Benzophin bicarbonate transporter from green algae

文档序号:751231 发布日期:2021-04-02 浏览:28次 中文

阅读说明:本技术 绿藻的bestrophin碳酸氢盐转运蛋白 (Benzophin bicarbonate transporter from green algae ) 是由 A·慕克吉 詹姆斯·V·莫罗尼 C·S·刘 L·C·M·麦金德 于 2019-07-12 设计创作,主要内容包括:本公开的方面涉及由于增加植物细胞内碳酸氢盐跨过膜的能力而具有增加的碳利用效率的基因修饰的植物和/或藻类。本公开的其他方面涉及制造这种植物和/或藻类以及栽培这些基因修饰的植物以增加碳利用效率和/或生长这些基因修饰的海藻以增加碳利用效率的方法。(Aspects of the present disclosure relate to genetically modified plants and/or algae having increased carbon utilization efficiency due to increased ability of bicarbonate to cross membranes within plant cells. Other aspects of the disclosure relate to methods of making such plants and/or algae and cultivating these genetically modified plants to increase carbon utilization efficiency and/or growing these genetically modified seaweeds to increase carbon utilization efficiency.)

1. A genetically altered plant or part thereof comprising one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell to enter the stroma of at least a portion of a chloroplast of the plant, or comprising one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the stroma to enter the lumen of at least a portion of a chloroplast of the plant.

2. The plant or portion thereof of claim 1, wherein the acquisition of bicarbonate membrane crossing capacity comprises expression of at least one of the chlorella bestrophin polypeptides.

3. The plant or portion thereof of claim 2, wherein the brastrophin polypeptide of a green alga is selected from the group consisting of a polypeptide consisting of a sequence identical to SEQ ID NO:1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and any combination thereof.

4. The plant or portion thereof of claim 3, wherein said chlorella bestrophin polypeptide is selected from the group consisting of a first polypeptide having at least 95% identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, and any combination thereof.

5. The plant or portion thereof of claim 2, wherein the chlorella bestrophin polypeptide is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 44, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 60, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 and 111, preferably selected from the group consisting of 10, 11, 15, 27, 28, 29, 42, 62 and 63.

6. The plant or part thereof of claim 2, wherein the bestrophin polypeptide of the green alga is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast within a plant cell.

7. The plant or part thereof of claim 6, wherein the plant cell is a mesophyll leaf cell.

8. The plant or portion thereof of claim 7, wherein the bestrophin polypeptide of the green alga is expressed in at least 70% of the mesophyll cells of the plant.

9. The plant or part thereof of claim 2, further comprising modulated expression of an endogenous carbonic anhydrase.

10. The plant or part thereof of claim 9, wherein said modulated expression is selected from the group consisting of increased expression, decreased expression, expression at a different location, and any combination thereof.

11. The plant or part thereof of claim 1, wherein the plant is selected from the group consisting of cowpea, soybean, cassava, rice, bean, wheat, and other C3 crop plants, and wherein the plant is not selected from the group consisting of corn, sorghum, and other C4 crop plants.

12. A plant or part thereof with increased carbon utilization efficiency comprising

At least one modified nucleic acid sequence comprising at least one coding sequence for a brastrophin polypeptide of a green alga in a plant or part thereof;

wherein a bestrophin polypeptide is expressed in a plant or part thereof; and

wherein the yield, growth rate or biomass is greater than or substantially similar to the yield, growth rate or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof which does not overexpress a bestrophin polypeptide, when said plant is cultivated under ambient carbon dioxide conditions.

13. The plant or part thereof of claim 12, wherein the bestrophin polypeptide is localized to the chloroplast envelope membrane or the chloroplast thylakoid membrane of at least one chloroplast of a plant cell, wherein the plant cell is a leaf mesophyll cell, and wherein the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

14. The plant or part thereof of claim 12, wherein the modified nucleic acid sequence is stably integrated into the nuclear genome of the plant.

15. The plant or portion thereof of claim 14, wherein the at least one modified nucleic acid sequence further comprises a second nucleic acid sequence encoding a signal peptide sequence or targeting sequence operably linked to at least one coding sequence for a bestrophin polypeptide of a green alga, wherein expression of the signal peptide sequence or targeting sequence results in localization of the bestrophin polypeptide to a chloroplast envelope or chloroplast thylakoid membrane of at least one chloroplast of a plant cell.

16. The plant or portion thereof of claim 12, wherein the brastrophin polypeptide of a green alga is selected from the group consisting of SEQ ID NOs: 1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and any combination thereof.

17. The plant or portion thereof of claim 12, wherein the chlorella bestrophin polypeptide is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 10, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 44, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 60, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably selected from the group consisting of 10, 11, 15, 27, 28, 29, 42, 62 and 63.

18. The plant or part thereof of claim 12, further comprising modulated expression of an endogenous carbonic anhydrase.

19. The plant or part thereof of claim 18, wherein said modulated expression is selected from the group consisting of increased expression, decreased expression, expression at a different location, and any combination thereof.

20. The plant or part thereof of claim 12, wherein the plant is selected from the group consisting of cowpea, soybean, cassava, rice, bean, wheat, and other C3 crop plants, and wherein the plant is not selected from the group consisting of corn, sorghum, and other C4 crop plants.

Technical Field

The present disclosure relates to genetically modified plants. In particular, the present disclosure relates to genetically modified plants containing the bestrophin bicarbonate transporter of green algae that preferably provide increased carbon utilization efficiency.

Background

Green algae and other photosynthetic water productionObjects are typically exposed to low and fluctuating CO in the natural environment2And (4) conditions. There are a number of factors that can reduce the CO of these organisms2Availability, which includes slow diffusion of gas in water, two inorganic carbon (Ci) forms of carbon dioxide (CO)2) And bicarbonate radical (HCO)3 -) Slow interconversion and pH change. Due to the variable natural environment, most aquatic photosynthetic organisms have evolved limited CO2A conditionally inducible carbon dioxide concentration mechanism (CCM). CCM allows aquatic photosynthetic organisms such as green algae to concentrate Ci efficiently for fixation by Rubisco (Giordano et al, Ann Rev Plant Bio 56:99-131,2005). The current CCM model of the green alga Chlamydomonas reinhardtii (Jungnick et al, Photosynth Res 121: 159) -173, 2014; Wang and Spalding, Plant Physiol 166:2040-2050,2014) comprises bicarbonate transporters on the plasma membrane and chloroplast envelope, which, as key components of CCM, allow Ci, in particular HCO3 -Move through the membrane. Interconversion of CO2And HCO3-The carbonic anhydrase of (C) is another important component of the CCM model (Mitra et al, Can J Bot 83:780-795, 2005; Moroney et al, Photosynth Res 109:133-149, 2011).

In chlamydomonas reinhardtii (c.reinhardtii), a compartment called the protein nucleus is located at the base of the chloroplast. The protein core is limited in CO2The position of the Rubisco was isolated under conditions (Kuchitsu et al, Plant Cell Phys 29: 1269-. Extensive networks of thylakoid and mini-tubules are associated with protein nuclei (Engel et al, Elife 13:04889,2015), presumably provided for use in HCO3 -The pathway to the protein core. Thylakoid carbonic anhydrase, CAH3, was found in these tubules and it was hypothesized that CAH3 converts HCO3 -Conversion to CO2For intraluminal fixation (Moroney and Ynalvez, Eukaryotic Cell 6: 1251-.

At high CO2Chlamydomonas reinhardtii cells grown under conditions (5% v/v) exhibited low affinity for Ci. When will accommodate high CO2Is exposed to lower CO2Condition (e.g., 0.0 of ambient)4% to less than<0.01% v/v), induction of high affinity Ci transporters has been reported. At the same time, CO is present in the cells2Will readily diffuse across membranes (Gutknecht et al, J.Gen.Physiol 69:779-3 -) Move to low CO2The position fixed by Rubisco can occur in cells grown under conditions (Moroney et al, Plant Physiol 83:460-463, 1987; Sultemeyer et al, Plant 176:256-260, 1988; Badger et al, Physiologia Plant 90:529-536, 1994; Ohnishi et al, Plant Cell 22:3105-3117, 2010). In addition, molecular and physiological studies have also confirmed the occurrence of multiple forms of Ci transporters on the plasma membrane and chloroplast envelope of cells (Amooso et al, Plant Physiol 116: 193-.

In cyanobacteria living in the marine environment, HCO is present at the plasma membrane3-Transporting high external Na, usually coupled to seawater+The ion concentration. In the freshwater environment where Chlamydomonas reinhardtii was found, transport was considered to be H+Coupled since Na+The concentration is relatively low (Morth et al, Nat Rev Mol Cell Biol 12:60-70,2011; Taylor et al, Trends Plant Sci 17:675-684, 2012). Thus, genomic studies with Chlamydomonas reinhardtii and Volvox artei have revealed the presence of H for sulfate and phosphate+And Na+Both conjugated transporters (Pootakham et al, Plant Physiol 153:1653-1668, 2010). It is not clear whether this type of ion coupling is also important for bicarbonate uptake.

To date, two high affinity bicarbonate transport proteins and one low affinity bicarbonate transport protein in Chlamydomonas reinhardtii have been characterized and are known to be at low CO2Functional under the condition. The first high affinity transporter, high light-activated protein 3(HLA3), is an ATP-binding cassette (ABC) -type transporter of the multidrug resistance protein family and is localized to the plasma membrane (Im and Grossman, 2002). Hla3 transcript consisting of high light and low CO2Condition twoInduced and controlled by a CCM 'master regulator' encoded by the Cia5 gene. Duanmu et al (2009) showed significant decreases in Ci affinity and Ci uptake in HLA3 RNAi knock-down mutants, supporting that the protein was in HCO3 -And (3) a role in transportation. The second high affinity transporter, low carbon inducible protein 1(LCI1), is a relatively small protein. LCI1 at low CO2Cells grown under conditions are strongly upregulated and have been localized to the plasma membrane (Ohnishi et al, Plant Cell 22:3105-3117, 2010). In addition, overexpression of the LCI1 protein in the Lcr1 (chlamydomonas strain lacking MYB-transcription factor) background resulted in increased Ci uptake. Thus, both HLA3 and LCI1 are considered Ci transporters located on the plasma membrane.

The third transporter, NAR1.2 (also known as LCIA), is a chloroplast envelope protein of the formate/nitrite transporter family. Although the NAR1.2 protein has a lower affinity for bicarbonate (e.g.to fall within the mM range1/2Revealed in the values), but expression of NAR1.2 in Xenopus Laevis (Xenopus Laevis) oocytes resulted in increased HCO3 -Uptake (Mariscal et al, prompt 157:421-433, 2006; Atkinson et al, Plant Biotechnol J5: 12497,2015). NAR1.2 has been shown to localize to the chloroplast envelope and is thought to be involved in Ci uptake, but the molecular mechanism for this is still unclear (Yamano et al, PNAS 112: 7315-. The results of the experiments indicate that NAR1.2 and HLA3 proteins have a cooperative role in CCM (Yamano et al, PNAS 112:7315-7320, 2015). At very low CO2Under the conditions, NAR1.2 has been shown to be in contact with low-CO2Can induce protein B (LCIB) conjugation. These results suggest a model in which LCIB participates in CO2Uptake and sequestration of CO leaked from protein nuclei2Whereas NAR1.2 participates in HCO3 -Uptake and transport pathways (Wang and Spalding, Plant Physiol 166:2040-2050, 2014).

In addition to the potential participation of proteins in CCM as described above, a variety of other protein roles have been suggested. For example, two soluble proteins, LCIB and LCIC, form a complex, and it has been observed that when cells adapt to very low CO2When the complex is in close association with the protein core (Yamano et al)Plant Cell Physiol 51: 1453-. Another example is provided by CCP1 and CCP2, which are other putative Ci transporters that have been shown to be localized to mitochondria (Atkinson et al, Plant Biotechnol J5: 12497,2015). This localization suggests that mitochondria are important in CCM function, but it is not clear what this mechanism may be, or what roles mitochondria may play.

Bestrophin is a family of membrane proteins that display Cl-Ca which is channel active and also acts as a voltage gate2+A modulator of a channel. Human and mouse bestrophin have been found to be on HCO3 -Has high permeability and conductivity (Qu and Hartzell, Am J Physiol Cell Physiol 294: C1371-C1377,2008). However, using protein alignment and phylogenetic tree analysis, amino acids in the phototrophic bestrophin proteins have been shown to show high diversity compared to their counterparts in mammals. For example, Ca formation in animal bestrophin2+The residues of the sensor were not conserved in the bestrophin-like proteins in Arabidopsis (AtBest1 and AtBest2), suggesting that Ca is not required for AtBest channel activation in chloroplasts2+. Therefore, during evolution, the heterologous proteins in phototrophic organisms have acquired electrophysiological properties that differ from those in mammals (Duan et al Journal of Integrated Plant Biology 58:848-858, 2016). LCI11 and Cre16.g662600 have been suggested as putative bestrophins in Chlamydomonas reinhardtii, and Cre16.g663400 was suggested as a bestrophin-like protein (Mackinder et al, Cell 171:133-147,2017), but these were not further characterized.

The present data only explicitly supports the need for five proteins in the influx of inorganic carbon (Ci) in Chlamydomonas reinhardtii, including HLA3, LCI1, LCIA, CAH3, and LCIB (Mackinder, New Phytologist 217:54-61,2018). As described above, these proteins localize to the plasma membrane and chloroplast envelope. The current model of Chlamydomonas reinhardtii CCM suggests that at least one additional transporter or channel in the chloroplast thylakoid membrane is required to maintain HCO3 -Flux from the substrate to CAH 3in the Chamber (Mackinder New Phytologist 2)17:54-61,2018). Moreover, the identification of functional bicarbonate transport proteins remains an important goal. Current research has identified many possible bicarbonate transport proteins, but only a few of these have promising experimental results and few mechanistic data are available.

Disclosure of Invention

To meet these needs, the present disclosure relates to a bestrophin polypeptide of green algae that acts as a bicarbonate transporter. Certain aspects of the present disclosure relate to a genetically altered plant or portion thereof comprising one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant. In some aspects, the disclosure relates to a genetically altered plant or portion thereof containing one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant. In some embodiments, the bicarbonate membrane crossing capacity is obtained as a result of expression of the bestrophin polypeptide of at least one green alga. In some embodiments, the bestrophin polypeptide of a green alga is selected from the group of SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 3. In some embodiments, the increase or provision of the ability of bicarbonate to cross the membrane is selected from the group consisting of: 1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, or any combination thereof. In some embodiments, the increase or provision of the ability of the bicarbonate across the membrane is a result of expression of a polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some embodiments, the increase or provision of the ability of the bicarbonate to cross the membrane is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 44, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 60, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably selected from the group of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63. In some embodiments, the polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast within a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the disclosure relates to a plant, or part thereof, having increased carbon utilization efficiency, comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant, or part thereof, wherein the bestrophin polypeptide is expressed in the plant, or part thereof, and wherein the yield, growth rate, or biomass (biomas) is greater than the yield, growth rate, or biomass or the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant, or corresponding WT part thereof, that does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions is substantially similar to the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant, or corresponding WT part thereof, that does not overexpress the bestrophin polypeptide when grown under ambient carbon dioxide conditions. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the disclosure relates to a plant, or part thereof, having increased water use efficiency, comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant, or part thereof, wherein the bestrophin polypeptide is expressed in the plant, or part thereof, and wherein the yield, growth rate, or biomass is greater than or substantially similar to the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant, or corresponding WT part thereof, that does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the present disclosure relates to plants, or parts thereof, having increased nitrogen use efficiency, containing at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant, or parts thereof, wherein the bestrophin polypeptide is expressed in the plant, or parts thereof, and wherein the yield, growth rate, or biomass is greater than or substantially similar to the yield, growth rate, or biomass from corresponding Wild Type (WT) plants, or corresponding WT parts thereof, that do not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the disclosure relates to a plant or part thereof with reduced photoinhibition comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant or part thereof, wherein the bestrophin polypeptide is expressed in the plant or part thereof, and wherein yield, growth rate or biomass is greater than or substantially similar to yield, growth rate or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof that does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some embodiments of any of the above embodiments, the modified nucleic acid sequence is stably integrated into the nuclear genome of the plant. In some embodiments of any of the above embodiments, the at least one modified nucleic acid sequence further comprises a second nucleic acid sequence encoding a signal peptide sequence or targeting sequence operably linked to at least one coding sequence for a bestrophin polypeptide of a green alga, wherein expression of the signal peptide sequence or targeting sequence results in localization of the bestrophin polypeptide to a chloroplast envelope or chloroplast thylakoid membrane of at least one chloroplast of a plant cell.

In some embodiments of any of the above embodiments, the increased carbon use efficiency, increased water use efficiency, increased nitrogen use efficiency, or reduced photoinhibition is a polypeptide selected from the group of a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID No. 3, or any combination thereof Results of expression of the peptide. In some embodiments of any of the above embodiments, the increased carbon utilization efficiency, increased water utilization efficiency, increased nitrogen utilization efficiency, or decreased photoinhibition is the result of expression of a polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some of any of the above embodiments, the increase or provision of the ability of the bicarbonate to cross the membrane is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 63, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably selected from the group of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63.

In some embodiments of any of the above embodiments, the plant is cowpea (i.e., black-eyed pea, cowpea (Vigna anguillata)), soybean (i.e., soybean (Glycine max)), cassava (i.e., manioc, cassava (Manihot esculenta)), rice (i.e., rice (Oryza sativa), Oryza sativa (Oryza glaberrima), Zizania species (Zizania spp)), wheat (i.e., Triticum aestivum, spelt, durum, wheat (Triticum aestivum), spelt (Triticum spelta), durum (Triticum durum), wheat species (Triticum spp)), barley (i.e., Hordeum vulgare), rye (Secale), oat (i.e., Avena), tomato (tomato), tomato (Solanum tuberosum)), or another crop plant, namely tomato (Solanum esculentum 3). In some embodiments, the plant is tobacco (i.e., Nicotiana tabacum, Nicotiana edwards sonii, Nicotiana plumbagninolia, Nicotiana longiflora) or Arabidopsis (i.e., Chorispora putida, Arabidopsis thaliana). In some embodiments of any of the above embodiments, the plant is not corn (i.e., maize, corn (Zea mays)), Sorghum (i.e., durra, foxtail millet, milo, Sorghum (Sorghum bicolor)), sugarcane (i.e., sugarcane (sugar cane), sugarcane (Saccharum officinale)), millet (i.e., dragon finger millet, common millet, pearl millet, chestnut, millet (Eleusine coracana), millet (Panicum milium), pearl millet (Pennisetum glaucum), millet (Setaria italica)), branch millet (i.e., Panicum paniculatum, couch grass, Panicum virginum), or another C4 crop plant.

In some embodiments, the plant part of any of the above embodiments is a leaf, stem, root, flower, seed, fruit, cell, or part thereof. In some embodiments, the plant part is a fruit. In some embodiments, the plant part is a kernel, bean, or tuber.

In some aspects, the present disclosure relates to a pollen grain or ovule of any of the above embodiments.

In some aspects, the disclosure relates to a protoplast produced by any of the above embodiments.

In some aspects, the disclosure relates to a tissue culture produced from a protoplast or cell of any of the above embodiments, wherein the cell or protoplast is produced from one of the plant parts in the group of leaf, anther, pistil, stem, petiole, root tip, fruit, seed, flower, cotyledon, hypocotyl, embryo, or meristem cells.

In some aspects, the disclosure relates to genetically altered seeds containing one or more genetic alterations that increase or provide the ability of bicarbonate to cross membranes. In some embodiments, the seed produces a plant having the ability of the bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant. In some embodiments, the seed produces a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant. In some embodiments, the plant expresses at least one bestrophin polypeptide from a green alga. In some embodiments, the bestrophin polypeptide of a green alga is selected from the group of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 or any combination thereof. In some embodiments, the plant expresses a polypeptide selected from the group consisting of SEQ ID NOs: 1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3, or any combination thereof, having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity. In some embodiments, the plant expresses at least one polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some embodiments, the plant expresses a polypeptide selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 13, SEQ ID NO 14, SEQ, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 65, 66, 67, 65, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 99, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably a polypeptide selected from the group of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63. In some embodiments, the polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of the plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant. In some embodiments, the plant is a cowpea, soybean, cassava, rice, bean (soy), wheat, or other C3 crop plant. In some embodiments, the plant is not a maize, sorghum, or other C4 crop plant.

In some embodiments of any of the above embodiments, the expression of endogenous carbonic anhydrase is modulated. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

Certain aspects of the present disclosure relate to methods of producing a plant with increased carbon utilization efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing the carbon utilization efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with increased water use efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing the water use efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with increased nitrogen use efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant, thereby increasing the nitrogen use efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with reduced photoinhibition, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby reducing photoinhibition of the plant.

In some aspects, the present disclosure relates to a method of producing a plant with increased growth or productivity (productivity), wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing growth or productivity of the plant.

In some embodiments of any of the above methods, the expression of endogenous carbonic anhydrase is modulated. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

In some aspects, the present disclosure relates to a method of growing a plant having increased carbon utilization efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases the carbon utilization efficiency as compared to a plant grown under the same conditions lacking the one or more genetic alterations.

In some aspects, the present disclosure relates to a method of growing a plant with increased water use efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) cultivating the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases water use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased nitrogen use efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases the efficiency of nitrogen utilization compared to a plant grown under the same conditions lacking the one or more genetic alterations.

In some aspects, the present disclosure relates to a method of growing a plant with reduced photoinhibition, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane reduces photoinhibition as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased growth or productivity, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) cultivating the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases growth or productivity as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased carbon utilization efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases carbon utilization efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant with increased water use efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases water use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased nitrogen use efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases nitrogen use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant with reduced photoinhibition, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane reduces photoinhibition as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased growth or productivity, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases growth or productivity as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some embodiments of any of the above methods, the seed, tissue culture, or protoplast has one or more genetic alterations that regulate the expression of endogenous carbonic anhydrase. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

In some embodiments of any of the above methods, the increase or provision of the ability of the bicarbonate across the membrane is a result of expression of at least one polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some embodiments of any of the above methods, the increase or provision of the ability of the bicarbonate to cross the membrane is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 63, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably at least one polypeptide selected from the group of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63. In some embodiments of any of the above methods, the plant is a cowpea, soybean, tapioca, rice, bean, wheat, or other C3 crop plant. In some embodiments of any of the above methods, the plant is not a maize, sorghum, or other C4 crop plant.

Certain aspects of the present disclosure relate to algae containing one or more genetic alterations that result in an increase in the ability of the algae to transport bicarbonate into the lumen of the chloroplasts of the algae. In some embodiments, increasing bicarbonate transport capacity is overexpression of a bicarbonate from a nucleic acid sequence identical to SEQ ID NO:1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3 at least one of the best variant polypeptides of the green algae of the group of third polypeptides having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity or at least 95% sequence identity, or any combination thereof. In some embodiments, increasing bicarbonate transport capacity is overexpression of a bicarbonate produced from a first polypeptide having at least 95% sequence identity to SEQ ID NO. 1, a second polypeptide having at least 95% sequence identity to SEQ ID NO. 2, a first polypeptide encoding a bicarbonate, a second polypeptide encoding a bicarbonate, and a third polypeptide,Results for a best variant of at least one of the foregoing bacteriophin polypeptides of the group of third polypeptides having at least 95% sequence identity with SEQ ID No. 3, or any combination thereof. In some embodiments, the polypeptide is localized to the chloroplast thylakoid membrane. In some embodiments, at least when the algae are present<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Under conditions, the polypeptide is overexpressed.

In some aspects, the disclosure relates to a green alga or portion thereof with increased bicarbonate transport comprising a modified nucleic acid sequence comprising a coding sequence for at least one bestrophin polypeptide of a green alga; wherein the bestrophin polypeptide is overexpressed; wherein the bestrophin polypeptide is located on a chloroplast thylakoid membrane; and wherein when in<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) When the algae are cultivated under conditions that yield, growth rate or biomass is greater than or substantially similar to that from corresponding Wild Type (WT) algae or WT parts thereof that do not overexpress at least one bestrophin polypeptide<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Yield, growth rate or biomass of a corresponding WT algae or corresponding WT fraction thereof cultivated under conditions that do not overexpress at least one bestrophin polypeptide. In some embodiments, the at least one chlorella bestrophin polypeptide is selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

In some aspects, the disclosure relates to<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) A green alga or a portion thereof having increased growth under conditions comprising a modified nucleic acid sequence comprising a coding sequence for at least one bestrophin polypeptide of a green alga; wherein the bestrophin polypeptide is overexpressed; wherein the bestrophin polypeptide is located on a chloroplast thylakoid membrane; and wherein when in<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) When cultivating algae under conditions that yield, growth rate, or biomass is greater than that obtained by overexpressing at least one of the best plantsThe yield, growth rate or biomass of a corresponding Wild Type (WT) alga or WT fraction thereof of the in polypeptide is substantially similar to that from<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Yield, growth rate or biomass of a corresponding WT algae or corresponding WT fraction thereof cultivated under conditions that do not overexpress at least one bestrophin polypeptide. In some embodiments, the at least one chlorella bestrophin polypeptide is selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

In some embodiments of any of the above seaweeds, the green algae is selected from the group of Chlamydomonas reinhardtii, Chlamydomonas eustigma, Volvox carterii f.

In some aspects, the present disclosure relates to methods of producing algae with increased carbon utilization efficiency, wherein the steps of the methods are: a) introducing a genetic alteration into an alga includes increasing the ability to transport bicarbonate into the lumen of chloroplasts of the alga, thereby increasing the carbon utilization efficiency of the alga. In some embodiments, the transport capacity is obtained by overexpressing a polypeptide selected from SEQ ID NO:1, a first polypeptide having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:2, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, or at least 95% sequence identity, and SEQ ID NO:3 at least one of the best variant polypeptides of the green algae of the group of third polypeptides having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity or at least 95% sequence identity, or any combination thereof. In some embodiments, increasing bicarbonate transport capacity is a result of over-expressing at least one chlorella bestrophin polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

Drawings

FIGS. 1A-1D show the similarity of Chlamydomonas reinhardtii genes (BST1, BST2, and BST3) and proteins (BST1, BST2, and BST3) to each other, and the similarity of BST1-3 to other bestrophin family proteins. Fig. 1A shows a schematic of BST1, BST2, and BST3 genes, where light grey boxes represent exons, thin grey lines represent introns, thick grey lines represent untranslated regions (UTRs), and overlapping lines (overlapping on exons and introns) indicate common regions shared by the three genes. FIG. 1B shows the location and orientation of the BST1, BST2, and BST3 genes on the Chlamydomonas reinhardtii genome. FIG. 1C shows an amino acid alignment of the BST1(SEQ ID NO:1), BST2(SEQ ID NO:2), and BST3(SEQ ID NO:3) proteins, with asterisks in the bottom row indicating the same amino acids in all three proteins. Fig. 1D shows a phylogenetic tree of the protein sequences of chlamydomonas reinhardtii BST1, BST2, and BST3 homologs in vascular plants (second group from top), non-vascular plants (third group from top), diatoms (fourth group from top), and green algae (group at bottom).

FIGS. 2A-2B show transcript analysis of Chlamydomonas reinhardtii genes BST1, BST2, and BST 3. FIG. 2A shows the results showing that wild type strains D66 and cia5 cells are low in CO2(in the air)<0.04%CO2) With high CO2(5% (v/v) CO in air2) Accumulation of BST1-3 in the PCR. FIG. 2B shows the display at high CO2(5% CO in air)2(v/v)) and switching to Low CO2(in the air)<0.04%CO2) Semi-quantitative RT-PCR time course of expression of BST1-3 in cDNA obtained from cells at 2 hours (2h), 4 hours (4h), 6 hours (6h), or 12 hours (12 h). Actin was used as a load control in both fig. 2A and fig. 2B, and the results shown were from one of the two replicates.

FIGS. 3A-3B show confocal microscope fluorescent protein images indicating localization of BST1-Venus, BST2-Venus, and BST3-Venus fusion proteins in Chlamydomonas reinhardtii. FIG. 3A shows the localization of BST1-Venus, BST2-Venus and BST3-Venus fusion protein expression in Chlamydomonas reinhardtii ("Venus" column), the localization of chloroplast thylakoids ("chloroplast" column) and the localization of the two relative to each other ("fusion" column). The scale bar is 5 μm. Fig. 3B shows a magnified image of the protein core from line "BST 1" in fig. 3A. The arrows highlight where BST1-Venus fluorescence is visible through the protein core inside the protein core in the thylakoid tubules. The scale bar is 1 μm. The images of both fig. 3A and 3B are representative images that are repeated multiple times.

FIG. 4 shows the results of qRT-PCR analysis of BST1-3 expression in RNAi knockdown strains bsi-1 and bsi-2 compared to wild type strain D66. Error bars indicate standard error of three biological replicates.

FIGS. 5A-5C show the pH and CO at different pH2Under these conditions, the RNAi knockdown strain, bsi-1, and the pmp1 and cia3 mutant strains, were analyzed for growth phenotype as compared to the wild type strain D66. The vertical dots represent three different cell concentrations; 10,000 cells, 5,000 cells and 2,500 cells. FIG. 5A shows very low CO2(0.01% CO in air)2(v/v)) conditions and pH of 7 or 8.4, results of growth phenotype analysis of the strains. FIG. 5B shows the process at low CO2(0.04% CO in air)2(v/v)) and pH of 7 or 8.4, results of growth phenotype analysis of the strains. FIG. 5C shows high CO2(5% CO in air)2(v/v)) conditions and pH of 7 or 8.4, results of growth phenotype analysis of the strains. The growth phenotype analysis experiment was repeated three times and the results shown are representative.

FIGS. 6A-6F show photosynthetic oxygen release activity of BST-RNAi lines 1 and 2, namely, bsi-1 and bsi-2, and D66. FIG. 6A shows low CO for adaptation at pH 8.42(<0.04%CO2)12 hours of bsi-1 and D66 from O2Release comparison CiCurve calculated K0.5(Ci) Value (C required for half maximum oxygen evolution)iConcentration). FIG. 6B shows low CO for adaptation at pH 8.42(<0.04%CO2)12 hours of bsi-1 and D66, will be at different CiThe amounts and oxygen release activity measured at different pH values were plotted as curves. FIG. 6C showsTo accommodate low CO at pH 7.82(<0.04%CO2)12 hours of bsi-1, bsi-2 and D66 from O2Release comparison CiCurve calculated K0.5(Ci) Value (C required for half maximum oxygen evolution)iConcentration). Symbol ". about" indicates K0.5(Ci) The difference in (P by student t test) was significant<0.05). FIG. 6D shows adaptation to low CO at pH 7.82(<0.04%CO2)12 hours of bsi-1, bsi-2 and D66, will be at different CiThe amounts and oxygen release activity measured at different pH values were plotted as curves. FIG. 6E shows adaptation to high CO at pH 7.82(>5%CO2)12 hours of bsi-1 and D66 from O2Release comparison CiCurve calculated K0.5(Ci) Value (C required for half maximum oxygen evolution)iConcentration). FIG. 6F shows adaptation to high CO at pH 7.82(>5%CO2)12 hours of bsi-1 and D66, will be at different CiThe amounts and oxygen release activity measured at different pH values were plotted as curves. For FIGS. 6A-6F, with each CiConcentrations were run in triplicate and error bars represent three biological replicates and are based on standard deviation. Vmax was set to 100% oxygen release activity for all strains.

FIGS. 7A-7D show inorganic carbon uptake for bsi-1 and D66. FIG. 7A shows intracellular (internal) C at pH 7.8iTime course of accumulation. FIG. 7B shows CO at pH 7.82(Ci) A fixed time course. FIG. 7C shows intracellular C at pH 8.4iTime course of accumulation. FIG. 7D shows CO at pH 8.42A fixed time course. Cells in elevated CO2(5% CO in air)2) Medium growth and then adaptation to low CO prior to assay2(<0.04%CO2) For 12 hours. Before running the assay, cells were harvested and endogenous C was depletediAnd triplicate samples were run at each time point. Error bars in FIGS. 7A-7D represent three biological replicates.

FIGS. 8A-8C show the BST3 knocked-out in mutant BST3 from the Chlamydomonas Library Item (CLiP). FIG. 8A shows a schematic of the BST3 gene, where exons are depicted as grey boxes, intronsDepicted as a black line and the untranslated regions as dark grey boxes. The position of the insert is shown as a light grey triangle and the primers detecting the insert are shown as small black arrows. FIG. 8B shows the results of a PCR reaction using the primers shown in FIG. 8A to confirm the position of the insert in bst 3. Lane 1, BST3F, and BST3R primers used WT strain D66 DNA as template; lane 2, CIB1F and BST3F primers used BST3 DNA as template; lane 3, CIB1R and BST3R primers used BST3 DNA as template; the primers BST3F and BST3R of lane 4 used BST3 DNA as a template. The size difference between lanes 1 and 4 shows the presence of the 1800bp cassette. FIG. 8C shows low CO in D66 and bst3 cells2(in the air)<0.04%CO2) High contrast ratio CO2(5% (v/v) CO in air2) BST1-3 accumulation in the PCR. As indicated by the red boxes, BST3 was not expressed in BST3 cells. Actin was used as a loading control.

FIGS. 9A-9D show the growth and measurement of inorganic carbon affinity of knockout strain bst3 compared to WT strain D66. FIG. 9A shows the process at low CO2(<0.04%CO2) Six days of bst3 and WT growth at pH 8.6 using OD730And (6) measuring. FIG. 9B shows the process at low CO2(<0.04%CO2) pH 8.6 growth of bst3 and WT in pH 8.6 for six days, measured at wavelengths 645 and 663 using chloroplast evaluation. FIG. 9C shows the oxygen release activity measured at pH 7.4 plotted as a curve for bst3 and D66. With each type CiConcentrations were run in triplicate. FIG. 9D shows the results from O for pH 7.4bst3 and D662Release comparison CiCurve calculated K0.5(Ci) Value (Ci concentration required for half-maximal oxygen release).

FIGS. 10A-10D show protein structural models of Chlamydomonas reinhardtii BST1, BST2, and BST 3. FIG. 10A shows a structural model of Chlamydomonas reinhardtii BST1-3 and Klebsiella pneumoniae (Kpbest) as monomers, with conserved residues inside selective pores, shown as overhanging shapes and labeled. Fig. 10B shows the secondary structure of BST1 homopentamer model shaded with local QMEAN scores (structure quality assessment scoring function). Fig. 10C shows the profile of the tunnel lumen drawn in black on the BST1 homopolymer model. Conserved residues from the BST1 model in fig. 10A are depicted as protruding shapes extending into the lumen of the channel. Fig. 10D shows the calculated electrostatic potential on the BST1 homopolymer model. The electrostatic potential is shown in the potential range of-4 kT/e (negative) to +4kT/e (positive).

FIG. 11 shows a process for inorganic carbon (C)i) Current CCM model of chlamydomonas reinhardtii for transport. BST1, BST2, and BST3 are shown as bicarbonate-transport channels (light gray, and dark gray rectangles) that localize to the chloroplast thylakoid membrane.

Detailed Description

The following description sets forth exemplary methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure, but is instead provided as a description of exemplary embodiments.

Genetically modified plants and seeds

Certain aspects of the present disclosure relate to plants or parts thereof containing one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant. In some aspects, the disclosure relates to a genetically altered plant, or portion thereof, containing one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant. In some embodiments, the bicarbonate membrane crossing capacity is obtained as a result of expression of the bestrophin polypeptide of at least one green alga. In some embodiments, the bicarbonate membrane crossing capacity is obtained as a result of expression of the bestrophin polypeptide of two or three green algae. In some embodiments, the bicarbonate membrane crossing capacity is obtained as a result of expression of the bestrophin polypeptides of four or more (e.g., five, six, seven, eight, nine, ten) green algae. In some embodiments, the BESTROPHIN polypeptide of the green alga is SEQ ID NO 1 (i.e., BESTROPIN 1, BST1, Cre16.g662600.t1.2), SEQ ID NO 2 (i.e., BESTROPIN 2, BST2, Cre16.g663400.t2.1), or SEQ ID NO 3 (i.e., BESTROPIN 3, BST3, Cre16.g663450.t 1.2). In some embodiments, the increase or provision of the ability of the bicarbonate across the membrane is selected from the group consisting of a first polypeptide having at least 70% sequence identity to SEQ ID NO. 1, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, a second polypeptide having at least 70% sequence identity to SEQ ID NO. 2, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, a second polypeptide having at least 70% sequence identity to SEQ ID NO. 3, results of expression of at least one polypeptide of the group of third polypeptides or any combination thereof of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity. In some embodiments, the increase or provision of the ability of the bicarbonate across the membrane is a result of expression of a polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

The term "BST 1," as well as upper case and italic versions thereof, refers to the genes and proteins of green algae, as described herein. In some embodiments, the term may refer to chlamydomonas reinhardtii genes and proteins, as described herein. In other embodiments, the term may refer to one or more homologs or orthologs of genes and proteins of any green algae species that also transport bicarbonate. In some embodiments, the term may refer to one or more paralogs of genes and proteins of any green algae species. In some embodiments, the green algae species is Chlamydomonas reinhardtii, Chlamydomonas eustigma, Volvox carterii f. SEQ ID NO. 1 provides Chlamydomonas reinhardtii BST1 protein. When denoted by all lower case letters in italics, means a mutant (e.g., knock-out) version of the gene/protein. In Chlamydomonas reinhardtii, the mutant version may be a single gene/protein. In other green algae species, the mutant version may be one, some or all of a homolog, ortholog, and/or paralog of the gene/protein.

The term "BST 2," as well as upper case and italic versions thereof, refers to the genes and proteins of green algae, as described herein. In some embodiments, the term may refer to chlamydomonas reinhardtii genes and proteins, as described herein. In other embodiments, the term may refer to one or more homologs or orthologs of genes and proteins of any green algae species that also transport bicarbonate. In some embodiments, the term may refer to one or more paralogs of genes and proteins of any green algae species. In some embodiments, the green algae species is Chlamydomonas reinhardtii, Chlamydomonas eustigma, Volvox carterii f. SEQ ID NO. 2 provides Chlamydomonas reinhardtii BST2 protein. When denoted by all lower case letters in italics, means a mutant (e.g., knock-out) version of the gene/protein. In Chlamydomonas reinhardtii, the mutant version may be a single gene/protein. In other green algae species, the mutant version may be one, some or all of a homolog, ortholog, and/or paralog of the gene/protein.

The term "BST 3," as well as upper case and italic versions thereof, refers to the genes and proteins of green algae, as described herein. In some embodiments, the term may refer to chlamydomonas reinhardtii genes and proteins, as described herein. In other embodiments, the term may refer to one or more homologs or orthologs of genes and proteins of any green algae species that also transport bicarbonate. In some embodiments, the term may refer to one or more paralogs of genes and proteins of any species of green algae. In some embodiments, the green algae species is Chlamydomonas reinhardtii, Chlamydomonas eustigma, Volvox carterii f. SEQ ID NO 3 provides Chlamydomonas reinhardtii BST3 protein. When denoted by all lower case letters in italics, means a mutant (e.g., knock-out) version of the gene/protein. In Chlamydomonas reinhardtii, the mutant version may be a single gene/protein. In other green algae species, the mutant version may be one, some or all of a homolog, ortholog, and/or paralog of the gene/protein.

In some embodiments, the increase or provision of the ability of bicarbonate to cross the membrane is a result of expression of a polypeptide from or having a high percentage of identity to one of the following groups: SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 44, SEQ ID NO 55, SEQ ID NO, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 80, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably selected from the group consisting of 10, 11, 15, 27, 28, 29, 42, 62 or 63. The phrases "high percent identical," "high percent identity," or "high sequence identity" and grammatical variations thereof in the context of two polynucleotides or polypeptides refer to two or more sequences or subsequences that have at least about 80% identity, at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide or amino acid identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In exemplary embodiments, there is a high percentage of identity over a region of the sequence that is at least about 16 nucleotides or amino acids in length. In another exemplary embodiment, there is a high percentage of identity over a region of the sequence that is at least about 50 nucleotides or amino acids in length. In yet another exemplary embodiment, there is a high percentage of identity over a sequence region that is at least about 100 nucleotides or amino acids in length or longer. In an exemplary embodiment, the sequences are a high percentage identical over the entire length of the polynucleotide or polypeptide sequence.

In some embodiments, the polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast within a plant cell. In some embodiments, the polypeptide is capable of moving bicarbonate (HCO)3 -) Across the membrane. In some embodiments, the polypeptide is capable of moving chloride anions (Cl)-) Across the membrane. In some embodiments, the polypeptide is capable of moving an HCO3 -And Cl-Both across the membrane. In some embodiments, the polypeptide is capable of moving negatively charged ions across the membrane. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant. In some embodiments, the polypeptide oligomerizes to form a pentamer. In some embodiments, the polypeptide oligomerizes to form a homopolymeric pentamer. In some embodiments of the present invention, the substrate is,pentamers or homopentamers have access pockets with primarily negative hydrostatic potential and selective pores with neutral/positive charge. In some embodiments, the homopolymer transports negatively charged ions.

In some aspects, the disclosure relates to a plant, or part thereof, having increased carbon utilization efficiency, comprising a sequence of at least one modified nucleic acid having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant, or part thereof, wherein the bestrophin polypeptide is expressed in the plant, or part thereof, and wherein the yield, growth rate, or biomass is greater than or substantially similar to the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof that does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions. As used herein, the term "ambient carbon dioxide" refers to CO without any addition or removal2The carbon dioxide content of the air. In some embodiments, the ambient carbon dioxide conditions are carbon dioxide conditions of 400-500ppm, 400-550ppm, 400-600ppm, 400-650ppm, 400-700ppm, 450-500ppm, 450-550ppm, 450-600ppm, 450-650ppm, 450-700ppm, 500-550ppm, 500-600ppm, 500-650ppm, 500-700ppm, 550-600ppm, 550-650ppm, 550-700ppm, 600-650ppm, 600-700ppm, or 650-700 ppm. As used herein, the term "carbon utilization efficiency" may refer to the proportion of carbon taken from the environment that is incorporated into the biomass of a plant. Carbon utilization efficiency can be measured by any method known in the art (e.g., the total amount of carbon absorbed by the plant minus the amount of carbon lost through plant respiration, then dividing this value by the total amount of carbon absorbed by the plant, etc.). In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the present disclosure relates to a plant, or part thereof, having increased water use efficiency, comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant, or part thereof, wherein the bestrophin polypeptide is expressed in the plant, or part thereof, and wherein the yield, growth rate, or biomass is greater than the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant, or corresponding WT part thereof, that does not overexpress the bestrophin polypeptide or the yield, growth rate, or biomass is substantially similar to the yield, growth rate, or biomass from a corresponding Wild Type (WT) plant, or corresponding WT part thereof, that does not overexpress the bestrophin polypeptide, grown under ambient carbon dioxide conditions. As used herein, the term "water use efficiency" refers to the ratio of carbon assimilation to water consumption in a plant. Measurements of water use efficiency include, but are not limited to, intrinsic water use efficiency and immediate water use efficiency. The instantaneous water use efficiency can be calculated by determining the ratio between plant carbon assimilation and plant transpiration. The inherent water use efficiency can be calculated by determining the ratio between plant carbon assimilation and plant stomatal permeability. Measurements of carbon assimilation may include, but are not limited to, plant photosynthetic rate, yield, and biomass. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the present disclosure relates to plants or parts thereof having increased nitrogen use efficiency, comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in a plant or part thereof, wherein the bestrophin polypeptide is expressed in the plant or part thereof, and wherein the yield, growth rate or biomass is greater than the yield, growth rate or biomass or the yield, growth rate or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof which does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditionsThe growth rate or biomass is substantially similar to the yield, growth rate or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof grown under ambient carbon dioxide conditions that does not overexpress the bestrophin polypeptide. As used herein, the term "nitrogen utilization efficiency" refers to the ratio of nitrogen used by a plant for metabolism to the total nitrogen supplied to the plant. Nitrogen utilization efficiency can be determined by any method known in the art (e.g.,15n isotope labeling, agronomic efficiency, apparent nitrogen recovery). Sources of nitrogen supplied to plants include, but are not limited to, nitrogen contained in soil, nitrogen supplied by nitrogen-fixing bacteria, and nitrogen contained in fertilizers. In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some aspects, the present disclosure relates to a plant or part thereof with reduced photoinhibition comprising at least one modified nucleic acid sequence having at least one coding sequence for a bestrophin polypeptide of a green alga in the plant or part thereof, wherein the bestrophin polypeptide is expressed in the plant or part thereof, and wherein the yield, growth rate or biomass is greater than or substantially similar to the yield, growth rate or biomass from a corresponding Wild Type (WT) plant or corresponding WT part thereof that does not overexpress the bestrophin polypeptide when the plant is grown under ambient carbon dioxide conditions. As used herein, the term "photoinhibition" refers to a photoinduced reduction in photosynthetic production in a plant. Photoinhibition can be measured by any method known in the art (e.g., rate of oxygen release upon photosaturation, ratio of variable level to maximum level of chloroplast fluorescence). In some embodiments, the bestrophin polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant.

In some embodiments of any of the above embodiments, the modified nucleic acid sequence is stably integrated into the nuclear genome of the plant. In some embodiments of any of the above embodiments, the at least one modified nucleic acid sequence additionally comprises a second nucleic acid sequence encoding a signal peptide sequence or targeting sequence operably linked to at least one coding sequence for a bestrophin polypeptide of a green alga, wherein expression of the signal peptide sequence or targeting sequence results in localization of the bestrophin polypeptide to a chloroplast envelope or chloroplast thylakoid membrane of at least one chloroplast of a plant cell. In some embodiments, the signal peptide sequence or targeting sequence is a leader sequence. In some embodiments, the signal peptide sequence or targeting sequence is any sequence known in the art that results in the expression of a polypeptide in the chloroplast envelope or the chloroplast thylakoid membrane.

In some embodiments of any of the above embodiments, the increased carbon use efficiency, increased water use efficiency, increased nitrogen use efficiency, or decreased photoinhibition is at least 70% sequence identity to SEQ ID No. 1, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity to a first polypeptide having at least 70% sequence identity to SEQ ID No. 2, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity to a second polypeptide having at least 70% sequence identity to SEQ ID No. 2, (iii) a third polypeptide having at least 70% sequence identity to SEQ ID No. 3, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, or any combination thereof. In some embodiments of any of the above embodiments, the increased carbon utilization efficiency, increased water utilization efficiency, increased nitrogen utilization efficiency, or reduced photoinhibition is the result of expression of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

In some of any of the above embodiments, the increase or provision of the ability of the bicarbonate to cross the membrane is from the group SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 63, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably selected from the group consisting of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63.

In some embodiments of any of the above embodiments, the plant is cowpea (i.e., black-eyed pea, cowpea (Vigna anguillata)), soybean (i.e., soybean (Glycine max)), cassava (i.e., manioc, cassava (Manihot esculenta)), rice (i.e., rice (Oryza sativa), Oryza sativa (Oryza glaberrima), Zizania species (Zizania spp)), wheat (i.e., Triticum aestivum, spelt, durum, wheat (Triticum aestivum), spelt (Triticum spelta), durum (Triticum durum), wheat species (Triticum spp)), barley (i.e., Hordeum vulgare), rye (Secale), oat (i.e., Avena), tomato (tomato), tomato (Solanum tuberosum)), or another crop plant, namely tomato (Solanum esculentum 3). In some embodiments, the plant is tobacco (i.e., Nicotiana tabacum, Nicotiana edwards sonii, Nicotiana plumbagninolia, Nicotiana longiflora) or Arabidopsis (i.e., Chorispora putida, Arabidopsis thaliana). In some embodiments of any of the above embodiments, the plant is not corn (i.e., maize, corn (Zea mays)), Sorghum (i.e., durra, foxtail millet, milo, Sorghum (Sorghum bicolor)), sugarcane (i.e., sugarcane (sugar cane), sugarcane (Saccharum officinale)), millet (i.e., dragon finger millet, common millet, pearl millet, chestnut, millet (Eleusine coracana), millet (Panicum milium), pearl millet (Pennisetum glaucum), millet (Setaria italica)), branch millet (i.e., Panicum paniculatum, couch grass, Panicum virginum), or another C4 crop plant.

In some embodiments, the plant part of any of the above embodiments is a leaf, stem, root, flower, seed, fruit, cell, or part thereof. In some embodiments, the plant part is a fruit. In some embodiments, the plant part is a kernel, bean, or tuber.

In some aspects, the present disclosure relates to a pollen grain or ovule of any of the above embodiments.

In some aspects, the disclosure relates to a protoplast produced by any of the above embodiments.

In some aspects, the disclosure relates to a tissue culture produced from a protoplast or cell of any of the above embodiments, wherein the cell or protoplast is produced from one of the plant parts in the group of leaf, anther, pistil, stem, petiole, root tip, fruit, seed, flower, cotyledon, hypocotyl, embryo, or meristem cells.

In some aspects, the disclosure relates to genetically altered seeds containing one or more genetic alterations that increase or provide the ability of bicarbonate to cross membranes. In some embodiments, the seed produces a plant having the ability of the bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant. In some embodiments, the seed produces a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant. In some embodiments, the plant expresses at least one bestrophin polypeptide from a green alga. In some embodiments, the bestrophin polypeptide of a green alga is SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, or any combination thereof. In some embodiments, the plant expresses a first polypeptide having at least 70% sequence identity to SEQ ID No. 1, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity, a second polypeptide having at least 70% sequence identity to SEQ ID No. 2, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity, a first polypeptide having at least 70% sequence identity to SEQ ID No. 1, at least 71%, 72%, or at least 95% sequence identity to SEQ ID No. 3, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, or any combination thereof. In some embodiments, the plant expresses a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some embodiments, the plant expresses a polypeptide from the group SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 19, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 21, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 17, SEQ ID NO, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 65, 66, 67, 65, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 99, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 94, SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably a polypeptide selected from the group consisting of 10, 11, 15, 27, 28, 29, 42, 62 or 63. In some embodiments, the polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of the plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant. In some embodiments of any of the above embodiments, the plant is cowpea (i.e., black-eyed pea, cowpea (Vigna anguillata)), soybean (i.e., soybean (Glycine max)), cassava (i.e., manioc, cassava (Manihot esculenta)), rice (i.e., rice (Oryza sativa), Oryza sativa (Oryza glaberrima), Zizania species (Zizania spp)), wheat (i.e., Triticum aestivum, spelt, durum, wheat (Triticum aestivum), spelt (Triticum spelta), durum (Triticum durum), wheat species (Triticum spp)), barley (i.e., Hordeum vulgare), rye (Secale), oat (i.e., Avena), tomato (tomato), tomato (Solanum tuberosum)), or another crop plant, namely tomato (Solanum esculentum 3). In some embodiments, the plant is tobacco (i.e., Nicotiana tabacum, Nicotiana edwards sonii, Nicotiana plumbagninolia, Nicotiana longiflora) or Arabidopsis (i.e., Chorispora putida, Arabidopsis thaliana). In some embodiments of any of the above embodiments, the plant is not corn (i.e., maize, corn (Zea mays)), Sorghum (i.e., durra, foxtail millet, milo, Sorghum (Sorghum bicolor)), sugarcane (i.e., sugarcane (sugar cane), sugarcane (Saccharum officinale)), millet (i.e., dragon finger millet, common millet, pearl millet, chestnut, millet (Eleusine coracana), millet (Panicum milium), pearl millet (Pennisetum glaucum), millet (Setaria italica)), branch millet (i.e., Panicum paniculatum, couch grass, Panicum virginum), or another C4 crop plant.

In some embodiments of any of the above embodiments, the expression of endogenous carbonic anhydrase is modulated. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

Methods of producing and cultivating genetically altered plants

Certain aspects of the present disclosure relate to methods of producing a plant with increased carbon utilization efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing the carbon utilization efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with increased water use efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing the water use efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with increased nitrogen use efficiency, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant, thereby increasing the nitrogen use efficiency of the plant.

In some aspects, the present disclosure relates to methods of producing a plant with reduced photoinhibition, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby reducing photoinhibition of the plant.

In some aspects, the present disclosure relates to a method of producing a plant with increased growth or productivity, wherein the steps of the method are: a) introducing a genetic alteration into a plant resulting in an increase or providing the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplast of the plant or an increase or providing the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant, thereby increasing growth or productivity of the plant. Measurements of increased growth may include, but are not limited to, faster growth rate, larger plants, increased biomass, increased dry mass, increased shoot mass, and increased root mass. Measurements of increased yield may include, but are not limited to, higher crop yield, greater leaf number, and fewer days to crop maturity.

In some embodiments of any of the above methods, the expression of endogenous carbonic anhydrase is modulated. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

In some aspects, the present disclosure relates to a method of growing a plant having increased carbon utilization efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases the carbon utilization efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant with increased water use efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) cultivating the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases water use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased nitrogen use efficiency, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases the efficiency of nitrogen utilization compared to a plant grown under the same conditions lacking the one or more genetic alterations.

In some aspects, the present disclosure relates to a method of growing a plant with reduced photoinhibition, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) growing the plant under conditions wherein the ability of the bicarbonate to cross the membrane reduces photoinhibition as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased growth or productivity, wherein the steps of the method are: a) providing a seed having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane, wherein the seed produces a plant having the ability of bicarbonate to cross the membrane from the cytoplasm of a plant cell into the stroma of at least a portion of the chloroplasts of the plant or a plant having the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; b) cultivating the plant under conditions wherein the ability of the bicarbonate to cross the membrane increases growth or productivity as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased carbon utilization efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases carbon utilization efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant with increased water use efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases water use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased nitrogen use efficiency, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases nitrogen use efficiency as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant with reduced photoinhibition, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane reduces photoinhibition as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some aspects, the present disclosure relates to a method of growing a plant having increased growth or productivity, wherein the steps of the method are: a) providing a tissue culture or protoplast having one or more genetic alterations that increase or provide the ability of bicarbonate to cross the membrane; b) regenerating the tissue culture or protoplast into a plantlet; c) growing a plantlet into a plant, wherein the plant has the ability of bicarbonate to cross the membrane from the cytoplasm of the plant cell into the stroma of at least a portion of the chloroplasts of the plant or the ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplasts of the plant; d) transplanting the plant into a condition wherein the ability of the bicarbonate to cross the membrane increases growth or productivity as compared to a plant lacking the one or more genetic alterations grown under the same conditions.

In some embodiments of any of the above methods, the seed, tissue culture, or protoplast has one or more genetic alterations that regulate the expression of endogenous carbonic anhydrase. In some embodiments, the modulated expression may be increased expression, decreased expression, expression at a different location, or any combination thereof.

In some embodiments of any of the above methods, the increase or provision of the ability of the bicarbonate across the membrane is a result of expression of at least one polypeptide selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. The increase or provision of the ability of bicarbonate to cross the membrane of any of the above methods is selected from the group consisting of SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 44, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 60, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 or 111, preferably at least one polypeptide selected from the group consisting of SEQ ID NO 10, 11, 15, 27, 28, 29, 42, 62 or 63. In some embodiments, the polypeptide is localized to the chloroplast envelope or thylakoid membrane of at least one chloroplast of the plant cell. In some embodiments, the plant cell is a mesophyll leaf cell. In some embodiments, the polypeptide is expressed in at least 70% of the leaf mesophyll cells of the plant. In some embodiments of any of the above embodiments, the plant is cowpea (i.e., black-eyed pea, cowpea (Vigna anguillata)), soybean (i.e., soybean (Glycine max)), cassava (i.e., manioc, cassava (Manihot esculenta)), rice (i.e., rice (Oryza sativa), Oryza sativa (Oryza glaberrima), Zizania species (Zizania spp)), wheat (i.e., Triticum aestivum, spelt, durum, wheat (Triticum aestivum), spelt (Triticum spelta), durum (Triticum durum), wheat species (Triticum spp)), barley (i.e., Hordeum vulgare), rye (Secale), oat (i.e., Avena), tomato (tomato), tomato (Solanum tuberosum)), or another crop plant, namely tomato (Solanum esculentum 3). In some embodiments, the plant is tobacco (i.e., Nicotiana tabacum, Nicotiana edwards sonii, Nicotiana plumbagninolia, Nicotiana longiflora) or Arabidopsis (i.e., Chorispora putida, Arabidopsis thaliana). In some embodiments of any of the above embodiments, the plant is not corn (i.e., maize, corn (Zea mays)), Sorghum (i.e., durra, foxtail millet, milo, Sorghum (Sorghum bicolor)), sugarcane (i.e., sugarcane (sugar cane), sugarcane (Saccharum officinale)), millet (i.e., dragon finger millet, common millet, pearl millet, chestnut, millet (Eleusine coracana), millet (Panicum milium), pearl millet (Pennisetum glaucum), millet (Setaria italica)), branch millet (i.e., Panicum paniculatum, couch grass, Panicum virginum), or another C4 crop plant.

Genetically altered seaweed

Certain aspects of the present disclosure relate to algae containing one or more genetic alterations that result in an increase in the ability of the algae to transport bicarbonate into the lumen of the chloroplasts of the algae. In some embodiments, the increase in bicarbonate transport capacity is an overexpression of a first polypeptide selected from the group consisting of a first polypeptide having at least 70% sequence identity to SEQ ID NO. 1, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity, a second polypeptide having at least 70% sequence identity to SEQ ID NO. 2, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity to SEQ ID NO. 3, at least 70% sequence identity, results for a third polypeptide of at least one green alga of the group of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, or any combination thereof. In some embodiments, the increase in bicarbonate transport capacity is overexpression of a first polypeptide selected from the group consisting of a first polypeptide having at least 95% sequence identity to SEQ ID NO. 1, a second polypeptide having at least 95% sequence identity to SEQ ID NO. 2Results for a best variant of at least one chlorella polypeptide from the group of a second polypeptide having at least 95% sequence identity, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof. In some embodiments, the polypeptide is localized to the chloroplast thylakoid membrane. In some embodiments, at least when the algae are present<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Under conditions, the polypeptide is overexpressed.

In some aspects, the disclosure relates to a green alga or portion thereof having increased bicarbonate transport comprising a modified nucleic acid sequence comprising a coding sequence for at least one bestrophin polypeptide of a green alga; wherein the bestrophin polypeptide is overexpressed; wherein the bestrophin polypeptide is located on a chloroplast thylakoid membrane; and wherein when in<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) When the algae are cultivated under conditions that yield, growth rate or biomass is greater than or substantially similar to that from corresponding Wild Type (WT) algae or WT parts thereof that do not overexpress at least one bestrophin polypeptide<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Yield, growth rate or biomass of a corresponding WT algae or corresponding WT fraction thereof cultivated under conditions that do not overexpress at least one bestrophin polypeptide. In some embodiments, the at least one chlorella bestrophin polypeptide is selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

In some aspects, the disclosure relates to<100ppm of carbon dioxide (<0.01%[v/v]CO2in air) conditions comprising a modified nucleic acid sequence comprising a coding sequence for at least one bestrophin polypeptide of a green alga; wherein the bestrophin polypeptide is overexpressed; wherein the bestrophin polypeptide is located on a chloroplast thylakoid membrane; and wherein when in<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Yield, growth rate or organism when cultivating algae under conditionsIn an amount greater than or substantially similar to that from a corresponding wild-type (WT) alga or WT fraction thereof which does not overexpress at least one bestrophin polypeptide<100ppm carbon dioxide (in air)<0.01%[v/v]CO2) Yield, growth rate or biomass of a corresponding WT algae or corresponding WT fraction thereof cultivated under conditions that do not overexpress at least one bestrophin polypeptide. In some embodiments, the at least one chlorella bestrophin polypeptide is selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

In some embodiments of any of the above algae, the green algae is selected from the group of Chlamydomonas reinhardtii, Chlamydomonas eustigma, Volvox carterii f.

Methods of producing genetically altered algae

In some aspects, the present disclosure relates to methods of producing algae with increased carbon utilization efficiency, wherein the steps of the methods are: a) introducing a genetic alteration into an alga includes increasing the ability to transport bicarbonate into the lumen of chloroplasts of the alga, thereby increasing the carbon utilization efficiency of the alga. In some embodiments, the transport capacity is obtained by overexpressing a first polypeptide selected from the group consisting of a first polypeptide having at least 70% sequence identity to SEQ ID NO. 1, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity, a second polypeptide having at least 70% sequence identity to SEQ ID NO. 2, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or at least 95% sequence identity to SEQ ID NO. 3, at least 70% sequence identity, results for a third polypeptide of at least one green alga of the group of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or at least 95% sequence identity, or any combination thereof. In some embodiments, the increase in bicarbonate transport capacity is the result of over-expressing at least one begrophin polypeptide of a green alga selected from the group of a first polypeptide having at least 95% sequence identity to SEQ ID No. 1, a second polypeptide having at least 95% sequence identity to SEQ ID No. 2, a third polypeptide having at least 95% sequence identity to SEQ ID No. 3, or any combination thereof.

Molecular biological methods for producing transgenic plants and plant cells

One embodiment of the present invention provides plants or plant cells comprising one or more modified plant genes and/or introduced genes. For example, the present disclosure provides a transgenic plant having an increased or provided ability for bicarbonate to cross the membrane from the plant cell cytoplasm into the stroma of at least a portion of the chloroplasts of the plant. Further, the present disclosure provides transgenic plants having an increased or provided ability of bicarbonate to cross the membrane from the stroma into the lumen of at least a portion of the chloroplast of the plant. In addition, the disclosure provides transgenic plants having at least one modified nucleic acid sequence comprising at least one coding sequence for a bestrophin polypeptide of a green alga. Regulated expression of other genetic elements (e.g., endogenous carbonic anhydrase) is also contemplated and described herein.

Transformation and production of genetically altered monocot and dicot plant cells is well known in the art. See, e.g., Weising et al, Ann. Rev. Genet.22:421-477 (1988); us patent 5,679,558; agrobacterium Protocols, ed: Gartland, Humana Press Inc. (1995) and Wang et al, Acta Hort.461: 401-. The choice of method will vary with the type of plant to be transformed, the particular application, and/or the desired result. Appropriate transformation techniques are readily selected by the skilled practitioner.

Any method of deleting, inserting, or otherwise modifying cellular DNA (e.g., genomic DNA and organelle DNA) known in the art can be used to practice the invention disclosed herein. For example, a loss-of-function Ti plasmid containing a gene construct that deletes or inserts a target gene in Agrobacterium tumefaciens (Agrobacterium tumefaciens) can be used to transform a plant cell, and thereafter, a transformed plant can be regenerated from the transformed plant cell using a process described in the art, for example, a process described in EP 0116718, EP0270822, PCT publication WO 84/02913, and published european patent application ("EP") 0242246. The Ti-plasmid vectors each contain genes located between the border sequences of the T-DNA of the Ti-plasmid, or at least to the left of the right border sequence. Of course, other types of vectors can be used to transform plant cells using procedures such as direct gene transfer (e.g., as described in EP 0233247), pollen-mediated transformation (e.g., as described in EP 0270356, PCT publication WO 85/01856, and U.S. Pat. No. 4,684,611), plant RNA virus-mediated transformation (e.g., as described in EP 0067553 and U.S. Pat. No. 4,407,956), liposome-mediated transformation (e.g., as described in U.S. Pat. No. 4,536,475), and other methods such as for transforming maize (e.g., U.S. Pat. No. 6,140,553; Fromm et al, Bio/Technology (1990)8,833839); Gordon-Kamm et al, The Plant Cell, (1990)2,603618) and rice (Shimamoto et al, Nature, (1989)338,274276; methods for certain lines of Datta et al, Bio/Technology, (1990)8,736740) and methods generally used to transform monocots (PCT publication WO 92/09696). For cotton transformation, the method described in PCT patent publication WO 00/71733 can be used. For soybean transformation, reference is made to methods known in the art, for example, the methods of Hinche et al (Bio/Technology, (1988)6,915) and Christou et al (Trends Biotech, (1990)8,145) or WO 00/42207.

The transgenic plants of the invention can be used in conventional plant breeding protocols to produce more transgenic plants with the same characteristics, or to introduce genetic alterations in other varieties of the same or related plant species. The seed obtained from the transformed plant preferably contains the genetic alteration as a stable insert in the chromosomal or organelle DNA. Plants comprising a genetic alteration according to the present invention include or are derived from plants comprising the rhizome of a genetic alteration of the present invention, such as fruit trees or ornamental plants. Thus, any non-transgenic grafted plant part inserted on a transformed plant or plant part is included in the present invention.

The introduced gene elements that result in expression of the introduced gene, whether in an expression vector or cassette, will generally utilize a plant-expressible promoter. A 'plant-expressible promoter' as used herein refers to a promoter that ensures altered expression of a gene of the invention in a plant cell. Examples of promoters that direct constitutive expression in plants are known in the art and include: cucumber mosaic virus (CaMV), for example, the strong constitutive 35S promoter ("35S promoter") of isolates CM 1841(Gardner et al, Nucleic Acids Res, (1981)9,28712887), CabbB S (Franck et al, Cell (1980)21,285294) and CabbB JI (Hull and Howell, Virology, (1987)86,482493); promoters from The ubiquitin family (e.g., The maize ubiquitin promoter of Christensen et al, Plant Mol Biol, (1992)18, 675-689), gos2 promoter (de Pater et al, The Plant J (1992)2,834-844), emu promoter (Last et al, The door Appl Genet, (1990)81,581-588), actin promoters such as The promoter described by An et al (The Plant J, (1996)10,107), The rice actin promoter described by Zhang et al (The Plant Cell, (1991)3, 1155-1165); the promoters of the cassava vein mosaic virus (WO 97/48819, Verdaguer et al (Plant Mol Biol, (1998)37,1055-1067), the pPLEX series of promoters from the clover stunt virus (WO 96/06932, in particular the S4 or S7 promoter), alcohol dehydrogenase promoters, for example pAdh1S (GenBank accession numbers X04049, X00581) and the TR1 'and TR2' promoters (TR 1 'and TR2' respectively) which drive the expression of the 1 'and 2' genes of the T DNA (Velten et al, EMBO J, (1984)3,27232730).

Alternatively, the plant-expressible promoter may be a tissue-specific promoter, i.e. a promoter that directs higher levels of expression (such as the promoter of PEP carboxylase) in some cells or tissues of the plant, e.g. in green tissues. The Plant PEP carboxylase promoter (Pathirana et al, Plant J, (1997)12:293-304) has been described as a strong promoter for expression in vascular tissue and is used in one embodiment of the present invention. Alternatively, the Plant-expressible promoter may also be a wound-inducible promoter, such as the promoter of the pea cell wall invertase gene (Zhang et al, Plant Physiol, (1996)112: 1111-. By 'wound-inducible' promoter as used herein is meant that when a plant is wounded, either mechanically or by insect feeding, the expression of the coding sequence under the control of the promoter is significantly increased in that plant. These plant expressible promoters may be combined with enhancer elements, they may be combined with minimal promoter elements, or may include repetitive elements to ensure a desired expression profile.

In some embodiments, genetic elements that increase expression in plant cells can be utilized. For example, at the 5 'or 3' end of the introduced gene, or in an intron in the coding sequence of the introduced gene, e.g., the hsp70 intron. Other such genetic elements may include, but are not limited to, a promoter enhancer element, a double or triple repeated promoter region, a5 'leader sequence that is different from another transgene or different from the endogenous (plant host) gene leader sequence, a 3' trailer sequence that is different from another transgene used in the same plant or different from the endogenous (plant host) trailer sequence.

