阅读说明：本技术 具有启动子和增强子组合的载体用于治疗苯丙酮尿症 (Vector with promoter and enhancer combination for treating phenylketonuria ) 是由 T·拉胡森 C·D·保扎 于 2018-10-02 设计创作，主要内容包括：公开了用于表达慢病毒颗粒的慢病毒载体系统。该慢病毒载体系统包括治疗载体。该慢病毒载体系统产生慢病毒颗粒,用于上调患有苯丙酮尿症(PKU)的对象细胞中PAH表达。(Lentiviral vector systems for expressing lentiviral particles are disclosed. The lentiviral vector system comprises a therapeutic vector. The lentiviral vector system produces lentiviral particles for up-regulating PAH expression in cells of a subject suffering from Phenylketonuria (PKU).)

1. A viral vector comprising a therapeutic cargo portion, wherein the therapeutic cargo portion comprises:

a PAH sequence or variant thereof;

a promoter; and

an enhancer specific to the liver,

wherein the PAH sequence or variant thereof is operatively controlled by the promoter and liver-specific enhancer.

2. The viral vector of claim 1, wherein the liver-specific enhancer comprises a prothrombin enhancer.

3. The viral vector of claim 2, wherein the promoter comprises a liver-specific promoter.

4. The viral vector of claim 3, wherein the liver-specific promoter comprises a hAAT promoter.

5. The viral vector of claim 1, wherein the PAH sequence or variant thereof is truncated.

6. The viral vector of claim 5, wherein the truncated portion of the PAH sequence or variant thereof is the 3' untranslated region (UTR) of the PAH sequence or variant thereof.

7. The viral vector of claim 1, wherein the therapeutic cargo portion further comprises an β globin intron.

8. The viral vector of claim 1, wherein the therapeutic cargo moiety further comprises at least one hepatocyte nuclear factor binding site.

9. The viral vector of claim 8, wherein the at least one hepatocyte nuclear factor binding site is placed upstream of the prothrombin enhancer.

10. The viral vector of claim 8, wherein the at least one hepatocyte nuclear factor binding site is placed downstream of the prothrombin enhancer.

11. The viral vector of claim 1, wherein the PAH sequence or variant thereof comprises a sequence identical to SEQ ID NO 1; 2, SEQ ID NO; 3, SEQ ID NO; or SEQ ID NO. 4, at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity.

12. The viral vector of claim 11, wherein the PAH sequence or variant thereof comprises SEQ ID NO 1; SEQ ID NO. 2; 3, SEQ ID NO; or SEQ ID NO 4.

13. The lentiviral vector of claim 2, wherein the prothrombin enhancer comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity to SEQ ID NO 5.

14. The viral vector of claim 2, wherein the prothrombin enhancer sequence comprises SEQ ID NO: 5.

15. the viral vector of claim 4, wherein the sequence of the hAAT promoter comprises SEQ ID NO: 6.

16. the viral vector of claim 5, wherein the sequence of the β globin intron comprises SEQ ID NO 7 or 8.

17. The viral vector according to claim 6, wherein the sequence of hepatocyte nuclear factor binding site comprises any of SEQ ID NO 9-12.

18. The viral vector of claim 1, wherein the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding at least one predetermined complementary mRNA sequence.

19. The viral vector of claim 18, wherein the at least one small RNA sequence targets a complementary mRNA sequence comprising a full-length UTR.

20. The viral vector of claim 18, wherein the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence.

21. The viral vector of claim 18, wherein the at least one small RNA sequence comprises an shRNA.

22. The viral vector of claim 18, wherein the at least one small RNA sequence is under the control of a first promoter and the PAH sequence or variant thereof is under the control of a second promoter.

23. The viral vector of claim 20, wherein the first promoter comprises the H1 promoter.

24. The viral vector of claim 20, wherein the second promoter comprises a liver-specific promoter.

25. The viral vector of claim 24, wherein the liver-specific promoter comprises a hAAT promoter.

26. The viral vector of claim 18, wherein the at least one small RNA sequence comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity to SEQ ID No. 13 or SEQ ID No. 14.

