阅读说明：本技术 通用供体细胞 (Universal donor cell ) 是由 R·拉莫斯-扎亚斯 A·雷扎尼亚 T·W·霍 于 2019-09-07 设计创作，主要内容包括：本文提供了与多名受试者相容的经遗传修饰的细胞,例如通用供体细胞；以及产生所述经遗传修饰的细胞的方法。这些通用供体细胞包含在编码一种或多种MHC-I或MHC-II人白细胞抗原或者MHC-I或MHC-II复合物的组分或转录调控因子的至少一种基因内或附近的至少一种遗传修饰、增加编码致耐受性因子的至少一种多核苷酸的表达的至少一种遗传修饰、以及任选的增加或减少编码存活因子的至少一种基因的表达的至少一种遗传修饰。(Provided herein are genetically modified cells, e.g., universal donor cells, that are compatible with a plurality of subjects; and methods of producing the genetically modified cells. These universal donor cells comprise at least one genetic modification within or adjacent to at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components of MHC-I or MHC-II complexes or transcriptional regulators, at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor, and optionally at least one genetic modification that increases or decreases the expression of at least one gene encoding a survival factor.)

1. A method of producing a universal donor cell, the method comprising genetically modifying a cell by:

(i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and

(ii) (ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor at a site that partially overlaps, completely overlaps, or is contained within the site of (i), thereby producing the universal donor cell.

2. A method of producing a universal donor cell, the method comprising genetically modifying a cell by:

(i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and

(ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor locus, thereby producing the universal donor cell.

3. The method of claim 1 or 2, wherein the universal donor cell has increased immune evasion and/or cell survival compared to an unmodified cell.

4. The method of any one of claims 1 to 3, wherein the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components or transcriptional regulators of the MHC-I or MHC-II complex is an MHC-I gene selected from HLA-A, HLA-B or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HL A-DOB, HLA-DQ or HLA-DR, or a gene selected from B2M, NLR C5, CIITA, RFX5, RFXAP or RFXANK.

5. The method of any one of claims 1 to 4, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD 47.

6. The method of any one of claims 1 to 5, wherein the at least one polynucleotide encoding a tolerogenic factor is operably linked to an exogenous promoter.

7. The method of claim 6, wherein the exogenous promoter is a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell-type specific promoter, optionally wherein the exogenous promoter is a CMV, EFla, PGK, CAG, or UBC promoter.

8. The method of any one of claims 1 to 7, wherein the deletion and/or insertion of (i) is within or near B2M and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

9. The method of any one of claims 1 to 8, wherein the method further comprises introducing at least one genetic modification that increases or decreases expression of at least one survival factor relative to unmodified cells.

10. The method of claim 9, wherein the at least one genetic modification that increases or decreases expression of at least one survival factor is an insertion of a polynucleotide encoding MANF that increases expression of MANF relative to the unmodified cell; or a deletion and/or insertion of at least one base pair within or near the gene encoding ZNF143, TXNIP, FOXO1 or JNK, which deletion and/or insertion reduces or eliminates expression of ZNF143, TXNIP, FOXO1 or JNK relative to the unmodified cell.

11. The method of claim 10, wherein the polynucleotide encoding MANF is inserted into a harbor safe locus or into a gene belonging to MHC-I, MHC-II or to a transcriptional regulator of MHC-I or MHC-II.

12. The method of any one of claims 1 to 11, wherein the genetic modification comprises delivering at least one RNA-guided endonuclease system to the cell.

13. The method of claim 12, wherein the at least one RNA-guided endonuclease system is a CRISPR system comprising a CRISPR nuclease and a guide RNA.

14. The method of claim 13, wherein the CRISPR nuclease is Cas9, Cpf1, a homolog thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof.

15. The method of claim 13 or 14, wherein the CRISPR nuclease is streptococcus pyogenes Cas 9.

16. The method of any of claims 13 to 15, wherein the CRISPR nuclease comprises an N-terminal Nuclear Localization Signal (NLS) and/or a C-terminal NLS.

17. The method of any of claims 13 to 16, wherein the CRISPR nuclease and the guide RNA are present in a 1:1 weight ratio.

18. The method of any one of claims 1 or 3 to 17, wherein the deletion and/or insertion of (i) is within or near the B2M locus and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1.

19. The method of claim 18, wherein the guide RNA for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOs 1-3 or 35-44.

20. The method of claim 18 or 19, wherein the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to the region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to the region to the right of the site in (i).

21. The method of claim 20, wherein the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the position in (i).

22. The method of claim 20 or 21, wherein (a) consists essentially of the nucleotide sequence of SEQ ID No. 13 and (b) consists essentially of the nucleotide sequence of SEQ ID No. 19.

23. The method of any one of claims 18 to 22, wherein the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

24. The method of any one of claims 1 to 23, wherein the cell is a mammalian cell, optionally wherein the cell is a human cell.

25. The method of any one of claims 1 to 24, wherein the cell is a stem cell.

26. The method of any one of claims 1 to 25, wherein the cell is a Pluripotent Stem Cell (PSC), an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem cell and progenitor cell (HSPC).

27. The method of any one of claims 1 to 24, wherein the cell is a differentiated cell or a somatic cell.

28. The method of any one of claims 1 to 24, wherein the universal donor cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell.

29. The method of claim 28, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

30. The method of claim 28, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

31. A plurality of universal donor cells produced by the method of any one of claims 1 to 30.

32. The plurality of universal donor cells of claim 31, maintained for a time and under conditions sufficient for the cells to undergo differentiation.

33. A composition comprising cells comprising:

(i) at least one deletion in or near at least one gene encoding one or more MHC-1 and MHC-II human leukocyte antigens or components of an MHC-I or MHC-II complex or transcriptional regulators; and

(ii) (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic deletion site of (i).

34. A method comprising administering to a subject a plurality of universal donor cells of claim 31 or 32.

35. A method for treating a subject in need thereof, the method comprising:

(i) obtaining or having obtained a plurality of universal donor cells according to claim 31 or 32 after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and

(ii) administering the lineage-restricted progenitor cells or fully differentiated somatic cells to the subject.

36. A method of obtaining cells for administration to a subject in need thereof, the method comprising:

(i) obtaining or having obtained the universal donor cell of claim 31 or 32; and

(ii) these universal donor cells are maintained for a time and under conditions sufficient to differentiate these cells into lineage-restricted progenitor cells or fully differentiated somatic cells.

37. The method of claim 35 or 36, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, or neural progenitor cells.

38. The method of claim 35 or 36, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

39. The method of any one of claims 34 to 38, wherein the subject is a human having, suspected of having, or at risk of having a disease.

40. The method of claim 39, wherein the disease is a genetically heritable disease.

Technical Field

The present invention relates to the field of gene editing, and in some embodiments, to genetic modifications for the purpose of generating cells (e.g., universal donor cells) compatible with multiple subjects.

Background

Various approaches have been proposed to overcome allograft rejection of transplanted or implanted cells, including HLA matching, blocking the pathway that triggers T cell activation with antibodies, using immunosuppressive drug cocktails, and autologous cell therapy. Another strategy to inhibit graft rejection involves minimizing allogenic differences between the transplanted or implanted cells and the recipient. Cell surface expressed Human Leukocyte Antigens (HLA), molecules encoded by genes located in the human major histocompatibility complex on chromosome 6, are the major mediators of immune rejection. Mismatches in a single HLA gene between the donor and the subject may elicit a robust immune response (Fleischhauer K. et al, "Bone marrow-allogenic emission by T lymphocytes recognizing a single amino acid difference in HLA-B44[ Bone marrow allograft rejection by T lymphocytes recognizing a single amino acid difference in HLA-B44 ]," N Engl J Med. [ New England journal of medicine ],1990,323: 1818-1822). HLA genes are classified into MHC class I (MHC-I) and MHC class II (MHC-II). The MHC-I genes (HLA-A, HLA-B and HLA-C) are expressed in almost all tissue cell types, presenting "non-self" antigen-treated peptides to CD8+ T cells, thereby facilitating their activation into cytolytic CD8+ T cells. Transplanted or implanted cells expressing "non-self" MHC-I molecules will elicit robust cellular immune responses against these cells, ultimately leading to their death by activated cytolytic CD8+ T cells. The MHC-I protein is closely associated with beta-2-microglobulin (B2M) in the endoplasmic reticulum, which is essential for the formation of functional MHC-I molecules on the cell surface.

In contrast to the widespread cellular expression of MHC-I genes, the expression of MHC-II genes is restricted to antigen presenting cells such as dendritic cells, macrophages and B cells. HLA antigen genes are the most polymorphic genes observed in the human genome (Rubinstein p., "HLA matching for bone marrow transfer-how much is there for HLA matching for bone marrow transplantation ]," N Engl J Med. [ new england journal of medicine ],2001,345: 1842-. The generation of "universal donor" cells compatible with any HLA genotype provides an alternative strategy that can address the associated economic costs of immune rejection and current approaches to immune evasion.

To generate this or such universal donor cell line, one prior approach has been to functionally disrupt the expression of MHC-I and MHC-II genes. This can be achieved, for example, by genetic disruption of the two genetic alleles encoding MHC-I light chain B2M. It is expected that the resulting B2M KO cell line and its derivatives will exhibit greatly reduced surface MHC-I, and thus reduced immunogenicity to allogeneic CD8+ T cells. Transcription activator-like effector nuclease (TALEN) targeting methods have been used to generate B2M-deficient hESC lines by deleting some of the nucleotides in exon 2 of the B2M gene (Lu, p. et al, "Generating immunogenic human embryonic cells by the disruption of β 2-microglobulin," Stem Cell Rev. [ Stem Cell review ]2013,9: 806-. Although the B2M targeting hESC lines appeared to be surface HLA-I deficient, they were found to still contain mRNA specific for B2M and MHC-I. Expression levels of B2M and MHC-I mRNA were comparable to those of non-targeted hESCs (both constitutive and IFN-g inducible). Therefore, there is a fear that: these TALEN B2M-targeted hESC lines likely express residual cell surface MHC-I that would be sufficient to cause immune rejection, such as has been observed in the case of B2M2/2 mouse cells that also express B2M mRNA (Gross, r. and rapupuoli, r. "pertussin toxin promoter sequences involved in regulation," Proc Natl Acad Sci [ american national academy of sciences ],1993,90: 3913-. Although the TALEN B2M targeted hESC line was not examined for off-target cleavage events, the occurrence of non-specific cleavage when using TALENs is still a significant problem that will bring about significant safety issues for their clinical use (Grau, J. et al, "TALENOFFER: genome-wide TALEN off-target prediction ]," Bioinformatics [ Bioinformatics ],2013,29: 2931-2932; Guilinger J. P. et al, "Broad specificity profiling of TALENs residues in engineered nucleic acids with engineered DNA-cleavage [ extensive specificity profiling of TALENS 435-mediated DNA-cleavage- ]," Nat Methods ]2014 11: 429). Furthermore, another report has generated IPS cells that escape allogeneic recognition by: the first B2M allele was knocked out and the HLA-E gene was knocked in at the second B2M allele, resulting in surface expression of HLA-E dimer or trimer in the absence of surface expression of HLA-A, HLA-B or HLA-C (Gornalusise, G.G. et al, "HLA-E-expressing pluripotent stem cells endothelial responses and lyses by NK cells [ HLA-E expressing pluripotent stem cells evading alloreactivity and NK cell lysis ]," Nature Biotechnology [ Nature Biotechnology ],2017,35,765 773).

A potential limitation of some of the above strategies is that MHC class I negative cells are susceptible to lysis by Natural Killer (NK) cells, since HLA molecules act as the primary ligand inhibitors of Natural Killer (NK) cells. Host NK cells have been shown to eliminate transplanted or implanted B2M-/-donor cells and to be similar in vitro in the case of MHC class I negative Human leukemia cell lines (Bix, M. et al, "Rejection of class I MHC-specific hematopoietic cells by irradated MHC-matched mice [ Rejection of class I MHC-deficient hematopoietic cells by irradiated MHC-matched mice ]," Nature [ Nature ],1991,349, 329-juice 331; Zarcone, D. et al, "Human leukemia-derived cell lines and complexes as models for structural analysis of native cell-mediated cytotoxicity ]," Cancer research [ 19874, 2682 ], 19882, 2682, 19847, et al). Thus, there is a need to improve previous approaches to generate universal donor cells capable of evading immune responses, as well as to generate cells that can survive implantation. As described herein, cell survival after implantation can be mediated by other pathways of the host independent of allograft rejection (e.g., hypoxia, reactive oxygen species, nutritional deprivation, and oxidative stress). As also described herein, genetic introduction of survival factors (genes and/or proteins) can aid in cell survival after implantation. As described herein, universal donor cell lines can combine properties that address both allograft rejection and post-implantation survival.

Disclosure of Invention

In some aspects, the disclosure includes methods of generating universal donor cells. The first method comprises genetically modifying a cell by: (i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and (ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor at a site that partially overlaps, completely overlaps, or is contained within the site of (i), thereby producing the universal donor cell. The second method comprises genetically modifying the cell by: (i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and (ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor (safe harbor) locus, thereby producing the universal donor cell. In some embodiments, the universal donor cell has increased immune evasion and/or cell survival compared to an unmodified cell.

In some embodiments, the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components of MHC-I or MHC-II complexes or transcriptional regulators is an MHC-I gene selected from HLA-A, HLA-B or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ or HLA-DR, or a gene selected from B2M, NLRC5, CIITA, RFX5, RFXAP or RFXANK.

In some embodiments, the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD 47. In some embodiments, the at least one polynucleotide encoding a tolerogenic factor is operably linked to an exogenous promoter. In some embodiments, the exogenous promoter is a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell type-specific promoter, optionally wherein the exogenous promoter is a CMV, EFla, PGK, CAG, or UBC promoter.

In some embodiments, the deletion and/or insertion of (i) is within or near B2M, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

In some embodiments, the method further comprises introducing at least one genetic modification that increases or decreases expression of at least one survival factor relative to an unmodified cell. In some embodiments, the at least one genetic modification that increases or decreases expression of at least one survival factor is an insertion of a polynucleotide encoding MANF that increases expression of MANF relative to the unmodified cell; or a deletion and/or insertion of at least one base pair within or near the gene encoding ZNF143, TXNIP, FOXO1 or JNK, which deletion and/or insertion reduces or eliminates expression of ZNF143, TXNIP, FOXO1 or JNK relative to the unmodified cell. In some embodiments, the polynucleotide encoding MANF is inserted into a harbor safe locus or into a gene belonging to MHC-I, MHC-II or to a transcriptional regulator of either MHC-I or MHC-II.

In some embodiments, genetically modifying the cell comprises delivering at least one RNA-guided endonuclease system to the cell. In some embodiments, the at least one RNA-guided endonuclease system is a CRISPR system comprising a CRISPR nuclease and a guide RNA. In some embodiments, the CRISPR nuclease is Cas9, Cpf1, a homolog thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof. In some embodiments, the CRISPR nuclease is streptococcus pyogenes (s. pyogenes) Cas 9. In some embodiments, the CRISPR nuclease comprises an N-terminal Nuclear Localization Signal (NLS) and/or a C-terminal NLS. In some embodiments, the CRISPR nuclease and the guide RNA are present in a 1:1 weight ratio.

In some embodiments, the deletion and/or insertion of (i) is within or near the B2M locus and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1. In some embodiments, the guide RNA for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOS: 1-3 or SEQ ID NOS: 35-44. In some embodiments, the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to the region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to the region to the right of the site in (i). In some embodiments, the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the site in (i). In some embodiments, (a) in the polynucleotide consists essentially of the nucleotide sequence of SEQ ID NO. 13, and (b) in the polynucleotide consists essentially of the nucleotide sequence of SEQ ID NO. 19. In some embodiments, the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

In some embodiments, the cell is a mammalian cell, optionally wherein the cell is a human cell. In some embodiments, the cell is a stem cell, optionally wherein the stem cell is a Pluripotent Stem Cell (PSC), an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem cell and progenitor cell (HSPC). In some embodiments, the cell is a differentiated cell or a somatic cell.

In some embodiments, the universal donor cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell. In some embodiments, the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells. In some embodiments, the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, renal cells, blood cells, or immune system cells.

In other aspects, the disclosure includes a plurality of universal donor cells produced by any of the methods disclosed herein. In some embodiments, the plurality of universal donor cells may be maintained for a time and under conditions sufficient for the cells to undergo differentiation.

In yet a further aspect, the disclosure provides a composition of cells comprising (I) at least one deletion in or near at least one gene encoding one or more MHC-1 and MHC-II human leukocyte antigens or components of an MHC-I or MHC-II complex or transcriptional regulators; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic deletion site of (i).

In additional aspects, the disclosure provides methods of administering any of the universal donor cells disclosed herein to a subject in need of treatment. In some embodiments, the methods comprise obtaining or having obtained universal donor cells as disclosed herein after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and administering the lineage-restricted progenitor cells or fully differentiated somatic cells to the subject. The disclosure also provides a method of obtaining cells for administration to a subject in need thereof. The method comprises (i) obtaining or having obtained any of the universal donor cells disclosed herein, and (ii) maintaining the universal donor cells for a time and under conditions sufficient for the cells to differentiate into lineage-restricted progenitor cells or fully differentiated somatic cells. In some embodiments, the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells. In some embodiments, the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, renal cells, blood cells, or immune system cells. In some embodiments, the subject is a human having, suspected of having, or at risk of having a disease, wherein the disease can be a genetically heritable disease.

While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof have been shown by way of example in the drawings and will herein be described in detail. It should be understood, however, that the drawings and detailed description presented herein are not intended to limit the disclosure to the particular embodiment disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the disclosure as defined by the appended claims.

Other features and advantages of the present invention will become apparent in the following detailed description of the preferred embodiments of the invention, which refers to the accompanying drawings.

Drawings

FIGS. 1A-1C provide specific gene editing strategies for immune evasion. Fig. 1A is a table depicting exemplary modifications in a given cell type for immune evasion. Fig. 1B provides an exemplary strategy for modifying the B2M locus. FIG. 1C provides an exemplary strategy for modifying HLA-A, HLA-B/C and CIITA loci.

FIG. 2 depicts a portion of the B2M gene (SEQ ID NO:6) and the positions of gRNAs (B2M-1, B2M-2, and B2M-3) for targeting exon 1. The positions of the PCR primers (B2MF2 and B2MR2) are also shown.

FIGS. 3A-3C show the results of screening for B2M gRNA in the TC-1133 iPSC cell line. Fig. 3A is a graph showing the frequency of insertion and deletion (indel) (insertion + deletion) for each B2M gRNA. B2M-1 gRNA provided an indel frequency of 2.5% ± 1.1% (n ═ 2). B2M-2 gRNA provided an indel frequency of 87.6% ± 14.1% (n ═ 2). B2M-3 gRNA provided an indel frequency of 63.9% ± 0.9% (n ═ 2). Fig. 3B and 3C are graphs showing a summary of the distribution of indel results for B2M-2 (fig. 3B) and B2M-3 (fig. 3C) grnas.

Fig. 4A-4B show the results of B2M Knockouts (KO) in ipscs using B2M-2 grnas. Fig. 4A is a diagram showing a summary of the distribution of insertion/deletion results for B2M-2 gRNA in iPSC. Fig. 4B presents clones homozygous for the B2M Knockout (KO) ("Homo") and heterozygous for the B2M KO ("Hets").

Fig. 5 shows the evaluation of B2M KO iPSC cloning. All three B2M KO clones tested showed reduced mRNA expression of B2M relative to wild-type or unmodified cells.

FIGS. 6A-6D show expression of B2M and HLA-ABC in B2M KO iPSC clones after 47 hours of treatment with interferon- γ. FIG. 6A presents expression in wild type cells. FIG. 6B shows expression in B2M KO clone C4. FIG. 6C presents expression in B2M KO clone C9. FIG. 6D shows expression in B2M KO clone C12.

FIGS. 7A-7D demonstrate the pluripotency of the B2M KO iPSC clone by evaluating the expression levels of SSEA-4 and TRA-1-60. FIG. 7A presents expression in wild type cells. FIG. 7B shows expression in B2M KO clone C4. FIG. 7C presents expression in B2M KO clone C9. FIG. 7D shows expression in B2M KO clone C12.

Fig. 8 shows a TIDE analysis of B2M gRNA cleavage in CyT49 cells. B2M gRNA-1, -2 or-3 was tested.

Figures 9A-9B show flow cytometric evaluation of B2M expression with and without IFN- γ in WT CyT49 cells (figure 9A) and edited CyT49 cells (figure 9B).

FIG. 10 shows the plasmid map of the B2M-CAGGS-PD-L1 donor vector for HDR.

FIG. 11 shows flow cytometric analysis of the pluripotency of B2M KO + PD-L1KI CyT49 stem cells. Derived clones were > 99% double positive against OCT4 and SOX2 (two transcription factors critical for pluripotency). IgG was used as a negative control.

FIGS. 12A-12B show flow cytometry analysis of WT CyT49 (FIG. 12A) and B2M KO/PD-L1 KI (FIG. 12B) derived stem cell clones. WT cells up-regulate B2M expression in response to IFN γ. The B2M KO/PD-L1 KI clone fully expressed PD-L1 and did not express B2M with or without IFN γ treatment. NT-1 as untreated. INTG-1 at 50ng/mL IFN γ treated 48 hr cells.

FIG. 13 shows the plasmid map of the B2M-CAGGS-HLA-E donor vector for HDR.

FIG. 14 shows flow cytometric analysis of the pluripotency of B2M KO/HLA-E KI CyT49 stem cells. Derived clones were > 99% double positive against OCT4 and SOX2 (two transcription factors critical for pluripotency). IgG was used as a negative control.

FIG. 15 shows flow cytometry analysis of WT CyT49 and B2M KO/HLA-E KI CyT49 stem cell clones. WT cells up-regulate HLA-A, B, C expression in response to IFN γ. The B2M KO/HLA-E KI clone did not express HLA-A, B, C with or without IFN γ treatment. IFN γ of 50 ng/mL. Cells were treated with IFN γ for 48 hours.