The introduced gene of the invention may be inserted into the host cell DNA such that the inserted gene portion is upstream (i.e., 5') of the appropriate 3' transcription regulatory signals (i.e., transcript formation and polyadenylation signals). This is preferably done by inserting the gene in the genome (nucleus or chloroplast) of the plant cell. Preferred polyadenylation and transcript formation signals include those of the nopaline synthase gene (Depicker et al, J.Molec Appl Gen, (1982)1,561-573), the octopine synthase gene (Gielen et al, EMBO J, (1984)3: 835845), the SCSV or malic enzyme terminator (Schunmann et al, Plant Funct Biol, (2003)30:453-460), and the T DNA gene 7(Velten and Schell, Nucleic Acids Res, (1985)13,69816998), which serve as 3' untranslated DNA sequences in transformed Plant cells. In some embodiments, one or more introduced genes are stably integrated into the nuclear genome. Stable integration occurs when the nucleic acid sequence remains integrated into the nuclear genome and continues to be expressed (i.e., produces a detectable mRNA transcript or protein) throughout subsequent plant generations. Stable integration into the nuclear genome can be accomplished by any method known in the art (e.g., microprojectile bombardment, agrobacterium-mediated transformation, CRISPR/Cas9, electroporation of protoplasts, microinjection, etc.).

The term recombinant or modified nucleic acid refers to a polynucleotide made by combining two other separate segments of sequence, either by genetic engineering techniques or by manual manipulation of the isolated polynucleotide segments by chemical synthesis. This can be done to join together polynucleotide segments of desired functions to produce a combination of desired functions.

As used herein, the terms "overexpression" and "upregulation" refer to increased expression (e.g., of mRNA, polypeptide, etc.) relative to expression in a wild-type organism (e.g., plant, algae) as a result of genetic modification. In some embodiments, the increase in expression is a minor increase of about 10% greater than expression in the wild type. In some embodiments, the increase in expression is a 50% or more (e.g., 60%, 70%, 80%, 100%, etc.) increase relative to expression in the wild type. In some embodiments, the endogenous gene is overexpressed. In some embodiments, the exogenous gene is overexpressed as a result of being expressed. Overexpression of a gene in a plant or algae can be achieved by any method known in the art, including, but not limited to, the use of constitutive promoters, inducible promoters, high expression promoters (e.g., PsaD promoters), enhancers, regulatory sequences for transcription and/or translation, codon optimization, modified transcription factors, and/or mutants or modified genes that control expression of the gene to be overexpressed.

Where a recombinant nucleic acid is used to express, clone or replicate a particular sequence, a DNA construct prepared for introduction into a host cell will generally include a replication system (i.e., a vector) recognized by the host that includes the desired DNA segment encoding the desired polypeptide, and may also include transcription and translation initiation regulatory sequences operably linked to the polypeptide-encoding segment. In addition, such constructs can include a cell localization signal (e.g., a chloroplast localization signal). In a preferred embodiment, such a DNA construct is introduced into the genomic DNA, chloroplast DNA or mitochondrial DNA of the host cell.

In some embodiments, a non-integrated expression system can be used to induce expression of one or more introduced genes. Expression systems (expression vectors) can include, for example, an origin of replication or Autonomously Replicating Sequences (ARS) and expression control sequences, promoters, enhancers, and necessary processing information sites such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcription terminator sequences, and mRNA stabilizing sequences. Signal peptides may also be included where appropriate with secreted polypeptides of the same or related species, which allow the protein to cross and/or embed into cell membranes, cell walls, or be secreted from the cell.

A selectable marker for use in practicing the methods of the invention disclosed herein can be a positive selectable marker. Typically, a positive selection refers to a situation in which a genetically altered cell can survive in the presence of a toxic substance, where only the recombinant polynucleotide of interest is present within the cell. Negative selectable markers and screenable markers are also well known in the art and are contemplated by the present invention. One skilled in the art will recognize that any available relevant marker may be used to practice the invention disclosed herein.

The screening and molecular analysis of the recombinant bacteria of the present invention can be performed by nucleic acid hybridization techniques. Hybridization procedures can be used to identify polynucleotides, such as those modified using the techniques described herein, that have sufficient homology to the subject regulatory sequences useful in the teachings herein. The particular hybridization technique is not important to the present invention. As hybridization techniques improve, they can be readily applied by those skilled in the art. The hybridization probes may be labeled with any suitable label known to those skilled in the art. Hybridization and washing conditions, such as temperature and salt concentration, can be varied to vary the stringency of the detection threshold. See, e.g., Sambrook et al (1989) see below or Ausubel et al (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, N.Y., for further guidance on hybridization conditions.

In addition, screening and molecular analysis of genetically altered strains and establishment of desired isolated nucleic acids can be performed using Polymerase Chain Reaction (PCR). PCR is a repetitive, enzymatic, primed synthesis of nucleic acid sequences. This procedure is well known to those skilled in the art and commonly used (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159; Saiki et al (1985) Science 230: 1350-. PCR is based on enzymatic amplification of a target DNA fragment flanked by two oligonucleotide primers that hybridize to opposite strands of a target sequence. The primers are oriented 3' to each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with DNA polymerase result in amplification of the segment defined by the 5' end of the PCR primer. Because the extension product of each primer can be used as a template for the other primers, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in an exponential accumulation of specific target fragments, up to several million fold within a few hours. The amplification process can be fully automated by using a thermostable DNA polymerase such as Taq polymerase isolated from the thermophilic bacterium Thermus aquaticus (Thermus aquaticus). Other enzymes that can be used are known to those skilled in the art.

The nucleic acids and proteins of the invention may also encompass homologs of the specifically disclosed sequences. Homology (e.g., sequence identity) can be 50% to 100%. In some cases, this homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. One skilled in the art can readily identify the degree of homology or identity required for any intended use of the sequence. The percent sequence identity of two nucleic acids as used herein is determined using algorithms known in the art, such as those disclosed by Karlin and Altschul (1990) Proc.Natl.Acad.Sci.USA 87: 2264-. This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al (1990) J.mol.biol.215: 402-. BLAST nucleotide searches were performed using the NBLAST program, scoring 100 and word length 12, to obtain nucleotide sequences with the desired percent sequence identity. To obtain a gap alignment for comparison purposes, Gapped BLAST was used as described in Altschul et al (1997) Nucl. acids. Res.25: 3389-. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See www.ncbi.nih.gov.

Preferred host cells are plant or algal cells. In this context, recombinant host cells are those that have been genetically modified to contain an isolated nucleic acid molecule, to contain one or more deleted or otherwise non-functional genes that are normally present and functional in the host cell, or to contain one or more genes that produce at least one recombinant protein. The protein-encoding nucleic acid of the present invention may be introduced by any means known in the art appropriate for the particular type of cell, including, but not limited to, transformation, lipofection, electroporation, or any other method known to one of skill in the art.

Having generally described this invention, the same will be better understood by reference to certain specific examples which are included herein to further illustrate the invention and are not intended to limit the scope of the invention as defined by the claims.

Examples

The present disclosure is described in further detail in the following examples, which are not intended to limit the scope of the present disclosure as claimed in any way. The drawings are intended to be considered an integral part of the specification and description of the disclosure. The following examples are provided to illustrate, but not to limit, the claimed disclosure.

Example 1: general materials and methods for cell culture and growth

The following examples describe the cell culture and growth conditions used in all of the following examples. Chlamydomonas reinhardtii cells were maintained on either phosphotrietate (TAP) medium or acetoyeast (YA) medium on Petri dishes. Prior to the experiment, cells were seeded into minimal medium (i.e., without carbon source) and at high CO2(in the air)>5%CO2) Up to 2-3x106Individual cell mL-1The density of (c). These cells were then diluted into minimal medium and referred to hereinpH and CO of2And (4) concentration growth.

The Chlamydomonas reinhardtii culture conditions were the same as those described in Ma et al, Plant Physiol156:884-896, 2011. The D66 strain (nit 2) was obtained from Dr.Rogene Schnell (University of Arkansas, Little Rock)-、cw15、mt+). CMJ030 (CC-4533; cw15, mt) was obtained from the CLiP deposit at the Chlamydomonas culture collection (Zhang et al, Plant Cell 26(4):1398--) And BST3(BST3 knock-out lmj. ry0402.089365). Triacetate phosphate (TAP), Yeast Acetate (YA) and minimal media (MIN; no acetate, i.e., no carbon source) were prepared according to Sueoka, PNAS 46:83-91,1960. Both TAP and YA Petri dishes were prepared by adding 1.2% (w/v) agar, and Chlamydomonas reinhardtii cells were maintained on both types of Petri dishes. Cell culture was initiated by inoculating colonies from TAP plates into 100mL TAP liquid medium in Erlenmeyer flasks for mixed vegetative growth. The culture was illuminated continuously (100. mu. mol m)-2s-1) Grow to early log phase and shake for 48 hours. Early log-phase TAP-grown cultures were harvested and washed with MIN medium, then resuspended in MIN medium and treated with high CO2(5% [ v/v ] in air]CO2) Bubbling to reach 0.2 and 0.3 (-2-3 x 10)6Individual cells mL-1) between OD 730. For CCM induction, cells were transferred to low CO2(in the air)<0.01%[v/v]CO2) bubbling for 12 hours or ambient CO2(0.04% -0.045% in air [ v/v ]]CO2)。

Example 2: phylogenetic tree of bestrophin family genes

The following example describes the construction of a phylogenetic tree depicting the evolutionary relationships of the bestrophin family genes in various photosynthetic organisms. In mammals, the bestrophin protein is known to conduct chloride and bicarbonate. In plants, most of the bestrophin proteins have not been characterized.

Materials and methods

For various reasons, three chlamydomonas reinhardtii genes BESTROPHIN1(BST1), BESTROPHIN2(BST2) and BESTROPHIN3(BST3) were selected for the tree. One reason, BST1, BST2, and BST3 genes share a common region (see fig. 1A-1B). For another reason, the amino acid sequences of the BST1(SEQ ID NO:1), BST2(SEQ ID NO:2) and BST3(SEQ ID NO:3) proteins are > 80% identical to each other (see FIG. 1C). Chlamydomonas reinhardtii contains seven other predicted bestrophins, but none of these other bestrophins have greater than 45% identity with these three proteins. Finally, all three selected bestrophins are predicted to target the chloroplast.

And (3) construction of a phylogenetic tree: the amino acid sequences of BST1(Cre16.g662600.t1.2), BST2(Cre16.g663400.t2.1) and BST3(Cre16.g663450.t1.2) were BLAST against NCBI Genbank (Benson et al, Nucleic Acids Res,21(13): 2963: 2965,1993) and Phytozome v12.1(https:// Phytozome.jgi. do. gov/pz/port. html; Goodstein et al, Nucleic Acids Res 40(Database assay): D1178-1186,2012). The picks identified using these databases are downloaded (top hit). In addition, amino acid sequences encoding homo sapiens BEST1(SJM31533.1) and klebsiella pneumoniae bestrophin (pdb _4WD8_ a) were downloaded from NCBI Genbank to be included as outliers in phylogenetic analyses. A total of 63 initial sequences were compared in Geneius 11.1.4(Kearse et al, Bioinformatics 28(12): 1647) and 1649,2012) using the ClustalW (Thompson et al, Nucleic Acids Res 22(22):4673-4680,1994) algorithm with the amino acid substitution matrix BLOSUM62(Henikoff & Henikoff, PNAS 89(22):10915-10919, 1992). Duplicate sequences from both databases (NCBI and Phytozome) and sequences with a pairwise percent positive identity (BLOSUM62) of less than 70% were removed. The final alignment comprised 30 sequences and was manually adjusted to remove the variable length ends of the sequences. Phylogenetic analyses were performed in MEGA X (Kumar et al, Computt Appl Biosci 10(2):189-191, 1994). The best Maximum Likelihood (ML) model for aligned phylogenetic analysis was calculated using the model selection function in MEGA X. ML trees were constructed using the LG replacement model (Le & Gascuel, Mol Biol Evol 25(7): 1307-. Adobe Illustrator CC is used to format and shade trees. Maximum Likelihood (ML) was used to construct a phylogenetic tree of protein sequences of chlamydomonas reinhardtii BST1, BST2, and BST3 homologs.

Results

FIG. 1A shows a schematic of the BST1, BST2, and BST3 genes. Light grey boxes indicate exons, thin grey lines indicate introns, thick grey lines indicate untranslated regions (UTRs), and overlapping lines (overlapping on exons and introns) indicate common regions shared by the three genes. Further, showing the length of each of the three bestrophin genes, BST1 is the shortest and below 3000kb and BST2 is the longest and above 5000 kb. In FIG. 1B, the location and orientation of the BST1, BST2, and BST3 genes on the Chlamydomonas reinhardtii genome are shown. BST1(cre16.g662600), BST2(cre16.g663400) and BST3(cre16.g663450) are paralog genes located in the 130kbp region on chromosome 16 of Chlamydomonas reinhardtii. In addition, the image depicts the position of the BST1, BST2, and BST3 relative to each other. Fig. 1C depicts an amino acid alignment of BST1, BST2, and BST3 proteins, with asterisks in the bottom row indicating identical amino acids in all three proteins. BST1, BST2, and BST3 proteins are > 80% identical to each other.

FIG. 1D shows a phylogenetic tree showing the relationship among the protein sequences of the Chlamydomonas reinhardtii BST1, BST2, and BST3 homologs in various photosynthetic organisms. These organisms include vascular plants (second group from the top), non-vascular plants (third group from the top), diatoms (fourth group from the top), and green algae (group at the bottom). The chlamydomonas reinhardin protein is shown in bold in the green algae group. An outer population (group at the top) consisting of proteins from non-photosynthetic organisms human (homo sapiens) and bacteria (klebsiella pneumoniae) is also shown. Sequence alignments of Chlamydomonas reinhardtii BST1, BST2, and BST3 with human Bestrophin 1(BEST1) show low sequence identity (21-23%) between BEST1 and BST 1-3. Chlamydomonas reinhardtii proteins show considerable sequence similarity to each other and to the bestrophin proteins of other green algae, depicted by their close position within the tree and the more shallow branching pattern connecting these proteins. Specifically, Pantoea and Chlamydomonas eustigma are very closely related to Chlamydomonas reinhardtii, whereas Dunaliella salina (Dunaliella salina) is more distantly related to Chlamydomonas reinhardtii. Diatom species (highlighted in cyan) are very far related to chlamydomonas reinhardtii and are in fact caused by different endosymbiotic events; this distant relationship is clearly depicted by the deeper branching pattern connecting these proteins. The vascular and non-vascular plant proteins shown in fig. 1D have only 30-35% low sequence similarity to the chlamydomonas reinhardtii proteins, depicted by their more distant location and deeper branching patterns connecting these proteins. For example, the arabidopsis thylakoid-localized VCCN1 protein has about 30% sequence identity with BST 1-3. Although the other proteins used to construct the tree are also bestrophin family genes, they are only distantly related to the Chlamydomonas reinhardtii. At the amino acid level, chlamydomonas reinhardtii has less than 50% identity with the bestrophin protein found in higher plants or mammals. Further, the human bestrophin protein is sufficiently different from Chlamydomonas reinhardtii that it can be used as a foreign population, together with the bacterial Klebsiella pneumoniae bestrophin protein, to anchor the phylogenetic tree.

Example 3: at low CO2Beltophin is upregulated and their expression is controlled by CIA5

CIA5 is a transcription factor that controls many CCM genes. Specifically, CIA5 controls all known CCM transporters. The following examples describe the use of a catalyst at high CO2Or low CO2Analysis of the expression of bestrophin in Wild Type (WT) D66 Chlamydomonas reinhardtii strains and cia5 mutant Chlamydomonas reinhardtii strains grown under conditions.

Materials and methods

Cell culture and growth conditions for chlamydomonas reinhardtii cells were as described in example 1. For the experiments, WT D66 Chlamydomonas reinhardtii strain and cia5 mutant Chlamydomonas reinhardtii strain were tested in high CO2(5% [ v/v ] in air]CO2) Or low CO2Condition (in air)<0.04%[v/v]CO2I.e. ambient CO2Conditions) were added.

RNA samples high CO from two Chlamydomonas reinhardtii strains2And low CO2Adapted culture was obtained. RNA extraction was performed using Trizol reagent (Invitrogen) according to the manufacturer's instructions. 1ug of RNA from each sample was used as template for cDNA, which was used according to the manufacturer's instructionsFirst Strand cDNA Synthesis kit (NEB). 100ng of RNA from each sample was used to perform qRTPCR using QuantStaudio 6 according to the manufacturer's instructions using RNA from NEBGeneral one-step RT-qPCR kit. Semi-quantitative RT-PCR was performed using primers specific for BST1, BST2, or BST3, and actin primers as controls (listed in table 1). PCR products were analyzed using gel electrophoresis. The experiment was repeated twice.

TABLE 1 primers for RT-PCR analysis

Time course analysis of BST1, BST2, and BST3 expression was also performed. For this analysis, the CO will be high2Transfer of lower-growing cells to low CO2Left for 2 to 12 hours, then RNA was extracted and cDNA was made as described above. This analysis was repeated twice.

Results

As shown in FIG. 2A, in D66(WT), e.g., with CO2Conditions at low CO2Under the condition, the expression level of all three bestrophin genes is up-regulated. In particular, at high CO2Expression of BST3 was very low in cells grown under conditions and at low CO2In cells grown under conditions, BST3 expression was much higher. With high CO2D66 cells grown in the conditions were derived from cells grown at low CO2The increased intensity of the bands of D66 cells grown in the conditions is clearly shown at low CO2Under these conditions, all three genes are up-regulated. Low CO, in contrast to D662The conditions did not induce increased expression of BST1, BST2, or BST 3in the cia5 mutant. Moreover, neither BST1 nor BST3 was expressed in the cia5 mutant under either condition, which was a similar transcriptional pattern to the other CCM genes in the cia5 mutant (Xiaoang et al, PNAS 98(9):5341-5346, 2001; Fukuzawa et al,PNAS 98(9) 5347-5352, 2001; moroney et al, Plant Physiol 89(3):897-903, 1989). cia5 BST2 transcript levels in cells at high CO2And low CO2The conditions are the same in both and are shown in low CO2There was no significant induction. This contrasts with D66 cells, where BST2 transcript levels are low in CO2The conditions increase.

FIG. 2B shows the process at high CO2Condition transfer to Low CO2Expression of three BST genes at different time points D66 after the conditions. All three genes are switched to low CO2Increased transcript levels within the next 2 hours and these expressed levels are maintained until at least 12 hours post-induction. These results indicate that low CO in the known induced CCM2Under growth conditions, all three BST genes are up-regulated. Further, this up-regulation was not observed in the CIA5 mutant, suggesting that the expression of the bestrophin gene was regulated by CIA 5. Taken together, these results indicate a possible role for the bestrophin gene in CCM.

Example 4: localization of bestrophin in chloroplasts

Current CCM models indicate that bicarbonate transporters at the chloroplast thylakoid membrane are essential for bicarbonate uptake, but these transporters have not been identified. The following example describes the localization of the chimeric bestrophin-Venus protein within cells of Chlamydomonas reinhardtii. Fluorescence imaging protocols were chosen to identify specific locations within the chloroplast, since computational analysis predicted chloroplast targeting based on the leader sequences of the three bestrophin proteins, rather than specific locations within the chloroplast.

Materials and methods

Labeling with fluorescent protein: for this experiment, the coding sequence of BST1, BST2, or BST3 was fused to the coding sequence of Venus to generate the fusion proteins BST1-Venus, BST2-Venus, and BST 3-Venus. The BST1-3 gene was cloned and transformed into Chlamydomonas strain CC-4533 as in Mackinder et al, Cell 171(1):133-147e114,2017. Briefly, the open reading frame of the BST1-3 gene was PCR amplified from genomic DNA (primers listed in Table 2) and cloned into a vector with a C-terminal Venus-3xFLAG and PSAD promoter assembled by GibsonpLM005 of mover. Three separate constructs were generated, one for each BST. PSAD is a high expression promoter that drives nuclear genes encoding abundant chloroplast proteins localized to the stroma side of the photosynthetic system I in chlamydomonas reinhardtii (Fischer and Rochaix, 2001). For transformation, wild type cultures were grown to mid-log phase and concentrated to 2x108Individual cell mL-1. The suspension was mixed with the constructed plasmid linearized by EcoRV prior to electroporation. The suspension was then plated on TAP paromomycin (20. mu.g mL)-1) And (4) above for selection. Three separate strains were generated: one expressing BST1-Venus, one expressing BST2-Venus, and one expressing BST 3-Venus. Fluorescent clones were identified using a Typhoon 8610 scanner. The laser for Venus was set at 532nm for excitation and 555/20 for emission, and chloroplast autofluorescence was excited at 633nm to emit at 670/30.

TABLE 2 primers for generating Venus-tagged fluorescent BST1-3 protein

Confocal microscopy: fluorescence images of the three generated strains were then taken using confocal microscopy in order to determine the location of the bestrophin protein. The identified fluorescent clones grew heterotrophically in TAP medium until a mid-log phase was reached. The cultures were then harvested and resuspended overnight in Tris-minimal medium prior to imaging. Images were captured with a laser-scanning microscope LSM880(Zeiss) equipped with an Airyscan module using an x63 objective with a NA of 1.4. Argon lasers at 514nm and 561nm were used for excitation of Venus and chloroplasts, respectively. The filter was set at 525-550 nm for Venus emission and at 620-670 nm for chloroplast emission. Chloroplast fluorescence was used to localize chloroplast thylakoid stacking in these strains, and the overlap of Venus and chloroplast fluorescence was used to identify the location of the bestrophin protein relative to chloroplast thylakoid stacking. Imaging is repeated a plurality of times.

Results

As shown in figure 3A, all three bestrophin fusion proteins exhibited heterogeneous signals within the chloroplast (shown in the left column), as indicated by the Venus signal. When the Venus signal and chloroplast signal (shown in the middle column) were fused, there was visible overlap between the Venus signal and thylakoid stacking in the chloroplasts. All three BST-Venus fusion proteins localize to the thylakoid membrane of chloroplasts. In addition, the thylakoid tubules of the protein nucleus showed the same overlap between Venus and chloroplast signals. This is clearly depicted in fig. 3B, which shows a magnified protein core image of BST1-Venus strain. Arrows indicate where BST1-Venus fluorescence is visible inside the protein core in the thylakoid tubules, penetrating the protein core. These results all confirm the in silico prediction that bestrophin is targeted to chloroplasts (based on bestrophin leader sequences) and strongly indicate thylakoid localization for bestrophin proteins.

Example 5: bestrophin is in low CO2Required for growth of Chlamydomonas reinhardtii

The following example describes the effect of reducing the expression of three bestrophin BST1, BST2 and BST3 on the growth of Chlamydomonas reinhardtii. In CO2The growth phenotype of the triple bestrophin RNAi knockdown strain, bsi-1, was compared to WT strain D66 and mutant strains cia3 and pmp1 under growth conditions of varying concentrations and pH. Both mutant strains had mutations in known CCM components; cia3 strain had mutations in CAH3, CAH3 being thylakoid carbonic anhydrase, while pmp1 strain had mutations in LCIB/LCIC, which is matrix theta carbonic anhydrase.

Materials and methods

Knockdown of BST1, BST2, and BST3 using RNAi: RNAi knockdown protocols were chosen to target all three bestrophin genes simultaneously. Currently, only the bst3 knockout strain is available from the Chlamydomonas Culture Collection; the bst1 and bst2 knock-out strains were not available. Moreover, as described in more detail in example 7, the bst3 knock-out strain was at low CO2Tests were performed under conditions and normal growth was found. This meansMaterials that taste only the bst3 knockout strain has been tested and that generate triple knockout strains are not currently available. Therefore, RNAi knockdown protocols are considered to be the best ones.

Artificial microRNA constructs for the knock-down of BST proteins were made using the protocol of Molnar et al, Plant J58 (1):165-174,2009. Briefly, the Web MicroRNA Designer MD3) website (http:// wmd3. weight world. org/cgi-bin/webapp. cgi) was used to design two sets of oligos that were complementary to different positions in the "common region" of the three BST coding sequences. Two independent constructs were designed and cloned into the pChlamyRNA3int plasmid obtained from the chlamydomonas resource center. Oligonucleotides (oligos) designed to target three bestrophins for RNAi knockdown are shown in table 3. Two triple knock-down lines (BST-RNAi lines 1 and 2 or bsti-1 and bsti-2) were isolated from 400 transformants. Oligo B1 was used in forward and reverse to generate bsti-1 and oligo B2 was used in forward and reverse to generate bsti-2.

Table 3. oligonucleotides designed to target three bestrophins.

By electroporation, resistance to paromomycin (para)R) The pChlamyRNA3int plasmid carrying the AphVIII gene of (9) was transformed into D66(Shimogawara et al, Genetics 148(4):1821-1828, 1998). In the presence of the antibiotic paromomycin (4. mu.g mL)-1(ii) a Invitrogen) on TAP agar medium. Then, they were replica plated on MIN plates to screen for "low CO" of resistant strains2The "pathological" phenotype. These were then placed in high CO2Chamber (5% [ v/v ] in air]CO2) And low CO2Chamber (0.01% [ v/v ] in air]CO2) Continuous illumination (100. mu. mol m)-2s-1) And 7 days. By suspending the growing cells in liquid MIN medium to the same cell density (OD)7300.1, 0.05 and 0.025) and 15 μ Ι _ were spotted on MIN plates. Place these panels in high, ambient and low CO2Chamber for 7 days. Use of ambient gas monitor (EGM-4, PP series)Systematic, Massachusetts) measure CO2And (4) concentration.

Quantitative RT-PCR (qRT-PCR; qPCR): RNA extraction was performed using Trizol reagent (Invitrogen) according to the manufacturer's instructions. 1ug of RNA from each sample was used as template for cDNA, which was used according to the manufacturer's instructionsFirst strand cDNA Synthesis kit (NEB) was prepared. 100ng of RNA from each sample was used to perform qRTPCR using QuantStaudio 6 according to the manufacturer's instructions using RNA from NEBGeneral one-step RT-qPCR kit. Primers used for qPCR are listed in table 4; CBLP primers were used as controls.

TABLE 4 primers for qPCR analysis

Name of Gene Primer name Primer sequences
BST1 qBST1F GCTGTGTGGCATTGAGGAGA(SEQ ID NO:130)
qBST1R GGATGAGGCTGATGAGTCCG(SEQ ID NO:131)
BST2 qBST2F ACGGTCTACGACTTCCCTCA(SEQ ID NO:132)
qBST2R TTGGATCACGTGGGATTGGG(SEQ ID NO:133)
BST3 qBST3F AAGTCAGCAAGGTTCCCTCG(SEQ ID NO:134)
qBST3R TGAATGAGCCTAGCGGGTTG(SEQ ID NO:135)
CBLP qCBLPF ATGTGCTGTCCGTGGCTTTC(SEQ ID NO:136)
qCBLPR CAGACCTTGACCATCTTGTCCC(SEQ ID NO:137)

At different pH and CO2Growth phenotype at level: WT strain D66, mutant strain cia3(CAH3 knockout), mutant strain pmp1(LCIB/LCIC knockout), and bsti-1 at very low CO2(0.01% CO in air)2(v/v)), low (or ambient) CO2(0.04% -0.045% CO in air)2(v/v)) and high CO2(5% CO in air)2(v/v)) And (4) growing. These three COs were tested at both pH 7 and pH 8.42Growth in each of the conditions. For plating, three different cell concentrations were used; the highest concentration was 10,000 cells, the middle concentration was 5,000 cells and the lowest concentration was 2,500 cells. Three spots at three different concentrations were applied to each test plate for all four strains. Growth phenotype experiments were repeated three times.

Results

To check at low CO2Under the condition, the function of the benztropin in the growth of the chlamydomonas reinhardtii adopts an RNAi scheme to simultaneously reduce the expression of all three benztropin genes. RNAi targeting BST1, BST2, and BST3 was used to generate two RNAi knockdown lines, bsi-1 and bsi-2. The expression levels of BST1, BST2 and BST 3in bsi-1, bsi-2 and WT control strain D66 were measured using quantitative RT-PCR. As shown in FIG. 4, the expression levels of all three bestrophin genes were lower in the bsi-1 and bsi-2 RNAi knockdown lines compared to the WT control strain D66 (error bars shown indicate the standard error for three biological replicates). In particular, bsti-1 and bsti-2(BST-RNAi lines 1 and 2) showed almost 60-90% knockdown in expression of BST1, BST2, and BST3 compared to D66. This result indicates that the expression of all three bestrophin genes in the bsi-1 and bsi-2 RNAi knockdown lines was effectively reduced using an RNAi protocol.

Next, the bsi-1 RNAi knockdown line, wild-type strain D66, and CAH3 mutant strain cia3 and LCIB/LCIC mutant strain pmp1 were tested at different pH and CO2Ability to grow at a horizontal level. Cultures at pH 7 or 8.4 and at very low CO2Low CO content2Or high CO2Growing under the condition. At very low CO2Middle bsti-1 showed severely reduced growth, further exacerbated at high pH, similar to the growth of CCM mutant, cia3, and pmp1 (fig. 5A). At pH 7, the growth of bsi-1 was slightly better than at pH 8.4. At low CO2In (D) and all of the bsi-1, cia3 and pmp1 showed reduced growth compared to the wild-type D66 strain (FIG. 5B). Furthermore, all four strains showed slightly better growth at pH 7 compared to pH 8.4. However, at high CO2The growth of bsi-1 was comparable to wild-type, cia3 and pmp1 (FIG. 5C). In summary, these results show that, as shown,with WT (D66) and others with known low CO2RNAi knockdown of all three bestrophins (bsi-1) showed clear low CO compared to the pathotype phenotype (cia3, pmp1) mutant2A pathological phenotype. Also, CAH3(cia3 is the CAH3 knockout) is a carbonic anhydrase found within the cystic cavity of chlamydomonas reinhardtii and is required for CCM function. The three bestrophin proteins may be the proteins of CAH3 that deliver bicarbonate to the inside of thylakoids. Thus, these results show that all three BSTs are at low CO2Required for wild-type-like growth of Chlamydomonas reinhardtii under conditions.

Example 6: triplex bestrophin RNAi knock-down strains with reduced accumulated inorganic carbon (C)i) Capability of

The following example describes the inorganic carbon affinity assay of the triple best RNAi knockdown strains bsi-1 and bsi-2 (described in example 5) compared to WT strain D66.

Materials and methods

Affinity of inorganic carbon: for this determination, at various inorganic carbon levels (inorganic carbon ═ CO)2&HCO3 -) Measuring photosynthesis (e.g. O)2Release) rate. External C was evaluated according to Ma et al, Plant Physiol156:884-i(K1/2[DIC]) (dissolved inorganic carbon) affinity. Specifically, cells with 100. mu.g chloroplast equivalents were suspended in bubbling inert nitrogen gas (i.e., CO-free)2) HEPES-NaOH buffer (pH 7.4), HEPES-NaOH buffer (pH 7.8) or 25mM EPPS-NaOH buffer (pH 8.4). Cells were transferred to a cell culture at 300. mu. mol m-2s-1Illuminated O2Electrode chambers (Rank Brothers, Cambridge UK) and placed to deplete any remaining DIC in buffer and intracellular space. At the depletion of endogenous CO2When, no net O was observed2And (4) releasing. Adding known concentration of NaHCO3Injecting into a chamber and measuring O2The rate of release. In this experiment, the level of inorganic carbon was changed from 25. mu.M to 2 mM. Calculating K1/2[DIC]DIC concentration required as half (50%) maximum rate of oxygen release (i.e., photosynthesis) (Badger, 1985). Chloroplast content was measured by combining chloroplasts a and b.Chloroplasts were extracted in 100% methanol and measured using a spectrophotometer. Get K1/2(CO2) As far as half Vmax O2Releasing the required CO2And (4) concentration.

Evaluation of Adaptation to Low CO at pH 8.42(<0.04%CO2)12 hours of bsi-1 and D66CiAffinity (fig. 6A). K shown in FIG. 6A0.5(Ci) The value (Ci concentration required for half maximum oxygen release) is O shown in FIG. 6B2Release pair CiThe curves are calculated. In addition, the adaptation to low CO at pH 7.8 was evaluated2(<0.04%CO2) C of 12 hours of bsi-1, bsi-2 and D66iAffinity (fig. 6C). K shown in FIG. 6C0.5(Ci) The value (Ci concentration required for half-maximum oxygen evolution) is O shown in FIG. 6D2Release pair CiThe curves are calculated. Further, the adaptation to high CO at pH 7.8 was evaluated2(>5%CO2)12 hours of bsi-1 and D66CiAffinity (fig. 6E). K shown in FIG. 6E0.5(Ci) The value (Ci concentration required for half-maximum oxygen evolution) is O shown in FIG. 6F2Release pair CiThe curves are calculated. With each type CiConcentrations were run in triplicate. Symbol ". about" indicates K0.5(Ci) The difference in (P by student's t-test) is significant<0.05). At pH 7.8 and low CO2The Vmax of D66 was 121. mu. mol O2 mg-1Chl hr-1The Vmax of bsi-1 was 105. mu. mol O2 mg-1Chl hr-1And the Vmax of bsi-2 is 95. mu. mol O2 mg-1Chl hr-1. At pH 7.8 and high CO2The Vmax of D66 was 121. mu. mol O2 mg-1Chl hr-1And the Vmax of bsi-1 is 120. mu. mol O2 mg-1Chl hr-1. At pH 8.4 and low CO2In the adapted case, the Vmax of D66 was 124. mu. mol O2 mg-1Chl hr-1And the Vmax of bsi-1 is 85.5. mu. mol O2 mg-1 Chl hr-1. Vmax was set to 100% oxygen release activity for all strains.

Uptake of inorganic carbon: according to Moroney et al, Plant Physiol 79(1):177-183,1985, centrifugation of silicone oils was used to measure dissolved CiIntracellular concentration of (a). Briefly, cells were centrifuged and washed with 25 μ g Chl mL-1Density suspended in CiDepleted 25mM EPPS-NaOH (pH 7.8 or 8.4) and incubated in light until net O2The release is zero. The cells are maintained in light until used. Then, 300. mu.L of CiThe depleted cells were centrifuged in a tube containing 25. mu.L of 1M glycine (pH 10) with 0.75% (w/v) SDS covered with 75. mu.L of Dow Corning AR 20 silicone oil. In Beckman Microfuge B, at 200. mu. mol m-2s-1The measurement was carried out in light at 25 ℃. By adding 3. mu.l of NaH at pH 7.8, 25mM (for an addition concentration of 25. mu.M) or at pH 8.4, 50mM (for an addition concentration of 50. mu.M)14CO3Start CiUptake, followed by illumination for the indicated time (at 150. mu. mol m)-2s-1Between 15 and 120 seconds). Triplicate samples were run at each time point. The reaction was stopped by centrifugation in microfuge B (Beckman) for 15 seconds. Using total and acid-stable in precipitation14Difference between C internal CiAnd cell volumes were corrected as described (Machingura et al, J Exp Bot 68(14): 3879-.

Results

Two characteristics of algal cells with CCM are, first, their pairing with inorganic carbon (C)i) And secondly, they accumulate CiTo a higher level than that obtainable by diffusion. Therefore, the RNAi knockdown lines, bsi-1 and bsi-2, and WT strain D66 were tested for photosynthetic oxygen release activity. As measured by them0.5(Ci) Judging that the pH value is 7.8, the low CO is adapted2The RNAi knockdown lines bsti-1 and bsti-2, respectively, show the same effect on CiIs three to ten times lower (fig. 6A and 6C). When adapting to high CO2Compared with D66, bsi-1 also has CiDecrease in affinity (fig. 6E). This indicates that decreasing expression of all three BST genes results in cell pair CiA decrease in affinity. K at pH 8.4, bsi-10.5(Ci) 95 μ M, 35 μ M low K with D660.5(Ci) A sharp contrast was formed. At higher pH 8.4, C predominates in the mediumiThe species will be bicarbonate, thus D66(WT) cells vs CiThe higher affinity of (b) reflects their ability to actively uptake and utilize bicarbonate. These results show that bsi-1 and bsi-2 have pairings for photosynthetic O2The higher demand for liberated inorganic carbon is strong evidence of the role of bestrophin in CCM.

C in D66 and bsi-1 was also measurediUptake activity to assess the accumulation and immobilization of BST1-3 in CiOf importance in (1). At both pH 7.8 and pH 8.4, low CO was accommodated compared to D662With a significantly lower bsti-114CiAccumulation and fixation (FIGS. 7A-7D). At both pH 7.8 and 8.4, bsti-1 accumulates14CiOnly to 20 to 25% of the levels observed in D66 cells. This difference was added at the earliest time point (15 seconds) and at the point where the D66 cells had been mostly used up14CiIs visible at the latest time point (at most two minutes in light). These results indicate that BST1-3 has low CO in Chlamydomonas reinhardtii2C in the conditioniPlays an important role in uptake and again provides strong evidence for the role of bestrophin in CCM.

Example 7: the bst3 knock-out strain had low CO when compared to WT2Normal growth under conditions and similar inorganic carbon affinities

The following example describes the Chlamydomonas reinhardtii bst3 knock-out strain at low CO compared to WT strain D662Growth under conditions and CiAnd (4) testing the affinity.

Materials and methods

Chlamydomonas reinhardtii knockout strains: knockout strains were created using random insertion mutagenesis and are part of the chlamydomonas library project (CLiP). The strains can be ordered from the Chlamydomonas resource center (https:// www.chlamycollection.org /). Currently, only the bst3 knockout strain is available; the bst1 and bst2 knock-out strains are not available. To confirm the insert location in the BST3 knock-out strain, PCR was performed using primers specific for the BST3 gene and for the insert (see table 5). Information on insert-specific primers (CIB1F and CIB1R) and flanking regions was obtained from the CLiP website (https:// www.chlamylibrary.org/allmutets).

TABLE 5 primers used to analyze insertion of bst3

Primer name Primer sequences
BST3F TGCCCCTTCTCAGCACGT(SEQ ID NO:138)
BST3R ACTGCCTCACACTCCCCT(SEQ ID NO:139)
CIB1F GCACCAATCATGTCAAGCCT(SEQ ID NO:140)
CIB1R GACGTTACAGCACACCCTTG(SEQ ID NO:141)

Semi-quantitative RT-PCR analysis was performed as in example 3.

And (3) growth measurement: using the methods described in the examples above, WT strain D66 and knockout strain bst3 were grown at pH 8.6. Using OD730Growth was measured and chloroplast assessment was performed at wavelengths 645 and 663. Measured at low CO2(<0.04%CO2) The treatment is carried out for six days. After the cells were placed at an OD of 0.01730Cells were grown in TAP for 48 hours before transfer to MIN.

Affinity of inorganic carbon: the procedure described in example 6 was used. Oxygen release activity was measured at pH 7.4 andand K is0.5(Ci) The value (Ci concentration required for half-maximal oxygen evolution) is from O2Release pair CiThe curves are calculated. With each type CiConcentrations were run in triplicate.

Results

The BST3 knockout (BST3) was obtained from a collection of CLiP mutants with a paromomycin insert in the first exon of the BST3 gene (fig. 8A). The position of the insert was confirmed using PCR (fig. 8B). In addition, BST1-3 is expressed in high and low CO2Analysis was performed in the bst3 knock-out strain under conditions and compared to WT strain D66. BST3 expression was not detected in BST3 under both conditions, whereas BST1 and BST2 expression were comparable between the BST3 knockout strain and WT strain D66 under both conditions (fig. 8C).

And in air low<0.04%CO2) (FIGS. 9A-9B), very low (0.02% CO)2) Or high CO2(5%CO2(v/v)) no significant growth difference was observed for the bst3 strain compared to the wild-type cells (data not shown). C between WT and bst3iThere was also no significant difference in affinity (fig. 9C). In the RNAi knock-down line, bsi-1, in which the expression of all three BST genes is reduced, C at both pH 7.8 and pH 8.4iThe affinity decreases. This is in sharp contrast to BST3, which is deleted for BST3 expression only, which is comparable to WT in CiThere were no differences in affinity (FIGS. 9C-9D). These results support the hypothesis that the functions of three BSTs are redundant and that the expression of all three genes must be reduced to observe physiological effects.

Example 8: structural features of BST1, BST2, and BST3 and current Chlamydomonas reinhardtii CCM model

The following examples describe the structural features of Chlamydomonas reinhardtii BST1, BST2, and BST3 proteins. The examples also describe the current Chlamydomonas reinhardtii CCM model.

Materials and methods

Peptide sequences of BST1, BST2, and BST3 were obtained from Phytozome v 12.1. Homology modeling was performed using Klebsiella pneumoniae (Kpbest; PDB: 4DW8) as a template and generated using a Swiss-Model web server (Yang et al, Science 346(6216):1498-1501, 2014). Kpbest was chosen because it was the highest ranking template identified by Swiss-Model as BST 1-3. The resulting structures and the structure of Kpbest are shown as monomers with residues conserved within the selective pore, as shown in the extended shape and labeled in fig. 10A. The obtained BST1 homopolymer model was submitted to minimize the energy with the gromos 43B1 force field and the electrostatic potential was calculated using the atomic partial charge using Swiss-PDBviewer (V4.01). The electric field was then shown on the BST1 homopolymer model to produce fig. 10D. The electrostatic potential is shown in the potential range of-4 kT/e (negative) to +4kT/e (positive), and highlights the cavity. The BST1 homopentamer structure quality was obtained using the QMEAN score (Benkert et al, proteins 71(1): 261-.

Results

To predict whether BST1-3 can be used as a negative ion transport bestrophin, homology modeling of BST1-3 was performed using bestrophin from Klebsiella pneumoniae. BST1-3 contains nonpolar residues along selective pores that are conserved among proteins of the bestrophin family (FIG. 10A; Qu et al, J Neurosci 26(20):5411-5419, 2006). Structural studies showed that human and klebsiella pneumoniae are pentamers and that modeling of BST1 in pentamer assembly is highly reliable (fig. 10B). The assumption that the entry pocket is predominantly of negative electrostatic potential and that the selective pore is neutral/positively charged supports the transport of negatively charged ions by BST1-3 (FIGS. 10C-10D; Yang et al, Science 346(6216):1498-1501, 2014; Kane et al, Nature 516(7530):213-218, 2014). These results suggest that Chlamydomonas reinhardtii can be an ion transporter.

The results described in examples 2-8 demonstrate the important role of the three bestrophin proteins for Chlamydomonas reinhardtii CCM. Taken together, these results indicate that the three bestrophin proteins are thylakoid-localized bicarbonate transport channels. FIG. 11 shows integration of BST1, BST2, and BST3 into a single chip for CiCurrent CCM model of chlamydomonas reinhardtii for transport.

Sequence listing

<110> louisiana State university college of proctor and agricultural machinery, university of York, England

