Mesenchymal stem cell preparation for treating diabetic foot and application thereof
阅读说明：本技术 治疗糖尿病足的间质干细胞制剂及其应用 (Mesenchymal stem cell preparation for treating diabetic foot and application thereof ) 是由 张倩 刘韬 于 2019-04-17 设计创作，主要内容包括：本发明属于生物技术领域,尤其涉及一种治疗糖尿病足的间质干细胞制剂,所述治疗糖尿病足的间质干细胞制剂包含：TSP4过表达的间质干细胞,所述TSP4过表达的间质干细胞的制备方法包括：以pCMV6-TSP4质粒和FT106质粒载体设计引物,通过PCR扩增和DNA连接反应得到FT106-TSP4-GFP慢病毒表达质粒,然后采用慢病毒包装质粒psPAX2和pMD.2G共转染293T细胞得到FT106-TSP4-GFP慢病毒,在用获得的FT106-TSP4-GFP慢病毒感染所述间质干细胞,得到TSP4过表达的间质干细胞。本发明提供的制剂能促进血管生成和活化,从而提高制剂对糖尿病足的治疗效果。(The invention belongs to the technical field of biology, and particularly relates to a mesenchymal stem cell preparation for treating diabetic foot, which comprises the following components in part by weight: TSP4 overexpressed mesenchymal stem cells, and a preparation method of the TSP4 overexpressed mesenchymal stem cells comprises the following steps: designing primers by using pCMV6-TSP4 plasmid and FT106 plasmid vector, obtaining FT106-TSP4-GFP lentivirus expression plasmid through PCR amplification and DNA ligation reaction, then co-transfecting 293T cells by using lentivirus packaging plasmid psPAX2 and pMD.2G to obtain FT106-TSP4-GFP lentivirus, and infecting the mesenchymal stem cells by using the obtained FT106-TSP4-GFP lentivirus to obtain TSP4 over-expressed mesenchymal stem cells. The preparation provided by the invention can promote angiogenesis and activation, thereby improving the treatment effect of the preparation on diabetic foot.)
1. A mesenchymal stem cell preparation for treating diabetic foot, which comprises: TSP4 overexpressed mesenchymal stem cells, and a preparation method of the TSP4 overexpressed mesenchymal stem cells comprises the following steps:
obtaining pCMV6-TSP4 plasmids and FT106 plasmid vectors, designing a first primer pair for amplifying TSP4 according to the gene coding region sequence of the pCMV6-TSP4 plasmids, and designing a second primer pair for amplifying FT106 according to the gene coding region sequence of the FT106 plasmid vectors;
respectively taking the pCMV6-TSP4 plasmid and the FT106 plasmid as templates, and performing polymerase chain reaction amplification to obtain a pCMV6-TSP4 oligonucleotide chain and an FT106 oligonucleotide chain;
connecting the pCMV6-TSP4 oligonucleotide chain to the FT106 oligonucleotide chain through DNA connection reaction to obtain a connection product FT106-TSP4-GFP lentivirus expression plasmid;
obtaining lentiviral vectors psPAX2 and pMD.2G, co-transfecting the FT106-TSP4-GFP lentiviral expression plasmid with the lentiviral vectors psPAX2 and pMD.2G to 293T cells to obtain FT106-TSP4-GFP lentivirus;
Obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells with the FT106-TSP4-GFP lentivirus to obtain the mesenchymal stem cells with TSP4 over-expression.
2. The mesenchymal stem cell preparation for treating diabetic foot according to claim 1, wherein the first primer pair comprises:
first upstream primer of 5 'TATATAAGCAGAGCTATGCCGGCCCCACGCGCG 3'
The first downstream primer is 5 'ATGGTCTTTGTAGTCATTATCCAAGCGGTCGAAACTCTGG 3'.
3. The mesenchymal stem cell preparation for treating diabetic foot according to claim 1, wherein the second primer pair comprises:
second upstream primer of 5 'GACTACAAAGACCATGACGG 3'
The second downstream primer is 5 'AGCTCTGCTTATATAAACCTCCC 3'.
4. The mesenchymal stem cell preparation for treating diabetic foot according to any of claims 1 to 3, wherein the step of DNA ligation comprises:
obtaining
and (3) reacting the reaction system at the temperature of 35-40 ℃ for 5-10 minutes and at the temperature of 45-55 ℃ for 10-20 minutes in sequence to obtain the FT106-TSP4-GFP lentivirus expression plasmid.