27. The viral vector of claim 21, wherein the at least one small RNA sequence comprises SEQ ID No. 13 or SEQ ID No. 14.

28. The viral vector of claim 1, wherein the viral vector is a lentiviral vector.

29. A lentiviral particle capable of infecting a target cell, the lentiviral particle comprising:

an envelope protein optimized for infecting the target cell; and

the viral vector of claim 1.

30. The lentiviral particle of claim 29, wherein the target cell is a hepatocyte, a muscle cell, an epithelial cell, an endothelial cell, a neural cell, a neuroendocrine cell, an endocrine cell, a lymphocyte, a bone marrow cell, a cell present in a solid organ, or a cell of the hematopoietic lineage, hematopoietic stem cell or a precursor hematopoietic stem cell.

31. A method of treating PKU in a subject, the method comprising administering to the subject a therapeutically effective amount of the lentiviral particle of claim 29 or 30.

32. A method of preventing PKU in a subject, the method comprising administering to the subject a therapeutically effective amount of the lentiviral particle of claim 29 or 30.

33. The method of claim 31 or 32, further comprising diagnosing a PKU genotype associated with a PKU phenotype in the subject.

34. The method of claim 31 or 32, wherein the subject is in utero.

35. The method of claim 33, wherein the diagnosing occurs during prenatal screening of the subject.

36. The method of claim 33, wherein said diagnosing occurs in vitro.

37. The method of claim 31 or 32, wherein the therapeutically effective amount of lentiviral particles comprises a plurality of single doses of lentiviral particles.

38. The method of claim 31 or 32, wherein the therapeutically effective amount of lentiviral particles comprises a single dose of lentiviral particles.

Technical Field

Aspects of the present disclosure relate to gene drugs for the treatment of Phenylketonuria (PKU). More specifically, aspects of the present disclosure relate to lentiviral vectors, including those comprising PAH, the expression of which is controlled by various promoter and enhancer combinations.

Background

Phenylketonuria (PKU) refers to a heterogeneous group of diseases that, if left untreated, can lead to impaired growth and development, intellectual disability, epilepsy, and behavioral problems in affected children. The mechanism by which hyperphenylalaninemia leads to dysnoesia reflects the surprising toxicity of high doses of phenylalanine and is involved in hypomyelination or demyelination of nervous system tissues. In north america, PKU has an average reported incidence of 1 out of every 12,000, with the same effect on males and females. The disease is most common in people of native civilian descent in europe or america and reaches higher levels in the eastern part of the mediterranean.

Neural changes have been confirmed in PKU patients within one month after birth, while Magnetic Resonance Imaging (MRI) of adult PKU patients shows white matter lesions in the brain. The size and number of these lesions is directly related to the blood phenylalanine concentration. Cognitive profile in adolescents and adults with PKU may include significant decreases in IQ, processing speed, motor control and inhibition, and reduced performance of attention tests compared to control subjects.

Most PKUs are caused by a deficiency in hepatic phenylalanine hydroxylase (PAH). PAH is a polymeric liver enzyme that binds to molecular oxygen and catalytic amounts of tetrahydrobiopterin (BH)₄) (its non-protein cofactor)Phenylalanine (Phe) is hydroxylated to tyrosine (Tyr). Without sufficient PAH expression, phenylalanine levels in the blood are elevated, leading to hyperphenylalaninemia and deleterious side effects on PKU patients. A decrease or loss of PAH activity may result in the absence of tyrosine and its downstream products, including melanin, 1-thyroxine and catecholamine neurotransmitters, including dopamine.

PKU may be caused by mutations in PAH and/or PAH cofactors (i.e., BH)₄) Defects in synthesis or regeneration. Notably, a variety of PAH mutations have been shown to affect protein folding in the endoplasmic reticulum, which results in accelerated degradation and/or polymerization due to small deletions (13%) and missense mutations (63%) in the protein structure that diminish or largely eliminate the catalytic activity of the enzyme.