FIG. 16 shows flow cytometric analysis of HLA-E expression of B2M KO/HLA-E KI CyT49 stem cell clones. Unedited clones were used as controls for HLA-E expression.

FIG. 17 shows flow cytometry for FOXA2 and SOX17 at stage 1 (definitive endoderm) cells differentiated from wild-type, PD-L1KI/B2M KO or B2MKO hESC.

FIG. 18 shows the quantitative percentages of FOXA2 and SOX17 expression in stage 1 (definitive endoderm) cells differentiated from wild-type, PD-L1KI/B2M KO or B2M KO cells.

FIG. 19 shows the quantitative percentages of CHGA, PDX1 and NKX6.1 expression in stage 4 (PEC) cells differentiated from wild-type, B2M KO, PD-L1KI/B2M KO (V1A) or HLA-E KI/B2M KO (V2A) cells.

Fig. 20 shows the heterogeneous cell population at stage 4 (PEC).

FIGS. 21A-21B show expression of selected genes over the course of differentiation time in cells differentiated from wild-type, PD-L1KI/B2MKO or B2MKO cells (FIG. 21A) and differentiated from B2M KO/HLA-E KI (V2A) cells (FIG. 21B).

FIGS. 22A-22F show B2M and PD-L1 expression at the PEC stage in cells differentiated from wild-type, PD-L1KI/B2M KO or B2M KO cells. Fig. 22A shows B2M expression in wild type cells. Fig. 22B shows B2M expression in B2M KO cells. FIG. 22C shows B2M expression in PD-L1KI/B2M KO cells. FIG. 22D shows PD-L1 expression in wild type cells. FIG. 22E shows PD-L1 expression in B2M KO cells. FIG. 22F shows PD-L1 expression in PD-L1KI/B2M KO cells.

FIGS. 23A-23F show MHC class I and II expression at the PEC stage in cells differentiated from wild-type, PD-L1KI/B2M KO or B2M KO cells. Figure 23A shows MHC class I expression in wild type cells. Figure 23B shows MHC class I expression in B2M KO cells. FIG. 23C shows MHC class I expression in PD-L1KI/B2M KO cells. Figure 23D shows MHC class II PD-L1 expression in wild type cells. Figure 23E shows MHC class II expression in B2M KO cells. FIG. 23F shows MHC class II expression in PD-L1KI/B2M KO cells.

FIGS. 24A-24D show flow cytometry analysis of T cell activation using the CFSE proliferation assay. Human primary CD3+ T cells were co-incubated with PECs derived from WT, B2M KO or B2M KO/PD-L1 KI CyT49 clone. Fig. 24A shows activation in wild type cells. FIG. 24B shows activation in PD-L1KI/B2M KO cells. Fig. 24C shows activation in B2M KO cells. Fig. 24D summarizes T cell activation in various cells. One-way anova with the "CFSE-T alone" set as control (α ═ 0.05, using Dunnett's multiple comparison test). P < 0.05; p < 0.01; p < 0.001; p < 0.0001. n.s. not significant.

Detailed Description

I. Definition of

Deletion (c): as used herein, the term "deletion" used interchangeably with the terms "genetic deletion" or "knockout" generally refers to a genetic modification in which a site or region of genomic DNA is removed by any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of the genomic DNA. Any number of nucleotides may be deleted. In some embodiments, the deletion involves removing at least one, at least two, at least three, at least four, at least five, at least ten, at least fifteen, at least twenty, or at least 25 nucleotides. In some embodiments, a deletion involves removing 10-50, 25-75, 50-100, 50-200, or more than 100 nucleotides. In some embodiments, the deletion involves removal of the entire target gene, e.g., the B2M gene. In some embodiments, the deletion involves removal of a portion of the target gene, e.g., all or a portion of the promoter and/or coding sequence of the B2M gene. In some embodiments, the deletion involves removal of a transcriptional regulatory factor, such as a promoter region, of the target gene. In some embodiments, the deletion involves removing all or a portion of the coding region such that the product normally expressed by the coding region is no longer expressed, expressed in truncated form, or expressed at a reduced level. In some embodiments, the deletion results in a decrease in expression of the gene relative to an unmodified cell.

Endonucleases: as used herein, the term "endonuclease" generally refers to an enzyme that cleaves phosphodiester bonds within a polynucleotide. In some embodiments, the endonuclease specifically cleaves phosphodiester bonds within the DNA polynucleotide. In some embodiments, the endonuclease is a Zinc Finger Nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Homing Endonuclease (HE), a meganuclease, MegaTAL, or a CRISPR-associated endonuclease. In some embodiments, the endonuclease is an RNA-guided endonuclease. In certain aspects, the RNA-guided endonuclease is a CRISPR nuclease, such as a type II CRISPR Cas9 endonuclease or a type V CRISPR Cpf1 endonuclease. In some embodiments, the endonuclease is a naturally occurring or recombinant form of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7 (also known as Csn 7 and Csx 7), Cas100, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csb 7, Csx 7, CsaX 7, Csx 36f 7, csxf 7, Csx 7, Csf 7, Csx 7, Csf, a7, a codon or a codon-optimized forms thereof, or a recombinant forms thereof. In some embodiments, the endonuclease can introduce one or more Single Strand Breaks (SSBs) and/or one or more Double Strand Breaks (DSBs).

Genetic modification: as used herein, the term "genetically modified" generally refers to a genomic DNA site that has been genetically edited or manipulated using any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of the genomic DNA. Exemplary genetic modifications include insertions, deletions, duplications, inversions, and translocations, and combinations thereof. In some embodiments, the genetic modification is a deletion. In some embodiments, the genetic modification is an insertion. In other embodiments, the genetic modification is an insertion-deletion mutation (or indel) that shifts the reading frame of the target gene, resulting in an altered or absent gene product.

Guide rna (grna): as used herein, the term "guide RNA" or "gRNA" generally refers to a short ribonucleic acid that can interact with, e.g., bind to, an endonuclease and bind to or hybridize to a target genomic site or region. In some embodiments, the gRNA is a single molecule guide rna (sgrna). In some embodiments, the gRNA may comprise a spacer extension region. In some embodiments, the gRNA may comprise a tracrRNA extension. In some embodiments, the gRNA is single stranded. In some embodiments, the gRNA comprises naturally occurring nucleotides. In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, a chemically modified gRNA is a gRNA that comprises at least one nucleotide with a chemical modification (e.g., a 2' -O-methyl sugar modification). In some embodiments, a chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises a 2' -O-methyl-phosphorothioate residue. In some embodiments, the gRNA may be pre-complexed with a DNA endonuclease.

Inserting: as used herein, the term "insertion" used interchangeably with the terms "genetic insertion" or "knock-in" generally refers to a genetic modification in which a polynucleotide is introduced or added into a site or region of genomic DNA by any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. In some embodiments, the insertion can occur within or near a site of the genomic DNA that is already the site of the previous genetic modification (e.g., deletion or insertion-deletion mutation). In some embodiments, the insertion occurs at a site of the genomic DNA that partially overlaps, completely overlaps, or is contained within a site of a previous genetic modification (e.g., a deletion or an insertion-deletion mutation). In some embodiments, the insertion occurs at a safe harbor locus. In some embodiments, the insertion involves introducing a polynucleotide encoding a protein of interest. In some embodiments, the insertion involves introducing a polynucleotide encoding a tolerogenic factor. In some embodiments, the insertion involves introducing a polynucleotide encoding a survival factor. In some embodiments, the insertion involves introducing an exogenous promoter, such as a constitutive promoter (e.g., CAG promoter). In some embodiments, the insertion involves introducing a polynucleotide encoding a non-coding gene. Typically, the polynucleotide to be inserted is flanked by sequences (e.g., homology arms) that have significant sequence homology to genomic DNA at or near the insertion site.

Major histocompatibility complex class I (MHC-I): as used herein, the term "major histocompatibility complex class I" or "MHC-I" generally refers to a class of biomolecules found on the cell surface of all nucleated cells in vertebrates (including mammals, e.g., humans); and functions to display peptides of non-self or foreign antigens (e.g., proteins) from within the cell (i.e., cytosol) to cytotoxic T cells (e.g., CD8+ T cells) in order to stimulate an immune response. In some embodiments, the MHC-I biomolecule is an MHC-I gene or an MHC-I protein. Complexing of MHC-I proteins with beta-2 microglobulin (B2M) is required for cell surface expression of all MHC-I proteins. In some embodiments, reducing expression of MHC-I Human Leukocyte Antigen (HLA) relative to unmodified cells involves a reduction (or decrease) in MHC-I gene expression. In some embodiments, reducing expression of MHC-I Human Leukocyte Antigens (HLA) relative to unmodified cells involves a reduction (or decrease) in cell surface expression of MHC-I proteins. In some embodiments, the MHC-I biomolecule is HLA-A (NCBI gene ID No. 3105), HLA-B (NCBI gene ID No. 3106), HLA-C (NCBI gene ID No. 3107), or B2M (NCBI gene ID No. 567).

Major histocompatibility complex class II (MHC-II): as used herein, the term "major histocompatibility complex class II" or "MHC-II" generally refers to a class of biomolecules that are typically found on the cell surface of antigen presenting cells in vertebrates (including mammals, e.g., humans); and functions to display peptides of non-self or foreign antigens (e.g., proteins) from the outside of the cell (extracellularly) to cytotoxic T cells (e.g., CD8+ T cells) in order to stimulate an immune response. In some embodiments, the antigen presenting cell is a dendritic cell, macrophage, or B cell. In some embodiments, the MHC-II biomolecule is an MHC-II gene or an MHC-II protein. In some embodiments, reducing expression of MHC-II Human Leukocyte Antigen (HLA) relative to unmodified cells involves a reduction (or decrease) in MHC-II gene expression. In some embodiments, reducing expression of MHC-II Human Leukocyte Antigens (HLA) relative to unmodified cells involves a reduction (or decrease) in cell surface expression of MHC-II proteins. In some embodiments, the MHC-II biomolecule is HLA-DPA (NCBI gene ID No.: 3113), HLA-DPB (NCBI gene ID No.: 3115), HLA-DMA (NCBI gene ID No.: 3108), HLA-DMB (NCBI gene ID No.: 3109), HLA-DOA (NCBI gene ID No.: 3111), HLA-DOB (NCBI gene ID No.: 3112), HLA-DQA (NCBI gene ID No.: 3117), HLA-DQB (NCBI gene ID No.: 3119), HLA-DRA (NCBI gene ID No.: 3122), or HLA-DRB (NCBI gene ID No.: 3123).

A polynucleotide: as used herein, the term "polynucleotide" used interchangeably with the term "nucleic acid" generally refers to a biological molecule comprising two or more nucleotides. In some embodiments, the polynucleotide comprises at least two, at least five, at least ten, at least twenty, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides. The polynucleotide may be a DNA or RNA molecule or a hybrid DNA/RNA molecule. The polynucleotide may be single-stranded or double-stranded. In some embodiments, the polynucleotide is a site or region of genomic DNA. In some embodiments, the polynucleotide is an endogenous gene contained within the genome of an unmodified cell or a universal donor cell. In some embodiments, the polynucleotide is an exogenous polynucleotide that is not integrated into the genomic DNA. In some embodiments, the polynucleotide is an exogenous polynucleotide integrated into the genomic DNA. In some embodiments, the polynucleotide is a plasmid or an adeno-associated viral vector. In some embodiments, the polynucleotide is a circular or linear molecule.

Safe harbor locus: as used herein, the term "safe harbor locus" generally refers to any location, site, or region of genomic DNA that may be capable of accommodating genetic insertion into the location, site, or region without adversely affecting the cell. In some embodiments, the safe harbor locus is an intragenic or extragenic region. In some embodiments, the safe harbor locus is a region of genomic DNA that is normally transcriptionally silent. In some embodiments, the safe harbor locus is the AAVS1(PPP 1R 12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp (a), Pcsk9, Serpina1, TF, or TTR locus. In some embodiments, the Safe harbor locus is described in Sadelain, m. et al, "Safe carbohydrates for the integration of new DNA in the human genome ]," Nature Reviews Cancer [ natural Cancer review ],2012, vol 12, p 51-58.

Safety switch: as used herein, the term "safety switch" generally refers to a biomolecule that causes a cell to undergo apoptosis. In some embodiments, the safety switch is a protein or a gene. In some embodiments, the safety switch is a suicide gene. In some embodiments, a safety switch (e.g., herpes simplex virus thymidine kinase (HSV-tk)) causes cells to undergo apoptosis through metabolic prodrugs (e.g., ganciclovir). In some embodiments, the presence of overexpression of the safety switch alone causes the cell to undergo apoptosis. In some embodiments, the safety switch is a p 53-based molecule, HSV-tk, or inducible caspase-9.

Subject: as used herein, the term "subject" refers to a mammal. In some embodiments, the subject is a non-human primate or rodent. In some embodiments, the subject is a human. In some embodiments, the subject has, is suspected of having, or is at risk for a disease or disorder. In some embodiments, the subject has one or more symptoms of a disease or disorder.

Survival factor: as used herein, the term "survival factor" generally refers to a protein (e.g., expressed by a polynucleotide as described herein) that, when increased or decreased in a cell, enables the cell (e.g., a universal donor cell) to survive at a higher survival rate after transplantation or implantation into a host subject relative to unmodified cells. In some embodiments, the survival factor is a human survival factor. In some embodiments, the survival factor is a member of a key pathway involved in cell survival. In some embodiments, key pathways involved in cell survival are associated with hypoxia, active oxygen, nutrient deprivation, and/or oxidative stress. In some embodiments, the genetic modification (e.g., deletion or insertion) of the at least one survival factor enables the universal donor cell to survive for a longer period of time after implantation than an unmodified cell, e.g., for a period of time that is at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold longer. In some embodiments, the survival factor is ZNF143(NCBI gene ID No.: 7702), TXNIP (NCBI gene ID No.: 10628), FOXO1(NCBI gene ID No.: 2308), JNK (NCBI gene ID No.: 5599), or MANF (NCBI gene ID No.: 7873). In some embodiments, the survival factor is inserted into a cell (e.g., a universal donor cell). In some embodiments, the survival factor is deleted from the cell (universal donor cell). In some embodiments, insertion of a polynucleotide encoding MANF enables cells (e.g., universal donor cells) to survive with a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, a deletion or insertion-deletion mutation within or near the ZNF143, TXNIP, FOXO1, or JNK gene enables the cells (e.g., universal donor cells) to survive in higher survival relative to unmodified cells after transplantation or implantation into a host subject.

Tolerogenic factors: as used herein, the term "tolerogenic factor" generally refers to a protein (e.g., expressed from a polynucleotide as described herein) that, when increased or decreased in a cell, enables the cell (e.g., a universal donor cell) to inhibit or escape immune rejection at a higher rate relative to unmodified cells upon transplantation or implantation into a host subject. In some embodiments, the tolerogenic factor is a human tolerogenic factor. In some embodiments, the genetic modification of the at least one tolerogenic factor (e.g., insertion or deletion of the at least one tolerogenic factor) enables a cell (e.g., a universal donor cell) to inhibit or escape immune rejection after implantation at a rate that is at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold higher than an unmodified cell. In some embodiments, the tolerogenic factor is HLA-E (NCBI gene ID No: 3133), HLA-G (NCBI gene ID No: 3135), CTLA-4(NCBI gene ID No: 1493), CD47(NCBI gene ID No: 961), or PD-L1(NCBI gene ID No: 29126). In some embodiments, the tolerogenic factors are inserted into a cell (e.g., a universal donor cell). In some embodiments, the tolerogenic factors are deleted from the cell (e.g., universal donor cell). In some embodiments, insertion of a polynucleotide encoding HLA-E, HLA-G, CTLA-4, CD47, and/or PD-L1 enables the cell (e.g., universal donor cell) to inhibit or escape immune rejection after transplantation or implantation into a host subject.

Transcriptional regulators of MHC-I or MHC-II: as used herein, the term "transcriptional regulator of MHC-I or MHC-II" generally refers to a biological molecule that regulates (e.g., increases or decreases) the expression of MHC-I and/or MHC-II human leukocyte antigens. In some embodiments, the biomolecule is a polynucleotide (e.g., a gene) or a protein. In some embodiments, a transcriptional regulator of MHC-I or MHC-II will increase or decrease cell surface expression of at least one MHC-I or MHC-II protein. In some embodiments, a transcriptional regulator of MHC-I or MHC-II will increase or decrease the expression of at least one MHC-I or MHC-II gene. In some embodiments, the transcriptional regulatory factor is CIITA (NCBI gene ID No.: 4261) or NLRC5(NCBI gene ID No.: 84166). In some embodiments, the deletion or reduction in CIITA or NLRC5 expression reduces the expression of at least one MHC-I or MHC-II gene.

Universal donor cell: as used herein, the term "universal donor cell" generally refers to a genetically modified cell that is less susceptible to allograft rejection during cell transplantation and/or exhibits increased survival after transplantation relative to an unmodified cell. In some embodiments, the genetically modified cell as described herein is a universal donor cell. In some embodiments, the universal donor cell has increased immune evasion and/or cell survival compared to an unmodified cell. In some embodiments, the universal donor cell has increased cell survival compared to an unmodified cell. In some embodiments, the universal donor cell can be a stem cell. In some embodiments, the universal donor cell may be an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem or progenitor cell (HSPC). In some embodiments, the universal donor cell can be a differentiated cell. In some embodiments, the universal donor cell can be a somatic cell (e.g., an immune system cell). In some embodiments, the universal donor cell is administered to the subject. In some embodiments, the universal donor cell is administered to a subject having, suspected of having, or at risk of having a disease. In some embodiments, the universal donor cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell. In some embodiments, the lineage-restricted progenitor cell is a pancreatic endoderm progenitor cell, a pancreatic endocrine progenitor cell, an mesenchymal progenitor cell, a muscle progenitor cell, a blast cell, or a neural progenitor cell. In some embodiments, the fully differentiated somatic cell is an endocrine cell such as a pancreatic beta cell, an epithelial cell, an endodermal cell, a macrophage, a hepatocyte, an adipocyte, a renal cell, a blood cell, or an immune system cell.

Unmodified cells: as used herein, the term "unmodified cell" refers to a cell that has not been genetically modified by a polynucleotide or gene involved in a transcriptional regulator, survival factor and/or tolerogenic factor encoding MHC-I, MHC-I, MHC-I or MHC-II. In some embodiments, the unmodified cell may be a stem cell. In some embodiments, the unmodified cell may be an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem or progenitor cell (HSPC). In some embodiments, the unmodified cell may be a differentiated cell. In some embodiments, the unmodified cells may be selected from somatic cells (e.g., immune system cells, such as T cells, e.g., CD8+ T cells). If the universal donor cell is compared "to an unmodified cell", the universal donor cell and the unmodified cell are the same cell type or have a common parental cell line, e.g., the universal donor iPSC is compared to the unmodified iPSC.

Within or near the gene: as used herein, the term "within or adjacent to a gene" refers to a site or region of genomic DNA that is an intron or exon component of the gene or that is located proximally to the gene. In some embodiments, a site of genomic DNA is within a gene if it comprises at least a portion of an intron or exon of the gene. In some embodiments, the site of genomic DNA located near a gene may be at the 5 'or 3' end of the gene (e.g., the 5 'or 3' end of the coding region of the gene). In some embodiments, the site of genomic DNA located near a gene may be a promoter region or a repressor region that regulates expression of the gene. In some embodiments, the site of the genomic DNA located near the gene may be on the same chromosome as the gene. In some embodiments, a site or region of genomic DNA is near a gene if it is within 50Kb, 40Kb, 30Kb, 20Kb, 10Kb, 5Kb, 1Kb of or closer to the 5 'or 3' end of the gene (e.g., the 5 'or 3' end of the coding region of the gene).

Genome editing method

Genome editing generally refers to the process of modifying a genomic nucleotide sequence, preferably in an accurate or predetermined manner. In some embodiments, genome editing methods (e.g., CRISPR-endonuclease systems) as described herein can be used to genetically modify cells as described herein, e.g., to generate universal donor cells. In some embodiments, genome editing methods (e.g., CRISPR-endonuclease systems) as described herein can be used to genetically modify a cell as described herein, e.g., to introduce at least one genetic modification within or near at least one gene that reduces the expression of one or more MHC-I and/or MHC-II human leukocyte antigens or other components of an MHC-I or MHC-II complex relative to an unmodified cell; to introduce at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and/or to introduce at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to an unmodified cell.

Examples of genome editing methods described herein include methods that use site-directed nucleases to cleave deoxyribonucleic acid (DNA) at a precise target location in the genome, thereby generating a single-stranded or double-stranded DNA break at a specific location within the genome. Such breaks can and regularly are repaired by natural endogenous cellular processes such as Homology Directed Repair (HDR) and non-homologous end joining (NHEJ), as described in Cox et al, "Therapeutic genome editing: prospects and galleries [ Therapeutic genome editing: prospect and challenge ], ", Nature Medicine 2015,21(2), 121-31. These two major DNA repair processes consist of a series of alternative pathways. NHEJ is directly ligated to DNA ends resulting from double strand breaks, sometimes with missing or added nucleotide sequences, which can disrupt or enhance gene expression. HDR uses homologous or donor sequences as templates to insert a defined DNA sequence at a breakpoint. Homologous sequences may be in an endogenous genome (e.g., a sister chromatid). Alternatively, the donor sequence may be an exogenous polynucleotide, such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, duplex oligonucleotide, or virus, that has regions of high homology to the locus cleaved by the nuclease (e.g., the left and right homology arms), but may also contain additional sequences or sequence changes (including deletions that may be incorporated into the cleaved target locus). A third repair mechanism may be microhomology-mediated end joining (MMEJ), also known as "surrogate NHEJ", whose genetic result is similar to NHEJ in that small deletions and insertions may occur at the cleavage site. MMEJ can use homologous sequences of a few base pairs flanking the DNA break site to drive more favorable DNA end-joining repair results, and recent reports further elucidate the molecular mechanism of this process; see, e.g., Cho and Greenberg, Nature [ Nature ],2015,518,174-76; kent et al, Nature Structural and Molecular Biology 2015,22(3): 230-7; Mateos-Gomez et al, Nature [ Nature ],2015,518,254-57; ceccaldi et al, Nature [ Nature ],2015,528,258-62. In some cases, possible repair outcomes can be predicted based on analysis of potential micro-homology at DNA break sites.