<120> bestrophin bicarbonate transporter of green algae

<130> 79454-20001.40

<140> not yet allocated

<141> at the same time

<150> US 62/769,214

<151> 2018-11-19

<150> US 62/697,840

<151> 2018-07-13

<160> 141

<170> FastSEQ for Windows version 4.0

<210> 1

<211> 438

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 1

Met Gln Met Gln Ala Asn Arg Ser Ser Leu Arg Ala Ser Pro Val Arg

1 5 10 15

Gly Leu Gly Ala Arg Pro Leu Leu Arg Ala Leu Pro Ala Gly Arg Val

20 25 30

Ala Arg Leu Asn Val Ser Ala Gln Ala Lys Asp Pro Asn Ala Pro Ile

35 40 45

Gln Ser Asn Pro Leu Gly Thr Leu Ser Ser Gln Ser Gly Gln Val Ala

50 55 60

Thr Leu Pro Arg Ser Glu Glu Ala Arg Lys Tyr Phe Arg Thr Val Tyr

65 70 75 80

Asp Phe Pro Gln Trp Gln Lys His Arg Ser Ser Tyr Arg Phe Ala Glu

85 90 95

Arg Leu Phe Gln Leu Ser Gln Ser His Ile Leu Gln Asn Ala Leu Pro

100 105 110

Ala Ile Ser Trp Val Thr Leu Val Ala Thr Leu Val Ala Ser Tyr Gly

115 120 125

Tyr Ser Tyr Asp Gln His Met Leu Pro Asp Val Phe Pro Ser Ile Ser

130 135 140

Pro Asn Ala Ser Cys Thr Ala Phe Ile Ser Asn Thr Ser Val Ala Leu

145 150 155 160

Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp

165 170 175

Glu Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile

180 185 190

Met Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys

195 200 205

Lys Ala Leu Ala Arg Trp Thr Val Ala Phe Ser Arg Ala Leu Arg Ile

210 215 220

His Phe Gln Pro Glu Val Thr Ile Glu Ser Glu Leu Gln Asn Ile Leu

225 230 235 240

Thr Pro Ala Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val

245 250 255

Arg Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro Met Ser

260 265 270

Ser Ile His Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp

275 280 285

Val Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser

290 295 300

Tyr Thr Arg His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu

305 310 315 320

Pro Phe Ala Leu Tyr Pro Thr Thr Gly Trp Gly Val Val Pro Val Cys

325 330 335

Thr Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln

340 345 350

Cys Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg

355 360 365

Ile Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys

370 375 380

Thr Ile Leu Ala Glu Ala Gly Leu Ile Ser Leu Ile Pro Ser Ala Thr

385 390 395 400

Ser Ala Thr Pro Val Ala Ser Ala Glu Pro Val Leu Val Ser Ala Arg

405 410 415

Pro Ser Ala Ala Pro Ala Pro Asn Asn Gly Leu Gln Val Arg Val Ala

420 425 430

Met Gly Gly Glu Arg Lys

435

<210> 2

<211> 450

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 2

Met Gln Cys Leu Ser Ser Arg Pro Val Ala Met Gly Arg Ala Gly Ser

1 5 10 15

Ser Ala Leu Pro Arg Leu Pro Leu Arg Ala Gly Arg Val Cys His Leu

20 25 30

Gly Val Arg Cys Gln Ala Ala Asn Lys Asp Pro Asn Ala Pro Ile Gln

35 40 45

Ser Asn Pro Leu Gly Ser Phe Ser Ser Gln Leu Gln Asn Gln Pro Thr

50 55 60

Leu Pro Arg Ser Glu Glu Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp

65 70 75 80

Phe Pro Gln Trp Gln Thr His Arg Asn Gln Tyr Arg Leu Met Lys Arg

85 90 95

Leu Phe Ser Ile Pro Gln Ser His Val Ile Gln Asn Ala Leu Pro Ser

100 105 110

Ile Met Trp Val Ala Phe Thr Ser Thr Cys Val Ala Ala Tyr Met Tyr

115 120 125

Gly Tyr Asp Gln His Met Leu Pro Glu Gly Phe Pro Thr Leu Ala Pro

130 135 140

Asn Ala Ala Cys Ser Ala Phe Ile Ser Asn Thr Ser Val Ala Leu Ser

145 150 155 160

Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu

165 170 175

Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile Met

180 185 190

Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys Lys

195 200 205

Ala Leu Ala Arg Trp Val Val Ala Phe Ser Arg Ala Leu Arg Ile His

210 215 220

Phe Gln Pro Glu Val Thr Ile Glu Ser Glu Leu Lys Asn Ile Leu Thr

225 230 235 240

Pro Ala Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val Arg

245 250 255

Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro Met Ser Ser

260 265 270

Ile His Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp Val

275 280 285

Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr

290 295 300

Thr Arg His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro

305 310 315 320

Phe Ala Leu Tyr Gly Ser Cys Gly Val Ser Val Ile Pro Val Cys Ser

325 330 335

Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Cys

340 345 350

Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg Ile

355 360 365

Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr

370 375 380

Ile Leu Ala Glu Ala Gly Leu Ile Ser Leu Arg Ala Asn Ser Ala Met

385 390 395 400

Ala Val Glu Asn Ala Leu Pro Asp Leu Asp Ser Ile Asn Ala Ala Ala

405 410 415

Pro Asn Gly Asn Gly Ser His Asn Gly Asn Gly Ala Ala Val Pro Val

420 425 430

Ser Val Ser Ala Gly Ala Ser Gly Asn Gly Met Asn Val Arg Ile Ser

435 440 445

Pro Arg

450

<210> 3

<211> 466

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 3

Met Gln Val Ser Lys Val Pro Ser Ser Ala Ser Ala Arg Cys Leu Pro

1 5 10 15

Arg Leu Pro Val Arg Thr Ser Arg Val Cys Gln Leu Ser Val Arg Cys

20 25 30

Gln Ala Ala Asn Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu

35 40 45

Gly Ser Phe Ser Ser Gln Asn Ser Ser Gly Ala Val Val Thr Ala Pro

50 55 60

Arg Asn Glu Asp Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp Phe Pro

65 70 75 80

Gln Trp Gln Lys His Arg Ser Gln Ser Arg Leu Val Arg Arg Leu Phe

85 90 95

Thr Ile Pro Gln Ser His Val Ile Gln Asn Ala Leu Pro Ser Ile Met

100 105 110

Trp Val Thr Phe Thr Ser Thr Cys Val Ala Ala Tyr Met Tyr Gly Tyr

115 120 125

Asp Leu His Ile Leu Pro Glu Gly Phe Pro Thr Leu Ala Pro Asn Ala

130 135 140

Ala Cys Ser Ala Phe Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu

145 150 155 160

Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg

165 170 175

Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln

180 185 190

Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu

195 200 205

Ala Arg Trp Thr Val Ala Phe Ala Arg Ala Leu Arg Ile His Phe Gln

210 215 220

Pro Glu Val Thr Ile Glu Ser Glu Leu Gln Asn Ile Leu Thr Pro Ala

225 230 235 240

Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val Arg Ala Ile

245 250 255

His Ala Ile Ser Gln Ile Ile Gln Ser Val Arg Met Ser Ser Ile His

260 265 270

Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp Val Leu Gly

275 280 285

Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg

290 295 300

His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala

305 310 315 320

Leu Tyr Gly Ser Cys Gly Val Ser Val Ile Pro Val Cys Thr Gly Ile

325 330 335

Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu

340 345 350

Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala

355 360 365

Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr Val Leu

370 375 380

Ala Glu Ala Gly Leu Ile Ser Leu Ile Pro Ser Met Ser Leu Pro Pro

385 390 395 400

Thr Glu His Ala Ser Pro Ser Asp Pro Val Thr Ala Ala Ala Ala Ala

405 410 415

Ala Leu Ala Ala Ala Asn Gly Asn Gly Ala Ala Ser His Ser Asn Gly

420 425 430

Asn Gly Ser Lys Pro Val Ser Thr Gln Val Pro Pro Pro Val Leu Ala

435 440 445

Pro Val Thr Val Thr Ser Ser Ser Gly Ser Met Asn Val Arg Ile Ser

450 455 460

Pro Arg

465

<210> 4

<211> 325

<212> PRT

<213> Spirospodopsis ATCC 50920

<400> 4

Met Leu Ala Ala Thr Asn Arg Ser Ala Ser Ser Pro Pro Lys Pro Pro

1 5 10 15

Phe Glu Gln Lys Gly Tyr Phe Pro Gly Ser Trp Pro His Ala Thr Phe

20 25 30

Asp Leu Ser Gln Gly Phe Tyr Ser Cys Thr Phe Ala Leu Ser Leu Leu

35 40 45

Leu Val Phe Arg Thr Asn Ala Ala Tyr Asp Arg Trp Trp Glu Ala Arg

50 55 60

Lys Thr Trp Gly Ser Leu Val Asn Arg Thr Arg Asp Phe Met Arg Gln

65 70 75 80

Ala Leu Thr Phe Phe Pro Ala Ser Glu Ser Ala Glu Ala Gly Val Leu

85 90 95

Leu Arg Trp Thr Val Ala Leu Pro Arg Met Leu Leu Trp Lys Leu Arg

100 105 110

Glu Gln Ala Val Leu Glu Ala Glu Leu Gln Gly Val Leu Leu Pro Ala

115 120 125

Glu Phe Ser Leu Leu Arg Glu Cys Asp His Arg Cys Ala Leu Ala Leu

130 135 140

Ala Leu Met Ser Glu Val Val Gln Arg Ala Arg Gly Leu Asp Arg Gly

145 150 155 160

Gln Arg Arg Cys Leu Asp Ala Asn Leu Thr Ala Leu Gly Asp Thr Val

165 170 175

Gly Val Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro Leu Ser Tyr Ser

180 185 190

Arg His Thr Ser Arg Trp Leu Leu Val Trp Leu Ala Phe Leu Pro Phe

195 200 205

Ser Leu Trp Arg Leu Tyr Ala Trp Gly Ser Val Pro Leu Ser Gly Leu

210 215 220

Leu Ala Phe Leu Met Leu Gly Ile Asp Glu Ile Gly Val Gln Ile Glu

225 230 235 240

Gln Pro Phe Gln Val Leu Pro Leu Glu Ser Leu Cys Cys Thr Val Glu

245 250 255

Arg Asn Leu Arg Asn Leu Ala Ala Ala Thr Pro Ala Val Lys Arg Leu

260 265 270

Ala Ser Leu Ala Val Glu Ala Gln Leu Ala Leu Ala Glu Ser Asp Ala

275 280 285

Thr Ala Ser Phe Arg Glu Pro Gly Lys Ser Leu Ala Cys Ser Val Phe

290 295 300

Pro Pro Val Ser Pro Arg Ser Ser Leu Ile Arg Ser Cys Leu Asp Arg

305 310 315 320

Pro Gln Ser Leu Pro

325

<210> 5

<211> 422

<212> PRT

<213> Jute of round fruit

<400> 5

Met Ala Gln Ser Ser Asn Pro Ser Lys Leu Ser Leu Ser Ser Asp Phe

1 5 10 15

Asn Pro Lys Leu Phe Pro Asn Lys Leu His Arg Tyr Ser Ser Phe Pro

20 25 30

Phe Lys Leu Ser Gln Pro Arg Ser Phe Lys Thr Leu Ser Ser Leu Ser

35 40 45

Pro Pro Pro Pro Pro Ser Ser Pro Pro Pro Pro Ser Ser Glu Pro Thr

50 55 60

Thr Thr Lys Thr Leu Asn Leu Val Ser Leu Leu Arg Ala Ile Pro Asp

65 70 75 80

Trp Ala Asp Arg Val Gln Glu Arg Gly Met Arg Gln Asn Arg Ala Leu

85 90 95

Tyr Asn His Asp Lys Trp Ser Glu His Arg Ser Ser Leu Arg His Leu

100 105 110

Arg His Leu Leu Ser Ser Leu Gln Ser Arg Val Ile Leu Ser Leu Val

115 120 125

Pro Pro Val Leu Ala Phe Thr Ser Val Ala Ala Val Ile Ala Thr Tyr

130 135 140

Asn Thr Ala Val Asp Leu His Trp Leu Pro Gly Phe Phe Pro Val Leu

145 150 155 160

Arg Ala Ser Ser Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu

165 170 175

Leu Leu Val Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Glu Glu Gly

180 185 190

Arg Lys Ala Trp Thr Lys Val Ile Ser Gly Thr Asn Asp Phe Ala Arg

195 200 205

Gln Val Ile Ser Gly Val Glu Asn Ser Ser Asp Asp Gln Ser Leu Lys

210 215 220

Asp Ala Leu Leu Arg Tyr Ile Met Ala Phe Pro Val Ala Leu Lys Cys

225 230 235 240

His Val Met Tyr Gly Ser Asp Ile Gly Arg Asp Leu Gln Asn Leu Leu

245 250 255

Glu Val Asp Asp Leu Thr Val Val Leu Asn Ser Lys His Arg Pro Arg

260 265 270

Cys Ile Ile Asp Phe Ile Ser His Ser Leu Arg Val Leu Asn Leu Lys

275 280 285

Glu Ser Glu Arg Thr Val Leu Glu Ser Lys Ile Ser Cys Phe His Glu

290 295 300

Gly Ile Gly Val Cys Glu Gln Leu Met Gly Ile Pro Ile Pro Leu Ser

305 310 315 320

Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val Leu Trp His Leu Thr Leu

325 330 335

Pro Ile Ile Leu Trp Asp Asp Cys His Trp Ile Val Val Pro Ala Thr

340 345 350

Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu

355 360 365

Ile Glu Glu Pro Phe Pro Met Leu Ala Leu Asp Glu Leu Cys Asn Val

370 375 380

Val Gln Asn Asn Ile Arg Glu Ala Ile Ala Thr Glu Lys Val Ile Lys

385 390 395 400

Ala Lys Leu Ile Gly Lys Arg Lys Arg His Ser Tyr Lys His Ser Pro

405 410 415

Asn Gly Trp Pro Asn Thr

420

<210> 6

<211> 406

<212> PRT

<213> liverwort subspecies terrestris

<400> 6

Met Glu Asp Val Arg Leu Gly Arg Cys Glu Gly Ala Glu Gly Val Gly

1 5 10 15

Lys Met Gly Lys Trp Val His Lys Leu Ala Arg Phe Tyr Ala Pro Cys

20 25 30

Ala Leu Pro Leu Leu Cys Val Thr Met Gly Leu Trp Ile Pro Glu Ser

35 40 45

Pro Gly Ser Arg Ser Gly Arg Ser Gly Pro Glu Pro Glu Pro Tyr Asp

50 55 60

Pro Asp Phe Pro Lys Glu Glu Val Phe Leu Tyr Arg Arg Thr Val Tyr

65 70 75 80

Asp His Lys Asp Trp Ser Arg His Arg Ser Ser Leu Arg His Ser Arg

85 90 95

His Ile Leu Ser Met Arg Ser Ser Arg Val Ile Leu Ala Leu Trp Pro

100 105 110

Pro Val Phe Gly Leu Thr Thr Val Ser Ile Ala Leu Ser Ala Tyr Asn

115 120 125

Glu Cys Ile Leu Ser His Trp Leu Pro Ser Phe Leu Pro Leu Leu His

130 135 140

Val Ser Ala Thr Pro Phe Gln Leu Met Ala Pro Ala Leu Ala Leu Leu

145 150 155 160

Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala Arg Phe Asp Glu Ala Arg

165 170 175

Arg Ala Trp Gly Ser Asn Val Asn Arg Thr Arg Asp Ile Thr Arg Gln

180 185 190

Ala Leu Thr Trp Met Gln His Pro Ser Asp Ala Glu Lys Val Lys Lys

195 200 205

Leu Ile Arg His Cys Val Ala Phe Asn Val Cys Met Lys His His Leu

210 215 220

Val Arg Gly Gly Asp Leu Arg Asp Asp Leu His Ser Trp Ile Asp Lys

225 230 235 240

Glu Glu Ile Asp Gly Ile Leu Ala Ser Thr His Arg Pro Asn Tyr Val

245 250 255

Leu Gln Val Met Ser Glu Ile Ile His Ser Cys Ser Ile Thr Glu Met

260 265 270

Gln Leu Thr Arg Met Asp Val Asn Met Thr Gln Phe Ala Asp Asn Leu

275 280 285

Gly Ala Cys Glu Arg Ile Phe Lys Thr Pro Ile Pro Leu Ser Tyr Thr

290 295 300

Arg Leu Thr Ser Arg Phe Leu Val Leu Trp His Ile Ala Leu Pro Leu

305 310 315 320

Ala Leu Trp Asp His Cys Gln Trp Val Ser Val Pro Ala Thr Phe Leu

325 330 335

Ser Ala Gly Ala Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu

340 345 350

Glu Pro Phe Gln Ile Phe Pro Leu Asp Asn Ile Cys Ser Thr Ile Lys

355 360 365

Lys Asn Val Asp Gly Leu Ile Leu Ala His Thr Glu Ile His His Cys

370 375 380

His Lys His Pro Pro Lys Gly Cys Asp Ile Pro Lys Lys Lys Ser Ser

385 390 395 400

Gly Asp Ala Pro Lys Ser

405

<210> 7

<211> 453

<212> PRT

<213> Miscanthus floridulus

<400> 7

Met Thr Cys Leu Thr Ser Val Leu Pro Leu Gly Gly Ala Leu Val Pro

1 5 10 15

Thr Arg Pro Leu Arg Ser Gly Ile His Ser Ser Thr Pro Arg Arg Arg

20 25 30

Leu Ser Ala Leu Ala Pro Leu Lys Pro His Leu Val Ala Glu Pro Glu

35 40 45

Ser Val Gln His Ala Ala Pro Ala Ala Ala Ala Pro Pro Pro Pro Pro

50 55 60

Pro Arg Asp Ala Thr Pro Ser Ala Pro Arg Gln Pro Leu Phe Gly Asp

65 70 75 80

Ala Leu Leu Glu Ser Thr Arg Pro Gln Leu Arg Thr Val Phe Asp Ala

85 90 95

Asp Arg Trp Val Met His Arg Ser Val Asn Arg Tyr Phe Arg His Leu

100 105 110

Trp Asp Leu Pro Arg Ser Arg Leu Leu Leu Gly Leu Ala Ala Pro Leu

115 120 125

Ala Tyr Val Leu Gly Leu Ser Ala Val Val Cys Ala Tyr Gly Ala Ala

130 135 140

Gln Gln Ala Gly Leu Leu Pro Ser Leu Leu Pro Ser Leu Ala Gly Ala

145 150 155 160

Ala Arg Met Arg Glu Leu Tyr Asn Leu Thr Ser Pro Thr Leu Ala Leu

165 170 175

Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala Arg Trp Asp Glu Gly

180 185 190

Arg Lys Met Trp Gly Met Val Leu Asn Arg Thr Arg Asn Ile Cys Arg

195 200 205

Leu Gly Leu Ala Trp Ile Gly Asp Asp Lys Arg Glu Leu Arg Ser Met

210 215 220

Leu Glu Glu Leu Glu Gly Ile Leu Leu Pro His Glu Ile Glu Gly Val

225 230 235 240

Leu Arg Ala Ser His Arg Pro Asn Tyr Val Leu Gln Val Leu Ala Gln

245 250 255

Ile Val Arg Thr Ala Gly Leu Pro Thr Ala Ala Thr Leu Arg Met Glu

260 265 270

Asp Asp Leu Thr Asn Phe Gly Asp Ser Leu Gly Gly Cys Glu Arg Leu

275 280 285

Leu Arg Thr Pro Ile Pro Leu Phe Tyr Thr Arg His Thr Ser Arg Phe

290 295 300

Leu Met Ile Trp Leu Thr Phe Leu Pro Ala Thr Leu Trp Pro Ala Cys

305 310 315 320

Gly Leu Leu Thr Leu Pro Leu Val Phe Leu Ile Ser Phe Leu Leu Leu

325 330 335

Gly Val Asp Lys Ile Gly Val Ser Ile Glu Glu Pro Phe Ser Ile Leu

340 345 350

Glu Leu Glu Thr Ile Ala Ser Arg Ala Leu Glu Asn Val His Glu Leu

355 360 365

Ala Ala Met His Asp Gly Val Ala Asp Ile Pro Leu Gly Gly Gly Ser

370 375 380

Ser Ser Ser Ser Ser Ser Asn Arg Ala Ser Ser Asn Arg Gly Ala Gly

385 390 395 400

Thr Gly Arg Leu His Pro Ser Phe Gly Val Tyr Ser Ser Ser Asn Gly

405 410 415

Ser Ser Gly Ala Asn Gly Ser Gly Gly His His Gly Ser Gly Leu Ile

420 425 430

Gly His Val Ser Ser Ile Val Ser Ala Ala Thr Met Val Ser Leu Ala

435 440 445

Arg Pro Ala Thr Ala

450

<210> 8

<211> 803

<212> PRT

<213> Chlorella

<400> 8

Met Pro Ala Ala Leu Val Ala Ala Ala Ala Ala Thr Ala Cys Pro Ala

1 5 10 15

Ala Met Gly Arg Ala Pro Ala Ala Ala Gly Ser Ala Ser Arg Leu Pro

20 25 30

Ala Gly Leu Val Pro Ser Ser Gln Gln Leu Arg Trp Thr Leu Ala Pro

35 40 45

Gln Arg His Ser Gln Pro Ser Arg Cys Arg Arg Ala Ala Arg Val Ala

50 55 60

Ala Val Ala Gly Pro Gln Ala Pro Pro Arg Leu Gly Ala Pro Leu Gln

65 70 75 80

Leu Gly Ser Pro Ala Ser Gln Lys Arg Arg Glu Glu Ile Leu Asn Arg

85 90 95

Ile Asp Thr Leu Ile Gln Glu Glu Leu Glu Ser Gln Leu Pro Leu Pro

100 105 110

Ser Val Asp Glu Leu Val Ala Asp Asp Phe Lys Glu Ser Glu Arg Arg

115 120 125

Lys Leu Arg Thr Val Phe Asp Phe Asp Leu Trp Lys Arg His Arg Ser

130 135 140

Ser Ser Arg Tyr Ser Arg His Met Phe Gly Leu Leu Glu Ser Arg Thr

145 150 155 160

Val Arg Trp Ile Gly Ala Pro Leu Ala Tyr Cys Val Ser Leu Ser Val

165 170 175

Ala Val Gly Val Tyr His Asn Leu Ala Asp Ala Gly Ile Val Pro Glu

180 185 190

Val Leu Pro Glu Leu Lys Thr Gln Leu Pro Ile Gln Leu Thr Ser Ala

195 200 205

Ala Leu Ser Thr Leu Leu Val Leu Arg Thr Asn Thr Ser Tyr Gln Arg

210 215 220

Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Ile Val Asn Arg Ser Arg

225 230 235 240

Asp Phe Thr Arg Gln Ala Leu Gly Tyr Ile Pro Asp Asp Gln Pro Glu

245 250 255

Leu Gln Asp Met Leu Cys Arg Trp Val Val Ala Tyr Ser Arg Ser Leu

260 265 270

Met Cys His Leu Arg Ser Asp Glu Asp Leu Tyr Arg Glu Leu Ala Thr

275 280 285

Lys Leu Lys Pro Gln Glu Leu Glu Ala Leu Met Ser Ser Ser His Arg

290 295 300

Pro Asn Tyr Thr Val Gln Val Leu Thr Ala Ile Met Gln Ala Ala Lys

305 310 315 320

Leu Pro Gly Val Asp Ile Asp Pro Arg Asp Ser Gly Ala Asn Val Lys

325 330 335

Ala Ser Ala Leu Val Arg Met Asp Glu Gln Leu Thr Gln Phe Ala Asp

340 345 350

Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val Pro Leu Ala

355 360 365

Tyr Ser Arg His Asn Ser Arg Met Leu Thr Leu Trp Met Thr Leu Leu

370 375 380

Pro Phe Ser Leu Trp Asp Thr Cys Gly Trp Ala Thr Pro Phe Val Val

385 390 395 400

Leu Ile Val Ala Phe Leu Leu Leu Gly Val Lys Glu Ile Gly Leu Asn

405 410 415

Ile Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Thr Ile Cys Asn Thr

420 425 430

Ile Glu Thr Asn Val Trp Glu Leu His Arg Thr His Ser Thr Ala Ala

435 440 445

Ala Glu Ala Gln Gln Glu Ala Ala Arg Arg Gly Ser Trp Ser Gln Gln

450 455 460

Ala Gln Gln Gly Pro Gln Gln Val Asp Ala Asp Leu Leu Ala Pro Ala

465 470 475 480

Ala Ala Thr Gln Leu Gly Val Ala Leu Trp Arg Phe Pro Thr Gly Ala

485 490 495

Ala Tyr Leu Leu Ser Arg Thr Asn Leu Ala Ser Leu Ile Glu Arg Asn

500 505 510

Leu Arg Leu Arg Arg Gln Leu Gly Ile Ser Asp Ala Ala Thr Ala Thr

515 520 525

Ala Leu Phe Gln Ser Gln Gly Ala Leu Val Ser Lys Phe Glu Arg Ala

530 535 540

Glu Val Met Val Ala His Leu Gln Arg Leu Gln Ala Ser Gly Glu Leu

545 550 555 560

Ser Ala Glu Gln Val Ala Arg Met Ala Leu Ala Pro Ser Ala Leu His

565 570 575

Leu Thr Pro Ala Glu Phe Asp Arg Arg Trp His Asp Gly Gly Leu Ser

580 585 590

Arg Pro Gly Ala Ser Pro Thr Asp Ile Thr Met Ser Asp Thr Ala Gly

595 600 605

Arg Gln Gln Ala Ala Ala Ala Ala Leu Gly Glu Leu Leu Gln Ala Ala

610 615 620

Asp Gly Val Pro Gly Pro Leu Gln Pro Gln Tyr Leu Gln Gln Gly Glu

625 630 635 640

Glu Leu Val Gln Arg Ser Ala Gly Leu Trp Arg Ala Gly Pro Ala Ala

645 650 655

Leu Arg Ala Gly Trp Ala Ser Leu Gln Gln Leu Gly Leu Ser Asp Ser

660 665 670

Gln Val Val Ala Ala Met Thr Met Gln Pro Ala Val Leu Ser Leu Asp

675 680 685

Trp Ala Gly Glu Thr Lys Gln Arg Leu Leu Ala Trp Ala Glu Glu His

690 695 700

Leu Gly Ile Asp Thr Phe Gly Phe Leu Thr Ser Tyr Thr Arg Phe Val

705 710 715 720

Thr Tyr Ser Gly Ala Ser Val Ala Met Arg Ala Asp Phe Leu Gln Gln

725 730 735

His His Pro Ala Met Trp Asp Gln Asn Leu Cys Arg Gly Pro Arg Thr

740 745 750

Leu Phe Arg Leu Leu Thr Glu Pro Glu Arg Leu Cys Ala His Ala Gly

755 760 765

Cys Thr Glu Thr Glu Leu Val Ala Phe Asn Arg Ala Trp Leu Ala Thr

770 775 780

Pro Ala Gly Leu Arg Trp Gly Gly Lys Ala Gly Arg Ser Gln Arg Arg

785 790 795 800

Ala Ala Ser

<210> 9

<211> 417

<212> PRT

<213> Philippine violet herb tabebuia root

<400> 9

Met Lys Ile Ser Pro Ser Ser Cys Ser Pro Gln Phe Leu Pro Arg Thr

1 5 10 15

Leu Phe Lys Phe His His Ser Pro Leu Pro Phe Ile Ser Lys Lys Pro

20 25 30

His Lys Leu Ser Phe Lys Phe Ile Cys Ala Cys Gln Ser Ser Asn Asp

35 40 45

Ser Asn Pro Ser Pro Ser Gln Asp Phe Thr Leu Leu Ser Leu Leu Leu

50 55 60

Ala Ile Pro Asn Trp Ala Asp Gly Ile Lys Glu Arg Arg Met Lys Gln

65 70 75 80

Lys Arg Ser Leu Tyr Asp His Lys Ser Trp Val Gln His Arg Ser Ser

85 90 95

Leu Arg His Val Arg His Phe Leu Ser Ser Leu Ser Ser Arg Val Ile

100 105 110

Leu Ser Leu Val Pro Pro Val Ile Val Phe Thr Leu Val Ala Val Ile

115 120 125

Ile Ala Ser Tyr Asn Ser Ala Val Ser Ile His Trp Leu Pro Glu Phe

130 135 140

Phe Pro Ile Leu Arg Ala Ser Ser Leu Pro Tyr Gln Leu Thr Ala Pro

145 150 155 160

Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu Ala Ser Tyr Ser Arg

165 170 175

Phe Glu Glu Gly Lys Lys Ala Trp Thr Lys Val Ile Ser Gly Thr Asn

180 185 190

Asp Phe Ala Arg Gln Val Ile Ala Ser Val Glu Ser Pro Ser Asp Ser

195 200 205

Met Leu Lys Lys Ala Ile Leu Gln Tyr Ile Met Ala Phe Pro Val Ala

210 215 220

Leu Lys Cys His Ile Ile Tyr Gly Ser Asp Ile Ala Gln Asp Leu Lys

225 230 235 240

Asn Leu Leu Glu Ala Asp Asp Leu Ser Val Val Leu Ser Ser Lys His

245 250 255

Arg Pro Arg Cys Ile Ile Glu Phe Ile Ser Gln Ser Leu Gln Leu Leu

260 265 270

Asp Met Asp Ala Thr Lys Leu His Val Leu Glu Ser Lys Leu Cys Cys

275 280 285

Phe His Glu Gly Ile Gly Val Cys Glu Gln Leu Met Gly Thr Pro Ile

290 295 300

Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Ile Leu Trp His

305 310 315 320

Leu Thr Leu Pro Val Ile Leu Trp Asp Asp Cys His Trp Ile Val Val

325 330 335

Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile Glu Glu Val

340 345 350

Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu Ala Leu Asp Glu Leu

355 360 365

Cys Leu Thr Ala Gln Ser Asn Ile Gln Asp Ile Met Arg Asn Glu Lys

370 375 380

Leu Ile Lys Asp Gln Val Lys Lys Ala Lys Arg Lys Ile His Ser Arg

385 390 395 400

Lys His Ser Ser Asn Gly Trp Pro Asn Pro Leu Glu Asp Arg Gln Pro

405 410 415

Ser

<210> 10

<211> 385

<212> PRT

<213> acid-fast green algae

<400> 10

Met Leu Val His Arg Val His Thr Arg Ser Leu Gly Asn Arg Asn Gln

1 5 10 15

Cys Gly Arg Lys Leu His Arg Val Ser Thr Phe Val Val Lys Thr Pro

20 25 30

Thr Glu Lys Pro Val Val Ala Asp Tyr Val Leu Pro Arg Ser Glu Glu

35 40 45

Ala Arg Arg Tyr Phe Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Lys

50 55 60

His Arg Ser Pro Thr Arg Leu Ile Asp Arg Leu Leu Gln Ile Pro Arg

65 70 75 80

Ser His Val Leu Gln Asn Ile Leu Pro Ser Ile Ala Trp Cys Ser Ser

85 90 95

Val Ala Gly Leu Leu Thr Leu Tyr Met Gln Ala Tyr Asp Ala His Ile

100 105 110

Leu Pro Asp Gly Phe Pro Ser Phe Ala Thr Asn Asn Ala Cys Thr Ser

115 120 125

Phe Val Asn Thr Thr Thr Val Ala Leu Ser Leu Leu Leu Val Phe Arg

130 135 140

Thr Asn Val Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Lys Gly

145 150 155 160

Leu Leu Val Asn Arg Ser Arg Asp Leu Met Arg Gln Val Cys Ala Met

165 170 175

Val Pro Glu Glu Asp Val Ala Thr Lys Ala Met Met Ala Lys Trp Thr

180 185 190

Ala Ala Phe Cys Arg Val Leu Arg Ile His Phe Gln Pro Glu Val Ser

195 200 205

Leu Glu Asp Glu Met Lys Gly Leu Leu Ser Pro Glu Glu Leu Glu Trp

210 215 220

Leu Ile Glu Ser Lys His Arg Pro Cys Ser Val Ile His Met Leu Ser

225 230 235 240

Gln Ile Ile Tyr Asp Ser Gln Ile Ser Ala Ile Cys Gln Ala Gln Met

245 250 255

Cys Asn Asn Leu Thr Ala Phe Glu Asp Val Leu Gly Gly Cys Glu Arg

260 265 270

Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg

275 280 285

Phe Leu Phe Thr Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Asn Ser

290 295 300

Cys Gly Val Trp Thr Leu Pro Val Val Ala Gly Val Ser Ala Val Leu

305 310 315 320

Cys Gly Ile Glu Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Gly Ile

325 330 335

Leu Pro Leu Glu Ala Ile Cys Gly Arg Ile Gln Ala Asp Val Met Ala

340 345 350

Thr Leu Lys Glu Asp Ala Lys Thr Arg Asn Leu Arg Asn Lys Val Leu

355 360 365

Leu Ile Arg Gly Pro Glu His Trp Ala Met Val Asn Gly His Ser Asn

370 375 380

Lys

385

<210> 11

<211> 397

<212> PRT

<213> acid-fast green algae

<400> 11

Met Asn Lys Ser Leu Leu Arg Ala Pro Glu Ser Asn Val Val Phe Arg

1 5 10 15

Arg Ala Cys Asn Lys Ser Phe Val Lys Arg Cys Lys Glu Val Gln Arg

20 25 30

Leu Pro Ser His Val Ala Leu Ala Val Lys Asn Pro Ala Glu Lys Pro

35 40 45

Val Val Ala Asp Tyr Val Leu Pro Arg Ser Glu Glu Ala Arg Arg Tyr

50 55 60

Phe Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Lys His Arg Ser Gln

65 70 75 80

Leu Arg Leu Ile Asp Arg Leu Leu Gln Ile Pro Arg Ser His Val Leu

85 90 95

Gln Asn Ile Leu Pro Ser Ile Ala Trp Cys Ser Ser Val Ala Gly Leu

100 105 110

Leu Thr Leu Tyr Met Gln Ala Tyr Asp Ala His Ile Leu Pro Asp Gly

115 120 125

Phe Pro Ser Phe Thr Pro Asn Asn Ala Cys Thr Ser Phe Val Asn Thr

130 135 140

Thr Thr Val Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Val Ser

145 150 155 160

Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Lys Gly Leu Leu Val Asn

165 170 175

Arg Ser Arg Asp Leu Met Arg Gln Ala Cys Ala Met Leu Pro Ala Glu

180 185 190

Asp Ile Glu Thr Lys Ala Met Met Ala Lys Trp Thr Ala Ala Phe Cys

195 200 205

Arg Val Leu Arg Ile His Phe Gln Pro Glu Val Ser Leu Glu Asp Glu

210 215 220

Met Lys Gly Leu Leu Ser Pro Glu Glu Leu Gln Trp Leu Gln Glu Ser

225 230 235 240

Lys His Arg Pro Cys Ser Val Ile His Val Leu Ser Gln Ile Ile Tyr

245 250 255

Asp Ser Gln Ile Ser Ala Ile Cys Gln Ala Gln Met Cys Asn Asn Leu

260 265 270

Thr Ala Phe Glu Asp Val Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala

275 280 285

Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Phe Thr

290 295 300

Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Asn Ser Cys Gly Val Trp

305 310 315 320

Thr Leu Pro Val Val Ala Gly Val Ser Ala Val Leu Cys Gly Ile Glu

325 330 335

Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Gly Ile Leu Pro Leu Glu

340 345 350

Ala Ile Cys Gly Arg Ile Gln Ala Asp Val Met Ala Thr Leu Arg Glu

355 360 365

Asp Glu Lys Met Arg Asn Leu Arg Lys Arg Val Ile Gln Thr Arg Thr

370 375 380

Thr Glu Leu Arg Glu Leu Ala Ser Gly Gly Ala Ser Lys

385 390 395

<210> 12

<211> 402

<212> PRT

<213> acid-fast green algae

<400> 12

Met Lys Val Gly Ile His Val Val Gln Thr Leu Ser Gly His Thr Ile

1 5 10 15

Ser Gly Gln Arg Phe Leu Asn Lys Ala Gly Cys Asn Lys Leu Arg Pro

20 25 30

Ala Asn Lys Ser Ser Phe Arg Ala Gln Ser Thr Ser Ala Leu Asp Glu

35 40 45

Phe Leu His Arg Ile Glu Ile Asn Ile Asp Lys Asp Lys Glu Ala Ala

50 55 60

Arg Ser Glu Arg Arg Gln Ala Phe Thr His Val Asp Trp Lys Arg His

65 70 75 80

Arg Ser Ser Ala Arg Phe Ile Arg His Leu Ser Thr Ile Pro Glu Ser

85 90 95

Trp Val Ile Arg Gly Val Leu Trp His Val Ala Cys Phe Ile Leu Leu

100 105 110

Ala Leu Gly Val Ala Ala Phe Asn Tyr Ser Tyr Ala Cys Lys Gly Leu

115 120 125

Val Pro Pro Tyr Ser Ile Ala Ile Glu Pro Met Gln Leu Thr Ser Phe

130 135 140

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala Arg

145 150 155 160

Trp Gln Glu Ala Arg Arg Ser Phe Gly Ser Ile Thr Thr Thr Gly Lys

165 170 175

Asp Ile Met Arg Gln Ser Leu Ala Trp Phe Cys Glu Asp Asp Trp Ala

180 185 190

Gly Lys Met Ala Leu Ser Gly Trp Leu Gln Ala Leu Ala Gln Ser Ser

195 200 205

Met Tyr His Leu Gln Asn Glu Gly His Leu Glu Asp Asp Ser Leu Val

210 215 220

Pro Leu Gln Gly Cys Leu Ser Pro Asp Glu Leu Ala Gln Leu Arg Ile

225 230 235 240

Ser Ser His Lys Pro Thr Phe Cys Ile Ala Met Ile Thr Arg Leu Val

245 250 255

Ser Arg Ala Gly Met Pro Thr Glu Leu Leu Leu Arg Met Asp Glu Asn

260 265 270

Ile Ser Thr Leu Val Gln Ala Val Ser Ser Cys Glu Arg Ile Ile Asn

275 280 285

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Met

290 295 300

Val Trp Leu Thr Cys Leu Pro Phe Ser Leu Trp Gln Tyr Cys Gly Trp

305 310 315 320

Ala Met Val Pro Ile Ala Gly Leu Ile Ser Phe Val Leu Leu Gly Ile

325 330 335

Glu Glu Ile Gly Val Tyr Ile Glu Glu Pro Phe Ser Leu Leu Pro Leu

340 345 350

Glu Ser Leu Cys Asp Lys Leu Thr His Ser Ile Asp Asn Met Met Leu

355 360 365

Glu His Arg Leu Phe Ser Glu Gly Glu Val Ile Thr Pro Lys Gly Ser

370 375 380

Thr Gly Asp Ser Glu Cys Leu Ala Thr Ser Ser Lys Met Gln Arg Tyr

385 390 395 400

Asn Cys

<210> 13

<211> 838

<212> PRT

<213> acid-fast green algae

<400> 13

Met Phe Phe Arg Lys Ala Cys Ser Gln Pro Ile Gly Arg Lys His Gln

1 5 10 15

Gly Gly His Arg Phe Gln Arg Leu Val Arg Pro Asn Phe Asn Cys Ser

20 25 30

Val Thr Asp Ala Asp Lys Ala Ala Glu Asn Phe Val Leu Ser Arg Ser

35 40 45

Glu Glu Ser Arg Arg Tyr Phe Arg Thr Val Tyr Asp Phe Pro Leu Trp

50 55 60

Gln Lys His Ser Asn Gln Pro Arg Ile Ile Asp Glu Val Arg Lys Asn

65 70 75 80

Ser Arg Thr Asn Ile Leu Lys Ser Ile Leu Pro Ser Thr Ala Trp Cys

85 90 95

Thr Gly Val Ala Ala Leu Leu Thr Ala Tyr Val Gln Ala Tyr Asp Ser

100 105 110

Asn Met Leu Pro Ala Gln Phe Pro Arg Phe Glu Ser Ile Pro Ser Tyr

115 120 125

Ala Ala Ile Val Asn Ile Thr Val Val Ser Leu Ser Leu Leu Leu Val

130 135 140

Phe Arg Thr Asn Ala Ser Tyr Gly Gln Trp Asp Ala Ala Arg Lys Met

145 150 155 160

Lys Gly Leu Leu Val Asn Arg Ser Gln Glu Leu Met Arg Glu Ala Cys

165 170 175

Ser Leu Leu Pro Ala Glu Asp Thr Ala Thr Lys Ile Met Met Gly Arg

180 185 190

Trp Ile Ser Ala Tyr Ala Gly Val Leu Arg Asn Gln Phe Gln Pro Glu

195 200 205

Glu Ser Leu Gly Lys Ile Val Asp Gly Leu Leu Ser Thr Glu Glu Leu

210 215 220

Glu Trp Leu Asn Ser Ser Asn Gln Arg Pro Ser Ser Val Ile Asp Val

225 230 235 240

Leu Ser Gln Ile Ile Ser Ser Ala Ala Ile Pro Ala Pro Asn Gln Ala

245 250 255

Gln Met Asn Asn Asn Leu Ala Ala Leu Arg Gly Val Leu Gly Gly Cys

260 265 270

Gln Arg Leu Leu Lys Asp Pro Ile Pro Met Ser Tyr Thr Arg Asn Ser

275 280 285

Ala Arg Leu Leu Phe Leu Trp Leu Thr Leu Leu Pro Phe Ala Leu Phe

290 295 300

Ser Ser Cys Gly Val Trp Thr Ala Pro Val Val Ala Ala Val Ser Ala

305 310 315 320

Val Leu Cys Ser Ile Glu Glu Ile Gly Val Gln Ile Glu Glu Pro Ser

325 330 335

Thr Thr Gly Met Leu Pro Leu Glu Ala Ile Gly Asp Arg Ile Gln Ala

340 345 350

Asp Val Ile Thr Thr Leu Leu Glu Asp Glu Lys Thr Lys Thr Met Arg

355 360 365

Gly Glu Val Asp Thr Ala Ala Leu Arg Ala Ala Ala Gln Pro Ser Lys

370 375 380

Leu Asp Glu Val Pro Gly Lys Leu Val Leu Leu Ala Glu Gln Val Ala

385 390 395 400

Val Val Gly Gln Ser Ser Asn Asn Gln Gly Thr Gly Gly Ala Gly Gln

405 410 415

Lys Gly Glu Arg Arg Val Leu Leu Ser Lys Leu Glu Thr Glu Thr Lys

420 425 430

Asp Met Lys Asp Asn Leu Gln Arg Leu Lys Gln Arg Ala Thr Glu Leu

435 440 445

Ser Thr Lys Ala Gln Gln Ala Ser Asp Val Ala Arg Lys Glu Arg Ala

450 455 460

Asn Ala Val Leu Lys Leu Gly Glu Met Asp Glu Gln Leu Lys Thr Ser

465 470 475 480

Gln Glu Ala Gly Val Tyr Ser Glu Ile Thr Gln Leu Lys Asp Ser Leu

485 490 495

Thr Thr Arg Glu Ser Asp Val Ala Ser Leu Val Ser Glu Leu Met Leu

500 505 510

Glu Gln Gln Ser Asn Gln Gln Leu Leu Glu Gln Val Ala Leu Leu Gln

515 520 525

Met Gln Leu Ser Glu Thr Glu Asn Met Leu Thr Ser Glu Lys Ser Ile

530 535 540

Gly Glu Gly Leu Ser Gln Gln Leu Gln Ile Thr Gln Val Asp Leu Asn

545 550 555 560

Thr Ser Gln Ser Ser Leu Ala Asp Met Ser Gln Lys Leu Arg Glu Glu

565 570 575

Glu Phe Gln Arg Ala Thr Leu Gln Ser Glu Ile Gln Ala Leu Arg Ser

580 585 590

Asp Leu Asp Arg Val Thr Ala Val Val Glu Thr Arg Gln Lys Glu Ala

595 600 605

Asp Val Tyr Arg Ala Ala Ala Glu Lys Ala Glu Gln Gln Val Val Asp

610 615 620

Ala Ala Ala Leu Arg Gln Ala Met Met Ala Glu Leu Thr Glu Thr Ser

625 630 635 640

Asp Ser Phe Ala Glu Leu Leu Ala Glu Ala Leu Ser Arg Ala Glu Ser

645 650 655

Ala Glu Ala Asp Lys Val Lys Val Glu Ala Glu Val Arg Met Leu Gln

660 665 670

Ser Lys Ile Val Ser Ala Asp Ala Ala Leu Ser Arg Leu Glu Thr Gln

675 680 685

Leu Leu Glu Glu Glu Arg Lys Gly Ile Pro Pro Ser Gly Ser Asn Asp

690 695 700

Met Glu Phe Glu Asp Val Gln Lys Arg Ile Ala Glu Leu Glu Gly Leu

705 710 715 720

Leu Gly Gly Leu Leu Ser Glu Val Glu Gln Ala Thr Val Lys Gln Gly

725 730 735

Arg Thr Arg Leu Thr Gln Asp Thr Ile Glu Glu Val Lys Arg Glu Ala

740 745 750

Glu Leu Arg Ser Ala Arg Val Ala Ala Glu Leu Ala Ala Glu Ser Gly

755 760 765

Ala Arg Ser Glu Ala Glu Asp Asn Leu Arg Val Leu Gln Ser Glu Leu

770 775 780

Leu Gln Leu Lys Glu Ala Ser Gln Thr Ser Arg His Ala Ala Glu Lys

785 790 795 800

Glu Leu Lys Glu Met Gln Leu Leu Ile Ser Glu Val Lys Ala Lys Ala

805 810 815

Ala Glu Thr Ala Ala Phe Val Gly Lys Ala Ala Lys Glu Gly Pro Lys

820 825 830

Lys Gly Lys Ser Ala Tyr

835

<210> 14

<211> 365

<212> PRT

<213> acid-fast green algae

<400> 14

Met Lys Val Cys Ile His Val Val Gln Thr Leu Ser Gly His Thr Ile

1 5 10 15

Ser Gly Gln Arg Phe Leu Asn Lys Ala Gly Cys Asn Lys Leu Arg Pro

20 25 30

Ala Asn Lys Ser Ser Phe Arg Ala Gln Ser Thr Ser Ala Leu Asp Glu

35 40 45

Phe Leu His Arg Ile Glu Ile Asn Ile Asp Lys Asp Lys Glu Ala Ala

50 55 60

Arg Ser Glu Arg Arg Gln Ala Phe Thr His Val Asp Trp Lys Arg His

65 70 75 80

Arg Ser Ser Ala Arg Phe Ile Arg His Leu Ser Thr Ile Pro Glu Ser

85 90 95

Trp Val Ile Arg Gly Val Leu Trp His Val Ala Cys Phe Ile Leu Leu

100 105 110

Ala Leu Gly Val Ala Ala Phe Asn Tyr Ser Tyr Ala Cys Lys Gly Leu

115 120 125

Val Pro Pro Tyr Ser Ile Ala Ile Glu Pro Met Gln Leu Thr Ser Phe

130 135 140

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala Arg

145 150 155 160

Trp Gln Glu Ala Arg Arg Ser Phe Gly Ser Ile Thr Thr Thr Gly Lys

165 170 175

Asp Ile Met Arg Gln Ser Leu Ala Trp Phe Cys Glu Asp Asp Trp Ala

180 185 190

Gly Lys Met Ala Leu Ser Gly Trp Leu Gln Ala Leu Ala Gln Ser Ser

195 200 205

Met Tyr His Leu Gln Asn Glu Gly His Leu Glu Asp Asp Ser Leu Val

210 215 220

Pro Leu Gln Gly Cys Leu Asn Pro Asp Glu Leu Ala Gln Leu Arg Ile

225 230 235 240

Ser Ser His Lys Pro Thr Phe Cys Ile Ala Met Ile Thr Arg Leu Val

245 250 255

Ser Arg Ala Gly Met Pro Thr Glu Leu Leu Leu Arg Met Asp Glu Asn

260 265 270

Ile Ser Thr Leu Val Gln Ala Val Ser Ser Cys Glu Arg Ile Ile Asn

275 280 285

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Met

290 295 300

Val Trp Leu Thr Cys Leu Pro Phe Ser Leu Trp Gln Tyr Cys Gly Trp

305 310 315 320

Ala Met Val Pro Ile Ala Gly Leu Ile Ser Phe Val Leu Leu Gly Ile

325 330 335

Glu Glu Ile Gly Val Tyr Ile Glu Val Ile Ile Phe Phe Leu Leu Tyr

340 345 350

Leu Gly Gln Leu Ser His Asn Cys Ser His Ile Val Lys

355 360 365

<210> 15

<211> 831

<212> PRT

<213> acid-fast green algae

<400> 15

Met Leu Val Gln Lys Thr Cys Ser Lys Pro Leu Ser Cys Lys Gln Gln

1 5 10 15

Ala Gly Leu Arg Thr Leu Arg Ile Phe Arg Tyr Val Phe Gln Asn Ala

20 25 30

Arg Gln Asp Val Lys Ile Ala Val Ala Lys Val Val Leu Pro Pro Ser

35 40 45

Glu Glu Ala Arg Arg Ser Phe Arg Thr Val Tyr Asp Phe Gln Ser Trp

50 55 60

Arg Lys His Arg Asn Gln Leu Arg Leu Phe Val Gln Val Gly Gln Ile

65 70 75 80

Pro Arg Ser Asn Ile Leu Lys Asn Ile Leu Pro Ser Met Ala Trp Cys

85 90 95

Thr Gly Val Ala Ala Leu Leu Thr Leu Tyr Met Gln Ala Tyr Asp Ser

100 105 110

Asn Leu Leu Pro Glu Pro Phe Pro Ser Phe Ala Ser Asn Thr Ala Ser

115 120 125

Val Thr Phe Val Asn Thr Thr Val Val Ala Leu Ser Leu Leu Leu Val

130 135 140

Phe Arg Thr Asn Ala Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met

145 150 155 160

Lys Gly Leu Leu Val Asn Arg Ser Arg Asp Leu Ile Arg Gln Ala Cys

165 170 175

Ser Met Phe Ser Pro Glu Asp Val Glu Arg Lys Ile Met Met Gly Lys

180 185 190

Trp Val Ser Val Tyr Cys Arg Val Leu Arg Ile His Phe Gln Ala Glu

195 200 205

Val Ser Leu Glu Glu Glu Met Asn Gly Ile Leu Ser Met Glu Glu Val

210 215 220

Glu Trp Leu Gln Ser Ser Thr His Arg Pro Cys Thr Val Ile His Val

225 230 235 240

Leu Ser Gln Ile Ile Tyr Ser Ala Pro Ile Ser Ala Phe Cys Gln Ala

245 250 255

Gln Met Cys Asn Asn Leu Thr Ala Leu Glu Asp Val Leu Gly Gly Cys

260 265 270

Glu Arg Ile Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg Asn Thr

275 280 285

Ala Arg Phe Leu Phe Val Trp Leu Thr Leu Leu Pro Phe Ala Leu Phe

290 295 300

Ser Ser Cys Gly Val Trp Thr Ala Pro Val Val Ala Gly Ile Ala Ala

305 310 315 320

Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Val Glu Glu Pro Phe

325 330 335

Gly Ile Leu Pro Leu Ala Ala Ile Gly Asp Arg Ile Gln Ala Asp Val

340 345 350

Ile Ser Thr Leu Leu Glu Asp Gly Arg Thr Arg Thr Met Arg Ser Glu

355 360 365

Val Asn Thr Ala Ala Leu Arg Ala Met Ala Gln Pro Pro Asn Gln Glu

370 375 380

Gly Val Leu Gly Ser Val Asp Arg Gln Ser Thr Asn Leu Ala Asn Ser

385 390 395 400

Gln Glu Ser Thr Thr Gly Ser Asn Pro Met Gly Gln Arg Val Val Leu

405 410 415

Leu Ser Lys Leu Glu Thr Glu Thr Lys Asp Met Lys Asp Asn Leu Asn

420 425 430

Lys Leu Lys Gln Arg Ala Thr Glu Leu Ser Met Lys Ala Gln Leu Ala

435 440 445

Ser Glu Ala Ala Gln Arg Glu Arg Ala Ser Ala Val Gln Lys Leu Gly

450 455 460

Ile Met Asn Glu Gln Leu Lys Gly Phe Lys Gly Ala Glu Val Tyr Ser

465 470 475 480

Glu Ile Ala Gln Leu Lys Asp Thr Leu Thr Ser Arg Glu Ser Asp Val

485 490 495

Ala Thr Val Val Ser Glu Met Gln Gln Gln Gln Leu Ser Ser Gln Gln

500 505 510

Leu Phe Glu Gln Leu Ala His Leu Gln Thr Gln Leu Ser Glu Ala Glu

515 520 525

Ala Leu Leu Ser Thr Glu Lys Ser Met Gly Gln Glu Leu Ser Gln Gln

530 535 540

Leu Gln Leu Thr Gln Met Gly Leu Lys Thr Asn Gln Ala Ser Leu Leu

545 550 555 560

Asp Val Ser His Lys Leu Gln Lys Glu Glu Leu Gln Arg Ser Ala Phe

565 570 575

Gln Thr Glu Ile Gln Ala Leu Arg Arg Asp Leu Asp Arg Ile Thr Thr

580 585 590

Ala Met Glu Ser Lys Arg Leu Glu Thr Glu Ala Phe Trp Ala Ala Ala

595 600 605

Glu Ser Ala Glu Gln His Val Ala Asp Ser Ala Ala Leu Gln Ser Ala

610 615 620

Met Met Ala Glu Leu Thr Glu Thr Ser Asp Ala Phe Ala Glu Arg Leu

625 630 635 640

Ala Ala Ala Leu Ser Arg Ala Glu Thr Ala Glu Thr Asp Lys Phe Arg

645 650 655

Ala Glu Gln Glu Val Lys Met Leu Gln Ser Lys Ile Ala Asp Thr Glu

660 665 670

Thr Met Leu Arg Lys Leu Glu Ala Lys Ala Ala Glu Leu Glu Arg Lys

675 680 685

Gly Ser Ala Pro Ser Glu Ser Thr Ala Leu Glu Phe Arg Asp Ala Gln

690 695 700

Trp Lys Ile Ala Glu Leu Glu Gly Leu Leu Gly Glu Val Leu Leu Glu

705 710 715 720

Val Lys His Ala Ala Ser Asn Asn Ala Thr Glu Tyr Ser Thr Gln Asp

725 730 735

Lys Ile His Glu Val Gln Arg Glu Ala Asp Arg Arg Ser Ile Arg Val

740 745 750

Ala Ala Glu Ile Ala Ala Glu Arg Gly Ala Arg Ser Glu Ala Glu Asp

755 760 765

Asn Leu Arg Ile Leu Gln Arg Glu Leu Leu Leu Leu Lys Glu Asp Ser

770 775 780

Leu Ser Ser Arg Asn Ala Ala Glu Arg Glu Leu Lys Glu Met Gln Leu

785 790 795 800

Leu Ile Cys Glu Val Lys Ala Lys Ala Ala Ser Thr Ala Thr Phe Val

805 810 815

Gly Thr Ala Ala Ala Glu Gly Pro Arg Arg Gly Gln Asn Thr Tyr

820 825 830

<210> 16

<211> 451

<212> PRT

<213> Chlorella

<400> 16

Met Thr Ala Ser Asp Ala Pro Ser Ala Ser Arg Ser Gly Gly His Ala

1 5 10 15

Arg Leu Val Gln Thr Ala Ala Ser Pro Arg Gly Asp Gly Ser Phe Ala

20 25 30

Val Gly Ser Thr Asp Leu Glu Gln Val Ala Glu Gln Ala Val Val Asp

35 40 45

Ala Val Ala Gln Thr Ala Gly Asp Arg Ala Thr Ser Ser Ser Ala Ala

50 55 60

Ala Gly Ser Arg Glu Val Asp Pro Ile Lys Glu Gly Ser Arg Lys Tyr

65 70 75 80

Arg Arg Thr Val Tyr Asp Phe Glu Asn Trp Arg Gln His Arg Ser Thr

85 90 95

Lys Arg Tyr Met Arg His Ala Lys Gly Leu Leu Gly Ser Arg Ile Phe

100 105 110

Arg Gly Leu Ala Ser Pro Leu Leu Tyr Ile Leu Ala Val Ser Ala Ser

115 120 125

Val Ala Val Trp Asn Thr Leu Val Glu Thr Gly Leu Ala Pro Asp Val

130 135 140

Leu Pro Glu Leu His Met Ser Asn Asn Gly Pro Phe Gly Leu Thr Ser

145 150 155 160

Phe Ala Leu Ser Leu Leu Leu Val Thr Asn Ala Ser Tyr Ala Arg Trp

165 170 175

Leu Asp Ala Arg Lys Ala Trp Gly Met Leu Val Asn Arg Ser Arg Asp

180 185 190

Ile Thr Arg Gln Ala Leu Thr Cys Phe Pro Ala Ala Asp Arg Pro Leu

195 200 205

Leu Asp Met Leu Cys Arg Trp Thr Ala Ala Tyr Ser Arg Ala Leu Met

210 215 220

Cys His Val Arg Glu Asp Ser Asp Leu Glu Ala Glu Leu Arg Lys Val

225 230 235 240

Leu Pro Ala His Glu Val Glu Ala Val Val Leu Ala Lys His Arg Pro

245 250 255

Asn Tyr Cys Leu Gln Val Met Ser Glu Ile Val His Ser Ala His Leu

260 265 270

Ser Ala Leu Pro Leu Pro Val Ala Arg Gly Ala Val Val Ala Ser Gly

275 280 285

Ala Pro Ala Leu Ala Ala Ala Gly Trp Glu Gly Thr Arg Tyr Arg Met

290 295 300

Asp Glu Asn Leu Thr Ala Met Glu Asp Ile Leu Gly Ala Cys Glu Arg

305 310 315 320

Ile Leu Arg Ala Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg

325 330 335

Phe Met Met Ile Trp Leu Thr Leu Leu Pro Phe Ser Leu Trp Asp Asn

340 345 350

Cys Gly Trp Ala Ser Val Pro Leu Cys Gly Ile Ile Ala Phe Leu Leu

355 360 365

Leu Gly Ile Glu Glu Ile Gly Val Ser Ile Glu Glu Pro Phe Ser Ile

370 375 380

Leu Pro Leu Glu Val Ile Cys Asp Ile Ile Glu Ala Asn Val Arg Glu

385 390 395 400

Leu Arg Ser Ile His Ala Gly Ser His Ala Glu Asp Gly Ser Gln Pro

405 410 415

Arg Arg Ala Pro Ala Ala Arg Asp Leu Val Gly Arg Ala Val Ala Glu

420 425 430

Ala Glu Gln Glu Glu Ala Ala Ala Ala Ala Gly Thr Val Ala Ala Ala

435 440 445

Ala Gly Ala

450

<210> 17

<211> 456

<212> PRT

<213> Chlorella

<400> 17

Met Ala Ser Arg Leu His Gly Ser Arg His Gln Gly Ala Leu Leu Gly

1 5 10 15

Leu Gln Gln Pro Ala Gly Leu Val Pro Arg Thr Arg Ser Leu Asn Arg

20 25 30

Gly Arg Leu Thr Gln Leu Arg Val Ala Ala Ala Ala Ser Ser Pro Pro

35 40 45

Leu Pro Ala Lys Leu Ser Gly Asp Asp Leu Lys Glu Ala Glu Leu Lys

50 55 60

Lys Leu Arg Thr Val Ala Asp Phe Glu Phe Trp Lys Arg His Arg Ser

65 70 75 80

Ser Ser Arg Tyr Trp Arg His Val Leu Gly Ile Phe Asp Ser Arg Thr

85 90 95

Phe Ser Trp Val Ala Ala Pro Leu Ser Tyr Val Met Leu Leu Thr Thr

100 105 110

Gly Val Cys Leu Tyr Tyr Thr Leu Ala Glu Ala Gly Ile Val Pro Glu

115 120 125

Val Ile Pro Glu Ile Ser Ala Ser Ala Ala Ala Pro Phe Gly Leu Thr

130 135 140

Ser Phe Ala Leu Ser Thr Leu Leu Val Leu Arg Thr Asn Thr Ser Tyr

145 150 155 160

Gln Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Ile Val Asn Arg

165 170 175

Thr Arg Asp Ile Ser Arg Gln Ala Val Gly Tyr Ile Pro Pro His Gln

180 185 190

Ala Glu Leu Gln Asp Met Phe Cys Arg Trp Leu Val Ala Tyr Cys Arg

195 200 205

Ser Leu Met Cys His Leu Arg Ala Gly Glu Asp Leu Glu Ala Glu Leu

210 215 220

Lys Gly Lys Leu Thr Asp Ile Glu Leu Lys Ala Leu Leu Ala Ser Thr

225 230 235 240

His Arg Pro Asn Tyr Thr Cys Gln Val Leu Thr Ala Ile Ile Arg Ala

245 250 255

Ala Gln Leu Pro Gly Gly Lys Val Asp Met Asn Asp Ser Phe Ala Asn

260 265 270

Val Lys Ala Ser Ala Ala Phe Arg Met Asp Glu Asn Leu Thr Gln Tyr

275 280 285

Ala Asp Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val Pro

290 295 300

Leu Ser Tyr Ser Arg His Asn Ser Arg Phe Leu Ile Ile Trp Leu Thr

305 310 315 320

Leu Leu Pro Phe Thr Leu Trp Asp Gln Cys His Trp Phe Thr Leu Pro

325 330 335

Val Thr Gly Leu Val Ala Phe Leu Leu Leu Gly Ile Lys Glu Ile Gly

340 345 350

Val Val Val Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Arg Ile Cys

355 360 365

Asp Thr Ile Glu Ala Asn Val Trp Glu Ile His Ser Ile His Ser Ala

370 375 380

Lys Ala Met Lys Glu Gln Ala Glu Ala Arg Ala Ala Gly Leu Pro Ser

385 390 395 400

Asp Leu Met Glu Ala Ser Asp Leu Val Ser Val Val Ser Glu Leu Ala

405 410 415

Leu Ala Ala Gly Thr Gly Gly Thr Gly Thr Thr Ala Gly Asn Gly Asn

420 425 430

Gly Ala Gly Asn Gly Asn Gly Ser Ala Ala Ala Ala Val Val Ala Ala

435 440 445

Asn Gly Ala Val Val Val Lys Val

450 455

<210> 18

<211> 480

<212> PRT

<213> Chlorella

<400> 18

Met Leu Ala His Ser Arg Pro Gly Ala Gly Ser Arg Pro Gly Asn Gly

1 5 10 15

Ala Ala Lys Ala Gly Ala Gly Gly Arg Ser Ala Pro Pro Leu Gln Pro

20 25 30

Ala Pro Ala Leu Thr Arg Arg Ala Leu Val His Pro Val Pro Ser Pro

35 40 45

Arg Pro Thr Pro Gly Leu Val Arg Gln Arg Pro Gln Arg Gln Arg Pro

50 55 60

Gln Glu Leu Pro Gly Ala Thr Pro Glu Gln Gln Gln Gln Phe Pro Gly

65 70 75 80

Ser Glu Leu Asp Ala Ala Ala Lys Ala Glu Ala Ala Ala Ala Lys Leu

85 90 95

Gln Arg Tyr Pro Trp His Ser Asp Glu Trp Lys Glu Glu Tyr Arg Lys

100 105 110

Gln Val Arg Val Thr Phe Asp Phe Glu Arg Trp Arg Thr His Arg Ser

115 120 125

Ser Ser Arg Phe Trp Arg His Met Ala Gly Leu Ala Gln Ser Asn Thr

130 135 140

Ala Gln Gly Leu Ala Gln Pro Leu Ala Tyr Val Met Ala Val Ser Leu

145 150 155 160

Gly Val Ala Ala Tyr His Val Ala Ala Ala Ala Gly Trp Leu Pro Leu

165 170 175

Trp Pro Val Leu Lys Leu Ala Ala Asn Ala Pro Phe Gly Leu Thr Ser

180 185 190

Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly

195 200 205

Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Val Val Asn Arg Ser

210 215 220

Arg Asp Leu Thr Arg Gln Ala Leu Gly Tyr Ile Pro Ala His Gln Ala

225 230 235 240

Glu Leu Gln Ser Met Leu Cys Arg Trp Val Val Ala Tyr Ser Arg Cys

245 250 255

Leu Met Cys His Leu Arg Glu Gly Glu Asp Leu Glu Ala Glu Leu Arg

260 265 270

Gly Val Leu Leu Pro Glu Glu Val Ala Glu Leu Leu Ala Ala Glu His

275 280 285

Arg Pro Asn Tyr Cys Cys Gln Val Leu Thr Glu Val Leu Arg Glu Ala

290 295 300

Gln Leu Pro Ala Ala Val Thr Ser Pro Thr Asp Ser Thr Gly Cys Val

305 310 315 320

Pro Ala Gly Ala Ala Tyr Arg Met Asp Glu Asn Leu Thr Val Phe Glu

325 330 335

Asp Val Thr Gly Gly Cys Glu Arg Leu Leu Arg Thr Pro Ile Pro Leu

340 345 350

Ala Tyr Thr Arg His Thr Ser Arg Phe Met Met Ala Trp Leu Thr Ile

355 360 365

Leu Pro Phe Ala Leu Trp Asp Thr Cys Gly Trp Ala Met Leu Pro Val

370 375 380

Met Ala Ile Val Ala Phe Val Leu Leu Gly Ile Glu Glu Ile Gly Val

385 390 395 400

Ser Ile Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Thr Ile Cys Arg

405 410 415

Thr Ile Glu Ser Asn Val Arg Glu Ser Val Gly Ala His Cys Gln Arg

420 425 430

Gln Ala Arg Arg Ala Gln Gln Ala Gln His Gly Gly Val Pro Gly Asp

435 440 445

Leu Pro Lys Arg His Ala His Ser Asn Gly Asn Asn Ala Val Pro Ala

450 455 460

Leu Leu Phe Met Pro Pro Gln Pro Val Ala Ser Ala Gly Gln Gln His

465 470 475 480

<210> 19

<211> 318

<212> PRT

<213> Chlorella

<400> 19

Val Phe Thr Phe Glu Arg Trp Asn Lys His Arg Asn Ser Met Arg Tyr

1 5 10 15

Ala Lys His Leu Ala His Met Phe Thr Ser Arg Val Phe Arg Gln Leu

20 25 30

Leu Gly Pro Val Leu Ala Val Met Thr Ile Ala Leu Ala Val Gly Val

35 40 45

Tyr Glu Thr Leu Val Gly Ala Gly Ala Leu Pro Gly His Trp Pro His

50 55 60

Val Thr Leu Ala Leu Gly Gln Gly Phe Asn Leu Thr Ala Phe Ala Leu

65 70 75 80

Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asp Arg Trp Trp

85 90 95

Glu Ala Arg Lys Leu Trp Gly Gly Val Val Asn Arg Cys Arg Asp Ile

100 105 110

Val Arg Gln Val Gly Pro Gln Gly Leu Val Phe Phe Arg Asp Glu Asp

115 120 125

Ala His Leu Lys Glu Leu Leu Ala Arg Trp Thr Met Ala Phe Pro Arg

130 135 140

Val Leu Met Cys His Leu Arg Glu Asp Met Asp Val Gly Lys Glu Val

145 150 155 160

Ala His Ile Leu Thr Ala His Glu Val Ala Val Met Cys Ala Ala Ala

165 170 175

His Arg Pro Asn Phe Val Leu Gln Val Met Ala Glu Thr Val Arg Ala

180 185 190

Ala Arg Pro Asn Glu Leu Cys Arg Met Arg Met Asp Asp Asn Leu Thr

195 200 205

Phe Phe Glu Asp Ala Met Gly Ser Cys Glu Arg Ile Leu Arg Thr Pro

210 215 220

Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Leu Val Trp

225 230 235 240

Leu Ile Leu Leu Pro Phe Thr Leu Trp Ala Ala Tyr Ser Trp Phe Ser

245 250 255

Ile Leu Leu Ser Gly Ile Phe Ala Phe Leu Met Phe Gly Ile Asp Glu

260 265 270

Ile Gly Val Gln Ile Glu Glu Pro Phe Gly Trp Val Ala Ala Thr Tyr

275 280 285

Thr Ala Trp His Leu Ala Cys Glu Lys Pro Gly Cys Cys Cys Trp Val

290 295 300

Val Leu Cys Gly Gly Val Arg Ala Ser Ala Ala His Gln Arg

305 310 315

<210> 20

<211> 433

<212> PRT

<213> Chlorella

<400> 20

Met Ala Ile Leu Leu Gly Ala Arg Val Gln Pro Val Ala Val Ala Ala

1 5 10 15

Thr Pro Ala Ala Lys Arg Gln Ala Arg Gly Ser Thr Leu Arg His Cys

20 25 30

Gln Pro Ala Gly Leu Ala Ala Leu Arg Gln Arg Cys Ala Thr Ser Arg

35 40 45

Cys Ser Arg Ala Ala Leu Arg Thr Leu Ala Val Ala Ser Thr Asp Lys

50 55 60

Thr Glu Pro Glu His Pro Tyr Phe Ser Asp Asp Trp Lys Glu Tyr Asn

65 70 75 80

Arg Arg Phe Gln Arg Pro Val Phe Asp Phe Glu Arg Trp Lys Thr His

85 90 95

Arg Ser Ser Ser Arg Tyr Leu Arg His Val Leu Gly Ile Phe Asp Ser

100 105 110

Lys Ile Val Gln Gly Leu Ala Lys Pro Leu Ala Tyr Val Met Thr Leu

115 120 125

Ala Thr Gly Val Ala Leu Tyr His Thr Leu Ala Glu Ala Gly Tyr Leu

130 135 140

Thr Asp Val Pro Asp Leu Lys Ala Thr Asn Ala Pro Phe Gly Leu Thr

145 150 155 160

Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Thr Ser Tyr

165 170 175

Gln Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Ser Met Val Asn Arg

180 185 190

Ser Arg Asp Phe Thr Arg Gln Ala Leu Gly Tyr Val Pro Glu Ser Gln

195 200 205

Pro Glu Leu Arg Ser Met Leu Val Arg Trp Ser Ile Ala Tyr Pro Arg

210 215 220

Ala Leu Met Cys His Leu Arg Pro Gly Glu Asn Ile Glu Glu Glu Val

225 230 235 240

Lys Asp Ile Leu Lys Pro Glu Glu Val Lys Ala Leu Ala Ala Ser Thr

245 250 255

His Arg Pro Asn Tyr Cys Met Gln Val Leu Thr Ala Cys Leu Lys Gln

260 265 270

Ala Gln Leu Pro Ala Ala Val Thr Ser Asn Arg Asp Ser Tyr Gly Ala

275 280 285

Val Pro Ala Gly Ala Ala Tyr Arg Met Asp Glu Asn Leu Thr Val Tyr

290 295 300

Ser Asp Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val Pro

305 310 315 320

Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Met Met Ile Trp Leu Thr

325 330 335

Leu Leu Pro Phe Thr Leu Trp Asp Asn Cys Gly Trp Ala Met Leu Pro

340 345 350

Ile Thr Phe Ile Val Ser Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly

355 360 365

Val Ser Ile Glu Glu Pro Phe Thr Ile Leu Pro Leu Glu Thr Ile Ala

370 375 380

Arg Thr Ile Glu Ala Asn Leu Arg Glu Leu Glu Ala Thr His Gly Pro

385 390 395 400

Ala Thr Leu Gly Lys Ala Gly Pro Gly Gln Val Asn Ala Thr Glu Leu

405 410 415

Leu Tyr Asp Met Ile Pro Ser Ala Ala Asn Gly Arg Ile Ser Ile Asn

420 425 430

Ala

<210> 21

<211> 503

<212> PRT

<213> Chlorella

<400> 21

Met Gln Leu Gly Ala Gly Arg Gln Val Ser Ala Ala Pro Val Ala Gly

1 5 10 15

Pro Ala Ser Arg Leu Pro Cys Gly Leu Gly Leu Ala Ser Pro Arg His

20 25 30

Pro Trp Pro Ala Ser Arg Gly Pro Leu Thr His His Gln Arg Arg Arg

35 40 45

Gln Leu Arg Val Ala Val Ala Gly Gly Pro Gly Gln Gln Pro Glu Glu

50 55 60

Ala Pro Glu Arg Pro Ala Phe Pro Ala Ala Ala Ala Ala Val Arg Arg

65 70 75 80

Gln Gln Ile Gln Arg Glu Arg Ala Ala Ile Arg Asn Arg Ile Glu Asn

85 90 95

Leu Val Ala Thr Asp Phe Asp Glu Glu Asp Ala Ala Leu Ile Asp Leu

100 105 110

Val Gly Asp Glu Phe Lys Glu Ala Asp Arg Lys Asn Leu Arg Thr Val

115 120 125

Phe Asp Phe Asp Arg Trp Lys Lys His Arg Ser Gly Ser Arg Tyr Met

130 135 140

Arg His Ala Arg Ala Thr Phe Thr Ser Arg Ile Thr Gln Gly Leu Ala

145 150 155 160

Ala Pro Leu Leu Tyr Val Thr Gly Leu Ser Ile Ala Val Ala Ser Trp

165 170 175

His Thr Ala Ala Glu Val Arg Trp Ala Gly Pro Met Gly Ile Leu Ser

180 185 190