5. The mesenchymal stem cell preparation for treating diabetic foot according to any one of claims 1 to 3, wherein the step of co-transfecting 293T cells with the FT106-TSP4-GFP lentiviral expression plasmid and the lentiviral vectors psPAX2 and pMD.2G comprises:
obtaining 2.5M CaCl2Preparing a first mixed solution, wherein the first mixed solution comprises the following components in percentage by mass of 100 percent: 10 to 15 percent of the 2.5M CaCl2Solution, 0.015-0.02% of psPAX2, 0.005-0.01% of pMD.2G, 0.02-0.03% of FT106-TSP4 lentivirus expression plasmid and the balance ddH2O；
Obtaining 2 HBS buffer solution, adding the first mixed solution into the 2 HBS buffer solution with the same volume, and standing at room temperature for 20-30 minutes to obtain DNA standing solution;
and (3) obtaining a culture dish containing 293T cells, and dropwise adding the DNA standing solution into the culture dish containing the 293T cells for culture to obtain the FT106-TSP4-GFP lentivirus.
6. The mesenchymal stem cell preparation for treating diabetic foot according to any one of claims 1 to 3, wherein the step of infecting the mesenchymal stem cells with FT106-TSP4-GFP lentivirus comprises:
inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
Replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is DMEM/F12 medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
and replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
7. The mesenchymal stem cell preparation for treating diabetic foot according to claim 6, wherein the culture medium of the lentivirus is DMEM/F-12 medium containing FBS, polybrene and supernatant of FT106-TSP4-GFP lentivirus, wherein the FBS accounts for 5% by mass of the total mass of the lentivirus culture medium, the polybrene has a concentration of 8ng/ml culture medium, and the supernatant of the FT106-TSP4-GFP lentivirus has a concentration of (0.5-1) ml/ml culture medium.
8. The mesenchymal stem cell preparation for treating diabetic foot according to claim 1 or 7, wherein the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells.
9. The mesenchymal stem cell preparation for treating diabetic foot according to claim 1 or 8, wherein the mesenchymal stem cells are selected from the group consisting of: mesenchymal stem cells of the third to sixth generations.
10. An application of the mesenchymal stem cell preparation for treating diabetic foot, which is characterized in that the mesenchymal stem cell preparation for treating diabetic foot according to any one of claims 1 to 9 is applied to a medicament for treating diabetic foot.
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an interstitial stem cell preparation for treating diabetic foot and application thereof.
Background
The diabetic foot refers to the disease states of foot pain, deep skin ulcer and even gangrene of limbs caused by the lower limb protection function decline caused by the neuropathy caused by the comprehensive factors such as diabetic vasculopathy, neuropathy and infection thereof, and microcirculation disturbance caused by insufficient arterial perfusion caused by the macrovascular and microvascular lesions. The diabetic foot is a serious complication of diabetes, is one of the important reasons for disability and even death of the diabetic, and causes pain to the diabetic and heavy medical burden to the society and families.
The clinical methods for treating diabetic foot include drug therapy, vascular reconstruction and interventional operation, however, diabetic patients are old and weak, often suffer from cardiovascular and cerebrovascular diseases and the like, cannot tolerate the stimulation of surgical bypass and the like, vascular lesions mostly involve arterioles, and partial patients lack distal arterial outflow tracts and do not have the conditions of vascular bypass and interventional therapy. Therefore, the current clinical treatment of diabetic foot is still very delicate, difficult to achieve satisfactory curative effect, often resulting in amputation and even life-threatening of the patient. At present, in the treatment of diabetic feet, stem cell therapy has become the most promising treatment strategy, and the application of stem cell transplantation provides hope for the tissue repair and function recovery of the ischemic injury of the diabetic feet. Mesenchymal stem cells, a cell population with self-renewal, high proliferation and multi-lineage differentiation capabilities. The mesenchymal stem cells are proved to be stem cells with multidirectional differentiation potential, can be differentiated into bone, cartilage, fat, nerves, cardiac muscle and the like under certain induction conditions, participate in the repair of different tissues, can promote angiogenesis, can be differentiated into vascular endothelial cells and smooth muscle cells to directly form new blood vessels, and can participate in the neogenesis process of the blood vessels by paracrine various angiogenesis factors such as VEGF, Ang-I, Ang-II and the like.
However, in practical applications, since the content of mesenchymal stem cells in the human body is not high, for example: the bone marrow mesenchymal stem cells occupy about 0.001 to 0.01 percent of the mononuclear cell number in bone marrow, and need larger marrow collection amount in clinical treatment, and have higher requirements on the age, physical condition and psychological acceptance of patients. Moreover, due to the change of microenvironment such as oxidative stress, hypoxia and the like, the survival rate of the transplanted mesenchymal stem cells is very low, the formation speed of new blood vessels is slow and the like, so that the treatment effect of the mesenchymal stem cells in the diabetic foot diseases is greatly limited.
Disclosure of Invention
The embodiment of the invention aims to provide a mesenchymal stem cell preparation for treating diabetic foot, aiming at solving the technical problems that the existing mesenchymal stem cells have low content in human bodies, very low survival rate, slow formation speed and the like, and the application and treatment effect of the mesenchymal stem cells in diabetic foot diseases are greatly limited.
Another object of the embodiments of the present invention is to provide an application of the mesenchymal stem cell preparation for treating diabetic foot.