In general, PKU is classified according to plasma Phe levels, dietary tolerance to Phe, and potential responsiveness to treatment using three major phenotypic groups. These groups include classical PKU (Phe >1200 μ Μ), atypical or mild PKU (Phe 600-.

Detection of PKU relies on universal neonatal screening (NBS). In a screening that must be performed in all 50 states of the united states, a drop of blood collected from the heel (heel stick) is tested for phenylalanine levels.

Currently, for Phe and BH₄Supplemental lifelong dietary restrictions are the only two treatment options available for PKU, where early therapeutic intervention is critical to ensure optimal clinical outcome for the affected infant. However, expensive pharmaceuticals and special low protein foods place a heavy burden on patients, especially where the personal health insurance does not fully cover these products, which may lead to malnutrition, psychosocial or neurocognitive complications. In addition, BH₄The treatment is mainly for treating BH₄Mild hyperphenylalaninemia associated with a deficiency in biosynthesis is effective, however only 20-30% of mild or classical PKU patients respond to this. Therefore, new PKU treatment modalities are urgently needed to replace the heavy Phe-restricted diet. Therefore, there is a need to develop a method for treating propiophenoneAlternative methods to uropathy.

Genetic drugs have the potential to effectively treat PKU. Genetic drugs may involve the delivery and expression of genetic constructs for disease treatment or prevention purposes. Expression of the genetic construct may be regulated by various promoters, enhancers, and/or combinations thereof.

Disclosure of Invention

Within aspects of the disclosure, the viral vector comprises a therapeutic cargo portion, wherein the therapeutic cargo portion comprises a PAH sequence or variant thereof, a promoter, a liver-specific enhancer, wherein the PAH sequence or variant thereof is operatively controlled by the promoter and the liver-specific enhancer.

In embodiments, the liver specific enhancer comprises a prothrombin enhancer, in embodiments, the promoter is a liver specific promoter, in embodiments, the liver specific promoter comprises an hAAT promoter, in embodiments, the therapeutic cargo portion further comprises β globin intron, in embodiments, the therapeutic cargo portion further comprises at least one hepatocyte nuclear factor binding site.

In some embodiments, the PAH sequence or variant thereof is truncated. In embodiments, the portion of the PAH sequence or variant thereof that is truncated is the 3' untranslated region (UTR) of the PAH sequence or variant thereof.

In some embodiments, the PAH sequence or variant thereof comprises a sequence that is at least 80%, or at least 85%, or at least 90%, or at least 95% identical in percentage to:

ATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGAAACAAGCTATATTGAAGACAACTGCAATCAAAATGGTGCCATATCACTGATCTTCTCACTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCGCTTATTTGAGGAGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGGTTCCCAAGAACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCGGAACTGGATGCTGACCACCCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAGTTTGCTGACATTGCCTACAACTACCGCCATGGGCAGCCCATCCCTCGAGTGGAATACATGGAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGACTCTGAAGTCCTTGTATAAAACCCATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTACTGTGGCTTCCATGAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAATTCCTGCAGACTTGCACTGGTTTCCGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTCCGAGTCTTCCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAACCTGACATCTGCCATGAGCTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCCCAGTTTTCCCAGGAAATTGGCCTTGCCTCTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCTCTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTACTGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGGATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAAATTGGAATCCTTTGCAGTGCCCTCCAGAAAATAAAGTAA(SEQ ID NO:1)；