Each of these genome editing mechanisms can be used to generate the desired genetic modification. One step in the genome editing process may be to create one or two DNA breaks, either double-stranded breaks or two single-stranded breaks, in the target locus in the vicinity of the intended mutation site. As described and shown herein, this can be achieved via the use of endonucleases.

CRISPR endonuclease system

The CRISPR-endonuclease system is a naturally occurring defense mechanism in prokaryotes that has been reused as an RNA-guided DNA targeting platform for gene editing. CRISPR systems include type I, II, III, IV, V and VI systems. In some aspects, the CRISPR system is a type II CRISPR/Cas9 system. In other aspects, the CRISPR system is a type V CRISPR/Cprf system. CRISPR systems rely on a DNA endonuclease (e.g., Cas9) and two non-coding RNAs (criprpr RNA (crrna)) and a trans-activating RNA (tracrrna)) to target cleavage of DNA.

crRNA drives sequence recognition and specificity of CRISPR-endonuclease complexes by watson-crick base pairing, typically with a sequence of about 20 nucleotides (nt) in the target DNA. Altering the 5' 20nt sequence in crRNA allows targeting of the CRISPR-endonuclease complex to a specific locus. If the target sequence is followed by a specific short DNA motif (sequence NGG), called a Protospacer Adjacent Motif (PAM), the CRISPR-endonuclease complex binds only to DNA sequences containing matches to the first 20nt sequence of a single guide rna (sgrna).

tracrRNA hybridizes to the 3' end of the crRNA to form an RNA duplex structure that binds to an endonuclease to form a catalytically active CRISPR-endonuclease complex, which can then cleave the target DNA.

Once the CRISPR-endonuclease complex binds to the DNA at the target site, two separate nuclease domains within the endonuclease each cleave one of the DNA strands three bases upstream of the PAM site, leaving a double-stranded break (DSB) where the two strands of DNA terminate in base pairs (blunt ends).

In some embodiments, the endonuclease is Cas9 (CRISPR-associated protein 9). In some embodiments, the Cas9 endonuclease is from streptococcus pyogenes, although other Cas9 homologs may be used, such as staphylococcus aureus (s.aureus) Cas9, neisseria meningitidis (n.meningidis) Cas9, streptococcus thermophilus (s.thermophilus) CRISPR1 Cas9, streptococcus thermophilus CRISPR 3 Cas9, or treponema denticola (t.denticola) Cas 9. In other cases, the CRISPR endonuclease is Cpf1, for example, a bacteria of the family lachnospiraceae (L. bacterium) ND2006 Cpfl or an aminoacidococcus species (Acidaminococcus sp.) BV3L6 Cpfl. In some embodiments, the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7 (also referred to as Csn 7 and Csx 7), Cas100, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csb 7, Csx 36f 7, Csx 36x 7, Csx 36f, Csf 7, Csx 7, Csf 7, or Cpf. In some embodiments, wild-type variants may be used. In some embodiments, modified forms of the foregoing endonucleases (e.g., homologs thereof, recombination of naturally occurring molecules thereof, codon optimization thereof, or modified forms thereof) can be used.

The CRISPR nuclease can be linked to at least one Nuclear Localization Signal (NLS). The at least one NLS can be located at or within 50 amino acids of the amino terminus of the CRISPR nuclease, and/or the at least one NLS can be located at or within 50 amino acids of the carboxy terminus of the CRISPR nuclease.

Exemplary CRISPR/Cas polypeptides include Cas9 polypeptides as disclosed in Fonfara et al, "Phylogeny of Cas9 definitions functional exchange of dual-RNA and Cas9 amplitude reporting type II CRISPR-Cas systems [ Phylogeny of Cas9 determines functional interchangeability of dual-RNA and Cas9 in an orthologous type II CRISPR-Cas system ]," Nucleic Acids Research [ Nucleic Acids Research ],2014,42: 2577-. Since the discovery of Cas genes, CRISPR/Cas gene naming systems have been extensively rewritten. Fonfara et al also provide PAM sequences for Cas9 polypeptides from various species.

Zinc finger nucleases

Zinc Finger Nucleases (ZFNs) are modular proteins consisting of an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease FokI. Since FokI functions only as a dimer, a pair of ZFNs must be engineered to bind to homologous target "half-site" sequences on opposite DNA strands, and the precise spacing between them enables the formation of catalytically active FokI dimers. Following dimerization of the fokl domains, which are not sequence specific per se, DNA double strand breaks occur between ZFN half-sites as an initial step in genome editing.

The DNA-binding domain of each ZFN is typically composed of 3-6 zinc fingers of the abundant Cys2-His2 architecture, each finger recognizing primarily a nucleotide triplet on one strand of the target DNA sequence, although strand-spanning interactions with the fourth nucleotide may also be important. Changes in the amino acid of a finger in a position that makes critical contact with DNA will alter the sequence specificity of the given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12bp target sequence that is a triplet-preferred composite of each finger contribution, but triplet preference may be affected to varying degrees by adjacent fingers. An important aspect of ZFNs is that they can be easily retargeted to almost any genomic address with only a single finger modification. In most applications of ZFNs, proteins with 4-6 fingers are used, recognizing 12-18bp, respectively. Thus, a pair of ZFNs will typically recognize a 24-36bp combined target sequence (excluding the typical 5-7bp spacer between half-sites). The binding sites may be further separated by larger spacers, including 15-17 bp. Assuming that repeats or gene homologues are excluded from the design process, the target sequence of that length may be unique in the human genome. However, ZFN protein-DNA interactions are not absolute in their specificity, so off-target binding and cleavage events do occur, either as heterodimers between two ZFNs or as homodimers of one or the other of the ZFNs. By engineering the dimerization interface of the FokI domains to produce "positive" and "negative" variants (also called obligate heterodimer variants, which can only dimerize with each other, but not with itself), the latter possibility is effectively eliminated. Favoring obligate heterodimers prevents homodimer formation. This greatly improves the specificity of ZFNs, as well as any other nucleases that employ these FokI variants.

A variety of ZFN-based systems have been described in the art, whose modifications are reported periodically, and a number of references describe rules and parameters for guiding ZFN design; see, e.g., Segal et al, Proc Natl Acad Sci [ Proc. Natl. Acad. Sci. USA ],199996(6): 2758-63; dreier B et al, J Mol Biol. [ J. Mol. Biol. ],2000,303(4): 489-; liu Q et al, J Biol Chem [ J.Biochem ],2002,277(6) 3850-6; dreier et al, J Biol Chem. [ J. Biochem. ],2005,280(42): 35588-97; and Dreier et al, J Biol Chem [ J. Biochem ]2001,276(31): 29466-78.

Transcription activator-like effector nucleases (TALEN)

TALENs represent another form of modular nuclease in which an engineered DNA binding domain is linked to a FokI nuclease domain as with ZFNs, and a pair of TALENs act in tandem to achieve targeted DNA cleavage. The main difference from ZFNs lies in the nature of the DNA binding domain and the associated target DNA sequence recognition characteristics. TALEN DNA binding domains are derived from TALE proteins originally described in the plant bacterial pathogen Xanthomonas sp. TALEs consist of a tandem array of 33-35 amino acid repeats, each of which recognizes a single base pair in a target DNA sequence, typically up to 20bp in length, giving a total target sequence length of up to 40 bp. The nucleotide specificity of each repeat sequence was determined by the Repeat Variable Diresidue (RVD) which comprises only two amino acids at positions 12 and 13. Guanine, adenine, cytosine, and thymine bases are primarily recognized by four RVDs: respectively Asn-Asn, Asn-Ile, His-Asp and Asn-Gly. This constitutes a much simpler recognition code than zinc fingers and therefore has advantages over zinc fingers in terms of nuclease design. However, like ZFNs, the protein-DNA interaction of TALENs is also not absolute in its specificity, and TALENs also benefit from using obligate heterodimer variants of fokl domains to reduce off-target activity.

Additional variants of FokI domains have been generated that are inactive in their catalytic function. If half of the TALEN or ZFN pair contains an inactivated FokI domain, only single-stranded DNA cleavage (nicking) will occur at the target site, and no DSB will occur. The results are comparable to using CRISPR/Cas9 or CRISPR/Cpf1 "nickase" mutants (where one of the Cas9 cleavage domains has been inactivated). DNA nicking can be used to drive genome editing by HDR, but is less efficient than DSB. Unlike DSBs, the main benefit is that off-target incisions are repaired quickly and accurately, whereas DSBs are susceptible to NHEJ-mediated error repair.

Various TALEN-based systems have been described in the art and modifications thereof are reported periodically; see, e.g., Boch, Science [ Science ], 2009326 (5959): 1509-12; mak et al, Science [ Science ],2012,335(6069) 716-9; and Moscou et al, Science [ Science ],2009,326(5959): 1501. There have been several groups that describe the use of TALENs based on the "gold Gate" platform or cloning scheme; see, e.g., Cerak et al, Nucleic Acids Res. [ Nucleic Acids research ],2011,39(12): e 82; li et al, Nucleic Acids Res. [ Nucleic Acids research ],2011,39(14): 6315-25; weber et al, PLoS One. [ public science library. synthesis ],2011,6(2): e 16765; wang et al, J Genet Genomics [ J. Gen. Genomics ],2014,41(6): 339-47; and Cerak T et al, Methods Mol Biol. [ Methods of molecular biology ],20151239: 133-59.

Homing endonucleases

Homing Endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and generally cleave DNA with high specificity at a unique site in the genome. There are at least six known HE families classified by their structure, including GIY-YIG, His-Cis box, H-N-H, PD- (D/E) xK, and Vsr-like, which are derived from a variety of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and bacteriophages. As with ZFNs and TALENs, HE can be used to generate DSBs at a target locus as an initial step in genome editing. In addition, some natural and engineered HEs cleave only a single strand of DNA, thereby acting as site-specific nickases. The large target sequences of HE and the specificity provided by HE make them attractive candidates for generating site-specific DSBs.

Various HE-based systems have been described in the art and modifications thereof are reported periodically; see, for example, the following for reviews: steentoft et al, Glycobiology 2014,24(8): 663-80; belfort and Bonocora, Methods Mol Biol. [ Methods of molecular biology ],2014,1123: 1-26; and Hafez and Hausner, Genome, 2012,55(8): 553-69.

MegaTAL/Tev-mTALEN/MegaTev

As additional examples of hybrid nucleases, the MegaTAL and Tev-mTALEN platforms utilize the fusion of the TALE DNA binding domain and HE with catalytic activity, while utilizing both tunable DNA binding and specificity of TALE, as well as the cleavage sequence specificity of HE; see, e.g., Boissel et al, Nucleic Acids Res. [ Nucleic Acids research ],2014,42: 2591-; kleinstimer et al, G3,2014,4: 1155-65; and Boissel and Scharenberg, Methods mol. biol. [ Methods of molecular biology ],2015,1239: 171-96.

In another variation, the MegaTev architecture is a fusion of meganuclease (Mega) with a nuclease domain derived from the GIY-YIG homing endonuclease I-TevI (Tev). These two active sites are about 30bp apart on the DNA substrate and produce two DSBs with incompatible sticky ends; see, e.g., Wolfs et al, Nucleic Acids Res [ Nucleic Acids research ],2014,42, 8816-29. It is envisioned that other combinations of existing nuclease-based methods will be developed and can be used to achieve targeted genomic modifications as described herein.

dCas9-FokI or dCpf1-Fok1 and other nucleases

Combining the structural and functional properties of the nuclease platform described above provides an additional method of genome editing that may overcome some of the inherent drawbacks. For example, CRISPR genome editing systems typically use a single Cas9 endonuclease to generate DSBs. The specificity of targeting is driven by a sequence of 20 or 24 nucleotides in the guide RNA that undergoes watson-crick base pairing with the target DNA (in the case of Cas9 from streptococcus pyogenes, plus an additional 2 bases in the adjacent NAG or NGG PAM sequence). This sequence is long enough to be unique in the human genome, however, the specificity of the RNA/DNA interaction is not absolute and can sometimes tolerate significant confounding, especially at the 5' half of the target sequence, which effectively reduces the number of bases driving specificity. One solution to this is to completely inactivate Cas9 or Cpf1 catalytic functions (retaining only RNA-guided DNA binding functions), while fusing the fokl domain to the inactivated Cas 9; see, e.g., Tsai et al, Nature Biotech [ Nature. Biotechnology ],2014,32: 569-76; and Guilinger et al, Nature Biotech. [ Nature Biotechnology ],2014,32: 577-82. Since fokl must dimerize to become catalytically active, two guide RNAs are required to tether the two fokl fusions in close proximity to form dimers and cleave DNA. This essentially doubles the number of bases in the combined target site, thereby increasing the stringency targeted by the CRISPR-based system.

As another example, fusion of a TALE DNA binding domain to a HE with catalytic activity (e.g., I-TevI) takes advantage of both the tunable DNA binding and specificity of TALEs, as well as the cleavage sequence specificity of I-TevI, and is expected to further reduce off-target cleavage.

RNA-guided endonucleases

An RNA-guided endonuclease system as used herein can comprise an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to a wild-type exemplary endonuclease (e.g., Cas9 from streptococcus pyogenes, US2014/0068797 sequence ID No.8 or Sapranauskas et al, Nucleic Acids Res [ Nucleic Acids research ],39(21):9275-9282 (2011)). The endonuclease can comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity over 10 consecutive amino acids to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra). The endonuclease may comprise at most: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity over 10 consecutive amino acids to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra). The endonuclease may comprise at least: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra) over 10 contiguous amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise at most: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra) over 10 contiguous amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise at least: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra) over 10 contiguous amino acids in the RuvC nuclease domain of the endonuclease. The endonuclease may comprise at most: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from streptococcus pyogenes, supra) over 10 contiguous amino acids in the RuvC nuclease domain of the endonuclease.

Endonucleases can include modified forms of wild-type exemplary endonucleases. Modified forms of the wild-type exemplary endonuclease can include mutations that reduce the nucleolytic activity of the endonuclease. Modified forms of wild-type exemplary endonucleases can have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity of wild-type exemplary endonucleases (e.g., Cas9 from streptococcus pyogenes, supra). Modified forms of endonucleases may not have significant nucleolytic activity. When the endonuclease is a modified form that does not have significant nucleolytic activity, it is referred to herein as "enzymatically inactive".

Contemplated mutations may include substitutions, additions and deletions or any combination thereof. The mutation converts the mutated amino acid to alanine. The mutation converts the mutated amino acid into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). The mutation converts the mutated amino acid to an unnatural amino acid (e.g., selenomethionine). The mutation converts the mutated amino acid into an amino acid mimetic (e.g., a phosphate mimetic). The mutation may be a conservative mutation. For example, the mutation converts the mutated amino acid into an amino acid that resembles the size, shape, charge, polarity, conformation, and/or rotamer of the mutated amino acid (e.g., cysteine/serine mutation, lysine/asparagine mutation, histidine/phenylalanine mutation). The mutation may cause a shift in the reading frame and/or the generation of a premature stop codon. Mutations can cause alterations in the regulatory regions of a gene or locus that affect the expression of one or more genes.

Guide RNA

The present disclosure provides guide RNAs (grnas) that can direct the activity of a relevant endonuclease to a specific target site within a polynucleotide. The guide RNA can comprise at least one spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat. In type II CRISPR systems, the gRNA also comprises a second RNA called a tracrRNA sequence. In type II CRISPR guide rnas (grnas), CRISPR repeats and tracrRNA sequences hybridize to each other to form duplexes. In a type V CRISPR system, the gRNA comprises a duplex forming crRNA. In some embodiments, the gRNA can bind to an endonuclease such that the gRNA and the endonuclease form a complex. The gRNA can provide target specificity to the complex due to its association with an endonuclease. Thus, a nucleic acid that targets the genome can direct the activity of an endonuclease.

Exemplary guide RNAs include spacer sequences comprising 15-200 nucleotides, wherein the gRNA targets a genomic location based on the GRCh38 human genome component. As understood by one of ordinary skill in the art, each gRNA can be designed to include a spacer sequence complementary to its genomic target site or region. See Jinek et al, Science [ Science ],2012,337, 816-.

The gRNA may be a bimolecular guide RNA. The gRNA may be a single guide RNA.

The bimolecular guide RNA can comprise two RNA strands. The first strand comprises in the 5 'to 3' direction an optional spacer extension sequence, a spacer sequence and a minimal CRISPR repeat. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat), a 3' tracrRNA sequence, and optionally a tracrRNA extension sequence.

The single guide rna (sgrna) may comprise in the 5' to 3' direction an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat, a single guide linker, a minimum tracrRNA sequence, a 3' tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension sequence may comprise elements that contribute additional functions (e.g., stability) to the guide RNA. A single-molecule guide linker can link the minimal CRISPR repeat and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension may comprise one or more hairpins.

In some embodiments, the sgRNA includes a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA includes a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA includes a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of variable length of 17-30 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer extension sequence of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides in length. In some embodiments, the sgRNA comprises a spacer extension sequence of less than 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides in length.

In some embodiments, the sgRNA comprises a spacer extension sequence comprising another portion (e.g., a stability control sequence, an endoribonuclease binding sequence, or a ribozyme). The moiety may decrease or increase the stability of the nucleic acid targeting the nucleic acid. The portion may be a transcription terminator segment (i.e., a transcription termination sequence). This moiety may function in eukaryotic cells. This moiety may function in prokaryotic cells. This moiety may function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., 7-methyl guanylate cap (m 7G)), a riboswitch sequence (e.g., to allow for regulatory stability and/or regulatory accessibility of the protein and protein complex), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplast, etc.), a sequence that provides a modification or sequence that tracks (e.g., directly conjugated to a fluorescent molecule, conjugated to a moiety that facilitates fluorescence detection, a sequence that allows for fluorescence detection, etc.), and/or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).

In some embodiments, the sgRNA comprises a spacer sequence that hybridizes to a sequence in the target polynucleotide. Spacers of grnas can interact with a target polynucleotide in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer may vary depending on the sequence of the target nucleic acid of interest.

In CRISPR-endonuclease systems, the spacer sequence can be designed to hybridize to a target polynucleotide located 5' to the PAM of the endonuclease used in the system. The spacer may be a perfect match to the target sequence or may have a mismatch. Each endonuclease (e.g., Cas9 nuclease) has a specific PAM sequence, such that the endonuclease recognizes the target DNA. For example, streptococcus pyogenes Cas9 recognizes a PAM comprising the sequence 5' -NRG-3', where R comprises a or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

The target polynucleotide sequence may comprise 20 nucleotides. The target polynucleotide may comprise less than 20 nucleotides. The target polynucleotide may comprise more than 20 nucleotides. The target polynucleotide may comprise at least: 5. 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide may comprise up to: 5. 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide sequence may comprise 20 bases immediately 5' of the first nucleotide of the PAM.

The spacer sequence that hybridizes to the target polynucleotide can have a length of at least about 6 nucleotides (nt). The spacer sequence may be at least about 6nt, at least about 10nt, at least about 15nt, at least about 18nt, at least about 19nt, at least about 20nt, at least about 25nt, at least about 30nt, at least about 35nt or at least about 40nt, from about 6nt to about 80nt, from about 6nt to about 50nt, from about 6nt to about 45nt, from about 6nt to about 40nt, from about 6nt to about 35nt, from about 6nt to about 30nt, from about 6nt to about 25nt, from about 6nt to about 20nt, from about 6nt to about 19nt, from about 10nt to about 50nt, from about 10nt to about 45nt, from about 10nt to about 40nt, from about 10nt to about 35nt, from about 10nt to about 30nt, from about 10nt to about 25nt, from about 10nt to about 20nt, from about 10nt to about 19nt, from about 19nt to about 25nt, from about 19nt to about 30nt, from about 19nt to about 35nt, from about 19nt to about 30nt, from about 35nt, from about 30nt to about 30nt, from about 10nt, From about 19nt to about 45nt, from about 19nt to about 50nt, from about 19nt to about 60nt, from about 20nt to about 25nt, from about 20nt to about 30nt, from about 20nt to about 35nt, from about 20nt to about 40nt, from about 20nt to about 45nt, from about 20nt to about 50nt, or from about 20nt to about 60 nt. In some examples, the spacer sequence may comprise 20 nucleotides. In some examples, the spacer may comprise 19 nucleotides. In some examples, the spacer may comprise 18 nucleotides. In some examples, the spacer may comprise 22 nucleotides.

In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six consecutive most 5' nucleotides of the target sequence of the complementary strand of the target nucleic acid. The percent complementarity between the spacer sequence and the target nucleic acid can be at least 60% over about 20 consecutive nucleotides. The spacer sequence and the target nucleic acid may differ in length by 1 to 6 nucleotides, which may be considered as one or more protrusions.

the tracrRNA sequence may comprise nucleotides that hybridize to a minimal CRISPR repeat in the cell. The minimal tracrRNA sequence and the minimal CRISPR repeat may form a duplex, i.e. a base-paired double-stranded structure. The smallest tracrRNA sequence and the smallest CRISPR repeat can together bind an RNA-guided endonuclease. At least a portion of the smallest tracrRNA sequence can hybridize to the smallest CRISPR repeat. The minimum tracrRNA sequence may have at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimum CRISPR repeat.

