60
tcggattcaa caggtagcaa tcagaatggc gagagatctg gcgcaaggag taaacagcgg 120
agaccccagg gattacccaa taatacagcc tcatggttta ctgccctaac tcagcatggc 180
aaagaagatc ttaagtttcc tcggggtcaa ggcgtaccca taaatacaaa ttcttccccg 240
gatgatcaaa tcggatacta tcgcagggcg actagacgca tcagaggcgg cgatggcaag 300
atgaaggatc tgagtcccag atggtatttt tattatttgg gaacaggacc cgaggcagga 360
ttaccgtatg gagcaaacaa ggatgggatt atttgggtgg ctacggaagg agcattaaat 420
actccgaagg atcacattgg tactcggaac ccggcaaaca atgctgctat tgtccttcaa 480
ttaccacaag gcacgacctt accgaaaggc ttttacgcgg aaggttcccg cggcggctct 540
caggcaagct cacgttcatc atccagatct cgtaatagca gccggaactc aacacccgga 600
agttcgagag ggacaagccc tgcgcgaatg gcaggaaacg gtggcgacgc cgcgctcgcc 660
ttgttgcttt tggatcggtt gaatcagctt gagtcaaaaa tgtctggaaa ggggcaacaa 720
caacaaggtc aaacagtgac gaaaaaatca gctgcggaag cgtcaaaaaa accccgtcaa 780
aaacgcacgg ctacaaaggc gtataacgta acacaagcat ttggaagaag ggggccggaa 840
caaacgcaag gtaattttgg agatcaagaa ctgattaggc agggcacaga ctataaacac 900
tggccgcaga tcgcacagtt tgcgcccagc gcgtcggcat ttttcggcat gtcgcgtatt 960
ggaatggagg tcacacccag cggcacatgg cttacgtata ccggcgcgat caagctcgac 1020
gataaagatc ctaactttaa agatcaggta atactgttga acaagcatat agacgcttac 1080
aaaacgtttc cccctacaga acctaaaaaa gataaaaaaa aaaaagcgga tgagacccaa 1140
gcgttacccc agagacagaa gaaacaacaa acagtgacac tgttaccagc cgcagatctg 1200
gatgatttta gcaaacagtt acaacagtct atgtcttccg ctgattcaac acaagcgtaa 1260
<210> 2
<211> 590
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
aatatcacga atttgtgccc atttggcgaa gtattcaacg caacgagatt tgcctccgtt 60
tatgcgtgga accggaagag aatctcaaat tgtgtcgcgg attatagcgt cctgtataat 120
tcagcgtcat tctccacctt taagtgctac ggcgtgtcac caacgaaatt gaatgatctg 180
tgtttcacta atgtatatgc agatagcttt gtgatccgcg gcgacgaagt cagacaaatt 240
gcgccaggcc aaacgggaaa aatcgcagat tataattata aacttcctga tgacttcacg 300
ggatgtgtaa ttgcatggaa ctctaataac cttgattcga aagtcggagg aaattataac 360
tatctgtata gactgttccg caagagcaat ctcaagcctt tcgaacgcga tatctcgacg 420
gagatttatc aagccggcag caccccgtgt aacggtgttg aaggcttcaa ttgctatttc 480
ccgctgcaga gctatggctt tcaaccgacg aacggggttg gctaccagcc ctaccgcgtc 540
gtggttctgt ccttcgaatt actccatgcc ccggctacgg tttaatgaaa 590
<210> 3
<211> 1716
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
tcacagaaaa agaacgggaa aagatgatgt aagcgtgaaa aattttttat cttatcactt 60
gaaattggaa gggagattct ttattataag aattgtggaa ttgtgagcgg ataacaattc 120
ccaattaaag gaggaaggat ccatgggcta ctataaaaaa tacaaagaag aatactatac 180
cgttaaaaag acatattaca agaagtatta tgagtacgat aaaaaagact atgattgtga 240
ttacgataaa aaatatgatg actatgataa aaaatattac gatcatgata aaaaagacta 300
tgattatgta gtagaatata aaaagcacaa aaaacattac gggggcgggg aggccgctgc 360
gaaaggtggc ggcatgtcag acaatggccc tcaaaaccag agaaacgctc cccgtataac 420
ttttggagga ccgtcggatt caacaggtag caatcagaat ggcgagagat ctggcgcaag 480