Pro Ile Pro Glu Leu Lys Ile Asp Thr Thr Phe Ser Leu Thr Ser Phe

195 200 205

Ala Leu Ser Leu Leu Leu Ala Tyr Arg Thr Asn Ala Gly Tyr Gly Arg

210 215 220

Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Val Val Asn Arg Ser Arg

225 230 235 240

Asp Met Thr Arg Gln Val Gly Ala Arg Leu Ala Gly Ala Gly Gln Cys

245 250 255

Val His Asn Ile Phe Ile Thr Val Cys Thr Cys Ser Arg Ser Leu Met

260 265 270

Cys His Leu Arg Gly Gly Glu Asp Ile Glu Ser Glu Leu Ala Gly Val

275 280 285

Leu Thr Pro Arg Glu Leu Asp Ala Leu Lys Ala Ser Ala His Arg Pro

290 295 300

Asn Tyr Cys Val Gln Val Arg Gly Arg Arg Val Ala Arg Gly Ser Ala

305 310 315 320

Val Gly Gly Ser Leu Pro Pro Leu Pro Pro Ala Ala Ala Ser Pro Gln

325 330 335

Asp Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro Leu

340 345 350

Ser Tyr Thr Arg His Thr Ser Arg Phe Met Met Ile Trp Leu Thr Val

355 360 365

Met Pro Phe Thr Leu Trp Asp Ala Ala Gly Trp Ala Met Val Pro Leu

370 375 380

Ala Met Thr Val Ala Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val

385 390 395 400

Met Ile Glu Glu Pro Phe Ser Val Leu Pro Leu Glu Val Ile Ser Arg

405 410 415

Thr Ile Glu Gly Asn Val Arg Glu Leu Glu Arg Ala His Gly Leu Glu

420 425 430

Ala Ala Ala Met Lys Glu Arg Glu Ala Ala Leu Ala Ala Ala Arg Asp

435 440 445

Gly Gly Gly Ala Ala Ala Pro Ala Ala Pro Ala Asp Gly Gln Val Asp

450 455 460

Ala Leu Asp Leu Val Leu Ser Ile Leu Pro Glu Glu Glu Leu Arg Gln

465 470 475 480

Pro Trp Gly Pro Gly Leu Ala Met Leu Ser Gly Thr Ala Gly Pro Ala

485 490 495

Thr Val Pro Ala Gly Asn Ser

500

<210> 22

<211> 444

<212> PRT

<213> Chlorella

<400> 22

Met Gly Ala Ala Ala Pro Pro Ser Ala Ala Leu Ala Arg Pro Ala Ala

1 5 10 15

Gly Gln Arg Pro Leu Ala Ala Gln Leu Arg Gln Arg Gln Pro Gly Leu

20 25 30

Ala Ala Leu Thr Gln Arg His His Ala Ala Ala Cys Arg Cys Asn Arg

35 40 45

Cys Gly Arg Gly Val Ala Leu Arg Thr Ser Ala Val Ala Asn Thr Asp

50 55 60

Lys Arg Glu Gln Pro His Pro Tyr Phe Thr Asp Glu Trp Lys Glu Tyr

65 70 75 80

Asn Arg Gln Phe Gln Arg Pro Val Phe Asp Phe Glu Arg Trp Lys Thr

85 90 95

His Arg Ser Ser Ser Arg Tyr Leu Arg His Val Leu Gly Met Gly Asp

100 105 110

Ser Lys Ile Val Gln Gly Leu Ala Lys Pro Leu Ala Tyr Val Met Thr

115 120 125

Leu Ala Thr Gly Val Ala Leu Tyr His Thr Leu Ala Glu Ala Gly Tyr

130 135 140

Leu Thr Asp Val Pro Asp Leu Lys Ala Thr Asn Ala Pro Phe Gly Leu

145 150 155 160

Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Thr Ser

165 170 175

Tyr Gln Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Ser Met Val Asn

180 185 190

Arg Ser Arg Asp Phe Thr Arg Gln Ala Leu Gly Tyr Val Pro Tyr Ser

195 200 205

Gln Pro Glu Leu Arg Ser Met Leu Val Arg Trp Ser Ile Ala Tyr Pro

210 215 220

Arg Ala Leu Met Cys His Leu Arg Pro Gly Glu Asn Ile Glu Glu Glu

225 230 235 240

Val Lys Asp Ile Leu Lys Pro Glu Glu Val Lys Ala Leu Ala Ala Ser

245 250 255

Thr His Arg Pro Asn Tyr Cys Met Gln Val Leu Thr Ala Cys Ile Lys

260 265 270

Gln Ala Gln Leu Pro Ala Ala Val Thr Ser Asn Arg Asp Ser Tyr Gly

275 280 285

Ala Val Pro Ala Gly Ala Ala Tyr Arg Met Asp Glu Asn Leu Thr Val

290 295 300

Tyr Ser Asp Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val

305 310 315 320

Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Met Met Ile Trp Leu

325 330 335

Thr Leu Leu Pro Phe Thr Leu Trp Asp Asn Cys Gly Trp Ala Met Leu

340 345 350

Pro Ile Thr Phe Ile Val Ser Phe Leu Leu Leu Gly Ile Glu Glu Ile

355 360 365

Gly Val Ser Ile Glu Glu Pro Phe Thr Ile Leu Pro Leu Glu Thr Ile

370 375 380

Ala Arg Thr Ile Glu Ala Asn Leu Arg Glu Leu Glu Ala Thr His Gly

385 390 395 400

Pro Ala Thr Leu Gly Lys Ala Pro Glu Gly Ala Met Asn Ala Thr Glu

405 410 415

Leu Leu Tyr Glu Val Ile Pro Ser Ala Ala Pro Ala Asp Thr Val Asn

420 425 430

Ala Asn Ser Asn Gly Ala Gln Ile Ala Val Lys Ala

435 440

<210> 23

<211> 273

<212> PRT

<213> Chlorella

<400> 23

Ser Thr Phe Thr Phe Arg Arg Trp Ala Phe His Arg Ser Thr Ser Arg

1 5 10 15

Tyr Val Arg His Met Ser Gly Ile Phe Gln Ser Arg Ile Val Arg Gly

20 25 30

Leu Ala Gln Pro Leu Leu Ser Ser Cys Ala Thr Ala Thr Ile Val Cys

35 40 45

Val Tyr Glu Gln Ala Leu Gln Asp Gly Trp Leu Pro Ser Phe Leu Pro

50 55 60

Thr Phe Ile Met Pro Ser Leu Pro Phe Asp Ile Thr Ala Ser Ser Leu

65 70 75 80

Gly Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asp Arg Trp Gln

85 90 95

Gln Ala Val Ser Ala Trp Gly Asp Ile Glu Thr Arg Ala Arg Asp Thr

100 105 110

Leu Arg Gln Leu Leu Ala Ala Ala Ser His Ser Ser Ala Gly His Gly

115 120 125

Gly Ala Arg Gln Ala Ala Leu Trp Leu Val Ala Phe Ser Arg Ser Leu

130 135 140

Lys Ala Gln Leu Thr Glu Asp Ser Asp Val Gln Ala Glu Leu Arg Glu

145 150 155 160

Val Leu Thr Gly Gln Glu Leu Ala Leu Leu Leu Gly Ala Gln His Arg

165 170 175

Pro Ser Phe Ala Leu Ala Val Leu Ser Glu Leu Ala Glu Ala Ala Pro

180 185 190

Leu Arg Asp Ala Gln Arg Val Arg Val Asp Glu Asn Leu Ser Cys Phe

195 200 205

Gln Asp Ala Ala Gly Arg Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro

210 215 220

Leu Ser Tyr Thr Arg His Ser Ser Arg Phe Met Val Ile Trp Leu Ser

225 230 235 240

Ala Leu Pro Leu Gly Leu Trp Ser Gln Cys Gly Phe Gly Thr Ile Pro

245 250 255

Leu Thr Val Ile Ser Pro Ser Cys Cys Trp Ala Leu Arg Arg Leu Gly

260 265 270

Val

<210> 24

<211> 668

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 24

Met Gln Cys Gln Leu Lys His Gly Ala Arg Pro Gln Ser Gln Arg Pro

1 5 10 15

Asn Trp Leu Pro Ala Arg Ala Ala Thr Leu Arg Pro Ala Val Gln His

20 25 30

Gly Val Arg Arg Gly Leu Thr Leu Gly Val Lys Ala Ala Ala Ala Pro

35 40 45

Leu Glu Asp Lys Lys Met Pro Ala Asp Met Thr Thr Arg Gln Tyr Arg

50 55 60

Arg Val Val Tyr Asp Phe Ala Leu Trp Ala Lys His Arg Asp Val Asn

65 70 75 80

Arg Tyr Leu Tyr Asn Leu Arg Thr Ile Pro Gly Ser Arg Ile Ile Arg

85 90 95

Gln Leu Ser Gln Pro Met Gly Val Val Leu Ala Trp Ala Ala Leu Phe

100 105 110

Gly Phe Tyr Glu Thr Cys Leu Glu Ala Gly Val Leu Pro Ser Tyr Leu

115 120 125

Pro Lys Met Thr Leu Met Ser Ala Glu Pro Gln Gly Leu Thr Ser Phe

130 135 140

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg

145 150 155 160

Phe Asp Glu Ala Arg Lys Ile Trp Gly Gly Ile Leu Asn Arg Ala Arg

165 170 175

Asn Ile Ala Asn Gln Ala Val Thr Phe Ile Pro Ala Glu Asp Gln Ala

180 185 190

Gly Arg Glu Ala Val Gly Lys Trp Thr Val Gly Phe Thr Arg Ala Leu

195 200 205

Gln Ala His Leu Gln Glu Asp Ile Asp Leu Arg Lys Glu Leu Glu Lys

210 215 220

Ala Thr Pro Arg Trp Ser Lys Glu Glu Ile Asp Met Leu Val Asn Ala

225 230 235 240

Gln His Arg Pro Ile Lys Ala Ile Ser Val Leu Ser Glu Leu Thr Arg

245 250 255

Gln Leu Ser Ile Thr Gln Phe Gln Ala Leu Gln Met Gln Glu Asn Cys

260 265 270

Thr Phe Phe Tyr Asp Ala Leu Gly Gly Cys Glu Arg Leu Leu Arg Thr

275 280 285

Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Thr Ile

290 295 300

Trp Leu Ala Met Leu Pro Leu Gly Leu Trp Glu Arg Tyr His Trp Ser

305 310 315 320

Met Leu Pro Val Ile Ala Leu Ile Gly Phe Leu Leu Leu Gly Ile Asp

325 330 335

Glu Ile Gly Ile Ser Ile Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp

340 345 350

Ala Ile Cys Gly Arg Ala Gln Thr Asp Val Asn Ser Leu Leu Lys Glu

355 360 365

Asp Pro Ala Val Met Lys Tyr Val Asp Asp Val Arg Ser Gly Arg Val

370 375 380

Lys Ser Pro Pro Pro Leu Pro Pro Ala Pro Ala Ala Pro Ala Ala Ala

385 390 395 400

Ala Ala Ala Ala Ala Ala Ala Ala Arg Ser Val Ser Pro Gln Pro Asp

405 410 415

Val Ala Lys Thr Leu Gly Ser Leu Phe Thr Asn Val Arg Ala Gly Val

420 425 430

Gly Ala Val Ala Pro Gly Ala Pro Leu Met Pro Gln Ala Pro Val Arg

435 440 445

Ser Pro Ser Pro Thr Arg Ser Val Ser Pro Ser Phe Pro Arg Ala Ser

450 455 460

Ala Gly Thr Gly Met Pro Pro Pro Val Gly Met Asn Gly Ala Thr Pro

465 470 475 480

Arg Val Ala Ala Ala Pro Pro Thr Pro Pro Pro Val Ser Arg Pro Ala

485 490 495

Ala Pro Ala Ala Ala Pro Ala Ala Gly Ser Gly Phe Thr Met Pro Asn

500 505 510

Phe Ser Ala Ser Leu Ser Gly Leu Thr Gly Gly Ala Ala Ala Ala Ala

515 520 525

Lys Ser Ala Ala Asp Ala Ala Ser Ser Lys Leu Thr Lys Met Ala Asp

530 535 540

Ser Met Ser Ser Gly Ala Ala Ala Pro Ala Pro Pro Ala Ala Pro Ala

545 550 555 560

Arg Pro Ser Thr Ser Pro Arg Pro Ser Ala Ser Ser Pro Ile Ser Ser

565 570 575

Ser Ala Asp Ala Asp Arg Ser Asp Ser Ser Arg Arg Pro Val Asn Trp

580 585 590

Arg Asp Glu Leu Gln Ser Leu Lys Ala Thr Arg Glu Pro Asn Gly Asn

595 600 605

Gly Asn Gly Ser Gly Val Ala Pro Ala Ala Gly Arg Ala Asp Ala Asp

610 615 620

Glu Glu Ala Leu Arg Arg Phe Gly Asn Leu Ala Gly Arg Ser Arg Ser

625 630 635 640

Gly Asn Gly Gly Gly Gly Ser Ser Asp Thr Glu Leu Ser Glu Ala Asn

645 650 655

Arg Pro Arg Thr Arg Pro Asp Trp Arg Asn Gln Leu

660 665

<210> 25

<211> 381

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 25

Met Asn Asn Leu Arg Lys Lys Arg Phe Glu Glu Lys Thr Val Glu Arg

1 5 10 15

Val Tyr Glu Ala Asp Val Tyr Pro Ala Val Phe Asp Phe Glu Ala Trp

20 25 30

His Asn His Arg Ser Arg Lys Arg Tyr Leu Glu His Cys Ile Thr Leu

35 40 45

Phe Arg Ser Tyr Phe Phe Arg Asp Leu Leu Gly Pro Leu Ala Val Leu

50 55 60

Val Gly Thr Ala Val Ala Val Gly Cys Tyr Glu Gln Ala Leu Gln Asp

65 70 75 80

His Leu Leu Pro Gly Ala Leu Pro Ser Phe Ser Gly Val Ser Asp Thr

85 90 95

Pro Phe Gln Leu Thr Ser Phe Ala Leu Ser Leu Met Leu Val Phe Arg

100 105 110

Thr Asn Ser Ser Tyr Ala Arg Trp Leu Asp Ala Arg Gln Gln Trp Gly

115 120 125

Leu Ile Val Asn Thr Ser Arg Thr Phe Ile Arg Gln Val Met Thr Thr

130 135 140

Leu Pro Glu Ser Ser Cys Ser Glu Leu Arg Asp Ala Ile Ala Arg Trp

145 150 155 160

Thr Ile Ala Phe Val Arg Leu Ser Lys Leu His Leu Arg Glu His Gly

165 170 175

Asp Val Arg Leu Glu Met Ala Gly Val Leu Arg Gly Glu Glu Leu Pro

180 185 190

Leu Val Ala Ala Ala Ala His Arg Pro Leu Ala Ala Ala His Val Leu

195 200 205

Ser Glu Leu Leu Arg Ser Ala Glu Ala Ala Gly Arg Leu Ser Asp Gln

210 215 220

Ser Arg Ala Arg Leu Glu Ala Asp Val Asn Met Leu Ser Gln Ala Leu

225 230 235 240

Gly Ala Cys Glu Lys Ile Leu Arg Asn Pro Ile Pro Leu Ser Tyr Thr

245 250 255

Arg His Thr Ser Arg Phe Leu Val Leu Trp Leu Leu Trp Leu Pro Ile

260 265 270

Ala Leu Trp Gly Lys Val Ser Trp Gly Val Val Pro Val Glu Ala Ile

275 280 285

Leu Cys Tyr Leu Leu Leu Gly Ile Asp Glu Ile Ala Ile Gln Met Glu

290 295 300

Glu Pro Phe Gly Ile Leu Pro Leu Glu Asn Phe Cys Asp Ala Val Gln

305 310 315 320

Gln Ser Val Glu Gln Val Ala Ser Met Asp His Gly Val Gln Asp Val

325 330 335

Val Ala Ser Tyr Val Cys His Ile Val Gln Gln Asp Ser Gly Asn Gly

340 345 350

Thr Gly Ala Ser Glu Pro Ala Pro Pro Ala Glu Asp Gly Gly Asn Gly

355 360 365

Phe Ala Asn Ile Phe Phe Arg Met Pro Ala Asp Arg Cys

370 375 380

<210> 26

<211> 401

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 26

Met Gly Ser Gly Pro Arg Thr Ile Gly Leu Asp Ser Pro Thr Thr Thr

1 5 10 15

Ile Arg Ser Ala Ala Arg Asp Gln Arg Gln Leu Tyr Glu Val Glu Gly

20 25 30

Arg Gly Thr Val Pro Phe Asp His Tyr Lys Glu Gly Ser Arg His Ala

35 40 45

Arg Arg Met Thr Phe Thr Phe Asp Asp Trp Lys Arg His Arg Ser Ser

50 55 60

Asn Arg Tyr Leu Tyr His Leu Lys Thr Leu Thr Glu Ser Gly Ile Val

65 70 75 80

Arg Gly Ile Trp Ala Pro Val Ala Trp Val Thr Leu Phe Thr Ala Val

85 90 95

Val Ala Thr Leu Asn Val Ala His Gly Ala Ala Met Leu Pro Pro Trp

100 105 110

Val Pro Ala Met Pro Gln Ile Ala Ile Glu Pro Val Gln Leu Thr Ser

115 120 125

Ile Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ser

130 135 140

Arg Trp Asp Glu Gly Arg Arg Ser Phe Gly Ser Ile Thr Thr Val Ser

145 150 155 160

Arg Asp Ile Ala Arg Gln Ala Phe Ala Trp Phe Arg Pro Asp Asp Tyr

165 170 175

Glu Ser Arg Val Arg Val Gly Arg Trp Leu Val Ala Leu Gly Arg Ser

180 185 190

Thr Met Val His Leu Arg Glu Glu His Asp Met Glu Asp Glu Leu Arg

195 200 205

Glu Val Leu Lys Pro Ala Glu Val Gln Ala Val Val Ser Ala Val His

210 215 220

Ala Pro Ser Phe Cys Leu Gln Met Ile Thr Leu Ile Ile Arg Thr Ala

225 230 235 240

Gly Leu Pro Gln Glu Leu Val Ile Arg Met Asp Glu Asn Val Ser Arg

245 250 255

Leu Thr Asp Ala Val Ser Ala Cys Glu Arg Ile Leu Asn Thr Pro Ile

260 265 270

Pro Leu Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Met Ala Trp Leu

275 280 285

Ala Cys Leu Pro Phe Cys Leu Trp Thr Tyr Cys Gly Pro Ala Met Val

290 295 300

Pro Ile Ala Ala Leu Val Ala Phe Val Leu Leu Gly Ile Glu Glu Ile

305 310 315 320

Gly Val Tyr Ile Glu Glu Pro Phe Ser Ile Leu Ala Leu Glu Lys Leu

325 330 335

Val Asn Lys Leu Glu Asn Ile Val Asn Ala Met Leu Arg Asp Ser Gln

340 345 350

Glu Leu Asp Arg Leu Val Lys Val Gly Ser Pro Thr Ala Ser Pro Arg

355 360 365

Pro Glu Pro Ala Ser Thr Asn Ser Asn Asn Ala Val Thr Asp Thr Ala

370 375 380

Phe Gly Leu Gly Ala Ala Gly Gly Phe Ser Pro Ala Val Ala Gly Ala

385 390 395 400

Met

<210> 27

<211> 438

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 27

Met Gln Met Gln Ala Asn Arg Ser Ser Leu Arg Ala Ser Pro Val Arg

1 5 10 15

Gly Leu Gly Ala Arg Pro Leu Leu Arg Ala Leu Pro Ala Gly Arg Val

20 25 30

Ala Arg Leu Asn Val Ser Ala Gln Ala Lys Asp Pro Asn Ala Pro Ile

35 40 45

Gln Ser Asn Pro Leu Gly Thr Leu Ser Ser Gln Ser Gly Gln Val Ala

50 55 60

Thr Leu Pro Arg Ser Glu Glu Ala Arg Lys Tyr Phe Arg Thr Val Tyr

65 70 75 80

Asp Phe Pro Gln Trp Gln Lys His Arg Ser Ser Tyr Arg Phe Ala Glu

85 90 95

Arg Leu Phe Gln Leu Ser Gln Ser His Ile Leu Gln Asn Ala Leu Pro

100 105 110

Ala Ile Ser Trp Val Thr Leu Val Ala Thr Leu Val Ala Ser Tyr Gly

115 120 125

Tyr Ser Tyr Asp Gln His Met Leu Pro Asp Val Phe Pro Ser Ile Ser

130 135 140

Pro Asn Ala Ser Cys Thr Ala Phe Ile Ser Asn Thr Ser Val Ala Leu

145 150 155 160

Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp

165 170 175

Glu Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile

180 185 190

Met Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys

195 200 205

Lys Ala Leu Ala Arg Trp Thr Val Ala Phe Ser Arg Ala Leu Arg Ile

210 215 220

His Phe Gln Pro Glu Val Thr Ile Glu Ser Glu Leu Gln Asn Ile Leu

225 230 235 240

Thr Pro Ala Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val

245 250 255

Arg Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro Met Ser

260 265 270

Ser Ile His Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp

275 280 285

Val Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser

290 295 300

Tyr Thr Arg His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu

305 310 315 320

Pro Phe Ala Leu Tyr Pro Thr Thr Gly Trp Gly Val Val Pro Val Cys

325 330 335

Thr Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln

340 345 350

Cys Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg

355 360 365

Ile Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys

370 375 380

Thr Ile Leu Ala Glu Ala Gly Leu Ile Ser Leu Ile Pro Ser Ala Thr

385 390 395 400

Ser Ala Thr Pro Val Ala Ser Ala Glu Pro Val Leu Val Ser Ala Arg

405 410 415

Pro Ser Ala Ala Pro Ala Pro Asn Asn Gly Leu Gln Val Arg Val Ala

420 425 430

Met Gly Gly Glu Arg Lys

435

<210> 28

<211> 450

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 28

Met Gln Cys Leu Ser Ser Arg Pro Val Ala Met Gly Arg Ala Gly Ser

1 5 10 15

Ser Ala Leu Pro Arg Leu Pro Leu Arg Ala Gly Arg Val Cys His Leu

20 25 30

Gly Val Arg Cys Gln Ala Ala Asn Lys Asp Pro Asn Ala Pro Ile Gln

35 40 45

Ser Asn Pro Leu Gly Ser Phe Ser Ser Gln Leu Gln Asn Gln Pro Thr

50 55 60

Leu Pro Arg Ser Glu Glu Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp

65 70 75 80

Phe Pro Gln Trp Gln Thr His Arg Asn Gln Tyr Arg Leu Met Lys Arg

85 90 95

Leu Phe Ser Ile Pro Gln Ser His Val Ile Gln Asn Ala Leu Pro Ser

100 105 110

Ile Met Trp Val Ala Phe Thr Ser Thr Cys Val Ala Ala Tyr Met Tyr

115 120 125

Gly Tyr Asp Gln His Met Leu Pro Glu Gly Phe Pro Thr Leu Ala Pro

130 135 140

Asn Ala Ala Cys Ser Ala Phe Ile Ser Asn Thr Ser Val Ala Leu Ser

145 150 155 160

Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu

165 170 175

Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile Met

180 185 190

Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys Lys

195 200 205

Ala Leu Ala Arg Trp Val Val Ala Phe Ser Arg Ala Leu Arg Ile His

210 215 220

Phe Gln Pro Glu Val Thr Ile Glu Ser Glu Leu Lys Asn Ile Leu Thr

225 230 235 240

Pro Ala Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val Arg

245 250 255

Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro Met Ser Ser

260 265 270

Ile His Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp Val

275 280 285

Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr

290 295 300

Thr Arg His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro

305 310 315 320

Phe Ala Leu Tyr Gly Ser Cys Gly Val Ser Val Ile Pro Val Cys Ser

325 330 335

Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Cys

340 345 350

Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg Ile

355 360 365

Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr

370 375 380

Ile Leu Ala Glu Ala Gly Leu Ile Ser Leu Arg Ala Asn Ser Ala Met

385 390 395 400

Ala Val Glu Asn Ala Leu Pro Asp Leu Asp Ser Ile Asn Ala Ala Ala

405 410 415

Pro Asn Gly Asn Gly Ser His Asn Gly Asn Gly Ala Ala Val Pro Val

420 425 430

Ser Val Ser Ala Gly Ala Ser Gly Asn Gly Met Asn Val Arg Ile Ser

435 440 445

Pro Arg

450

<210> 29

<211> 466

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 29

Met Gln Val Ser Lys Val Pro Ser Ser Ala Ser Ala Arg Cys Leu Pro

1 5 10 15

Arg Leu Pro Val Arg Thr Ser Arg Val Cys Gln Leu Ser Val Arg Cys

20 25 30

Gln Ala Ala Asn Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu

35 40 45

Gly Ser Phe Ser Ser Gln Asn Ser Ser Gly Ala Val Val Thr Ala Pro

50 55 60

Arg Asn Glu Asp Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp Phe Pro

65 70 75 80

Gln Trp Gln Lys His Arg Ser Gln Ser Arg Leu Val Arg Arg Leu Phe

85 90 95

Thr Ile Pro Gln Ser His Val Ile Gln Asn Ala Leu Pro Ser Ile Met

100 105 110

Trp Val Thr Phe Thr Ser Thr Cys Val Ala Ala Tyr Met Tyr Gly Tyr

115 120 125

Asp Leu His Ile Leu Pro Glu Gly Phe Pro Thr Leu Ala Pro Asn Ala

130 135 140

Ala Cys Ser Ala Phe Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu

145 150 155 160

Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg

165 170 175

Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln

180 185 190

Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu

195 200 205

Ala Arg Trp Thr Val Ala Phe Ala Arg Ala Leu Arg Ile His Phe Gln

210 215 220

Pro Glu Val Thr Ile Glu Ser Glu Leu Gln Asn Ile Leu Thr Pro Ala

225 230 235 240

Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg Pro Val Arg Ala Ile

245 250 255

His Ala Ile Ser Gln Ile Ile Gln Ser Val Arg Met Ser Ser Ile His

260 265 270

Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp Val Leu Gly

275 280 285

Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg

290 295 300

His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala

305 310 315 320

Leu Tyr Gly Ser Cys Gly Val Ser Val Ile Pro Val Cys Thr Gly Ile

325 330 335

Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu

340 345 350

Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala

355 360 365

Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr Val Leu

370 375 380

Ala Glu Ala Gly Leu Ile Ser Leu Ile Pro Ser Met Ser Leu Pro Pro

385 390 395 400

Thr Glu His Ala Ser Pro Ser Asp Pro Val Thr Ala Ala Ala Ala Ala

405 410 415

Ala Leu Ala Ala Ala Asn Gly Asn Gly Ala Ala Ser His Ser Asn Gly

420 425 430

Asn Gly Ser Lys Pro Val Ser Thr Gln Val Pro Pro Pro Val Leu Ala

435 440 445

Pro Val Thr Val Thr Ser Ser Ser Gly Ser Met Asn Val Arg Ile Ser

450 455 460

Pro Arg

465

<210> 30

<211> 456

<212> PRT

<213> golden algae CCMP291

<400> 30

Met Arg Glu His Pro Leu Ser Tyr Glu Glu Tyr Met Arg Gln Arg Ser

1 5 10 15

Ala Gly Arg Asp Pro Leu Ala Glu Ala Val Gln Gly Gln Ser Ala Ser

20 25 30

Met Glu Arg Gly Val Val Pro Pro Pro Pro Val Lys Ala Thr Pro Glu

35 40 45

Arg Thr Glu Ala Ala Phe Thr Pro Pro Ala Glu Phe Asp Phe Phe Gln

50 55 60

Asp Val Phe Lys Pro Thr Val Glu Ser Val Val Lys Ala Val Val Ser

65 70 75 80

Pro Gly Ala Gln Gln Asp Ser Asp Glu Ser Tyr Met Arg Val Pro Trp

85 90 95

Trp Glu Gln Gly Ser Thr Tyr Ser Glu Asp Gln Arg Lys Asp Arg Arg

100 105 110

Thr Val Phe Met His Asp Asp Trp Lys Arg His Arg Ser Ser Glu Arg

115 120 125

Phe Phe Arg Asn Ile Lys Thr Trp Pro Ser Ser Gly Ile Asn Gln Ala

130 135 140

Leu Arg Lys Glu Leu Thr Phe Val Thr Ser Val Ser Val Phe Val Val

145 150 155 160

Leu Ala Asn Met Leu Leu Tyr Gln Tyr Gln Asp Phe Gly Gly Val Val

165 170 175

His Pro Gly Pro Leu Ser Phe Leu Asp Gly Pro Ile Lys Ser Leu Ser

180 185 190

Leu Pro Ala Leu Pro Phe Ser Met Ala Ser Pro Val Leu Ser Leu Leu

195 200 205

Leu Val Phe Arg Thr Asn Thr Ala Tyr Phe Arg Trp Asn Glu Ala Arg

210 215 220

Thr Leu Trp Gly Gly Leu Ile Asn Asn Cys Arg Asn Ile Val Arg Gln

225 230 235 240

Thr Thr Thr Met Phe Pro Asn Asp Ala Tyr His Asn Ala Leu Lys Lys

245 250 255

Arg Leu Ala Thr Glu Thr Ala Thr Phe Ile Lys Ser Leu Arg Asn Phe

260 265 270

Leu Arg Gly Pro Glu Asp Asp Ala Thr Leu Arg Lys Glu Leu Tyr Ala

275 280 285

Tyr Val Asn Gln Gly Leu Met Thr Ser Ala Gln Ala Glu Ala Thr Leu

290 295 300

Ala Ala Lys Asn Arg Pro Met Phe Ala Leu Ala Ala Met Ser Ala Thr

305 310 315 320

Leu Arg Lys Ala Asn Ile Asp Glu Met Tyr Ile Ser Arg Met Asp Ser

325 330 335

Thr Ile Ser Val Leu Val Asp Leu Thr Gly Ala Asn Glu Arg Ile Phe

340 345 350

Lys Ser Pro Ile Pro Leu Val Tyr Thr Arg Leu Thr Ala Arg Phe Leu

355 360 365

Ser Val Phe Leu Thr Leu Leu Pro Leu Ala Met Trp Ala Ala Leu Gly

370 375 380

Glu Ser Trp Asn His Trp Ala Thr Ile Pro Ala Thr Phe Ile Leu Ser

385 390 395 400

Val Phe Leu Phe Gly Val Glu Glu Val Gly Ile Gln Ile Glu Glu Pro

405 410 415

Phe Ser Ile Leu Pro Leu Glu Ala Met Cys Asn Gly Ala Ile Glu Ala

420 425 430

Val Gln Leu Glu Met Leu Ala Ala Glu Gln Ser Gln Val Phe Glu Ala

435 440 445

Ala Gly Asp Ala Val Ala Val Ala

450 455

<210> 31

<211> 415

<212> PRT

<213> Fistulifera solaris

<400> 31

Met Arg Phe Thr Thr Arg Gln Leu Ile Val Gly Ile Ala Leu Thr Ala

1 5 10 15

Ser Leu His Gly Ala Phe Ala Phe Val Thr Pro Ser Val Val Gly Ser

20 25 30

Ser Lys Ala Ser Lys Ser Ala Leu Asp Val Ser Thr Val Pro Arg Asn

35 40 45

Asp Gly Ser Gly Leu Ser Tyr Gly Glu Arg Ser Arg Pro Phe Arg Arg

50 55 60

Asn Phe Tyr Thr Gln Pro Asp Trp Glu Lys His Arg Ser Arg Asn Arg

65 70 75 80

Phe Lys Gly Asn Leu Leu Ser Ile Thr Arg Ser Gly Val Ile Arg Gln

85 90 95

Leu Thr Asn Glu Val Leu Phe Ile Thr Ala Val Ala Thr Ala Val Trp

100 105 110

Ala Ile Asn Cys Leu Thr Ala Ala Gly Tyr Asp Asp Leu Asn Gly Val

115 120 125

His His Glu Gly Leu Leu Pro Phe Phe Pro Thr Leu Gln Met Pro Ser

130 135 140

Glu Phe Phe Thr Phe Ser Ser Pro Ala Leu Ser Leu Leu Leu Val Phe

145 150 155 160

Lys Thr Asn Thr Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Ala Trp

165 170 175

Gly Val Ile Val Asn Ser Ser Arg Thr Ile Leu Arg Gln Gly Ala Ala

180 185 190

Trp Leu Gln Glu Thr Asn Ile Pro Glu Arg Asp Lys Ile Arg Leu Ile

195 200 205

Ala Arg Leu Ala Ala Ala Val Trp Cys Phe Pro Arg Ser Met Thr Arg

210 215 220

His Val Leu Ser Ala Arg Glu Asp Asp Ala Ala Tyr Ala Glu Asp Cys

225 230 235 240

Arg Ala Asn Leu Arg Pro Asp Leu Ala Glu Asp Leu Ile Ala Ala Arg

245 250 255

His Lys Pro Thr Arg Ala Thr Tyr Glu Ile Ser Cys Ala Ile Asn Asp

260 265 270

Leu Pro Leu Ser Asp Ile Gln Lys Ala Thr Leu Glu Tyr Ser Val Asn

275 280 285

Gln Leu Cys Asp Ala Met Gly Ala Asn Asp Arg Ile Leu Ser Ser Pro

290 295 300

Val Pro Leu Val Tyr Thr Arg His Leu Ala Arg Phe Leu Glu Val Trp

305 310 315 320

Leu Leu Met Leu Pro Leu Gly Leu Trp Pro Asp Phe Thr Asn Ser Trp

325 330 335

Asn His Ile Ala Met Ile Pro Ile Thr Val Leu Leu Ser Tyr Phe Leu

340 345 350

Leu Gly Ile Glu Glu Leu Gly Val Gln Leu Glu Glu Pro Phe Ser Val

355 360 365

Leu Pro Leu His Lys Ile Thr Ser Gly Ile Gly Leu Ser Ala Glu Glu

370 375 380

His Val Gln Trp Phe Leu Asn Asp Ser Ala Lys Ser Glu Met Lys Thr

385 390 395 400

Asn Ser Ala Gly Ser Thr Ser Pro Asn Tyr Gln Ser Leu Ser Pro

405 410 415

<210> 32

<211> 430

<212> PRT

<213> Fistulifera solaris

<400> 32

Met Met Leu Arg Leu Ser Asn Ala Val Phe Ala Leu Ile Ala Leu Ala

1 5 10 15

Ser Val Ser Gln Gly Ser Ala Phe Ala Pro Ser Ser Thr Ser Ser Arg

20 25 30

Val Asp Thr Ala Leu Phe Gly Asn Thr Gln Ser Pro Pro Pro Ile Pro

35 40 45

Met Pro Lys Ala Ile Ser Tyr Gly Glu Glu Ser Arg Lys Tyr Arg Arg

50 55 60

Thr Val Phe Thr His Asp Asp Trp Val Lys His Arg Ser Pro Glu Arg

65 70 75 80

Phe Val Arg Asn Leu Ser Ser Ile Trp Ser Ser Gly Val Tyr Lys Asn

85 90 95

Leu Ala Asn Glu Val Met Ala Thr Thr Gly Val Ala Thr Phe Val Val

100 105 110

Leu Tyr Asn Ala Leu Val Gly Gly Tyr Thr Asp Phe Ser Gly Val Ala

115 120 125

His Ala Ala Pro Ile Gln Gly Leu Met Gln Val Gly Leu Pro Leu Ala

130 135 140

Pro Phe Thr Leu Ser Ser Pro Ser Leu Gly Leu Leu Leu Val Phe Arg

145 150 155 160

Thr Asn Thr Ser Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly

165 170 175

Met Asn Ile Asn His Thr Arg Asp Leu Val Arg Met Gly Thr Ala Met

180 185 190

Tyr Asp Arg Gln Gly Val Ser Pro Glu Lys Val Glu Lys Asp Leu Lys

195 200 205

Thr Leu Ser Leu Cys Thr Trp Ala Phe Val Arg Ala Met Lys Arg His

210 215 220

Leu Ser Pro Glu Ser Glu Asp Glu Glu Ala Phe Lys Arg Glu Leu Tyr

225 230 235 240

Glu Lys Leu Pro Ser Ala Gln Ala Glu Ala Ile Ile Lys Ala Ala His

245 250 255

Arg Pro Asn Arg Ala Leu Phe Asp Leu Ser Leu Ala Ile Glu Asn Leu

260 265 270

Asn Met His Phe Met Arg Lys Asn Glu Ile His Lys Ala Ala Thr Ile

275 280 285

Phe Glu Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser Pro Val

290 295 300

Pro Leu Phe Tyr Ser Arg His Leu Ala Arg Phe Leu Ser Leu Trp Leu

305 310 315 320

Leu Leu Ile Pro Phe Ala Leu Tyr Asp Thr Leu Gly Gly Thr Trp Asn

325 330 335

His Val Gly Leu Ile Pro Thr Thr Ala Val Leu Ser Thr Phe Leu Phe

340 345 350

Gly Ile Glu Glu Leu Ala Ala Gln Met Glu Glu Pro Phe Thr Ile Leu

355 360 365

Pro Met Gln Ala Phe Cys Asp Lys Ile Gly Asn Trp Cys Asn Glu Ile

370 375 380

Val Ser Trp Ser Pro Gly Asp Asn Gly Met Glu Val Thr Ile Pro Ser

385 390 395 400

Ala Val Glu Gln Asp His Val Val Glu Glu Met Met Val Ala Asn Gly

405 410 415

Ser Thr Arg Pro Ser Leu Arg Lys Val Leu Gly Leu Lys Lys

420 425 430

<210> 33

<211> 430

<212> PRT

<213> Fistulifera solaris

<400> 33

Met Met Leu Arg Leu Ser Ser Ala Val Phe Ala Leu Ile Ala Leu Ala

1 5 10 15

Ser Val Ser Gln Gly Ser Ala Phe Thr Pro Ser Ser Thr Ser Ser Arg

20 25 30

Val Asp Thr Ala Leu Phe Gly Asn Thr Gln Ser Pro Pro Pro Ile Pro

35 40 45

Met Pro Lys Ala Ile Ser Tyr Gly Glu Glu Ser Arg Lys Tyr Arg Arg

50 55 60

Thr Val Phe Thr His Asp Asp Trp Val Lys His Arg Ser Pro Glu Arg

65 70 75 80

Phe Val Arg Asn Leu Ser Ser Ile Trp Ser Ser Gly Val Tyr Lys Asn

85 90 95

Leu Ala Asn Glu Val Met Ala Thr Thr Gly Val Ala Thr Phe Val Val

100 105 110

Ile Tyr Asn Ala Leu Val Gly Gly Tyr Thr Asp Phe Ser Gly Val Ala

115 120 125

His Ala Ala Pro Ile Gln Gly Leu Leu Gln Val Gly Leu Pro Leu Ala

130 135 140

Pro Phe Thr Leu Ser Ser Pro Ser Leu Gly Leu Leu Leu Val Phe Arg

145 150 155 160

Thr Asn Thr Ser Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly

165 170 175

Met Asn Ile Asn His Thr Arg Asp Leu Val Arg Met Gly Thr Ala Met

180 185 190

Tyr Asp Arg Gln Gly Val Pro Pro Glu Lys Val Glu Lys Asp Leu Lys

195 200 205

Met Leu Ser Leu Cys Thr Trp Ala Phe Val Arg Ala Met Lys Arg His

210 215 220

Leu Ser Pro Glu Ser Glu Asp Glu Glu Ala Phe Lys Arg Glu Leu Tyr

225 230 235 240

Glu Lys Leu Pro Ser Ala Gln Ala Glu Ala Ile Ile Lys Ala Ala His

245 250 255

Arg Pro Asn Arg Ala Leu Phe Asp Leu Ser Leu Ala Ile Glu Asn Leu

260 265 270

Asn Met His Phe Met Arg Lys Asn Glu Ile His Lys Ala Ala Thr Ile

275 280 285

Phe Glu Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser Pro Val

290 295 300

Pro Leu Phe Tyr Ser Arg His Leu Ala Arg Phe Leu Ser Leu Trp Leu

305 310 315 320

Leu Leu Ile Pro Phe Ala Leu Tyr Asp Pro Leu Ala Gly Thr Trp Asn

325 330 335

His Val Gly Leu Ile Pro Thr Thr Ala Met Leu Ser Val Phe Leu Phe

340 345 350

Gly Ile Glu Glu Leu Ala Ala Gln Met Glu Glu Pro Phe Thr Ile Leu

355 360 365

Pro Met Gln Ala Phe Cys Asp Lys Ile Gly Asn Trp Cys Asn Glu Ile

370 375 380

Val Ser Trp Ser Pro Gly Asp Asn Gly Met Glu Val Thr Ile Pro Ser

385 390 395 400

Ala Val Glu Glu Asp His Val Val Glu Glu Met Met Val Ala Asn Gly

405 410 415

Ser Thr Arg Pro Ser Leu Arg Lys Val Leu Gly Leu Lys Lys

420 425 430

<210> 34

<211> 505

<212> PRT

<213> Fistulifera solaris

<400> 34

Met Val Arg Phe Thr Cys Ile Phe Pro Leu Val Ala Ala Leu Ile Ser

1 5 10 15

Asn Ala Ser Ala Phe Val Thr Pro Ala Asn Ser Val Ala Lys His Ala

20 25 30

Thr Pro Arg Phe Glu Gly Asn Glu Arg Arg Leu Ile Ser Ala Pro Ser

35 40 45

Asp Gly Ser Val Ala Lys Arg Ser Thr Ser Arg Phe Ser Ser Glu Gly

50 55 60

Thr Gly Trp Asp Ser Phe Lys Gly Leu Arg Asp Phe Thr Asn Ile Pro

65 70 75 80

Ser Gly Glu Glu Gln Arg Lys Phe Arg Arg Thr Val Tyr Thr His Lys

85 90 95

Asp Trp Lys Lys His Arg Ser Gln Asp Arg Phe Val Phe Tyr Leu Leu

100 105 110

Ala Met Phe Lys Ser Gly Val Tyr Lys Asn Ile Gly Arg Glu Val Ile

115 120 125

Thr Ile Thr Ala Val Ala Ala Phe Val Cys Ile Tyr Asn Ser Leu Val

130 135 140

Gly Gly Phe Thr Asp Leu Asn Gly Val Gln Gln Ala Ala Leu Leu Gln

145 150 155 160

Ser Gln Phe Leu Pro Lys Leu Thr Leu Pro Leu Ser Leu Phe Thr Ile

165 170 175

Thr Ser Ser Ser Leu Gly Leu Leu Leu Val Phe Arg Thr Asn Thr Ser

180 185 190

Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly Met Asn Ile Asn

195 200 205

His Thr Arg Asp Leu Val Arg Met Ala Asn Ala Tyr Tyr Asp Ser Thr

210 215 220

Gly Val Pro Pro Glu Val Arg Ala Asp Asp Met Asn His Val Ala Leu

225 230 235 240

Cys Thr Trp Ala Phe Val Arg Cys Met Lys Arg His Leu Ser Pro Glu

245 250 255

Glu Glu Asp Glu Ala Asp Phe Gln Lys Glu Ile Leu Glu Lys Leu Pro

260 265 270

Arg Gln Gln Ala Glu Met Ile Ile Ala Ala Ala His Arg Pro Asn Arg

275 280 285

Ala Leu Gln Asp Leu Ser Tyr Ala Ile Asp Asp Leu Pro Met His Phe

290 295 300

Ile Arg Lys Asn Glu Ile His Arg Ala Val Thr Ile Phe Glu Asp Asn

305 310 315 320

Leu Gly Ser Ser Glu Arg Leu Leu Ser Ser Pro Val Pro Val Phe Tyr

325 330 335

Ser Arg His Leu Ala Arg Phe Leu Ala Val Trp Leu Leu Phe Val Pro

340 345 350

Phe Ala Leu Tyr Asp Ser Phe Asn Ala Ser Trp Asn His Ile Ala Met

355 360 365

Val Pro Ala Thr Ala Val Met Ser Ile Phe Leu Val Gly Ile Glu Glu

370 375 380

Leu Gly Thr Gln Leu Glu Glu Pro Phe Thr Ile Leu Pro Met Gln Gly

385 390 395 400

Phe Cys Asp Lys Ile Tyr Asn Trp Cys Met Glu Ile Ala Ser Trp Gln

405 410 415

Pro Gly Asp Asn Gly Arg Pro Met Arg Pro Val Lys Pro Glu His Ala

420 425 430

Tyr Phe Thr Ser Thr Ser Glu Gly Val Asn Gly Tyr Ala Asn Asn Tyr

435 440 445

Tyr Thr Pro Gln Gln Ser Tyr Tyr Asn Glu Pro Ala Gln Pro Gln Gln

450 455 460

Ser Tyr Tyr Ser Glu Pro Thr Pro Ala Pro Gln Tyr Tyr Asn Glu Pro

465 470 475 480

Thr Pro Ala Gln Pro Ala Ala Asn Gln Gly Trp Val Asp Met Ala Glu

485 490 495

Phe Leu Arg Arg Gln Gly Ser Gly Val

500 505

<210> 35

<211> 502

<212> PRT

<213> Fistulifera solaris

<400> 35

Met Val Arg Met Ile Cys Ile Leu Pro Leu Val Ala Ala Leu Ile Gly

1 5 10 15

Ser Ala Asn Ala Leu Val Ala Pro Ala Asn Asn Val Ala Lys Gln Ala

20 25 30

Met Pro Arg Phe Ser Asn Asn Val Ala Lys Ser Ala Val Pro Arg Leu

35 40 45

Leu Thr Ser Glu Gly Thr Arg Leu Phe Ser Ser Glu Gly Thr Gly Trp

50 55 60

Asp Ser Phe Lys Gly Val Arg Asp Phe Thr Asn Ile Pro Ser Gly Glu

65 70 75 80

Glu Gln Arg Lys Phe Arg Arg Thr Val Tyr Thr His Lys Asp Trp Lys

85 90 95

Lys His Arg Ser Gln Asp Arg Phe Ile Tyr Tyr Leu Leu Ala Ile Phe

100 105 110

Lys Ser Gly Val Tyr Lys Asn Ile Gly Arg Glu Val Ile Thr Ile Thr

115 120 125

Ala Val Ala Ala Leu Val Cys Val Tyr Asn Ser Leu Val Gly Gly Tyr

130 135 140

Thr Asp Leu Asn Gly Val Gln Gln Ala Ala Leu Leu Gln Ser Gln Phe

145 150 155 160

Leu Pro Lys Leu Thr Leu Pro Leu Ser Leu Phe Thr Ile Thr Ser Ser

165 170 175

Ser Leu Gly Leu Leu Leu Val Phe Arg Thr Asn Thr Ser Tyr Gln Arg

180 185 190

Trp Asp Glu Ala Arg Lys Asn Trp Gly Met Asn Ile Asn His Thr Arg

195 200 205

Asp Leu Val Arg Met Ala Asn Ala Tyr Tyr Asp Ser Thr Gly Val Pro

210 215 220

Pro Glu Val Arg Ala Asp Asp Met Asn His Ile Ala Leu Cys Thr Trp

225 230 235 240

Ala Phe Val Arg Cys Met Lys Arg His Leu Ser Pro Glu Glu Glu Asp

245 250 255

Glu Leu Asp Phe Gln Lys Glu Ile Leu Glu Lys Leu Pro Arg Lys Gln

260 265 270

Ala Glu Met Ile Ile Ala Ala Ala His Arg Pro Asn Arg Ala Leu Gln

275 280 285

Asp Leu Ser Tyr Ala Ile Asp Asp Leu Pro Met His Phe Met Arg Lys

290 295 300

Asn Glu Ile His Arg Ala Val Thr Ile Phe Glu Asp Asn Leu Gly Ser

305 310 315 320

Ser Glu Arg Leu Leu Ser Ser Pro Val Pro Val Phe Tyr Ser Arg His

325 330 335

Leu Ala Arg Phe Leu Ala Val Trp Leu Leu Phe Val Pro Phe Ala Leu

340 345 350

Tyr Asp Ser Phe Asn Ala Ser Trp Asn His Ile Ala Met Val Pro Ala

355 360 365

Thr Ala Val Met Ser Ile Phe Leu Val Gly Ile Glu Glu Leu Gly Thr

370 375 380

Gln Leu Glu Glu Pro Phe Thr Ile Leu Pro Met Gln Gly Phe Cys Asp

385 390 395 400

Lys Ile Tyr Asn Trp Cys Met Glu Ile Ala Ser Trp Gln Pro Gly Asp

405 410 415

Asn Gly Arg Ser Met Arg Pro Val Lys Pro Glu His Ala Tyr Phe Thr

420 425 430

Ser Thr Ser Glu Gly Val Asn Gly Tyr Ser Asn Asn Tyr Tyr Thr Pro

435 440 445

Gln Gln Ser Tyr Tyr Asn Glu Pro Ala Gln Pro Gln Gln Ser Tyr Tyr

450 455 460

Ser Glu Pro Thr Pro Ala Pro Gln Tyr Tyr Asn Glu Pro Thr Pro Ala

465 470 475 480

Gln Pro Ala Gly Asn Gln Gly Trp Val Asp Met Ala Glu Phe Leu Arg

485 490 495

Arg Gln Gly Ser Gly Val

500

<210> 36

<211> 433

<212> PRT

<213> Pachyrhizia sp CCMP1102

<400> 36

Met Gly Leu Ala Ser Thr Leu Ile Glu Glu Val Val Glu Glu Glu Val

1 5 10 15

Trp Val Pro Pro Ser Ser Phe Ser Thr Pro Asp Gln Tyr Asn Ser Ser

20 25 30

Pro Thr Leu Ser Ala Gln Ser Pro Thr Ile Ser Val Thr Leu Pro Val

35 40 45

Gly Leu Arg Pro Pro Lys Phe Gly Pro Lys Lys Asp Ile Thr Tyr Gly

50 55 60

Glu Asn Ser Arg Lys Phe Arg Arg Thr Val Tyr Thr His Glu Asp Trp

65 70 75 80

Val Arg His Arg Ser Pro Asp Arg Phe Phe Arg Tyr Ile Ala Ser Val

85 90 95

Pro Thr Ser Gly Ile Ala Lys Asn Leu Ala Arg Glu Leu Tyr Phe Leu

100 105 110

Thr Ala Ile Thr Ala Ile Val Val Leu Tyr Asn Gly Leu Ile Thr Gly

115 120 125

Tyr Gln Asp Ile Asn Gly Ile Ala His Gly Pro Val Trp Ser Ser Pro

130 135 140

Phe Leu Pro Pro Leu Thr Leu Pro Met Gln Pro Phe Ala Leu Ala Ser

145 150 155 160

Pro Ser Leu Gly Leu Leu Leu Val Phe Arg Ser Asn Thr Ala Tyr Gln

165 170 175

Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly Met Asn Ile Asn His Thr

180 185 190

Arg Asp Leu Asn Arg Met Ala Asn Ala Tyr Tyr Asp Lys Thr Gly Ile

195 200 205

Ser Asp Glu Lys Arg Lys Asp Asp Leu Glu Arg Leu Ser Leu Cys Thr

210 215 220

Trp Ala Phe Val Arg Ala Met Lys Arg His Leu Ser Pro Ala Asp Glu

225 230 235 240

Asp Glu Ala Ala Phe Lys Ala Glu Leu Tyr Glu Lys Leu Pro Lys Leu

245 250 255

Gln Ala Gln Gln Ile Ile Lys Ala Ala His Arg Pro Asn Arg Ala Leu

260 265 270

Tyr Asp Leu Ser Leu Ala Ile Glu Asn Leu Pro Met His Phe Leu Arg

275 280 285

Lys Asn Lys Leu His Ala Ala Leu Thr Ile Phe Glu Asp Thr Leu Gly

290 295 300

Ser Ser Glu Arg Leu Leu Thr Ser Pro Val Pro Leu Ile Tyr Asn Arg

305 310 315 320

His Thr Ser Arg Phe Leu Leu Val Trp Leu Leu Leu Leu Pro Phe Ala

325 330 335

Leu Trp Glu Glu Phe Gly Phe Met Trp Asn His Ile Gly Met Ile Pro

340 345 350

Gly Met Ser Ile Leu Gly Leu Leu Leu Phe Gly Ile Glu Glu Leu Ala

355 360 365

Thr Gln Leu Glu Glu Pro Phe Thr Ile Leu Pro Met Gln Ala Phe Cys

370 375 380

Asp Lys Ile Trp Asn Trp Cys Asn Glu Ile Ala Ser Trp Glu Asp Gly

385 390 395 400

Gln Asn Gly Ile Thr Thr Asn Arg Ser Tyr Gln Gly Arg Thr Glu Val

405 410 415

Tyr Val Asp Asn Ser Tyr Glu Asn Glu Asn Ala Tyr Thr Thr Pro Thr

420 425 430

Pro

<210> 37

<211> 430

<212> PRT

<213> Pachyrhizia sp CCMP1102

<400> 37

Met Arg Phe Val Gly Val Ser Ser Leu Met Ser Met Ala Ala Val Met

1 5 10 15

Thr Val Val Val Val Ser Cys His Val Gly Ser Ala Ser Ala Phe Val

20 25 30

Pro Pro Ser Gly Lys Thr Ser Ser Ser Trp Asn Ser Val Ala Ser Gln

35 40 45

Gln Ala Lys Asp Pro Leu His Ile Leu Pro Pro Asp Ala Thr Asp Ile

50 55 60

Pro Tyr Gly Glu Glu Ser Arg Lys Phe Arg Arg Thr Val Tyr Thr His

65 70 75 80

Asp Asp Trp Ile Lys His Arg Ser Pro Asp Arg Phe Phe Lys Thr Leu

85 90 95

Arg Thr Thr Thr Thr Ser Gly Ile Tyr Lys Asn Val Gly Arg Glu Val

100 105 110

Leu Ala Val Thr Phe Ile Ala Thr Phe Val Met Leu Trp Asn Met Leu

115 120 125

Thr Gly Glu Tyr Thr Asp Leu Val Gly Leu Val His Pro Gly Ile Met

130 135 140

Arg Gly Gln Phe Thr Pro Ser Leu Ala Leu Pro Met Ser Pro Phe Thr

145 150 155 160

Leu Ser Ser Gly Phe Leu Gly Leu Leu Leu Val Phe Arg Thr Asn Lys

165 170 175

Ala Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly Met Asn Ile

180 185 190

Asn His Thr Arg Asp Leu Val Arg Met Gly Thr Thr Phe Tyr Asp Asp

195 200 205

Ala Gln Ile Ser Asn Pro Glu Gln Arg Asp Ile Asp Leu Glu Arg Leu

210 215 220

Ser Leu Cys Thr Trp Ala Phe Val Arg Ser Met Lys Arg His Leu Ser

225 230 235 240

Pro Glu Trp Glu Asp Glu Gln Glu Phe Lys Met Glu Leu Tyr Gln Arg

245 250 255

Leu Pro Ser Gln Gln Ala Gln Thr Ile Leu Asp Ala Ala His Arg Pro

260 265 270

Asn Arg Ala Leu Tyr Asp Leu Ser Leu Ala Ile Glu Gln Leu Pro Met

275 280 285

His Phe Ile Arg Lys Asp Gln Met His Lys Ala Leu Thr Ile Phe Glu

290 295 300

Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser Pro Val Pro Ile

305 310 315 320

Phe Tyr Asn Arg His Val Ala Arg Phe Leu Phe Val Trp Leu Ala Phe

325 330 335

Leu Pro Phe Ala Leu Tyr Asp Pro Phe Lys Glu Ser Trp Asn His Val

340 345 350

Met Met Ile Pro Thr Thr Ala Leu Leu Ser Leu Phe Leu Phe Gly Ile

355 360 365

Glu Glu Leu Ala Thr Gln Met Glu Glu Pro Phe Thr Ile Leu Pro Met

370 375 380

Gln Ala Phe Cys Asp Lys Ile Gly Asn Trp Cys Asn Glu Ile Val Ser

385 390 395 400

Trp Lys Asp Gly Asp Asn Gly Val Tyr Asn Lys Pro Ser Asn Asn Phe

405 410 415

Pro Ala Lys Gly His Asn Ser Val Tyr Phe Glu Ser Glu Leu

420 425 430

<210> 38

<211> 393

<212> PRT

<213> Pachyrhizia sp CCMP1102

<400> 38

Met Cys Phe Ala Phe Cys Glu Arg Leu Leu Asp Val Met Ser Ser Ser

1 5 10 15

Cys Asp Thr Ala Met Leu Leu Glu Lys Tyr Gln Val Thr Thr Lys Asp

20 25 30

Ile Pro Tyr Gly Glu Thr Ser Arg Gln Phe Arg Arg Thr Val Tyr Thr

35 40 45

His Asp Asp Trp Val Lys His Arg Ser Pro Asn Arg Phe Ile Lys Asn

50 55 60

Leu Ser Thr Ile Val Ser Ser Gly Val Tyr Lys Asn Val Gly Arg Glu

65 70 75 80

Val Ala Ser Thr Thr Ser Ile Ala Thr Phe Val Val Leu Trp Asn Met

85 90 95

Leu Thr Val Gly Tyr Asp Asp Leu Asn Gln Ile His His Leu Pro Leu

100 105 110

Ile Asn Ser Tyr Tyr Val Pro Gly Leu Thr Leu Pro Leu Gln Pro Phe

115 120 125

Thr Leu Ala Ser Gly Ser Leu Gly Leu Leu Leu Val Phe Arg Thr Asn

130 135 140

Thr Ala Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly Met Asn

145 150 155 160

Ile Asn His Thr Arg Asp Leu Val Arg Met Gly Asn Thr Phe Tyr Asp

165 170 175

Arg Thr Gly Val Ser Asp Glu Thr Arg Lys Glu Asp Leu Gln Arg Leu

180 185 190

Ser Val Cys Thr Trp Ser Phe Val Arg Cys Met Lys Arg His Leu Ser

195 200 205

Pro Glu Trp Glu Asp Glu Ala Ala Phe Arg Leu Glu Met Phe Glu Arg

210 215 220

Leu Pro Glu Ser Gln Ala Asn Ala Val Ile Asn Ala Ala His Arg Pro

225 230 235 240

Asn Arg Ala Leu Phe Asp Leu Ser Met Ala Ile Glu Asn Leu Pro Met

245 250 255

His Phe Met Arg Lys Asn Glu Met His Lys Ala Leu Thr Ile Phe Glu

260 265 270

Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser Pro Val Pro Leu

275 280 285

Ile Tyr Asn Arg His Thr Leu Arg Phe Leu Ser Ile Trp Leu Leu Leu

290 295 300

Met Pro Phe Ser Leu Tyr Lys Pro Phe Asp Ser Thr Trp Asn His Ile

305 310 315 320

Gly Met Ile Pro Ala Thr Ala Met Ile Ser Leu Phe Leu Phe Gly Ile

325 330 335

Glu Glu Leu Ala Thr Gln Met Glu Glu Pro Phe Thr Ile Leu Pro Met

340 345 350

Gln Ala Phe Cys Asp Lys Ile Gly His Ser Glu Val Tyr Phe Glu Asn

355 360 365

Leu Gly Ser Ser Pro Gly Val Val Asp Gly Ser Asn Ala Phe Val Glu

370 375 380

Gln Gln Pro Glu Ile Val Arg Val Pro

385 390

<210> 39

<211> 467

<212> PRT

<213> Thoraciola gigantea

<400> 39

Met Leu Arg Pro Leu Pro Gly Cys Val Thr Ala Arg Arg Pro Ser Ala

1 5 10 15

Ser Cys Pro Ala Leu Trp Ser Val Glu Ala Val Leu Ser Thr Leu Arg

20 25 30

Lys Lys Arg Leu Glu Pro Asn Thr Val Glu Arg Val Tyr Glu Ala Asp

35 40 45

Val Tyr Pro Ala Val Phe Asp Phe Ala Ala Trp Thr Gln His Arg Ser

50 55 60

Arg Gly Arg Tyr Leu Glu His Cys Ile Thr Leu Phe Arg Ser Tyr Phe

65 70 75 80

Phe Arg Asp Leu Leu Gly Pro Leu Leu Val Leu Val Gly Ala Ala Val

85 90 95

Ala Val Gly Leu Tyr Glu Thr Phe Leu Gln Glu Gly Leu Leu Pro Glu

100 105 110

Trp Val Pro Asp Phe Gly Gly Val Ser Asp Thr Pro Phe Gln Leu Thr

115 120 125

Ser Phe Ala Leu Ser Leu Met Leu Val Phe Arg Thr Asn Ser Ser Tyr

130 135 140

Ala Arg Trp Leu Asp Ala Arg Gln Gln Trp Gly Leu Ile Val Asn Thr

145 150 155 160

Ala Arg Thr Phe Val Arg Gln Ala Met Thr Thr Leu Pro Glu Asp Ser

165 170 175

Cys Ser Glu Leu Arg Asp Ala Val Ala Arg Trp Thr Ile Ala Phe Val

180 185 190

Arg Leu Ser Lys Leu His Leu Arg Glu His Gly Asp Val Arg Ala Glu

195 200 205

Met Gln Gly Val Leu Arg Gly Glu Glu Leu Pro Leu Val Ala Ala Ala

210 215 220

Ala His Arg Pro Leu Ala Ala Cys His Val Leu Ser Gln Leu Met Ala

225 230 235 240

Ala Ala Ala Gly Ala Gly Ala Ile Ser Asp Gln Ser Arg Gln Arg Leu

245 250 255

Glu Ala Asp Ile Asn Gly Leu Ser Gln Ala Leu Gly Ala Cys Glu Lys

260 265 270

Ile Leu Arg Asn Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg

275 280 285

Phe Leu Ile Leu Trp Leu Leu Trp Leu Pro Val Ala Leu Trp Gly Lys

290 295 300

Ala Gly Trp Cys Val Val Pro Val Glu Ala Ile Leu Thr Tyr Leu Leu

305 310 315 320

Leu Gly Ile Asp Glu Ile Ala Ile Gln Met Glu Glu Pro Phe Gly Ile

325 330 335

Leu Pro Leu Glu Asn Phe Cys Asp Ala Val Gln Gln Ser Val Glu Gln

340 345 350

Val Thr Arg Met Asp His Ser Val His Asp Val Val Ser Ser Tyr Val

355 360 365

Cys Ala Leu Val Pro Ala Ala Pro Ala Thr Ala Ala Ala Pro Pro Val

370 375 380

Ala Ala Pro Pro Ala Thr Ala Met Gly Gly Thr Ala Ser Ala Val Val

385 390 395 400

Ala Ala Ala Ala Ala Glu Glu Ser Ser Pro Val Ala Ala Ser Val Thr

405 410 415

Ala Thr Ala Ala Pro Gly Asp Leu Asn Arg Ala Ala Arg Asp Gln Gly

420 425 430

Ser Gly Met Glu Gly Ser Gly Val Gly Asp Gly Ser Gly Asp Gly Arg

435 440 445

Thr Gly Gln Gly Phe Trp Gln Ala Ile Trp Thr Pro Asn Ile Pro Ser

450 455 460

Asp Arg Cys

465

<210> 40

<211> 481

<212> PRT

<213> Thoraciola gigantea

<400> 40

Met Gln Gly Arg Ala Gly Ala Ala Val Glu Glu Gly Val Ser Leu Pro

1 5 10 15

Thr Pro Thr Arg Asn Pro Val Phe Asn Pro Thr Arg Trp Ser Tyr His

20 25 30

Arg Ser Thr Ser Arg Tyr Gly Arg His Leu Thr Thr Ile Phe Lys Ser

35 40 45

Val Thr Phe Arg Asn Leu Gln Ala Pro Leu Ser Phe Leu Thr Met Met

50 55 60

Ala Cys Leu Val Val Leu Tyr Arg Thr Ser Val Glu Leu Glu Gln Leu

65 70 75 80

Pro Asp Phe Phe Glu Gly Val Thr Phe Thr Asp Val Pro Phe Gln Leu

85 90 95

Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asp Ala Gly

100 105 110

Tyr Gly Arg Trp Cys Ala Ala Met Asp Ala Trp Gly Thr Leu Arg Asn

115 120 125

Ala Ser Ala Asp Leu Ile Arg Lys Ala Ser Ala Trp Val Asp Asp Gly

130 135 140

Pro His Leu Arg Arg Leu Val Arg Trp Val Ala Ala Phe Pro Leu Cys

145 150 155 160

Leu Met Val Glu Leu Arg His Asp Gln Gly Asp Pro Ala Met Glu Gly

165 170 175

Ala Leu Arg Ala Glu Leu Ala Arg Val Leu Arg Pro Tyr Glu Leu Gln

180 185 190

Gln Val Leu Ala Ala Gly Pro Tyr His His Gln Phe Cys Leu Ser Val

195 200 205

Leu Thr Ala Leu Val Glu Ala Ala Gln Leu Gly Glu Ser Arg Glu Thr

210 215 220

Ala Met Leu Glu Asp Leu His Gly Phe Asn Asp Ala Ala Cys Glu Cys

225 230 235 240

Glu Lys Ile Leu Arg Phe Pro Ile Pro Leu Thr Tyr Thr Arg His Thr

245 250 255

Ser Arg Phe Met Leu Ile Tyr Leu Ser Ala Leu Pro Leu Ala Leu Tyr

260 265 270

Asp Ser Cys Asp Trp Ala Val Ile Pro Val Thr Ala Val Ile Ala Phe

275 280 285

Leu Leu Leu Gly Ile Glu Asp Ile Gly Val Gln Ile Glu Glu Pro Phe

290 295 300

Ser Ile Leu Pro Leu Pro Asp Ile Cys Ala Asp Leu His Met Thr Ala

305 310 315 320

Gln Arg Ala Val Ala Gln Arg Asp Met Val Arg Cys Leu Ala Asp Pro

325 330 335

Ala Val Cys Arg Val Arg Asp Glu Asp Leu Glu Pro Thr Ala Arg Arg

340 345 350

His Ala Ala Ala His Gly Gly Pro Gly Thr Ser Tyr Gly Glu Gly Arg

355 360 365

Gly His Ala Ala Thr Gly His Pro Gly Ala Gly Pro Asp Ala Trp Gln

370 375 380

Gly Asp Glu Tyr Val Val Glu Ala Gly Phe Gly Ser Gly Gly Val Ala

385 390 395 400

Gly Gly Gly Gly Val Gly Ala Gly Ala Gly Ala Gly Ala Ser Ala Arg

405 410 415

Ser Asn Gly Asn Gly Ala Gly Gly Gly Ala Gly Gly Gly Gly Gly Lys

420 425 430

Gly Val Gly Ala Arg Gly Arg Phe Val Glu Ser Gly Lys Gly Pro Gly

435 440 445

Leu Val Ala Ala Ile Ser Glu Asn Gly Asn Gly Asn Gly Tyr Asn Gly

450 455 460

Asn Gly Asn Gly Tyr Ser Gly Gly Thr Ala Ser Gly Trp Pro His Arg

465 470 475 480

Pro

<210> 41

<211> 308

<212> PRT

<213> Thoraciola gigantea

<400> 41

Met Arg Val Ala Trp Ser Gly Ile Val Arg Gly Ile Ser Ala Pro Val

1 5 10 15

Leu Phe Val Thr Ala Phe Thr Ala Val Val Ala Ala Leu Asn Ala Ala

20 25 30

His Ala Ala Ser Leu Leu Pro Ala Trp Val Pro Ala Met Pro Ala Ile

35 40 45

Ala Ile Glu Pro Val Gln Leu Thr Ser Ile Ala Leu Ser Leu Leu Leu

50 55 60

Val Phe Arg Thr Asn Ala Ser Tyr Ser Arg Trp Asp Glu Gly Arg Arg

65 70 75 80

Ser Phe Gly Ser Ile Thr Thr Val Ser Arg Asp Ile Ala Arg Gln Ala

85 90 95

Phe Ala Trp Phe Arg Pro Asp Asp Gly His Asn Arg Arg Arg Leu Gly

100 105 110

Arg Trp Leu Val Ala Leu Gly Arg Ser Thr Met Val His Leu Arg Glu

115 120 125

Glu His Lys Met Glu Asp Glu Leu Lys Tyr Val Leu Glu Pro Gln Glu

130 135 140

Val Glu Ala Val Leu Ser Ser Val His Ala Pro Ser Phe Cys Leu Gln

145 150 155 160

Met Ile Thr Trp Ile Ile Arg His Ala Gly Leu Pro Gln Glu Leu Val

165 170 175

Ile Arg Met Asp Glu Asn Val Ser Arg Leu Thr Asp Ala Val Ser Ala

180 185 190

Cys Glu Arg Ile Leu Asn Thr Pro Ile Pro Leu Ser Tyr Thr Arg His

195 200 205

Thr Ala Arg Phe Leu Met Ala Trp Leu Val Cys Leu Pro Phe Cys Leu

210 215 220

Trp Pro Tyr Cys Gly Pro Ala Met Ile Pro Ile Ala Ala Leu Ile Ala

225 230 235 240

Phe Val Leu Leu Gly Ile Glu Glu Ile Gly Val Tyr Ile Glu Glu Pro

245 250 255

Phe Ser Ile Leu Ala Leu Glu Lys Leu Val Asn Lys Leu Glu Asn Ile

260 265 270

Ile Asn Ala Met Leu His Glu Trp Gln Asn Leu Asp Glu Leu Ser Arg

275 280 285

Thr Ala Met Gly Thr Ala Asn Gly Ser Gln Pro Val Ser Ala Ala Ala

290 295 300

Ser Ala Thr Ala

305

<210> 42

<211> 447

<212> PRT

<213> Thoraciola gigantea

<400> 42

Met Gln Leu Ser Gly Arg Gln Gln Ala Leu Ser Ala Arg Gly Val Ala

1 5 10 15

Pro Leu Pro Ser Arg Leu Cys Arg Lys Arg Leu Ile Ile Ala Ala Asn

20 25 30

Ala Ala Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly Thr

35 40 45

Leu Ser Ser Gln Gly Asn Thr Met Ala Thr Pro Pro Arg Ser Glu Ala

50 55 60

Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Glu

65 70 75 80

His Arg Ser Gln Phe Arg Leu Met Lys Arg Leu Phe Thr Ile Pro Gln

85 90 95

Ser His Val Ile Gln Asn Ala Leu Pro Ser Ile Ser Trp Val Gly Val

100 105 110

Val Ser Thr Ala Leu Thr Leu Tyr Met Thr Ala His Asp Gln His Ile

115 120 125

Leu Pro Glu Gly Phe Pro Ser Leu Val Pro Asn Ala Ser Cys Ser Ala

130 135 140

Phe Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu Leu Val Phe Arg

145 150 155 160

Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly

165 170 175

Gly Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln Gly Ala Thr Cys

180 185 190

Phe Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp Val

195 200 205

Val Ala Phe Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val Thr

210 215 220

Ile Glu Ser Glu Leu Lys Asn Ile Leu Thr Pro Ala Glu Leu Glu Met

225 230 235 240

Leu Ala Lys Ser Gln His Arg Pro Val Arg Ala Ile His Ala Ile Ser

245 250 255

Gln Ile Ile Gln Ser Val Pro Met Ser Ser Ile His Gln Met Gln Met

260 265 270

Ser Asn Asn Leu Thr Phe Phe His Asp Val Leu Gly Gly Cys Glu Arg

275 280 285

Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg

290 295 300

Phe Leu Phe Thr Trp Leu Ser Leu Leu Pro Phe Ala Leu Tyr Gly Gln

305 310 315 320

Cys Gly Ala Gly Val Ile Pro Val Ser Thr Gly Ile Ala Ala Val Leu

325 330 335

Cys Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly Ile

340 345 350

Leu Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met Ala

355 360 365

Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr Ile Leu Ala Glu Ala Gly

370 375 380

Leu Val Ser Leu Leu Pro Ser Ala Ala Ser Ala Met Ala His Thr Ser

385 390 395 400

Ala Ser Ser Asn Gly Asn Gly Asn Gly Ala Asn Gly Asn Gly Ala Asn

405 410 415

Gly Asn Gly Ala Asn Gly Asn Gly Ala Ala Val Ala Ala Pro Gln Val

420 425 430

Pro Val Ser Ala Ser Ala Gly Met Thr Val Gln Ile Ser Pro Arg

435 440 445

<210> 43

<211> 1866

<212> PRT

<213> Thoraciola gigantea

<400> 43

Met Glu His Thr Gly Pro Ser Leu Ala Gly Pro Pro Pro Pro Pro Pro

1 5 10 15

Leu Ala Ser Ala Pro Ser Val Ala Val Glu Arg Ser Gly Ser Glu Met

20 25 30

Gly Ser Ala Leu Pro Tyr Arg Arg Arg Ser Thr Ala Pro Ala Val Ala

35 40 45

Ala Pro Pro Pro Pro Ser Val Met Val Pro Ala Ala Ala Ala Gly Pro

50 55 60

Ala Ala Ala Thr Ala Leu Ala Arg His Gln Pro Gln Ala Ala Ala Ala

65 70 75 80

Ala Gly Ala Ala Pro Phe Pro Gly Ala Ala Ala Pro Leu Pro Pro Ala

85 90 95

Leu Gln Ala Ser Thr Ser Arg Val Gly Arg Leu Leu Gln Glu Arg Phe

100 105 110

Arg Arg Cys Arg Ser His Gln Ala Phe Asn Trp Thr Pro Glu Glu Ala

115 120 125

Pro Leu Ser Pro Pro Pro Pro Pro Pro Pro Leu Ser Pro Pro Leu Pro

130 135 140

Ala Val Gln Lys Trp Ala Ala Ser Thr Val Pro Lys Pro Gly Pro Ala

145 150 155 160

Ala Ala Ala Ala Ala Ala Ala Ala Pro Pro Thr Pro Tyr Leu Ser Pro

165 170 175

Ser Pro Ser Thr Ser Pro Ser Pro Ser Pro Ser Pro Pro Pro Pro Gln

180 185 190

Ala Thr Ala Ala Ala Ser Ala Ala Ser Gly Ala Asp Gly Asp Phe Met

195 200 205

Thr Ala Ala Val Ser Glu Leu Val Glu Arg Pro Phe Arg Leu Val Val

210 215 220

Val Ala Asn Arg Leu Pro Val Thr Cys Val Gln Asp Ala Pro Gly Gly

225 230 235 240

Glu Trp Gln Leu Lys Ala Ser Ser Gly Gly Leu Val Ser Ala Leu Arg

245 250 255