In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:
a mesenchymal stem cell preparation for treating diabetic foot, the mesenchymal stem cell preparation for treating diabetic foot comprising: TSP4 overexpressed mesenchymal stem cells, and a preparation method of the TSP4 overexpressed mesenchymal stem cells comprises the following steps:
Obtaining pCMV6-TSP4 plasmids and FT106 plasmid vectors, designing a first primer pair for amplifying TSP4 according to the gene coding region sequence of the pCMV6-TSP4 plasmids, and designing a second primer pair for amplifying FT106 according to the gene coding region sequence of the FT106 plasmid vectors;
respectively taking the pCMV6-TSP4 plasmid and the FT106 plasmid as templates, and performing polymerase chain reaction amplification to obtain a pCMV6-TSP4 oligonucleotide chain and an FT106 oligonucleotide chain;
connecting the pCMV6-TSP4 oligonucleotide chain to the FT106 oligonucleotide chain through DNA connection reaction to obtain a connection product FT106-TSP4-GFP lentivirus expression plasmid;
obtaining lentiviral vectors psPAX2 and pMD.2G, co-transfecting the FT106-TSP4-GFP lentiviral expression plasmid with the lentiviral vectors psPAX2 and pMD.2G to 293T cells to obtain FT106-TSP4-GFP lentivirus;
obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells with the FT106-TSP4-GFP lentivirus to obtain the mesenchymal stem cells with TSP4 over-expression.
Preferably, the first primer pair comprises:
first upstream primer of 5 'TATATAAGCAGAGCTATGCCGGCCCCACGCGCG 3'
The first downstream primer is 5 'ATGGTCTTTGTAGTCATTATCCAAGCGGTCGAAACTCTGG 3'.
Preferably, the second primer pair comprises:
second upstream primer of 5 'GACTACAAAGACCATGACGG 3'
The second downstream primer is 5 'AGCTCTGCTTATATAAACCTCCC 3'.
Preferably, the step of DNA ligation reaction comprises:
obtaining
and (3) reacting the reaction system at the temperature of 35-40 ℃ for 5-10 minutes and at the temperature of 45-55 ℃ for 10-20 minutes in sequence to obtain the FT106-TSP4-GFP lentivirus expression plasmid.
Preferably, the step of co-transfecting the FT106-TSP4-GFP lentiviral expression plasmid with the lentiviral vectors psPAX2 and pmd.2g into 293T cells comprises:
obtaining 2.5M CaCl2Preparing a first mixed solution, wherein the first mixed solution comprises the following components in percentage by mass of 100 percent: 10 to 15 percent of the 2.5M CaCl2Solution, 0.015-0.02% of psPAX2, 0.005-0.01% of pMD.2G, 0.02-0.03% of FT106-TSP4 lentivirus expression plasmid and the balance ddH2O；
Obtaining 2 HBS buffer solution, adding the first mixed solution into the 2 HBS buffer solution with the same volume, and standing at room temperature for 20-30 minutes to obtain DNA standing solution;
And (3) obtaining a culture dish containing 293T cells, and dropwise adding the DNA standing solution into the culture dish containing the 293T cells for culture to obtain the FT106-TSP4-GFP lentivirus.
Preferably, the step of infecting the mesenchymal stem cells with the FT106-TSP4-GFP lentivirus comprises:
inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is DMEM/F12 medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
And replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
Preferably, the culture medium of the lentivirus is a DMEM/F-12 culture medium containing FBS, polybrene and a supernatant of FT106-TSP4-GFP lentivirus, wherein the mass percentage of the FBS accounts for 5% of the total mass of the lentivirus culture medium, the concentration of the polybrene is 8ng/ml culture medium, and the concentration of the supernatant of the FT106-TSP4-GFP lentivirus is (0.5-1) ml/ml culture medium.
Preferably, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells.
Preferably, the mesenchymal stem cells are selected from the group consisting of: mesenchymal stem cells of the third to sixth generations.
The application of the mesenchymal stem cell preparation for treating the diabetic foot is to apply the mesenchymal stem cell preparation for treating the diabetic foot to a medicament for treating the diabetic foot.