The minimum tracrRNA sequence may have a length of from about 7 nucleotides to about 100 nucleotides. For example, the length of the minimum tracrRNA sequence may be from about 7 nucleotides (nt) to about 50nt, from about 7nt to about 40nt, from about 7nt to about 30nt, from about 7nt to about 25nt, from about 7nt to about 20nt, from about 7nt to about 15nt, from about 8nt to about 40nt, from about 8nt to about 30nt, from about 8nt to about 25nt, from about 8nt to about 20nt, from about 8nt to about 15nt, from about 15nt to about 100nt, from about 15nt to about 80nt, from about 15nt to about 50nt, from about 15nt to about 40nt, from about 15nt to about 30nt, or from about 15nt to about 25 nt. The length of the minimum tracrRNA sequence may be about 9 nucleotides. The minimum tracrRNA sequence may be about 12 nucleotides. The minimum tracrRNA may consist of tracrRNA nt 23-48 as described in Jinek et al (supra).

The minimum tracrRNA sequence may be at least about 60% identical to a reference minimum tracrRNA (e.g., a wild-type tracrRNA from streptococcus pyogenes) sequence over a stretch of at least 6, 7, or 8 consecutive nucleotides. For example, the smallest tracrRNA sequence may have at least about 65% identity, about 70% identity, about 75% identity, about 80% identity, about 85% identity, about 90% identity, about 95% identity, about 98% identity, about 99% identity, or 100% identity over a stretch of at least 6, 7, or 8 consecutive nucleotides to the reference smallest tracrRNA sequence.

The duplex between the smallest CRISPR RNA and the smallest tracrRNA comprises a double helix. The duplex between the smallest CRISPR RNA and the smallest tracrRNA can comprise at least about 1,2, 3, 4,5, 6, 7,8, 9, or 10 or more nucleotides. The duplex between the smallest CRISPR RNA and the smallest tracrRNA can contain up to about 1,2, 3, 4,5, 6, 7,8, 9, or 10 or more nucleotides.

The duplex may contain mismatches (i.e., the two strands of the duplex are not 100% complementary). The duplex may contain at least about 1,2, 3, 4, or 5 or mismatches. The duplex may contain up to about 1,2, 3, 4 or 5 or mismatches. The duplex may contain no more than 2 mismatches.

In some embodiments, the tracrRNA may be a 3' tracrRNA. In some embodiments, the 3' tracrRNA sequence may comprise a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from streptococcus pyogenes).

In some embodiments, the gRNA may comprise a tracrRNA extension sequence. the tracrRNA extension sequence may have a length of from about 1 nucleotide to about 400 nucleotides. the tracrRNA extension sequence may have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides. the tracrRNA extension sequence may have a length of from about 20 to about 5000 nucleotides or more. the tracrRNA extension sequence may have a length of less than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 nucleotides. the tracrRNA extension sequence may comprise less than 10 nucleotides in length. the length of the tracrRNA extension sequence may be 10-30 nucleotides. the length of the tracrRNA extension sequence may be 30-70 nucleotides.

the tracrRNA extension sequence may comprise a functional portion (e.g., a stability control sequence, a ribozyme, an endoribonuclease binding sequence). The functional portion may comprise a transcription terminator segment (i.e., a transcription termination sequence). The functional moiety may have a total length of from about 10 nucleotides (nt) to about 100 nucleotides, from about 10nt to about 20nt, from about 20nt to about 30nt, from about 30nt to about 40nt, from about 40nt to about 50nt, from about 50nt to about 60nt, from about 60nt to about 70nt, from about 70nt to about 80nt, from about 80nt to about 90nt, or from about 90nt to about 100nt, from about 15nt to about 80nt, from about 15nt to about 50nt, from about 15nt to about 40nt, from about 15nt to about 30nt, or from about 15nt to about 25 nt.

In some embodiments, the sgRNA can comprise an adapter sequence from about 3 nucleotides to about 100 nucleotides in length. In Jinek et al (supra), for example, a simple 4-nucleotide "tetracycle" (-GAAA-) (Jinek et al, Science [ Science ],2012,337(6096):816-821) is used. Illustrative linkers have a length of from about 3 nucleotides (nt) to about 90nt, from about 3nt to about 80nt, from about 3nt to about 70nt, from about 3nt to about 60nt, from about 3nt to about 50nt, from about 3nt to about 40nt, from about 3nt to about 30nt, from about 3nt to about 20nt, from about 3nt to about 10 nt. For example, the linker may have a length of from about 3nt to about 5nt, from about 5nt to about 10nt, from about 10nt to about 15nt, from about 15nt to about 20nt, from about 20nt to about 25nt, from about 25nt to about 30nt, from about 30nt to about 35nt, from about 35nt to about 40nt, from about 40nt to about 50nt, from about 50nt to about 60nt, from about 60nt to about 70nt, from about 70nt to about 80nt, from about 80nt to about 90nt, or from about 90nt to about 100 nt. The linker of the single molecule guide nucleic acid may be between 4 and 40 nucleotides. The linker may be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker may be up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

The linker may comprise any of a variety of sequences, although in some examples the linker will not comprise a sequence of a broad region of homology to other portions of the guide RNA, which may result in intramolecular binding that may interfere with other functional regions of the guide. In Jinek et al (supra), a simple 4 nucleotide sequence-GAAA- (Jinek et al, Science [ Science ],2012,337(6096): 816-.

The linker sequence may comprise a functional moiety. For example, the linker sequence may comprise one or more features including an aptamer, ribozyme, protein-interacting hairpin, protein binding site, CRISPR array, intron, or exon. The linker sequence may comprise at least about 1,2, 3, 4 or 5 or more functional moieties. In some examples, a linker sequence may comprise up to about 1,2, 3, 4, or 5 or more functional moieties.

In some embodiments, the sgRNA does not comprise uracil, e.g., at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA includes one or more uracils, e.g., at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA comprises 1,2, 3, 4,5, 6, 7,8, 9, or 10 uracils (U) at the 3' end of the sgRNA sequence.

The sgrnas can be chemically modified. In some embodiments, a chemically modified gRNA is a gRNA that comprises at least one nucleotide with a chemical modification (e.g., a 2' -O-methyl sugar modification). In some embodiments, a chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises a 2' -O-methyl-phosphorothioate residue. In some embodiments, the chemical modification enhances stability, reduces the likelihood or extent of an innate immune response, and/or enhances other attributes, as described in the art.

In some embodiments, the modified gRNA may comprise a modified backbone, such as a phosphorothioate, phosphotriester, morpholino, methylphosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatom or heterocyclic intersugar linkages.

Morpholino-based compounds are described in the following references: braasch and David Corey, Biochemistry, 2002,41(14) 4503-4510; genesis [ century creation ],2001, vol 30, stage 3; heasman, Dev.biol. [ developmental biology ],2002,243: 209-; nasevicius et al, nat. Genet. [ Nature. genetics ],2000,26: 216-; lacerra et al, Proc. Natl.Acad.Sci. [ Proc. Natl.Acad.Sci. ],2000,97: 9591-; and U.S. Pat. No. 5,034,506 issued on 23/7 in 1991.

Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al, J.Am.chem.Soc. [ J.Am.chem. ],2000,122: 8595-8602.

In some embodiments, the modified gRNA may comprise one or more substituted sugar moieties at the 2' position, such as one of: OH, SH, SCH₃、F、OCN、OCH₃、OCH₃ O(CH₂)n CH₃、O(CH₂)n NH₂Or O (CH)₂)n CH₃Wherein n is from 1 to about 10; c1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; cl; br; CN; CF (compact flash)₃；OCF₃(ii) a O-, S-or N-alkyl; o-, S-or N-alkenyl; SOCH₃；SO₂ CH₃；ONO₂；NO₂；N₃；NH₂(ii) a A heterocycloalkyl group; a heterocycloalkylaryl group; an aminoalkylamino group; a polyalkylamino group; a substituted silyl group; an RNA cleaving group; a reporter group; an intercalator; 2' -O- (2-methoxyethyl); 2 '-methoxy (2' -O-CH)₃) (ii) a2 '-propoxy (2' -OCH)₂ CH₂CH₃) (ii) a And 2 '-fluoro (2' -F). Similar modifications can also be made at other positions on the gRNA, particularly the 3 'position of the sugar on the 3' terminal nucleotide and the 5 'position of the 5' terminal nucleotide. In some examples, both the sugar and internucleoside linkages (i.e., the backbone) of the nucleotide unit can be replaced with novel groups.

The guide RNA may additionally or alternatively include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases that are only rarely or transiently found in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-methylcytosine, and in particular 5-methylcytosine (also known as 5-methyl-2' deoxycytidine and commonly referred to in the art as 5-Me-C), 5-Hydroxymethylcytosine (HMC), glycosyl HMC, and gentiobiosyl HMC, as well as synthetic nucleobases, such as 2-aminoadenine, 2- (methylamino) adenine, 2- (imidazolylalkyl) adenine, 2- (aminoalkylamino) adenine or other heterosubstituted alkyl adenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine and 2, 6-diaminopurine. Kornberg, a., DNA Replication [ DNA Replication ], w.h.freeman & Co [ w.h. frieman, san francisco, pages 75-77, 1980; gebeyehu et al, Nucl. acids Res. [ nucleic acids research ]1997,15: 4513. "universal" bases known in the art, such as inosine, may also be included. It has been shown that 5-Me-C substitutions increase nucleic acid duplex stability by 0.6 deg.C-1.2 deg.C. (Sanghvi, Y.S., crook, S.T. and Lebleu, B. editions, Antisense Research and Applications, CRC Press [ CRC Press ], Boca Raton [ Bokalton ],1993, p. 276-278) are aspects of base substitution.

Modified nucleobases may include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo is in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Complexes of genome-targeted nucleic acids and endonucleases

The gRNA interacts with an endonuclease (e.g., an RNA-guided nuclease such as Cas9) to form a complex. The gRNA directs endonucleases to the target polynucleotide.

The endonuclease and gRNA can each be administered to a cell or subject, respectively. In some embodiments, the endonuclease may be pre-complexed with one or more guide RNAs, or one or more crrnas and tracrrnas. The pre-composite may then be administered to a cell or subject. Such pre-composites are called ribonucleoprotein particles (RNPs). The endonuclease in the RNP may be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. The endonuclease can be flanked at the N-terminus, C-terminus, or both the N-terminus and C-terminus by one or more Nuclear Localization Signals (NLS). For example, Cas9 endonuclease may be flanked by two NLS, one at the N-terminus and a second at the C-terminus. The NLS can be any NLS known in the art, such as SV40 NLS. The weight ratio of genome-targeted nucleic acid to endonuclease in the RNP can be 1: 1. For example, the weight ratio of sgRNA to Cas9 endonuclease in RNP can be 1: 1.

Nucleic acids encoding system components

The disclosure provides nucleic acids comprising nucleotide sequences encoding the genome-targeted nucleic acids of the disclosure, endonucleases of the disclosure, and/or any nucleic acid or protein molecule necessary to perform aspects of the methods of the disclosure. The encoding nucleic acid may be RNA, DNA, or a combination thereof.

Nucleic acids encoding the genome-targeting nucleic acids of the disclosure, endonucleases of the disclosure, and/or any nucleic acids or protein molecules necessary to perform aspects of the methods of the disclosure can constitute vectors (e.g., recombinant expression vectors).

The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

In some examples, the vectors may be capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors", or more simply "expression vectors", which have equivalent functions.

The term "operably linked" means that the nucleotide sequence of interest is linked to one or more regulatory sequences in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in the following documents: goeddel; gene Expression Technology Methods in Enzymology [ Gene Expression Technology: enzymatic methods ],1990,185, Academic Press, San Diego, CA, Calif. Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells as well as those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). One skilled in the art will recognize that the design of an expression vector may depend on factors such as the selection of the target cell, the desired level of expression, and the like.

Contemplated expression vectors include, but are not limited to, viral vectors and other recombinant vectors based on vaccinia Virus, poliovirus, adenovirus, adeno-associated Virus, SV40, herpes simplex Virus, human immunodeficiency Virus, retroviruses (e.g., murine leukemia Virus, splenic necrosis Virus, and vectors derived from retroviruses such as Rous Sarcoma Virus (Rous Sarcoma Virus), hayworm Sarcoma Virus (Harvey Sarcoma Virus), avian leukemia Virus, lentiviruses, human immunodeficiency Virus, myeloproliferative Sarcoma Virus, and mammary tumor Virus). Other vectors contemplated for use in eukaryotic target cells include, but are not limited to, vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used so long as they are compatible with the host cell.

In some examples, the vector may comprise one or more transcriptional and/or translational control elements. Depending on the host/vector system utilized, any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like. The vector may be a self-inactivating vector which inactivates viral sequences or components or other elements of the CRISPR machine.

Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that are functional in eukaryotic cells) include those from Cytomegalovirus (CMV) immediate early, Herpes Simplex Virus (HSV) thymidine kinase, early and late SV40, Long Terminal Repeats (LTR) from retroviruses, the human elongation factor-1 promoter (EF1), the chicken beta-actin promoter (CBA), ubiquitin C promoter (UBC), hybrid constructs comprising cytomegalovirus enhancer fused to chicken β -actin promoter (CAG), hybrid constructs comprising cytomegalovirus enhancer fused to chicken β -actin gene promoter (CAG or CAGGS), first exon and first intron, murine stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus Promoter (PGK), and mouse metallothionein-I promoter.

The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline regulated promoter, a steroid regulated promoter, a metal regulated promoter, an estrogen receptor regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., CMV promoter, UBC promoter, CAG promoter). In some cases, the promoter can be a spatially and/or temporally limited promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.).

Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into a cell can occur by: viral or phage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nuclear transfection, calcium phosphate precipitation, Polyethyleneimine (PEI) mediated transfection, DEAE-dextran mediated transfection, liposome mediated transfection, gene gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle mediated nucleic acid delivery, and the like.

Strategies for evading immune responses and increasing survival

Described herein are strategies that enable genetically modified cells (i.e., universal donor cells) to evade an immune response and/or increase their survival or viability upon implantation into a subject. In some embodiments, these strategies enable universal donor cells to evade immune responses and/or survive with higher success rates than unmodified cells. In some embodiments, the genetically modified cell comprises introduction of at least one genetic modification within or near at least one gene that reduces expression of one or more MHC-I and MHC-II human leukocyte antigens relative to an unmodified cell; at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and/or at least one genetic modification that alters expression of at least one gene encoding a survival factor relative to unmodified cells. In some embodiments, the genetically modified cell comprises introduction of at least one genetic modification within or near at least one gene that reduces expression of one or more MHC-I and MHC-II human leukocyte antigens relative to an unmodified cell; at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and at least one genetic modification that alters expression of at least one gene encoding a survival factor relative to unmodified cells. In other embodiments, the genetically modified cell comprises at least one deletion or insertion-deletion mutation within or near at least one gene that alters expression of one or more MHC-I and MHC-II human leukocyte antigens relative to an unmodified cell; and at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps, or is contained within a site that is missing a gene that alters the expression of one or more MHC-I and MHC-II HLAs. In still other embodiments, the genetically modified cell comprises at least one genetic modification that alters expression of at least one gene encoding a survival factor relative to an unmodified cell.

The gene encoding Major Histocompatibility Complex (MHC) is located on human chromosome 6p 21. The resulting proteins encoded by MHC genes are a series of surface proteins that are critical for donor compatibility during cell transplantation. MHC genes are classified into MHC class I (MHC-I) and MHC class II (MHC-II). The MHC-I genes (HLA-A, HLA-B and HLA-C) are expressed in almost all tissue cell types, presenting "non-self" antigen-treated peptides to CD8+ T cells, thereby facilitating their activation into cytolytic CD8+ T cells. Transplanted or implanted cells expressing "non-self" MHC-I molecules will elicit robust cellular immune responses against these cells, ultimately leading to their death by activated cytolytic CD8+ T cells. The MHC-I protein is closely associated with beta-2-microglobulin (B2M) in the endoplasmic reticulum, which is essential for the formation of functional MHC-I molecules on the cell surface. In addition, there are three atypical MHC-Ib molecules (HLA-E, HLA-F and HLA-G) that have immune regulatory functions. MHC-II biomolecules include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ and HLA-DR. Due to their major function in the immune response, MHC-I and MHC-II biomolecules contribute to immune rejection following cell engraftment of non-host cells (e.g., cell engraftment for regenerative medicine purposes).

MHC-I cell surface molecules are composed of MHC encoded heavy chains (HLA-A, HLA-B or HLA-C) and invariant subunit beta-2-microglobulin (B2M). Thus, a reduction in intracellular B2M concentration enables an efficient method of reducing cell surface expression of MHC-I cell surface molecules.

In some embodiments, the cell comprises a genomic modification of one or more MHC-I or MHC-II genes. In some embodiments, the cell comprises a genomic modification of one or more polynucleotide sequences that regulate expression of MHC-I and/or MHC-II. In some embodiments, the genetic modification of the present disclosure is performed using any gene editing method, including but not limited to those described herein.

In some embodiments, the reduction in expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells is achieved by direct targeting, e.g., by genetic deletion and/or insertion of at least one base pair, in the MHC-I and/or MHC-II gene. In some embodiments, reducing expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells is achieved by targeting the CIITA gene, e.g., by genetic deletion. In some embodiments, reducing the expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells is achieved by targeting at least one transcriptional regulator of MHC-I or MHC-II, e.g., by genetic deletion. In some embodiments, the transcriptional regulator of MHC-I or MHC-II is NLRC5 or CIITA gene. In some embodiments, the MHC-I or MHC-II transcriptional regulator is the RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, IRF-1, and/or TAP1 gene.

In some embodiments, the genome of the cell has been modified to delete all or a portion of the HLA-A, HLA-B and/or HLA-C genes. In some embodiments, the genome of the cell has been modified to delete all or a portion of the promoter region of the HLA-A, HLA-B and/or HLA-C genes. In some embodiments, the genome of the cell has been modified to delete all or a portion of a gene encoding a transcriptional regulator of MHC-I or MHC-II. In some embodiments, the genome of the cell has been modified to delete all or a portion of the promoter region of a gene encoding a transcriptional regulator of MHC-I or MHC-II.

In some embodiments, the genome of the cell has been modified to reduce the expression of beta-2-microglobulin (B2M). B2M is a non-polymorphic gene encoding a common protein subunit required for surface expression of all polymorphic MHC class I heavy chains. The HLA-I protein is closely related to B2M in the endoplasmic reticulum, and the B2M is important for the formation of functional cell surface expressed HLA-I molecules. In some embodiments, the gRNA targets a site within the B2M gene that includes the 5'GCTACTCTCTCTTTCTGGCC 3' sequence (SEQ ID NO: 1). In some embodiments, the gRNA targets a site within the B2M gene that includes the 5'GGCCGAGATGTCTCGCTCCG 3' sequence (SEQ ID NO: 2). In some embodiments, the gRNA targets a site within the B2M gene that includes the 5'CGCGAGCACAGCTAAGGCCA 3' sequence (SEQ ID NO: 3). In alternative embodiments, the gRNA targets a site within the B2M gene comprising any one of the following sequences: 5'-TATAAGTGGAGGCGTCGCGC-3' (SEQ ID NO:35), 5'-GAGTAGCGCGAGCACAGCTA-3' (SEQ ID NO:36), 5'-ACTGGACGCGTCGCGCTGGC-3' (SEQ ID NO:37), 5'-AAGTGGAGGCGTCGCGCTGG-3' (SEQ ID NO:38), 5-GGCCACGGAGCGAGACATCT-3' (SEQ ID NO:39), 5'-GCCCGAATGCTGTCAGCTTC-3' (SEQ ID NO:40), 5'-CTCGCGCTACTCTCTCTTTC-3' (SEQ ID NO:41), 5'-TCCTGAAGCTGACAGCATTC-3' (SEQ ID NO:42), 5'-TTCCTGAAGCTGACAGCATT-3' (SEQ ID NO:43) or 5'-ACTCTCTCTTTCTGGCCTGG-3' (SEQ ID NO: 44). In some embodiments, the gRNA comprises a polynucleotide sequence of any one of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, or SEQ ID NO 44. The gRNA/CRISPR nuclease complex targets and cleaves a target site in the B2M locus. Repair of a double-stranded break by NHEJ may result in deletion of at least one nucleotide and/or insertion of at least one nucleotide, thereby disrupting or eliminating expression of B2M. Alternatively, the B2M locus may be targeted by at least two CRISPR systems, each CRISPR system comprising a different gRNA, such that cleavage at two sites in the B2M locus results in deletion of the sequence between the two nicks, thereby eliminating expression of B2M.

In some embodiments, the genome of the cell has been modified to reduce expression of class II transactivator (CIITA). CIITA is a member of the LR or Nucleotide Binding Domain (NBD) Leucine Rich Repeat (LRR) protein family and regulates MHC-II transcription by association with MHC enhancers. CIITA expression is induced in B cells and dendritic cells according to developmental stage and can be induced by IFN-gamma in most cell types.

In some embodiments, the genome of the cell has been modified to reduce the expression of the NLR family CARD domain 5-containing (NLRC 5). NLRC5 is a key regulator of MHC-I mediated immune responses, and like CIITA, NLRC5 is highly inducible by IFN- γ and can translocate into the nucleus. NLRC5 activates the promoter of the MHC-I gene and induces transcription of MHC-I and related genes involved in MHC-I antigen presentation.

In some embodiments, tolerogenic factors may be inserted or reinserted into the genetically modified cells to generate the universal donor cell immune privileged. In some embodiments, the universal donor cells disclosed herein have been further modified to express one or more tolerogenic factors. Exemplary tolerogenic factors include, but are not limited to, one or more of HLA-C, HLA-E, HLA-F, HLA-G, PD-L1, CTLA-4-Ig, CD47, CI inhibitors and IL-35. In some embodiments, the genetic modification (e.g., insertion) of the at least one polynucleotide encoding the at least one tolerogenic factor enables the universal donor cell to inhibit or escape immune rejection after implantation at a rate that is at least 1.05 fold, at least 1.1 fold, at least 1.25 fold, at least 1.5 fold, at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 10 fold, at least 20 fold, or at least 50 fold higher than the unmodified cell. In some embodiments, insertion of a polynucleotide encoding HLA-E, HLA-G, CTLA-4, CD47, and/or PD-L1 enables the universal donor cell to inhibit or escape immune rejection after transplantation or implantation into a host subject.