Gly Leu Gly Phe Arg Ser Ser Met Trp Ile Gly Trp Pro Gly Val Trp

260 265 270

Leu Pro Pro Gly Ser Asp Arg Asn Arg Leu Thr Glu Leu Leu Arg Arg

275 280 285

Asp Gly Tyr Glu Pro Val Trp Leu Glu Ser Lys Leu Met Asp Leu Phe

290 295 300

Tyr Lys Gly Phe Cys Asn Ser Val Leu Trp Gln Leu Phe His Tyr Asp

305 310 315 320

Pro Pro Ser Leu Glu Gly Trp Ala Arg Ser Ala Glu Gln Gln Ala Ser

325 330 335

Ser Gln Ala Ala Gln Trp Gly Ala Tyr Val Glu Ala Asn Gly Arg Phe

340 345 350

Ala Asp Ala Val Leu Ala Thr His Gly Ser Ala Asp Met Val Trp Val

355 360 365

His Asp Tyr His Leu Met Leu Leu Pro Gly Ile Leu Lys Arg Ala Val

370 375 380

Pro Lys Met Arg Val Gly Phe Phe Leu His Thr Pro Phe Pro Ser Ser

385 390 395 400

Glu Val Tyr Arg Ala Leu Pro Val Arg Glu Gln Val Ser Gly Gly Gly

405 410 415

Gly Gly Gly Glu Ser Arg Leu Trp Ile Leu Ser Gly Val Leu Ala Ala

420 425 430

Asp Leu Val Gly Phe His Thr Tyr Asp Tyr Ala Arg His Phe Ile Ser

435 440 445

Ala Cys Ala Arg Ile Leu Gly Leu Glu Gly Thr Pro Glu Gly Val Glu

450 455 460

Thr His Gly Ser Leu Thr Arg Val Gly Thr Phe Pro Ile Gly Ile Glu

465 470 475 480

Thr Cys Arg Phe Val Arg Ala Ala Ala Asp Pro Asp Val Val Arg Gln

485 490 495

Val Ala Ala Leu Arg Thr Arg Phe Val Gly Arg Lys Ile Val Leu Gly

500 505 510

Val Asp Arg Leu Asp Pro Ile Lys Gly Leu Pro His Lys Leu Leu Ala

515 520 525

Phe Glu Lys Leu Leu Glu Glu Gln Pro Tyr Trp Arg Asp Lys Val Val

530 535 540

Leu Val Gln Ile Ala Val Pro Ser Arg Thr Asp Val Pro Glu Tyr Gln

545 550 555 560

His Leu Ser Ser Ile Val His Glu Ile Val Gly Arg Val Asn Gly Leu

565 570 575

Tyr Gly Ser Leu Thr His Val Pro Ile His Tyr Leu Asp Thr Cys Leu

580 585 590

Ala Phe Ser Gln Leu Val Ala Leu Tyr Gly Ala Thr Asp Val Ala Leu

595 600 605

Val Thr Ser Leu Arg Asp Gly Met Asn Leu Val Ser Tyr Glu Phe Val

610 615 620

Ala Cys Gln Gly Asp Gly Ser Gly Pro Glu Pro Pro Gly Val Leu Leu

625 630 635 640

Leu Ser Glu Phe Ala Gly Ala Ala Gln Thr His Thr Ala Gln His Trp

645 650 655

Ala Asp Thr Phe Leu Ser Glu Leu Asn Asp Thr His Ile Glu Ala Asp

660 665 670

Leu Arg Gly Arg Ala Ala Ala Pro Gln Leu Asp Val Arg Gln Val Leu

675 680 685

Glu Ala Tyr Gly Ser Ser Arg Arg Arg Leu Phe Val Leu Ser Tyr Ser

690 695 700

Ala Val Leu Thr Ala Gly Gly Glu Ala Ala Ala Gly Pro Asp Pro Ala

705 710 715 720

Asn Val Val Val Leu Met Gly Gly Cys Glu Ala Gly Arg Met Glu Ala

725 730 735

Leu Ala Gly Arg Gln Leu Ala Gly Ala Trp Leu Ala Ala Glu Asn Gly

740 745 750

Leu Leu Val Arg Pro Pro Val Pro Pro Glu Ala Leu Asp Gly Asp Asp

755 760 765

Asp Ser Gly Gly Ala Pro Ala Ala Ala Ala Thr Thr Val Pro Ala Arg

770 775 780

Gln Ala Ala Tyr Ser Pro Ser Ser Ser Ser Gly His Pro Thr Ala Ser

785 790 795 800

Gln Pro Pro Gln Pro Pro Leu Pro Arg Gly Trp Arg Trp Leu Pro Gly

805 810 815

Gly Pro Pro Ala Ser Leu Pro Pro Ser Ala Leu Pro Ser Ala Ser Pro

820 825 830

Ser Thr Ser Pro Ser Pro Arg Gly Leu Ala Ala Ala Arg Cys Val Leu

835 840 845

Asp Tyr Phe Cys Glu Arg Thr Pro Gly Ser Phe Val Glu Ala Arg Gln

850 855 860

Thr Ser Leu Val Trp Asn Tyr Lys Tyr Thr Asp Ala Glu Phe Gly Ser

865 870 875 880

Leu Gln Ala Arg Asp Leu Leu Gln His Leu Arg Ala Gly Pro Ile Gly

885 890 895

Asn Glu Pro Leu Glu Val Val Gln Ser Gly Arg Ser Val Glu Ile Arg

900 905 910

Pro Val Gly Val Thr Lys Gly Thr Ser Met Met Arg Leu Leu Gly Leu

915 920 925

Leu Ala Gly Gly Gly Gly Gly Gly Pro Pro Ser Gly Gly Gly Gly Ala

930 935 940

Ala Ala Ala Ser Thr Pro Asp Ser Gly Gly Gly Arg Ser Ala Ser Arg

945 950 955 960

Gly Tyr Gly Gly Phe Asn Gly His Gly Asn Gly Thr Ser Arg Asn Gly

965 970 975

Gly Gly Gly Gly Ser Trp Arg Arg Val Gly Ala Gly Arg Arg Arg Leu

980 985 990

Ser Ile Asp Gly Gly Arg Pro Ser Val Asp Gly Gly Arg Gly Thr Leu

995 1000 1005

Leu Pro Phe Arg Ala Gly Gly Gly Ala Gly Gly Ala Ser Gly Ala Pro

1010 1015 1020

Ala Val Gly Gly Gly Ser Asp Gly Arg Gly Gly Ser Arg Glu Val Glu

1025 1030 1035 1040

Gln Gly Ser Ser Gly Gly Asp Gly Gly Gly Gly Arg Asp Ala Ala Thr

1045 1050 1055

Ala Ala Ala Ala Ala Ala Gly Phe Asp Phe Ala Leu Val Val Cys Gly

1060 1065 1070

His Leu Thr Pro Arg Asp Glu Asp Met Phe Ile Leu Phe Arg Asp Asp

1075 1080 1085

Gly Asn Ser Gly Gly Gly Gly Cys Gly Ala Ser Ala Ser Ala Val Arg

1090 1095 1100

Ala Pro Asp Ala Ser Gly Pro Ala Asn Gly Phe Ala Ala Asn Gly Leu

1105 1110 1115 1120

Val Gln Asn Gly Gly Gly Gly Gln Ala Ile Pro His Ala Pro Ala Pro

1125 1130 1135

Ala Ser Arg Pro Gln Val Ala Glu Gly Leu Gly Ala Asn Ala Gly Gly

1140 1145 1150

Gly Gly Gly Ile Gly Gly Thr Gly Gly Gly Thr Gly Gly Gly Asp Gly

1155 1160 1165

Gly Ala Pro Gly Asn Arg Arg Arg Cys Ala Ser Phe Thr Val Ala Leu

1170 1175 1180

Gly Arg Arg Pro Ser Cys Ala Ser Ser Ser Leu Gly Gly Gly Gly Gln

1185 1190 1195 1200

Leu Val Asp Leu Leu Gln Ala Leu Ala Ala Gly Arg Ala Ala Ala Pro

1205 1210 1215

Ser Gln Gly Glu Pro Pro Gly Ala Ala Ala Gly Thr Ala Ala Pro Ile

1220 1225 1230

Ser Asp Pro Asn Asn Arg Arg Arg Gln Gly Val Val Ala Asp Ala Pro

1235 1240 1245

Pro Gln Pro His Ser His Glu Arg Trp Gln Pro Lys Ala Gly Gly Thr

1250 1255 1260

Ser Ala Ile Arg Thr Gln Arg Arg Gly Ser Asp Gly Asp Leu Gly Ala

1265 1270 1275 1280

Ala Gly Thr Ala Ala Gly Ala Ala Ala Gly Val Thr Thr Gly Asn Gly

1285 1290 1295

Ile Ala Glu Cys Thr Ala Gly Arg Arg Ser Ala Arg Val His Glu Pro

1300 1305 1310

His Thr Thr Val Arg Gln Ala Ser Glu Pro Ser Glu Gly Glu Ser Pro

1315 1320 1325

Phe Thr Ala Asp Gly Ala Gly Gly Gly Gly Arg Ser Gly Ser Asp Ala

1330 1335 1340

Asp Ala Asp Ala Asp Ala Pro Asp Ala Asn Asp Gly Asp Gly Asp Gly

1345 1350 1355 1360

Gly Asp Gly Asp Gly Pro Leu Arg Pro Leu Ala Glu Pro Leu Ser Ala

1365 1370 1375

Phe Pro Ser Pro Val Leu Pro Ala Ala Ala Ser Pro Leu Ala Phe Gly

1380 1385 1390

Gly Thr Pro Leu Gln Ala Phe Ala Arg Trp Ala Ala Ala Pro Ala Ala

1395 1400 1405

Ala Gly Ala Ala Ala Val His Ser Gly Ser Ser Asn Ser Gly Gly Gly

1410 1415 1420

Arg Ser Gly Gly Arg Gly Phe Gly Ser Gly Ala Ala Gly Gly Gly Gly

1425 1430 1435 1440

Gly Gly Gly Cys Val Ala Arg Arg Ser Leu Val Val Val Ala Asn Ala

1445 1450 1455

Ala Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly Thr Leu

1460 1465 1470

Ser Ser Gln Ser Gly Thr Val Ser Val Leu Pro Arg Ser Glu Glu Ala

1475 1480 1485

Arg Arg Tyr Trp Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Lys His

1490 1495 1500

Arg Ser Ser Tyr Arg Phe Ala Glu Arg Leu Phe Gln Leu Ser Gln Ser

1505 1510 1515 1520

His Ile Leu Gln Asn Ala Leu Pro Ser Ile Ser Trp Val Thr Leu Val

1525 1530 1535

Ala Thr Ala Val Ala Ala Tyr Gly Thr Ala Tyr Asp Ala Glu Met Leu

1540 1545 1550

Pro Glu Ile Leu Pro Ser Ile Ala Pro Asn Ala Ser Cys Thr Ala Phe

1555 1560 1565

Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu Leu Val Phe Arg Thr

1570 1575 1580

Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Gly

1585 1590 1595 1600

Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln Gly Ala Thr Cys Phe

1605 1610 1615

Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp Val Val

1620 1625 1630

Ala Phe Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val Thr Leu

1635 1640 1645

Glu Ser Glu Leu Lys Asn Ile Leu Thr Pro Ala Glu Leu Glu Met Leu

1650 1655 1660

Ala Lys Ser Gln His Arg Pro Val Arg Ala Ile His Ala Ile Ser Gln

1665 1670 1675 1680

Ile Ile Gln Ser Val Pro Met Ser Ser Ile His Gln Met Gln Met Ser

1685 1690 1695

Asn Asn Leu Thr Phe Tyr His Asp Val Leu Gly Gly Cys Glu Arg Leu

1700 1705 1710

Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg Phe

1715 1720 1725

Leu Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Pro Thr Val

1730 1735 1740

Gly Trp Gly Val Val Pro Val Cys Thr Gly Ile Ala Ala Val Leu Cys

1745 1750 1755 1760

Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly Ile Leu

1765 1770 1775

Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met Ala Thr

1780 1785 1790

Leu Lys Asp Asp Ala Asp Thr Lys Thr Val Leu Ala Glu Ala Gly Leu

1795 1800 1805

Leu Asn Leu Val Pro Ser Ala Ala Ala Ala Val Pro Val Ala Ser Ala

1810 1815 1820

Ala Pro Ala Ala Pro Ala Ala Ala Gln Gln Pro Ala Met Ala Gly Ser

1825 1830 1835 1840

Ala Ser Ser Ser Ser Ala Gly Arg Gly Pro Ser Asn Gly Leu Gln Val

1845 1850 1855

Arg Val Ala Ile Gly Ser Gln Asp Lys Gln

1860 1865

<210> 44

<211> 381

<212> PRT

<213> Klebsiella sp

<400> 44

Met Asn Ala Pro Lys Ile Asp Pro Glu Pro Leu Leu Glu Tyr Leu Gln

1 5 10 15

Asp Glu Thr Lys Lys Thr Ile Phe Asp Phe Val Arg Trp Ala Thr His

20 25 30

Arg Asn Thr Arg Arg Tyr Ala Arg His Val Ser Gly Leu Trp Arg Ser

35 40 45

Gly Ile Ile Arg Ser Leu Arg Ser Pro Leu Leu Phe Val Phe Phe Ser

50 55 60

Ser Leu Ser Leu Val Leu Tyr His Thr Ala Lys Asp Arg Ala Trp Ile

65 70 75 80

Ser Pro Ser Phe Pro Thr Leu Ser Leu Ser Ser Thr Gln Pro Phe Thr

85 90 95

Leu Ser Ser Leu Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala

100 105 110

Ser Tyr Ala Arg Phe Asp Glu Ala Arg Thr Ile Leu Gly Ala Ile Leu

115 120 125

Cys Arg Thr Arg His Leu Ala Arg Gln Gly Leu Ala Trp Ile Asp Pro

130 135 140

Lys Asp Ala Asp Leu Ile Ala Leu Leu Glu Arg Trp Thr Ile Ala Phe

145 150 155 160

Thr Phe Ala Leu Ala Val His Leu Arg Pro Asp Gly Asp Val Arg Lys

165 170 175

Glu Leu Gln Gly Val Leu Leu Pro Ser Glu Leu Ala Ala Leu Glu Glu

180 185 190

Ala Glu His Lys Pro Ser Phe Val Leu Ser Val Leu Gln His Ile Leu

195 200 205

Pro Gln Ala Gly Val Ser Asp Tyr Leu Gln Gly Cys Met Asn Glu Ser

210 215 220

Leu Ala Gln Leu Glu Thr Ser Leu Gly Ser Cys Glu Arg Ile Phe Asn

225 230 235 240

Thr Pro Ile Pro Leu Met Tyr Thr Arg His Thr Ser Arg Phe Leu Met

245 250 255

Leu Trp Ile Gly Ile Ile Pro Phe Met Met Trp Glu Ala Cys Gly Phe

260 265 270

Ala Ser Leu Ile Leu Ser Pro Ala Ile Ala Phe Phe Leu Leu Gly Ile

275 280 285

Glu Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Ser Ile Leu Pro Ile

290 295 300

Thr Tyr Ile Ala Ser Val Ala Glu Arg Asn Ile Arg Glu Met Val Lys

305 310 315 320

Lys Arg Glu Leu Thr Arg Gly Ile Val Gly Arg Gly Arg Arg Gly Val

325 330 335

Ser Trp Glu Gly Gly Leu Gly Gly Pro Leu Asp Gly Val Met Asn Gly

340 345 350

Cys Asn Ala Val Ser Gly Gln Gln Ser Glu Gly His Phe Glu Arg Ala

355 360 365

Gln Lys Arg Cys Leu Phe Arg Thr His Phe Ser Ser Leu

370 375 380

<210> 45

<211> 460

<212> PRT

<213> Klebsiella sp

<400> 45

Met Ala Thr Ser Ala His Val Ala Met Arg Pro Gln Ala Leu Trp Thr

1 5 10 15

Gly Gly Gly Pro Ala Ser Ala Arg Ser Ala Pro Ala Phe Asn Pro Leu

20 25 30

Pro Ala Gln Val Gly Cys Pro Leu Ala Thr Lys Glu Lys Trp Gln Arg

35 40 45

Met Trp Gly His Ala Ser Leu Arg Ala Ser Leu Asp Leu Ala Asp Ser

50 55 60

Lys Glu Glu Ala Ala Arg Lys Thr Arg Thr Pro Ser Leu Pro Gln Arg

65 70 75 80

Arg Ser Val Arg Cys Gln Ser Ala Pro Lys Ser Asn Ser Pro Pro Pro

85 90 95

Val Ala Leu Lys His Tyr Leu Thr Pro Ile Ser Ala Asp Val Lys Lys

100 105 110

Glu Glu Ser Met Val Tyr Arg Arg Thr Val Phe Gly His Pro Glu Trp

115 120 125

Leu Arg His Arg Ser Ser Thr Arg His Tyr Arg His Ile Leu Ser Ile

130 135 140

Ser Ser Ser Arg Val Ile Leu Ala Leu Gly Pro Pro Val Leu Ala Leu

145 150 155 160

Thr Gly Gly Ala Leu Ala Met Ala Leu Tyr Asn Glu Ala Ile Val His

165 170 175

Asp Ile Leu Pro His Glu Leu Pro Leu Leu Lys Ala Ser Ala Leu Pro

180 185 190

Leu Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr

195 200 205

Asn Ala Ser Tyr Ser Arg Phe Asp Glu Ala Arg Lys Met Trp Gly Ala

210 215 220

Thr Leu Asn Arg Val Arg Asp Leu Ala Arg Gln Ala Leu Ser Tyr Met

225 230 235 240

Asp Asp Asn Glu Glu Arg Glu Glu Val Leu Arg Tyr Leu Met Ala Phe

245 250 255

Pro Tyr Ala Phe Lys Asn His Leu Leu Arg Glu Asp His Ile Val Asp

260 265 270

Asp Met Arg Asn Val Gly Leu Asn Ser Asp Glu Ile Glu Ile Leu Thr

275 280 285

Ser Thr Glu His Arg Pro Asn Tyr Cys Leu Gln Val Met Ser Gln Val

290 295 300

Ile Ser Lys Asn Thr Asp Leu Thr Asp Phe Gln Arg Val Asn Leu Asp

305 310 315 320

His Asn Leu Thr His Phe His Asp Gln Val Gly Gly Cys Glu Arg Ile

325 330 335

Phe Lys Thr Pro Leu Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe

340 345 350

Leu Val Leu Trp His Phe Phe Leu Pro Leu Ala Leu Trp Asp Ala Cys

355 360 365

His Trp Met Val Val Pro Ala Thr Phe Leu Ser Ala Ala Ala Leu Phe

370 375 380

Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Ser Ile Leu

385 390 395 400

Pro Leu His Ala Ile Cys Asn Thr Ala Glu Lys Asn Val Arg Glu Leu

405 410 415

Thr Arg Leu Gln Gly Glu His Leu Asn Lys Arg Ala Ile Gly Gly Lys

420 425 430

Lys Gln Ala Gln Leu Asn Gly Ala Ser Gln Asn Gly Val Ala Asp Gly

435 440 445

Ala Ala Ala Arg Arg Thr Asn Val Gln Val Thr Asn

450 455 460

<210> 46

<211> 428

<212> PRT

<213> liverwort

<400> 46

Met Glu Thr Leu Cys Ser Ile Pro Lys Leu Thr Ser Arg Cys Leu Ser

1 5 10 15

Phe Ser Thr Ser Leu Leu Glu Leu Ser Arg Phe His Ser Phe Cys Pro

20 25 30

Gly Leu Pro Gln Glu Leu Asn Val Arg Arg Gly Arg Thr Ala Phe Arg

35 40 45

Leu Arg Ala Gln Pro Cys Ser Gly Ile Ser Thr Ile His Val Lys Glu

50 55 60

Ser Arg Val Ser Arg Arg Gln Thr Ile Arg Cys Val Gly Ser Gly Pro

65 70 75 80

Glu Pro Glu Pro Tyr Asp Pro Asp Phe Pro Lys Glu Glu Val Phe Leu

85 90 95

Tyr Arg Arg Thr Val Tyr Asp His Lys Asp Trp Ser Arg His Arg Ser

100 105 110

Ser Leu Arg His Ser Arg His Ile Leu Ser Met Arg Ser Ser Arg Val

115 120 125

Ile Leu Ala Leu Trp Pro Pro Val Phe Gly Leu Thr Thr Val Ser Ile

130 135 140

Ala Leu Ser Ala Tyr Asn Glu Cys Ile Leu Ser His Trp Leu Pro Ser

145 150 155 160

Phe Leu Pro Leu Leu His Val Ser Ala Thr Pro Phe Gln Leu Met Ala

165 170 175

Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala

180 185 190

Arg Phe Asp Glu Ala Arg Arg Ala Trp Gly Ser Asn Val Asn Arg Thr

195 200 205

Arg Asp Ile Thr Arg Gln Ala Leu Thr Trp Met Gln His Pro Ser Asp

210 215 220

Ala Glu Lys Val Lys Lys Leu Ile Arg His Cys Val Ala Phe Asn Val

225 230 235 240

Cys Met Lys His His Leu Val Arg Gly Gly Asp Leu Arg Asp Asp Leu

245 250 255

His Ser Trp Ile Asp Lys Glu Glu Ile Asp Gly Ile Leu Ala Ser Thr

260 265 270

His Arg Pro Asn Tyr Val Leu Gln Val Met Ser Glu Ile Ile His Ser

275 280 285

Cys Ser Ile Thr Glu Met Gln Leu Thr Arg Met Asp Val Asn Met Thr

290 295 300

Gln Phe Ala Asp Asn Leu Gly Ala Cys Glu Arg Ile Phe Lys Thr Pro

305 310 315 320

Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val Leu Trp

325 330 335

His Ile Ala Leu Pro Leu Ala Leu Trp Asp His Cys Gln Trp Val Ser

340 345 350

Val Pro Ala Thr Phe Leu Ser Ala Gly Ala Leu Phe Cys Ile Glu Glu

355 360 365

Val Gly Val Leu Ile Glu Glu Pro Phe Gln Ile Phe Pro Leu Asp Asn

370 375 380

Ile Cys Ser Thr Ile Lys Lys Asn Val Asp Gly Leu Ile Leu Ala His

385 390 395 400

Thr Glu Ile His His Cys His Lys His Pro Pro Lys Gly Cys Asp Ile

405 410 415

Pro Lys Lys Lys Ser Ser Gly Asp Ala Pro Lys Ser

420 425

<210> 47

<211> 337

<212> PRT

<213> Monoraphidium neglectum

<400> 47

Met Gly Ala Ala Ala Ala Val Val Ala Tyr Glu Ala Leu Arg Thr Gly

1 5 10 15

Ala Leu Thr Phe Leu Pro Ser Leu His Val Ser Pro Gln Leu Ile Ser

20 25 30

Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala

35 40 45

Ser Tyr Glu Arg Trp Asp Gly Ala Arg Lys Thr Trp Gly Leu Ile Ile

50 55 60

Asn Arg Ser Arg Asp Ile Val Arg Gln Gly Leu Thr His Ile Pro Arg

65 70 75 80

Asp Lys Pro Asp Leu Arg Ala Met Leu Cys Arg Trp Val Pro Ala Phe

85 90 95

Ser Lys Ala Leu Met Cys His Leu Arg Arg Asp Lys Ser Leu Arg Gln

100 105 110

Glu Leu Gln Gly Val Leu Leu Pro Ala Glu Val Asp Glu Val Met Arg

115 120 125

Ser Gln His Arg Pro Asn Tyr Val Leu Gln Val Leu Ala Glu Ile Ile

130 135 140

Arg Thr Gly Arg Val Arg Ala Pro Ala Ala Ile Arg Met Glu Glu Asn

145 150 155 160

Leu Thr Ser Phe Glu Asp Cys Leu Gly Gly Cys Glu Arg Val Leu Lys

165 170 175

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Ser Leu Met

180 185 190

Ile Trp Leu Thr Leu Leu Pro Phe Ala Leu Val Ser Thr Cys Gly Leu

195 200 205

Ala Thr Ile Pro Leu Cys Gly Phe Val Ala Phe Leu Leu Leu Gly Glu

210 215 220

Thr Ile Arg Ile Glu Glu Ile Gly Val Ser Ile Glu Glu Pro Phe Ser

225 230 235 240

Thr Leu Pro Leu Ala Ala Ile Cys Gly Ser Val Leu Thr Asn Val Arg

245 250 255

Glu Leu Gln Ala Thr His Ala Ala Asp Thr Thr Gly Ser Ser Ala Ala

260 265 270

Asp Val Asn Pro Leu Pro Leu Ser Ala Ser Gln Leu Val Thr Arg Tyr

275 280 285

Gly Val Ala Ala Ala Glu Ala Glu Val Arg Gly Met Asp Val Ala Val

290 295 300

Ser Gly Ala Ala Ala Ala Ala Ala Ala Ile Arg Ala Gly Val Pro Gly

305 310 315 320

Asn His Ala Val Trp Pro Gln Ile Arg Ala Gly Leu Ala Ala Ala Gln

325 330 335

Ser

<210> 48

<211> 430

<212> PRT

<213> Monoraphidium neglectum

<400> 48

Met Gln His Ala Ala Arg Leu Gln His Ala Ala Ala Ala Pro Gln Leu

1 5 10 15

Met Arg Pro Pro Thr His Gln Arg Ala Leu Cys Ala Thr Ile Ser Ala

20 25 30

Tyr Val Arg Ser Ile Glu Lys Gly Asp Asp Leu Ala Lys Asn Gln Leu

35 40 45

Cys His Val Lys Arg Ala Ser Val Arg Ala Lys Ala Ser Ala Lys Asp

50 55 60

Pro Arg Val Phe Asp His Asp Asn Trp Asp Val His Arg Ser Thr Thr

65 70 75 80

Arg His Ala Arg His Ile Ala Gly Leu Cys Arg Ser Gln Thr Val Ala

85 90 95

Asn Leu Val Arg Pro Leu Ser Tyr Val Met Gly Val Ala Val Thr Val

100 105 110

Val Ala Val Glu Ala Leu Arg Ala Ala Gly Cys Ala Pro Ala Phe Leu

115 120 125

Pro Ser Leu Gln Val Asn Ser Ala Leu Phe Gly Leu Thr Ser Phe Ala

130 135 140

Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Glu Arg Trp

145 150 155 160

Asp Ser Ala Arg Lys Met Trp Gly Leu Val Leu Asn Arg Ser Arg Asp

165 170 175

Ile Val Arg Gln Gly Leu Thr His Ile Pro Arg Asp Lys Pro Asp Leu

180 185 190

Arg Ala Met Leu Cys Arg Trp Val Pro Ala Phe Ser Lys Ala Leu Met

195 200 205

Cys His Leu Arg Arg Asp Lys Asn Leu Ser Gln Glu Leu Gln Gly Val

210 215 220

Leu Leu Pro Ala Glu Val Asp Glu Val Met Arg Ala Gln His Arg Pro

225 230 235 240

Asn Tyr Val Leu Gln Val Leu Ala Glu Ile Ile Arg Thr Gly Arg Val

245 250 255

Arg Ala Thr Ala Ala Ile Arg Met Glu Glu Asn Leu Thr Ser Phe Glu

260 265 270

Asp Cys Leu Gly Gly Cys Glu Arg Ile Leu Lys Thr Pro Ile Pro Leu

275 280 285

Ser Tyr Thr Arg His Thr Ser Arg Thr Met Met Ile Trp Leu Thr Leu

290 295 300

Leu Pro Ser Ala Leu Val Ser Thr Cys Gly Leu Ala Thr Ile Pro Leu

305 310 315 320

Cys Gly Phe Val Ala Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val

325 330 335

Ser Ile Glu Glu Pro Phe Ser Ile Leu Pro Leu Asp Ala Ile Ser Gly

340 345 350

Ser Val Leu Thr Asn Val Arg Glu Leu Gln Ala Thr His Asp Ala Ala

355 360 365

Ala Gly Ala Thr Gly Ala Ala Asp Ala Ala Pro Leu Pro Leu Ser Ala

370 375 380

Ser Gln Leu Val Thr Arg Tyr Gly Val Ala Ala Ala Glu Ala Gln Val

385 390 395 400

Arg Gly Met His Val Gly Val Asn Gly Ala Ala Ala Ala Val Ala Ala

405 410 415

Asn Gly Thr Ala Val Arg Ser Thr His Ala Val Trp Pro Gln

420 425 430

<210> 49

<211> 318

<212> PRT

<213> Monoraphidium neglectum

<400> 49

Met Thr Ser Pro Ile His Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys

1 5 10 15

Met Trp Gly Leu Val Leu Asn Arg Ser Arg Asp Ile Ala Arg Gln Gly

20 25 30

Leu Ser Tyr Ile Pro Asp Asp Arg Gln Asp Leu Arg Asp Met Leu Cys

35 40 45

Arg Trp Thr Pro Ala Phe Ser Arg Ser Leu Met Thr His Leu Arg Lys

50 55 60

Gly Glu Asp Leu Arg Glu Glu Leu Lys Asp Ile Leu Arg Pro His Glu

65 70 75 80

Leu Asp Ser Leu Leu Met Ser Thr His Arg Pro Asn Tyr Cys Leu Gln

85 90 95

Val Leu Ser Gln Val Val Lys Asp Ala Asn Ala Gly Thr Ala Ala Thr

100 105 110

Ile Arg Met Asp Asp Asn Ile Thr Ala Phe Glu Asp Cys Leu Gly Gly

115 120 125

Cys Glu Arg Ile Leu Lys Thr Pro Val Pro Leu Ser Tyr Thr Arg His

130 135 140

Thr Ser Arg Phe Leu Ile Ile Trp Leu Thr Met Leu Pro Phe Thr Leu

145 150 155 160

Tyr Gly Ser Cys Gly Phe Ala Thr Val Pro Leu Cys Cys Val Ile Ala

165 170 175

Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val Ser Ile Glu Glu Pro

180 185 190

Phe Ser Ile Leu Ala Leu Gln Ala Ile Cys Asp Ser Ala Leu Asn Asn

195 200 205

Val Arg Glu Leu Gln Ala Gln His Asp Ile Ser Lys Ala Lys Ser Asp

210 215 220

Gln Tyr Ser Ala Ile Glu Leu Val Ser Met Ala Ala Ala Glu Ala Ala

225 230 235 240

Gly Ala Ser Ala Thr Ala Ala Ala Ala Glu Ser His Asn Gly Asn Gly

245 250 255

Asn Gly Asn Gly Ser Arg Ala Pro Ser Pro Ala Phe Ala Thr Ala Gly

260 265 270

Val Ala Asn Gly Gly Asn Arg Phe Ala Val Ala Pro Pro Gly Ser Asn

275 280 285

Gly Thr Ala Ala Ser Ser Asp Gly Ala Gly Ser Gly Gly Ser Asn Val

290 295 300

Trp Pro Arg Lys Gly Asn Tyr Ser Ser Val Ser Phe Arg Lys

305 310 315

<210> 50

<211> 363

<212> PRT

<213> Monoraphidium neglectum

<400> 50

Met Glu Leu Arg Cys Ala Pro Ala Ser Ala Pro Gly Ile Ala Pro Asn

1 5 10 15

Asp Thr Ala Ala Ala Ala Ala Ser Phe Gly Gly Ala Pro Ile Ser His

20 25 30

Gly Gly Ala Ala Ala Ala Asn Thr Thr Lys Gly Gly Arg Glu Gln Ser

35 40 45

Val Gly Gly Thr Ala Arg Pro Arg Ser Ala Leu Gly Arg Leu Ser Arg

50 55 60

Ser Lys Ile Leu Asn Leu Gly Ala Pro Glu Phe Val Lys Tyr Val Leu

65 70 75 80

Asp Lys Asp Gly His Asp Arg His Glu Thr Asp Ile Thr Arg Arg Arg

85 90 95

Phe Trp His Asn Val Arg Arg Arg Glu Ala Gly Met Arg Gly Lys Gln

100 105 110

Thr Ser Lys Phe Phe Ser Ala Ala Gly Ser Gly Val Leu Ala Pro Ala

115 120 125

Asp Leu Val Phe Thr Phe Asp Arg Trp Asn Lys His Arg Asn Ser Leu

130 135 140

Arg Tyr Val Lys His Leu Thr His Val Phe Thr Ser Arg Ile Phe Arg

145 150 155 160

Asn Leu Arg Gly Pro Val Val Val Val Met Ala Met Ala Val Leu Val

165 170 175

Gly Thr Tyr Glu Thr Leu Arg Thr Thr Gly Tyr Leu Pro Gly Phe Pro

180 185 190

His Leu Ala His Ser Ala Leu Asp Glu Gly Phe Gln Leu Thr Ala Phe

195 200 205

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asp Arg

210 215 220

Trp Trp Glu Ala Arg Lys Ile Trp Gly Gly Val Val Asn Arg Ser Arg

225 230 235 240

Asp Val Val Arg Gln Gly Leu Val Phe Phe Ala Asp Glu Asp Thr His

245 250 255

Leu Lys Glu Thr Leu Ala Cys Trp Ala Met Ala Phe Pro Lys Val Leu

260 265 270

Met Cys His Leu Arg Asp Ser Met Asp Val Lys Lys Glu Val Gly His

275 280 285

Leu Leu Ser Pro Leu Glu Leu Glu Leu Leu Cys Ser Ser Ala His Arg

290 295 300

Pro Asn Phe Ile Leu Gln Val Ile Ser Glu Thr Ile Arg Ala Ala Lys

305 310 315 320

Pro His Glu Leu Tyr Arg Ile Arg Met Asp Glu Asn Leu Thr Phe Phe

325 330 335

His Asp Ala Leu Gly Ser Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro

340 345 350

Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu

355 360

<210> 51

<211> 406

<212> PRT

<213> Monoraphidium neglectum

<400> 51

Met Met Val Cys Gly Leu Met Ala Gly Arg Val Gln Leu Thr Asp Leu

1 5 10 15

Gly Arg Pro Val Ala Gly Asp Tyr Glu Asp Ala Ile Lys Glu Glu Ser

20 25 30

Arg Arg Tyr Arg Arg Thr Val Phe Asp Ile Gln Ala Trp Glu Gly His

35 40 45

Arg Ser Thr Thr Arg Tyr Gly Arg His Leu Val Gly Ile Leu Thr Ser

50 55 60

Arg Val Val Trp Gly Leu Ala Arg Pro Leu Leu Tyr Val Ala Ala Val

65 70 75 80

Ala Ala Ala Val Val Ala Tyr Glu Ser Leu Arg Gln Ala Gly Leu Leu

85 90 95

Pro Ala Ala Leu Pro Ser Val Gln Leu Thr Ser Lys Glu Pro Phe Gly

100 105 110

Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser

115 120 125

Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Val Leu

130 135 140

Asn Arg Ser Arg Asp Ile Val Arg Gln Gly Leu Ser Tyr Ile Ser Pro

145 150 155 160

Asp Cys Trp Gln Leu Arg Asp Met Leu Cys Arg Trp Thr Pro Ala Phe

165 170 175

Ser Arg Ala Leu Met Cys His Leu Arg Lys Gly Asn Asp Leu Arg Gln

180 185 190

Glu Leu Gln Asp Ile Leu Leu Pro His Glu Leu Asp Ser Leu Leu Lys

195 200 205

Ala Thr His Arg Pro Asn Tyr Val Leu Gln Val Leu Ser Gln Ile Ile

210 215 220

Ser Ser Ala Asn Leu Ser Val Ala Ala Thr Ile Arg Met Asp Gln Asn

225 230 235 240

Leu Thr Ser Phe Ala Asp Cys Leu Gly Gly Cys Glu Arg Ile Leu Arg

245 250 255

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Met

260 265 270

Ile Trp Leu Thr Leu Leu Pro Phe Ser Leu Phe Gly Ser Cys Gly Leu

275 280 285

Ser Thr Ile Pro Leu Ser Val Ala Ile Ala Phe Leu Leu Leu Gly Ile

290 295 300

Glu Glu Ile Gly Val Ser Ile Glu Ala Glu Pro Phe Ser Ile Leu Ala

305 310 315 320

Leu Glu Val Ile Cys Asp Ser Val Leu Ser Asn Val Arg Glu Ile Gln

325 330 335

Ser Thr His Ala Ala Asn Gly Asn Gly Gly Ser Ser Thr Gly Val Ser

340 345 350

Gly Asn Gly Asn Gly Ser Gly Ala Pro Pro Ala Gln Gln Arg Arg Glu

355 360 365

Gln Leu Ser Ala Ala Gln Leu Val Gly Leu Ala Arg Ser Gly Pro Gln

370 375 380

Gly Gln Lys Glu Trp Pro Pro Val Gln Ala Val Asn Arg Tyr Pro Val

385 390 395 400

Pro Gln Ala Ala Gly Val

405

<210> 52

<211> 358

<212> PRT

<213> Physcomitrella patens

<400> 52

Met His Arg Asn Ala Val Tyr Gly His Asp Glu Trp Ala Lys His Lys

1 5 10 15

Ser Cys Trp Arg His Gly Arg His Leu Lys Thr Ile Phe Ala Ser Arg

20 25 30

Pro Ile Val Ala Thr Gly Pro Pro Val Ala Phe Cys Thr Leu Ile Ala

35 40 45

Val Phe Val Val Ile Phe Asn His Ser Val Leu Val Gly His Phe Pro

50 55 60

Val Trp Val Pro Val Ile Gln Val Ala Ser Ile Pro Phe Ala Leu Thr

65 70 75 80

Ser Ser Val Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr

85 90 95

Asn Arg Phe Asp Glu Ala Arg Lys Ala Trp Gly Ser Asn Val Asn Arg

100 105 110

Thr Arg Asp Leu Ala Arg Gln Ala Leu Thr Trp Ile Arg Ser Pro Ala

115 120 125

Asp Leu Pro Lys Leu His Cys Leu Leu Arg His Ile Lys Ala Tyr Ser

130 135 140

Tyr Cys Leu Lys Asp His Leu Thr Gln Asp Asn Thr Leu Arg Glu Glu

145 150 155 160

Leu Ala Lys Val Leu Glu Pro Thr Glu Leu Glu Leu Val Leu Ser Ser

165 170 175

Lys His Arg Pro Asn Tyr Val Met Gln Val Met Ser Glu Leu Ile Lys

180 185 190

Gln Cys Lys Val Ser Glu Trp Glu Ser Met Ser Met Asp Arg Asn Leu

195 200 205

Thr Gln Phe His Asp Asn Val Gly Ala Cys Glu Arg Leu Phe Lys Thr

210 215 220

Pro Ile Pro Val Ala Tyr Thr Arg Leu Thr Ser Arg Val Leu Ser Leu

225 230 235 240

Trp His Ile Ser Leu Pro Phe Ala Leu Trp Asn Ser Cys His Trp Leu

245 250 255

Thr Ile Pro Ala Thr Phe Phe Ser Ser Ala Ala Leu Phe Tyr Ile Glu

260 265 270

Glu Val Gly Val Leu Ile Glu Glu Pro Phe Trp Ile Leu Ala Leu Met

275 280 285

Ser Ile Ser Asp Gly Ile Cys Ser Ala Leu Asp Gly Leu Val Ala Ala

290 295 300

His Gln Glu Thr Arg Leu Val Trp Gly Val His Pro Gln Ala Val Cys

305 310 315 320

Lys Lys Asp His Val Val Ile Thr Phe Glu Asn Ser Arg Ser Cys Ala

325 330 335

Ser Asp Gly Phe Arg Pro Gln His Asp Tyr Ile Asp Val Ala Met Thr

340 345 350

Arg Val Asn Ser Val Ser

355

<210> 53

<211> 416

<212> PRT

<213> Physcomitrella patens

<400> 53

Met Ala Pro Gly Gln Val His Thr Asp Cys Leu Trp Met Lys Tyr Ser

1 5 10 15

Cys Leu Arg Asn Thr Tyr Ser Lys Leu Gln Ala Leu Gln Met Lys Asp

20 25 30

Leu Asp Phe Arg His Trp Ala Ser Gln Glu Phe Ser Leu Val Thr Pro

35 40 45

Glu Glu Gln Ala Val Leu Gly Ser Gly Leu Glu Pro Gln Lys Ile Met

50 55 60

His Arg Asn Lys Val Tyr Gly His Leu Glu Trp Ala Arg His Lys Ser

65 70 75 80

Ser Trp Arg His Gly Arg His Ile Phe Ser Ile Leu Ser Ser Gly Val

85 90 95

Ile Phe Ala Val Phe Pro Pro Val Leu Val Cys Thr Leu Phe Gly Thr

100 105 110

Phe Val Thr Ile Phe Asn His Phe Val Gln Asn Gly His Leu Pro Thr

115 120 125

Trp Met Pro Ile Leu His Val Ala Ser Leu Pro Phe Thr Leu Thr Ser

130 135 140

Ser Val Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asn

145 150 155 160

Arg Phe Glu Glu Ala Arg Lys Phe Trp Gly Ser Asn Val Asn Arg Thr

165 170 175

Arg Asp Leu Val Arg Gln Ser Leu Thr Trp Ile Ser Gln Pro Gly Asp

180 185 190

Ser Leu Ile Leu Leu Ser Leu Leu Arg His Ile Lys Ala Tyr Ser Phe

195 200 205

Cys Leu Lys Asp His Leu Thr Glu Asp Glu Thr Leu Arg Asp Asp Leu

210 215 220

Val Gly Ile Val Glu Pro His Glu Leu Glu Ser Ile Leu Ser Ser Pro

225 230 235 240

His Arg Pro Asn Tyr Ile Leu Gln Val Leu Ser Glu Leu Ile Asn Gln

245 250 255

Cys His Ile Ser Gln Trp Glu Lys Met Ser Met Asp Glu Asn Ile Thr

260 265 270

Thr Phe His Asp Asn Val Gly Ala Cys Glu Arg Ile Leu Lys Thr Pro

275 280 285

Ile Pro Ile Ala Tyr Thr Leu Val Thr Ser Arg Phe Leu Ile Leu Trp

290 295 300

His Ser Ala Leu Pro Leu Ala Leu Trp Asn Asp Cys Gly Trp Leu Thr

305 310 315 320

Ile Pro Ala Thr Phe Leu Thr Gly Met Ala Leu Phe Tyr Ile Glu Glu

325 330 335

Val Gly Val Val Ile Glu Glu Pro Phe Trp Ile Leu Pro Leu Gly Ser

340 345 350

Ile Cys Thr Gly Ile Val Ser Ala Ile Asp Gly Leu Ser Ala Ala His

355 360 365

Lys Thr Ser Asn Leu Leu Trp Ser Leu His Gln Pro Met Thr Asp His

370 375 380

Val Val Gln Ile Ala Phe Glu Arg Ser Lys Thr Asp Gly Phe Ser Lys

385 390 395 400

Thr Arg Asp Gln Ile Asp Val Met Leu Thr Arg Ile Asn Ser Ile Ala

405 410 415

<210> 54

<211> 297

<212> PRT

<213> Physcomitrella patens

<400> 54

Met Gly Leu His Lys Ser Ser Trp Arg His Gly Arg His Ile Gln Thr

1 5 10 15

Ala Phe Ser Thr Gly Val Ile Ser Ser Ile Ile Pro Arg Val Phe Phe

20 25 30

Cys Thr Leu Ile Ser Val Leu Val Thr Ile Phe Asn His Ala Val Met

35 40 45

Glu Gly Val Leu Pro His Trp Val Pro Ser Leu Arg Val Pro Thr Leu

50 55 60

Pro Met Ser Leu Thr Ala Pro Val Leu Ser Leu Leu Leu Val Phe Arg

65 70 75 80

Thr Asn Ser Ser Tyr Asn Arg Leu Asp Glu Ala Arg Lys Ala Trp Gly

85 90 95

Ser Asn Val Asn Arg Thr Arg Asp Val Ser Arg Gln Ala Leu Ser Trp

100 105 110

Ile Cys Asp Pro Asp Asp Ala Asp Lys Leu Gln Ser Leu Leu Arg His

115 120 125

Ile Lys Ala Phe Ser Tyr Cys Leu Lys Asp His Leu Thr Gln Glu Asn

130 135 140

Leu Leu Gln Glu Glu Leu Ala Arg Val Leu Glu Pro Arg Glu Val Glu

145 150 155 160

Leu Val Leu Lys Ser Ser His Arg Pro Asn Tyr Val Leu His Val Met

165 170 175

Ser Asp Thr Ile Lys His Cys Arg Ile Ser Lys Trp Glu Ser Lys Ser

180 185 190

Met Asp Arg Asn Ile Thr Gln Phe His Asp Asn Val Gly Ala Cys Glu

195 200 205

Arg Leu Phe Lys Thr Pro Ile Pro Val Ala Tyr Thr Arg Met Ile Ser

210 215 220

Arg Phe Leu Ser Ile Trp His Phe Leu Leu Pro Leu Ala Leu Trp Asn

225 230 235 240

Ser Cys Arg Trp Leu Thr Ile Pro Val Thr Phe Val Ser Gly Val Gly

245 250 255

Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Asp Pro Ser Thr

260 265 270

Ser Leu Leu Cys Cys Gln Ser Ala Met Ala Phe Pro Gln Leu Trp Met

275 280 285

Ala Ser Ala Arg Leu Met Lys Glu Leu

290 295

<210> 55

<211> 669

<212> PRT

<213> Cephalosporium Tomentosum

<400> 55

Met Leu Ala Thr Ala Pro Cys Ala Ala Ala Cys Thr Pro Ser Arg Arg

1 5 10 15

Gly Gly Arg Cys His Arg Arg Leu Trp Thr Pro Pro Arg Thr Ala Ala

20 25 30

His Gly Gln His Ala Ala Ala Asp Gly Asp Lys Gln Gln Gln Pro Asp

35 40 45

Gln Pro Pro Pro Pro Pro Ala Thr Ala Ala Ala Ala Gly Ser Asp Pro

50 55 60

Ala Pro Pro Ser Pro Ala Ala Ala Pro Pro Pro Thr Pro Pro Gly Gly

65 70 75 80

Phe Thr Pro Tyr Trp Pro Ser Asn Tyr Arg Lys Arg Leu Glu Ala Ala

85 90 95

Thr Leu Glu Arg Ala His Glu Ala Asp Val Thr Pro Thr Val Phe Asp

100 105 110

Phe Ala Leu Trp Arg Arg His Arg Ser Arg Leu Arg Tyr Val Glu His

115 120 125

Leu Val Thr Leu Thr Gly Ser Tyr Phe Val Leu Asp Leu Ala Ala Pro

130 135 140

Val Ile Val Leu Thr Ala Ala Ala Ala Ala Val Gly Leu Tyr Glu Thr

145 150 155 160

Val Leu Gln Gly Gly Met Leu Pro Ser Phe Leu Pro Asn Ile Ala Met

165 170 175

Ala Ala Glu Gly Pro Phe Asn Ala Ala Ser Phe Ala Met Ser Leu Met

180 185 190

Leu Ala Phe Lys Thr Asn Val Ser Tyr Ala Arg Trp Asn Glu Ala Arg

195 200 205

Cys Leu Trp Gly Ser Leu Val Asn Arg Ser Arg Asn Leu Val Arg Gln

210 215 220

Gly Leu Met Leu Ile Pro Arg Glu His Ala Ala Leu Lys Pro Val Leu

225 230 235 240

Ala Arg Trp Ser Ile Ala Phe Ala Arg Ala Leu Lys Thr His Leu Arg

245 250 255

Glu Asp Gly Asp Val Ala Gly Glu Leu Ala Ala Ile Leu Glu Pro His

260 265 270

Glu Val Ala Val Val Ala Ala Asn Leu Asn Arg Pro Leu Ala Cys Leu

275 280 285

Gln Ala Met Ser Ala Val Val Arg Ala Ala Arg Leu Asp Pro Ile Gly

290 295 300

Thr Ser Arg Leu Asp Ile Asn Leu Glu Thr Phe Glu Asp Ile Met Gly

305 310 315 320

Ala Cys Glu Arg Ile Leu Lys Thr Pro Ile Pro Leu Ser Tyr Thr Arg

325 330 335

His Thr Ser Arg Phe Leu Thr Leu Trp Leu Ala Thr Leu Pro Phe Val

340 345 350

Leu Trp Asn His Ile His Trp Gly Val Ile Pro Ser Thr Ala Val Ile

355 360 365

Ser Phe Leu Leu Phe Gly Ile Asp Glu Ile Ala Ile Gln Leu Glu Glu

370 375 380

Pro Phe Gly Ile Leu Pro Leu Glu Ala Ile Cys Asp Thr Ile Gln Arg

385 390 395 400

Asn Ile Glu Glu Leu Val Asn Ser Glu Gly Ala Val Ala Leu Ala Leu

405 410 415

Asp Ala Ser Met His Glu Ala Arg Ala Arg Leu Ala Gln Glu Glu Glu

420 425 430

Leu Ala Arg Met Leu Glu Glu Gln Leu Pro Phe Asn Trp Gly Pro Arg

435 440 445

Gly Leu Ser Gln Pro His Ser Pro Ala Ala Ala Pro Gly Thr Pro Gly

450 455 460

Ala Ala Gly Gly Ala Gly Ala Ala Ala Ala Ala Ala Ala Leu Ile Ala

465 470 475 480

Ala Asn Arg Pro Arg Pro Phe Gln Asp Phe Pro Ala Gly Gln Pro Ala

485 490 495

Thr Arg Ile Glu Pro Trp Arg Glu Glu Pro Val Gly Ala Thr Ala Pro

500 505 510

Pro Pro Val Ser Glu Glu Gly Gln Pro Pro Gln Trp Arg Pro Gly Trp

515 520 525

Gly Arg Gly Gly Asp Gly Phe Gly Gln Gln Pro Glu Cys Pro Pro Asn

530 535 540

Cys Ser Cys Arg Met Ala Glu Pro Gly Ala Ala Gly Gly Gln Gln His

545 550 555 560

Ser Ser Pro Ala Leu Arg Arg Glu Asp Ala Asp Arg Leu Arg Arg Ala

565 570 575

Leu Gly Glu Val Ala Ala Arg Arg Ala Ala Gln Ser Glu Ala Arg Ala

580 585 590

Ala Pro Leu Glu Pro Val Glu Met Pro Trp Tyr Ala Asp Asp Val Ala

595 600 605

Ser Asp Ser Leu Leu Gly Ala Ala Ala Ala Glu Ala Asp Pro Arg Glu

610 615 620

Ala Gly Val Val Glu Phe Leu Leu Gly Arg Ala His Gly Ala Asn Ala

625 630 635 640

Val Arg His Pro Gly Thr Pro Met Gly Thr His Glu Glu Glu Glu Glu

645 650 655

Gly Pro Ala Ala Ala Gly Pro Ala Pro Pro Ala Gly Gly

660 665

<210> 56

<211> 564

<212> PRT

<213> Cephalosporium Tomentosum

<400> 56

Met Arg Ser Ser Leu Ala Ala Pro Pro Ala His Ala Ser Ser Pro Arg

1 5 10 15

Gly Leu Arg Ala Ala Ala Pro Pro Arg Pro Arg Ala Gly Ala Arg Gly

20 25 30

Gly Arg Pro Ala Val Val Val Ala Ala Leu Ser Gln Glu Asp Asp Gln

35 40 45

Ile Lys Glu Gln Ser Arg Lys Phe Arg Arg Thr Val Phe Thr Phe Glu

50 55 60

Asp Trp Glu Lys His Arg Ser Thr Ser Arg Tyr Ser Arg His Leu Ser

65 70 75 80

Gly Met Phe Ser Ser Arg Val Val Trp Gly Leu Gln Arg Pro Leu Val

85 90 95

Tyr Val Cys Gly Val Ser Leu Ala Val Ile Leu Tyr Glu Lys Ser Leu

100 105 110

Glu Leu Leu Ser Arg Glu Pro Phe Gly Leu Thr Ser Phe Ala Leu Ser

115 120 125

Leu Leu Leu Val Phe Arg Thr Asn Val Ser Tyr Glu Arg Trp Asp Ser

130 135 140

Ala Arg Lys Met Trp Gly Leu Leu Leu Asn Arg Ser Arg Asp Leu Val

145 150 155 160

Arg Gln Gly Ile Thr Tyr Ile Pro Glu Asp Arg Pro Glu Leu Arg Thr

165 170 175

Leu Leu Val Arg Trp Thr Pro Ala Phe Ala Arg Ala Leu Leu Cys His

180 185 190

Leu Arg Lys Asp Gly Asp Trp Glu Gly Gln Leu Gly Leu Thr Leu Lys

195 200 205

Pro His Glu Val Glu Gln Val Leu Lys Ala Thr His Arg Pro Asn Tyr

210 215 220

Val Leu Gln Val Leu Ser Gln Ile Ile Arg Glu Ala Asp Leu Gly Val

225 230 235 240

Ala Pro Thr Thr Arg Met Asp Glu Asn Leu Thr Gln Phe Glu Asp Val

245 250 255

Leu Gly Gly Cys Glu Arg Ile Leu Lys Thr Pro Val Pro Leu Ser Tyr

260 265 270

Thr Arg His Thr Ser Arg Phe Leu Met Ile Trp Leu Thr Leu Leu Pro

275 280 285

Phe Thr Leu Tyr Ser Thr Val Gly Leu Gly Thr Ala Pro Leu Cys Ala

290 295 300

Ile Ile Ala Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val Ser Ile

305 310 315 320

Glu Glu Pro Phe Ser Ile Leu Ala Leu Glu Ala Ile Ser Asp Ser Ser

325 330 335

Leu Asn Asn Ser Arg Glu Leu Ala Ala Met His Ala Thr Asp Ala Ala

340 345 350

Val Pro Leu Pro Glu Gly Ala Asp Pro Pro Pro Ala Tyr Thr Ser Ala

355 360 365

Arg Asp Leu Ile Ala Leu Ala Ser Ala Ala Ala Val Ala Ser Ala Ala

370 375 380

Ala Asp Ala Leu Ala Ala Pro Ala His Ala Pro Ala Pro Ala Ser His

385 390 395 400

Ser Ala Pro Ala Pro Gln Glu Pro Ala Ala Pro Ala Ala Pro Ala Ala

405 410 415

Val Ala Pro Ala Ala Ala Ala Pro Ala Pro Ala Ala Pro Ala Pro Thr

420 425 430

Ala Pro Ala His Ser Ala Pro Val Pro Lys Glu Pro Ala Ala Glu Pro

435 440 445

Glu Arg Val Pro Val Leu Ala Gly Val Gly Ala Gly Arg Ala Pro Val

450 455 460

His Leu Asn Gly Lys Ser Gly Asn Gly Ala Thr Ala Tyr Glu Pro Ala

465 470 475 480

Ala Ala Pro Ala Arg Ala Asn Gly Ala Arg Pro Ala Ala Ala Ala Ser

485 490 495

Pro Lys Pro Ala Ala Ala Ala Ala Pro Ala Ala Ala Ser His Ala Ala

500 505 510

Pro Ala Ala Pro Ala Ala Ala Ala Ala Pro Gln Ala Ala Ala Ala Pro

515 520 525

Gln Ala Ala Ala Pro Ala Pro Ala Pro Ala Ala Lys Pro Leu Pro Asn

530 535 540

Thr Gly Arg Ala Gly Ser Leu Arg Arg Thr Gly Gly Tyr Gly Leu Ile

545 550 555 560

Arg Phe Arg Ser

<210> 57

<211> 513

<212> PRT

<213> Cephalosporium Tomentosum

<400> 57

Met Gln Cys Ala Ile Gly Asn Ala Ala Val Gln Pro Leu Gly Arg Pro

1 5 10 15

Leu Gly Val Pro Arg Ser Arg Ala Ala Ala Ala Ala Ala Ala Ala Val

20 25 30

Arg Ala Arg Ser Trp Pro Arg Leu Thr Ala Leu Arg Ala Ala Pro Gly

35 40 45

Asp Gly Pro Glu Pro Ser Ala Pro Ser Thr Ala Gly Ser Leu Gln Ser

50 55 60

Leu Ala Glu Arg Leu Arg Ala Thr Ala Thr Pro Gly Glu Val Gln Ser

65 70 75 80

Asp Leu Asn Tyr Tyr Gly Leu Ala Asn Leu Glu Asp Ala Arg Arg Ser

85 90 95

Gly Asp Glu Ala Gln Asp Asp Leu Leu Trp Arg Thr Pro Val Ser Glu

100 105 110

Leu Ala Ala Arg Arg Arg Gly Leu Gly Leu Val Ala Ala Asp Leu Ser

115 120 125

Thr Glu Gln Glu Arg Lys Leu Arg Arg Ala Val Phe Gly Phe Asp Arg

130 135 140

Trp Ala Ala His Arg Ser Thr Ser Arg Tyr Leu Arg His Leu Lys Gly

145 150 155 160

Ile Val Ser Ser Arg Thr Met Arg Ala Leu Leu Pro Pro Leu Ala Phe

165 170 175

Phe Gly Ala Val Ala Val Ala Ala Gly Trp Tyr Thr Leu Glu Leu Ala

180 185 190

Pro Gln Tyr Gly Leu Pro Lys Val Val Leu Asn Asp Ser Ser Leu Glu

195 200 205

Ile Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asp Ser

210 215 220

Ser Tyr Ala Arg Trp Glu Gln Ala Leu Asn Ala Trp Gln Ser Val Arg

225 230 235 240

Ala Glu Ser Lys Asn Leu Ala Arg Gln Ala Cys Tyr Phe Val Glu Glu

245 250 255

Pro Ile Arg Arg Ala Met Leu Met Arg Trp Thr Val Ala Phe Pro His

260 265 270

Ala Leu Leu Ser His Val Arg Cys Asp Ala Pro Leu Arg Ala Gln Leu

275 280 285

Ala Gly Val Leu Ala Pro His Glu Val Glu Ala Val Glu Ala Val Gly

290 295 300

Ala Ala Ser Ala Pro Glu Phe Val Leu Gln Val Met Ser Glu Leu Val

305 310 315 320

Glu Gln Cys Arg Leu Gly Asp Ser His Arg Ala Glu Gln Leu Tyr Phe

325 330 335

Ser Ile Lys Ala Leu Gly Gly Ala Val Gly Thr Cys Asp Lys Leu Leu

340 345 350

Arg Tyr Pro Ile Pro Leu Ala Tyr Ser Arg His Thr Ser Arg Phe Met

355 360 365

Cys Val Trp Leu Ser Ala Leu Pro Phe Ala Leu Phe Ser Ser Gly Leu

370 375 380

Gly Trp Gly Ala Val Pro Val Thr Leu Val Thr Ala Tyr Leu Leu Leu

385 390 395 400

Ala Val Asp Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Ser Ile Leu

405 410 415

Pro Leu Glu Asp Ile Leu Phe Asp Ile Gln Ser Glu Thr Ala Ala Leu

420 425 430

Gly Glu Arg Gln Gly Ala Val Ala Glu Ile Leu Arg Ala Gly Gly Ile

435 440 445

Glu Cys Thr Pro Arg Thr Pro Phe Asp Asp Ala Ala Cys Ala Ala Cys

450 455 460

Gly Ala Leu Val Ser Pro Ala Gly Ser Leu Asp Asp Gly Asp Asp Ala

465 470 475 480

Gly Gly Gly Gly Ala Gly Ala Gly Ala Gly Glu Ala Leu Pro Gly Leu

485 490 495

Pro Leu Arg Pro Arg Ala Pro Gly Gly Arg Arg Val Val Arg Thr Ser

500 505 510

Arg

<210> 58

<211> 469

<212> PRT

<213> Cephalosporium Tomentosum

<400> 58

Met Lys Leu Ser Ala Gly Pro Met Gln Ser Arg Ala Ala Phe Ala Gly

1 5 10 15

Gln Arg Leu Ala Val Arg Pro Ala Leu Arg Ser Arg Ala Ala Lys Arg

20 25 30

Thr Pro Ala Val Gln Thr Ser Cys Gly Ala Ala Pro Lys Gly Leu Pro

35 40 45

Ser Ser Val Thr Ser Tyr Asp Asp Asp Ile Lys Glu Lys Ser Arg Lys

50 55 60

Phe Arg Arg Thr Val Phe Thr Phe Glu Ser Trp Glu Gly His Arg Ser

65 70 75 80

Thr Glu Arg Tyr Ala Arg His Ile Ile Ser Met Phe Ser Ser Arg Val

85 90 95

Val Arg Gly Leu Ser Lys Pro Leu Phe Tyr Met Val Gly Val Ser Ser

100 105 110

Phe Val Val Ala Tyr Glu Thr Ala Arg Leu Ala Gly Leu Leu Pro Leu

115 120 125

Trp Ala Pro Ser Val Gln Leu Asn Ser Lys Glu Val Phe Gly Leu Thr

130 135 140

Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr

145 150 155 160

Glu Arg Trp Asp Gly Ala Arg Lys Met Trp Gly Leu Val Leu Asn Arg

165 170 175

Ser Arg Asp Ile Val Arg Gln Gly Leu Thr Tyr Phe Pro Ser Asp Arg

180 185 190

Pro Glu Leu Lys Asp Met Leu Val Arg Trp Thr Pro Ala Phe Ser Lys

195 200 205

Ser Leu Met Cys His Leu Arg Lys Asp Asp Asp Tyr Arg Glu Val Leu

210 215 220

Gln Asp Ile Leu Leu Pro His Glu Leu Asp Ser Ile Met Met Ala Thr

225 230 235 240

His Arg Pro Asn Tyr Ala Leu Gln Val Leu Ser Glu Ile Val Arg Glu

245 250 255

Ala Asn Cys Gly Thr Ala Pro Thr Met Arg Met Asp Asp Asn Ile Thr

260 265 270

Ser Phe Glu Asp Cys Leu Gly Gly Cys Glu Arg Ile Leu Lys Thr Pro

275 280 285

Val Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Met Ile Trp

290 295 300

Leu Ser Leu Leu Pro Phe Ala Leu Tyr Gly Thr Cys Gly Val Ser Thr

305 310 315 320

Ile Pro Leu Cys Val Ile Ile Ala Phe Leu Leu Leu Gly Ile Glu Glu

325 330 335

Ile Gly Val Ser Ile Glu Glu Pro Phe Ser Ile Leu Ala Leu Glu Ala

340 345 350

Ile Ser Asp Ser Ala Leu Asn Asn Ser Arg Glu Leu Lys Ala Gln His

355 360 365

Asp Ala Glu Val Arg Asn Gly Asn Gln Met Ser Ala Thr Asp Leu Ile

370 375 380

Ala Phe Glu Ala Ala Ala Arg Gly Arg Thr Pro Leu Ser Lys Leu Ser

385 390 395 400

Gly Ala Pro Ala Ala Ala Pro Ala Pro Val Pro Ala Ala Ala Pro Ala

405 410 415

Pro Ala Ala Ala Pro Ala Pro Ala Pro Ala Pro Val Pro Ala Ala Ala

420 425 430

Pro Ala Tyr Val Ala Ala Ala Ala Thr Asn Gly Ser Ala Asn Gly Ala

435 440 445

Ala Pro Asn Thr Trp Pro Arg Pro Arg Ser Pro Val Pro Thr Ser Gly

450 455 460

Val Ser Phe Arg Lys

465

<210> 59

<211> 443

<212> PRT

<213> Cephalosporium Tomentosum

<400> 59

Met Ala Leu Ala Ala Ala Arg Pro Ala Leu Cys Ala Gly Pro Ser Gln

1 5 10 15

Leu Arg Arg Ala Gly Gln Pro Ala Ala Gln Ala Ala Arg Pro Leu Leu

20 25 30

Pro Leu Arg Arg Ala Arg Ala Pro Leu Arg Val Gln Ala Ser Lys Ala

35 40 45

Asn Pro Tyr Ala His Met Asn Val Asp Asp Ala Ile Lys Glu Gln Thr

50 55 60

Arg Lys Thr Ala Arg Thr Val Phe Asp Phe Glu Arg Trp Glu Ala His

65 70 75 80

Arg Cys Ser Gly Arg Tyr Phe Arg His Ile Leu Gly Val Phe Asn Ser

85 90 95

Arg Ile Ile Phe Gly Leu Leu Arg Pro Leu Met Leu Val Ile Leu Thr

100 105 110

Ala Thr Ala Val Val Met Trp Glu Ser Leu Arg Gln Ala Gly Val Leu

115 120 125

Pro Pro Val Val Pro Ser Val Gln Leu Ala Trp Ser Lys Glu Leu Phe

130 135 140

Gly Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe His Thr Asn

145 150 155 160

Ala Gly Tyr Glu Arg Trp Asp Gly Ala Arg Lys Ile Trp Gly Leu Met

165 170 175

Leu Asn Arg Ser Arg Asp Ile Ala Arg Gln Gly Leu Thr Tyr Ile Pro

180 185 190

Arg Asp Gln Pro His Leu Arg Ala Met Leu Cys Arg Trp Val Pro Ala

195 200 205

Phe Ser Arg Thr Leu Met Cys His Leu Arg Gln Asp Ser Asp Phe Gly

210 215 220

Ala His Leu Lys Gly Val Leu Tyr Pro His Glu Ile Glu Ala Val Leu

225 230 235 240

Ser Ser Thr His Arg Pro Asn Tyr Val Leu Gln Val Ile Ser Glu Ile

245 250 255

Val Lys Ser Ala Arg Leu Pro Leu Ala Ala Arg Val Lys Met Asp Gln

260 265 270

Asn Ile Thr Thr Phe His Asp Asp Leu Gly Gly Cys Glu Arg Ile Leu

275 280 285

Lys Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Gly Arg Phe Leu

290 295 300

Met Ile Trp Leu Leu Leu Leu Pro Phe Thr Leu Val Gly Gly Cys Gly

305 310 315 320

Val Thr Thr Ile Pro Leu Cys Ala Thr Ile Gly Phe Leu Leu Met Gly

325 330 335

Ile Asp Glu Ile Gly Val Ala Ile Glu Glu Pro Phe Ser Ile Leu Pro

340 345 350

Leu Glu Ala Ile Ala Asn Ser Ala Leu Val Asn Ile Arg Glu Leu Glu

355 360 365

Ala Ala His Gln Ala Asp Pro Glu Pro Asp Phe Ser Ala Ala Glu Asp

370 375 380

His His Thr Arg Thr Ala Leu Asp Leu Val Ser Ala Thr Ala Thr Ala

385 390 395 400

Gly Thr Ala Gln Arg Ala Ala Ala Ala Ala Ala Thr Ala Ala Ser Ala

405 410 415

Ala Ala Val Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Ala Pro

420 425 430

Arg Ser Trp Pro Ser Ser Pro Ala Phe Ala Asn

435 440

<210> 60

<211> 1146

<212> PRT

<213> Tetrastigmaea sp

<400> 60

Met Gln Ala Leu Arg Leu Lys Gly Gln Arg Pro Gly Leu Arg Ala Ser

1 5 10 15

Leu Gln Pro Arg Arg Thr Val Val Arg Ile Val Ala Asn Ala Ala Lys

20 25 30

Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly Thr Leu Ser Ser

35 40 45

Gln Ser Gly Thr Val Ala Pro Leu Leu Arg Ser Glu Glu Ala Arg Arg

50 55 60

Tyr Trp Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Lys His Arg Ser

65 70 75 80

Ser Tyr Arg Phe Met Glu Arg Leu Phe Gln Leu Leu Gln Ser His Ile

85 90 95

Leu Gln Asn Ala Leu Pro Ser Ile Ser Trp Val Thr Leu Val Ala Thr

100 105 110

Leu Val Ala Ala Tyr Gly Thr Ser Phe Asp Gln Gly Leu Leu Pro Asp

115 120 125

Gly Leu Pro Asn Ile Ser Pro Asn Ala Ser Cys Thr Ala Phe Ile Ser

130 135 140

Asn Thr Ser Ile Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser

145 150 155 160

Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Gly Leu Leu

165 170 175

Asn Arg Ser Arg Asp Ile Met Arg Gln Gly Ala Thr Cys Phe Pro Asp

180 185 190

Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp Val Val Ala Tyr

195 200 205

Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val Thr Leu Glu Ser

210 215 220

Glu Leu Lys Asn Ile Leu Thr Ala Pro Glu Leu Glu Met Leu Ala Arg

225 230 235 240

Ser Gln His Arg Pro Val Arg Ala Ile His Ser Ile Ser Gln Ile Ile

245 250 255

Gln Ser Val Pro Met Ser Ser Ile His Gln Met Gln Met Ser Asn Asn

260 265 270

Leu Thr Phe Phe His Asp Val Leu Gly Gly Cys Glu Arg Leu Leu Arg

275 280 285

Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Phe

290 295 300

Ala Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Pro Thr Val Gly Trp

305 310 315 320

Gly Val Val Pro Val Ser Thr Gly Ile Ala Ala Val Leu Cys Gly Ile

325 330 335

Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly Ile Leu Pro Leu

340 345 350

Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met Ala Thr Leu Lys

355 360 365

Asp Asp Gln Asp Thr Lys Ile Val Leu Ser Glu Ala Gly Leu Leu Gly

370 375 380

Leu Leu Pro Ser Ala Val Ala Thr Val Pro Val Ala Ala Ala Ala Ala

385 390 395 400

Ala Ala Ala Ala Ala Ala Ala Ala Pro Ala Asn Gly Asn Gly Asn Gly

405 410 415

Asn Gly Asn Gly Asn Gly Ala Tyr Ala Gln Pro Ala Gly Ala Val Ala

420 425 430

Ser Lys Asp Met Gln Val Arg Val Ala Ile Gly Ala Glu Lys His Gln

435 440 445

Arg Val Cys Ala Pro Arg Gly Leu Arg Ala Pro Ala Leu Cys Gly Arg

450 455 460

Arg Leu Arg Leu Val Val Ser Ala Asp Ala Ala Lys Asp Pro Asn Ala

465 470 475 480

Pro Ile Gln Ser Asn Pro Leu Gly Thr Leu Ser Ser Gln Ser Gly Leu

485 490 495

Val Ser Thr Thr Pro Arg Ser Glu Met Ala Arg Lys Tyr Phe Arg Thr

500 505 510

Val Tyr Asp Phe Pro Gln Trp Gln Lys His Arg Asn Gln Tyr Arg Leu

515 520 525

Met Lys Arg Leu Ile Thr Ile Pro Gln Ser His Ile Ile Gln Asn Ala

530 535 540

Leu Pro Ser Ile Ala Trp Val Gly Leu Val Ser Thr Ala Leu Ala Val

545 550 555 560

Tyr Met Thr Ala Leu Asp Gln His Leu Leu Pro Glu Gly Leu Pro Ser

565 570 575

Phe Ala Pro Asn Ala Ser Cys Ser Ala Phe Ile Ser Asn Thr Ser Val

580 585 590

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Thr Ser Tyr Ser Arg

595 600 605

Trp Asp Glu Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg

610 615 620

Asp Ile Met Arg Gln Ala Ala Thr Cys Phe Pro Asp Asp Gln Val Glu

625 630 635 640

Ala Lys Lys Ala Leu Ala Arg Trp Val Val Ala Tyr Ala Arg Ala Leu

645 650 655

Arg Ile His Phe Gln Pro Glu Val Thr Leu Glu Ser Glu Leu Lys Asn

660 665 670

Ile Leu Thr Pro Ala Glu Leu Glu Met Leu Ala Arg Ser Gln His Arg

675 680 685

Pro Val Arg Ala Ile His Ser Ile Ser Gln Ile Ile Gln Ser Val Pro

690 695 700

Met Ser Ser Val His Gln Met Gln Met Ser Asn Asn Leu Thr Phe Phe

705 710 715 720

His Ala Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly Thr

725 730 735

Leu Ser Ser Gln Ser Gly Leu Val Ser Thr Thr Pro Arg Ser Glu Met

740 745 750

Ala Arg Lys Tyr Phe Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Lys

755 760 765

His Arg Asn Gln Tyr Arg Leu Met Lys Arg Leu Ile Thr Ile Pro Gln

770 775 780

Ser His Ile Ile Gln Asn Ala Leu Pro Ser Ile Ala Trp Val Gly Leu

785 790 795 800

Val Ser Thr Ala Leu Ala Val Tyr Met Thr Ala Leu Asp Gln His Leu

805 810 815

Leu Pro Glu Gly Leu Pro Ser Phe Ala Pro Asn Ala Ser Cys Ser Ala

820 825 830

Phe Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu Leu Val Phe Arg

835 840 845

Thr Asn Thr Ser Tyr Ser Arg Trp Asp Glu Ala Arg Lys Met Trp Gly

850 855 860

Gly Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln Ala Ala Thr Cys

865 870 875 880

Phe Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp Val

885 890 895

Val Ala Tyr Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val Thr

900 905 910

Leu Glu Ser Glu Leu Lys Asn Ile Leu Thr Pro Ala Glu Leu Glu Met

915 920 925

Leu Ala Arg Ser Gln His Arg Pro Val Arg Ala Ile His Ser Ile Ser

930 935 940

Gln Ile Ile Gln Ser Val Pro Met Ser Ser Val His Gln Met Gln Met

945 950 955 960

Ser Asn Asn Leu Thr Phe Phe His Asp Val Leu Gly Gly Cys Glu Arg

965 970 975

Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg

980 985 990

Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Gly Gln

995 1000 1005

Leu Gly Tyr Ala Val Val Pro Thr Cys Leu Gly Ile Ala Ala Val Leu

1010 1015 1020

Cys Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly Ile

1025 1030 1035 1040

Leu Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met Ala

1045 1050 1055

Thr Leu Lys Asp Asp Glu Asp Thr Lys Ile Val Leu Ala Glu Ala Gly

1060 1065 1070

Leu Leu Asn Leu Leu Pro Arg Pro Ala Ala Leu Ala Leu Glu Pro Ala

1075 1080 1085

Val Gln Tyr Ala Ala Ala Ser Asn Gly Asn Gly Asn Gly Ala Ser Thr

1090 1095 1100

Asn Gly Asn Gly Ala Ser Thr Asn Gly Asn Gly Ala Ser Thr Asn Gly

1105 1110 1115 1120

Asn Gly Asn Gly Lys Pro Ala Leu Val Thr Val Gly Ala Ser Ser Ala

1125 1130 1135

Ala Ala Met Lys Val Glu Ile Thr Pro Arg

1140 1145

<210> 61

<211> 705

<212> PRT

<213> Volvox carteri f. nagariensis

<400> 61

Met Gln Ser Gln Leu Gln Pro Arg Leu Gln Leu Gln Gly Thr Arg Leu

1 5 10 15

Asn Trp Leu Pro Gln Arg Ser Cys Val Gln Arg Arg Ser Leu Arg Val

20 25 30

Asp Ala Thr Ser Gly Ala Ala Pro Pro Pro Pro Ala Gly Lys Glu Leu

35 40 45

Ser Asn Asp Met Val Thr Arg Gln Tyr Arg Arg Thr Val Tyr Asp Phe

50 55 60

Ser Leu Trp Ala Lys His Arg Asp Val Asn Arg Tyr Leu Tyr Asn Leu

65 70 75 80

Lys Thr Ile Pro Gly Ser Arg Ile Ile Arg Thr Leu Gly Gln Pro Met

85 90 95

Gly Ile Val Leu Ala Trp Ala Ala Met Phe Gly Phe Tyr Glu Thr Cys

100 105 110

Leu Glu Ser Gly Val Leu Pro Ser Tyr Phe Pro Lys Leu Thr Leu Met

115 120 125

Ser Ala Glu Pro Gln Gly Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu

130 135 140

Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Phe Asp Glu Ala Arg Lys

145 150 155 160