The invention provides a mesenchymal stem cell preparation for treating diabetic foot, which comprises TSP4 overexpressed mesenchymal stem cells, wherein the TSP4 overexpressed mesenchymal stem cells are subjected to PCR amplification by using pCMV6-TSP4 plasmid and FT106 plasmid vectors to design amplification primers to obtain pCMV6-TSP4 oligonucleotide chains and FT106 oligonucleotide chains respectively, then FT106-TSP4-GFP lentivirus expression plasmids are obtained through DNA ligation reaction, then the 293T cells are co-transfected by using lentivirus vectors (packaging plasmids) psPAX2 and pMD.2G to obtain FT106-TSP4-GFP lentiviruses, and finally the obtained FT106-TSP4-GFP lentiviruses are used for infecting the mesenchymal stem cells to obtain the TSP4 overexpressed mesenchymal stem cells. The mesenchymal stem cell preparation for treating diabetic foot of the invention uses pCMV6-TSP4 plasmid and FT106 plasmid vector to design primers through an adjustable gene modification means, and obtains FT106-TSP4-GFP lentivirus containing TSP4 through the steps of PCK amplification, DNA connection, plasmid packaging transfection and the like, wherein TSP4 in the pCMV6-TSP4 plasmid has the functions of promoting the growth of new vessels and promoting the angiogenesis in endothelial cells; the FT106 plasmid has good combination effect with mesenchymal stem cells, and the mesenchymal stem cells are easier to infect after being packaged into lentiviruses, so that the infection effect is improved; and the FT106 plasmid contains GFP marker genes, which is beneficial to the subsequent detection and identification of target products. The mesenchymal stem cells infected by FT106-TSP4-GFP lentivirus containing TSP4 introduce TSP4 gene segment into the mesenchymal stem cell genome, so that when the mesenchymal stem cells express secretion protein, besides self protein, simultaneously, the newly added TSP4 target gene segment is expressed, TSP4 can be over-expressed in mesenchymal stem cells, the paracrine function of the mesenchymal stem cells is promoted, so that the synergistic effect is exerted, vascular endothelial growth factors, angiopoietin 1/2 and other angiogenesis factors in the mesenchymal stem cells are over-expressed, the angiogenesis and activation efficiency of the mesenchymal stem cells is improved, the blood vessel density of ischemic areas of diabetic feet is increased, the generated activated blood vessels can promote the recovery of microcirculation and metabolism, thereby improving the treatment effect of the mesenchymal stem cell preparation for treating the diabetic foot on the diabetic foot and promoting the recovery of the nervous system and the motor function of the diabetic foot.
The application of the mesenchymal stem cell preparation for treating the diabetic foot, which is provided by the invention, applies the mesenchymal stem cell preparation which can realize overexpression of a plurality of angiogenesis factors such as TSP4, vascular endothelial growth factor, angiopoietin 1/2 and the like and has high hematopoietic reconstruction and angiogenesis efficiency and is infected by FT106-TSP4-GFP lentivirus into the medicine for treating the diabetic foot disease, can effectively induce the angiogenesis of an ischemic injury marginal area caused by the diabetic foot, promote the metabolism of the ischemic area and repair the nervous system and motor function, thereby improving the treatment efficiency of the medicine for treating the diabetic foot on the diabetes.
Drawings
FIG. 1 is an agarose gel electrophoresis image of the FT106-TSP4-GFP lentiviral plasmid restriction enzyme provided in example 1 of the present invention.
Fig. 2 is a flow chart of bone marrow mesenchymal stem cells provided in example 2 of the present invention.
Fig. 3 is a fluorescent protein assay of TSP4 overexpressed mesenchymal stem cells provided in example 3 of the present invention.
FIG. 4 is a graph showing the positive expression rate of the vascular endothelial cell marker vWF in the angiogenesis test of rat DF model ischemic region by lentivirus-infected mesenchymal stem cells according to the present invention.
FIG. 5 is a graph showing the distribution of lentivirus-infected mesenchymal stem cells on vascular endothelial cell marker vWF in an angiogenesis test in an ischemic zone of rat DF model.
FIG. 6 is a graph of the assessment of the recovery of motor function of lentivirus-infected mesenchymal stem cells in the rat DF model.
Detailed Description
In order to make the purpose, technical solution and technical effect of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all embodiments. All other embodiments obtained by a person of ordinary skill in the art without any inventive step in connection with the embodiments of the present invention shall fall within the scope of protection of the present invention.
In the description of the present invention, it is to be understood that the terms "first", "second" and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.
The weight of the related components mentioned in the description of the embodiments of the present invention may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, the content of the related components is scaled up or down within the scope disclosed in the description of the embodiments of the present invention as long as it is in accordance with the description of the embodiments of the present invention. Specifically, the weight described in the description of the embodiment of the present invention may be a unit of mass known in the chemical industry field, such as μ g, mg, g, and kg.
The embodiment of the invention provides an interstitial stem cell preparation for treating diabetic foot, which comprises the following components in part by weight: TSP4 overexpressed mesenchymal stem cells, and a preparation method of the TSP4 overexpressed mesenchymal stem cells comprises the following steps:
s10, acquiring a pCMV6-TSP4 plasmid and an FT106 plasmid vector, designing a first primer pair for amplifying TSP4 according to the gene coding region sequence of the pCMV6-TSP4 plasmid, and designing a second primer pair for amplifying FT106 according to the gene coding region sequence of the FT106 plasmid vector;
s20, respectively using the pCMV6-TSP4 oligonucleotide chain and the FT106 oligonucleotide chain as templates to perform polymerase chain reaction amplification, and respectively amplifying to obtain a pCMV6-TSP4 oligonucleotide chain and an FT106 oligonucleotide chain;
s30, connecting the pCMV6-TSP4 oligonucleotide chain to the FT106 oligonucleotide chain through DNA connection reaction to obtain a connection product FT106-TSP4-GFP lentivirus expression plasmid;
s40, obtaining lentiviral vectors psPAX2 and pMD.2G, co-transfecting 293T cells with the FT106-TSP4-GFP lentiviral expression plasmid and the lentiviral vectors psPAX2 and pMD.2G to obtain FT106-TSP4-GFP lentivirus;
s50, obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells with the FT106-TSP4-GFP lentivirus to obtain the mesenchymal stem cells over-expressed by TSP 4.