Polynucleotides encoding tolerogenic factors typically comprise a left homology arm and a right homology arm flanking a sequence encoding a tolerogenic factor. The homology arms have significant sequence homology to genomic DNA at or near the targeted insertion site. For example, the left homology arm may be a nucleotide sequence homologous to a region located to the left or upstream of the target site or cleavage site, and the right homology arm may be a nucleotide sequence homologous to a region located to the right or downstream of the target site or cleavage site. The proximal end of each homology arm may be homologous to a genomic DNA sequence adjacent to the cleavage site. Alternatively, the proximal end of each homology arm may be homologous to a genomic DNA sequence located up to about 10, 20, 30, 40, 50, 60, or 70 nucleobases away from the cleavage site. In this way, a polynucleotide encoding a tolerogenic factor may be inserted into the targeted locus within about 10, 20, 30, 40, 50, 60 or 70 base pairs of the cleavage site, and additional genomic DNA adjacent to the cleavage site (and not homologous to the homology arms) may be deleted. The length of the homology arms can range from about 50 nucleotides to thousands of nucleotides. In some embodiments, the length of the homology arms can range from about 500 nucleotides to about 1000 nucleotides. Significant sequence homology between the homology arms and the genomic DNA can be at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%.

In some embodiments, a homology arm is used with a B2M guide (e.g., a gRNA comprising the nucleotide sequence of SEQ ID NOS: 1-3 or 35-44). In some embodiments, the homology arms are designed for use with any B2M guide that will eliminate the start site of the B2M gene. In some embodiments, the B2M homology arm may comprise or consist essentially of the polynucleotide sequence of SEQ ID No. 13 or 19 or a polynucleotide sequence having at least 85%, 90%, 95%, or 99% sequence identity to the polynucleotide sequence of SEQ ID No. 13 or 19. In some embodiments, the left B2M homology arm may comprise or consist essentially of SEQ ID No. 13 or a polynucleotide sequence having at least 85%, 90%, 95%, or 99% sequence identity to the polynucleotide sequence of SEQ ID No. 13. In some embodiments, the right B2M homology arm can comprise or consist essentially of SEQ ID No. 19 or a polynucleotide sequence having at least 85%, 90%, 95%, or 99% sequence identity to the polynucleotide sequence of SEQ ID No. 19.

The at least one polynucleotide encoding at least one tolerogenic factor may be operably linked to an exogenous promoter. The exogenous promoter may be a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell-type specific promoter. In some embodiments, the exogenous promoter is a CMV, EFla, PGK, CAG, or UBC promoter.

In some embodiments, the at least one polynucleotide encoding at least one tolerogenic factor is inserted into a safe harbor locus (e.g., the AAVS1 locus). In some embodiments, the at least one polynucleotide encoding at least one tolerogenic factor is inserted into the genomic DNA at a site or region that partially overlaps, completely overlaps, or is contained within (i.e., within or near) an MHC-I gene, an MHC-II gene, or a transcriptional regulator of MHC-I or MHC-II.

In some embodiments, a polynucleotide encoding PD-L1 is inserted at a site within or near the B2M locus. In some embodiments, the polynucleotide encoding PD-L1 is inserted at a site within or near the B2M locus, simultaneously with or after deletion of all or a portion of the B2M gene or promoter. The polynucleotide encoding PD-L1 is operably linked to a foreign promoter. The exogenous promoter may be a CMV promoter.

In some embodiments, a polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus. In some embodiments, a polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus, simultaneously with or subsequent to the deletion of all or a portion of the B2M gene or promoter. The polynucleotide encoding HLA-E is operably linked to a foreign promoter. The exogenous promoter may be a CMV promoter.

In some embodiments, the polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B or HLA-C locus. In some embodiments, the polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B or HLA-C locus, simultaneously with or subsequent to the deletion of the HLA-A, HLA-B or HLA-C gene or promoter.

In some embodiments, the polynucleotide encoding CD47 is inserted at a site within or near the CIITA locus. In some embodiments, the polynucleotide encoding CD47 is inserted at a site within or near the CIITA locus, either simultaneously with or subsequent to the deletion of the CIITA gene or promoter.

In some embodiments, the polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B or HLA-C locus simultaneously with the insertion of the polynucleotide encoding CD47 at a site within or near the CIITA locus.

In some embodiments, the cell comprises increased or decreased expression of one or more survival factors. In some embodiments, the cell comprises an insertion of one or more polynucleotide sequences encoding a survival factor. In some embodiments, the cell comprises a deletion of one or more survival factors. In some embodiments, the genetic modification of the present disclosure is performed using any gene editing method, including but not limited to those described herein. In some embodiments, the cell comprises increased or decreased expression of at least one survival factor relative to an unmodified cell. In some embodiments, the survival factor is a member or key pathway involved in cell survival, such as hypoxia, active oxygen, nutrient deprivation, and/or oxidative stress. In some embodiments, the genetic modification of the at least one survival factor enables the universal donor cell to survive for a longer period of time after implantation than an unmodified cell, e.g., for a period of time that is at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold longer. In some embodiments, the survival factor is ZNF143, TXNIP, FOXO1, JNK, or MANF.

In some embodiments, the cells comprise an insertion of a polynucleotide encoding MANF that enables the universal donor cell to survive at a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, the polynucleotide encoding MANF is inserted into a safe harbor locus. In some embodiments, the polynucleotide encoding MANF is inserted into a gene belonging to MHC-I, MHC-II or a transcriptional regulator of either MHC-I or MHC-II.

In some embodiments, the genome of the cell has been modified to delete all or a portion of the ZNF143, TXNIP, FOXO1, and/or JNK genes. In some embodiments, the genome of the cell has been modified to delete all or a portion of the ZNF143, TXNIP, FOXO1, and/or promoter region of the JNK gene.

In some embodiments, more than one survival factor is genetically modified within the cell.

In certain embodiments, cells that have no MHC-II expression and moderate expression of MHC-I are genetically modified to have no MHC-I or MHC-II surface expression. In another example, cells without surface expression of MHC-I/II are further edited to have PD-L1 expression, e.g., insertion of a polynucleotide encoding PD-L1. In yet another embodiment, a cell without surface expression of MHC-I/II is further edited to have expression of PD-L1, e.g., by insertion of a polynucleotide encoding PD-L1, and is also genetically modified to increase or decrease expression of at least one gene encoding a survival factor relative to an unmodified cell.

In some embodiments, the cells further comprise increased or decreased expression (e.g., by genetic modification) of one or more additional genes that are not necessarily implicated in immune escape or cell survival after implantation. In some embodiments, the cells further comprise increased expression of one or more safety switch proteins relative to unmodified cells. In some embodiments, the cells comprise increased expression of one or more additional genes encoding a safety switch protein. In some embodiments, the safety switch is also a suicide gene. In some embodiments, the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9. In some embodiments, the polynucleotide encoding the at least one safety switch is inserted into the genome, e.g., into a safe harbor locus. In some other embodiments, the one or more additional genes that are genetically modified encode one or more of the following integrated with the construct: a safety switch protein; a targeting mode; a receptor; a signaling molecule; a transcription factor; a pharmaceutically active protein or peptide; a drug target candidate; and proteins that promote their implantation, transport, homing, viability, self-renewal, persistence and/or survival.

One aspect of the invention provides a method of producing a genome-engineered universal donor cell, wherein the universal donor cell comprises at least one targeted genomic modification at one or more selected sites in the genome, the method comprising genetically engineering a cell type as described herein by: introducing one or more constructs into the cell to effect targeted modification at the selected site; introducing into the cell one or more double-stranded breaks at selected sites using one or more endonucleases capable of recognizing these selected sites; and culturing the edited cells to allow endogenous DNA repair to produce targeted insertions or deletions at the selected sites; thereby obtaining a genome modified universal donor cell. The universal donor cells produced by this method will comprise at least one functional targeted genomic modification, and wherein the genomically modified cells (if they are stem cells) are then capable of differentiating into progenitor cells or fully differentiated cells.

In some other embodiments, the genome-engineered universal donor cell comprises an introduction or increased expression of at least one of HLA-E, HLA-G, CD47 or D-L1. In some embodiments, the genome-engineered universal donor cell is HLA class I and/or class II deficient. In some embodiments, the genome-engineered universal donor cell comprises null or low B2M. In some embodiments, the genome-engineered universal donor cell comprises an integrated or non-integrated exogenous polynucleotide encoding one or more of HLA-E, HLA-G and PD-Ll proteins. In some embodiments, the introduced expression is increased expression from a non-expressed or under-expressed gene contained in the cell. In some embodiments, the non-integrating exogenous polynucleotide is introduced using sendai virus, AAV, episomes, or plasmids. In some embodiments, the universal donor cell is B2M null and has introduced expression of one or more of HLA-E, HLA-G, PD-L1, and increased or decreased expression of at least one safety switch protein. In another embodiment, the universal donor cell is HLA-A, HLA-B and HLA-C null, and has introduced expression of one or more of HLA-E, HLA-G, PD-L1 and at least one safety switch protein. In some embodiments, the universal donor cell is B2M null and has introduced expression of one or more of HLA-E, HLA-G, PD-L1, and increased or decreased expression of at least one survival factor (e.g., MANF). Methods of producing any of the genetically modified cells described herein are contemplated using at least any of the gene editing methods described herein.

Cell type IV

Cells (e.g., universal donor cells) (and corresponding unmodified cells) as described herein can belong to any possible class of cell type. In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a mammalian cell. In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a human cell. In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a stem cell. In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a Pluripotent Stem Cell (PSC). In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) may be an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem or progenitor cell (HSPC). In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a differentiated cell. In some embodiments, the cell (e.g., universal donor cell) (and corresponding unmodified cell) can be a somatic cell, such as an immune system cell or a contractile cell (e.g., skeletal muscle cell).

The cells described herein (e.g., universal donor stem cells) can be differentiated into relevant cell types to assess HLA expression, as well as to assess immunogenicity of universal stem cell lines. Generally, differentiation involves maintaining the cells of interest for a period of time and under conditions sufficient to differentiate the cells into differentiated cells of interest. For example, the universal stem cells disclosed herein can be differentiated into Mesenchymal Progenitor Cells (MPCs), hypoimmunogenic cardiomyocytes, muscle progenitor cells, blasts, Endothelial Cells (ECs), macrophages, hepatocytes, beta cells (e.g., pancreatic beta cells), pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or Neural Progenitor Cells (NPCs).

Stem cells are capable of both proliferating and producing more progenitor cells, which in turn have the ability to produce large numbers of progenitor cells, which in turn can produce differentiated or differentiable daughter cells. The daughter cells themselves may be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types while also retaining one or more cells with parental developmental potential. Thus, the term "stem cell" refers to a cell that has the ability or potential to differentiate into a more specialized or differentiated phenotype under particular circumstances, and in some circumstances retains the ability to proliferate without substantial differentiation. In one aspect, the term progenitor or stem cell refers to a broad mother cell whose progeny (descendants) are typically specialized in different directions by differentiation as occurs in the progressive diversification of embryonic cells and tissues (e.g., by acquiring completely independent characteristics). Cell differentiation is a complex process that typically occurs through many cell divisions. Differentiated cells may be derived from pluripotent cells, which themselves are also derived from pluripotent cells, and the like. Although each of these pluripotent cells can be considered a stem cell, the range of cell types that each pluripotent cell can produce may vary widely. Some differentiated cells also have the ability to give rise to cells of greater developmental potential. This ability may be natural or may be artificially induced after treatment with various factors. In many biological examples, stem cells may also be "pluripotent" in that they may produce progeny of more than one different cell type, but this is not required for "sternness".

A "differentiated cell" is a cell that has progressed further in a developmental pathway than the cell to which it is compared. Thus, stem cells can differentiate into lineage-restricted precursor cells (e.g., myocyte progenitor cells), which in turn can differentiate into other types of precursor cells that are further differentiated along the pathway (e.g., myocyte precursors), and then into terminally differentiated cells (e.g., myocytes) that play a particular role in certain tissue types and may or may not retain the ability to further proliferate.

Embryonic stem cells

The cells described herein can be Embryonic Stem Cells (ESCs). ESCs are derived from embryonic cells of mammalian embryos and are capable of differentiating into any cell type and proliferating rapidly. ESCs are also believed to have a normal karyotype, retain high telomerase activity, and exhibit significant long-term proliferative potential, making these cells excellent candidates for use as universal donor cells.

Adult stem cells

The cells described herein may be Adult Stem Cells (ASCs). ASCs are undifferentiated cells that can be found in mammals (e.g., humans). ASCs are defined by their ability to self-renew (e.g., through several rounds of cell replication passages while maintaining their undifferentiated state) and to differentiate into several different cell types (e.g., glial cells). Adult stem cells are a broad class of stem cells that may include hematopoietic stem cells, mammary stem cells, intestinal stem cells, mesenchymal stem cells, endothelial stem cells, neural stem cells, olfactory adult stem cells, neural crest stem cells, and testicular cells.

Induction of pluripotent stem cells

The cells described herein may be induced pluripotent stem cells (ipscs). Ipscs can be produced directly from adult human cells by introducing genes encoding key transcription factors involved in pluripotency (e.g., Oct4, Sox2, cMyc, and Klf 4). The ipscs can be derived from the same subject to which the subsequent progenitor cells are to be administered. That is, somatic cells can be obtained from a subject, reprogrammed to induce pluripotent stem cells, and then re-differentiated into progenitor cells (e.g., autologous cells) to be administered to the subject. However, in the case of autologous cells, there is still a risk of poor immune response and viability after implantation.

Human hematopoietic stem and progenitor cells

The cells described herein may be human hematopoietic stem and progenitor cells (hHSPC). This stem cell lineage produces all blood cell types, including erythroid (erythroid) or Red Blood Cell (RBC), myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, megakaryocytes/platelets, and dendritic cells), and lymphoid (T cells, B cells, NK cells). Blood cells result from the proliferation and differentiation of a very small population of pluripotent Hematopoietic Stem Cells (HSCs) that also have the ability to replenish themselves by self-renewal. During differentiation, the progeny of HSCs undergo various intermediate stages of maturation before reaching maturity, producing multipotent and lineage-committed progenitors. Bone Marrow (BM) is the major site of hematopoiesis in humans, and under normal conditions, only a small number of Hematopoietic Stem and Progenitor Cells (HSPCs) are found in the Peripheral Blood (PB). Treatment with cytokines, some myelosuppressive drugs for cancer therapy, and compounds that disrupt the interaction between hematopoietic cells and BM stromal cells can rapidly mobilize large numbers of stem and progenitor cells into the circulation.

Differentiation of cells into other cell types

Another step of the methods of the present disclosure may include differentiating the cells into differentiated cells. The differentiation step may be performed according to any method known in the art. For example, human ipscs were differentiated into definitive endoderm using various treatments including activin and B27 supplements (Life Technologies). Further differentiation of definitive endoderm into hepatocytes, treatments comprising: FGF4, HGF, BMP2, BMP4, Oncostatin M, dexamethasone, etc. (Duan et al, Stem Cells [ Stem cell ], 2010; 28: 674-related Medicine ], Ma et al, Stem Cells Translational Medicine [ Stem cell transformation Medicine ], 2013; 2: 409-419). In another embodiment, the method may be performed according to Sawitza et al, Sci Rep. [ scientific report ] 2015; 13320 carrying out a differentiation step. The differentiated cell can be any somatic cell of a mammal (e.g., a human). In some embodiments, the somatic cell can be an endocrine epithelial cell (e.g., thyroid hormone secreting cells, adrenal cortical cells), exocrine epithelial cells (e.g., salivary gland mucus cells, prostate cells), hormone secreting cells (e.g., anterior pituitary cells, pancreatic islet cells), keratinocyte (e.g., epidermal keratinocytes), moisture stratified barrier epithelial cells, sensory transducing cells (e.g., photoreceptors), autonomic neuronal cells, sensory organs, and peripheral neuronal support cells (e.g., Schwann cells), central nervous system neurons, glial cells (e.g., astrocytes, oligodendrocytes), lens cells, adipocytes, kidney cells, barrier function cells (e.g., ductal cells), extracellular matrix cells, contractile cells (e.g., skeletal muscle cells, pancreatic keratinocytes, pancreatic cells, and a method of the like a cell's for example, and/cell's for example, cell's for example, and/or for example, cell's for example, for stimulating cell's for stimulating cell ' organ's for stimulating the skin, Cardiomyocytes, smooth muscle cells), blood cells (e.g., erythrocytes), immune system cells (e.g., megakaryocytes, microglia, neutrophils, mast cells, T cells, B cells, natural killer cells), germ cells (e.g., sperm cells), trophoblasts, or stromal cells.

V. preparation and application

Formulation and delivery for gene editing

Guide RNAs, polynucleotides (e.g., polynucleotides encoding tolerogenic factors or polynucleotides encoding endonucleases) and endonucleases as described herein can be formulated and delivered to cells in any manner known in the art.

The guide RNA and/or polynucleotide is formulated with pharmaceutically acceptable excipients (e.g., carriers, solvents, stabilizers, adjuvants, diluents, etc.) according to the particular mode of administration and dosage form. The guide RNA and/or polynucleotide compositions can be formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the route of formulation and administration. In some cases, the pH may be adjusted to a range from about pH 5.0 to about pH 8. In some cases, a composition may comprise a therapeutically effective amount of at least one compound as described herein and one or more pharmaceutically acceptable excipients. Optionally, the compositions may contain a combination of compounds described herein, or may include a second active ingredient useful in the treatment or prevention of bacterial growth (such as, but not limited to, an antibacterial or antimicrobial agent), or may include a combination of agents of the present disclosure.

Suitable excipients include, for example, carrier molecules comprising large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polyamino acids, amino acid copolymers and inactivated viral particles. Other exemplary excipients may include antioxidants (such as, but not limited to, ascorbic acid), chelating agents (such as, but not limited to, EDTA), carbohydrates (such as, but not limited to, dextrins, hydroxyalkyl celluloses, and hydroxyalkyl methylcelluloses), stearic acid, liquids (such as, but not limited to, oils, water, saline, glycerol, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

The guide RNA polynucleotide (RNA or DNA) and/or one or more endonuclease polynucleotides (RNA or DNA) may be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, one or more endonuclease polypeptides may be delivered by viral or non-viral delivery vehicles known in the art (e.g., electroporation or lipid nanoparticles). In a further alternative aspect, the DNA endonuclease may be delivered as one or more polypeptides pre-complexed alone or with one or more guide RNAs, or one or more crrnas with a tracrRNA.

Polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 2011,18:1127-1133 (with an emphasis on non-viral delivery vehicles for siRNA that can also be used to deliver other polynucleotides).

For polynucleotides of the present disclosure, a formulation may be selected from any of those taught, for example, in international application PCT/US 2012/069610.

Polynucleotides, such as guide RNAs, sgrnas, and mRNA encoding endonucleases, can be delivered to cells or subjects by Lipid Nanoparticles (LNPs).

LNP refers to any particle with a diameter of less than 1000nm, 500nm, 250nm, 200nm, 150nm, 100nm, 75nm, 50nm or 25 nm. Alternatively, the size of the nanoparticles may range from 1-1000nm, 1-500nm, 1-250nm, 25-200nm, 25-100nm, 35-75nm, or 25-60 nm.

LNPs can be made from cationic, anionic or neutral lipids. Neutral lipids (such as the fusogenic phospholipid DOPE or the membrane component cholesterol) may be included in LNPs as "helper lipids" to enhance transfection activity and stability of the nanoparticles. Limitations of cationic lipids include poor efficacy due to poor stability and rapid clearance, as well as the development of inflammatory or anti-inflammatory responses.

LNPs can also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

Any lipid or combination of lipids known in the art can be used to produce LNPs. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE and GL 67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1 and 7C 1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14 and PEG-CerC 20.

The lipids can be combined in any number of molar ratios to produce LNP. In addition, the one or more polynucleotides can be combined with one or more lipids in a wide range of molar ratios to produce LNPs.

Recombinant adeno-associated virus (AAV) vectors can be used for delivery. Techniques for producing rAAV particles in which the AAV genome to be packaged, which includes the polynucleotide to be delivered, the rep and cap genes, and the helper virus functions, are provided to a cell are standard in the art. Production of rAAV typically requires the presence of the following components within a single cell (referred to herein as a packaging cell): rAAV genome, AAV rep and cap genes separate from (i.e. not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype from which a recombinant virus may be derived, and may be from a different AAV serotype than the rAAV genomic ITRs, including but not limited to the AAV serotypes described herein. The production of pseudotyped rAAV is disclosed, for example, in international patent application publication No. WO 01/83692.

Formulation and administration of cells (e.g., universal donor cells)

Genetically modified cells (e.g., universal donor cells) as described herein can be formulated and administered to a subject by any means known in the art.

The terms "administering", "introducing", "implanting" and "transplanting" are used interchangeably in the context of placing (by a method or route that results in at least partial localization of the introduced cells at a desired site) cells (e.g., progenitor cells) into a subject. The cells (e.g., progenitor cells) or differentiated progeny thereof can be administered by any suitable route that results in delivery to a desired location in a subject where at least a portion of the implanted cells or cellular components remain viable. After administration to a subject, the viability phase of the cells may be as short as several hours (e.g., twenty-four hours), days, up to several years, or even the lifetime of the subject (i.e., long-term implantation).

A genetically modified cell (e.g., a universal donor cell) as described herein can be viable after administration to a subject for a longer period of time than an unmodified cell.

In some embodiments, a composition comprising cells as described herein may be administered by a suitable route, which may include intravenous administration, e.g., as a bolus injection or by continuous infusion over a period of time. In some embodiments, intravenous administration can be by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, or intrathecal routes. In some embodiments, the composition may be in solid form, aqueous form, or liquid form. In some embodiments, the aqueous or liquid form may be nebulized or lyophilized. In some embodiments, the nebulized or lyophilized form can be reconstituted with an aqueous or liquid solution.