Ile Trp Gly Gly Ile Leu Asn Arg Ala Arg Asn Ile Ala Asn Gln Ala

165 170 175

Val Thr Phe Ile Pro Ala Glu Asp Val Ala Gly Arg Glu Ala Val Gly

180 185 190

Lys Trp Ala Val Gly Phe Cys Arg Ala Leu Gln Ala His Leu Gln Glu

195 200 205

Asp Ala Asn Leu Arg Glu Glu Leu Gln Lys Ala Gln Pro Arg Trp Ser

210 215 220

Arg Glu Glu Ile Asp Met Leu Cys Ser Ala Gln His Ser Trp Gln Gln

225 230 235 240

Leu Gln Ser Cys Val Asn Ala Phe Trp Pro Ile Lys Ala Ile Ser Met

245 250 255

Leu Ser Glu Leu Thr Arg Gln Leu Pro Ile Ser Gln Phe Gln Ala Leu

260 265 270

Gln Met Gln Glu Asn Val Thr Phe Phe Tyr Asp Ala Leu Gly Gly Cys

275 280 285

Glu Arg Leu Leu Arg Thr Pro Ile Pro Val Ser Tyr Thr Arg Ile Leu

290 295 300

Pro Leu Asp Ala Ile Cys Thr Arg Ala Gln Thr Asp Val Val Ser Leu

305 310 315 320

Leu Lys Asp Asp Pro Ala Val Val Lys Tyr Ile Ser Asp Val Arg Gln

325 330 335

Gly Arg Ile Ala Pro Pro Thr Glu Pro Pro Val Ala Gly Ala Ala Pro

340 345 350

Val Ala Ala Ala Pro Pro Pro Pro Pro Pro Ala Ser Ala Gly Gly Gly

355 360 365

Ile Ser Arg Ser Gly Ser Pro Thr Ala Gln Gln Gln Pro Asp Val Met

370 375 380

Lys Thr Val Thr Ser Met Leu His Asn Val Lys Ala Gly Ile Gly Ala

385 390 395 400

Val Ala Pro Ala Pro Pro Arg Pro Pro Ser Pro Gln Pro Arg Ala Arg

405 410 415

Ser Pro Arg Ala Ala Ser Pro Gly Gly Pro Ser Pro Phe Pro Arg Ala

420 425 430

Ser Ala Gly Thr Gly Gly Ala Ala Ala Ala Val Pro Ser Pro Pro Pro

435 440 445

Ile Lys Pro Leu Thr Ser Ser Ser Ser Ser Ser Ser Gly Ala Val Ser

450 455 460

Lys Asp Ser Asn Asn Ser Thr Ala Thr Ala Lys Lys Pro Ala Ser Ala

465 470 475 480

Pro Ala Ala Ser Ser Ala Gly Phe Ser Met Gly Phe Ser Gly Leu Ala

485 490 495

Asp Gly Ala Ala Ala Ala Ala Lys Ser Ala Ser Ala Ala Ala Ala Lys

500 505 510

Phe Ser Lys Ile Ala Asp Ser Val Val Ala Gly Thr Pro Ala Ala Pro

515 520 525

Ala Ser Glu Ala Lys Arg Glu Thr Ala Ala Ala Ala Ala Met Gln Ala

530 535 540

Gln Pro Arg Asn Thr Pro Ser Ser Ser Ser Ser Thr Pro Ser Ala Ala

545 550 555 560

Pro Ala Asn Gly Ser Ser Asp Asp Asp Arg Ser Ser Ser Gly Arg Arg

565 570 575

Thr Ala Ala Ala Val Asn Trp Arg Glu Glu Leu Ala Ala Leu Arg Ala

580 585 590

Gly Arg Glu Asp Ala Glu Glu Pro Ala Ser Ala Ser Ala Ser Tyr Asp

595 600 605

Arg Glu Phe Pro Ser Ser Ser Trp Ser Phe Ser Ser Ala Ser Ser Ala

610 615 620

Ala Val Val Gln Ser Gly Asp Ala Glu Asp Glu Ala Arg Arg Arg Phe

625 630 635 640

Gly Gly Leu Ala Gly Arg Gly Ala Arg Ser Asp Thr Thr Thr Ser Ala

645 650 655

Ala Ala Val Met Arg Gly Asn Gly Asn Gly Leu Ser Glu Asn Gly Tyr

660 665 670

Gly Asn Gly Tyr Gly Asn Asp Asn Gly Asn Gly Asn Gly Asn Thr Val

675 680 685

Glu Ala Arg Gly Ala Arg Pro Arg Thr Arg Pro Asp Trp Arg Asn Gln

690 695 700

Leu

705

<210> 62

<211> 403

<212> PRT

<213> Volvox carteri f. nagariensis

<400> 62

Met Ser Ser Ser Met Met Val Cys Gly Arg Gln Gln Arg Leu Ser Met

1 5 10 15

Pro Arg Gly Leu Gly Ser Ala Leu Pro Gly Ser Arg Leu Cys Arg Ser

20 25 30

Arg Leu Ile Ile Val Ala Ser Ala Ala Lys Asp Pro Asn Ala Pro Ile

35 40 45

Gln Ser Asn Pro Leu Gly Ala Leu Ser Ser Gln Ala Gly Thr Val Thr

50 55 60

Pro Leu Pro Arg Ser Glu Glu Ala Arg Lys Tyr Phe Arg Thr Val Tyr

65 70 75 80

Asp Phe Pro Gln Trp Gln Thr His Arg Ser Gln Phe Arg Leu Met Lys

85 90 95

Arg Leu Phe Thr Ile Pro Gln Ser His Val Ile Gln Asn Ala Leu Pro

100 105 110

Ser Ile Leu Trp Val Gly Ile Val Ser Ser Ala Leu Ala Ala Tyr Met

115 120 125

Thr Ala His Asp Gln His Ile Leu Pro Glu Gly Phe Pro Ser Leu Ser

130 135 140

Pro Asn Ala Ser Cys Ser Ala Phe Ile Ser Asn Thr Ser Val Ala Leu

145 150 155 160

Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp

165 170 175

Glu Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile

180 185 190

Met Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu Ala Lys

195 200 205

Lys Ala Leu Ala Arg Trp Val Val Ala Phe Ala Arg Ala Leu Arg Ile

210 215 220

His Phe Gln Pro Glu Val Ser Ile Glu Ser Glu Leu Lys Asn Ile Leu

225 230 235 240

Thr Pro Ala Glu Leu Glu Met Leu Ala Lys Ser Gln His Arg Pro Val

245 250 255

Arg Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro Met Ser

260 265 270

Ser Ile His Gln Met Gln Met Ser Asn Asn Leu Thr Phe Phe His Asp

275 280 285

Val Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro Val Ser

290 295 300

Tyr Thr Arg His Thr Ala Arg Phe Leu Phe Met Trp Leu Thr Leu Leu

305 310 315 320

Pro Phe Ala Leu Tyr Gly Gln Cys Gly Leu Gly Val Val Pro Val Cys

325 330 335

Thr Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly Val Gln

340 345 350

Cys Glu Glu Pro Phe Gly Ile Leu Pro Leu Glu Val Ile Cys Asn Arg

355 360 365

Ile Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys

370 375 380

Thr Val Leu Ala Glu Ala Gly Leu Glu Arg Pro Gln Pro Gln Pro Gln

385 390 395 400

Arg Gly Glu

<210> 63

<211> 446

<212> PRT

<213> Volvox carteri f. nagariensis

<400> 63

Met Gln Ile Gly Thr Pro Met Arg Ala Ala Ala Ser Gln Arg Pro Leu

1 5 10 15

Gly Leu Arg Tyr Ser Cys Leu Pro Arg Lys Leu Ile Arg Val Val Ala

20 25 30

Asn Ala Ala Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly

35 40 45

Thr Leu Ser Ser Gln Ser Gly Thr Val Asn Pro Leu Pro Arg Ser Glu

50 55 60

Glu Ala Arg Arg Tyr Trp Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln

65 70 75 80

Lys His Arg Ser Pro Tyr Arg Phe Met Glu Arg Leu Phe Gln Leu Ser

85 90 95

Gln Ser His Ile Leu Gln Asn Ala Leu Pro Ala Ile Ser Trp Val Thr

100 105 110

Leu Val Ala Thr Met Val Ala Ala Tyr Gly Thr Ser Tyr Asp Gln His

115 120 125

Leu Leu Pro Asp Gly Phe Pro Ser Ile Ser Pro Asn Ala Ser Cys Ser

130 135 140

Ala Phe Val Ser Asn Thr Ser Val Ala Leu Ser Leu Leu Leu Val Phe

145 150 155 160

Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp

165 170 175

Gly Gly Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln Gly Ala Thr

180 185 190

Cys Phe Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp

195 200 205

Val Val Ala Phe Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val

210 215 220

Thr Ile Glu Ser Glu Leu Lys Asn Ile Leu Thr Pro Ala Glu Leu Glu

225 230 235 240

Met Leu Ala Lys Ser Gln His Arg Pro Val Arg Ala Ile His Ala Ile

245 250 255

Ser Gln Ile Ile Gln Ser Val Pro Met Ser Ser Ile His Gln Met Gln

260 265 270

Met Ser Asn Asn Leu Thr Phe Phe His Asp Val Leu Gly Gly Cys Glu

275 280 285

Arg Leu Leu Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala

290 295 300

Arg Phe Leu Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Pro

305 310 315 320

Ser Ala Gly Trp Gly Val Val Pro Val Cys Thr Gly Ile Ala Ala Val

325 330 335

Leu Cys Gly Ile Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly

340 345 350

Ile Leu Pro Leu Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met

355 360 365

Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr Val Leu Ala Glu Ala

370 375 380

Gly Leu Ala Ala Thr Gly Ala Ala Val Ala Ala Pro Arg Trp Leu Met

385 390 395 400

Arg Arg Ala Pro Arg Ser Gly Trp Glu Glu Gly Ala Arg Glu Leu Val

405 410 415

Val Cys Arg Arg Ala Arg Ile Thr Ser Ser Ser Ser Asp Ser Glu Cys

420 425 430

Glu Val Val Ala Ser Pro Cys Val Arg Phe Leu Ile Glu Pro

435 440 445

<210> 64

<211> 398

<212> PRT

<213> Volvox carteri f. nagariensis

<400> 64

Met Gln Ala Asp Leu Ala Gly Phe His Ala Arg Pro Thr Phe Lys Arg

1 5 10 15

Thr Arg Asn Asn Cys Leu Arg His Ala His Arg Lys Pro Pro Phe Ala

20 25 30

Arg Pro Val Ala Phe Gly Ser Pro Ile Gln Pro Leu Asp Arg Ser Ser

35 40 45

Leu Trp Thr Ser Ser Ala Leu Trp Thr Val Glu Ser Val Leu Val Asn

50 55 60

Leu Arg Arg Lys Arg Phe Glu Pro Lys Thr Val Glu Arg Val Tyr Glu

65 70 75 80

Ala Asp Val Tyr Pro Ala Val Phe Asp Phe Ala Ser Trp Thr Gln His

85 90 95

Arg Ser Arg Gly Arg Tyr Leu Glu His Cys Ile Thr Leu Phe Arg Ser

100 105 110

Tyr Phe Phe Arg Asp Leu Leu Gly Pro Leu Leu Val Leu Val Gly Ala

115 120 125

Ala Met Thr Val Ala Ser Tyr Glu Thr Ala Leu Gln Thr Gly Leu Leu

130 135 140

Pro Arg Trp Leu Pro Asp Phe Gly Gly Ser Ser Asp Thr Pro Phe Gln

145 150 155 160

Leu Thr Ser Phe Ala Leu Ser Leu Met Leu Val Phe Arg Thr Asn Ser

165 170 175

Ser Tyr Ala Arg Trp Leu Asp Ala Arg Gln Gln Trp Gly Leu Ile Val

180 185 190

Asn Thr Ala Arg Thr Phe Val Arg Gln Val Met Thr Thr Leu Pro Glu

195 200 205

Thr Ser Cys Cys Glu Val Arg Ser Ala Leu Ala Arg Trp Thr Val Ala

210 215 220

Phe Val Arg Leu Gly Lys Leu His Leu Arg Glu His Gly Asp Val Gly

225 230 235 240

Ala Glu Val Gln Gly Leu Leu Asp Gly Glu Glu Val Pro Leu Val Leu

245 250 255

Ala Ala Ser His Arg Pro Leu Ala Ala Cys His Val Met Ser Gly Leu

260 265 270

Leu Arg Ser Ala Glu Gly Ser Gly Gln Leu Ser Glu Gln Ala Arg Met

275 280 285

Arg Leu Glu Ala Asp Ile Asn Leu Met Ser Gln Ala Leu Gly Ala Cys

290 295 300

Glu Lys Ile Leu Arg Asn Pro Ile Pro Leu Ser Tyr Thr Arg His Thr

305 310 315 320

Ser Arg Phe Leu Ile Leu Trp Leu Leu Trp Leu Pro Leu Ala Leu Trp

325 330 335

Gly Lys Val Gly Trp Cys Val Val Pro Val Glu Ala Val Met Thr Tyr

340 345 350

Leu Leu Leu Gly Ile Asp Glu Ile Ala Val Gln Met Glu Glu Pro Phe

355 360 365

Gly Gly Ser Gly Leu Gly Gly Ala Gly Arg Ser Ala Ala Ser Cys Arg

370 375 380

Trp Lys Thr Cys Val Arg Leu Tyr Asn Asn Pro Trp Ser Asn

385 390 395

<210> 65

<211> 389

<212> PRT

<213> Volvox carteri f. nagariensis

<400> 65

Met Ser Thr Asp Phe Val Ala Tyr Ser Val Cys Thr Ser Ala Leu Val

1 5 10 15

Cys Val Thr Phe Thr Phe Asp Asp Trp Lys Arg His Arg Ser Ser Asn

20 25 30

Arg Tyr Leu Tyr His Leu Lys Thr Leu Ser Glu Ser Gly Ile Val Arg

35 40 45

Gly Ile Ala Ala Pro Val Leu Phe Val Thr Ala Phe Thr Ala Gly Met

50 55 60

Thr Leu Leu Tyr Val Val Ala Ala Leu Asn Val Ala His Ala Ala Arg

65 70 75 80

Met Leu Pro Ala Trp Leu Pro Pro Leu Pro Asn Ile Ala Ile Glu Pro

85 90 95

Ile Gln Leu Thr Ser Ile Ala Leu Ser Leu Leu Leu His Met Leu Thr

100 105 110

Gly Val Arg His Glu Ser Ser Glu Thr Pro Pro Lys Pro Arg His Pro

115 120 125

Arg Leu Leu Thr Cys Arg Arg Phe Pro Cys Ala Pro Leu Ser Leu Pro

130 135 140

Val Leu Phe Tyr Asp Met Glu Lys Val Phe Arg Thr Asn Ala Ser Tyr

145 150 155 160

Ser Arg Trp Asp Glu Gly Arg Arg Ser Phe Gly Ser Ile Thr Thr Val

165 170 175

Ser Arg Asp Ile Ala Arg Gln Ala Phe Ala Trp Phe Arg Thr Asp Asp

180 185 190

Met Thr Asn Arg Ser Arg Leu Gly Arg Trp Leu Val Ala Leu Gly Arg

195 200 205

Val Thr Met Val His Leu Arg Glu Glu His Gly Met Gln Glu Glu Leu

210 215 220

Lys Gly Val Leu Lys Pro Gln Glu Ile Asp Ala Val Thr Ser Ser Ile

225 230 235 240

His Ala Pro Ser Phe Cys Leu Gln Met Ile Thr Trp Thr Ile Arg Thr

245 250 255

Ala Gly Leu Pro Gln Glu Leu Val Ile Arg Met Asp Glu Asn Val Ser

260 265 270

Arg Leu Thr Asp Ala Val Ser Ala Cys Glu Arg Ile Leu Asn Thr Pro

275 280 285

Ile Pro Leu Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Met Ala Trp

290 295 300

Leu Val Cys Leu Pro Phe Cys Leu Trp Ser Tyr Cys Gly Leu Ala Met

305 310 315 320

Val Pro Ile Ala Ala Leu Val Ala Phe Val Leu Leu Gly Ile Glu Glu

325 330 335

Ile Gly Val Tyr Ile Glu Glu Pro Phe Ser Ile Leu Ala Leu Glu Lys

340 345 350

Leu Val Asn Lys Leu Glu Asn Ile Val Asn Ala Met Leu Arg Glu Ser

355 360 365

Gln Trp Gln Thr Gln Ser Phe Ala Leu His Ile Leu Phe Val Gly Pro

370 375 380

Phe Pro Val Ser Val

385

<210> 66

<211> 929

<212> PRT

<213> Micractinium conductrix

<400> 66

Met Gln Arg Val Leu Ala Ala Ser Gly Ser Thr Thr His Met Ala Ala

1 5 10 15

Arg Pro Gly Leu Ser Gly Ser Ser Arg Ala Arg Ala Ala Thr Ala Ala

20 25 30

Ala Thr Ala Arg Leu Thr Pro Ala Gly Arg Gly Asn Ala Leu Arg Leu

35 40 45

Ala Met Pro Gln His Ala Gly Ala Ala Ala Ala Gly Pro Arg Thr Arg

50 55 60

Ala Pro Val Arg Val Ser Ala Ala Ala Asp Pro Ala Val Lys Leu Thr

65 70 75 80

Gly Asp Asp Leu Lys Glu Ala Asn Arg Lys Gln Met Arg Thr Val Phe

85 90 95

Asp Phe Glu Leu Trp Arg Lys His Arg Ser Ser Ala Arg Tyr Trp Arg

100 105 110

His Ile Thr Gly Ile Phe Glu Ser Arg Ile Val Ser Gly Leu Ala Ala

115 120 125

Pro Leu Gly Tyr Val Ala Ala Leu Ser Thr Thr Val Ala Leu Tyr His

130 135 140

Val Leu Ala Glu Ala Gly Tyr Ile Met Asp Val Pro Asp Leu Lys Leu

145 150 155 160

Ala Ser Asn Ala Pro Phe Gly Leu Thr Ser Phe Ala Leu Ser Leu Leu

165 170 175

Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg

180 185 190

Lys Met Trp Gly Leu Ile Val Asn Arg Ser Arg Asp Phe Val Arg Gln

195 200 205

Gly Leu Gly Tyr Ile Pro Asp Ser Gln Pro Glu Leu Gln Asn Met Leu

210 215 220

Cys Arg Trp Thr Val Ala Tyr Ser Arg Ser Leu Met Cys His Leu Arg

225 230 235 240

Pro Gly Glu Asn Leu Glu Glu Glu Leu Lys Glu Thr Leu Pro Ala His

245 250 255

Glu Leu Lys Ala Leu Leu Ser Ser Thr His Arg Pro Asn Tyr Val Val

260 265 270

Gln Val Leu Thr Ala Val Leu Lys Glu Ala Gln Leu Pro Thr Ala Val

275 280 285

Thr Ser Ser Arg Asp Ser Thr Ala Val Val Pro Ala Gly Ala Ala Tyr

290 295 300

Arg Met Asp Glu Asn Leu Thr Val Phe Ala Asp Val Thr Gly Gly Cys

305 310 315 320

Glu Arg Ile Leu Arg Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr

325 330 335

Ser Arg Phe Met Met Ile Trp Leu Thr Leu Leu Pro Phe Thr Leu Trp

340 345 350

Asp Ser Cys Arg Trp Ala Met Val Pro Ile Ser Leu Ile Val Ser Phe

355 360 365

Leu Leu Leu Gly Ile Glu Glu Ile Gly Val Ser Ile Glu Glu Pro Phe

370 375 380

Thr Ile Leu Pro Leu Glu Val Ile Ser Arg Thr Ile Glu Gly Asn Val

385 390 395 400

Lys Glu Leu Gln Lys Met His Ser Ser Glu Gly Lys Ala Val Met Gly

405 410 415

Ala Ser Ala Glu Gly Asp Asn Leu Ser Ala Gln Ala Leu Val Asp Ala

420 425 430

Val Leu Pro Ala Ile Ser Gly Asn Gly Asn Gly Gly Ala Leu Ser Ala

435 440 445

Ala Gly Ser Ser Ser Gly Ser Ser Arg Ile Val Ile Lys Pro Ala Met

450 455 460

Ala Met Gln Gln Arg Ala Ser Ala Ala Pro Lys Arg Ser Ala Ala Thr

465 470 475 480

Gly Ala Arg Ala Leu Val Ala His Pro Ala Ala Cys Arg Cys Ala Ala

485 490 495

His Arg Arg Gly Arg Ser Leu Val Val Arg Ala Ala Ser Asp Asn Val

500 505 510

Met Glu Val Gly Gly Arg Thr Ile Val Val Glu Asp Asp Gly Thr Ile

515 520 525

Ile Ile Ser Gln Pro Ala Ala Ser Ala Ala Val Asp Val Lys Glu Ser

530 535 540

Ala Glu Val Glu Tyr Leu Thr Ala Arg Ser Ala Ile Val Asn Lys His

545 550 555 560

Phe Glu Gly Ser Leu Gly Ala Asp Asp Phe Ile Gln Arg Val Glu Met

565 570 575

Ala Leu Tyr Ala Phe Gly Phe Thr Gly Glu Asn Ser Ile Ala Met Val

580 585 590

Asn Leu Cys Arg Asp Glu Val Thr Val Thr Leu Lys Gln Lys Ile Asp

595 600 605

Ala Val Phe Gly Ala Ser Phe Ser Thr Asn Gly Leu Gly Gly Val Leu

610 615 620

Thr Cys Gly Ala Val Gly Met Gly Ala Gly Phe Ser His Ser Pro Ile

625 630 635 640

Cys Asp Thr Thr Gly Lys Glu Arg Tyr Ile Phe Phe Ser Phe Pro His

645 650 655

Ile Ser Ile Asn Ser Lys Gly Glu Val Gly Pro Met Ser Arg Pro Gly

660 665 670

Arg Pro Gly Gln Ser Cys Ala Cys Gly Ala Leu Ile Lys Ser Trp Thr

675 680 685

Glu Leu Arg Ser Glu Gly Val Ser Cys Asn Cys Lys Ile Pro Gly Val

690 695 700

His Asp Ala Glu Asn Pro Glu Tyr Ser Ile Leu Lys Gln Arg Ile Ala

705 710 715 720

Arg Arg Leu Arg His Glu Gly Glu Thr Asp Glu Ser Val Gln Gln Leu

725 730 735

Ser Leu Val Asp Ile Thr Lys Val Ala Glu Arg Thr Ile Ser Asp Asp

740 745 750

Leu Glu Tyr Leu Ile Ser Lys Thr Val Asp Thr Asn Lys Ala Asp Tyr

755 760 765

Ala Val Ile Thr Gly Val Gln Val His Asn Trp Ala Phe Asp Phe Glu

770 775 780

Asp Asp Ser Pro Asn Leu Glu Phe Val Phe Pro Thr Ser Ala Tyr Val

785 790 795 800

Val Val Asp Gly Val Lys Thr His Val Asp Leu Ala Ala Met Pro Pro

805 810 815

Leu Thr Pro Arg Gln Ile Arg Leu Val His Gly Gly Asp Gln Gly Val

820 825 830

Val Cys Asn Thr Gly Gly Gln Ser Thr Leu Arg Ala Glu Asp Pro Pro

835 840 845

Tyr Ala Tyr Asp Ser Lys Asp Ala Arg Lys Val Gln Arg Thr Arg Leu

850 855 860

Gln Asn Tyr Ile Ser Leu Ile Lys Asp Glu Gly Leu Glu Ser Val Ala

865 870 875 880

Ala Ala Pro Ser Ser Pro Ala Trp Ala Lys Gln Ile Thr Lys Ser Val

885 890 895

Ala Asp Arg Thr Asn Ser Thr Ala Leu Asp Met Lys Phe Ala Gln Asn

900 905 910

Glu Asp Leu Lys Glu Met Gln Ala Gln Leu Glu Ala Lys Tyr Gln Ser

915 920 925

Leu

<210> 67

<211> 250

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 67

Met Thr Arg Trp Arg Pro Arg Arg Pro Trp Pro Ala Gly Leu Val Ala

1 5 10 15

Phe Ala Arg Ala Leu Arg Ile His Phe Gln Pro Glu Val Thr Ile Glu

20 25 30

Ser Glu Leu Lys Asn Ile Leu Thr Pro Ala Glu Leu Gln Met Leu Ala

35 40 45

Lys Ser Gln His Arg Pro Val Arg Ala Ile His Ala Ile Ser Gln Ile

50 55 60

Ile Gln Ser Val Pro Met Ser Ser Ile His Gln Gln Gln Met Ser Asn

65 70 75 80

Asn Leu Thr Phe Phe His Asp Val Leu Gly Gly Cys Glu Arg Leu Leu

85 90 95

Arg Ala Pro Ile Pro Val Ser Tyr Thr Arg His Thr Ala Arg Phe Leu

100 105 110

Phe Ala Trp Leu Thr Leu Leu Pro Phe Ala Leu Tyr Gly Ser Cys Gly

115 120 125

Val Ser Val Ile Pro Val Cys Ser Gly Ile Ala Ala Val Leu Cys Gly

130 135 140

Ile Glu Glu Ile Gly Val Gln Cys Glu Glu Pro Phe Gly Ile Leu Pro

145 150 155 160

Leu Asp Val Ile Cys Asn Arg Ile Gln Ala Asp Val Met Ala Thr Leu

165 170 175

Lys Asp Asp Ala Asp Thr Lys Thr Ile Leu Ala Glu Ala Gly Leu Ile

180 185 190

Ser Leu Arg Ala Asn Ser Ala Met Ala Val Glu Asn Ala Leu Pro Asp

195 200 205

Leu Asp Ser Ile Asn Ala Ala Ala Pro Asn Gly Asn Gly Ser His Asn

210 215 220

Gly Asn Gly Ala Ala Val Pro Val Ser Val Ser Ala Gly Ala Ser Gly

225 230 235 240

Asn Gly Met Asn Val Arg Ile Ser Pro Arg

245 250

<210> 68

<211> 883

<212> PRT

<213> Micractinium conductrix

<400> 68

Met Arg Arg Arg Ala Leu Ala Ala Ala Ala Ala Ala Gly Ser Thr Ala

1 5 10 15

Pro Pro Pro His Arg Leu Gly Asp Asp Gly Ala Gly Asn Ala Ala Pro

20 25 30

Pro Pro Leu Asp Pro Ser Met Pro Leu Pro Leu Pro Trp Gln Ala Tyr

35 40 45

Phe Asp Gly Arg His Ala Ala Ser Cys Pro Gly Arg Gly Ala Thr Phe

50 55 60

Asn Val Tyr Thr Ala Gly Ser Ala Gly Pro Val Val Leu Cys Leu His

65 70 75 80

Gly Gly Gly Tyr Thr Gly Leu Ser Trp Ser Leu Ile Ala Arg Ala Leu

85 90 95

Lys Asp Lys His Arg Val Val Ala Pro Asp Leu Arg Cys His Gly Leu

100 105 110

Thr Val Ala Glu Asp Glu Ala Asp Phe Ser Ala Asp Thr Leu Ala Gly

115 120 125

Asp Val Val Ala Leu Trp Arg Ala Leu Phe Ala Gly Gly Gly Ala Ala

130 135 140

Gly Ser Asp Gly Ser Thr Gly Ser Gly Gly Gly Gly Gly Gly Ser Ser

145 150 155 160

Glu Ala Asp Val Gln Gln His Leu Gln Arg Leu Arg Gln Gly Pro Pro

165 170 175

Pro Pro Thr Val Leu Val Gly His Ser Met Gly Gly Ala Ile Ala Val

180 185 190

His Ala Ala Ala Leu Gly Gly Ile Thr Ser Leu Ala Gly Ile Val Val

195 200 205

Ile Asp Val Val Glu Gly Thr Ala Leu Ala Ser Leu Pro Tyr Met Ala

210 215 220

Gly Val Leu Glu Lys Arg Pro Arg Arg Phe Ala Ser Leu Gln Gln Ala

225 230 235 240

Val Asp Trp Ala Val Asp Ser Gly Met Cys Lys Arg Gln Glu Ala Ala

245 250 255

His Val Ser Leu Pro Ala Met Leu Arg Arg Glu Pro Pro Gly Gly Pro

260 265 270

Thr Gly Gly Gly Ala Glu Ala Ala Gly Gly Val Val Arg Leu Val Pro

275 280 285

Gly Gly Leu Ala Pro Leu Ala Glu Glu Gly Glu Glu Glu Glu Asp Gly

290 295 300

Ala Glu Ala Ala Ala Ala Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln

305 310 315 320

Gln Gln Gln Gln Val Gln Gln Pro Ala Ala Gly Thr Gln Gln Ala Ala

325 330 335

Pro Ser Gly Gly Gly Gly Gly Gly Gly Gly Trp Val Trp Arg Thr Pro

340 345 350

Leu Glu Arg Ser Ala Pro Phe Trp Glu Gly Trp Tyr Gln Gly Leu Ser

355 360 365

Asp Met Phe Leu Lys Leu Ser Val Pro Lys Val Leu Val Leu Val Gly

370 375 380

Thr Asp Arg Leu Asp Arg Pro Leu Thr Ile Gly Gln Met Gln Gly Arg

385 390 395 400

Phe Gln Pro Val Leu Leu Pro Gln Ala Gly His Ala Val His Glu Asp

405 410 415

Glu Pro Glu Ala Thr Ala Asp Ala Ile Ala Ala Phe Ile Lys Arg Phe

420 425 430

Arg Asn Gly Glu Pro Pro Leu Gln Ile Pro Arg Pro Thr Pro Gly Leu

435 440 445

Arg Pro Val Leu Pro Val Ala Met Gly Pro Ala Asp Ser Leu Arg Val

450 455 460

Gln Ser Lys Pro Asp Arg Ser Ile Asp Arg Ala Ser Ser Ser Asp Lys

465 470 475 480

Val Val Ser Phe Pro Ala Leu Asp Ser Ile Glu Arg Tyr Tyr Glu Pro

485 490 495

Val Lys Glu Asp Ala Arg Gln Tyr Arg Arg Thr Val Phe Asp Phe Glu

500 505 510

Lys Trp Arg Glu His Arg Ser Thr Lys Arg Tyr Ala Arg His Ile Lys

515 520 525

Ser Ile Lys Gly Ser Arg Met Val Arg Gly Leu Ala Ala Pro Leu Leu

530 535 540

Trp Leu Thr Ala Val Ala Ala Ala Val Ala Thr Phe Asn Thr Leu Val

545 550 555 560

Glu Ala Gly Leu Ala Pro Asp Val Leu Pro Glu Leu Lys Phe Ser Asn

565 570 575

Asn Gly Pro Phe Gly Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val

580 585 590

Phe Arg Thr Asn Ala Ser Tyr Ala Arg Trp Leu Asp Ala Arg Lys Asn

595 600 605

Trp Gly Thr Leu Thr Asn Arg Ser Arg Asp Leu Thr Arg Gln Ala Leu

610 615 620

Thr Phe Phe Pro Ala Glu Asp Pro Ala Leu Phe His Leu Leu Cys Arg

625 630 635 640

Trp Val Gln Ala Tyr Ser Arg Ser Leu Met Cys His Leu Arg Asp Asp

645 650 655

Val Ser Ile Glu Glu Glu Leu Pro Lys Ala Leu Leu Pro Tyr Glu Val

660 665 670

Glu Ala Val Leu Ala Ser Arg His Arg Pro Leu Tyr Cys Leu Gln Met

675 680 685

Leu Ser Glu Ile Val Arg Ala Ala His Val Pro Pro Ala Gly Gln Pro

690 695 700

Pro Ala Gly Ala Ala Ala Ala Ala Val Ala Ala Ala Ala Asp Pro Phe

705 710 715 720

Ala Gly Ala Ala Leu Ala Ala Ala Leu Arg Ala Ala Ala Ala Gln Arg

725 730 735

Met Asp Glu Asn Leu Ser Ile Phe Glu Asp Val Cys Gly Thr Cys Glu

740 745 750

Arg Ile Leu Arg Ala Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser

755 760 765

Arg Phe Met Thr Ile Tyr Leu Ser Leu Leu Pro Phe Thr Leu Trp Asp

770 775 780

Ser Ala Gly Trp Ala Met Val Pro Leu Ile Ala Ile Val Ala Phe Leu

785 790 795 800

Leu Leu Gly Ile Glu Glu Ile Gly Val Ser Ile Glu Glu Pro Phe Ser

805 810 815

Ile Leu Pro Leu Glu Gln Met Cys Asp Thr Ile Gln Ala Ser Val Val

820 825 830

Glu Leu Arg Ala Ile Asn Ser Gln Gln His Glu Gly Ser Ser Gly Asp

835 840 845

Gly Gly Asn Gly Asn Gly Val Ala Ala Ala Pro Arg Gln Pro Pro Ser

850 855 860

Ala Arg Ala Leu Leu Arg Arg Gly Val Ala Glu Ala Ala Ala Ala Asp

865 870 875 880

Ala Leu Ala

<210> 69

<211> 2445

<212> PRT

<213> Chlorella

<400> 69

Met Gly Gly His Gly Phe Ile Glu Gly Phe Leu Lys Ser Trp Gly Val

1 5 10 15

Ile Leu Ala Ser Glu Ile Gly Asp Lys Thr Phe Phe Ile Ala Ala Ile

20 25 30

Met Ala Met Arg His Ala Arg Leu Thr Val Phe Ala Gly Ala Met Ala

35 40 45

Ala Leu Ala Ala Met Thr Val Leu Ser Ala Ala Leu Gly Trp Ala Ala

50 55 60

Pro Asn Leu Ile Ser Lys Thr Tyr Thr His Tyr Ala Ala Thr Ala Leu

65 70 75 80

Phe Phe Phe Phe Gly Gly Arg Met Leu Tyr Glu Ala Val Thr Asn Ala

85 90 95

His Ala Gly Glu Asn Glu Leu Asp Glu Val Glu Lys Glu Leu Glu Ala

100 105 110

Val Asp Lys Ser Pro Lys Thr Gly Gly Pro Ala Ala Asn Gly Lys Asn

115 120 125

Pro Leu Leu Gly Thr Leu Arg Arg Phe Val Ser Pro Val Leu Leu Glu

130 135 140

Ala Phe Thr Leu Thr Phe Leu Ala Glu Trp Gly Asp Arg Ser Gln Ile

145 150 155 160

Ala Thr Ile Gly Leu Ala Ala Ala Ala Asp Val Phe Gly Val Thr Val

165 170 175

Gly Gly Ile Leu Gly His Ala Met Cys Thr Gly Ala Ala Val Leu Gly

180 185 190

Gly Lys His Leu Ala Glu His Ile Asp Glu Arg Lys Val Ala Tyr Phe

195 200 205

Gly Gly Val Leu Phe Leu Leu Phe Gly Ala His Ser Leu Tyr Thr Gly

210 215 220

Val Pro Glu Cys Gly Gly Glu Ala Lys Met Pro Ser Leu Ala Ala Thr

225 230 235 240

Glu Pro Val Asp Tyr Ala Val Leu Gly Ala Ala Gly Ala Ala Ala Leu

245 250 255

Ala Gly Leu Ala Ala Cys Leu Tyr Thr Val Pro Trp Arg Leu Cys Arg

260 265 270

Ala Ala Ala Pro Pro Ser Ala Pro Lys Ala Thr Arg Ser Phe Asn Val

275 280 285

Leu Trp His Gly Arg Ser Leu Leu Ala Leu Leu Leu Thr Ala Trp Ala

290 295 300

Leu Ser Pro Leu Leu Arg Val Ser Arg Leu Trp Gly Ala Asn Ser Phe

305 310 315 320

Val Phe Ser Asp Gly Val Thr Ser Trp Thr Gly Ser Gly Trp Met Cys

325 330 335

Arg Ile Tyr Leu Thr Ala Ala Leu Gly Val Leu Gln Pro Leu Cys Ala

340 345 350

Phe Leu Ala Leu Leu Met Leu Thr Ala Gly Leu Ser Arg Arg His Arg

355 360 365

Pro Glu Ala Leu Arg His Pro Asn Ala Arg Leu Leu Gly Leu Ala Ala

370 375 380

Leu Cys Thr Leu Pro Val Ala Ala Val Gln Val Val Val Ala Trp Leu

385 390 395 400

Ser Leu Ala Val Gln Tyr Gln Gly Gln Pro Leu Glu Gln Ala Pro Arg

405 410 415

Ser Val Leu Gly Tyr Phe Phe Ala Thr Tyr Trp Glu Gly Ser Pro Glu

420 425 430

Gln Cys Gly Thr Gln Ala Ala Ala Ala Ala Ala Val Val Pro Ala Ala

435 440 445

Ala Asn Asp Ala Ala Ala Leu Gln Thr Pro Gly Gly Ser Gly Ser Leu

450 455 460

Ser Leu Ser Ala Ala Gly Ser Pro Gly Asp Ala Ala Ala Ala Gly Ala

465 470 475 480

Ala Val Ala Pro Asp Gly Gly Cys Thr Leu Cys Cys Phe Pro Ala Ala

485 490 495

Ala Val Ala Val His Ala Ile Phe Thr Val Ala Phe Leu Ala Ala Leu

500 505 510

Trp Val Thr Cys Ser Arg Leu Ala Asp Ala Val Leu Asn Ser Arg Leu

515 520 525

Lys Arg Arg Met Arg Leu Phe Gln Leu Ala His Ser Leu Leu Ala Val

530 535 540

Gly Gly Val Ala Ala Leu Gly Val Ser Ile Val Gln Gly Pro Phe Thr

545 550 555 560

Trp Leu Asn Gln Ala Cys Trp Ala Ala Tyr Val Gly Thr Ala Val Ala

565 570 575

Thr Val Ala Leu Val Leu Trp Glu Val Val Val Ser Pro Val Arg Asp

580 585 590

Leu Arg Ser Val Asp Lys Arg Leu Ala Leu Trp Ala Asp Ala Thr Thr

595 600 605

Ala Ala Phe Ala Ala Ala Gly Ala Asp Glu Pro Pro Met Ser Thr Gln

610 615 620

Ser Ser Gly Gly Ser Ser Val Leu Ile Lys Ala His Asn Arg Ser Ala

625 630 635 640

Glu Ala Glu Ala Tyr Val Gln Ala Ala Ala Ala Ala Arg Thr Leu Ser

645 650 655

Ala Ser Pro Ala Gln Gly Gln Glu Lys Gly Gln Pro Ala Pro Pro Arg

660 665 670

Pro Ser Leu Gln Leu Ala Pro Leu Ala Leu Pro Pro Leu Pro Gln Gly

675 680 685

Thr Pro Arg Arg Ser Pro Ala Lys Gln Pro Thr Pro Leu Trp Arg Gln

690 695 700

Gln Ala Gln Pro Ser Leu Leu Arg Gln Gln Tyr Gly Thr Ala Pro Ser

705 710 715 720

Pro Leu Val Ser Pro Pro Arg Gln Pro Ala Arg Val Thr Val Ala Gly

725 730 735

Ala Ala Ala Asp Leu Pro Pro Pro Gly Pro Val Thr Ala Gly Leu Lys

740 745 750

Ala Ala Gln Arg Arg Gln Pro Gly Ser Leu Arg Gly Lys Gln Glu Asp

755 760 765

Val Trp Ser Leu Glu Asp Ala Ala Glu Met Gly Ala Ala Cys Ser Asn

770 775 780

Ser Glu Lys Glu Leu Gly Arg Arg Tyr Met Arg Ser Leu Ser Thr Phe

785 790 795 800

Asn Phe Gln Arg Trp Ala Phe His Arg Ser Thr Asp Arg Tyr Ala Arg

805 810 815

His Met Leu Gly Ile Phe Gln Ser Arg Ile Val Arg Gly Leu Ala Ala

820 825 830

Pro Leu Leu Ser Ala Gly Ala Thr Ala Thr Leu Val Cys Leu Tyr Glu

835 840 845

Gln Ala Leu Gln Gln Gly Ala Leu Pro Ala Gln Leu Pro Ser Leu Val

850 855 860

Ile Ser Pro Leu Pro Leu Asp Leu Thr Ser Ala Ala Leu Gly Leu Leu

865 870 875 880

Leu Val Phe Arg Thr Asn Ser Ser Tyr Glu Arg Trp Gln Gln Ala Leu

885 890 895

Ala Ala Trp Gly Ala Ile Thr Thr Arg Ser Arg Asp Thr Met Arg Gln

900 905 910

Leu Leu Cys Tyr Thr Ala Ala Thr Pro Glu Ala Gly Pro Ala Ser Thr

915 920 925

Lys Leu Leu Thr Val Ala Ala Thr Gly Arg Trp Leu Val Ala Phe Ala

930 935 940

Arg Ala Leu Lys Ala Gln Leu Thr Glu Asp Ser Asp Leu Arg Ala Glu

945 950 955 960

Leu Glu Gly Ile Leu Thr Pro Thr Glu Leu Asp Leu Leu Cys Thr Ser

965 970 975

Tyr Gln Pro Ser Ser Phe Thr Leu Ser Val Leu Thr Glu Leu Val Ala

980 985 990

Ala Ala Pro Leu Arg Asp Ser Gln Arg Ile Arg Val Asp Glu Asn Leu

995 1000 1005

Thr Ala Cys Glu Asp Ala Met Ser Ala Cys Glu Arg Ile Leu Arg Thr

1010 1015 1020

Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Met Val Ile

1025 1030 1035 1040

Trp Leu Ser Cys Leu Pro Leu Gly Leu Trp Pro Ala Val Gly Trp Gly

1045 1050 1055

Thr Val Pro Leu Thr Val Ala Ile Ala Phe Leu Leu Leu Gly Ile Glu

1060 1065 1070

Glu Ile Gly Val Ala Val Glu Glu Pro Phe Ser Ile Leu Pro Leu Asp

1075 1080 1085

Glu Leu Cys Arg Glu Ile Glu Ile Ser Leu Ser Asp Ile Val Glu Gln

1090 1095 1100

Ala Ser Ser Ser Lys Arg Ala Ala Lys Glu Ala Val Ser Ala Ala Ala

1105 1110 1115 1120

Ala Ala Ala Val Thr Ala Ala Ala Ala Glu Ala Ala Ala Ala Ala Ala

1125 1130 1135

Ala Ala Ala Ala Glu Ala Ala Asp Gly Ser Gly Ser Ser Thr Ser Ser

1140 1145 1150

Gly Asp Ser Thr Pro Leu Tyr Ala Ala Ala Ala Gln Ala Pro Ala Ala

1155 1160 1165

Ala Asn Ala Val Ala Pro Leu Leu Pro Gly Ala Leu Gly Arg Ala Ser

1170 1175 1180

Pro Leu Lys Met Ala Ala Lys Asp Leu Glu Ser Gly Asp Ala Ser Thr

1185 1190 1195 1200

Ser Ser Asp Gly Cys Arg Leu Glu Pro Ser Pro Lys Lys Gly Leu Lys

1205 1210 1215

Gln Ser Leu Ser Arg Ala Phe Leu Ser Ser Gly Leu Gln Val Thr Phe

1220 1225 1230

Lys Asp Ile Thr Tyr Thr Val Val Asn Ser Gln Asn Lys Lys Glu Lys

1235 1240 1245

Leu Asp Leu Leu Lys Gly Val Gly Gly Tyr Leu Gln Ala Gly Glu Met

1250 1255 1260

Ala Ala Leu Met Gly Pro Ser Gly Ser Gly Lys Ser Thr Leu Leu Asp

1265 1270 1275 1280

Val Leu Ser Gly Arg Lys Thr Val Gly Glu Leu Gln Gly Glu Val Ala

1285 1290 1295

Phe Ala Gly Asn Arg Pro Thr Pro Gln Phe Leu Arg Arg Phe Thr Gly

1300 1305 1310

Tyr Val Glu Gln Phe Asp Thr Leu Leu Asp Ile Leu Thr Val Glu Glu

1315 1320 1325

Met Leu Met Tyr Thr Ala Glu Leu Lys Arg Pro Val Ser Gln Thr Leu

1330 1335 1340

Glu Gln Lys Lys Gly Ala Val Asp Glu Leu Ile Glu Val Leu Gly Leu

1345 1350 1355 1360

Asp Gly Cys Arg Thr Val Arg Ile Gly Asn Pro Met Ala Arg Gly Ile

1365 1370 1375

Ser Gly Gly Gln Ala Lys Arg Val Asn Ile Gly Ile Ala Leu Val Thr

1380 1385 1390

Asn Pro Arg Val Leu Phe Leu Asp Glu Pro Thr Ser Gly Leu Asp Ser

1395 1400 1405

Tyr Thr Ala Asn Glu Val Met Ser Val Val Lys Ser Leu Ala Ser His

1410 1415 1420

Gly Ile Thr Val Cys Ala Thr Ile His Ser Pro Thr Pro Tyr Thr Phe

1425 1430 1435 1440

Asn Leu Phe Asp Arg Leu Leu Leu Leu Leu Lys Gly Arg Val Val Tyr

1445 1450 1455

Phe Gly Pro Asn Gly Lys Leu Ala Leu Asn Tyr Phe His Thr Gln Cys

1460 1465 1470

Pro Cys Leu Ala Gly Leu Lys Glu Gly Glu Asn Glu Ala Glu Trp Leu

1475 1480 1485

Val Asp Leu Thr Thr Gln Ala Asp Arg Gln Gly Arg Ala Ala Asp Phe

1490 1495 1500

Ala Asp Thr Tyr Glu Arg Ser Glu Phe Lys Ala Ala Ala Glu Lys Glu

1505 1510 1515 1520

Ile Ala Ala Gln Leu Ala Thr Ala Ser Asp Leu Asp Glu Ala Thr Lys

1525 1530 1535

Arg Asp Leu Ala Val Arg Arg Asp Thr Val Thr Pro Phe Trp Trp Gly

1540 1545 1550

Leu Arg Thr Leu Leu Lys Tyr Arg Thr Leu Lys Asn Tyr Arg Asn Pro

1555 1560 1565

Glu Tyr Leu Gly Pro Arg Ile Gly Asp Lys Leu Ile Phe Ser Leu Leu

1570 1575 1580

Ile Phe Thr Leu Phe Trp Lys Val Gly Asn Asn Leu Ala Gln Asp Asn

1585 1590 1595 1600

Leu Met Asn Ile Ala Ala Val Leu Phe Met Trp Thr Thr Leu Pro Ala

1605 1610 1615

Phe Gly Ala Ala Ser Tyr Val Pro Ala Ile Val Leu Glu Arg Pro Leu

1620 1625 1630

Phe Thr Arg Glu Arg Asn Asp Gly Leu Tyr Arg Val Ile Thr Tyr Leu

1635 1640 1645

Val Ala Lys Ile Ile Glu Glu Leu Gly Leu Ala Leu Leu Cys Ser Ile

1650 1655 1660

Val Phe Ala Asn Ile Val Trp Trp Ala Leu Gln Leu Gln Gly Ser Phe

1665 1670 1675 1680

Ala Leu Phe Trp Leu Ile Tyr Phe Leu Thr Leu Ser Thr Gly Ile Val

1685 1690 1695

Leu Ala Tyr Thr Val Ala Ala Leu Ser Pro Asn Met Asp Val Ala Asn

1700 1705 1710

Ala Ala Leu Pro Ala Tyr Val Val Thr Leu Leu Phe Phe Ala Gly Phe

1715 1720 1725

Leu Ile Arg Phe Asp Lys Ile Pro Asn Tyr Trp Lys Trp Tyr Ser Tyr

1730 1735 1740

Ile Asp Val Leu Arg Tyr Ala Trp Gly Ala Leu Met Lys Asn Gln Phe

1745 1750 1755 1760

Asn Gly Asp Arg Asn Val Glu Phe Val Ser Gly Gln Thr Ile Leu Asp

1765 1770 1775

Tyr Tyr Ser Leu Ser Gly Ile Asn Ala Trp Gly Trp Leu Gly Ile Glu

1780 1785 1790

Ala Ala Phe Val Ala Val Phe Phe Gly Phe Ala Tyr Leu Ala Leu Lys

1795 1800 1805

Tyr Ile Ser His Pro Leu Lys Met Thr Thr Lys Asp Leu Glu Ala Gly

1810 1815 1820

Asp Ala Ser Thr Gly Ser Asp Gly Cys His Leu Gly Leu Glu Ala Ser

1825 1830 1835 1840

Pro Lys Lys Gly Leu Lys Gln Ser Leu Ser Arg Ala Phe Leu Ser Ser

1845 1850 1855

Gly Leu Gln Val Thr Phe Lys Asp Ile Thr Tyr Thr Val Val Asn Ser

1860 1865 1870

Gln Asn Lys Lys Glu Lys Leu Asp Leu Leu Lys Gly Val Gly Gly Tyr

1875 1880 1885

Leu Gln Ala Gly Glu Met Ala Ala Leu Met Gly Pro Ser Gly Ser Gly

1890 1895 1900

Lys Ser Thr Leu Leu Asp Val Leu Ser Gly Arg Lys Thr Val Gly Glu

1905 1910 1915 1920

Leu Gln Gly Glu Val Ala Phe Ala Gly Asn Arg Pro Thr Pro Gln Phe

1925 1930 1935

Leu Arg Arg Phe Thr Gly Tyr Val Glu Gln Phe Asp Thr Leu Leu Asp

1940 1945 1950

Ile Leu Thr Val Glu Glu Met Leu Met Tyr Thr Ala Glu Leu Lys Arg

1955 1960 1965

Pro Val Glu Gln Ser Leu Glu His Lys Arg Ala Ala Val Asp Glu Leu

1970 1975 1980

Ile Glu Val Leu Ala Leu Glu Gly Cys Arg Thr Val Arg Ile Gly Asn

1985 1990 1995 2000

Pro Met Ala Arg Gly Ile Ser Gly Gly Gln Ala Lys Arg Val Asn Ile

2005 2010 2015

Gly Ile Ala Leu Val Thr Asn Pro Arg Val Leu Phe Leu Asp Glu Pro

2020 2025 2030

Thr Ser Gly Leu Asp Ser Tyr Thr Ala Asn Glu Val Met Ser Val Val

2035 2040 2045

Lys Ser Leu Ala Ser His Gly Ile Thr Val Cys Ala Thr Ile His Ser

2050 2055 2060

Pro Thr Pro Tyr Thr Phe Asn Leu Phe Asp Arg Leu Leu Leu Leu Leu

2065 2070 2075 2080

Lys Gly Arg Val Val Tyr Phe Gly Pro Asn Gly Lys Leu Ala Leu Asp

2085 2090 2095

Tyr Phe His Thr Gln Cys Pro Cys Leu Ala Gly Leu Lys Glu Gly Glu

2100 2105 2110

Asn Glu Ala Glu Trp Leu Val Asp Leu Thr Thr Gln Ala Asp Arg Gln

2115 2120 2125

Gly Arg Ala Ala Asp Phe Ala Asp Thr Tyr Glu Arg Ser Glu Phe Lys

2130 2135 2140

Ala Ala Ala Asp Lys Glu Val Ala Ala Gln Leu Ala Thr Ala Ser Asn

2145 2150 2155 2160

Leu Asp Glu Ala Thr Lys Arg Asp Leu Ala Val Arg Arg Asp Thr Val

2165 2170 2175

Thr Pro Phe Trp Trp Gly Leu Arg Thr Leu Leu Lys Tyr Arg Thr Leu

2180 2185 2190

Lys Asn Tyr Arg Asn Pro Glu Tyr Leu Gly Pro Arg Ile Gly Asp Lys

2195 2200 2205

Leu Ile Phe Ser Leu Leu Ile Phe Thr Leu Phe Trp Lys Val Gly Asn

2210 2215 2220

Asn Leu Ala Gln Asp Asn Leu Met Asn Ile Thr Ser Met Leu Phe Met

2225 2230 2235 2240

Trp Thr Val Leu Pro Ala Phe Gly Ala Ala Ser Tyr Val Pro Ala Ile

2245 2250 2255

Val Leu Glu Arg Pro Leu Phe Thr Arg Glu Arg Asn Asp Gly Leu Tyr

2260 2265 2270

Arg Val Ile Thr Tyr Leu Val Ala Lys Ile Val Glu Glu Leu Gly Leu

2275 2280 2285

Ala Leu Leu Cys Ser Ile Val Phe Ala Asn Ile Val Trp Trp Ala Leu

2290 2295 2300

Gln Leu Gln Gly Ser Phe Ala Leu Phe Trp Leu Ile Tyr Tyr Leu Thr

2305 2310 2315 2320

Leu Ser Thr Gly Ile Val Leu Ala Tyr Thr Val Ala Ala Leu Ser Pro

2325 2330 2335

Asn Met Asp Val Ala Asn Ala Ala Leu Pro Ala Tyr Val Val Thr Leu

2340 2345 2350

Leu Phe Phe Ala Gly Cys Leu Ile Arg Phe Val Asp Ile Pro Asn Tyr

2355 2360 2365

Trp Lys Trp Tyr Ala Tyr Ile Asp Val Leu Arg Tyr Ala Trp Gly Ala

2370 2375 2380

Leu Met Lys Asn Gln Phe Asp Gly Asp Arg Asn Val Glu Phe Val Gly

2385 2390 2395 2400

Gly Gln Thr Ile Leu Asp Tyr Tyr Ser Leu Ser Gly Ile Asn Ala Trp

2405 2410 2415

Gly Trp Leu Gly Ile Glu Ala Ala Phe Val Ala Val Phe Phe Cys Phe

2420 2425 2430

Ala Tyr Leu Ala Leu Lys Tyr Ile Ser His Val Arg Arg

2435 2440 2445

<210> 70

<211> 282

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 70

Met Ala Thr Leu Lys Asp Asp Ala Asp Thr Lys Thr Val Leu Ala Glu

1 5 10 15

Ala Gly Leu Ile Ser Leu Ile Pro Gly His Trp Arg Asn Ala Asp Thr

20 25 30

Asn Leu Ser Leu Ser Arg Arg Tyr Gly Gly Gly Tyr Glu Val Val Tyr

35 40 45

Cys Ala Pro Pro Arg Ser Ser Gln Ala Gly Pro Val Ser Trp Ala Ala

50 55 60

Asn Lys Asp Pro Asn Ala Pro Ile Gln Ser Asn Pro Leu Gly Ser Phe

65 70 75 80

Ser Ser Gln Leu Gln Asn Gln Pro Thr Leu Pro Arg Ser Glu Glu Ala

85 90 95

Arg Lys Tyr Phe Arg Thr Val Tyr Asp Phe Pro Gln Trp Gln Thr His

100 105 110

Arg Asn Gln Tyr Arg Leu Met Lys Arg Leu Phe Ser Ile Pro Gln Ser

115 120 125

His Val Ile Gln Asn Ala Leu Pro Ser Ile Met Trp Val Ala Phe Thr

130 135 140

Ser Thr Cys Val Ala Ala Tyr Met Tyr Gly Tyr Asp Gln His Met Leu

145 150 155 160

Pro Glu Gly Phe Pro Thr Leu Ala Pro Asn Ala Ala Cys Ser Ala Phe

165 170 175

Ile Ser Asn Thr Ser Val Ala Leu Ser Leu Leu Leu Val Phe Arg Thr

180 185 190

Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Gly

195 200 205

Leu Leu Asn Arg Ser Arg Asp Ile Met Arg Gln Gly Ala Thr Cys Phe

210 215 220

Pro Asp Asp Gln Val Glu Ala Lys Lys Ala Leu Ala Arg Trp Val Val

225 230 235 240

Ala Phe Ser Arg Ala Leu Arg Ile His Phe Gln Pro Glu Ser Gly Tyr

245 250 255

Trp Gln Ser Ala Arg Ala Leu Leu Leu Ala Gly Arg Ala Ser Val Ile

260 265 270

Gln Gly Ser Ala Cys Val Val Ala Thr Gln

275 280

<210> 71

<211> 302

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 71

Val Tyr Asp Phe Pro Gln Trp Gln Lys His Arg Ser Ser Tyr Arg Phe

1 5 10 15

Ala Glu Arg Leu Phe Gln Leu Ser Gln Ser His Ile Leu Gln Asn Ala

20 25 30

Leu Pro Ala Ile Ser Trp Val Thr Leu Val Ala Thr Leu Val Ala Ser

35 40 45

Tyr Gly Tyr Ser Tyr Asp Gln His Met Leu Pro Asp Val Phe Pro Ser

50 55 60

Ile Ser Pro Asn Ala Ser Cys Thr Ala Phe Ile Ser Asn Thr Ser Val

65 70 75 80

Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg

85 90 95

Trp Asp Glu Ala Arg Lys Met Trp Gly Gly Leu Leu Asn Arg Ser Arg

100 105 110

Asp Ile Met Arg Gln Gly Ala Thr Cys Phe Pro Asp Asp Gln Val Glu

115 120 125

Ala Lys Lys Ala Leu Ala Arg Trp Thr Val Ala Phe Ser Arg Ala Leu

130 135 140

Arg Ile His Phe Gln Pro Glu Val Thr Ile Glu Ser Glu Leu Gln Asn

145 150 155 160

Ile Leu Thr Pro Ala Glu Leu Gln Met Leu Ala Lys Ser Gln His Arg

165 170 175

Pro Val Arg Ala Ile His Ala Ile Ser Gln Ile Ile Gln Ser Val Pro

180 185 190

Met Ser Ser Ile His Gln Gln Gln Met Ser Asn Asn Leu Thr Phe Phe

195 200 205

His Asp Val Leu Gly Gly Cys Glu Arg Leu Leu Arg Ala Pro Ile Pro

210 215 220

Val Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Phe Ala Trp Leu Thr

225 230 235 240

Leu Leu Pro Phe Ala Leu Tyr Pro Thr Thr Gly Trp Gly Val Val Pro

245 250 255

Val Cys Thr Gly Ile Ala Ala Val Leu Cys Gly Ile Glu Glu Ile Gly

260 265 270

Val Gln Cys Glu Glu Pro Phe Gly Ile Leu Pro Leu Asp Val Ile Cys

275 280 285

Asn Arg Ile Gln Ala Asp Val Met Ala Thr Leu Lys Asp Asp

290 295 300

<210> 72

<211> 414

<212> PRT

<213> Chlamydomonas reinhardtii

<400> 72

Met Ser Val Ala Arg Arg Ser Ala Ala Pro Glu Ile Phe Ile Leu Ala

1 5 10 15

Ala Ala Arg Ala Leu His Leu Cys Ser Leu Lys Lys Asn Ala Leu Ser

20 25 30

Asn Met Val Ile Arg Phe Met Ser Ile Asn Pro Arg Ser Leu Ser Trp

35 40 45

Leu Gln Ser Phe Cys Gln Lys Asn Ala Lys Ser Ala Ala Arg Asp Gln

50 55 60

Arg Gln Leu Tyr Glu Val Glu Gly Arg Gly Thr Val Pro Phe Asp His

65 70 75 80

Tyr Lys Glu Gly Ser Arg His Ala Arg Arg Met Thr Phe Thr Phe Asp

85 90 95

Asp Trp Lys Arg His Arg Ser Ser Asn Arg Tyr Leu Tyr His Leu Lys

100 105 110

Thr Leu Thr Glu Ser Gly Ile Val Arg Gly Ile Trp Ala Pro Val Ala

115 120 125

Trp Val Thr Leu Phe Thr Ala Val Val Ala Thr Leu Asn Val Ala His

130 135 140

Gly Ala Ala Met Leu Pro Pro Trp Val Pro Ala Met Pro Gln Ile Ala

145 150 155 160

Ile Glu Pro Val Gln Leu Thr Ser Ile Ala Leu Ser Leu Leu Leu Val

165 170 175

Phe Arg Thr Asn Ala Ser Tyr Ser Arg Trp Asp Glu Gly Arg Arg Ser

180 185 190

Phe Gly Ser Ile Thr Thr Val Ser Arg Asp Ile Ala Arg Gln Ala Phe

195 200 205

Ala Trp Phe Arg Pro Asp Asp Tyr Glu Ser Arg Val Arg Val Gly Arg

210 215 220

Trp Leu Val Ala Leu Gly Arg Ser Thr Met Val His Leu Arg Glu Glu

225 230 235 240

His Asp Met Glu Asp Glu Leu Arg Glu Val Leu Lys Pro Ala Glu Val

245 250 255

Gln Ala Val Val Ser Ala Val His Ala Pro Ser Phe Cys Leu Gln Met

260 265 270

Ile Thr Leu Ile Ile Arg Thr Ala Gly Leu Pro Gln Glu Leu Val Ile

275 280 285

Arg Met Asp Glu Asn Val Ser Arg Leu Thr Asp Ala Val Ser Ala Cys

290 295 300

Glu Arg Ile Leu Asn Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr

305 310 315 320

Ala Arg Phe Leu Met Ala Trp Leu Ala Cys Leu Pro Phe Cys Leu Trp

325 330 335

Thr Tyr Cys Gly Pro Ala Met Val Pro Ile Ala Ala Leu Val Ala Phe

340 345 350

Val Leu Leu Gly Ile Glu Glu Ile Gly Val Tyr Ile Glu Glu Leu Asp

355 360 365

Arg Leu Val Lys Val Gly Ser Pro Thr Ala Ser Pro Arg Pro Glu Pro

370 375 380

Ala Ser Thr Asn Ser Asn Asn Ala Val Thr Asp Thr Ala Phe Gly Leu

385 390 395 400

Gly Ala Ala Gly Gly Phe Ser Pro Ala Val Ala Gly Ala Met

405 410

<210> 73

<211> 374

<212> PRT

<213> Phaeodactylum tricornutum CCAP 1055/1

<400> 73

Met Leu Ser Ser Ser Arg Trp Gly Ser Ala Phe Val Cys Phe Leu Ala

1 5 10 15

Leu Ala Cys Ser Ser Ser Tyr Arg Thr Gln Ala Phe Ile Val Pro Ser

20 25 30

Gly Thr Ser Ser Arg Val Ser Val Ala Val Arg Ser Leu Pro Pro Pro

35 40 45

Arg Asp Ile Ala Tyr Gly Glu Glu Ser Arg Lys Tyr Arg Arg Thr Val

50 55 60

Tyr Thr His Asp Asp Trp Val Asn His Arg Ser Pro Asp Arg Phe Trp

65 70 75 80

Arg Asn Ile Ile Ala Met Pro Thr Ser Gly Val Tyr Lys Asn Leu Ala

85 90 95

Lys Glu Cys Ile Ala Thr Thr Ala Val Ala Thr Ala Ile Val Val Tyr

100 105 110

Asn Ala Leu Val Gly Gly Tyr Thr Asp Phe Gly Gly Val Gln His Ala

115 120 125

Ala Val Leu Gln Asn Glu Leu Leu Pro Lys Ile Gly Met Pro Val Ser

130 135 140

Pro Phe Thr Val Ser Gly Ser Phe Leu Gly Phe Leu Leu Ile Phe Arg

145 150 155 160

Thr Asn Ser Ser Tyr Lys Arg Trp Asp Glu Ala Arg Lys Asn Trp Gly

165 170 175

Met Asn Ile Asn His Thr Arg Asp Leu Val Arg Met Gly Thr Ala Phe

180 185 190

Tyr Asp Lys Thr Gly Val Thr Asp Glu Gln Arg Lys Lys Asp Leu Gln

195 200 205

Ala Leu Ser Leu Ala Thr Trp Ser Phe Val Arg Ala Met Lys Arg His

210 215 220

Leu Ser Pro Glu Gln Glu Asp Glu Gln Asp Phe Arg Arg Glu Leu His

225 230 235 240

Glu Arg Leu Pro Pro Arg Gln Ala Gln Ala Ile Ile Asp Ala Ala His

245 250 255

Arg Pro Asn Arg Ala Leu Phe Asp Leu Ser Val Ala Ile Glu Asn Leu

260 265 270

Pro Met His Phe Met Arg Lys Asn Glu Ile His Asn Ala Ala Thr Ile

275 280 285

Phe Glu Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser Pro Ile

290 295 300

Pro Leu Phe Tyr Ala Arg His Thr Ala Arg Phe Leu Gly Val Trp Leu

305 310 315 320

Leu Leu Met Pro Phe Cys Leu Tyr Asp Pro Phe Ala Gly Ser Trp Asn

325 330 335

His Val Gly Met Ile Pro Ala Thr Ala Leu Ile Ser Ile Phe Leu Phe

340 345 350

Gly Ile Glu Glu Leu Ala Thr Ser Met Glu Glu Pro Phe Thr Ile Leu

355 360 365

Pro Met Gln Ala Phe Cys

370

<210> 74

<211> 455

<212> PRT

<213> Phaeodactylum tricornutum CCAP 1055/1

<400> 74

Met Met Arg Asn Phe Ala Ser Val Leu Leu Leu Leu Ser Ser Gly Ala

1 5 10 15

Ala Ala Phe Ala Pro Val Gln His Asn Gly Val Arg Thr Ile Ala Thr

20 25 30

Pro Ser Thr Pro Leu Tyr Gly Asn Thr Lys Gln Pro Pro Ala Leu Pro

35 40 45

Pro Ile Lys Asp Ile Ser Tyr Gly Glu Glu Ser Arg Lys Tyr Arg Arg

50 55 60

Thr Val Tyr Ser His Asp Asp Trp Val Lys His Arg Ser Ser Asp Arg

65 70 75 80

Phe Leu Arg Asn Leu Leu Ala Ile Gly Ser Ser Gly Val Tyr Lys Ser

85 90 95

Leu Ala Lys Glu Val Leu Ala Thr Thr Gly Val Ala Thr Phe Ile Val

100 105 110

Leu Tyr Asn Cys Leu Val Gly Gly Tyr Thr Asp Leu Glu Gly Ile Lys

115 120 125

His Ser Ala Leu Ile Glu Ser Val Trp Ala Pro Leu Met Ala Leu Pro

130 135 140

Leu Ala Pro Phe Thr Leu Ser Ser Pro Ser Leu Gly Leu Leu Leu Val

145 150 155 160

Phe Arg Thr Asn Thr Ser Tyr Gln Arg Trp Asp Glu Ala Arg Lys Asn

165 170 175

Trp Gly Met Asn Ile Asn His Thr Arg Asp Leu Val Arg Met Gly Thr

180 185 190

Ser Phe Tyr Asp Asn Ala Ala Val Ser Ser Glu Gln Arg Ala Lys Asp

195 200 205

Leu Lys Ala Leu Ser Leu Ala Thr Trp Ser Phe Val Arg Ala Met Lys

210 215 220

Arg His Leu Ser Pro Glu Ser Glu Asp Glu Gln Asp Phe Arg Arg Glu

225 230 235 240

Leu Phe Glu Arg Leu Pro Ala Pro Gln Ala Gln Ala Ile Ile Asp Ala

245 250 255

Ala His Arg Pro Asn Arg Ala Leu Phe Asp Leu Ser Val Ala Ile Glu

260 265 270

Asn Leu Pro Met His Phe Leu Arg Lys Asn Gln Val His Gln Ala Val

275 280 285

Thr Ile Phe Glu Asp Asn Leu Gly Ser Ser Glu Arg Leu Leu Thr Ser

290 295 300

Pro Val Pro Leu Phe Tyr Ser Arg His Thr Ala Arg Phe Leu Ser Phe

305 310 315 320

Trp Leu Leu Leu Leu Pro Phe Ala Leu Trp Asp Pro Phe Ala Gly Thr

325 330 335

Trp Asn His Val Gly Met Ile Pro Ala Thr Ala Val Ile Ser Ile Phe

340 345 350

Leu Phe Gly Ile Glu Glu Leu Ala Thr Gln Met Glu Glu Pro Phe Thr

355 360 365

Ile Leu Pro Met Gln Ala Phe Cys Asp Lys Ile Gly Asn Trp Cys Asn

370 375 380

Glu Ile Val Ser Trp Gln Ala Gly Asp Asn Gly Met Ala Val Asn Met

385 390 395 400

Pro Ser Met Ile Ser Pro Glu Gly Leu Pro Glu Leu Lys Glu Pro Ala

405 410 415

Pro Val Pro Ala Met Ala Val Ala Ser Val Ala Ala Ala Met Pro Val

420 425 430

Met Ala Asn Gly Asp Ile Asn Gly Asp Thr Thr Gly Ile Thr Met Asp

435 440 445

Gln Pro His Asn Ala Ile Pro

450 455

<210> 75

<211> 408

<212> PRT

<213> Thalassiosira pseudonana CCMP1335

<400> 75

Met Pro Ser Phe Thr Ser Leu Ser Thr Leu Leu Leu Leu Ala Leu Ser

1 5 10 15

Ser Pro Gln Ile Ser Ala Phe Ala Pro Leu Ser Ser Thr Ser Thr Pro

20 25 30

Ile Asn Val Ala Pro Ser Thr Thr Thr Ser Thr Thr Asn Leu Gln Met

35 40 45

Gly Pro Pro Lys Thr Asp Ile Val Leu Ser Glu Thr Tyr Gly Glu Gly

50 55 60

Ser Arg Lys Tyr Arg Arg Thr Val Tyr Thr His Asn Glu Trp Val Lys

65 70 75 80

His Arg Ser Ser Asp Arg Phe Ala Lys Asn Leu Phe Ser Met Val Asn

85 90 95

Ser Gly Val Tyr Lys Ser Leu Ala Lys Glu Val Phe Ala Thr Thr Ala

100 105 110

Val Ala Ser Ala Ile Val Ala Trp Asn Gly Ile Ala Gly Gly Tyr Thr

115 120 125

Asp Phe Asn Gly Val Glu His Gly Ala Ile Met Ser Phe Leu Pro Gln

130 135 140

Leu Val Leu Pro Leu Thr Pro Phe Thr Leu Leu Ser Pro Ser Leu Gly

145 150 155 160

Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu

165 170 175

Ala Arg Lys Met Trp Gly Leu Asn Ile Asn His Thr Arg Asp Leu Asn

180 185 190

Arg Met Ala Thr Ala Trp Tyr Gly His Asp Asn Gln Ile Ile Asp Pro

195 200 205

Ala Lys Arg Ala Glu Asp Leu Arg Gln Val Ser Leu Tyr Thr Trp Ala

210 215 220

Phe Val Arg Ser Met Lys Arg His Leu Ser Pro Pro Ser Glu Asp Glu

225 230 235 240

Glu Ala Phe Val Glu Glu Leu Tyr Ala Arg Met Ala Pro Glu Gln Ala

245 250 255

Glu Ala Ile Ile Ser Ala Ala His Arg Pro Asn Arg Ala Leu Tyr Asp

260 265 270

Leu Ser Val Val Ile Asp Lys Leu Pro Met His Phe Met Arg Lys Asn

275 280 285

Glu Ile Asn Lys Asn Leu Ser Ile Phe Glu Asp Thr Leu Gly Gly Cys

290 295 300

Glu Arg Leu Leu Ser Ser Pro Val Pro Leu Phe Tyr Thr Arg His Thr

305 310 315 320

Ala Arg Phe Leu Ser Thr Trp Leu Leu Leu Leu Pro Leu Ala Met Tyr

325 330 335

Gln Pro Phe Ser Gly Ser Trp Asn His Val Ala Met Ile Pro Ala Thr

340 345 350

Ala Leu Thr Ser Val Phe Leu Phe Gly Ile Asp Glu Leu Ser Thr Gln

355 360 365

Leu Glu Glu Pro Phe Thr Ile Leu Pro Met Gln Gly Phe Cys Asp Lys

370 375 380

Ile Gly Gly Trp Cys Asp Glu Ile Val Ser Trp Arg Gly Gln Gly Leu

385 390 395 400

Asp Lys Glu Glu Gln Gln Tyr Tyr

405

<210> 76

<211> 390

<212> PRT

<213> Thalassiosira pseudonana CCMP1335

<400> 76

Met Gly Pro Pro Ile Asp Pro Ser Val Pro Val Thr Asp Gln Val Gly

1 5 10 15

Glu Gly Ser Arg Lys Tyr Arg Arg Thr Val Tyr Thr His Asp Asp Trp

20 25 30

Val Arg His Arg Ser Pro Asp Arg Phe Gly Asn Asn Leu Ser Thr Leu

35 40 45

Phe Asn Ser Gly Ile Tyr Lys Gln Val Ala Asn Glu Val Phe Ala Thr

50 55 60

Thr Ala Val Ala Thr Phe Val Phe Leu Trp Asn Met Ile Ala Gly Gly

65 70 75 80

Tyr Thr Asp Leu Ala Gly Val Gln His Gly Pro Ile Ile Asp Ser Pro

85 90 95

Leu Ala Gln Met Val Gly Leu Pro Met Thr Ala Phe Thr Ile Leu Thr

100 105 110

Pro Ser Leu Gly Leu Leu Leu Val Phe Arg Thr Asn Thr Ser Tyr Gly

115 120 125

Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Leu Asn Ile Asn His Thr

130 135 140

Arg Asp Leu Asn Arg Met Ala Thr Ala Trp Tyr Gly Asn Glu Gly Asn

145 150 155 160

Met Asp Ser Val Ala Phe Met Gly Gly Asp Ile Pro Tyr Ser Gln Pro

165 170 175

Ile Asp Pro Val Gln Arg Ala Tyr Asp Leu Gly Gln Val Ser Leu Phe

180 185 190

Thr Trp Ala Phe Val Arg Ser Met Lys Arg His Leu Ser Pro Pro Glu

195 200 205

Glu Asp Glu Glu Asp Phe Lys Ala Glu Leu Arg Ala Arg Leu Thr Pro

210 215 220

Glu Gln Ala Glu Asn Ile Ile Asn Ala Ala His Arg Pro Asn Arg Ala

225 230 235 240

Leu Phe Asp Leu Ser Val Ala Ile Glu Asn Leu Pro Met His Phe Leu

245 250 255

Arg Lys Asn Ala Ile Asn Thr Asn Leu Ser Ile Phe Glu Asp Thr Leu

260 265 270

Gly Gly Cys Glu Arg Leu Leu Ser Ser Pro Val Pro Leu Phe Tyr Ser

275 280 285

Arg His Thr Ala Arg Phe Leu Ser Thr Trp Leu Leu Leu Leu Pro Phe

290 295 300

Gly Leu Tyr Glu Gln Phe Lys Asp Ser Trp Asn His Ile Ala Met Ile

305 310 315 320

Pro Ala Thr Ala Phe Ile Ser Val Cys Leu Phe Gly Ile Glu Glu Leu

325 330 335

Ala Thr Gln Leu Glu Glu Pro Phe Thr Ile Leu Pro Met Gln Gly Phe

340 345 350

Cys Asp Lys Ile Gly Gly Trp Cys Asp Glu Ile Val Ser Trp Ala Gly

355 360 365

Gln Gly Gln Gln Glu Tyr Thr Glu Glu Asn Ala Met Ser Asn Glu Gln

370 375 380

Glu Met Thr Tyr Trp Arg

385 390

<210> 77

<211> 426

<212> PRT

<213> Hedgehog hydnum flower

<400> 77

Met Thr Asn Pro Ile His His Ser Ala Thr Lys Leu Ser Pro Ser Ser

1 5 10 15

Ser Ser Ser Ser Leu Ser Ser His Phe Thr Pro Lys Thr Leu Lys Lys

20 25 30

Phe His Leu Tyr Pro Ser Asn Asn His His Arg Ser Asn His His Leu

35 40 45

Arg Phe Ser Cys Cys Gln Ser Ser Lys Asp Ser Asn Phe Ser Leu Asn

50 55 60

Gln Asp Ser Thr Phe Phe Ser Ile Leu Leu Ala Leu Pro Asn Trp Val

65 70 75 80

Asp Ser Ile Gln Glu Lys Gly Leu Glu Lys Lys Arg Ser Leu Tyr Asp

85 90 95

His Gly Asp Trp Val Gln His Arg Ser Ser Ser Arg His Val Arg His

100 105 110

Phe Leu Ser Ser Leu Gly Ser Arg Val Ile Leu Ser Leu Leu Pro Pro

115 120 125

Val Ile Val Phe Thr Ser Val Ala Val Val Val Ser Thr Tyr Asn Thr

130 135 140

Ala Val Ala Leu Ala Trp Leu Pro Glu Phe Phe Pro Ile Leu Arg Ala

145 150 155 160

Ser Ser Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu

165 170 175

Val Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Asp Glu Gly Lys Lys

180 185 190

Ala Trp Thr Lys Val Val Ser Gly Thr Asn Asp Phe Ala Arg Gln Val

195 200 205

Ile Ala Ser Ala Val Gly Pro Asp Asp Ser Val Leu Lys Thr Ala Ile

210 215 220

Leu Gln Tyr Val Val Ala Phe Pro Val Ala Leu Lys Cys His Val Ile

225 230 235 240

His Asp Ser Asp Ile Glu Gln Asp Leu Lys Asn Ile Leu Glu Thr Asp

245 250 255

Asp Leu Ala Val Val Leu Thr Ser Asn His Arg Pro Arg Cys Ile Ile

260 265 270

Glu Phe Ile Ser Gln Ser Leu Arg Ser Leu Asp Val Asp Pro Thr Lys

275 280 285

Leu Gln Val Leu Glu Ser Lys Leu Ser Cys Phe His Glu Gly Ile Gly

290 295 300

Val Cys Glu Gln Leu Leu Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg

305 310 315 320

Leu Thr Ser Arg Phe Leu Val Leu Trp His Phe Thr Leu Pro Ile Ile

325 330 335

Leu Trp Asp Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser

340 345 350

Ala Ala Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu

355 360 365

Pro Phe Pro Met Leu Ala Leu Asp Glu Leu Cys Glu Lys Val Arg Ser

370 375 380

Asn Ile Glu Asp Val Met Arg Asn Glu Lys Leu Ile Gln Ala Arg Val

385 390 395 400

Asn Ala Lys Arg Lys Thr His Tyr Lys Arg Asp Ser Pro Asn Gly Trp

405 410 415

Thr Ala Ser Leu Glu Asn Arg Lys Pro Asp

420 425

<210> 78

<211> 412

<212> PRT

<213> tomato

<400> 78

Met Thr Asn Pro Arg Thr Leu Phe Thr Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Asn Pro Ser Lys Ser Gln Gln