The mesenchymal stem cell preparation for treating diabetic foot provided by the embodiment of the invention comprises TSP4 overexpressed mesenchymal stem cells, wherein the TSP4 overexpressed mesenchymal stem cells are subjected to PCR amplification by using pCMV6-TSP4 plasmid and FT106 plasmid vectors to design amplification primers, respectively, so as to obtain pCMV6-TSP4 oligonucleotide chain and FT106 oligonucleotide chain, then FT106-TSP4-GFP lentivirus expression plasmid is obtained through DNA ligation reaction, 293T cells are co-transfected by using lentivirus vectors (packaging plasmids) psPAX2 and pMD.2G so as to obtain FT106-TSP4-GFP lentivirus, and finally the obtained FT106-TSP4-GFP lentivirus is used for infecting the mesenchymal stem cells, so as to obtain the TSP4 overexpressed mesenchymal stem cells. The mesenchymal stem cell preparation for treating diabetic foot provided by the embodiment of the invention is prepared by designing primers by using pCMV6-TSP4 plasmid and FT106 plasmid vector through an adjustable gene modification means, and carrying out the steps of PCK amplification, DNA connection, plasmid packaging transfection and the like to obtain FT106-TSP4-GFP lentivirus containing TSP4, wherein TSP4 in the pCMV6-TSP4 plasmid has the functions of promoting the growth of new blood vessels and promoting angiogenesis in endothelial cells; the FT106 plasmid has good combination effect with mesenchymal stem cells, and the mesenchymal stem cells are easier to infect after being packaged into lentiviruses, so that the infection effect is improved; and the FT106 plasmid contains GFP marker genes, which is beneficial to the subsequent detection and identification of target products. The mesenchymal stem cells infected by FT106-TSP4-GFP lentivirus containing TSP4 introduce TSP4 gene segment into the mesenchymal stem cell genome, so that when the mesenchymal stem cells express secretion protein, besides self protein, simultaneously, the newly added TSP4 target gene segment is expressed, TSP4 can be over-expressed in mesenchymal stem cells, the paracrine function of the mesenchymal stem cells is promoted, so that the synergistic effect is exerted, vascular endothelial growth factors, angiopoietin 1/2 and other angiogenesis factors in the mesenchymal stem cells are over-expressed, the angiogenesis and activation efficiency of the mesenchymal stem cells is improved, the blood vessel density of ischemic areas of diabetic feet is increased, the generated activated blood vessels can promote the recovery of microcirculation and metabolism, thereby improving the treatment effect of the mesenchymal stem cell preparation for treating the diabetic foot on the diabetic foot and promoting the recovery of the nervous system and the motor function of the diabetic foot.
Specifically, in the above step S10, the pCMV6-TSP4 plasmid and the FT106 plasmid vector are obtained, a first primer pair for amplifying the TSP4 is designed based on the gene coding region sequence of the pCMV6-TSP4 plasmid, and a second primer pair for amplifying the FT106 is designed based on the gene coding region sequence of the FT106 plasmid vector. In the embodiment of the invention, a first primer pair is designed by using a gene coding region sequence of a pCMV6-TSP4 plasmid, the adopted pCMV6-TSP4 plasmid contains a TSP4 gene sequence, and TSP4 has the characteristics of combining collagen, heparin and calcium ions, can be combined with various matrix proteins to regulate the interaction of cell-cells and cell-matrix, participate in the biological processes of regulating platelet adhesion and aggregation, thrombosis, smooth muscle proliferation, migration and the like, can promote the growth of new blood vessels, activate vascular endothelial cells and improve the function of promoting the angiogenesis of the endothelial cells. In addition, a second primer pair is designed by using the gene coding region sequence of the FT106 plasmid vector, the FT106 plasmid and the mesenchymal stem cells have good combination effect, and the mesenchymal stem cells are easier to infect after being packaged into lentiviruses, so that the infection effect is improved; and the FT106 plasmid contains GFP marker genes, which is beneficial to the subsequent detection and identification of target products. According to the embodiment of the invention, the sequences are designed by the pCMV6-TSP4 plasmid and the FT106 plasmid vector, so that the subsequent lentivirus infection of the mesenchymal stem cells is facilitated, the lentivirus is better combined into the mesenchymal stem cells, and the subsequently prepared mesenchymal stem cells containing TSP4 gene sequences ensure the overexpression of TSP4 in the mesenchymal stem cells and promote the paracrine of various angiogenesis factors in the mesenchymal stem cells, so that the treatment effect of the mesenchymal stem cell preparation for treating the diabetic foot on the diabetic foot is improved.