ATGAGTACGGCTGTGCTCGAGAATCCAGGTTTGGGCCGAAAGCTGTCTGATTTTGGACAGGAGACATCTTATATTGAAGACAACTGCAACCAGAATGGTGCGATATCCCTTATTTTTTCTCTGAAAGAAGAAGTAGGTGCGCTGGCAAAGGTCTTGCGGCTGTTTGAAGAGAACGATGTTAATCTTACTCATATTGAGTCCAGACCATCACGGCTGAAAAAAGACGAGTACGAATTTTTTACTCACTTGGACAAACGAAGCTTGCCGGCTCTTACTAATATCATTAAGATCCTCCGGCATGACATAGGGGCGACAGTGCATGAGCTTTCAAGGGATAAAAAGAAAGATACCGTCCCCTGGTTTCCAAGGACCATACAAGAACTCGACCGATTCGCGAACCAGATCCTTTCATATGGTGCTGAGTTGGATGCTGACCACCCCGGCTTCAAAGACCCGGTCTACCGAGCGCGGCGGAAACAATTTGCTGACATCGCATACAATTACAGGCATGGCCAGCCAATTCCTAGAGTAGAATACATGGAAGAAGAGAAAAAAACCTGGGGTACCGTCTTCAAGACGCTGAAATCATTGTATAAAACTCATGCATGTTACGAATATAACCATATTTTTCCGTTGCTCGAGAAATATTGCGGGTTCCACGAAGATAACATCCCACAACTCGAGGATGTATCTCAGTTCCTCCAGACCTGTACGGGGTTTCGACTTAGGCCTGTCGCGGGTTTGCTCAGTTCTCGAGACTTCCTGGGTGGATTGGCGTTTCGGGTATTCCATTGCACGCAGTATATCCGACACGGAAGTAAGCCAATGTACACGCCAGAACCCGATATCTGTCACGAATTGCTTGGACACGTTCCTCTGTTTTCTGATCGATCATTCGCTCAGTTTTCACAGGAAATCGGCCTGGCATCTTTGGGAGCGCCGGATGAATATATTGAGAAGCTCGCTACAATTTACTGGTTCACGGTAGAATTTGGGTTGTGCAAGCAGGGTGATAGTATTAAAGCATACGGTGCGGGATTGCTGTCCTCATTCGGGGAGCTTCAGTATTGCCTGTCCGAGAAACCCAAGCTGTTGCCGTTGGAATTGGAAAAAACCGCTATCCAAAATTACACAGTAACGGAGTTCCAACCTTTGTACTACGTAGCCGAGTCATTTAACGATGCAAAGGAGAAGGTCAGAAATTTTGCTGCGACGATACCCAGACCGTTCTCAGTAAGGTACGATCCTTACACTCAGAGGATTGAAGTCCTGGATAATACGCAACAGCTCAAGATCCTGGCAGACTCCATAAATTCTGAAATCGGCATCTTGTGTTCAGCACTGCAAAAGATAAAATAA(SEQ ID NO:2)；

AGCCATGGACAGAATGTGGTCTGTCAGCTGTGAATCTGTTGATGGAGATCCAACTATTTCTTTCATCAGAAAAAGTCCGAAAAGCAAACCTTAATTTGAAATAACAGCCTTAAATCCTTTACAAGATGGAGAAACAACAAATAAGTCAAAATAATCTGAAATGACAGGATATGAGTACATACTCAAGAGCATAATGGTAAATCTTTTGGGGTCATCTTTGATTTAGAGATGATAATCCCATACTCTCAATTGAGTTAAATCAGTAATCTGTCGCATTTCATCAAGATTAATTAAAATTTGGGACCTGCTTCATTCAAGCTTCATATATGCTTTGCAGAGAACTCATAAAGGAGCATATAAGGCTAAATGTAAAACCCAAGACTGTCATTAGAATTGAATTATTGGGCTTAATATAAATCGTAACCTATGAAGTTTATTTTTTATTTTAGTTAACTATGATTCCAATTACTACTTTGTTATTGTACCTAAGTAAATTTTCTTTAAGTCAGAAGCCCATTAAAATAGTTACAAGCATTGAACTTCTTTAGTATTATATTAATATAAAAACATTTTTGTATGTTTTATTGTAATCATAAATACTGCTGTATAAGGTAATAAAACTCTGCACCTAATCCCCATAACTTCCAGTATCATTTTCCAATTAATTATCAAGTCTGTTTTGGGAAACACTTTGAGGACATTTATGATGCAGCAGATGTTGACTAAAGGCTTGGTTGGTAGATATTCAGGAAATGTTCACTGAATAAATAAGTAAATACATTATTGAAAAGCAAATCTGTATAAATGTGAAATTTTTATTTGTATTAGTAATAAAACATTAGTAGTTTAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGACTCTAGATT (SEQ ID NO: 3); or