20 25 30

Gln Pro Pro Val Tyr Lys Lys Leu Asn Phe Arg Val Leu Cys Ser Ser

35 40 45

Gln Pro Ser Arg Thr Pro Gln Asn Ser Asn Leu Ile Ser Thr Leu Val

50 55 60

Lys Ile Leu Arg Val Val Pro Asp Trp Ala Asp Lys Ile Gln Glu Gly

65 70 75 80

Gly Met Arg Lys Lys Arg Ser Leu Tyr Lys His Glu Thr Trp Val Gln

85 90 95

His Arg Ser Ser Leu Arg His Val Arg His Leu Phe Ser Ser Phe Asn

100 105 110

Ser Arg Val Val Leu Ser Leu Ile Pro Pro Val Ile Ala Phe Thr Ser

115 120 125

Phe Ala Phe Val Ile Ala Ser Tyr Asn Ser Ala Val Ser Phe His Trp

130 135 140

Leu Pro Glu Phe Phe Pro Ile Leu Arg Ala Ser Pro Gln Pro Tyr Gln

145 150 155 160

Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu Ala

165 170 175

Ser Tyr Ser Arg Phe Glu Ala Gly Lys Lys Ala Trp Thr Lys Val Ile

180 185 190

Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Cys Val Asp Lys

195 200 205

Arg Asp Asp Val Leu Lys Glu Ala Leu Leu Gln Tyr Ile Met Ala Phe

210 215 220

Pro Val Ala Leu Lys Cys His Ile Val Tyr Asp Ser Asp Ile Ala Ser

225 230 235 240

Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu Ala Val Val Leu Ser

245 250 255

Ser Lys His Arg Pro Arg Cys Ile Ile Gly Phe Ile Ala Gln Ser Leu

260 265 270

Gln Ser Leu Asn Leu Glu Gly Thr Ile Leu Ser Gln Leu Glu Ser Lys

275 280 285

Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu Gln Leu Leu Gly

290 295 300

Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val

305 310 315 320

Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp Asp Cys His Trp

325 330 335

Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile

340 345 350

Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu Ala Leu

355 360 365

Asp Glu Leu Cys Gln Arg Val His Asp Asn Ile His Glu Ala Met Ala

370 375 380

Asn Glu Lys Gln Ile Gln Glu Ile Val Asn Ser Lys Arg Lys Arg Ser

385 390 395 400

Phe Ser Glu His Ser Pro Asn Gly Trp Pro Thr Ser

405 410

<210> 79

<211> 414

<212> PRT

<213> genus Fragaria

<400> 79

Met Leu Thr Gln Pro Thr Asn Cys Ile Lys Pro Thr Ser Asn Ile Leu

1 5 10 15

Phe Ser Phe Asn Ser Ile Pro Lys Ser Phe Phe Lys Leu His Pro Pro

20 25 30

Leu Asn Pro Arg Thr Leu Ser Leu Lys His His Cys Ser Gln Tyr Pro

35 40 45

Asn Pro Thr Pro Ser Ser Ser Ser Ser Ser Ser Pro Phe Gln Pro Leu

50 55 60

Ser Ser Ile Leu Arg Ile Ile Pro Asp Trp Ala Asp Glu Ile Lys Glu

65 70 75 80

Arg Gly Phe Arg Gln Asp Arg Thr Leu Tyr Asp His Glu Lys Trp Val

85 90 95

His His Arg Ser Ser Tyr Arg His Leu Arg His Phe Leu Thr Ser Leu

100 105 110

Ser Ser Arg Val Ile Leu Ser Leu Ile Pro Pro Val Ile Ala Phe Thr

115 120 125

Leu Val Ala Val Val Ile Ala Ser Tyr Asn Thr Ala Val Ala Leu Glu

130 135 140

Trp Leu Pro Glu Val Phe Pro Met Leu Arg Ser Ser Thr Leu Pro Tyr

145 150 155 160

Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu

165 170 175

Ala Ser Tyr Ser Arg Phe Glu Glu Gly Arg Lys Ala Trp Thr Lys Val

180 185 190

Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Ile Ile Ser Gly Val Glu

195 200 205

Asn Ser Gly Asp Ala Glu Leu Lys Lys Ala Leu Leu Gln Tyr Val Val

210 215 220

Ala Phe Pro Val Ala Leu Lys Cys His Val Ile Tyr Gly Ser Asn Met

225 230 235 240

Gly Arg Asp Leu Gln Asn Leu Leu Glu Val Asp Asp Leu Leu Val Val

245 250 255

Leu Ser Ser Lys His Gly Pro Gly Cys Ile Ile Glu Phe Ile Ser Gln

260 265 270

Asn Ile Arg Met Leu Lys Leu Glu Glu Ser Arg Arg Asn Met Leu Glu

275 280 285

Ser Asn Met Ser Cys Phe His Glu Gly Ile Ser Val Cys Glu Asn Leu

290 295 300

Ile Gly Thr Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe

305 310 315 320

Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp Asp Cys

325 330 335

His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe

340 345 350

Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu

355 360 365

Ala Leu Asp Asp Leu Cys Arg Ser Val Gln Glu Asn Val Gln Glu Ala

370 375 380

Leu Ser Arg Glu Lys Leu Ile Gln Ala Arg Leu Thr Ala Lys Gly Arg

385 390 395 400

Ile Gln Lys Gln Gln His Cys Pro Asn Gly Gln Pro Lys Ser

405 410

<210> 80

<211> 416

<212> PRT

<213> woody cotton

<400> 80

Met Ala Gln Ser Pro Asn Ser Pro Lys Leu Ser Leu Ser Pro Ser Phe

1 5 10 15

Thr Ser Lys Pro Phe Leu His Phe His Phe Asn Ser Ser Leu Pro Ala

20 25 30

Lys Phe Lys Arg Pro Pro Ser Phe Lys Ile Leu Phe Ser Ala Ser Gln

35 40 45

Pro Pro Pro Pro Ser Ser Lys Pro Thr Thr Ala Pro Lys Thr Phe Asn

50 55 60

Leu Ile Thr Leu Leu Arg Ala Ile Pro Asp Trp Ala Asp Arg Ile Gln

65 70 75 80

Glu Arg Gly Met Gln Gln Asn Arg Ala Leu Tyr Asn His Glu Lys Trp

85 90 95

Val His His Arg Ser Ser Leu Arg His Leu Arg His Leu Leu Ser Ser

100 105 110

Leu Gln Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val Leu Ala Phe

115 120 125

Thr Ser Val Ala Thr Val Val Ala Leu Tyr Asn Thr Ala Val Asp Leu

130 135 140

His Trp Phe Pro Gly Phe Phe Pro Val Leu Arg Ala Ser Ser Leu Pro

145 150 155 160

Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr

165 170 175

Glu Ala Ser Tyr Ser Arg Tyr Glu Glu Gly Arg Lys Ala Trp Thr Lys

180 185 190

Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Gly Val

195 200 205

Asp Asn Ser Ala Asp Asp Gln Ser Ile Lys Ala Ala Leu Leu Gln Tyr

210 215 220

Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Val Met Tyr Gly Ser

225 230 235 240

Asp Ile Gly Arg Asp Leu Gln Asn Leu Leu Glu Val Asp Asp Leu Ala

245 250 255

Val Ile Leu Asn Ser Lys His Arg Pro Arg Cys Ile Ile Glu Phe Ile

260 265 270

Ser Gln Ser Leu His Leu Leu Asn Leu Glu Glu Ser Lys Arg Thr Thr

275 280 285

Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu

290 295 300

Gln Leu Met Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser

305 310 315 320

Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp

325 330 335

Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser

340 345 350

Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro

355 360 365

Met Leu Ala Leu Asp Glu Leu Cys Ile Val Thr Gln Asn Asn Ile Arg

370 375 380

Glu Ala Ile Ala Thr Glu Lys Asp Ile Gln Ala Met Leu Lys Gly Lys

385 390 395 400

Arg Lys Arg His Ser Tyr Lys Arg Ser Pro Asn Gly Cys Pro Asn Thr

405 410 415

<210> 81

<211> 416

<212> PRT

<213> upland cotton

<400> 81

Met Ala Gln Ser Pro Asn Ser Pro Lys Leu Ser Leu Ser Ser Ser Phe

1 5 10 15

Thr Ser Lys Pro Phe Leu His Phe His Ser Asn Ser Ser Leu Pro Ala

20 25 30

Lys Phe Lys Arg Pro Pro Ser Phe Lys Ile Leu Phe Ser Ala Ser Gln

35 40 45

Pro Pro Pro Pro Ser Ser Lys Pro Thr Thr Ala Pro Lys Thr Phe Asn

50 55 60

Leu Ile Thr Leu Leu Arg Ala Ile Pro Asp Trp Ala Asp Arg Ile Gln

65 70 75 80

Glu Arg Gly Met Gln Gln Asn Arg Ala Leu Tyr Asn His Glu Lys Trp

85 90 95

Val His His Arg Ser Ser Leu Arg His Leu Arg His Leu Leu Ser Ser

100 105 110

Leu Gln Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val Leu Ala Phe

115 120 125

Thr Ser Val Ala Ile Val Ile Ala Leu Tyr Asn Thr Ala Val Asp Leu

130 135 140

His Trp Phe Pro Gly Phe Phe Pro Val Leu Arg Ala Ser Ser Leu Pro

145 150 155 160

Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr

165 170 175

Glu Ala Ser Tyr Ser Arg Tyr Glu Glu Gly Arg Lys Ala Trp Thr Lys

180 185 190

Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Gly Val

195 200 205

Asp Asn Ser Ala Asp Asp Gln Ser Ile Lys Ala Ala Leu Leu Gln Tyr

210 215 220

Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Val Met Tyr Gly Ser

225 230 235 240

Asp Ile Gly Arg Asp Leu Gln Asn Leu Leu Glu Val Asp Asp Leu Ala

245 250 255

Leu Ile Leu Asn Ser Lys His Arg Pro Arg Cys Ile Ile Glu Phe Ile

260 265 270

Ser Gln Ser Leu Gln Leu Leu Asn Leu Glu Glu Ser Lys Arg Thr Met

275 280 285

Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu

290 295 300

Gln Leu Met Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser

305 310 315 320

Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp

325 330 335

Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser

340 345 350

Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro

355 360 365

Met Leu Ala Leu Asp Glu Leu Cys Ile Val Thr Gln Asn Asn Ile Lys

370 375 380

Glu Ala Ile Ala Thr Glu Lys Asp Ile Gln Ala Met Leu Lys Gly Lys

385 390 395 400

Arg Lys Arg His Ser Tyr Lys His Ser Pro Asn Gly Cys Pro Asn Thr

405 410 415

<210> 82

<211> 416

<212> PRT

<213> cotton Raymond

<400> 82

Met Ala Gln Ser Pro Asn Ser Pro Lys Leu Ser Leu Ser Ser Ser Phe

1 5 10 15

Thr Ser Lys Pro Phe Leu His Phe His Ser Asn Ser Ser Leu Pro Ala

20 25 30

Lys Phe Lys Arg Pro Pro Ser Phe Lys Ile Leu Phe Ser Ala Ser Gln

35 40 45

Pro Pro Pro Pro Ser Ser Lys Pro Thr Thr Ala Pro Lys Thr Phe Asn

50 55 60

Leu Ile Thr Leu Leu Arg Ala Ile Pro Asp Trp Ala Asp Arg Ile Gln

65 70 75 80

Glu Arg Gly Met Gln Gln Asn Arg Ala Leu Tyr Asn His Glu Lys Trp

85 90 95

Val His His Arg Ser Ser Leu Arg His Leu Arg His Leu Leu Ser Ser

100 105 110

Leu Gln Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val Leu Ala Phe

115 120 125

Thr Ser Val Ala Ile Val Val Ala Leu Tyr Asn Thr Ala Val Asp Leu

130 135 140

His Trp Phe Pro Gly Phe Phe Pro Val Leu Arg Ala Ser Ser Leu Pro

145 150 155 160

Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr

165 170 175

Glu Ala Ser Tyr Ser Arg Tyr Glu Glu Gly Arg Lys Ala Trp Thr Lys

180 185 190

Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Gly Val

195 200 205

Asp Asn Ser Ala Asp Asp Gln Ser Ile Lys Ala Ala Leu Leu Gln Tyr

210 215 220

Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Val Met Tyr Gly Ser

225 230 235 240

Asp Ile Gly Arg Asp Leu Gln Asn Leu Leu Glu Val Asp Asp Leu Ala

245 250 255

Leu Ile Leu Asn Ser Lys His Arg Pro Arg Cys Ile Ile Glu Phe Ile

260 265 270

Ser Gln Ser Leu Gln Leu Leu Asn Leu Glu Glu Ser Lys Arg Thr Met

275 280 285

Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu

290 295 300

Gln Leu Met Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser

305 310 315 320

Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp

325 330 335

Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser

340 345 350

Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro

355 360 365

Met Leu Ala Leu Asp Glu Leu Cys Ile Val Thr Gln Asn Asn Ile Lys

370 375 380

Glu Ala Ile Ala Thr Glu Lys Asp Ile Gln Ala Met Leu Lys Gly Lys

385 390 395 400

Arg Lys Arg His Ser Tyr Lys His Ser Pro Asn Gly Cys Pro Asn Thr

405 410 415

<210> 83

<211> 417

<212> PRT

<213> tobacco plants

<400> 83

Met Thr Asn Ser Arg Thr Leu Phe Ser Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Leu Pro Ser Lys Leu Gln Gln

20 25 30

Gln Ser Phe Pro Ser Lys Leu Ser Cys Lys Lys Phe Ser Phe Thr Thr

35 40 45

Phe Lys Val Arg Cys Cys Pro Gln Gln Thr Pro Gln Asn Gln Asn Ser

50 55 60

Thr Ser Ala Leu Ile Ser Ile Leu Arg Ile Ile Pro Asp Trp Ala Asp

65 70 75 80

Arg Ile Gln Glu Gly Gly Met Lys Lys Lys Arg Ser Leu Tyr Lys His

85 90 95

Glu Ser Trp Val Gln His Arg Ser Ser Leu Arg His Val Arg His Leu

100 105 110

Phe Ser Ser Leu Asn Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val

115 120 125

Ile Ala Phe Thr Ser Val Ala Val Val Ile Ala Ser Tyr Asn Ser Ala

130 135 140

Val Leu Met His Trp Leu Pro Glu Phe Phe Pro Val Leu Arg Ala Ser

145 150 155 160

Pro Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val

165 170 175

Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Glu Thr Gly Lys Lys Ala

180 185 190

Trp Thr Lys Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile

195 200 205

Ala Cys Val Asp Lys Ser Asp Ala Val Leu Lys Glu Ala Leu Leu Gln

210 215 220

Tyr Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Ile Thr Tyr Gly

225 230 235 240

Ser Asp Ile Ala Ser Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu

245 250 255

Ala Leu Val Leu Ser Ser Lys His Arg Pro Arg Cys Val Ile Gly Phe

260 265 270

Ile Ser Gln Cys Leu Gln Ser Leu Asn Leu Glu Gly Thr Lys Leu Thr

275 280 285

Gln Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys

290 295 300

Glu Gln Leu Ala Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr

305 310 315 320

Ser Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp

325 330 335

Asp Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala

340 345 350

Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe

355 360 365

Pro Met Leu Ala Leu Asp Glu Leu Cys Gln Leu Val Arg Asp Asn Ile

370 375 380

Gln Glu Ala Met Ala Asn Glu Lys Gln Ile Gln Glu Arg Leu Asn Ala

385 390 395 400

Lys Arg Lys Arg Arg Phe Ser Glu His Ser Gln Asn Gly Trp Pro Thr

405 410 415

Ser

<210> 84

<211> 417

<212> PRT

<213> Meihua tobacco

<400> 84

Met Thr Asn Ser Arg Thr Leu Phe Ser Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Leu Pro Ser Lys Leu Gln Gln

20 25 30

Gln Ser Phe Pro Ser Lys Leu Ser Tyr Lys Lys Phe Ser Phe Ser Thr

35 40 45

Phe Lys Val Arg Cys Cys Pro Gln Gln Thr Pro Glu Asn Gln Asn Ser

50 55 60

Thr Ser Ala Leu Ile Ser Ile Leu Arg Ile Ile Pro Asp Trp Ala Asp

65 70 75 80

Arg Ile Gln Glu Glu Gly Met Lys Lys Lys Arg Ser Leu Tyr Lys His

85 90 95

Glu Ser Trp Val Gln His Arg Ser Ser Leu Arg His Val Arg His Leu

100 105 110

Phe Ser Ser Leu Asn Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val

115 120 125

Ile Ala Phe Thr Ser Val Ala Val Val Ile Ala Ser Tyr Asn Ser Ala

130 135 140

Val Ser Met His Trp Leu Pro Glu Phe Phe Pro Val Leu Arg Ala Ser

145 150 155 160

Pro Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val

165 170 175

Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Glu Thr Gly Lys Lys Ala

180 185 190

Trp Thr Lys Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile

195 200 205

Ala Cys Val Asp Lys Ser Asp Ala Val Leu Lys Glu Ala Leu Leu Gln

210 215 220

Tyr Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Ile Thr Tyr Gly

225 230 235 240

Ser Asp Ile Ala Ser Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu

245 250 255

Ala Leu Val Leu Ser Ser Lys His Arg Pro Arg Cys Val Ile Gly Phe

260 265 270

Ile Ser Gln Cys Leu Gln Ser Leu Asn Leu Glu Gly Thr Lys Leu Thr

275 280 285

Gln Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys

290 295 300

Glu Gln Leu Ala Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr

305 310 315 320

Ser Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp

325 330 335

Asp Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala

340 345 350

Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe

355 360 365

Pro Met Leu Ala Leu Asp Glu Leu Cys Gln Leu Val Arg Asp Asn Ile

370 375 380

Gln Glu Ala Met Ala Asn Glu Lys Gln Ile Gln Glu Arg Leu Asn Ala

385 390 395 400

Lys Arg Lys Lys Cys Phe Ser Glu His Ser Pro Asn Gly Trp Pro Thr

405 410 415

Ser

<210> 85

<211> 417

<212> PRT

<213> tobacco

<400> 85

Met Thr Asn Ser Arg Thr Leu Phe Ser Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Leu Pro Ser Lys Leu Gln Gln

20 25 30

Gln Ser Phe Pro Ser Lys Leu Ser Tyr Lys Lys Phe Ser Phe Ser Thr

35 40 45

Phe Lys Val Arg Cys Cys Pro Gln Gln Thr Pro Glu Asn Gln Asn Ser

50 55 60

Thr Ser Ala Leu Ile Ser Ile Leu Arg Ile Ile Pro Asp Trp Ala Asp

65 70 75 80

Arg Ile Gln Glu Glu Gly Met Lys Lys Lys Arg Ser Leu Tyr Lys His

85 90 95

Glu Ser Trp Val Gln His Arg Ser Ser Leu Arg His Val Arg His Leu

100 105 110

Phe Ser Ser Leu Asn Ser Arg Val Ile Leu Ser Leu Val Thr Pro Val

115 120 125

Ile Ala Phe Thr Ser Val Ala Val Val Ile Ala Ser Tyr Asn Ser Ala

130 135 140

Val Ser Met His Trp Leu Pro Glu Phe Phe Pro Val Leu Arg Ala Ser

145 150 155 160

Pro Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val

165 170 175

Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Glu Thr Gly Lys Lys Ala

180 185 190

Trp Thr Lys Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile

195 200 205

Ala Cys Val Asp Lys Ser Asp Ala Val Leu Lys Glu Ala Leu Leu Gln

210 215 220

Tyr Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Ile Thr Tyr Gly

225 230 235 240

Ser Asp Ile Ala Ser Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu

245 250 255

Ala Leu Val Leu Ser Ser Lys His Arg Pro Arg Cys Val Ile Gly Phe

260 265 270

Ile Ser Gln Cys Leu Gln Ser Leu Asn Leu Glu Gly Thr Lys Leu Thr

275 280 285

Gln Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys

290 295 300

Glu Gln Leu Ala Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr

305 310 315 320

Ser Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp

325 330 335

Asp Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala

340 345 350

Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe

355 360 365

Pro Met Leu Ala Leu Asp Glu Leu Cys Gln Leu Val Arg Asp Asn Ile

370 375 380

Gln Glu Ala Met Ala Asn Glu Lys Gln Ile Gln Glu Arg Leu Asn Ala

385 390 395 400

Lys Arg Lys Lys Cys Phe Ser Glu His Ser Pro Asn Gly Trp Pro Thr

405 410 415

Ser

<210> 86

<211> 417

<212> PRT

<213> tobacco fluffy

<400> 86

Met Thr Asn Ser Arg Thr Leu Phe Ser Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Thr Pro Ser Lys Leu Gln Gln

20 25 30

Gln Ser Phe Pro Ser Lys Leu Asn Phe Lys Lys Leu Arg Phe Ser Thr

35 40 45

Phe Lys Val Arg Cys Cys Pro Gln Gln Thr Pro Gln Asn Gln Asn Pro

50 55 60

Thr Ser Ala Leu Ile Ser Ile Leu Arg Ile Ile Pro Asp Trp Ala Asp

65 70 75 80

Arg Ile Gln Glu Glu Gly Met Lys Lys Lys Arg Ser Leu Tyr Thr His

85 90 95

Glu Ser Trp Met Gln His Arg Ser Ser Leu Arg His Val Arg His Leu

100 105 110

Phe Ser Ser Leu Asn Ser Arg Val Ile Leu Ser Leu Val Pro Pro Val

115 120 125

Ile Ala Phe Thr Ser Val Ala Val Val Ile Ala Ser Tyr Asn Ser Ala

130 135 140

Val Ser Met His Trp Leu Pro Glu Leu Phe Pro Val Leu Arg Ala Ser

145 150 155 160

Pro Leu Pro Tyr Gln Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val

165 170 175

Phe Arg Thr Glu Ala Ser Tyr Ser Arg Phe Glu Thr Gly Lys Lys Ala

180 185 190

Trp Thr Lys Val Ile Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile

195 200 205

Ala Cys Val Asp Lys Ser Asp Ala Val Leu Lys Ala Ala Leu Leu Gln

210 215 220

Tyr Ile Met Ala Phe Pro Val Ala Leu Lys Cys His Ile Thr Tyr Gly

225 230 235 240

Ser Asp Ile Ala Ser Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu

245 250 255

Ala Val Val Leu Ser Ser Lys His Arg Pro Arg Cys Ile Ile Gly Phe

260 265 270

Ile Ser Gln Cys Leu Gln Ser Leu His Leu Glu Gly Thr Lys Leu Thr

275 280 285

Gln Leu Glu Ser Lys Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys

290 295 300

Glu Gln Leu Ala Gly Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr

305 310 315 320

Ser Arg Phe Leu Val Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp

325 330 335

Asp Asp Cys His Trp Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala

340 345 350

Ser Leu Phe Cys Ile Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe

355 360 365

Pro Met Leu Ala Leu Asp Glu Leu Cys Gln Leu Val His Asp Asn Ile

370 375 380

Gln Glu Ser Met Ala Asn Glu Lys Lys Ile Gln Glu Arg Leu Ser Ala

385 390 395 400

Lys Arg Lys Arg Arg Phe Ser Glu His Ser Gln Asn Gly Trp Pro Thr

405 410 415

Ser

<210> 87

<211> 412

<212> PRT

<213> Pennelli tomato

<400> 87

Met Thr Asn Pro Arg Thr Leu Phe Thr Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Asn Pro Ser Lys Ser Gln Gln

20 25 30

Gln Gln Pro Val Tyr Lys Lys Leu Asn Phe Arg Val Leu Cys Ser Ser

35 40 45

Gln Pro Ser Arg Thr Pro Gln Asn Ser Asn Leu Ile Ser Thr Leu Val

50 55 60

Lys Ile Leu Arg Val Val Pro Asp Trp Ala Asp Lys Ile Gln Glu Gly

65 70 75 80

Gly Met Arg Lys Lys Arg Ser Leu Tyr Lys His Glu Thr Trp Val Gln

85 90 95

His Arg Ser Ser Leu Arg His Val Arg His Leu Phe Ser Ser Phe Asn

100 105 110

Ser Arg Val Val Leu Ser Leu Ile Pro Pro Val Ile Ala Phe Thr Ser

115 120 125

Phe Ala Phe Val Ile Ala Ser Tyr Asn Ser Ala Val Ser Phe His Trp

130 135 140

Leu Pro Glu Phe Phe Pro Ile Leu Arg Ala Ser Pro Gln Pro Tyr Gln

145 150 155 160

Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu Ala

165 170 175

Ser Tyr Ser Arg Phe Glu Ala Gly Lys Lys Ala Trp Thr Lys Val Ile

180 185 190

Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Cys Val Asp Lys

195 200 205

Arg Asp Asp Val Leu Lys Glu Ala Leu Leu Gln Tyr Ile Met Ala Phe

210 215 220

Pro Val Ala Leu Lys Cys His Ile Val Tyr Asp Ser Asp Ile Ala Ser

225 230 235 240

Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu Ala Val Val Leu Ser

245 250 255

Ser Lys His Arg Pro Arg Cys Ile Ile Gly Phe Ile Ala Gln Ser Leu

260 265 270

Gln Ser Leu Asn Leu Glu Gly Thr Ile Leu Ser Gln Leu Glu Ser Lys

275 280 285

Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu Gln Leu Leu Gly

290 295 300

Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val

305 310 315 320

Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp Asp Cys His Trp

325 330 335

Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile

340 345 350

Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu Ala Leu

355 360 365

Asp Glu Leu Cys Gln Arg Val His Asp Asn Ile His Glu Ala Met Ala

370 375 380

Asn Glu Lys Gln Ile Gln Glu Ile Val Asn Ser Lys Arg Lys Arg Ser

385 390 395 400

Phe Ser Glu His Ser Pro Asn Gly Trp Pro Thr Ser

405 410

<210> 88

<211> 412

<212> PRT

<213> Potato

<400> 88

Met Thr Asn Pro Arg Thr Phe Phe Thr Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Phe Ser Ser His Phe Thr Leu Lys Lys Pro Ser Asn Ser Gln Gln