As a preferred embodiment, the first primer pair includes:
first upstream primer of 5 'TATATAAGCAGAGCTATGCCGGCCCCACGCGCG 3'
The first downstream primer is 5 'ATGGTCTTTGTAGTCATTATCCAAGCGGTCGAAACTCTGG 3'.
As a preferred embodiment, the second primer pair includes:
second upstream primer of 5 'GACTACAAAGACCATGACGG 3'
The second downstream primer is 5 'AGCTCTGCTTATATAAACCTCCC 3'.
Specifically, in step S20, pcr amplification is performed using the pCMV6-TSP4 oligonucleotide and the FT106 oligonucleotide as templates, respectively, to obtain the pCMV6-TSP4 oligonucleotide and the FT106 oligonucleotide. The embodiment of the invention obtains the target gene by respectively amplifying the following genes through Polymerase Chain Reaction (PCR) amplification with strong specificity, high sensitivity and simple and convenient operation: the pCMV6-TSP4 oligonucleotide strand and the FT106 oligonucleotide strand.
As a preferred embodiment, the PCR amplification reaction system of the first primer pair includes the following table 1:
TABLE 1
As a more preferred embodiment, the PCR amplification reaction system of the first primer pair includes: constructing a PCR amplification system by taking the plasmid pCMV6-TSP4 as a template, adding 2 alphanta enzyme 50ul, a first upstream primer 2ul, a first downstream primer 2ul, a plasmid 2ul and a complementary ddH 2O-100 ul, uniformly mixing, performing pre-denaturation at 94 ℃ for 2min, and performing denaturation at 94 ℃ for 10 s; then annealing at 57 deg.C for 30s, extending at 72 deg.C for 3min, and performing 30 cycles; finally, extension is carried out for 5min at 72 ℃, and PCR amplification pCMV6-TSP4 sequences are obtained.
As a preferred embodiment, the PCR amplification reaction system of the second primer pair comprises the following table 2:
TABLE 2
As a more preferred embodiment, the PCR amplification reaction system of the second primer pair includes: constructing a PCR amplification system by taking the plasmid FT106 as a template, adding 50ul of 2 alphanta enzyme, 2ul of a second upstream primer, 2ul of a second downstream primer, 2ul of a plasmid and from 2O to 100ul of supplemented ddH, uniformly mixing, performing pre-denaturation at 94 ℃ for 2min, and performing denaturation at 94 ℃ for 10 s; then annealing at 57 ℃ for 30s, and extending at 72 ℃ for 30s for 30 cycles; finally, extension is carried out for 5min at 72 ℃, and a PCR amplified FT106 sequence is obtained.
Specifically, the pCMV6-TSP4 oligonucleotide chain was ligated to the FT106 oligonucleotide chain by DNA ligation reaction in the above step S30, resulting in a ligation product FT106-TSP4-GFP lentiviral expression plasmid. In the embodiment of the invention, the pCMV6-TSP4 oligonucleotide chain is connected into the FT106 oligonucleotide chain through DNA connection reaction, so that a lentivirus expression plasmid containing a pCMV6-TSP4 sequence and an FT106 sequence at the same time is obtained, the lentivirus plasmid not only has better infection binding capacity with mesenchymal stem cells, but also has TSP4 gene sequence which can over-express TSP4 in the mesenchymal stem cells, promote over-expression of various angiogenesis factors such as vascular endothelial growth factor and angiopoietin 1/2, improve the efficiency of angiogenesis and activation of the mesenchymal stem cells, generate activated blood vessels and promote the recovery of microcirculation and metabolism, thereby improving the treatment effect of the stem cell preparation for treating the diabetic foot stroma on the diabetic foot. In addition, the ligation product FT106-TSP4-GFP lentiviral expression plasmid also contained a GFP tag for ease of detection.
As a preferred embodiment, the step of DNA ligation reaction comprises: obtainingHD protease as described
In some embodiments, the step of DNA ligation reaction comprises: establishing an In-Fusion reaction system: 4ul of each of the PCR-amplified FT106 and pCMV6-TSP4 oligonucleotide chains,HD Enzymepremix2ul, mixed well. And (3) placing the PCR tube into a PCR instrument, and setting an operation program as follows: at 37 ℃ for 15min and 50 ℃ for 15min, FT106-TSP4-GFP lentivirus expression plasmids are obtained, and products are stored at-20 ℃ for later use. Transforming the ligation product, extracting plasmid after PCR of bacterial liquid, and carrying out enzyme digestion identification on the FT106-TSP4-GFP lentivirus expression plasmid of the ligation product.