The cell composition may also be emulsified or presented as a liposome composition, provided that the emulsification process does not adversely affect cell viability. The cells and any other active ingredients can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the methods of treatment described herein.

The additional agents included in the cell composition may include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, tartaric, mandelic, and the like. Salts formed with free carboxyl groups can also be derived from inorganic bases such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, as well as organic bases such as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

Physiologically tolerable vectors are well known in the art. Exemplary liquid carriers are sterile aqueous solutions which contain no material other than the active ingredient and water, or which contain a buffer (e.g., sodium phosphate at physiological pH, physiological saline, or both, such as phosphate buffered saline). Still further, the aqueous carrier may contain more than one buffering salt, as well as salts (e.g., sodium chloride and potassium chloride), dextrose, polyethylene glycol, and other solutes. In addition to and excluding water, the liquid composition may also contain a liquid phase. Examples of such additional liquid phases are glycerol, vegetable oils (such as cottonseed oil) and water-oil emulsions. The amount of active compound used in the cellular composition effective to treat a particular disorder or condition may depend on the nature of the disorder or condition and may be determined by standard clinical techniques.

In some embodiments, a composition comprising a cell can be administered to a subject (e.g., a human subject) having, suspected of having, or at risk of having a disease. In some embodiments, the composition can be administered to a subject that does not have a disease, is not suspected of having a disease, or is not at risk for a disease. In some embodiments, the subject is a healthy human. In some embodiments, a subject (e.g., a human subject) has, is suspected of having, or is at risk for a genetically heritable disease. In some embodiments, the subject is suffering from or at risk of suffering from a symptom indicative of a disease.Specific compositions and methods of the disclosure

Accordingly, the present disclosure is directed to the following non-limiting compositions and methods, among others.

In a first composition, composition 1, the present disclosure provides a composition comprising cells comprising (I) at least one genetic modification in or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of an MHC-I or MHC-II complex or transcriptional regulators; (ii) at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and (iii) at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to an unmodified cell.

In another composition, composition 2, the disclosure provides a composition comprising cells comprising (I) at least one deletion and/or insertion of at least one base pair within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of an MHC-I or MHC-II complex or transcriptional regulators; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic deletion site of (i).

In another composition, composition 3, the present disclosure provides a composition comprising cells comprising at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to unmodified cells.

In another composition, composition 4, the present disclosure provides a composition as provided in composition 1, wherein the genetic modification of (i) is a deletion.

In another composition, composition 5, the present disclosure provides a composition as provided in composition 1, wherein the genetic modification of (ii) is an insertion of a polynucleotide encoding a tolerogenic factor at a safe harbor locus or at a site that partially overlaps, completely overlaps, or is contained within the genetic modification site of (i).

In another composition, composition 6, the present disclosure provides a composition as provided in composition 1, wherein the genetic modification of (I) is a deletion of a gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators; and the genetic modification of (ii) is insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic modification site of (i).

In another composition, composition 7, the present disclosure provides a composition as provided in any one of compositions 1,2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators is one or more of: MHC-I genes (e.g., HLA-A, HLA-B and HLA-C), MHC-II genes (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR), or genes encoding transcriptional regulators of MHC-I or MHC-II or other components of the MHC-I complex (e.g., B2M, NLRC5, and CIITA).

In another composition, composition 8, the present disclosure provides a composition as provided in any one of compositions 1,2 or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators is one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

In another composition, composition 9, the present disclosure provides a composition as provided in compositions 1 or 2, wherein (i) is a deletion in or near one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

In another composition, composition 10, the present disclosure provides a composition as provided in composition 9, wherein (i) is a deletion in or near HLA-A, a deletion in or near HLA-B, a deletion in or near HLA-C, or a deletion in or near B2M.

In another composition, composition 11, the present disclosure provides a composition as provided in composition 9, wherein (i) is a deletion in or near HLA-A, a deletion in or near HLA-B, a deletion in or near HLA-C, or a deletion in or near CIITA.

In another composition, composition 12, the present disclosure provides a composition as provided in any one of compositions 1,2, or 4 to 11, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of HLA-E, HLA-G, CTLA-4, CD47, or PD-L1.

In another composition, composition 13, the present disclosure provides a composition as provided in composition 12, wherein (i) is a deletion within or near B2M, and (ii) is an insertion of a polynucleotide encoding PD-L1 at a site that partially overlaps, completely overlaps, or is contained within the deletion in (i).

In another composition, composition 14, the present disclosure provides a composition as provided in composition 12, wherein (i) is a deletion in or near HLA-a, a deletion in or near HLA-B, or a deletion in or near HLA-C, and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps, completely overlaps, or is contained within the deletion in (i) (e.g., an HLA-a deletion).

In another composition, composition 15, the present disclosure provides a composition as provided in composition 12, wherein (i) is a deletion in or near HLA-A, a deletion in or near HLA-B, a deletion in or near HLA-C, or a deletion in or near CIITA; and (ii) is an insertion of a polynucleotide encoding HLA-G at a site within the deletion that partially overlaps, completely overlaps or is contained within or near HLA-a, and an insertion of a polynucleotide encoding CD47 at a site within the deletion that partially overlaps, completely overlaps or is contained within or near CIITA.

In another composition, composition 16, the present disclosure provides a composition as provided in any one of compositions 1 or 3 to 15, wherein the at least one gene encoding a survival factor is one or more genes encoding one or more of ZNF143, TXNIP, FOXO1, JNK, or MANF.

In another composition, composition 17, the present disclosure provides a composition as provided in any one of compositions 1 or 3 to 16, wherein the genetic modification to increase or decrease expression of the gene encoding survival factor relative to an unmodified cell is, for example, insertion of a polynucleotide encoding MANF at a safe harbor locus.

In another composition, composition 18, the present disclosure provides a composition as provided in any one of compositions 1 or 3 to 16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor relative to an unmodified cell is a deletion within or near the ZNF143, TXNIP, FOXO1, or JNK gene that decreases or eliminates expression of the ZNF143, TXNIP, FOXO1, or JNK gene relative to an unmodified cell.

In another composition, composition 19, the present disclosure provides a composition as provided in any one of compositions 1 to 18, wherein the cells further comprise an exogenous polynucleotide that is not integrated into the genomic DNA of the cells.

In another composition, composition 20, the present disclosure provides the composition as provided in composition 19, wherein the exogenous polynucleotide encodes HLA-E, HLA-G, CTLA-4, CD47, MANF, and/or PD-L1.

In another composition, composition 21, the present disclosure provides a composition as provided in any one of compositions 1 to 20, wherein the cells further comprise increased expression of one or more safety switches relative to unmodified cells.

In another composition, composition 22, the present disclosure provides a composition as provided in composition 21, wherein the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9.

In another composition, composition 23, the present disclosure provides a composition as provided in compositions 21 or 22, wherein the increased expression of the one or more safety switches results from a genetic insertion of a polynucleotide encoding a safety switch protein, for example, into a safe harbor locus.

In another composition, composition 24, the present disclosure provides a composition as provided in any one of compositions 5, 17 or 23, wherein the safe harbor locus is selected from the group consisting of: AAVS1(PPP 1R 12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp (a), Pcsk9, Serpina1, TF, and TTR.

In another composition, composition 25, the present disclosure provides a composition as provided in any one of compositions 1 to 24, wherein the cells further comprise an additional genetic modification that reduces the expression of any additional genes.

In another composition, composition 26, the present disclosure provides a composition as provided in any one of compositions 1 to 25, wherein the genetic modification, genetic deletion, or genetic insertion is produced by delivering an endonuclease and a guide rna (grna) to the cells.

In another composition, composition 27, the present disclosure provides a composition as provided in composition 26, wherein the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7 (also known as Csn 7 and Csx 7), Cas100, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csb 7, Csx 36x 7, Csx 7, Csf 7, or Csf 7; homologues thereof, recombination of naturally occurring molecules thereof, codon-optimized or modified forms thereof, and combinations thereof.

In another composition, composition 28, the present disclosure provides a composition as provided in composition 27, wherein the endonuclease is Cas9, optionally streptococcus pyogenes Cas9, or a variant thereof comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS.

In another composition, composition 29, the present disclosure provides a composition as provided in composition 26, wherein the weight ratio of the gRNA to the endonuclease is 1: 1.

In another composition, composition 30, the present disclosure provides a composition as provided in any one of compositions 2,5, 6, 12 to 15, 17, 19, 20, or 23, wherein the polynucleotide comprises an exogenous promoter.

In another composition, composition 31, the present disclosure provides a composition as provided in composition 30, wherein the exogenous promoter is CMV, EFla, PGK, CAG, UBC, or other constitutive, inducible, time-specific, tissue-specific, or cell type-specific promoter.

In another composition, composition 32, the present disclosure provides a composition as provided in composition 31, wherein the exogenous promoter is a CAG promoter.

In another composition, composition 33, the present disclosure provides a composition as provided in any one of compositions 1-32, wherein the cells are stem cells (e.g., human stem cells).

In another composition, composition 34, the present disclosure provides a composition as provided in any one of compositions 1 to 33, wherein the cells are Embryonic Stem Cells (ESCs), Adult Stem Cells (ASCs), induced pluripotent stem cells (ipscs), or Hematopoietic Stem and Progenitor Cells (HSPCs).

In another composition, composition 35, the present disclosure provides a composition as provided in any one of compositions 1 to 32, wherein the cells are differentiated cells.

In another composition, composition 36, the present disclosure provides a composition as provided in any one of compositions 1 to 32 or 35, wherein the cells are somatic cells.

In a first method, method 1, the present disclosure provides a method of producing a modified cell, the method comprising: (i) introducing at least one genetic modification in or adjacent to at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of an MHC-I or MHC-II complex or transcriptional regulators; (ii) introducing into these cells at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor; and (iii) introducing at least one genetic modification that increases or decreases the expression of at least one gene encoding a survival factor in the universal donor cells.

In another method, method 2, the present disclosure provides a method of producing a universal donor cell, the method comprising: (i) introducing at least one deletion of at least one region of genomic DNA within or adjacent to at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators; and (ii) introducing at least one insertion of at least one polynucleotide encoding a tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the deletion site of (i).

In another approach, method 3, the present disclosure provides a method of producing a universal donor cell comprising introducing at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor.

In another approach, method 4, the present disclosure provides a method as provided in method 1, wherein the genetic modification of (i) is a deletion.

In another approach, method 5, the present disclosure provides a method as provided in method 1, wherein the genetic modification of (ii) is an insertion of a polynucleotide encoding a tolerogenic factor at a safe harbor locus or at a site that partially overlaps, completely overlaps, or is contained within the genetic modification site of (i).

In another method, method 6, the present disclosure provides a method as provided in method 1, wherein the genetic modification of (I) is a deletion of a gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulators; and the genetic modification of (ii) is insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic modification site of (i).

In another method, method 7, the present disclosure provides a method as provided in any one of methods 1,2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators is one or more of: MHC-I genes (e.g., HLA-A, HLA-B and HLA-C), MHC-II genes (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ and HLA-DR), or genes encoding transcriptional regulators of MHC-I or MHC-II (e.g., B2M, NLRC5 and CIITA).

In another method, method 8, the present disclosure provides a method as provided in any one of methods 1,2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of MHC-I or MHC-II complexes or transcriptional regulators is one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

In another approach, method 9, the present disclosure provides a method as provided in methods 1 or 2, wherein (i) is a deletion in or near one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

In another approach, method 10, the present disclosure provides a method as provided in method 9, wherein (i) is a deletion in or near HLA-A, a deletion in or near HLA-B, a deletion in or near HLA-C, and a deletion in or near B2M.

In another approach, method 11, the present disclosure provides a method as provided in method 9, wherein (i) is a deletion in or near HLA-A, a deletion in or near HLA-B, a deletion in or near HLA-C, and a deletion in or near CIITA.

In another method, method 12, the present disclosure provides a method as provided in any one of methods 1,2, or 4 to 11, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of HLA-E, HLA-G, CTLA-4, CD47, or PD-L1.

In another approach, method 13, the present disclosure provides a method as provided in method 12, wherein (i) is a deletion within or near B2M, and (ii) is an insertion of the polynucleotide encoding PD-L1 at a site that partially overlaps, completely overlaps, or is contained within the deletion in (i).

In another approach, method 14, the present disclosure provides a method as provided in method 12, wherein (i) is a deletion in or near HLA-a, a deletion in or near HLA-B, and a deletion in or near HLA-C, and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps, completely overlaps, or is contained within the deletion in (i) (e.g., an HLA-a deletion).

In another approach, method 15, the present disclosure provides a method as provided in method 12, wherein (i) is a deletion in or near HLA-a, a deletion in or near HLA-B, a deletion in or near HLA-C, and a deletion in or near CIITA; and (ii) is an insertion of a polynucleotide encoding HLA-G at a site within the deletion that partially overlaps, completely overlaps or is contained within or near HLA-a, and an insertion of a polynucleotide encoding CD47 at a site within the deletion that partially overlaps, completely overlaps or is contained within or near CIITA.

In another method, method 16, the present disclosure provides a method as provided in any one of methods 1 or 3 to 15, wherein the at least one gene encoding a survival factor is one or more genes encoding one or more of ZNF143, TXNIP, FOXO1, JNK, or MANF.

In another method, method 17, the present disclosure provides a method as provided in any one of methods 1 or 3 to 16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor is, for example, insertion of a polynucleotide encoding MANF at a safe harbor locus.

In another method, method 18, the disclosure provides a method as provided in any of methods 1 or 3-16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor is a deletion within or near the ZNF143, TXNIP, FOXO1, or JNK gene that decreases or eliminates expression of the ZNF143, TXNIP, FOXO1, or JNK gene relative to unmodified cells.

In another method, method 19, the present disclosure provides a method as provided in any one of methods 1-18, wherein the cells are stem cells (e.g., human stem cells).

In another method, method 20, the present disclosure provides a method as provided in any one of methods 1 to 19, wherein the cells are Embryonic Stem Cells (ESC), Adult Stem Cells (ASC), Induced Pluripotent Stem Cells (iPSC), or Hematopoietic Stem and Progenitor Cells (HSPC).

In another method, method 21, the present disclosure provides a method as provided in any one of methods 1 to 18, wherein the cells are differentiated cells.

In another method, method 22, the present disclosure provides a method as provided in any one of methods 1 to 18 or 21, wherein the cells are somatic cells.

In another method, method 23, the present disclosure provides a method as provided in any one of methods 1-22, wherein the method further comprises introducing into the cells an exogenous polynucleotide that does not become integrated into the genomic DNA of the cells.

In another method, method 24, the present disclosure provides a method as provided in method 23, wherein the exogenous polynucleotide encodes HLA-E, HLA-G, CTLA-4, CD47, MANF, and/or PD-L1.

In another method, method 25, the present disclosure provides a method as provided in any one of methods 1 to 24, wherein the method further comprises increasing expression of one or more safety switches relative to the unmodified cell.

In another method, method 26, the present disclosure provides a method as provided in method 25, wherein the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9.

In another method, method 27, the present disclosure provides a method as provided in methods 25 or 26, wherein increasing the expression of the one or more safety switches results from a genetic insertion of a polynucleotide encoding the safety switch, e.g., into a safe harbor locus.

In another method, method 28, the present disclosure provides a method as provided in any one of methods 5, 17, or 27, wherein the safe harbor locus is selected from the group consisting of: AAVS1(PPP 1R 12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp (a), Pcsk9, Serpina1, TF, and TTR.

In another method, method 29, the present disclosure provides a method as provided in any one of methods 1 to 28, wherein the method further comprises introducing an additional genetic modification that reduces the expression of any additional gene.

In another method, method 30, the present disclosure provides a method as provided in any one of methods 1 to 29, wherein the genetic modification, deletion, or insertion is produced by delivering to the cells an endonuclease and at least one guide rna (grna).

In another approach, method 31, the present disclosure provides a method as provided in method 30, wherein the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7 (also known as Csn 7 and Csx 7), Cas100, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csb 7, Csx 36x 7, Csx 7, Csf 7, or Csf 7; homologues thereof, recombination of naturally occurring molecules thereof, codon-optimized or modified forms thereof, and combinations thereof.

In another approach, method 32, the present disclosure provides a method as provided in method 31, wherein the endonuclease is Cas9, optionally streptococcus pyogenes Cas9, or a variant thereof comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS.

In another method, method 33, the present disclosure provides a method as provided in method 30, wherein the weight ratio of the one or more grnas to the endonuclease is 1: 1.

In another method, method 34, the present disclosure provides a method as provided in any one of methods 2,5, 6, 12 to 15, 17, 23, 25, or 27, wherein the polynucleotide comprises an exogenous promoter.

In another method, method 35, the present disclosure provides the method as provided in method 34, wherein the exogenous promoter is CMV, EFla, PGK, CAG, UBC, or other constitutive promoter, inducible promoter, time-specific promoter, tissue-specific promoter, or cell type-specific promoter.

In another approach, method 36, the present disclosure provides a method as provided in method 35, wherein the exogenous promoter is a CAG promoter.

In another method, method 37, the present disclosure provides a method comprising administering to a subject a cell composition as provided in any one of compositions 1 to 36 or a composition comprising a plurality of cells produced by any one of methods 1 to 36.

In another method, method 38, the present disclosure provides a method comprising (i) obtaining a cell composition as provided in any one of compositions 1 to 34; (ii) differentiating the cells into lineage-restricted cells or fully differentiated cells; and (iii) administering the lineage-restricted cells or fully differentiated cells to a subject in need thereof.

In another method, method 39, the disclosure provides a method as provided in method 37 or 38, wherein the subject is a human having, suspected of having, or at risk of having a disease.

In another approach, method 40, the present disclosure provides a method as provided in method 39, wherein the disease is a genetically heritable disease.

In another approach, method 41, the present disclosure provides a method as provided in methods 39 or 40, wherein the cells further comprise a genetic modification that reduces the expression of a gene or protein associated with the disease.

In another method, method 42, the present disclosure provides a method as provided in any one of methods 39 to 41, wherein the genetic modification is capable of treating the disease or a symptom of the disease.

In another method, method 43, the present disclosure provides a method as provided in any one of methods 37-42, wherein the cells are obtained from a source different from the subject.

In another method, method 44, the present disclosure provides a method of producing a universal donor cell, the method comprising genetically modifying a cell by: (i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and (ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor at a site that partially overlaps, completely overlaps, or is contained within the site of (i), thereby producing the universal donor cell.

In another method, method 45, the present disclosure provides a method of producing a universal donor cell, the method comprising genetically modifying a cell by: (i) introducing a deletion and/or insertion of at least one base pair in the genome of the cell at a site within or adjacent to at least one gene encoding an MHC-I or MHC-II human leukocyte antigen or one or more of a component of an MHC-I or MHC-II complex or a transcriptional regulator; and (ii) introducing into the genome of the cell an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor locus, thereby producing the universal donor cell.

In another approach, method 46, the present disclosure provides a method as provided in methods 44 or 45, wherein the universal donor cell has increased immune evasion and/or cell survival compared to an unmodified cell.

In another method, method 47, the present disclosure provides a method as provided in any one of methods 44-46, wherein the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components of the MHC-I or MHC-II complex or transcriptional regulators is an MHC-I gene selected from HLA-A, HLA-B or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ or HLA-DR, or a gene selected from B2M, NLRC5, CIITA, RFX5, RFXAP or RFXANK.

In another method, method 48, the present disclosure provides a method as provided in any one of methods 44 to 47, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD 47.

In another method, method 49, the present disclosure provides a method as provided in any one of methods 44 to 48, wherein the at least one polynucleotide encoding a tolerogenic factor is operably linked to an exogenous promoter.

In another method, method 50, the present disclosure provides the method as provided in method 49, wherein the exogenous promoter is a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell type-specific promoter, the constitutive promoter is a CMV, EFla, PGK, CAG, or UBC promoter.

In another method, method 51, the present disclosure provides a method as provided in any one of methods 44 to 50, wherein the deletion and/or insertion of (i) is within or near B2M and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

In another method, method 52, the present disclosure provides a method as provided in any one of methods 44 to 51, wherein the method further comprises introducing at least one genetic modification that increases or decreases expression of at least one survival factor relative to an unmodified cell.

In another method, method 53, the present disclosure provides a method as provided in method 52, wherein the at least one genetic modification that increases or decreases expression of at least one survival factor is an insertion of a polynucleotide encoding MANF that increases expression of MANF relative to the unmodified cell; or a deletion and/or insertion of at least one base pair within or near the gene encoding ZNF143, TXNIP, FOXO1 or JNK, which deletion and/or insertion reduces or eliminates expression of ZNF143, TXNIP, FOXO1 or JNK relative to the unmodified cell.

In another method, method 54, the present disclosure provides a method as provided in method 53, wherein the polynucleotide encoding MANF is inserted into the harbor safe locus or into a gene belonging to the transcriptional regulators of MHC-I, MHC-II or MHC-I or MHC-II.

In another approach, method 55, the present disclosure provides a method as provided in any one of methods 44 to 54, wherein the genetic modification comprises delivering at least one RNA-guided endonuclease system to the cell.

In another method, method 56, the present disclosure provides a method as provided in method 55, wherein the at least one RNA-guided endonuclease system is a CRISPR system comprising a CRISPR nuclease and a guide RNA.

In another approach, method 57, the present disclosure provides a method as provided in method 56, wherein the CRISPR nuclease is Cas9, Cpf1, a homolog thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof.

In another approach, method 58, the present disclosure provides a method as provided in methods 56 or 57, wherein the CRISPR nuclease is streptococcus pyogenes Cas 9.

In another method, method 59, the present disclosure provides a method as provided in any one of methods 56 to 58, wherein the CRISPR nuclease comprises an N-terminal Nuclear Localization Signal (NLS) and/or a C-terminal NLS.