20 25 30

Gln Pro Pro Val Tyr Lys Lys Phe Thr Phe Arg Val Leu Cys Ser Ser

35 40 45

Gln Pro Ser Arg Thr Pro Gln Asn Ser Asn Leu Ile Ser Thr Leu Val

50 55 60

Lys Ile Leu Arg Val Val Pro Asp Trp Ala Asp Lys Ile Gln Glu Gly

65 70 75 80

Gly Met Arg Lys Lys Arg Ser Leu Tyr Lys His Glu Thr Trp Val Gln

85 90 95

His Arg Ser Ser Leu Arg His Leu Arg His Leu Phe Ser Ser Phe Asn

100 105 110

Ser Arg Val Val Leu Ser Leu Ile Pro Pro Val Ile Ala Phe Thr Ser

115 120 125

Phe Ala Phe Val Ile Ala Cys Tyr Asn Ser Ala Val Ser Leu His Trp

130 135 140

Leu Pro Glu Phe Phe Pro Ile Leu Arg Ala Ser Pro Gln Pro Tyr Gln

145 150 155 160

Leu Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu Ala

165 170 175

Ser Tyr Ser Arg Phe Glu Ala Gly Lys Lys Ala Trp Thr Lys Val Ile

180 185 190

Ala Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Ala Cys Val Asp Lys

195 200 205

Arg Asp Asp Val Leu Lys Glu Ala Leu Leu Gln Tyr Ile Met Ala Phe

210 215 220

Pro Val Ala Leu Lys Cys His Ile Val Tyr Asp Ser Asp Ile Ala Ser

225 230 235 240

Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu Ala Leu Val Val Ser

245 250 255

Ser Lys His Arg Pro Arg Cys Ile Ile Gly Phe Ile Ser Gln Ser Leu

260 265 270

Gln Ser Leu Asn Leu Asp Gly Thr Ile Leu Ser Gln Leu Glu Ser Lys

275 280 285

Ile Thr Cys Phe His Glu Gly Ile Gly Val Cys Glu Gln Leu Leu Gly

290 295 300

Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val

305 310 315 320

Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp Asp Cys His Trp

325 330 335

Ile Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile

340 345 350

Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu Ala Leu

355 360 365

Asp Glu Leu Cys Gln Arg Val His Asp Asn Ile His Glu Ala Met Ala

370 375 380

Asn Glu Lys Gln Ile Gln Glu Ile Val Asn Ser Lys Arg Lys Arg Ser

385 390 395 400

Phe Ser Glu His Ser Pro Asn Gly Trp Pro Thr Ser

405 410

<210> 89

<211> 481

<212> PRT

<213> Chlorella

<400> 89

Met Val Val Ala Ala Cys Arg Gly His Ala Met Leu Ser Asp Ala Ala

1 5 10 15

Gln Arg Arg Gly Pro Ala Ala Gly Gln Gly Pro Ala Ala Ala Ala Ala

20 25 30

Ile Arg Gly Leu Ser Pro Cys Arg Arg Ser Ala Ser Thr Trp Arg Leu

35 40 45

Val Pro Ala Ala Gln Arg Arg Pro Arg Pro Pro Met Met Asp Ser Ile

50 55 60

Leu Asp Asp Leu Gly Ser Asn Gly Asp Ser Ala Ala Glu Ser Ser Thr

65 70 75 80

Asp Leu Ala Ala Ala Glu Pro Pro Ala Val Phe Pro Pro Leu Leu Ser

85 90 95

Val Asp Leu Ala Ser Asp Pro Val Lys Glu Gly Ser Arg Arg Tyr Arg

100 105 110

Arg Thr Val Phe Asp Phe Asn Glu Trp Arg Lys His Arg Ser Thr Glu

115 120 125

Arg Tyr Val Arg His Met Gln Ser Met Thr Ser Ser Arg Met Val Arg

130 135 140

Gly Leu Ala Ala Pro Leu Ala Tyr Ile Phe Ala Val Ala Thr Ala Val

145 150 155 160

Ser Val Tyr Asn Ala Ser Val Glu Ala Gly Leu Leu Pro Ser Leu Leu

165 170 175

Pro Glu Val Lys Met Ala Ser Asn Gly Pro Phe Gly Ser Val Ser Phe

180 185 190

Ala Ile Ser Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr Ala Arg

195 200 205

Trp Leu Asp Ala Arg Lys Ala Trp Gly Lys Leu Ile Asn Arg Ser Arg

210 215 220

Asp Leu Thr Arg Gln Ala Leu Thr Tyr Phe Pro Pro Glu Asp Lys Pro

225 230 235 240

Leu Leu Asp Leu Leu Cys Arg Trp Thr Val Ala Phe Ser Arg Thr Leu

245 250 255

Lys Cys His Leu Cys Glu Asp Tyr Pro Leu Ala Glu Glu Leu Ala Arg

260 265 270

Val Leu Arg Pro His Glu Ala Glu Ala Leu Leu Leu Ala Lys His Arg

275 280 285

Pro Thr Tyr Cys Leu Gln Ile Leu Ser Glu Thr Leu Lys Ser Ala His

290 295 300

Leu Pro Pro Pro Leu Pro Val Ala Gln Pro His Asn Gly Ala Thr Ala

305 310 315 320

Gly His Ala Ala Ala Ala Gln Ala Val Ala Ala Val Pro Ala Ala Ala

325 330 335

Ala Tyr Arg Met Asp Glu Asn Leu Thr Glu Phe Glu Asp Ile Val Gly

340 345 350

Thr Cys Glu Arg Ile Leu Arg Ala Pro Ile Pro Leu Ser Tyr Thr Arg

355 360 365

His Thr Ser Arg Phe Met Ile Ile Trp Leu Thr Leu Leu Pro Phe Ala

370 375 380

Leu Trp Asp Ser Val Gly Trp Ala Thr Val Pro Leu Ala Val Ile Val

385 390 395 400

Ala Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val Ser Ile Glu Glu

405 410 415

Pro Phe Ser Ile Leu Pro Leu Asp Ala Leu Cys Asp Thr Ile Glu Ala

420 425 430

Asn Val Lys Glu Leu Gln Arg Thr His Ser Gln Gln Gly Gly Gly Gly

435 440 445

Gly Glu Glu Gly Ser His Lys Ala Arg Pro Pro Pro Ala Arg Asp Ile

450 455 460

Val Gly Met Ala Ala Ala Glu Ala Glu Ala Glu Glu Ala Ala Val Ala

465 470 475 480

Lys

<210> 90

<211> 590

<212> PRT

<213> Chlorella

<400> 90

Met Ser Ala Leu Leu Arg Ala Arg Val Ser Ala Phe Leu Ala Gly Val

1 5 10 15

Ala Val Ala Gly Val Phe Gly Val Tyr Gln Leu Arg Gly Asp Val Ala

20 25 30

Glu Gly Gln Gln Arg Leu Leu Asp Gln Thr Lys Lys Tyr Thr Ala Gly

35 40 45

Leu Glu Gly Arg Val Ala Glu Leu Glu Ala Ala Val Ala Arg Leu Ser

50 55 60

Ser Asn Arg Ala Leu Lys Pro Asn Ser Ala Ala Pro Pro Pro Ala Pro

65 70 75 80

Ala Met Pro Ala Gly Leu Met Thr Gln Gln Ser Thr Ala Cys Ser Ala

85 90 95

Ala Ala Ala Ser Gly Arg Leu Gln Gly Ala Ala Arg Ser Leu Pro Arg

100 105 110

Arg His Ala Leu Ser Gly Ala Ala Val Gly Arg Pro Ala Pro Ala Gly

115 120 125

Leu Gly Arg Gly Leu Ser Ser Ala Ser Arg Ala Gln Gly Arg Arg Ala

130 135 140

Gly Ala Val Arg Val Gln Ala Ala Ala Thr Pro Gly Val Pro Gly Ala

145 150 155 160

Asn Ser Ala Ser Glu Gly Pro Phe Asp Trp Met Thr Asp Glu Trp Lys

165 170 175

Glu Ala Asp Arg Lys Asn Leu Arg Thr Val Phe Asp Phe Asp Ala Trp

180 185 190

Lys Arg His Arg Ser Ser Ser Arg Tyr Trp Arg His Leu Gly His Leu

195 200 205

Pro Asn Ser Arg Ile Leu Lys Trp Val Ala Gly Pro Leu Ser Tyr Val

210 215 220

Thr Ala Val Ala Ile Gly Val Cys Ala Tyr His Thr Ala Ala Glu Ala

225 230 235 240

Gly Ile Val Pro Glu Val Leu Pro Glu Leu Ala Lys Gly Ala Ala Ala

245 250 255

Pro Phe Gly Leu Thr Ser Phe Ala Leu Ser Thr Leu Leu Val Leu Arg

260 265 270

Thr Asn Thr Ser Tyr Gln Arg Trp Asp Glu Ala Arg Lys Met Trp Gly

275 280 285

Leu Ile Val Asn Arg Ser Arg Asp Val Ala Arg Gln Ala Leu Gly Tyr

290 295 300

Ile Pro Ala Ser Gln Pro Glu Leu Gln Asp Met Phe Cys Arg Trp Leu

305 310 315 320

Val Ala Tyr Cys Arg Ser Leu Met Cys His Leu Arg Pro Gly Glu Asp

325 330 335

Leu Arg Ala Glu Leu Glu Gly Lys Leu Lys Pro Glu Glu Leu Glu Ala

340 345 350

Leu Leu Ser Ser Ala His Arg Pro Asn Tyr Thr Cys Gln Val Leu Thr

355 360 365

Ala Val Ile Lys Arg Ala Gln Leu Pro Gly Asp Asp Ile Asp Asn Arg

370 375 380

Asp Ser Phe Ala Asn Val Lys Ala Ser Ala Ala Phe Arg Met Asp Glu

385 390 395 400

Asn Leu Thr Gln Phe Ala Asp Val Thr Gly Gly Cys Glu Arg Ile Leu

405 410 415

Arg Thr Pro Val Pro Leu Met Tyr Thr Arg His Asn Ser Arg Phe Leu

420 425 430

Met Ile Trp Leu Ser Leu Leu Pro Phe Thr Leu Trp Asp Thr Cys His

435 440 445

Trp Ala Thr Val Pro Val Thr Ala Leu Val Ala Phe Leu Leu Leu Gly

450 455 460

Ile Lys Glu Val Gly Val Ala Ile Glu Glu Pro Phe Thr Ile Leu Pro

465 470 475 480

Leu Glu Val Ile Cys Asn Thr Ile Glu Gly Asn Val Trp Glu Leu His

485 490 495

Arg Met His Ser Ala Asn Gly Val Glu Gln Gln His Ala Ala Gly Asn

500 505 510

Ala Val Val Thr Ala Glu Ala Leu Val Asp Ile Met Ala Pro Gln Thr

515 520 525

Ile Gly Gly Leu Ala Leu Asn Gly Ala Gly Ser Ala Ala Tyr Val Asn

530 535 540

Gly Asn Gly Asn Gly Ala Tyr Thr Asn Gly Ala Ala Asn Gly Asn Gly

545 550 555 560

Ala Glu Ser Gly Thr Ile Lys Val Pro Pro Glu Glu Leu Ile Arg Ala

565 570 575

Ala Gln Gly Leu Arg Gln Arg Val Ser Ser Ser Leu Arg Gln

580 585 590

<210> 91

<211> 450

<212> PRT

<213> Chlorella

<400> 91

Met Ala Thr Pro Ala Ala Ala Ala Pro Arg Arg Leu Gly Ala Ala Ala

1 5 10 15

Ala Pro Lys Gly Leu Pro Arg Leu Ala Gly Val Ser Ala Arg Pro Arg

20 25 30

Arg Ala Ala Gln Thr Ala Gly Ser Phe His Ser Ala Ala Leu Pro Val

35 40 45

Asp Gln Ala Val Asn Gly Asn Gly Thr Val Pro Pro Asp Pro Glu Pro

50 55 60

Glu Pro Thr Tyr Ser Trp Phe Ser Gln Glu Trp Lys Glu Glu Arg Arg

65 70 75 80

Lys Lys Lys Gly Arg Thr Val Phe Asp Phe Glu Arg Trp Gln Lys His

85 90 95

Arg Ser Ser Ala Arg Tyr Leu Arg His Met Ala Gly Met Phe Ser Ser

100 105 110

Ser Val Ile Gln Gly Leu Ala Val Pro Leu Ala Tyr Val Val Thr Val

115 120 125

Ser Val Gly Val Ala Thr Tyr Tyr Thr Ala Ala Ala Lys Gly Met Val

130 135 140

Pro Leu Phe Pro Ala Leu Lys Val Leu Ala Ser Ala Pro Phe Ser Leu

145 150 155 160

Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser

165 170 175

Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly Gln Val Val Asn

180 185 190

Arg Ser Arg Asp Ile Ala Arg Gln Ala Leu Ala Tyr Ile Pro Ala Ala

195 200 205

Gln Val His Leu Gln Asp Val Ile Cys Arg Trp Thr Ile Ala Tyr Thr

210 215 220

Arg Ala Leu Met Cys His Leu Arg Gln Gly Glu Asp Leu Gly Ser Glu

225 230 235 240

Leu Ala Gly Ile Leu Ser Pro Ser Glu Leu Ala Ala Leu Leu Ala Ala

245 250 255

Lys His Arg Pro Asn Phe Cys Thr Gln Val Leu Ser Ala Ala Val Arg

260 265 270

Asp Ala Gln Leu Pro Gly Thr Gly Pro Thr Ser Arg Glu Pro Thr Ala

275 280 285

Ala Val Pro Ala Gly Ala Ala Tyr Arg Met Asp Glu Asn Ile Thr Val

290 295 300

Phe Val Glu Val Ser Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Ile

305 310 315 320

Pro Leu Gly Tyr Thr Arg His Thr Ser Arg Phe Leu Met Leu Trp Leu

325 330 335

Thr Leu Leu Pro Phe Ser Leu Trp Glu Ser Cys Gly Leu Ala Met Ile

340 345 350

Pro Val Ala Ala Leu Val Ala Phe Leu Leu Leu Gly Val Glu Glu Ile

355 360 365

Gly Val Gln Ile Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Val Ile

370 375 380

Ser Ser Thr Ile Glu Gly Asn Ile Arg Glu Leu Gln Ala Thr His Gly

385 390 395 400

Ala Ala Ala Ala Val Pro Ser Pro Ile His Asp Ile Ile Arg Pro Pro

405 410 415

Gln Leu Gln Ser Pro Glu Gly Asn Ser Ser Asn Val Val Gly Ala Pro

420 425 430

Ser Leu Ala Thr Asn Gly Ala Pro Ala Gly Arg Pro Ser Gly Gly Gly

435 440 445

Ala Arg

450

<210> 92

<211> 408

<212> PRT

<213> Chlorella

<400> 92

Met Gln Lys Arg Thr Arg Pro Arg Ser Arg Leu Pro Pro Val Thr Leu

1 5 10 15

Cys Cys Arg Leu Pro Pro Ala Ala Gln Pro Pro Arg Gly Val His Ala

20 25 30

Ala Gln Ala Leu Leu Arg Pro Ala Gly Cys Ser Gly Ser Gln Gln Gln

35 40 45

Arg Arg Arg Arg Arg Pro Pro Ser Thr Ala Ala Ser Leu Leu Pro Leu

50 55 60

Gly Asp Arg Asp Glu Asp Lys Glu Glu Arg Leu Arg Arg Phe Arg Val

65 70 75 80

Met Tyr Asp Phe Asp Ala Trp Ala Ala His Arg Ser Val Lys Arg Tyr

85 90 95

Trp Arg His Phe Ile Gly Leu Phe Arg Ser Arg Ile Val Ala Gly Ile

100 105 110

Ala Leu Pro Ile Leu Leu Val Phe Leu Glu Ala Thr Gly Val Cys Trp

115 120 125

Tyr Glu Thr Ala Leu Arg Ser Gly Leu Leu Pro Ala Thr Trp Arg Ser

130 135 140

Ile Gln Val Arg Ala Pro Met Leu Phe Ser Leu Ser Ser Phe Ala Leu

145 150 155 160

Ser Leu Leu Leu Gly Phe Arg Thr Asn Gln Ser Ile Ala Arg Phe Asp

165 170 175

Glu Ala Arg Arg Leu Trp Asn Thr Met Ile Asn Arg Cys Arg Asp Ala

180 185 190

Met Arg Gln Ala Val Ser Tyr Leu Gly Pro Gln Leu Pro Gln Gln Ala

195 200 205

Ala Leu Leu Gly Ala Leu Ser Arg Trp Leu Gln Ala Phe Pro Trp Val

210 215 220

Leu Lys Asn His Val Arg Glu His Lys His Trp Gln Ala Glu Leu Gly

225 230 235 240

Asp Ile Leu Glu Pro Ser Glu Leu Glu Ala Val Val Ala Ser Lys His

245 250 255

Pro Pro Leu Leu Ala Leu Gln Val Ile Thr Glu Leu Leu Asp Arg Ala

260 265 270

Pro Ile Ser Ala Lys Gln Arg Leu Arg Ile Asp Gly Cys Val Thr Asp

275 280 285

Leu Ser Asp Val Val Gly Gly Cys Gln Arg Ile Leu Asn Thr Pro Ile

290 295 300

Pro Val Ser Tyr Thr Arg His Thr Cys Arg Tyr Leu Thr Val Trp Leu

305 310 315 320

Phe Leu Leu Pro Leu Ser Ile Phe Asn Gln Cys Gly Trp Val Thr Val

325 330 335

Phe Ser Ser Val Val Leu Ala Phe Phe Leu Leu Thr Ile Glu Glu Ile

340 345 350

Gly Val Thr Ile Glu Glu Pro Phe Asn Ile Leu Pro Leu Ala Glu Leu

355 360 365

Asn Arg Gly Ala Asp Val Ala Gln Asn Leu Asp Arg Ile Asp Glu Val

370 375 380

Val Ala Leu Val Asp Ala Ala Thr Gly Ser Arg Arg Thr Ala Met Gln

385 390 395 400

Leu Ala Pro Ala Tyr Pro Ile Glu

405

<210> 93

<211> 456

<212> PRT

<213> Chlorella

<400> 93

Met Ser Thr Ala Met Leu Ala Gly Ser Arg Ile Gln Leu Gln Gln Pro

1 5 10 15

Ala Gly Leu Gly Gly Ser Arg Leu Gln Arg Ala Ala Ala Pro Val Ala

20 25 30

Ala Ala Ala Arg Leu Gly Ser Val Arg Pro Ala Gly Leu Gln Ala Arg

35 40 45

Ser Thr Ala Ala Arg Arg Ala Asp Arg Ser Ala Leu Arg Val Ser Ala

50 55 60

Thr Ala Ser Pro Glu Ala Ala Pro Val Lys Leu Ser Gly Asp Asp Leu

65 70 75 80

Lys Glu Ala Asn Arg Lys His Met Arg Ser Val Phe Asp Phe Asp Leu

85 90 95

Trp Lys Lys His Arg Ser Ser Ser Arg Tyr Leu Arg His Ile Val Gly

100 105 110

Leu Gly Glu Ser Arg Ile Val Ser Gly Leu Met Ala Pro Leu Thr Tyr

115 120 125

Val Met Thr Leu Ser Leu Ala Val Ala Cys Tyr Asn Ala Ala Ala Glu

130 135 140

Ala Gly Tyr Leu Pro Val Phe Pro Glu Leu Lys Leu Ala Thr Asn Ala

145 150 155 160

Pro Phe Gly Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg

165 170 175

Thr Asn Ser Ser Tyr Gly Arg Trp Asp Glu Ala Arg Lys Met Trp Gly

180 185 190

Leu Ile Val Asn Arg Ser Arg Asp Phe Ile Arg Gln Gly Leu Gly Tyr

195 200 205

Ile Pro Pro Glu Gln Glu Glu Leu Gln Lys Met Leu Val Arg Trp Thr

210 215 220

Val Ala Tyr Ser Arg Ser Leu Met Cys His Leu Arg Pro Gly Glu Asp

225 230 235 240

Leu Arg Val Glu Leu Lys Asp Thr Leu Lys Pro Glu Glu Leu Glu Ala

245 250 255

Leu Leu Ala Ser Thr His Arg Pro Asn Tyr Val Val Gln Val Leu Thr

260 265 270

Ala Ile Ile Lys Thr Ala Gln Leu Pro Ala Ala Val Thr Asn Asn Arg

275 280 285

Asp Ser Thr Gly Cys Val Pro Ala Gly Ala Ala Tyr Arg Met Asp Glu

290 295 300

Asn Leu Thr Val Phe Ala Asp Val Thr Gly Gly Cys Glu Arg Ile Leu

305 310 315 320

Arg Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Met

325 330 335

Met Ile Trp Leu Thr Leu Leu Pro Phe Thr Leu Trp Asp Ser Cys His

340 345 350

Trp Ala Met Leu Pro Ile Ala Gly Ile Val Ser Phe Leu Leu Leu Gly

355 360 365

Ile Glu Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Thr Ile Leu Pro

370 375 380

Leu Glu Val Ile Ser Arg Thr Ile Glu Gly Asn Val Trp Glu Leu Tyr

385 390 395 400

Arg Met His Ser Gly Glu Ala Leu Glu Lys Glu Gln Ala Glu Leu Ala

405 410 415

Asn Gly Gln Asp Val Gln Val Leu Asn Ala Gln Asp Leu Val Ala Leu

420 425 430

Met Ala Pro Ser Ala Val Gly Asn Thr Ala Asn Gly Thr Ser Arg Lys

435 440 445

Ser Leu Val Val Asn Tyr Gly Leu

450 455

<210> 94

<211> 589

<212> PRT

<213> Chlorella

<400> 94

Met Gly Leu Met Pro Asn Met Glu Asn Thr Tyr Ser His Val Pro Arg

1 5 10 15

Ser Ala Met Ala Ala Met Ala Ala Ser Ala Pro Ala Asp Ala Ser Thr

20 25 30

Asn Ala Gly Gly Ser Pro Gly Val Gly Arg Leu Ala Ala Arg Thr Ser

35 40 45

Ser Glu Pro Pro Ser Gly Val His Ser Arg Ser Ser Ser Leu Thr Asn

50 55 60

Leu Ala Arg Leu Pro Gly Lys Ala Arg Ala Lys Leu Gln Asn Leu Thr

65 70 75 80

His Ser Gln Phe Val Arg Phe Ile Glu Asp Asn Asp Ala Gln Asp Lys

85 90 95

Glu Glu Asn Asp Ile Tyr Arg Gly Ala Ala Ala Ala Arg Gln Asn Pro

100 105 110

Ala Asp Gln Val Phe Thr Phe Glu Arg Trp Asn Lys His Arg Asn Pro

115 120 125

Met Arg Tyr Ala Lys His Leu Leu His Met Phe Thr Ser Arg Val Phe

130 135 140

Lys Gln Leu Leu Gly Pro Val Leu Ala Val Met Ala Leu Ala Leu Ser

145 150 155 160

Val Gly Ile Tyr Glu Thr Leu Val Ser Ala Gly Ala Leu Pro Gly His

165 170 175

Trp Pro His Val Thr Leu Ala Leu Gly Gln Gly Phe Asn Leu Thr Ala

180 185 190

Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asp

195 200 205

Arg Trp Trp Glu Gly Arg Lys Leu Trp Gly Gly Val Val Asn Arg Thr

210 215 220

Arg Asn Ile Val Arg Gln Ser Leu Val Phe Phe Arg Glu Asp Val His

225 230 235 240

Leu Lys Glu Leu Leu Ala Arg Trp Thr Met Ala Phe Pro Lys Val Leu

245 250 255

Met Val His Leu Arg Glu Gly Met Asp Leu Gln Ala Glu Val Ala His

260 265 270

Ile Leu Thr Ala Asn Glu Val Ala Ala Leu Val Ala Ala Ala His Arg

275 280 285

Pro Asn Phe Val Leu Gln Val Met Ala Glu Ala Ile Arg Ala Ala Arg

290 295 300

Pro His Glu Leu Ala Arg Met Arg Met Asp Asp Asn Leu Thr Phe Phe

305 310 315 320

Glu Asp Ala Met Gly Ser Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro

325 330 335

Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Leu Leu Val Trp Leu Ile

340 345 350

Leu Leu Pro Phe Thr Leu Trp Ala Ala Tyr Ser Trp Phe Ala Val Ile

355 360 365

Leu Ser Gly Ile Phe Ala Phe Leu Met Phe Gly Ile Asp Glu Ile Gly

370 375 380

Val Gln Ile Glu Glu Pro Phe Gly Ile Leu Pro Leu Glu Ala Ala Gly

385 390 395 400

Ala Thr Ile Glu Arg Asn Ile Arg Glu Leu Leu Ala Arg Asn Tyr Glu

405 410 415

Val Ala Ser Leu Val His Gln Gln Asn Leu Pro Val Gly Leu Gly Asp

420 425 430

Ser Arg Gly Lys Gln Pro Ala Gly Ser Ser Pro Ala Pro Ala Gly Gly

435 440 445

Leu Gly Gly Thr Gly Gly Ser Ala Val Ser Leu Ile Gly Leu Ala Ala

450 455 460

Glu Gly Glu Thr Glu Asp Phe Gly Glu Met Thr Gly Ala Ser Pro Ala

465 470 475 480

Asp Ala Ala Ala Val Asp Ala Glu Gly Lys Leu Gly Gly Gly Ala Arg

485 490 495

Pro Ser Ile Ile Arg Leu Ser Ala Thr Ala Gly Gly Ala Ala Pro Ala

500 505 510

Ala Ser Pro Arg Arg Val Gln Phe Ala Asp Asp Ser Thr Val Ile Asp

515 520 525

Val Arg Ser Ser Asp Gly Gly Ala Val Gly Ala Arg Pro Val Val Ile

530 535 540

Ser Ala Ala Ala Pro Gly Gly Leu Asp Tyr Arg Arg Gln Pro Leu Leu

545 550 555 560

Leu Glu Val Glu Leu Ala Ser Gly Ala Ser Pro Leu Ile Ser Pro Arg

565 570 575

Asp Ser Pro Ser Ser Ser Tyr Ser Ser Trp Leu His Asp

580 585

<210> 95

<211> 490

<212> PRT

<213> Micractinium conductrix

<400> 95

Met Pro Ala Ala Leu Cys Thr Gly Ser Ala Met Gln Leu Gln Arg Arg

1 5 10 15

Ser Pro Val Thr Ala Ala Ala Pro Ala Ala Ala Ala Gln Arg Leu Val

20 25 30

Ala Pro Ala Ala Ala Ala Ala Pro Gln His Ala Ala Ser Leu Arg Cys

35 40 45

Ser Leu Arg Ser Thr Phe Pro Gly Gly Ala Ser Ile Ser Ser Val Ala

50 55 60

Ala Leu Arg Thr Ser Ala Gly Arg Arg Ser Leu His Val Ala Gly Ala

65 70 75 80

Val Gly Pro Asn Glu Lys Arg Ala Gln Ile Gln Gln Gln Arg Leu Asp

85 90 95

Ser Leu Ser Lys Ile Asp Val Leu Phe Asp Glu Glu Leu Lys Ala Leu

100 105 110

Asp Thr Asn Leu Val Lys Glu Leu Val Ala Asp Asp Phe Lys Glu Gln

115 120 125

Asp Arg Lys Lys Leu Arg Val Val Phe Asp Phe Asp Arg Trp Gln Arg

130 135 140

His Arg Ser Ser Ser Arg Tyr Leu Arg His Met Thr Gly Leu Phe Thr

145 150 155 160

Ser Arg Thr Leu Lys Trp Met Gly Ala Pro Leu Val Cys Thr Leu Ser

165 170 175

Val Ala Thr Ala Val Gly Ile Tyr Tyr Thr Ala Ala Glu Met Gly Met

180 185 190

Val Pro Asp Ile Pro Asp Ile Lys Thr Asn Ala Val Phe Gly Leu Thr

195 200 205

Ser Phe Ala Leu Ala Asn Leu Leu Val Leu Thr Thr Asn Thr Ala Tyr

210 215 220

Gln Arg Phe Asp Glu Ala Arg Lys Met Trp Gly Leu Ile Val Asn Arg

225 230 235 240

Ser Arg Asp Met Thr Arg Gln Gly Leu Ala Tyr Ile Pro Glu Asp Gln

245 250 255

Pro Glu Leu Gln Glu Met Phe Cys Arg Trp Val Val Ala Tyr Ser Arg

260 265 270

Ser Leu Met Cys His Leu Arg Ala Gly Glu Asn Leu Glu Arg Glu Leu

275 280 285

Leu Gly Lys Leu Pro Glu Ser Glu Leu Arg Ala Leu Leu Thr Ala Thr

290 295 300

His Arg Pro Asn Phe Thr Asn Gln Val Ile Ala Gln Ile Leu Lys Arg

305 310 315 320

Ala Asp Leu Pro Gly Ala Glu Val Lys Pro Trp Asp Ser Thr Ala Asn

325 330 335

Val Lys Ala Ser Ala Phe Val Arg Met Asp Glu His Leu Thr Val Phe

340 345 350

Ala Asp Val Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val Pro

355 360 365

Leu Met Tyr Ser Arg His Thr Ser Arg Met Leu Thr Ile Trp Leu Ser

370 375 380

Phe Leu Pro Phe Ser Leu Trp Asp Ala Cys His Trp Trp Thr Val Pro

385 390 395 400

Val Thr Gly Leu Val Ala Tyr Leu Leu Leu Gly Ile Lys Glu Ile Gly

405 410 415

Leu Thr Val Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Lys Ile Cys

420 425 430

Asp Thr Ile Glu Ser Asn Val Trp Glu Leu His Ser Thr His Ser Ala

435 440 445

Gln Gly Ala Ala Ala Ser Arg Arg Arg Ser Ala Ala Thr Arg Asp Ala

450 455 460

Thr Gln Ser Met Asp Ala Glu Asp Leu Val Ser Ile Ala Ala Ala Val

465 470 475 480

Asp Ala Gly Ala Met Pro Ala Pro Ala Gln

485 490

<210> 96

<211> 460

<212> PRT

<213> Micractinium conductrix

<400> 96

Met Arg Leu Leu Pro Gly Cys Arg Arg Pro Gly Ala Ala His Gly Thr

1 5 10 15

Ala Ala Ser Leu Gly Cys Arg Pro Gln Arg Gln Arg Leu Arg Arg Ala

20 25 30

Pro Leu Ala Thr Ala Gln Pro Ser Asp Gly Asp Ser Ser Ser Ser Ser

35 40 45

Asn Gly Thr Gly Leu Leu Ser Lys Val Pro Ala Val Leu Lys Ser Val

50 55 60

Asp Glu Asp Ala Val Tyr Val Tyr Asp Ser Gly Ser Asp Asp Val Pro

65 70 75 80

Leu Asp Ile Leu Leu Leu Pro Leu Asp Arg Asp Asp Tyr Lys Glu Asp

85 90 95

Ser Arg Arg His Phe Arg Thr Val Phe Asp His Asn Arg Trp Ala Ala

100 105 110

His Arg Ser Thr Arg Arg Tyr Val Arg His Val Leu Gly Met Thr Ser

115 120 125

Ser Arg Met Val Arg Gly Leu Ala Ala Pro Leu Phe Phe Val Ala Gly

130 135 140

Ile Ser Ala Ala Val Cys Ala Gly His Gln Ala Ala Glu Ala Gly Leu

145 150 155 160

Leu Pro Leu Pro Glu Val Ala His Gln Leu Gln Met Arg Ser Thr Glu

165 170 175

Pro Phe Ala Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg

180 185 190

Thr Asn Ser Ser Tyr Ser Arg Trp Leu Asp Ala Arg Lys Asn Trp Gly

195 200 205

Leu Val Val Thr Arg Ser Arg Asp Leu Val Arg Gln Gly Ile Thr His

210 215 220

Ile Pro His Ser Glu Arg Ala Leu Ile Asp Leu Leu Cys Arg Trp Thr

225 230 235 240

Ala Ala Phe Ser Arg Ser Leu Met Ala His Leu Arg Ala Asp Val Asp

245 250 255

Ala Glu Ala Glu Leu Arg Arg Val Leu Arg Pro Ala Glu Ala Glu Ala

260 265 270

Ala Leu Ala Ala Glu His Arg Pro Gly Tyr Cys Leu Gln Val Leu Ser

275 280 285

Glu Ile Ile Lys Asp Ala Gln Leu Glu Arg Pro His Ala Ala Ala Thr

290 295 300

Ala Ala Ala Ala Thr Ala Arg Pro Gly Gln Ala Ala Lys Pro Thr Arg

305 310 315 320

Leu Asp Gly Gly Ala Ala Cys Arg Met Asp Glu Asn Leu Thr Ala Leu

325 330 335

Glu Asp Met Val Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro

340 345 350

Leu Ser Tyr Thr Arg His Thr Ser Arg Phe Met Met Ile Phe Leu Ser

355 360 365

Leu Leu Pro Phe Ala Leu Trp Glu Ser Cys Arg Trp Ala Thr Val Pro

370 375 380

Ala Val Thr Ile Ile Ser Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly

385 390 395 400

Val Thr Ile Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Gln Leu Cys

405 410 415

Asp Val Ile Glu Lys Asn Val Trp Glu Leu His Arg Cys His Val Gln

420 425 430

Pro Ala Ser Ala Ala Ile Asp Gly Ser Gly Ser Arg Pro Leu Thr Ala

435 440 445

Ala Gly Val Val Ala Ala Ala Arg Leu Ala Glu Asp

450 455 460

<210> 97

<211> 511

<212> PRT

<213> Micractinium conductrix

<400> 97

Met Arg Thr Glu Pro Gln Thr Arg Leu Ala Thr Gly Gly Ala Ala Thr

1 5 10 15

Gln Arg Arg Arg Ser Ala Pro Val Val Ala Gly Ser Ala Ala Gly Leu

20 25 30

Pro Pro Pro Ser Pro Phe Ala Ser Ser Arg Ser Gly Ala Arg Thr Gln

35 40 45

Arg Gly Ala Ala Ser Pro Glu Gln Arg Glu Val Thr Trp Ser Leu Glu

50 55 60

Asp Ala Gly Ala Asp Met Thr Ile Asn Pro Asp Arg Glu Ala Gly Arg

65 70 75 80

Arg Leu Met Arg Asp Leu Ser Asn Phe Ser His Arg Arg Trp Ala Phe

85 90 95

His Arg Ser Thr Asp Arg Tyr Trp Arg His Leu Ala Gly Ile Phe Gln

100 105 110

Ser Arg Ile Gly Arg Gln Leu Phe Val Pro Leu Ser Cys Ala Gly Gly

115 120 125

Thr Ala Ala Ala Ile Cys Ala Tyr Glu Thr Leu Leu Arg Asp Gly Ala

130 135 140

Leu Pro Ala Tyr Phe Pro Ser Phe Val Leu Pro Ser Leu Pro Phe Asp

145 150 155 160

Phe Thr Ala Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Thr

165 170 175

Ser Tyr Asp Arg Trp Gln Ala Ala Ile Asn Ala Trp Gly Asp Ile Ser

180 185 190

Thr Arg Ser Arg Asp Thr Leu Arg Gln Leu Leu Ala Tyr Thr Ser Ala

195 200 205

Thr Pro Ala Ala Ala Ala Val Ala Arg Asp Thr Ser Ala Ala Pro Leu

210 215 220

His Gly Ala Gly Gly Ser Gly Ala Ala Ala Ala Ser Ala Ala Gln Thr

225 230 235 240

Thr Ala Ala Ala Gly Lys Trp Leu Val Ala Phe Ser Arg Ser Leu Lys

245 250 255

Ala Gln Leu Thr Glu Asp Ser Asp Leu Gln Ala Glu Leu Lys Gly Val

260 265 270

Leu Thr Ala Gly Glu Leu Glu Leu Leu Thr Ala Ala Tyr His Arg Pro

275 280 285

Ser Phe Ala Leu Ala Val Leu Ser Glu Leu Val Ala Ala Ala Pro Val

290 295 300

Arg Asp Ser Gln Arg Ala Arg Leu Asp Glu Asn Leu Thr Thr Leu Glu

305 310 315 320

Asp Met Val Gly Gly Cys Glu Arg Leu Leu Arg Thr Pro Ile Pro Leu

325 330 335

Ser Tyr Thr Arg His Thr Ser Arg Phe Met Val Ile Trp Leu Ser Cys

340 345 350

Leu Pro Leu Cys Leu Trp Asn Ser Cys Gly Trp Gly Thr Val Pro Leu

355 360 365

Thr Val Val Ile Ser Phe Leu Leu Leu Gly Ile Glu Glu Ile Gly Val

370 375 380

Ala Ile Glu Glu Pro Phe Ser Ile Met Pro Leu His Glu Met Cys Ala

385 390 395 400

Glu Met Glu Cys Gly Leu Ala Asp Ile Leu Glu Gln Ala Ala Pro Ser

405 410 415

Lys Arg Ala Ala Ala Gln Ala Ala Ala Ala Ala Ala Leu Thr Ala Ala

420 425 430

Ser Ala Ala Val Gly Gly Ser Ala Asp Ala Pro Ala Asp Ala Ser Gly

435 440 445

Gly Gly Gly Gly Gly Gly Ser Thr Ala Gly Ala Ala Pro Ala Pro Ala

450 455 460

Leu Gly Val Pro Ala Ala Ala Ala Asn Ser Val Ala Pro Phe Val Leu

465 470 475 480

Gly Met Thr Ala Gln Arg Leu Arg Arg Pro Leu Ser Ala Thr Pro Arg

485 490 495

Pro Met Asp Ala Ile Phe Cys Ser Met Asp Asp Pro Asp Ala Arg

500 505 510

<210> 98

<211> 523

<212> PRT

<213> Micractinium conductrix

<400> 98

Met Pro Arg Thr Glu Asn Ser Tyr Thr His Gly Ala Arg Gly Ser Pro

1 5 10 15

Ser Leu Asp Pro Glu Gly Ser Pro Leu Thr Gln His Ala Arg Asn Ser

20 25 30

Ser Leu Gln Asn Leu Ala Arg Leu Pro Gly Val Ala Arg Ala Lys Leu

35 40 45

Gln Asn Leu Ser Gln Thr Lys Phe Val Arg Tyr Ile Glu Asp Asn Asp

50 55 60

Asp Gly Ser Arg Asp Glu Asn Asp Ile Tyr Arg Gln His Pro Gly Asp

65 70 75 80

Gln Val Phe Thr Phe Glu Arg Trp Asn Lys His Arg Asp Ser Phe Arg

85 90 95

Tyr Ala Lys His Leu Ala His Met Phe Ser Ser Arg Val Phe Lys Gln

100 105 110

Leu Leu Gly Pro Val Leu Cys Val Ser Ala Leu Ala Leu Ala Val Gly

115 120 125

Val Tyr Glu Thr Leu Val Ala Ala Gly Lys Leu Pro Gly His Trp Pro

130 135 140

His Val Thr Leu Ala Leu Gly Gln Gly Phe Asn Leu Thr Ala Phe Ala

145 150 155 160

Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr Asp Arg Trp

165 170 175

Trp Glu Ala Arg Lys Leu Trp Gly Gly Val Val Asn Arg Thr Arg Asp

180 185 190

Phe Val Arg Gln Ser Leu Val Phe Phe Arg Asp Glu Asp Ala His Leu

195 200 205

Arg Glu Leu Leu Ala Lys Trp Thr Ile Ala Phe Pro His Val Leu Met

210 215 220

Cys His Leu Arg Glu His Gly Asp Val Ala Lys Ala Val Ala Met Met

225 230 235 240

Ala Glu Ile Val Arg Thr Ala Arg Pro Pro Glu Leu Cys Arg Met Arg

245 250 255

Met Asp Glu Asn Leu Ser Phe Phe Glu Asp Ala Met Gly Ser Met Glu

260 265 270

Arg Ile Leu Arg Thr Pro Ile Pro Leu Ser Leu Val Trp Leu Ile Leu

275 280 285

Leu Pro Phe Thr Leu Trp Ala Ala Tyr Ser Trp Phe Ser Val Leu Leu

290 295 300

Ser Gly Ile Phe Ala Phe Leu Met Phe Gly Ile Asp Glu Ile Gly Val

305 310 315 320

Gln Ile Glu Glu Pro Phe Gly Ile Leu Pro Leu Glu Ala Ile Ser Ser

325 330 335

Thr Ile Glu Arg Asn Ile Arg Glu Leu Leu Ala Arg Asn Asp Glu Val

340 345 350

Val Gly Leu Val Ala Gln Ala Ala Gln Ala Gly Ala Val Ala Ala Ala

355 360 365

Ala Ala Ala Ala Ala Asp Val Ala Val Ala Ala Leu Pro Gln Gly Gly

370 375 380

Gln His Asp Ala Asp Ala Ala Thr Val Leu Ala Val Pro Gly Asp Glu

385 390 395 400

Phe Gly Glu Met Val Ala Ala Gly Ser Pro Val Gly Lys Glu Pro Ser

405 410 415

Ala Gly Asn Leu Ile Thr Leu Thr Ala Ser Ser Gly Glu Ala Ala Ala

420 425 430

Ala Ala Ala Ala Ala His His His Leu His Ala Ala Ala Arg Arg Val

435 440 445

Gln Phe Gly Gly Ala Thr Val Ile Glu Val Gly Gly Ser Asp Glu Glu

450 455 460

Ala Ala Gly Gly Gly Gly Gly Ser Pro Leu Gly Ser Pro Ser His Ala

465 470 475 480

His Ser Pro His Arg Ala Leu Asn Arg Gln Ala Ser Met Val Glu Val

485 490 495

Glu Leu Ala Ser Gly Ala Ser Pro Leu Leu Ser Pro Thr Asp Gly Ser

500 505 510

Ser Ala Pro Val Tyr Ser Asn Trp Leu Arg Asp

515 520

<210> 99

<211> 425

<212> PRT

<213> Micractinium conductrix

<400> 99

Met Thr Leu Leu Gln Gln Ala Val Pro Ser Arg Val Val Val Gly Gly

1 5 10 15

Arg Gln Pro Arg Gly Ile Gly Ser Val Leu Lys Pro Leu Arg Thr Ser

20 25 30

Cys Arg Pro Ala Lys Ala Ala Arg Gly Arg Gln Ala Leu Pro Gln Ala

35 40 45

Ser Leu Gln Pro Ala Val Ala Ala Gly Thr Ala Ala Pro Pro Pro Pro

50 55 60

Ser Tyr Val Ala Ser Ala Asn Asp Glu Arg Met Glu Ala Ser Arg Val

65 70 75 80

Glu Met Arg Ala Val Phe Asp Ala Asp Arg Trp Ile Met His Arg Ser

85 90 95

Thr Asp Arg Tyr Phe Arg His Leu Trp Gly Leu Pro Ser Ser Arg Val

100 105 110

Leu Gln Gly Leu Phe Lys Pro Ile Gly Tyr Ile Leu Ala Ile Ser Ala

115 120 125

Ala Val Cys Ala Tyr Gly Thr Ala Gln Ala Ala Gly Ala Leu Pro Ala

130 135 140

Thr Leu Pro Leu Leu Ala Ser Ala Ile Lys Leu Lys Glu Leu Phe Gly

145 150 155 160

Met Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ala

165 170 175

Ser Tyr Ala Arg Trp Asp Glu Gly Arg Lys Met Trp Gly Met Val Leu

180 185 190

Asn Arg Thr Arg Asn Ile Cys Arg Leu Gly Leu Ala Trp Ile Gly Asp

195 200 205

Asp Lys Arg Glu Leu Arg Ser Met Leu Cys Arg Trp Ala Pro Ala Phe

210 215 220

Ser Lys Thr Leu Met Cys His Leu Arg Lys Gly Glu Asp Leu Arg Glu

225 230 235 240

Glu Leu Glu Gly Ile Leu Leu Pro His Glu Ile Glu Gly Val Leu Arg

245 250 255

Ala Ser His Arg Pro Asn Tyr Val Leu Gln Val Leu Ala Gln Ile Val

260 265 270

Arg Thr Ala Gly Leu Pro Thr Ala Ala Thr Leu Arg Met Glu Asp Asp

275 280 285

Leu Thr Asn Phe Gly Asp Ser Leu Gly Gly Cys Glu Arg Leu Leu Arg

290 295 300

Thr Pro Ile Pro Leu Phe Tyr Thr Arg His Thr Ser Arg Phe Leu Met

305 310 315 320

Ile Trp Leu Thr Phe Leu Pro Ala Thr Leu Trp Pro Ala Cys Gly Leu

325 330 335

Leu Thr Leu Pro Leu Val Phe Leu Ile Ser Phe Leu Leu Leu Gly Val

340 345 350

Asp Lys Ile Gly Val Ser Ile Glu Glu Pro Phe Ser Ile Leu Ala Leu

355 360 365

Glu Val Ile Ala Gly Thr Ala Leu Ala Asn Val Arg Glu Leu Val Ala

370 375 380

Met His Glu Asp Thr Ala Ala Gly Val Ala Ala Ala Ala Asn Gly Asn

385 390 395 400

Gly Gly Ala Ala Gly Ala Pro Ala Glu Ala Asp Val Ser Ala Ala His

405 410 415

Met Val Thr Leu Ala Gly Ala Ala Ala

420 425

<210> 100

<211> 490

<212> PRT

<213> Micractinium conductrix

<400> 100

Met Ser Ala Leu Leu Arg Ala Arg Val Ser Ser Phe Leu Ala Gly Val

1 5 10 15

Ala Val Ala Gly Val Phe Gly Val Tyr Gln Leu Arg Gly Asp Val Ala

20 25 30

Glu Gly Gln Ala Gln Leu Leu Glu Gln Thr Lys Lys Tyr Thr Ser Gly

35 40 45

Leu Glu Ala Arg Val Ala Glu Leu Glu Ala Ser Val Ala Arg Leu Gln

50 55 60

Lys Ser Ser Leu Leu Leu Ala Ser Arg Pro Leu Gly Ala Gly Leu Val

65 70 75 80

Gly Leu Arg Ser Ser Gln Gly Gly Leu Glu Arg Arg Arg Arg Ala Ser

85 90 95

Ala Arg Val Ala Ala Val Ala Ser Pro Val Gly Asp Ile Glu Gly Arg

100 105 110

Lys Pro Thr Val Asp Glu Arg Arg Glu Ser Asp Leu Lys Glu Leu Arg

115 120 125

Ser Val Phe Asp Phe Ala Ala Trp Lys Arg His Arg Ser Ser Asp Arg

130 135 140

Tyr Trp Arg His Met Thr Gly Leu Trp Asp Ser Arg Thr Leu Asp Trp

145 150 155 160

Val Gly Pro Pro Leu Thr Tyr Val Met Ser Val Ala Ala Leu Val Cys

165 170 175

Leu Tyr His Ala Ala Ala Asp Ala Gly Tyr Val Ala Glu Val Ile Pro

180 185 190

Glu Leu Lys Pro Ala Ala Thr Ala Pro Phe Ser Leu Thr Ser Phe Ala

195 200 205

Leu Ser Thr Leu Leu Val Leu Arg Thr Asn Thr Ser Tyr Gln Arg Trp

210 215 220

Asp Glu Ala Arg Lys Met Trp Gly Leu Ile Val Asn Arg Ser Arg Asp

225 230 235 240

Ile Ser Arg Gln Ala Leu Gly Tyr Ile Pro Ala Thr Gln Pro Glu Leu

245 250 255

Gln Asp Met Phe Ile Arg Trp Val Val Ala Tyr Ser Arg Ser Leu Met

260 265 270

Cys His Leu Arg Ala Gly Glu Asp Leu Glu Lys Glu Leu Lys Asp Thr

275 280 285

Leu Gly Pro Glu Glu Leu Lys Ala Leu Met Ala Ser Ala His Arg Pro

290 295 300

Asn Tyr Thr Val Gln Val Leu Thr Ser Ile Ile Lys Ala Ala Gln Leu

305 310 315 320

Pro Gly Glu Pro Ile Ser Asn Tyr Asn Ser Thr Ala Asn Val Lys Ala

325 330 335

Ser Ala Ala Phe Arg Met Asp Glu Asn Leu Thr Cys Phe Ala Asp Val

340 345 350

Thr Gly Gly Cys Glu Arg Ile Leu Arg Thr Pro Val Pro Leu Met Tyr

355 360 365

Thr Arg His Asn Ser Arg Phe Leu Met Ile Trp Leu Thr Leu Leu Pro

370 375 380

Leu Thr Leu Trp Asp Ser Cys His Trp Phe Thr Met Pro Val Thr Gly

385 390 395 400

Ile Val Ala Phe Leu Leu Leu Gly Ile Lys Glu Ile Gly Val Ile Val

405 410 415

Glu Glu Pro Phe Ser Ile Leu Pro Leu Glu Lys Ile Cys Asp Thr Ile

420 425 430

Glu Gly Asn Val Arg Glu Leu His Ala Thr His Ser Ala Asp Ala Ile

435 440 445

Ser Ala Gln Leu Ala Val Ala Asn Ala Gln Asn Ser Gly Ala Ala Ser

450 455 460

Gly Gly Val Asp Ala Asp Thr Leu Val Asn Thr Val Val Pro Ala Val

465 470 475 480

Thr Leu Arg Lys Pro Ala Val Ala Ala Leu

485 490

<210> 101

<211> 1322

<212> PRT

<213> Micractinium conductrix

<400> 101

Met Gly Ala Ser Thr Asp Asp Ser Ala Ala Met Ala Asp His Pro Gly

1 5 10 15

Arg Thr Pro Gly Gly Arg Pro Pro Pro Leu Ser Ser Ser Val Gly Gly

20 25 30

Ser Ser Arg Ala Lys Ala Met Leu Ala Met Ala Thr Gly Gly Gly Gly

35 40 45

Lys Ala Lys Thr Arg Thr Pro Ser Gly Arg Pro Thr Pro Pro Pro Ile

50 55 60

Thr Phe Glu Arg Arg Lys Lys Arg Pro Gln Ser Glu Pro Gly Asp Gly

65 70 75 80

Gly Gly Gly Glu Ala Ala Ala Leu Gly Gly Glu Thr Thr Pro Lys Arg

85 90 95

Gln Arg Thr Pro Ala Gly Ala Asp Cys Pro Ser Val Pro Val Ala Ala

100 105 110

Pro Arg Pro Ala Ser Leu Leu Ala Ala Arg Pro Gly Ser Ala Ala Gly

115 120 125

Ser Ala Gly Asp Ala Pro Arg Leu Thr Cys Tyr Ser Asn Ala Gln Arg

130 135 140

Leu Arg Glu Leu Ala Ala Glu Gly Gly Asp Ala Leu Ala Arg Arg Arg

145 150 155 160

Ala Ala Leu Gly Gly Ser Gly Phe Ile His Arg Arg Pro Ser Ser Gly

165 170 175

Gly Ser Leu Gly Arg Met Gln Gly Leu Ser Arg Leu Pro Ala Gly Met

180 185 190

Met Asn Leu Gly Asn Thr Cys Tyr Leu Asn Ala Val Leu Gln Val Leu

195 200 205

Leu Ser Leu Pro Ser Phe Val Ala Asp Leu Arg His Gly Arg Ala Ala

210 215 220

Leu Glu Ala Ala Gly Gln Pro Leu Ala Pro Ser Gly Val Tyr Ser Ala

225 230 235 240

Leu Leu Glu Cys Ala Ala Ala Arg Glu Arg Gly Phe Glu Arg Tyr Leu

245 250 255

Thr Pro Ala Ser Leu Lys Arg Ala Leu Asp Ala Ala Ser Ser Ala Phe

260 265 270

His Gly Thr Leu Gln Gln Asp Ala His Glu Leu Phe Cys Ser Leu Leu

275 280 285

Asp Ala Ala Gln Gly Glu Val Leu Ala Arg Glu Val Ala Arg Leu Gly

290 295 300

Arg Thr Arg Val Ala Val Ser Glu Thr Ala Asp Pro Gly Ala Arg Asn

305 310 315 320

Phe Gly Phe Ala Met Gln His Glu Leu Val Cys Gly Ala Cys Gly His

325 330 335

Thr Ser Gln Leu Val Glu Gln Tyr Thr His Leu Ser Leu Glu Leu Pro

340 345 350

Pro Ala Gln Pro Gly Gly Thr Ala Ala Cys Ser Val Ala Ser Leu Leu

355 360 365

Arg Asp Tyr Phe Lys Glu Glu Gln Val Glu Lys Ala Cys Glu Ala Cys

370 375 380

Gly Gly Gly Gly Val Ala His Thr Leu Arg His Ala Val Lys Arg Leu

385 390 395 400

Pro Arg Val Leu Val Leu His Leu Lys Arg Phe Lys Ile Ser Trp Ser

405 410 415

Ala Glu Gln Gln Arg Val Val Cys Gln Lys Val His Thr Gly Val Gly

420 425 430

Met Pro Glu Thr Val Gln Leu Gly Arg Leu Leu Ala Ala Gly Pro Ala

435 440 445

Pro Pro Leu Leu Gly Gly Gln Gln Leu Gly Ala Gly Lys Glu Asn Glu

450 455 460

Gln Leu Glu Ala Asn Ala Gly Val Val Gly Ser Ala Ala Gln Gln Gln

465 470 475 480

Gln Gln Gln Gln Gln Arg Gly Asp Asp Ser Val Ala Lys Gly Leu Arg

485 490 495

Met Arg Glu Gln Ala Gly Phe Ser Phe Tyr Ser Gly Gly Gly Gly Ala

500 505 510

Thr Pro Val Ala Ala Ser Ala Leu Leu Ser Pro Gly Ala Leu His Ser

515 520 525

Pro Thr Leu Arg Arg Arg Leu Gly Thr Pro Ala Ala Pro Lys Leu Ser

530 535 540

Asn Ile Val Val Asp Asn Asp Asp Ala Val Leu Gln Arg Val Leu Ala

545 550 555 560

Glu Ser Leu Arg Glu Gln Gln Pro Gly Gly Gly Gln Leu Pro Gly Gly

565 570 575

Thr Ala Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln

580 585 590

Gln Gln Gln Asp Gly Pro Glu Leu Ser Leu Gly Pro Gly Gly Cys Leu

595 600 605

Gln Arg His Ser Thr Glu Gly Ala Glu Cys Pro Leu Ile Arg Cys Gly

610 615 620

Ser Pro Gly Leu Arg Gln Ala Glu Ala Ala Pro Leu Leu Leu Pro Glu

625 630 635 640

Val Ala Ala Ala Ala Ala Ala Gly Ser Ala Pro Ala Gly Gly Cys His

645 650 655

Lys Leu Glu Asp Gln Trp Phe Thr Gly Phe Arg Arg Gly Ser Pro Pro

660 665 670

Ala Ala Pro Met Ala Ala Glu Gln Glu Ala Ala Glu Leu Gln Arg Val

675 680 685

Leu Asp Met Ser Arg Arg Glu His Glu Arg Gln Ala Ala Ala Val Ala

690 695 700

Val Arg Ser Ser Ser Ala Ala Gly Ser Ala Ala Gln Gln Glu Glu Ala

705 710 715 720

Asp Leu Leu Arg Ala Ile Glu Leu Ser Met Gln Glu Gln Arg Gly Lys

725 730 735

Gln Pro Thr Ser Thr Gln Pro Gln Gln His Gly Gly Ser Gln Gly Thr

740 745 750

Ala Gly Gly Asp Ser Ser Gly Gly Ala Gly Gly Ala Ala Ala Gly Ala

755 760 765

Ala Ala Pro Gly Ala Ser Ala Ala Ala Ala Ala Ala Ala Ala Ala Val

770 775 780

Thr Glu Gln Phe Asp Ala Gly Glu Ala Gly Lys Ala Glu Glu Ala Ala

785 790 795 800

Ser Ala Val Gln Ser Val Ala Pro His Gly Asp Asp Gly Val Glu Leu

805 810 815

Val Ala Asp Ala Gly Gly Ala Ala Pro Ala Pro Leu His Ala Gln Ile

820 825 830

Val Glu Asp Asn Asp Ala Gln Leu Ala Ala Gln Arg Ala Gln Gln Ala

835 840 845

Gln His Gly Ser Ser Gly Ala Ser Ala Asp Gln Gln Ala Ala Ala Glu

850 855 860

Val Thr Asp Ala Ala Glu Ala Ala Ala Gly Ala Glu Glu Lys Ala Ala

865 870 875 880

Ala Ala Ala Ala Val Arg Ser Gly Lys Pro Pro Ala Ala Glu Tyr Arg

885 890 895

Leu His Ala Val Val Asn His Lys Gly Pro Ala Ala Ser Cys Gly His

900 905 910

Phe Thr Ser Asp Ile Arg Asp Ala Ala Ser Gly Val Trp His Arg Phe

915 920 925

Asp Asp Ser Leu Ala Ser Arg Ile Ala Gly Trp Glu Ala Arg Ser Ser

930 935 940

Glu Lys Gln Arg Glu Cys Tyr Leu Leu Phe Tyr Thr Gly Thr Val Ala

945 950 955 960

Gly Leu Ile Tyr Ser Asp Arg Asp Glu Gly Lys Glu Phe Arg Leu Ala

965 970 975

Asp Phe Arg Thr Val Tyr Thr Phe Glu Ser Trp Ala Ala His Arg Ser

980 985 990

Thr Met Arg Tyr Leu Arg His Phe Met Gly Met Phe Arg Ser Arg Val

995 1000 1005

Leu Cys Gly Leu Arg Val Pro Leu Leu Leu Ile Ala Leu Glu Ala Thr

1010 1015 1020

Leu Val Cys Ser Tyr Glu His Ala Leu Lys Asn Gly Leu Leu Pro Ala

1025 1030 1035 1040

Phe Cys Arg Thr Ile Gln Ile Arg Ala Pro Met Leu Phe Ser Leu Ser

1045 1050 1055

Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Gln Ser Tyr

1060 1065 1070

Ala Arg Phe Asp Glu Gly Arg Arg Leu Trp Ser Val Met Ala Asn Arg

1075 1080 1085

Cys Arg Asp Val Met Arg Gln Ala Cys Ser Tyr Leu Ser Leu Gly Pro

1090 1095 1100

Gln Asn Ala Ala Leu Leu Ala Thr Leu Ser Arg Trp Met Gln Ala Phe

1105 1110 1115 1120

Pro Trp Val Met Lys Asn Tyr Val Arg Glu Ser Lys Ser Trp His Ala

1125 1130 1135

Asp Leu Gly Ser Leu Leu Arg Pro Ala Glu Leu Ala Ala Leu Leu Asp

1140 1145 1150

Thr Arg Asn Pro Pro Leu Leu Thr Leu Gln Val Ile Thr Glu Ile Leu

1155 1160 1165

Asp Arg Met Pro Ile Ser Thr Lys Gln Arg Leu Arg Leu Asp Ile Phe

1170 1175 1180

Met Thr Glu Leu Ser Asp Met Val Gly Ala Ser Glu Arg Leu Ile Thr

1185 1190 1195 1200

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Ile

1205 1210 1215

Thr Trp Leu Val Leu Thr Pro Phe Thr Ile Phe Ser Ser Cys Gly Trp

1220 1225 1230

Val Thr Ile Phe Ser Ser Val Leu Leu Ala Phe Phe Leu Leu Thr Ile

1235 1240 1245

Glu Glu Ile Gly Val Thr Ile Glu Glu Pro Phe Asn Ile Leu Pro Leu

1250 1255 1260

Glu Ala Ile Asn Thr Arg Val Cys Ala Asp Ile Ala Arg Tyr Pro Gln

1265 1270 1275 1280

Lys Ile Asp Thr Val Val Ser Leu Val Asp Asp Ala Thr Gly Thr Gln

1285 1290 1295

Arg Pro Gln Gln Gln Pro Pro Phe Gln Pro Val Ala Glu Phe Val Ser

1300 1305 1310

Thr Ala Ala Thr Ser Asp Asn Gly Asp Ser

1315 1320

<210> 102

<211> 1327

<212> PRT

<213> Micractinium conductrix

<400> 102

Met Gly Ala Ser Thr Asp Asp Ser Ala Ala Met Ala Asp His Pro Gly

1 5 10 15

Arg Thr Pro Gly Gly Arg Pro Pro Pro Leu Ser Ser Ser Val Gly Gly

20 25 30

Ser Ser Arg Ala Lys Ala Met Leu Ala Met Ala Thr Gly Gly Gly Gly

35 40 45

Lys Ala Lys Thr Arg Thr Pro Ser Gly Arg Pro Thr Pro Pro Pro Ile

50 55 60

Thr Phe Glu Arg Arg Lys Lys Arg Pro Gln Ser Glu Pro Gly Asp Gly

65 70 75 80

Gly Gly Gly Glu Ala Ala Ala Leu Gly Gly Glu Thr Thr Pro Lys Arg

85 90 95

Gln Arg Thr Pro Ala Gly Ala Asp Cys Pro Ser Val Pro Val Ala Ala

100 105 110

Pro Arg Pro Ala Ser Leu Leu Ala Ala Arg Pro Gly Ser Ala Ala Gly

115 120 125

Ser Ala Gly Asp Ala Pro Arg Leu Thr Cys Tyr Ser Asn Ala Gln Arg

130 135 140

Leu Arg Glu Leu Ala Ala Glu Gly Gly Asp Ala Leu Ala Arg Arg Arg

145 150 155 160

Ala Ala Leu Gly Gly Ser Gly Phe Ile His Arg Arg Pro Ser Ser Gly

165 170 175

Gly Ser Leu Gly Arg Met Gln Gly Leu Ser Arg Leu Pro Ala Gly Met

180 185 190

Met Asn Leu Gly Asn Thr Cys Tyr Leu Asn Ala Val Leu Gln Val Leu

195 200 205

Leu Ser Leu Pro Ser Phe Val Ala Asp Leu Arg His Gly Arg Ala Ala

210 215 220

Leu Glu Ala Ala Gly Gln Pro Leu Ala Pro Ser Gly Val Tyr Ser Ala

225 230 235 240

Leu Leu Glu Cys Ala Ala Ala Arg Glu Arg Gly Phe Glu Arg Tyr Leu

245 250 255

Thr Pro Ala Ser Leu Lys Arg Ala Leu Asp Ala Ala Ser Ser Ala Phe

260 265 270

His Gly Thr Leu Gln Gln Asp Ala His Glu Leu Phe Cys Ser Leu Leu

275 280 285

Asp Ala Ala Gln Gly Glu Val Leu Ala Arg Glu Val Ala Arg Leu Gly

290 295 300

Arg Thr Arg Val Ala Val Ser Glu Thr Ala Asp Pro Gly Ala Arg Asn

305 310 315 320

Phe Gly Phe Ala Met Gln His Glu Leu Val Cys Gly Ala Cys Gly His

325 330 335

Thr Ser Gln Leu Val Glu Gln Tyr Thr His Leu Ser Leu Glu Leu Pro

340 345 350

Pro Ala Gln Pro Gly Gly Thr Ala Ala Cys Ser Val Ala Ser Leu Leu

355 360 365

Arg Asp Tyr Phe Lys Glu Glu Gln Val Glu Lys Ala Cys Glu Ala Cys

370 375 380

Gly Gly Gly Gly Val Ala His Thr Leu Arg His Ala Val Lys Arg Leu

385 390 395 400

Pro Arg Val Leu Val Leu His Leu Lys Arg Phe Lys Ile Ser Trp Ser

405 410 415

Ala Glu Gln Gln Arg Val Val Cys Gln Lys Val His Thr Gly Val Gly

420 425 430

Met Pro Glu Thr Val Gln Leu Gly Arg Leu Leu Ala Ala Gly Pro Ala

435 440 445

Pro Pro Leu Leu Gly Gly Gln Gln Leu Gly Ala Gly Lys Glu Asn Glu

450 455 460

Gln Leu Glu Ala Asn Ala Gly Val Val Gly Ser Ala Ala Gln Gln Gln

465 470 475 480

Gln Gln Gln Gln Gln Arg Gly Asp Asp Ser Val Ala Lys Gly Leu Arg

485 490 495

Met Arg Glu Gln Ala Gly Phe Ser Phe Tyr Ser Gly Gly Gly Gly Ala

500 505 510

Thr Pro Val Ala Ala Ser Ala Leu Leu Ser Pro Gly Ala Leu His Ser

515 520 525

Pro Thr Leu Arg Arg Arg Leu Gly Thr Pro Ala Ala Pro Lys Leu Ser

530 535 540

Asn Ile Val Val Asp Asn Asp Asp Ala Val Leu Gln Arg Val Leu Ala

545 550 555 560

Glu Ser Leu Arg Glu Gln Gln Pro Gly Gly Gly Gln Leu Pro Gly Gly

565 570 575

Thr Ala Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln

580 585 590

Gln Gln Gln Asp Gly Pro Glu Leu Ser Leu Gly Pro Gly Gly Cys Leu

595 600 605

Gln Arg His Ser Thr Glu Gly Ala Glu Cys Pro Leu Ile Arg Cys Gly

610 615 620

Ser Pro Gly Leu Arg Gln Ala Glu Ala Ala Pro Leu Leu Leu Pro Glu

625 630 635 640

Val Ala Ala Ala Ala Ala Ala Gly Ser Ala Pro Ala Gly Gly Cys His

645 650 655

Lys Leu Glu Asp Gln Trp Phe Thr Gly Phe Arg Arg Gly Ser Pro Pro

660 665 670

Ala Ala Pro Met Ala Ala Glu Gln Glu Ala Ala Glu Leu Gln Arg Val

675 680 685

Leu Asp Met Ser Arg Arg Glu His Glu Arg Gln Ala Ala Ala Val Ala

690 695 700

Val Arg Ser Ser Ser Ala Ala Gly Ser Ala Ala Gln Gln Glu Glu Ala

705 710 715 720

Asp Leu Leu Arg Ala Ile Glu Leu Ser Met Gln Glu Gln Arg Gly Lys

725 730 735

Gln Pro Thr Ser Thr Gln Pro Gln Gln His Gly Gly Ser Gln Gly Thr

740 745 750

Ala Gly Gly Asp Ser Ser Gly Gly Ala Gly Gly Ala Ala Ala Gly Ala

755 760 765

Ala Ala Pro Gly Ala Ser Ala Ala Ala Ala Ala Ala Ala Ala Ala Val

770 775 780

Thr Glu Gln Phe Asp Ala Gly Glu Ala Gly Lys Ala Glu Glu Ala Ala

785 790 795 800

Ser Ala Val Gln Ser Val Ala Pro His Gly Asp Asp Gly Val Glu Leu

805 810 815

Val Ala Asp Ala Gly Gly Ala Ala Pro Ala Pro Leu His Ala Gln Ile

820 825 830

Val Glu Asp Asn Asp Ala Gln Leu Ala Ala Gln Arg Ala Gln Gln Ala

835 840 845

Gln His Gly Ser Ser Gly Ala Ser Ala Asp Gln Gln Ala Ala Ala Glu

850 855 860

Val Thr Asp Ala Ala Glu Ala Ala Ala Gly Ala Glu Glu Lys Ala Ala

865 870 875 880

Ala Ala Ala Ala Val Arg Ser Gly Lys Pro Pro Ala Ala Glu Tyr Arg

885 890 895

Leu His Ala Val Val Asn His Lys Gly Pro Ala Ala Ser Cys Gly His

900 905 910

Phe Thr Ser Asp Ile Arg Asp Ala Ala Ser Gly Val Trp His Arg Phe

915 920 925

Asp Asp Ser Leu Ala Ser Arg Ile Ala Gly Trp Glu Ala Arg Ser Ser

930 935 940

Glu Lys Gln Arg Glu Cys Tyr Leu Leu Phe Tyr Thr Gly Thr Val Ala

945 950 955 960

Gly Leu Ile Tyr Ser Asp Arg Asp Glu Gly Lys Glu Phe Arg Leu Ala

965 970 975

Asp Phe Arg Thr Val Tyr Thr Phe Glu Ser Trp Ala Ala His Arg Ser

980 985 990

Thr Met Arg Tyr Leu Arg His Phe Met Gly Met Phe Arg Ser Arg Val

995 1000 1005

Leu Cys Gly Leu Arg Val Pro Leu Leu Leu Ile Ala Leu Glu Ala Thr

1010 1015 1020

Leu Val Cys Ser Tyr Glu His Ala Leu Lys Asn Gly Leu Leu Pro Ala

1025 1030 1035 1040

Phe Cys Arg Thr Ile Gln Ile Arg Ala Pro Met Leu Phe Ser Leu Ser

1045 1050 1055

Ser Phe Ala Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Gln Ser Tyr

1060 1065 1070

Ala Arg Phe Asp Glu Gly Arg Arg Leu Trp Ser Val Met Ala Asn Arg

1075 1080 1085

Cys Arg Asp Val Met Arg Gln Ala Cys Ser Tyr Leu Ser Leu Gly Pro

1090 1095 1100

Gln Asn Ala Ala Leu Leu Ala Thr Leu Ser Arg Trp Met Gln Ala Phe

1105 1110 1115 1120

Pro Trp Val Met Lys Asn Tyr Val Arg Glu Ser Lys Ser Trp His Ala

1125 1130 1135

Asp Leu Gly Ser Leu Leu Arg Pro Ala Glu Leu Ala Ala Leu Leu Asp

1140 1145 1150

Thr Arg Asn Pro Pro Leu Leu Thr Leu Gln Val Ile Thr Glu Ile Leu

1155 1160 1165

Asp Arg Met Pro Ile Ser Thr Lys Gln Arg Leu Arg Leu Asp Ile Phe

1170 1175 1180

Met Thr Glu Leu Ser Asp Met Val Gly Ala Ser Glu Arg Leu Ile Thr

1185 1190 1195 1200

Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ala Arg Phe Leu Ile

1205 1210 1215

Thr Trp Leu Val Leu Thr Pro Phe Thr Ile Phe Ser Ser Cys Gly Trp

1220 1225 1230

Val Thr Ile Phe Ser Ser Val Leu Leu Ala Phe Phe Leu Leu Thr Ile

1235 1240 1245

Glu Glu Ile Gly Val Thr Ile Glu Glu Pro Phe Asn Ile Leu Pro Leu

1250 1255 1260

Glu Ala Ile Asn Thr Arg Ala Ile Asn Thr Arg Val Cys Ala Asp Ile

1265 1270 1275 1280

Ala Arg Tyr Pro Gln Lys Ile Asp Thr Val Val Ser Leu Val Asp Asp

1285 1290 1295

Ala Thr Gly Thr Gln Arg Pro Gln Gln Gln Pro Pro Phe Gln Pro Val

1300 1305 1310

Ala Glu Phe Val Ser Thr Ala Ala Thr Ser Asp Asn Gly Asp Ser

1315 1320 1325

<210> 103

<211> 333

<212> PRT

<213> Physcomitrella patens

<400> 103

Met His Arg Asn Ser Val Tyr Gly His Gly Glu Trp Lys Lys His Lys

1 5 10 15

Ser Ser Trp Arg His Val Arg His Val Cys Thr Ile Leu Ser Ser Gly

20 25 30

Leu Ile Arg Ala Ile Gly Pro Pro Val Phe Leu Cys Thr Leu Val Ser

35 40 45

Val Phe Val Ala Val Ile Asn His Cys Val Asp Asn Gly Val Leu Pro

50 55 60

Ser Trp Phe Pro Val Leu Lys Val Ala Thr Leu Pro Phe Thr Leu Thr

65 70 75 80

Ser Pro Val Leu Ala Leu Leu Leu Val Phe Arg Thr Asn Thr Ser Tyr

85 90 95

Gln Arg Phe Asp Glu Ala Arg Lys Ala Trp Gly Ser Asn Val Asn Arg

100 105 110

Ala Arg Asp Leu Ala Arg Gln Ala Leu Thr Trp Ile Arg Asn Pro Gly

115 120 125

Asp Ser Lys Lys Leu Gln Cys Leu Leu Arg Tyr Thr Lys Ala Tyr Ser

130 135 140

Phe Cys Leu Met His His Leu Arg Glu Glu Gly Cys Leu Arg Lys Glu

145 150 155 160

Leu Glu Ala Thr Ile Val Asn Glu Glu Glu Val Glu Cys Val Met Asn

165 170 175

Ser Lys Asn Arg Pro Ile Trp Val Leu Gln Val Ile Ser Asp Ile Ile

180 185 190

Asn Glu Cys Gln Ile Thr Pro Trp Glu Arg Ile Ala Met Asp Lys Asn

195 200 205

Ile Thr Gln Phe His Asp Asn Val Gly Ala Cys Glu Arg Ile Phe Lys

210 215 220

Thr Pro Ile Pro Val Ala Tyr Thr Arg Leu Thr Ser Arg Val Leu Thr

225 230 235 240

Leu Trp His Leu Val Leu Pro Phe Ala Leu Trp Glu Thr Cys Gly Trp

245 250 255

His Thr Ile Thr Val Ser Phe Val Ser Ser Ala Ala Leu Phe Tyr Ile

260 265 270

Glu Glu Val Gly Val Met Ile Glu Glu Pro Phe Ser Ile Leu Ala Leu

275 280 285

Ser Thr Ile Cys Thr Gly Ile Val Ala Ala Leu Glu Gly Leu Ser Asn

290 295 300

Ala His Thr Asp Ala Leu Ile Leu Val Trp Gly Ile Val Glu Gln Gln

305 310 315 320

Trp Ser Thr Lys Ala Asp His Leu Met Ile Asn Leu Lys

325 330

<210> 104

<211> 402

<212> PRT

<213> Physcomitrella patens

<400> 104

Met His Arg Asn Thr Val Tyr Gly His Asp Glu Trp Arg Arg His Lys

1 5 10 15

Ser Ser Trp Arg His Ala Arg His Val Ile Ser Ile Ala Ala Ser Gly

20 25 30

Val Ile Ala Ala Leu Gly Pro Pro Val Leu Leu Ser Thr Ile Thr Ala

35 40 45

Val Phe Val Thr Val Ile Asn His Gly Val Gln His Met Leu Val Ala

50 55 60

Ser Trp Val Pro Tyr Leu Lys Val Ser Pro Ile Pro Phe Thr Phe Ile

65 70 75 80

Ser Pro Val Leu Ala Phe Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr

85 90 95

Gln Arg Phe Asp Glu Ala Arg Lys Val Trp Gly Ser Asn Val Asn Arg

100 105 110

Cys Arg Asp Leu Ala Arg Gln Ala Leu Ser Trp Ile Lys Asn Pro Glu

115 120 125

Asp Ala Ala Arg Leu Glu Cys Leu Leu Arg Phe Leu Lys Ala Tyr Pro

130 135 140

Tyr Tyr Leu Lys Leu His Leu Thr Gln Glu Gly Pro Ser Ser Ser Thr

145 150 155 160

Thr Ser Glu Ile Lys Asp Ile Leu Lys Asp Glu Glu Phe His Lys Val

165 170 175

Ser Leu Val Gln Asn Gln Pro Ile Tyr Val Leu Gln Val Ile Ser Glu

180 185 190

Ile Ile Ser Gln Cys His Ile Pro Asn Trp Glu Lys Ile Cys Met Asp

195 200 205

Ala Asn Leu Thr Gln Phe His Asp Asn Val Gly Ala Cys Glu Arg Ile

210 215 220

Phe Lys Thr Pro Ile Pro Ile Ala Tyr Thr Arg Met Thr Ser Arg Met

225 230 235 240

Leu Ile Met Trp His Leu Ala Leu Pro Tyr Gly Leu Trp Asn Asp Cys

245 250 255

Arg Trp Leu Thr Ile Pro Ala Thr Phe Met Ser Ser Ala Ala Leu Phe

260 265 270

Tyr Ile Glu Gln Val Gly Val Val Ile Glu Glu Pro Phe Cys Ile Leu

275 280 285

Ala Leu Asp Ser Ile Cys Gly Gly Ile Arg Ser Ala Ile Asp Met Phe

290 295 300

Arg Ala Thr Arg Glu Asp Val Phe Leu Leu Thr Glu Ser Ile Arg Ser

305 310 315 320

Glu His Pro Lys Lys Thr Asp Thr Thr Lys Asn Leu Glu Gln Ile Ile

325 330 335

Glu Met Glu Ser Met Asp Ser Asp Pro Leu Glu Glu Thr Ser Lys Glu

340 345 350

Asp Glu Val Met Leu Gly Leu Gly Arg Ser Lys Ser Tyr Lys Ser Tyr

355 360 365

Ser Gly Arg Lys Phe Phe Asp Lys Ser Arg Ser His Ser His Ser Thr

370 375 380

Thr Ser Leu Tyr Gly Asp Leu Asn Val Gly Phe Ser Lys Leu Lys Ser

385 390 395 400

Val Ser

<210> 105

<211> 353

<212> PRT

<213> Physcomitrella patens

<400> 105

Met His Arg Asn Thr Val Tyr Gly His Thr Glu Trp Arg Arg His Lys

1 5 10 15

Ser Cys Trp Arg His Ser Arg His Leu Ser Ser Ile Phe Ser Ser Gly

20 25 30

Val Ile Phe Thr Leu Gly Pro Pro Val Ile Leu Cys Thr Leu Val Ala

35 40 45

Thr Leu Val Ser Val Ile Asn His Leu Val Gln Asp Arg Arg Leu Pro

50 55 60

Lys Trp Met Pro Leu Leu His Val Ala Ser Leu Pro Phe Thr Leu Thr

65 70 75 80

Ala Pro Val Leu Ala Leu Leu Leu Val Phe Arg Thr Asn Ala Ser Tyr

85 90 95

Ser Arg Phe Asp Glu Ala Arg Lys Ala Trp Gly Ser Asn Val Asn Arg

100 105 110

Thr Arg Asp Leu Ala Arg Gln Ala Leu Thr Trp Ile Arg Met Pro Cys

115 120 125

Asp Ala Pro Lys Leu His Cys Leu Leu Arg His Ile Lys Ala Tyr Ser

130 135 140

Leu Cys Leu Lys Asp His Met Thr Glu Asp Asn Thr Leu Arg Glu Glu

145 150 155 160

Leu Thr Ala Val Leu Glu Pro Ser Glu Val Asp Cys Ala Met Ser Ser

165 170 175

Gln His Arg Pro Asn Tyr Ile Leu Gln Val Met Ser Glu Leu Ile Ser

180 185 190

Gln Cys Gln Ile Ser Gln Trp Glu Lys Ile Thr Met Asp Lys Asn Ile

195 200 205

Thr Ala Phe His Asp Asn Val Gly Ala Cys Glu Arg Ile Phe Lys Thr

210 215 220

Pro Ile Pro Leu Ala Tyr Thr Arg Leu Thr Ser Arg Met Leu Met Phe

225 230 235 240

Trp His Leu Ala Leu Pro Val Gly Leu Trp Asn Thr Cys Gly Trp Leu

245 250 255

Thr Ile Pro Val Ser Phe Met Ser Ala Ala Ala Leu Phe Tyr Ile Glu

260 265 270

Glu Val Gly Val Leu Ile Glu Glu Pro Phe Trp Ile Leu Pro Leu Leu

275 280 285

Ser Ile Ser Gln Gly Ile Cys Ser Ala Val Asp Gly Leu Tyr Val Ala

290 295 300

His Lys Glu Ala Ser Met Leu Trp Ser Ile His Gln Pro Thr Asn Val

305 310 315 320

Asn Asp His Val Ile Ile Ser Phe Asp Gly Ser Arg Ser Ala Gly Ile

325 330 335

Tyr Gln His Asn Asn Ile Asp Val Lys Phe Ser Arg Val Asn Ser Val

340 345 350

Gly

<210> 106

<211> 353

<212> PRT

<213> Physcomitrella patens

<400> 106

Met His Arg Asn Lys Val Tyr Gly His Ala Glu Trp Ala Lys His Lys

1 5 10 15

Ser Ser Trp Arg His Gly Arg His Leu Met Ser Ile Leu Ser Ser Gly

20 25 30

Val Ile Ser Ala Val Gly Pro Pro Val Leu Ala Cys Thr Leu Leu Ala

35 40 45

Thr Phe Val Thr Val Phe Asn Tyr Phe Val Lys Val Gly Arg Leu Pro

50 55 60

Asn Trp Ile Pro Ile Leu Glu Val Ser Ser Leu Pro Phe Thr Leu Thr

65 70 75 80

Ser Ser Val Leu Ser Leu Leu Leu Val Phe Arg Thr Asn Ser Ser Tyr

85 90 95

Asn Arg Phe Asp Glu Ala Arg Lys Ile Trp Gly Ser Asn Val Asn Arg

100 105 110

Thr Arg Asp Leu Ala Arg Gln Ala Leu Ser Trp Ile Arg Ser Pro Ala

115 120 125

Asp Ala Tyr Lys Leu Ser Cys Leu Leu Arg His Ile Lys Ala Tyr Pro

130 135 140

Phe Ser Leu Lys Asp His Leu Thr Glu Asp Phe Ile Leu Lys Asp Glu

145 150 155 160

Leu Asp Gln Ile Leu Glu Pro Gln Glu Leu Glu Ala Leu Met Ala Thr

165 170 175

Lys His Arg Pro Asn Tyr Ile Leu Gln Val Leu Ser Glu Leu Val Asp

180 185 190

Lys Cys Asn Leu Ser Glu Trp Glu Lys Met Ala Met Asp Glu Asn Ile

195 200 205

Thr Thr Phe His Asp Asn Val Gly Ala Cys Glu Arg Ile Leu Lys Thr

210 215 220

Pro Ile Pro Leu Ala Tyr Thr Leu Val Thr Ser Arg Phe Leu Ile Leu

225 230 235 240

Trp His Leu Val Leu Pro Phe Ala Leu Trp Ala Thr Cys His Trp Leu

245 250 255

Thr Ile Pro Val Thr Phe Leu Thr Ala Thr Ala Leu Phe Tyr Ile Glu

260 265 270

Glu Val Gly Val Leu Ile Glu Glu Pro Phe Trp Ile Leu Pro Leu Leu

275 280 285

Ser Ile Ser Asp Gly Ile Val Ala Ala Leu Asp Gly Leu Ala Ala Ala

290 295 300

His Lys Thr Ser Ser Leu Leu Trp Arg Leu His Gln Pro Asn Lys Asp

305 310 315 320

His Val Val Gln Ile Thr Phe Glu Thr Ser Arg Ser Asp Gly Phe Arg

325 330 335

Lys Ser Arg Asp Val Gly His Val Leu Leu Thr Arg Met Asn Ser Ile

340 345 350

Ala

<210> 107

<211> 391

<212> PRT

<213> Physcomitrella patens

<400> 107

Met Phe Trp Lys His Pro Ser Gly Arg Thr Ala Ser Ser Glu Gly Phe

1 5 10 15

Val Ile Lys Pro Pro Asp Ser Val Gln Gln Glu Gln Gln Ser Val Asp

20 25 30

Thr Ala Gly Phe Ser Leu Leu Phe His Pro Asn Ala Leu Ser His Lys

35 40 45

His Lys Val Ser Asp Glu Lys Val Ala Trp Gly Glu Thr Ser Lys Gly

50 55 60

Gly Val Ser Gly Gly Gly Gly Gly Gly Ser Val Thr Leu Glu Phe Phe

65 70 75 80

Ser Phe Lys Asn Ala Ser Gln Arg Ser Val Trp Ala Arg Arg Met Gly

85 90 95

Leu His Lys Ser Ser Trp Arg His Gly Arg His Ile Gln Thr Ala Phe

100 105 110

Ser Thr Gly Val Ile Ser Ser Ile Ile Pro Arg Val Phe Phe Cys Thr

115 120 125

Leu Ile Ser Val Leu Val Thr Ile Phe Asn His Ala Val Met Glu Gly

130 135 140

Val Leu Pro His Trp Val Pro Ser Leu Arg Val Pro Thr Leu Pro Met

145 150 155 160

Ser Leu Thr Ala Pro Val Leu Ser Leu Leu Leu Val Phe Arg Thr Asn

165 170 175

Ser Ser Tyr Asn Arg Leu Asp Glu Ala Arg Lys Ala Trp Gly Ser Asn

180 185 190

Val Asn Arg Thr Arg Asp Val Ser Arg Gln Ala Leu Ser Trp Ile Cys

195 200 205

Asp Pro Asp Asp Ala Asp Lys Leu Gln Ser Leu Leu Arg His Ile Lys

210 215 220

Ala Phe Ser Tyr Cys Leu Lys Asp His Leu Thr Gln Glu Asn Leu Leu

225 230 235 240

Gln Glu Glu Leu Ala Arg Val Leu Glu Pro Arg Glu Val Glu Leu Val

245 250 255

Leu Lys Ser Ser His Arg Pro Asn Tyr Val Leu His Val Met Ser Asp

260 265 270

Thr Ile Lys His Cys Arg Ile Ser Lys Trp Glu Ser Lys Ser Met Asp

275 280 285

Arg Asn Ile Thr Gln Phe His Asp Asn Val Gly Ala Cys Glu Arg Leu

290 295 300

Phe Lys Thr Pro Ile Pro Val Ala Tyr Thr Arg Met Ile Ser Arg Phe

305 310 315 320

Leu Ser Ile Trp His Phe Leu Leu Pro Leu Ala Leu Trp Asn Ser Cys

325 330 335

Arg Trp Leu Thr Ile Pro Val Thr Phe Val Ser Gly Val Gly Leu Phe

340 345 350

Cys Ile Glu Glu Val Gly Val Leu Ile Glu Asp Pro Ser Thr Ser Leu

355 360 365

Leu Cys Cys Gln Ser Ala Met Ala Phe Pro Gln Leu Trp Met Ala Ser

370 375 380

Ala Arg Leu Met Lys Glu Leu

385 390

<210> 108

<211> 518

<212> PRT

<213> oleaginous microalgae

<400> 108

Met Pro Gly Ala Leu Ala Thr Ser Leu Asp Glu Pro Asp Arg Pro Gln

1 5 10 15

Arg Ser Val Ser Lys Thr Leu Lys Arg Ala Val Ser Ser Tyr Phe Val

20 25 30

Pro Arg Gly Arg Phe Lys Lys Leu Leu Glu Ser Ala Glu Asn Asp Asn

35 40 45

Glu Ala Asp Val Tyr Arg Arg Asn Ser Gly His Arg Val Phe Thr His

50 55 60

Ala Asp Trp Ala Val His Arg Lys Pro Ser Arg Tyr Ala Arg His Leu

65 70 75 80

Ala Leu Ile Phe Ala Ser Arg Ile Phe Arg Ser Leu Ile Pro Pro Ile

85 90 95

Thr Ala Val Thr Leu Ile Ser Thr Leu Val Gly Val Tyr Glu Thr Leu

100 105 110

Leu Lys Glu His Arg Leu Pro Ala Gln Trp Pro His Val Thr Leu Ala

115 120 125

Leu Gly Gln Gly Phe Gln Leu Thr Ala Phe Ala Leu Ser Leu Leu Leu

130 135 140

Val Phe Arg Thr Asn Ser Ala Tyr Gly Arg Trp Trp Glu Ala Arg Met

145 150 155 160

Leu Trp Gly Ser Leu Thr Asn Arg Thr Arg Asp Phe Val Arg Gln Cys

165 170 175

Leu Ala Phe Phe Pro Glu Asp Ala Lys Arg Leu Arg Glu Ala Ala Val

180 185 190

Leu Trp Thr Ile Ala Leu Pro Tyr Val Val Lys Ala His Leu Arg Glu

195 200 205

Gly Asn Arg Leu Glu Ser Glu Leu Glu Gly Ile Leu Thr Arg Asp Glu

210 215 220

Val Asp Ala Leu Thr Gly Ala Thr His Arg Pro Cys Phe Val Leu Ala

225 230 235 240

Ala Leu Ser Gln Val Val Ala Ala Ala Gly Leu Asp Pro Gln Leu Arg

245 250 255

Gln Arg Leu Asp Thr Asn Leu Thr Ala Phe Glu Asp Cys Ile Gly Gly

260 265 270

Cys Glu Arg Ile Leu Arg Thr Pro Ile Pro Gln Ser Tyr Thr Arg His

275 280 285

Thr Ser Arg Phe Leu Met Ile Trp Leu Ile Met Met Pro Phe Thr Leu

290 295 300

Trp Ala Ala Tyr Ser Trp Val Ser Ile Leu Leu Ser Gly Leu Phe Ala

305 310 315 320

Tyr Leu Met Leu Gly Ile Asp Glu Ile Gly Val Gln Ile Glu Glu Pro

325 330 335

Phe Gly Val Leu Pro Leu Gly Ser Phe Cys Ala Thr Ile Glu Arg Asn

340 345 350

Leu Arg Glu Leu His Tyr Ser Asn Pro Glu Ala Arg Phe Ala Ala Leu

355 360 365

Pro Trp Leu Val Pro Ala Ser Pro Thr Cys Ser Arg Ala Ser Gly Ser

370 375 380

Cys Asp Gly Ala Asp Met Ala Ala Gly Met Asp Asp Ile Asp Pro Val

385 390 395 400

Ala Gly Lys Leu Pro His Leu Asn Gly Ala Pro Gln Ala Gly Gln Pro

405 410 415

Arg Val Tyr Lys His Thr Ser Asp Ala Ala Glu Leu Ala Ala Gly His

420 425 430

Val Arg Phe Ala His Arg Trp Leu Glu Pro His Pro His Leu Ile His

435 440 445

Ser Pro Val His Pro His His Pro Asn His His His Gly His Gly His

450 455 460

Gly His Gly Ala Gln Glu His Gly Arg Gly Ala Phe His Gln Thr Ser

465 470 475 480

Thr Leu His Ala Asp Val Glu Asp Gln Val Val His Pro Ala Ser Tyr

485 490 495

Pro Thr Ala Ala Arg His Thr Pro Pro His Arg Ser Trp Phe Gly Gly

500 505 510

Arg Trp Val Glu Glu Asp

515

<210> 109

<211> 412

<212> PRT

<213> Bell pepper

<400> 109

Met Thr Asn Pro Arg Ser Leu Phe Asn Ile Gln Ser Pro Thr Asn Ala

1 5 10 15

Ser Leu Ser Ser His Phe Thr Leu Lys Lys Pro Ser Lys Leu Leu Ser

20 25 30

Tyr Lys Lys Leu Thr Phe Cys Ser Phe Lys Val Leu Cys Ser Ser Gln

35 40 45

Pro Ser Lys Ala Pro Gln Asn Ser Asn Leu Thr Ser Thr Leu Val Ser

50 55 60

Ile Leu Arg Val Ile Pro Asp Trp Ala Asp Lys Ile Gln Glu Gly Gly

65 70 75 80

Met Arg Lys Lys Arg Ser Leu Tyr Lys His Glu Thr Trp Val Gln His

85 90 95

Arg Ser Ser Leu Arg His Leu Arg His Leu Phe Ser Ser Phe Asn Ser

100 105 110

Arg Val Val Leu Ser Leu Ile Pro Pro Val Ile Ala Phe Thr Ser Phe

115 120 125

Ala Phe Val Ile Ala Ser Tyr Asn Ser Ala Val Ser Leu His Trp Leu

130 135 140

Pro Glu Phe Phe Pro Leu Leu Arg Ala Ser Pro Gln Pro Tyr Gln Leu

145 150 155 160

Thr Ala Pro Ala Leu Ala Leu Leu Leu Val Phe Arg Thr Glu Ala Ser

165 170 175

Tyr Ala Arg Phe Glu Thr Gly Lys Lys Ala Trp Thr Asn Val Ile Ala

180 185 190

Gly Thr Asn Asp Phe Ala Arg Gln Val Ile Thr Ala Cys Val Asp Lys

195 200 205

Arg Asp Gly Val Leu Lys Glu Ala Leu Leu Gln Tyr Ile Met Ala Phe

210 215 220

Pro Val Ala Leu Lys Cys His Ile Val Tyr Gly Ser Asp Leu Ala Ser

225 230 235 240

Asp Leu Lys Asn Leu Leu Glu Ala Asp Asp Leu Ala Val Val Leu Ser

245 250 255

Ser Lys His Arg Pro Arg Cys Ile Ile Gly Phe Ile Ser Gln Ser Leu

260 265 270

Gln Ser Leu Asn Leu Glu Gly Thr Lys Leu Ser Gln Leu Glu Ser Lys

275 280 285

Ile Ser Cys Phe His Glu Gly Ile Gly Val Cys Glu Gln Leu Ile Gly

290 295 300

Ile Pro Ile Pro Leu Ser Tyr Thr Arg Leu Thr Ser Arg Phe Leu Val

305 310 315 320

Leu Trp His Leu Thr Leu Pro Ile Ile Leu Trp Asp Asp Cys His Trp

325 330 335

Leu Val Val Pro Ala Thr Phe Ile Ser Ala Ala Ser Leu Phe Cys Ile

340 345 350

Glu Glu Val Gly Val Leu Ile Glu Glu Pro Phe Pro Met Leu Ala Leu

355 360 365

Asp Glu Leu Cys Gln Arg Val His Asp Asn Ile Gln Glu Ala Met Ala

370 375 380

Ser Glu Lys Gln Ile Gln Glu Arg Leu Asn Thr Lys Arg Lys Arg His

385 390 395 400

Phe Ser Glu Asn Ser Pro Asn Gly Trp Pro Thr Ser

405 410

<210> 110

<211> 435

<212> PRT

<213> Gliocladium C-169

<400> 110

Met Ile Ala Thr Ile His Thr Leu Tyr Tyr Gln Ala Gly Leu Gln Lys

1 5 10 15

Gly Phe Gln Thr Pro Arg Pro Arg Trp Arg Lys Leu His Tyr Ser Arg

20 25 30

Ala Pro Gly Lys Leu Ser Arg Asn Leu Leu Val Arg Cys Gln Glu Thr

35 40 45

Asp Ile Glu Trp Val Glu Arg Ala Ala Ile Gln Arg Glu Ala Trp Lys

50 55 60

Glu Glu Ser Arg Lys Tyr Arg Arg Val Thr Phe Thr Tyr Asp Asp Trp

65 70 75 80

Val Ala His Arg Ser Thr Thr Arg Tyr Ser Arg His Leu Ala Gly Ile

85 90 95

Leu Asp Ser Arg Ile Phe Arg Gly Leu Leu Pro Thr Leu Thr Ala Val

100 105 110

Met Met Val Ala Thr Phe Val Ser Val Tyr Glu Thr Leu Arg Glu Ala

115 120 125

Gly Ile Leu Ile Pro His Asp Trp Val Gly Leu Thr Val Glu Ala Gly

130 135 140

Gln Ala Phe Asn Leu Thr Ser Phe Ala Leu Ser Leu Leu Leu Val Phe

145 150 155 160

Arg Thr Asn Glu Ser Tyr Ser Arg Trp Leu Glu Ala Arg Lys Ala Trp

165 170 175

Thr Asn Ile Val Thr Arg Ser Arg Asp Phe Ala Arg Gln Gly Leu Ser

180 185 190

Trp Leu Ser Gly Asp Lys Gln Arg Glu Ser Met Leu Glu Arg Trp Thr

195 200 205

Ile Ala Phe Ile Lys Cys Thr Met Ala His Val Arg Glu Glu Cys Asp

210 215 220

Leu Gln Ser Leu Leu Glu Asp Val Leu Glu Ala His Glu Leu Glu Gln

225 230 235 240

Leu Met Ala Ala Gln His Lys Pro Asn Phe Val Leu His Val Leu Ser

245 250 255

Glu Leu Val Trp Gly Ala Asn Leu Met Glu Gly Gln Ala Met Arg Met

260 265 270

Asp Glu Ala Leu Thr Val Phe Gly Glu Gln Val Gly Thr Cys Glu Arg

275 280 285

Leu Leu Lys Thr Pro Ile Pro Leu Ser Tyr Thr Arg His Thr Ser Arg

290 295 300

Phe Leu Val Met Trp Leu Ala Phe Leu Pro Phe Ser Leu Trp Asp Ala

305 310 315 320

Cys His Trp Val Thr Ile Pro Ala Ser Gly Ile Ile Ala Phe Leu Leu

325 330 335

Leu Gly Ile Glu Glu Ile Gly Val Gln Ile Glu Glu Pro Phe Gly Ile

340 345 350

Leu Pro Leu Gly Ala Trp Ile Leu Phe His Thr Ile Glu Ala Asp Ser

355 360 365

Val Ile Asp Pro Gln Ser Phe Asp Cys Thr Ile Gln Gln Ser Val Lys

370 375 380

Gly Ala Leu Ser Leu Ala Leu Leu Leu Arg Met Thr Gly Cys Ala Arg

385 390 395 400

Arg Ala Ile Gln Arg Cys Cys Cys Gly Arg Asp Gln Thr Asp Gly Ala

405 410 415

Arg His Glu Cys Ala Ser Ser Gly Gly Gly Arg Pro Glu Arg Glu Arg

420 425 430

Cys Lys Arg

435

<210> 111

<211> 474

<212> PRT

<213> Gliocladium C-169

<400> 111

Met Ser Arg Leu Asn His His Ala Leu Phe Glu Asp His Val Val Thr

1 5 10 15

Ala Ala Asp Trp Tyr His Leu Arg Ser Trp Arg Arg His Leu Pro Asp

20 25 30

Leu Thr Trp Val Thr Val Leu Ser Gly Phe Trp Leu Trp Val Val Tyr

35 40 45

Phe Ala Leu Ile Ala Val Leu Ile Gly Leu Tyr His Thr Val Leu Val

50 55 60

Pro Arg Gly Ala Pro Asp Trp Pro Pro Lys Asn Val Ala Ser Val Leu

65 70 75 80

Tyr Gln Pro Phe Ala Ile Thr Ser Phe Ala Leu Ala Leu Leu Met Val

85 90 95

Phe Arg Thr Asn Ser Ser Tyr Ala Arg Trp Trp Glu Ala Arg Thr Val

100 105 110

Trp Gly Gln Val Phe Asn Val Thr Arg Asn Leu Val Arg Gln Ala Asp

115 120 125

Ala Trp Phe Gly Glu Glu Asp Val Ala Ala Phe Gln Met Leu Val Arg

130 135 140

Trp Cys Ala Ala Ala Gly Tyr Ile Leu Gln Ala His Leu Cys Thr Ala

145 150 155 160

Lys Leu Gly Pro Glu Ala Glu Gly Leu Leu His Pro Glu Glu Leu Lys

165 170 175

Leu Leu Ala Ser Trp Glu His Arg Pro Ile Cys Ala Gly Gln Val Leu

180 185 190

Ser Ser Ile Val Ala Ser Ala Val Lys Asp Ser Gln Leu Arg Ala Ala

195 200 205

Met Asp Asp Gln Ile Ala Thr Tyr Ile Asn Asp Ala Gly Ala Cys Glu

210 215 220

Arg Ile Gln Arg Thr Cys Ile Pro Phe Cys Tyr Thr Arg His Thr Ser

225 230 235 240

Arg Phe Leu Ile Leu Trp Leu Thr Phe Leu Pro Phe Ala Leu Trp Glu

245 250 255

Ile Cys Gly Trp Ala Ser Pro Val Ala Glu Ala Val Leu Ala Phe Leu

260 265 270

Leu Met Gly Val Glu Asn Ile Gly Ile Gln Ile Glu Glu Pro Phe His

275 280 285

Val Leu Pro Met His Ser Tyr Cys Ala Val Ile Ala Lys Asn Ala Leu

290 295 300

Glu Val Ala Arg Glu Arg Lys Gly Leu Asp Leu Phe Val Glu Glu Ala

305 310 315 320

Leu Arg Arg Glu Leu Cys Met Glu Pro Leu Gly Lys Leu Glu Asn Gly

325 330 335

Gly Ala Gly Ala Asp Ser Asn Val Phe Val Arg Pro Ser Gly Ala Ala

340 345 350

Gly Val Ser His Lys Ala Ser Pro Arg Pro Thr Asn Pro Ser Leu Arg

355 360 365

Val Arg Cys Gln Ser His Arg His Asn Ala Asp Pro Ser Leu His Glu

370 375 380

Ala Arg Gly Val Phe Gln Met Val Pro Gln Arg Gly Glu Ala Thr Leu

385 390 395 400

Leu Asp Ala Arg Asp Ala Leu Glu Thr Cys Ser Ala Leu Asn Asp Ala

405 410 415

Ser Ser Lys Glu Ala Cys Tyr Ala Thr Phe Gly Cys Asp Gly Arg Arg

420 425 430

Val Glu Lys Tyr Phe Gly Ala Val Glu Val Leu Glu Thr Ala Trp Glu

435 440 445

Gln Val Lys Glu Glu Glu Val Glu Asp Asp Asp Glu Phe Val Glu Glu

450 455 460

Asn Leu Ser Pro Trp Pro Trp Asp Gly Arg

465 470

<210> 112

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 112

gacaccaaga ccatcctggc 20

<210> 113

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 113

aacagaactg cagaggtccc g 21

<210> 114

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 114

cggtgcccat gagctcc 17

<210> 115

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 115

gccactaacc ggcccaa 17

<210> 116

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 116

aatcccgtcc atgtcgct 18

<210> 117

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 117

cggcttgtga ggacctcg 18

<210> 118

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 118

gccagaagga ctcgtacgtt 20

<210> 119

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 119

cgccagagtc cagcacgata 20

<210> 120

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 120

gctactcaca acaagcccag ttatgcagat gcaagcaaac cgttcgtc 48

<210> 121

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 121

gagccaccca gatctccgtt cttgcgctcc ccacccatgg 40

<210> 122

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 122

gctactcaca acaagcccag ttatggccac tggtcagacc 40

<210> 123

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 123

gagccaccca gatctccgtt tctccttgtc tccgcac 37

<210> 124

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 124

gctactcaca acaagcccag ttatgcaagt cagcaaggtt ccctcg 46

<210> 125

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 125

gagccaccca gatctccgtt ccggggcgag atgcgcac 38

<210> 126

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 126

ctagtgggag cgagttgcaa ggcatatctc gctgatcggc accatggggg tggtggtgat 60

cagcgctata tgttttgcaa ctcgctcccg 90

<210> 127

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 127

ctagcgggag cgagttgcaa aacatatagc gctgatcacc accaccccca tggtgccgat 60

cagcgagata tgccttgcaa ctcgctccca 90

<210> 128

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 128

ctagtgagag cgtgttgcaa ggcatatctc gctgatcggc accatggggg tggtggtgat 60

cagcgctata tgttttgcaa cacgctctcg 90

<210> 129

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 129

ctagcgagag cgtgttgcaa aacatatagc gctgatcacc accaccccca tggtgccgat 60

cagcgagata tgccttgcaa cacgctctca 90

<210> 130

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 130

gctgtgtggc attgaggaga 20

<210> 131

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 131

ggatgaggct gatgagtccg 20

<210> 132

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 132

acggtctacg acttccctca 20

<210> 133

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 133

ttggatcacg tgggattggg 20

<210> 134

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 134

aagtcagcaa ggttccctcg 20

<210> 135

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 135

tgaatgagcc tagcgggttg 20

<210> 136

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 136

atgtgctgtc cgtggctttc 20

<210> 137

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 137

cagaccttga ccatcttgtc cc 22

<210> 138

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 138

tgccccttct cagcacgt 18

<210> 139

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 139

actgcctcac actcccct 18

<210> 140

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 140

gcaccaatca tgtcaagcct 20

<210> 141

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic construct

<400> 141

gacgttacag cacacccttg 20

272页详细技术资料下载
上一篇:一种医用注射器针头装配设备
下一篇:用于温育在水产养殖、农业、废水和环境修复应用中使用的孢子的系统、方法和组合物

网友询问留言

已有0条留言

还没有人留言评论。精彩留言会获得点赞!

精彩留言,会给你点赞!