As a preferred example, the lentiviral vectors psPAX2 and pMD.2G are obtained in the above step S40, and the FT106-TSP4-GFP lentiviral expression plasmid is co-transfected into 293T cells together with the lentiviral vectors psPAX2 and pMD.2G to obtain FT106-TSP4-GFP lentivirus. According to the embodiment of the invention, lentivirus packaging plasmids (vectors) psPAX2, pMD.2G and FT106-TSP4-GFP lentivirus are packaged, the FT106-TSP4-GFP lentivirus expression plasmids are packaged and transfected into virus particles with infectivity, and then the FT106-TSP4-GFP lentivirus is obtained by transfecting 293T cells, so that the expression of lentivirus genes in cells or living tissues is realized.
In some examples, the FT106-TSP4-GFP lentiviral expression plasmid after correct restriction was co-transfected with lentiviral packaging plasmids psPAX2 and pmd.2g into 293T cells (human renal epithelial cell line) to give FT106-TSP4-GFP lentivirus. In some embodiments, the FT106-TSP4-GFP lentiviral expression plasmid was identified by a double cleavage with SalI and EcoRI, the cleavage system comprising table 3 below:
TABLE 3
As a preferred embodiment, the step of co-transfecting the FT106-TSP4-GFP lentiviral expression plasmid with the lentiviral packaging plasmid psPAX2 and pmd.2g into 293T cells comprises:
s41, obtaining 2.5M CaCl2Preparing a first mixed solution, wherein the first mixed solution comprises the following components in percentage by mass of 100 percent: 10 to 15 percent of the 2.5M CaCl2Solution, 0.015-0.02% of psPAX2, 0.005-0.01% of pMD.2G, 0.02-0.03% of FT106-TSP4 lentivirus expression plasmid and the balance ddH2O；
S42, obtaining a 2 HBS buffer solution, adding the first mixed solution into the 2 HBS buffer solution with the same volume, and standing at room temperature for 20-30 minutes to obtain a DNA standing solution;
s43, obtaining a culture dish containing 293T cells, dropwise adding the DNA standing solution into the culture dish containing the 293T cells for culture, and obtaining the FT106-TSP4-GFP lentivirus.
In some embodiments, the step of co-transfecting the FT106-TSP4-GFP lentiviral expression plasmid with the lentiviral packaging plasmid psPAX2 and pmd.2g into 293T cells comprises:
s41, obtaining 2.5M CaCl2A solution to prepare a first mixed liquor, the first mixed liquor comprising: 50ul of said 2.5M CaCl2A solution, 7.5ug of the psPAX2, 2.5ug of the pmd.2g, 10ug of the FT106-TSP4-GFP lentiviral expression plasmid, supplemented ddH2O to 500 ul;
s42, obtaining a 2 HBS buffer solution, adding the first mixed solution into the 2 HBS buffer solution supplemented with ddH 2O-500 ul, and standing at room temperature for 20 minutes to obtain a DNA standing solution;
s43, obtaining a culture dish containing 293T cells, dropwise adding the DNA standing solution into the culture dish containing the 293T cells for culture, and obtaining the FT106-TSP4-GFP lentivirus.
Specifically, mesenchymal stem cells are obtained in the step S50, and the mesenchymal stem cells are infected with the FT106-TSP4-GFP lentivirus, so as to obtain mesenchymal stem cells with TSP4 overexpressed. The mesenchymal stem cells with TSP4 over-expression can be obtained by infecting the mesenchymal stem cells with the prepared FT106-TSP4-GFP lentivirus, the mesenchymal stem cells infected with the FT106-TSP4-GFP lentivirus can realize the over-expression of TSP4, promote the paracrine function of the mesenchymal stem cells, and over-express vascular endothelial growth factors, angiopoietin 1/2 and other growth factors in the mesenchymal stem cells, so that the angiogenesis promoting efficiency of the mesenchymal stem cells is improved, and the application of the mesenchymal stem cells in medicines for treating ischemic diseases is improved.
As a preferred embodiment, the step of infecting the mesenchymal stem cells with the FT106-TSP4-GFP lentivirus comprises:
s51, inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
s52, replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is a DMEM/F12 culture medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
s53, replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
s54, replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
Specifically, in step S51, the mesenchymal stem cells are inoculated into a cell culture flask of a first culture medium, and cultured in a cell culture box at 35-40 ℃ until the density of the mesenchymal stem cells is 75-85%, so as to obtain a first culture product. The first culture medium adopted by the embodiment of the invention is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium, and the DMEM/F12 culture medium plays a role in inhibiting bacterial growth and avoiding cell pollution while culturing mesenchymal stem cells. The first culture product obtained by the embodiment of the invention has the mesenchymal stem cell density of 75-85%, and the cell density not only keeps the cells in the optimal proliferation state, but also keeps the cells in a certain number so as to be better combined with the virus.