gagtaaacag cggagacccc agggattacc caataataca gcctcatggt ttactgccct 540
aactcagcat ggcaaagaag atcttaagtt tcctcggggt caaggcgtac ccataaatac 600
aaattcttcc ccggatgatc aaatcggata ctatcgcagg gcgactagac gcatcagagg 660
cggcgatggc aagatgaagg atctgagtcc cagatggtat ttttattatt tgggaacagg 720
acccgaggca ggattaccgt atggagcaaa caaggatggg attatttggg tggctacgga 780
aggagcatta aatactccga aggatcacat tggtactcgg aacccggcaa acaatgctgc 840
tattgtcctt caattaccac aaggcacgac cttaccgaaa ggcttttacg cggaaggttc 900
ccgcggcggc tctcaggcaa gctcacgttc atcatccaga tctcgtaata gcagccggaa 960
ctcaacaccc ggaagttcga gagggacaag ccctgcgcga atggcaggaa acggtggcga 1020
cgccgcgctc gccttgttgc ttttggatcg gttgaatcag cttgagtcaa aaatgtctgg 1080
aaaggggcaa caacaacaag gtcaaacagt gacgaaaaaa tcagctgcgg aagcgtcaaa 1140
aaaaccccgt caaaaacgca cggctacaaa ggcgtataac gtaacacaag catttggaag 1200
aagggggccg gaacaaacgc aaggtaattt tggagatcaa gaactgatta ggcagggcac 1260
agactataaa cactggccgc agatcgcaca gtttgcgccc agcgcgtcgg catttttcgg 1320
catgtcgcgt attggaatgg aggtcacacc cagcggcaca tggcttacgt ataccggcgc 1380
gatcaagctc gacgataaag atcctaactt taaagatcag gtaatactgt tgaacaagca 1440
tatagacgct tacaaaacgt ttccccctac agaacctaaa aaagataaaa aaaaaaaagc 1500
ggatgagacc caagcgttac cccagagaca gaagaaacaa caaacagtga cactgttacc 1560
agccgcagat ctggatgatt ttagcaaaca gttacaacag tctatgtctt ccgctgattc 1620
aacacaagcg taatgaaatc tagagtcgac gtccccgggg cagcccgcct aatgagcggg 1680
cttttttcac gtcacgcgtc catggagatc tttgtc 1716
<210> 4
<211> 1125
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
ccgcggaagg gggggcggaa agatgatgta agcgtgaaaa attttttatc ttatcacttg 60
aaattggaag ggagatcttt attataagaa ttgtggaatt gtgagcggat aacaattccc 120
aattaaagga ggaaggatcc atgggctact ataaaaaata caaagaagaa tactataccg 180
ttaaaaagac atattacaag aagtattatg agtacgataa aaaagactat gattgtgatt 240
acgataaaaa atatgatgac tatgataaaa aatattacga tcatgataaa aaagactatg 300
attatgtagt agaatataaa aagcacaaaa aacattacgg gggcggggag gccgctgcga 360
aaggtggcgg caatatcacg aatttgtgcc catttggcga agtattcaac gcaacgagat 420
ttgcctccgt ttatgcgtgg aaccggaaga gaatctcaaa ttgtgtcgcg gattatagcg 480
tcctgtataa ttcagcgtca ttctccacct ttaagtgcta cggcgtgtca ccaacgaaat 540
tgaatgatct gtgtttcact aatgtatatg cagatagctt tgtgatccgc ggcgacgaag 600
tcagacaaat tgcgccaggc caaacgggaa aaatcgcaga ttataattat aaacttcctg 660
atgacttcac gggatgtgta attgcatgga actctaataa ccttgattcg aaagtcggag 720
gaaattataa ctatctgtat agactgttcc gcaagagcaa tctcaagcct ttcgaacgcg 780
atatctcgac ggagatttat caagccggca gcaccccgtg taacggtgtt gaaggcttca 840
attgctattt cccgctgcag agctatggct ttcaaccgac gaacggggtt ggctaccagc 900
cctaccgcgt cgtggttctg tccttcgaat tactccatgc cccggctacg gtttaatgaa 960
atctagagtc gacgtccccg gggcagcccg cctaatgagc gggctttttt cacgtcacgc 1020
gtccatggag atctttgtct gcaactgaaa agtttatacc ttacctggaa caaatggttg 1080
aaacatacga ggctaatatc ggcttattag gaatagtccc tgtac 1125