In another method, method 60, the present disclosure provides a method as provided in any one of methods 56 to 59, wherein the CRISPR nuclease and the guide RNA are present in a 1:1 weight ratio.

In another method, method 61, the present disclosure provides a method as provided in any one of methods 44 or 46 to 60, wherein the deletion and/or insertion of (i) is within or near the B2M locus and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1.

In another method, method 62, the present disclosure provides a method as provided in method 61, wherein the guide RNA for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOs 1-3 or 35-44.

In another approach, method 63, the present disclosure provides a method as provided in methods 61 or 62, wherein the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to the region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to the region to the right of the site in (i).

In another method, method 64, the present disclosure provides a method as provided in method 63, wherein the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the site in (i).

In another approach, method 65, the present disclosure provides a method as provided in methods 63 or 64, wherein (a) consists essentially of the nucleotide sequence of SEQ ID NO:13, and (b) consists essentially of the nucleotide sequence of SEQ ID NO: 19.

In another method, method 66, the present disclosure provides a method as provided in any one of methods 61 to 65, wherein the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

In another method, method 67, the present disclosure provides a method as provided in any one of methods 44 to 66, wherein the cell is a mammalian cell, optionally wherein the cell is a human cell.

In another method, method 68, the present disclosure provides a method as provided in any one of methods 44 to 67, wherein the cell is a stem cell.

In another method, method 69, the present disclosure provides a method as provided in any one of methods 44 to 68, wherein the cell is a Pluripotent Stem Cell (PSC), an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem cell and progenitor cell (HSPC).

In another method, method 70, the present disclosure provides a method as provided in any one of methods 44 to 69, wherein the cell is a differentiated cell or a somatic cell.

In another approach, method 71, the present disclosure provides a method as provided in any one of methods 44 to 69, wherein the universal donor cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell.

In another approach, method 72, the present disclosure provides a method as provided in method 71, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

In another approach, method 73, the present disclosure provides a method as provided in method 71, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

In another composition, composition 37, the present disclosure provides a composition comprising universal donor cells produced by a method as provided in any one of methods 44 to 73.

In another composition, composition 38, the present disclosure provides a composition as provided in composition 37, wherein the plurality of universal donor cells can be maintained for a time and under conditions sufficient for the cells to undergo differentiation.

In another composition, composition 39, the present disclosure provides a composition comprising cells comprising (I) at least one deletion in or near at least one gene encoding one or more MHC-1 and MHC-II human leukocyte antigens or components of an MHC-I or MHC-II complex or transcriptional regulators; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps or is contained within the genetic deletion site of (i).

In another method, method 74, the present disclosure provides a method comprising administering to a subject a plurality of universal donor cells as described in compositions 37 or 38.

In another method, method 75, the present disclosure provides a method for treating a subject in need thereof, the method comprising (i) obtaining or having obtained a plurality of universal donor cells as described in compositions 37 or 38 after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and (ii) administering the lineage-restricted progenitor cells or fully differentiated somatic cells to the subject.

In another method, method 76, the present disclosure provides a method of obtaining cells for administration to a subject in need thereof, the method comprising (i) obtaining or having obtained universal donor cells as described in compositions 37 or 38; and (ii) maintaining the universal donor cells for a time and under conditions sufficient to differentiate the cells into lineage-restricted progenitor cells or fully differentiated somatic cells.

In another approach, method 77, the present disclosure provides methods as provided in methods 75 or 76, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

In another approach, method 78, the present disclosure provides a method as provided in methods 75 or 76, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

In another method, method 79, the present disclosure provides a method as provided in any one of methods 74 to 78, wherein the subject is a human having, suspected of having, or at risk of having a disease.

In another approach, method 80, the present disclosure provides a method as provided in method 79, wherein the disease is a genetically heritable disease.

In another approach, method 81, the present disclosure provides a method for generating a universal donor cell, the method comprising delivering to a Pluripotent Stem Cell (PSC) (a) an RNA-guided nuclease; (b) a guide rna (grna) that targets a target site in the β -2-microglobulin (B2M) locus; and (c) a vector comprising a nucleic acid comprising (i) a nucleotide sequence homologous to a region to the left of the target site in the B2M locus, (ii) a nucleotide sequence encoding a tolerogenic factor, and (iii) a nucleotide sequence homologous to a region to the right of the target site in the B2M locus, wherein the B2M locus is cleaved at the target site and the nucleic acid is inserted into the B2M locus within 50 base pairs of the target site, thereby generating a universal donor cell, wherein the universal donor cell has increased immune evasion and/or cell survival compared to a PSC that does not comprise the nucleic acid inserted into the B2M locus.

In another approach, method 82, the present disclosure provides a method as provided in method 81, wherein the gRNA comprises a nucleotide sequence selected from SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3.

In another approach, method 83, the present disclosure provides a method as provided in methods 81 or 82, wherein (i) consists essentially of the nucleotide sequence of SEQ ID NO:13, and (iii) consists essentially of the nucleotide sequence of SEQ ID NO: 19.

In another method, method 84, the present disclosure provides a method as provided in any one of methods 81 to 83, wherein the tolerogenic factor is programmed death ligand 1(PD-L1) or human leukocyte antigen E (HLA-E).

In another approach, method 85, the present disclosure provides a method as provided in any one of methods 81 to 84, wherein the nucleotide sequence encoding the tolerogenic factor is operably linked to an exogenous promoter.

In another approach, method 86, the present disclosure provides a method as provided in method 85, wherein the exogenous promoter is constitutive, cell type specific, tissue type specific, or temporally regulated.

In another method, method 87, the present disclosure provides a method as provided in methods 85 or 86, wherein the exogenous promoter is a CAG promoter.

In another approach, method 88, the present disclosure provides a method as provided in any one of methods 81 to 87, wherein the vector is a plasmid vector.

In another approach, method 89, the present disclosure provides a method as provided in method 88, wherein the plasmid vector comprises the nucleotide sequence of SEQ ID NO:33 or SEQ ID NO: 34.

In another method, method 90, the present disclosure provides a method as provided in any one of methods 81 to 89, wherein the RNA-guided nuclease is Cas9 nuclease.

In another approach, method 91, the present disclosure provides a method as provided in method 90, wherein the Cas9 nuclease is linked to at least one Nuclear Localization Signal (NLS).

In another approach, method 92, the disclosure provides a method as provided in methods 90 or 91, wherein the Cas9 nuclease is streptococcus pyogenes Cas 9.

In another method, method 93, the present disclosure provides a method as provided in any one of methods 81 to 92, wherein the PSC is an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a Hematopoietic Stem and Progenitor Cell (HSPC).

In another approach, method 94, the present disclosure provides a method as provided in any one of methods 81 to 93, wherein the PSC is a human PSC.

In another approach, method 95, the present disclosure provides a method for generating a universal donor cell, the method comprising delivering to a Pluripotent Stem Cell (PSC) (a) an RNA-guided nuclease; (b) a guide rna (gRNA) targeting a target site in a β -2-microglobulin (B2M) locus, wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 2; and (c) a vector comprising a nucleic acid comprising (i) a nucleotide sequence homologous to the region to the left of the target site in the B2M locus, the nucleotide sequence consisting essentially of SEQ ID NO:13, (ii) a nucleotide sequence encoding a tolerogenic factor, and (iii) a nucleotide sequence homologous to the region to the right of the target site in the B2M locus, the nucleotide sequence consisting essentially of SEQ ID NO:19, wherein the B2M locus is cleaved at the target site and the nucleic acid is inserted into the B2M locus over 50 base pairs of the target site, thereby generating the universal donor cell, wherein the universal donor cell has increased immune escape and/or cell survival compared to a PSC that does not comprise the nucleic acid inserted into the B2M locus.

In another method, method 96, the present disclosure provides a method as provided in method 95, wherein the tolerogenic factor is programmed death ligand 1(PD-L1) or human leukocyte antigen E (HLA-E).

In another approach, method 97, the present disclosure provides a method as provided in methods 95 or 96, wherein the nucleotide sequence encoding the tolerogenic factor is operably linked to an exogenous promoter.

In another approach, method 98, the present disclosure provides a method as provided in method 97, wherein the exogenous promoter is constitutive, cell type specific, tissue type specific, or temporally regulated.

In another approach, method 99, the present disclosure provides a method as provided in method 97 or 98, wherein the exogenous promoter is a CAG promoter.

In another approach, method 100, the present disclosure provides a method as provided in any one of methods 95 to 99, wherein the vector is a plasmid vector.

In another approach, method 101, the present disclosure provides a method as provided in method 100, wherein the plasmid vector comprises the nucleotide sequence of SEQ ID NO:33 or SEQ ID NO: 34.

In another method, method 102, the present disclosure provides a method as provided in any one of methods 95 to 101, wherein the RNA-guided nuclease is Cas9 nuclease.

In another approach, method 103, the present disclosure provides a method as provided in method 102, wherein the Cas9 nuclease is linked to at least one Nuclear Localization Signal (NLS).

In another approach, method 104, the present disclosure provides a method as provided in methods 102 or 103, wherein the Cas9 nuclease is streptococcus pyogenes Cas 9.

In another method, method 105, the present disclosure provides a method as provided in any one of methods 95 to 104, wherein the PSC is an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a Hematopoietic Stem and Progenitor Cell (HSPC).

In another approach, method 106, the present disclosure provides a method as provided in any one of methods 95-105, wherein the PSC is a human PSC.

Examples VII. examples

The following examples describe the generation and characterization of universal donor cells according to the present disclosure. Table 1 lists tolerogenic factors that may be genetically modified in the cells, and table 2 lists survival factors that may be genetically modified in the cells. FIGS. 1A-1C depict various gene editing strategies that can be used for immune evasion.

TABLE 1 tolerogenic factors which can be genetically modified

Factor(s)	Knock Out (KO)	Knock (KI)
			HLA-E		+
HLA-G		+
			CTLA-4		+
CD47		+
			PD-L1		+
B2M	-
			HLA-ABC	-
CIITA	-

TABLE 2 survival factors that can be genetically modified

Factor(s)	Knock Out (KO)	Knock (KI)
			ZNF143	-
TXNIP	-
			FOXO	-
JNK	-
			MANF		+

Example 1: generation of B2M knockout IPSC

Guide rna (grna) selection for B2M. In order to identify a wide range of grnas capable of editing the B2M DNA target region, In Vitro Transcription (IVT) gRNA screens were performed. Grnas targeting B2M were designed to target exon 1 of the B2M gene. The B2M genomic sequence was submitted for analysis using gRNA design software. The resulting list of grnas was narrowed down to a list of about 200 grnas based on sequence uniqueness (only grnas that did not perfectly match elsewhere in the genome were screened) and minimal expected off-target. This set of grnas was transcribed in vitro and transfected into HEK293T cells constitutively expressing Cas9 using MessengerMax. Cells were harvested 48 hours post transfection, genomic DNA was isolated, and the cutting efficiency was evaluated using the TIDE assay. Guide RNAs with high insertion deletions and low predicted off-target effects were selected for further analysis. Table 3 presents the target sequences of selected B2M grnas.

TABLE 3 selected B2M gRNA target sequences

Screening for B2M grnas in IPSCs. Three grnas (B2M-1, B2M-2, and B2M-3) were used to edit ipscs. The position of the target sequence for each of these grnas is illustrated in fig. 2. IPSC (TC-1133 cell line, RUDCR, N.J.) cells were nuclear transfected with a mixture of RNPs (final concentrations of 125pmol Cas9 and 375pmol gRNA) from Cas9(Aldevron, Cat. No. 9212-5MG) and gRNA (Syntheto) at a molar ratio of 3:1(gRNA: Cas9) using a Lonza 4D nuclear transfection and P3 primary cell kit (Longza group (Lonza), Cat. No. V4 XP-3024). The cells were dissociated using Accutase (Stempro, Cat. No. A1110501), then resuspended in DMEM/F12 medium (Gibco, Cat. No. 11320033), counted using a Cellometer (Nexcellon, Inc.) and centrifuged. Cells were plated at 2X10³The concentration of individual cells/. mu.L was resuspended in P3 buffer with supplement 1(4.5:1 ratio). Will total 2x10⁵The individual cells were pooled with the RNP complex, transferred to a nuclear transfection cuvette (Longsha group kit) and subjected to nuclear transfection using the procedure CA-137. For each cuvette, 250 μ L of StemFlex medium (Gibco, cat # a3349401) with CloneR (Stem Cell Technologies, cat # 05888) (1:10 ratio) was used to resuspend the nuclear transfected cells. The cell suspension was dispensed into two wells of a vitronectin (Gibco, cat # a14700) coated 24-well plate with an additional 250 μ L of StemFlex with CloneR. Cells were cultured in a hypoxic incubator (37 ℃, 4% O)₂，8％CO₂) And recovering for 48 hours. After 48 hours, genomic DNA was harvested from one well of each technical replicate using a gDNA isolation kit (Qiagen, Cat. No. 69506)

PCR was performed on the isolated gDNA to determine the indel frequency. PCR of the relevant region was performed using Platinum Taq Supermix (Invitrogen, Cat. No. 125320176 and Cat. No. 11495017) with the B2M primer. The primer sequences are provided in table 4, and the position of the B2M primer relative to the gRNA target site is shown in fig. 2.

The cycling conditions are provided in table 5.

TABLE 4B 2M TIDE primers

Name (R)	Type (B)	Sequence (5'-3')	SEQ ID NO:
				B2MF2	Forward direction	CAGACAGCAAACTCACCCAG	4
B2MR2	Reverse direction	AAACTTTGTCCCGACCCTCC	5

TABLE 5B 2M PCR cycling parameters

The resulting amplicons were submitted for PCR clean-up and Sanger sequencing. Sanger sequencing results were entered into Tsunami along with the guide sequence. Percent indels and identity were calculated by the software (fig. 3A). The indel frequencies of B2M-1, B2M-2, and B2M-3 grnas were 2.5% ± 1.1%, 87.6% ± 14.1%, and 63.9% ± 0.9%, respectively (n ═ 2). FIGS. 3B and 3C present the distribution of insertion deletion results for B2M-2 (FIG. 3B) and B2M-3 gRNAs (FIG. 3C).

Cells in duplicate wells were maintained until confluent and then serially passaged into larger containers. The mixed population was transferred to Advanced 20/10/10 medium (see table 6) and laminin-521 (stem cell technologies, catalog No. 77004) for maintenance.

TABLE 6 Advanced 20/10/10 Medium formulation

B2M KO IPS clone was generated and characterized. The sequence-verified mixed-edited population (fig. 4A) was single-cell sorted into vitronectin-coated 96-well plates using FACS-ARIA (BD biosciences) and recovered in StemFlex with CloneR. Briefly, cells were dissociated from the maintenance flasks using Accutase and resuspended in StemFlex with CloneR. Cells were then counted using a Cellometer and diluted to 1x10⁵and/mL. 2mL of this dilution was filtered through a cell strainer (Furkon (Falcon), #352235) into a FACS tube, provided to the operator, and individual cells were sorted into individual wells. Plating single cells in a hypoxic incubator (37 ℃, 8% CO)₂，4％O₂) Medium was changed every other day until the colonies were large enough to re-inoculate as single cells. At the time of confluence, the samples were separated for maintenance and gDNA extraction (see above). The identity of the clones was confirmed via PCR and Sanger sequencing (for detailed information, see below). The sequences around the cleavage sites of the selected clones are presented in table 7 (deleted and/or inserted sequences are shown in bold).

TABLE 7 sequence analysis of B2M KO clones

The cloned sequences were aligned in the Snapgene software to determine the identity of the indels and the homozygosity or heterozygosity. As shown in fig. 4B, 8 clones were homozygous for B2M KO and 7 clones were heterozygous for B2M KO. Homozygous clones with the desired edits were amplified and further verified by sequencing and flow cytometry. Clones were initially maintained in StemFlex medium on vitronectin-coated plates and then finally switched to Advanced 20/10/10 medium and laminin-521 coated containers.

The cells were further maintained in laminin-521 coated flasks with Advanced 20/10/10. The indel identity of the edited clones was verified by PCR and Sanger sequencing of the B2M region. The knockdown was verified by: flow cytometry for B2M and HLA-a (see tables 8 and 9 for the list of antibodies utilized) and Taqman qPCR analysis of B2M expression using standard Taqman FastAdvanced Mastermix, zemer feishel (ThermoFisher), catalog No. 4444556). The B2M expression levels of the three B2M KO clones and wild type (unmodified) cells are presented in fig. 5. All three tested KO clones showed reduced mRNA expression of B2M relative to wild-type cells.

TABLE 8 antibodies for pluripotent flow cytometry

TABLE 9 antibodies against B2M and HLA-ABC

RNA extraction was performed using Qiagen RNeasy kit with rnase-free dnase (Qiagen, catalogue numbers 74104 and 79254) according to the manufacturer's instructions. cDNA synthesis was performed using the Advanced iScript cDNA synthesis kit for RT-qPCR (BioRad, catalog No. 1725037) according to the manufacturer's instructions. The karyotype status of the clones was evaluated by Karyostat service (sequoyielder) and by the tracking of known karyotypic abnormalities of BCL2L1 by ddPCR using the manufacturer's instructions and ddPCR super-mix (no dUTP) against the probe (burle, catalog No. 1863024; primers in table 10) using an annealing temperature of 59 ℃ and RPP30 as a reference assay.

TABLE 10 ddPCR primer Probe set

The resulting amplicons were gel checked on a pre-cast 2% agarose gel (seimer feishell, catalog number G501802) and submitted for PCR clearance and Sanger sequencing. The resulting sequencing file was entered into Tsunami software along with gRNA sequences and control sequence files to determine indel identity and percentage.

These clones were also confirmed by flow cytometry of clones as negative for both B2M and MHC class I antigen (HLA-A, B, C) expression with or without interferon- γ treatment (25ng/mL, R & D Systems, 285-IF). See fig. 6A-6D.

Clones were confirmed to retain pluripotency by flow cytometry against pluripotency cell surface markers (fig. 7A-7D). Additional confirmation of pluripotency include Taqman Scorecard (seimer fly-er, catalog number a15872), Thermo Pluritest service, and Trilineage differentiation (for complete protocol, see below).

Cells were dissociated and counted as above, then centrifuged and resuspended in Advanced 20/10/10 medium with 2 μ M Y-27632(Tocris Corp., Cat. No. 1245) up to 1X10⁶and/mL. The resuspended cells were then filtered through a 40 μ M filter (Fisherbrand, catalog No. 22363547) and 5mL of the suspension was plated into individual wells of an ultra-low attachment 6-well petri dish (Corning, catalog No. 3471). Cells were then placed on an orbital shaker at 98RPM overnight to form aggregates. After 16 hours, the spent media was removed from each well by careful plate swirling to collect aggregates. 4mL of fresh Advanced 20/10/10 was added.

After another 24 hours, the cells were allowed to differentiate. The aggregates were first collected into 50mL conical tubes and centrifuged at 1000RPM for 1min to precipitate the aggregates. The medium was aspirated and the aggregates were washed with DMEM/F12. The aggregates were again collected by centrifugation and resuspended in 4mL of the corresponding differentiation medium before returning to the petri dish and shaker. The following basal media were used for all differentiation: 480mL of IMDM + Glutamax (Gibco, Cat. No. 31980030), 480mL of F12+ Glutamax (Gibco, Cat. No. 31765035), 10mL of nonessential amino acids (Gibco, Cat. No. 11140076), 5mL of 20% BSA (Sigma, Cat. No. A7638-5G), 2mL of a chemically defined lipid (Gibco, Cat. No. 11905031), 1mL of 200mM ascorbic acid (Sigma, Cat. No. A4403-100MG), 1mL of 10MG/mL iron-saturated transferrin (Sigma, Cat. No. T0665), and 100 μ L of 140 μ G/mL sodium selenite (Sigma, Cat. No. S5261). To differentiate the cells into ectodermal cells, 4mg/mL insulin (Gibco, Cat. No. 12585014), 2. mu. M A83-01, 2. mu.M Dorsomorphin (Peptotak, Cat. No. 8666430), and 2. mu.M PNU-74654 at final concentrations were used for two days. To differentiate the cells into mesodermal cells, final concentrations of 1. mu.g/mL insulin, 0.1. mu.M PIK-90, 3. mu.M CHIR99021 (Peptaclet, Cat 2520691) and 0.5. mu.M LDN193189 (Peptaclet, Cat 1062443) were used for two days. For day 1 of endoderm differentiation, final concentrations of 0.2. mu.g/mL insulin, 0.1. mu.M PIK-90, 100ng/mL activin-A (Peptake, Cat. No. 120-00), 2. mu.M CHIR99021, and 20ng/mL basic FGF (Peptake, Cat. No. 101-18b) were used. Two more days of endoderm differentiation were performed using the following: 0.2. mu.g/mL insulin, 0.1. mu.M PIK-90, 100ng/mL activin A, and 0.25. mu.M LDN 193189. For all differentiation, the medium was changed daily. All were collected on day 3 for RNA analysis using Taqman Scorecard.

Example 2: cell maintenance and expansion.

Maintenance of hESC/hipSC. Such as Schulz et al (2012) PLoS ONE]7(5) e37004 cells of the human embryonic stem cell (hESC) line CyT49 were maintained, cultured, passaged, expanded and plated. CyT49 cells were used(Stem cell technology company 07920 or equivalent).

Human induced pluripotent stem cells (hipscs) such as TC1133 are subdividedThe cell line (Longsha group) was maintained in a StemFlex Complete (Life technologies, A3349401) on a tissue culture plate coated with BIOLAMINE 521 CTG (BioLamina, Cat. No. CT 521). Plates were pre-coated with 1:10 or 1:20 dilutions of BIOLAMININ DPBS, calcium, magnesium (life science 14040133) for 2 hours at 37 ℃. Cells were fed daily with StemFlex medium. For passaging cells, cells were used at the same density as CyT 49. To plate the cells as single cells, the cells were plated with 1% RevitaCell in StemFlex^TMSupplement (100X) (Saimer Feishale, catalog No. A2644501) was plated on BIOLAMININ-coated plates.