Specifically, in step S52, the medium of the first culture product is replaced with a second medium, and the first culture product is cultured at 35 to 40 ℃ for 2 to 4 hours to obtain a second culture product. The second culture medium adopted in the embodiment of the invention is DMEM/F12 culture medium containing FBS, the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium, and the main purpose of culture in the culture medium is to remove the killing effect of double antibodies in the culture medium on the subsequently added FT106-TSP4-GFP lentivirus, reduce the serum content, enable mesenchymal stem cells to be in a starvation state and facilitate the subsequent lentivirus to enter the cells.
Specifically, in step S53, the medium of the second culture product is replaced with a lentiviral culture medium, and the second culture product is cultured at 35 to 40 ℃ for 5 to 8 hours to obtain a third culture product. In the embodiment of the invention, the second culture product is cultured by using the lentivirus culture medium, so that lentiviruses enter the mesenchymal stem cells to infect the mesenchymal stem cells.
In a preferred embodiment, the culture medium of the lentivirus is a DMEM/F-12 culture medium containing FBS, polybrene (polybrene) and a supernatant of FT106-TSP4-GFP lentivirus, wherein the FBS accounts for 5% of the total mass of the lentivirus culture medium, the polybrene is 8ng/ml of the culture medium, and the supernatant of the FT106-TSP4-GFP lentivirus is 0.5-1 ml/ml of the culture medium.
Specifically, in the step S54, the medium of the third culture product is replaced by a third medium, and the third medium is cultured for 48 to 72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third medium is a DMEM/F12 medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third medium, and the mass percentage of the GM accounts for 1% of the total mass of the third medium. In the embodiment of the invention, the mesenchymal stem cells after lentivirus infection are cultured in a DMEM/F12 culture medium containing FBS and GM, wherein the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium for later use.
As a preferred embodiment, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells. The mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells used in the embodiments of the present invention include Vascular Endothelial Growth Factor (VEGF), Platelet Derived Growth Factor (PDGF), angiopoietin 1/2(angiopoietin-1/2, Ang1/2), transforming growth factor- β (transforming growth factor- β, TGF- β), epidermal growth factor (epidermal growth factor, EGF), and other growth factors, which participate in various cellular responses such as regulation of cell nutrition, migration, support, proliferation, survival, apoptosis, differentiation, and further include thrombospondin-4 (thrombospondin-4) that can promote the growth of new blood vessels and improve the angiogenesis function of endothelial cells. The mesenchymal stem cells adopted by the embodiment of the invention have the capabilities of self-renewal, multidirectional differentiation, high proliferation and the like, can accelerate hematopoietic reconstruction, induce angiogenesis in ischemic injury marginal areas, promote metabolism of the ischemic areas, repair nervous systems and motor functions, and improve the treatment effect of the mesenchymal stem cell preparation for treating diabetic feet on the diabetic feet.
As a more preferred embodiment, the mesenchymal stem cells are selected from the group consisting of: mesenchymal stem cells of the third to sixth generations. The embodiment of the invention adopts third-generation to sixth-generation bone marrow mesenchymal stem cells, which mainly comprise uniform long fusiform cells, more filopodia are arranged around the cells, and reticular connection between adjacent cells is formed, at the moment, the cell nucleus is larger, the nuclear membrane is clear, two or three nucleoli are contained, the nucleoplasm is smaller, at the moment, the life of the stem cells is vigorous, the cell proliferation and differentiation capacity is strong, and the FT106-TSP4-GFP lentivirus infection rate is high. More preferably, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells of third to sixth generations.
The embodiment of the invention also provides an application of the mesenchymal stem cell preparation for treating diabetic foot, which comprises the following steps: the mesenchymal stem cell preparation for treating the diabetic foot is applied to the medicine for treating the diabetic foot.
The application of the mesenchymal stem cell preparation for treating the diabetic foot provided by the embodiment of the invention applies the mesenchymal stem cell preparation which can realize the overexpression of a plurality of angiogenesis factors such as TSP4, vascular endothelial growth factor, angiopoietin 1/2 and the like and has high hematopoietic reconstruction and angiogenesis efficiency and is infected by FT106-TSP4-GFP lentivirus to the medicine for treating the diabetic foot disease, can effectively induce the angiogenesis of the ischemic injury marginal area caused by the diabetic foot, promote the metabolism of the ischemic area and repair the nervous system, thereby improving the treatment efficiency of the medicine for treating the diabetic foot on the diabetes.
As a preferred embodiment, any one of the mesenchymal stem cell preparations for treating the diabetic foot is applied to an intramuscular injection medicament for treating the diabetic foot, and the local intramuscular injection medicament for treating the diabetic foot is convenient to apply, directly reaches an affected part and has a quick curative effect.
In order to clearly understand the details and operation of the above-mentioned embodiments of the present invention for those skilled in the art, and to show the remarkable performance of the embodiments of the present invention in the preparation of mesenchymal stem cells for treating diabetic foot and the application thereof, the above-mentioned technical solutions are illustrated by a plurality of examples.