Single cell cloning of hpscs. For single cell cloning, in useHpscs (hescs or hipscs) were fed 3-4 hours before dissociation with StemFlex Complete with Revitacell (final concentration 1 × Revitacell). After dissociation, cells were sorted as single cells in each well of a BIOLAMININ coated 96-well tissue culture plate. Single cells were sorted into wells using a WOLF FACS sorter (nanocell). The plates were pre-filled with 100-. Three days after cell inoculation, cells were fed with fresh StemFlex and continued to be fed with 100-. After 10 days of growth, cells were fed daily with StemFlex until day 12-14. At this time, the board is usedDissociation and the collected cell suspension 1:2 was split, half into a new 96-well plate for maintenance and half into the DNA extraction solution QuickExtract^TMDNA extraction solution (Lucigen). After DNA extraction, PCR is performed to assess the presence or absence of the desired gene edit at the targeted DNA locus. Sanger sequencing was used to verify the required edits.

Amplification of single cell derived hPSC clones. For CyT49, successfully targeted clones were passaged to 24-well plates with pure 10% XF KSR a10H10 medium, rather than to BIOLAMININ coated plates. After the 24-well stage, CyT49 clones were passaged as described in Schulz et al (2012) PLoS ONE [ public science library. integration ]7(5): e 37004.

For hiPSC (TC1133), cells were maintained in the StemFlex Complete during the entire cloning and periodic maintenance on BIOLAMININ coated plates with Revitacell at the passage stage.

Example 3: generation of B2M knockout human pluripotent Stem cells (hPSCs)

Guide rna (grna) selection for B2M in hPSC. Three B2M-targeting grnas described above in example 1 were used to target the B2M gene in hPSC. To evaluate their cleavage efficiency in hpscs, CyT49 cells were electroporated with a Neon electroporator (Neon transfection kit, seimer femalyl, catalog No. MPK5000), with a Ribonucleoprotein (RNP) mixture of Cas9 protein (beohumei (Biomay)) and guide RNA (syntheo) in a molar ratio of 3:1(gRNA: Cas9) (125 pmol Cas9 and 375pmol gRNA absolute). To form RNP complexes, grnas and Cas9 were combined with R-buffer (Neon transfection kit) in one container to a total volume of 25 μ Ι _, and incubated at room temperature for 15 min. Use ofThe cells were dissociated and then resuspended in DMEM/F12 medium (Gibco, Cat. No. 11320033), counted using NC-200 (Chemometec) and centrifuged. Resuspending a total of 1X10 with RNP complex⁶Cells and add R-buffer to a total volume of 125 μ Ι _. The mixture was then electroporated with 2 pulses at 1100V for 30 ms. After electroporation, cells were pipetted out into Eppendorf tubes filled with StemFlex medium with RevitaCell. The cell suspension was then plated onto tissue culture dishes pre-coated with BIOLAMININ 521 CTG at a 1:20 dilution. Cells were cultured in an aerobic incubator (37 ℃, 8% CO)₂) And culturing for 48 hours. After 48 hours, genomic DNA was harvested from the cells using QuickExtract (Luxigen, Mildelton, Wis.; Cat. QE 09050).

PCR was performed against the target B2M sequence, and the cleavage efficiency of the resulting amplified DNA was evaluated by TIDE analysis. PCR of the relevant region was performed using Platinum Taq Supermix (Invitrogen, Cat. No. 125320176 and Cat. No. 11495017). The sequences of the PCR primers are presented in table 4; and the cycling conditions are as provided in table 5. The resulting amplicons were submitted for PCR clean-up and Sanger sequencing. Sanger sequencing results were entered into Tsunami software along with the guide sequence. Percent indels and identity were calculated by software. Specific grnas were then selected based on their frequency of indels in hpscs. Fig. 8 shows the cleavage efficiency of 3B 2M grnas.

Off-target of selected grnas was assessed in stem cell-derived DNA using hybrid capture analysis of sequence similarity predicted sites. The B2M-2 and B2M-3 guides showed no detectable off-target effect. B2M-2 gRNA was selected for further clonal production due to its high on-target activity and undetectable off-target activity.

B2M KO hPSC clones were generated and characterized. CyT49hESC were electroporated using B2M-2 gRNA and single cells were sorted 3 days after electroporation into BIOLAMININ 521 CTG-coated 96-well plates with StemFlex and Revitacell using WOLF FACS sorter (nano selike). Plating single cells in an aerobic incubator (37 ℃, 8% CO)₂) Medium was changed every other day until the colonies were large enough to re-inoculate as single cells. Upon pooling, the samples were separated for maintenance and genomic DNA extraction.

The B2M KO status of the clones was confirmed via PCR and Sanger sequencing. The resulting DNA sequences of the target B2M region were aligned in Snapgene software to determine the identity of indels and homozygosity or heterozygosity. Clones with the required edits were expanded and further validated by flow cytometry evaluation for B2M expression (see table 11 for a list of antibodies utilized). Clones were evaluated with or without interferon-gamma treatment (25ng/mL, R & D systems, Inc., 285-IF). Fig. 9A shows B2M expression in wild-type cells, and fig. 9B presents B2M expression in KO cells. The karyotype status of the clones was evaluated by the Cell Line Genetics service (madison, wisconsin) and normal karyotypes were reported.

TABLE 11 antibodies for pluripotent flow cytometry

Clone retention pluripotency was confirmed by intracellular flow cytometry against pluripotency markers OCT4 and SOX 2. The confirmed pluripotent clones were differentiated into pancreatic endocrine progenitor cells using a previously established method (Schulz et al (2012) PLoS ONE [ public science library. integration ]7(5): e 37004).

Example 4: generation of B2M knock-out PD-L1 knock-in human pluripotent Stem cells (hPSCs)

Design of B2M-KO PD-L1-KI strategy. Plasmid design to insert PD-L1(CD274) into the B2M locus was performed such that the start codon of B2M was removed after undergoing Homology Directed Repair (HDR) to insert PD-L1, thereby nullifying any opportunity for partial B2M expression. Figure 10 presents a schematic of the plasmid, and table 12 identifies the elements and positions therein. The donor plasmid contained the CAGGS promoter-driven PD-L1 cDNA flanked by 800 base pair homology arms with the same sequence as the B2M locus surrounding exon 1. The complete sequence of the plasmid is presented as SEQ ID NO 33.

TABLE 12 elements of the B2M-CAGGS-PD-L1 donor plasmid

Component	Position (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	12
LHA-B2M	145-944(800)	13
			CMV enhancer	973-1352(380)	14
Chicken beta-actin promoter	1355-1630(276)	15
			Chimeric introns	1631-2639(1009)	16
PD-L1	2684-3556(873)	17
			bGH poly (A) signal	3574-3798(225)	18
RHA-B2M	3805-4604(800)	19
			Right ITR	4646-4786(141)	20

B2M-2 gRNA was used to facilitate insertion of the PD-L1 transgene at the targeted B2M locus. The PD-L1 donor plasmid was introduced together with an RNP complex consisting of a gRNA targeting B2M and a Cas9 protein. Every 100 million CyT49 cells, 4. mu.g of plasmid DNA was delivered with RNP. Electroporation was performed as described in example 3. Seven days after electroporation, cells were sorted for PD-L1 surface expression using a WOLF FACS sorter (navosarter) into BIOLAMININ 521 CTG-coated 96-well plates with StemFlex and Revitacell. For FACS sorting, unedited cells served as negative controls. PD-L1 positive cells were selected for sorting and single cell cloning.

To detect PD-L1 surface expression, anti-PD-L1 fluorescent antibody was used (see table 11). Plating single cells in an aerobic incubator (37 ℃, 8% CO)₂) Medium was changed every other day until the colonies were large enough to re-inoculate as single cells. Upon pooling, the samples were separated for maintenance and genomic DNA extraction.

Correctly targeted clones were identified via PCR against the PD-L1 knock-in (KI) insertion using primers that amplify the region from outside the plasmid homology arm to the PD-L1 cDNA insertion, enabling amplification of only KI integrated DNA. Zygosity of the target insert was tested by PCR to assess whether KI occurred in heterozygous or homozygous fashion. If a heterozygous clone is identified, the KI negative allele is sent for Sanger sequencing to verify that it contains an indel that disrupts B2M. The correct KI clone with a complete B2M disruption (formed via KI insertion or indel) was expanded in an increased tissue culture format until a population size of 3000 ten thousand cells was reached. Approximately 10 clones were expanded in this manner and confirmed to be pluripotent by testing against OCT4 and SOX2 via intracellular flow cytometry (fig. 11). Clones that passed the above test were then further tested for karyotyping (Cell Line Genetics) as described below. In addition, the clones were then tested for their ability to differentiate into pancreatic endoderm Precursors (PEC) via an established protocol (Schulz et al (2012) PLoS ONE [ public science library. synthesis ]7(5): e37004), as described below. The loss of B2M was further confirmed by flow cytometry through the lack of B2M expression with or without interferon-gamma treatment (25ng/mL, R & D systems, inc., 285-IF). FIGS. 12A and 12B show PD-L1 expression in wild type and B2M KO/PD-L1 KI cells, respectively.

Example 5: generation of B2M knock-out HLA-E knock-in human pluripotent Stem cells (hPSCs)

Design of B2M-KO HLA-E-KI strategy. Plasmid design to insert HLA-E trimer into the B2M locus was performed such that the start codon of B2M was removed after undergoing Homology Directed Repair (HDR) to insert HLA-E trimer, thereby nullifying any opportunity for partial B2M expression. Fig. 13 presents a schematic of the plasmid, and table 13 identifies the elements and positions therein. The HLA-E trimeric cDNA is composed of the B2M signal peptide fused to an HLA-G presenting peptide fused to the B2M membrane protein, the B2M membrane protein fused to the HLA-E protein without its signal peptide. This trimer design has been previously published (Gornalusse et al (2017) nat. Biotechnol. [ Nature. Biotechnology ]35(8): 765-. The donor plasmid for HLA-E delivery contains the CAGGS promoter driving expression of HLA-E trimer flanked by 800 base pair homology arms with the same sequence as the B2M locus around exon 1. The complete sequence of the plasmid is presented as SEQ ID NO 34.

TABLE 13 elements of B2M-CAGGS-HLA-E Donor plasmid

Component	Position (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	12
LHA-B2M	145-944(800)	13
			CMV enhancer	973-1352(380)	14
Chicken beta-actin promoter	1355-1630(276)	15
			Chimeric introns	1631-2639(1009)	16
B2M Signal sequence	2684-2743(60)	21
			HLA-G peptides	2744-2770(27)	22
GS Joint	2771-2815(45)	23
			B2M membrane protein	2816-3112(297)	24
GS Joint	3113-3172(60)	25
			HLA-E	3173-4183(1011)	26
bGH poly (A) signal	4204-4428(225)	18
			RHA-B2M	4435-5234(800)	19
Right ITR	5276-5416(141)	20

B2M-2 gRNA was used to facilitate insertion of HLA-E transgene at the targeted B2M locus. HLA-E donor plasmid was introduced together with RNP complex consisting of gRNA targeting B2M and Cas9 protein. Every 100 million CyT49 cells, 4. mu.g of plasmid DNA was delivered with RNP. Electroporation was performed as described in example 3. Seven days after electroporation, cells were sorted for HLA-E surface expression using a WOLF FACS sorter (nanoseclatch) into BIOLAMININ 521 CTG-coated 96-well plates with StemFlex and Revitacell. For FACS sorting, unedited cells served as negative controls. HLA-E positive cells were selected for sorting and single cell cloning.

For the detection of HLA-E surface expression, anti-HLA-E fluorescent antibodies were used (Table 11). Plating single cells in an aerobic incubator (37 ℃, 8% CO)₂) Medium was changed every other day until the colonies were large enough to re-growThe inoculation is single cell. Upon pooling, the samples were separated for maintenance and genomic DNA extraction.

Correctly targeted clones were identified via PCR against HLA-E knock-in (KI) insertion using primers that amplify regions from outside the plasmid homology arms to the HLA-E cDNA insertion, thereby enabling amplification of only KI-integrated DNA. Zygosity of the target insert was tested by PCR to assess whether KI occurred in heterozygous or homozygous fashion. If a heterozygous clone is identified, the KI negative allele is sent for Sanger sequencing to verify that it contains an indel that disrupts B2M. The correct KI clone with a complete B2M disruption (formed via KI insertion or indel) was expanded in an increased tissue culture format until a population size of 3000 ten thousand cells was reached. Approximately 10 clones were expanded in this manner and confirmed to be pluripotent by testing against OCT4 and SOX2 via intracellular flow cytometry (fig. 14). Clones that passed the above test were then further tested for karyotyping (cell line genetic center). In addition, clones were tested for their ability to differentiate into pancreatic endoderm Precursors (PEC) via an established protocol (Schulz et al (2012) PLoS ONE [ public science library. complex ]7(5): e 37004). Loss of B2M was further confirmed by flow cytometry through lack of HLA-A, B, C expression with or without interferon- γ treatment (50ng/mL, R & D systems, 285-IF) (fig. 15). FIG. 16 shows HLA-E expression.

Example 6: karyotyping of edited clones

G-band karyotyping of edited Embryonic Stem (ES) cells. 100 ten thousand of the edited ES cells were passaged into T-25 culture flasks with medium (DMEM/F12+ 10% Xeno KSR with 10ng/mL activin and 10ng/mL heregulin). After overnight culture, three T25 culture flasks were shipped to a Cytogenetics Laboratory (Cytogenetics Laboratory) (Cell Line Genetics, Inc.) for karyotyping; FISH analysis against chromosomes 1, 12, 17, 20; and array comparative genomic hybridization (aCGH) analysis with a standard 8x60K array. The G band results for selected cells electroporated with non-cutting guides ("NCG"), B2M KO clone, B2M HO/PD-L1 HI clone ("V1-A") and B2M KO/HLA-E KI clone ("V2-A") are shown in Table 14.

TABLE 14 results of nuclear analysis of the G bands

Example 7: differentiation of edited human embryonic stem cells into Pancreatic Endoderm Cells (PEC)

Maintenance of edited human embryonic stem cells (ES). Edited human embryonic stem cells at different passages (P38-42) were passaged at 33,000 cells/cm for 4 days²Inoculation, or 50,000 cells/cm for 3 days passage²Inoculation, this passage with hESM medium (DMEM/F12+ 10% KSR +10ng/mL activin A and 10ng/mL heregulin) and finally 10% human AB serum.

Aggregation of edited human embryonic stem cells for PEC differentiation. By usingThe edited ES was dissociated into single cells, then centrifuged and resuspended at 100 ten thousand cells/ml in 2% StemPro (catalog No. A1000701, Invitrogen, Calif.) in DMEM/F12 medium, and a total of 3.5-4 million cells were spun at 8 RPM. + -. 0.5RPM for one 850cm²Roller bottles (catalog No. 431198, corning, n.y.) were inoculated for 18-20 hours prior to differentiation. Such as Schulz et al (2012) PLoS ONE]7(5) e37004 ES aggregates from edited human embryonic stem cells were differentiated into pancreatic lineages using roller bottles. Example 8: characterization of differentiated Pancreatic Endoderm Cells (PEC)

Flow cytometry for FOXA2 and SOX17 at stage 1 (DE) and CHGA, PDX1 and NKX6.1 at PEC. hESC-derived stage 1 aggregates or hESC-derived pancreatic aggregates were washed with PBS followed by ACCUMAX^TM(Cat. No. A7089, Sigma, Mo.) was enzymatically dissociated into a single cell suspension at 37 ℃. Addition of MACS separation buffer: (Catalog No. 130-. For intracellular marker staining, cells were fixed in 4% (wt/v) paraformaldehyde for 30min in FACS buffer (PBS, 0.1% (wt/v) BSA, 0.1% (wt/v) NaN₃) Washed with Perm buffer (PBS, 0.2% (v/v) Triton X-100 (Cat. A16046, Afa Aesar, Mass.), 5% (v/v) normal donkey serum, 0.1% (wt/v) NaN3) on ice for 30min, then washed with washing buffer (PBS, 1% (wt/v) BSA, 0.1% (wt/v) NaN3)₃) And (6) washing. The cells were incubated with blocking buffer (PBS, 0.1% (v/v) Triton X-100, 5% (v/v) normal donkey serum, 0.1% (wt/v) NaN₃) The diluted primary antibodies (Table 15) were incubated together overnight at 4 ℃. Cells were washed in IC buffer and then incubated with appropriate secondary antibodies at 4 ℃ for 60 min. Cells were washed in IC buffer and then FACS buffer. Flow cytometry data were obtained using a NovoCyte flow cytometer (asea Biosciences, brussel). Data were analyzed using FlowJo software (Tree Star, Inc.). Intact cells were identified based on forward (low angle) and lateral (orthogonal, 90 °) light scattering. Background was estimated using antibody controls and undifferentiated cells. In the figure, a representative flow cytometry plot for one of the subpopulations is shown. The numbers reported in the figure represent the percentage of total cells from the whole phylum.

TABLE 15 antibodies for flow cytometry to characterize differentiated PECs

In the DE stage, the population of FOXA2 and SOX17 double positive cells exceeded 90% of the total cells from CyT49 wild type differentiated cells. PD-L1KI/B2M KO, HLA-E KI/B2M KO and B2M KO cells showed comparable percent DE compared to wild-type cells (FIGS. 17A-17B and 18).

In the PEC phase, flow cytometry was performed against Chromogranin (CHGA), PDX1 and NKX 6.1. The heterogeneous population at the PEC stage included pancreatic progenitor cells, early endocrine (fig. 19). The distribution of the cell population from differentiated edited cells (PD-L1 KI/B2M KO or B2M KO) was very similar to wild-type cells according to the pie chart of the heterogeneous population (fig. 20).

Targeting RNAseq. Targeted RNAseq for gene expression analysis was performed using Illumina TruSeq and a custom panel of oligonucleotides targeting 111 genes. This panel contains mainly genes that are markers of developmental stages during pancreatic differentiation. At the end of each differentiation stage, 10 μ L of APV (aggregated pellet volume) was collected and extracted using Qiagen RNeasy or RNeasy 96 spin column protocol (including on-column dnase treatment). Quantification and quality control were performed using TapeStation in combination with Qubit, or by using Qiagen QIAxcel. 50-200ng of RNA was treated according to the Illumina TruSeq library preparation protocol consisting of: cDNA synthesis, hybridization of custom pools of oligonucleotides, washing, extension, ligation of bound oligonucleotides, PCR amplification of the library, and cleanup of the library; the resulting dsDNA library was then quantified and quality controlled using TapeStation in conjunction with Qubit, or by using Qiagen QIAxcel. The library was subsequently diluted to a concentration of 4nM and pooled, then denatured, spiked with PhiX control, and further diluted to 10-12pM before loading on an Illumina MiSeq sequencer. After the sequencing run, initial data analysis was performed automatically by BaseSpace, generating raw read counts for each custom probe. For each gene, these read counts for all probes corresponding to that gene are then summed and 1 read count is added (to prevent the downstream portion from reaching 0). Normalization was performed for gene SF3B2 and reads were generally visualized as fold changes compared to stage 0. When processing data for principal component analysis, normalization was performed using the DEseq method. Expression of the selected genes is shown in figure 21. The kinetic expression patterns of FOXA2, CHGA, PDX1 and NKX6.1 from PD-L1KI/B2M KO or B2M KO cells were similar to wild-type cells.

Confirmation of expression in PEC stages B2M and PD-L1. At the PEC stage, with or without interferon-gamma (50ng/ml)Aggregates were differentiated by laser for 48 hours. Aggregate was washed with PBS followed by ACCUMAX^TM(Cat. No. A7089, Sigma, Mo.) was enzymatically dissociated into a single cell suspension at 37 ℃. MACS separation buffer (catalog No. 130-. For surface marker staining, dissociated cells were incubated with fluorescent conjugated antibody diluted in MACS separation buffer for 20min, then washed in MACS separation buffer. Cells were resuspended in FACS buffer for flow acquisition. Flow cytometry data were obtained using a NovoCyte flow cytometer. As shown in fig. 22A-22F, B2M expression was below the limit of detection in differentiated PECs from PD-L1KI/B2M KO or B2M KO, and PDL1 was expressed in differentiated PECs from PD-L1KI/B2M KO cells.

Immunophenotype of PEC cells. In the PEC stage, differentiated aggregates were stimulated with or without interferon-gamma (50ng/ml) for 48 hours. Aggregates were harvested for MHC class I and class II staining. There was no MHC class II expression from wild type or edited cells (PD-L1 KI/B2M KO and B2M KO cells) at the PEC stage (FIGS. 23D-23F). HLA-ABC (MHC class I) expression is low (1.3% from wild type cells) and it is highly regulated following IFN- γ stimulation. However, HLA-ABC was not expressed in the edited cells (PD-L1 KI/B2M KO and B2M KO cells) even under IFN- γ stimulation (fig. 23A-23C).

Example 9: t cell activation/proliferation assay

The ability of PEC differentiated cells to trigger an immune response was tested via an in vitro human T cell activation/proliferation assay. Fresh donor PBMC were purchased from Hemacare and CD3+ T cells were purified using a human pan T cell isolation kit (Miltenyi, catalog No. 130-096-535). The isolated T cells were used as CellTrace according to the manufacturer's instructions^TMCFSE cell proliferation kit protocol (seimer feishell, catalog No. C34554) was labeled and incubated with differentiated PEC for 5 days. Dynabeads to be used for T cell expansion and activation^TMHuman T-activator CD3/CD28 (Saimer Feishale, catalog No. 11161D) was used as a positive controlT cells are activated. Individual T cells were labeled with CFSE and used as negative controls. The percentage of CD3+ CFSE + cells was measured to assess the percentage of T cell proliferation (fig. 24A-24D). WT PEC triggered T cell proliferation above T cell only controls. B2M KO and B2M KO/PD-L1 KI CyT49 derived PECs did not trigger T cell proliferation above the T cell only control, showing the low immunogenic properties of the edited cells.