AGCCATGGACAGAATGTGGTCTGTCAGCTGTGAATCTGTTGATGGAGATCCAACTATTTCTTTCATCAGAAAAAGTCCGAAAAGCAAACCTTAATTTGAAATAACAGCCTTAAATCCTTTACAAGATGGAGAAACAACAAATAAGTCAAAATAATCTGAAATGACAGGATATGAGTACATACTCAAGAGCATAATGGTAAATCTTTTGGGGTCATCTTTGATTTAGAGATGATAATCCCATACTCTCAATTGAGTTAAATCAGTAATCTGTCGCATTTCATCAAGATTA(SEQ IDNO:4)。

In some embodiments, the PAH sequence or variant thereof comprises: 1, SEQ ID NO; 2, SEQ ID NO; 3, SEQ ID NO; or SEQ ID NO 4.

In some embodiments, the prothrombin enhancer comprises a sequence that is at least 80%, or at least 85%, or at least 90%, or at least 95% identical in percentage to:

GCGAGAACTTGTGCCTCCCCGTGTTCCTGCTCTTTGTCCCTCTGTCCTACTTAGACTAATATTTGCCTTGGGTACTGCAAACAGGAAATGGGGGAGGGACAGGAGTAGGGCGGAGGGTAG(SEQ ID NO:5)。

in an embodiment, the prothrombin enhancer comprises SEQ ID NO 5.

In embodiments, the hAAT promoter sequence comprises SEQ ID NO 6 in embodiments the sequence of the β globin intron comprises any of SEQ ID NO 7 or 8 in embodiments the sequence of the hepatocyte nuclear factor binding site comprises any of SEQ ID NO 9-12.

In embodiments, the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding at least one predetermined complementary mRNA sequence. In embodiments, the at least one small RNA sequence targets a complementary mRNA sequence containing the full-length UTR. In embodiments, the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence. In embodiments, the at least one small RNA sequence inhibits the production of endogenous PAH. In embodiments, the at least one small RNA sequence comprises a shRNA. In embodiments, the at least one small RNA sequence is under the control of a first promoter and the PAH sequence or variant thereof is under the control of a second promoter. In an embodiment, the first promoter comprises the H1 promoter. In embodiments, the second promoter comprises a liver-specific promoter. In embodiments, the liver-specific promoter comprises a hAAT promoter. In some embodiments, the at least one small RNA sequence comprises a sequence that is at least 80%, or at least 85%, or at least 90%, or at least 95% identical in percentage to:

TCGCATTTCATCAAGATTAATCTCGAGATTAATCTTGATGAAATGCGATTTTT (SEQ ID NO: 13); or

ACTCATAAAGGAGCATATAAGCTCGAGCTTATATGCTCCTTTATGAGTTTTTT(SEQ ID NO:14)。

In embodiments, at least one small RNA sequence comprises SEQ ID NO 13; or SEQ ID NO 14.

In some embodiments, the viral vector is a lentiviral vector. In an embodiment, the viral vector is an AAV vector.

Among aspects of the disclosure, a lentiviral particle capable of infecting a target cell comprises an envelope protein optimized for infecting the target cell, and a viral vector according to any one of the embodiments of the disclosure. In embodiments, the target cell is a hepatocyte, muscle cell, epithelial cell, endothelial cell, neural cell, neuroendocrine cell, endocrine cell, lymphocyte, bone marrow cell, a cell present in a solid organ, or a cell of the hematopoietic lineage, hematopoietic stem cell or precursor hematopoietic stem cell.

Among the aspects of the disclosure are methods of treating PKU in a subject. The method comprises administering to the subject a therapeutically effective amount of a lentiviral particle described herein. Within aspects of the disclosure, a method of preventing PKU in a subject comprises administering to the subject a therapeutically effective amount of a lentiviral particle described herein. In embodiments, the method further comprises diagnosing a PKU genotype associated with the PKU phenotype in the subject. In an embodiment, the subject is within uterus. In an embodiment, the diagnosis occurs during prenatal screening of the subject. In embodiments, the diagnosis occurs in vitro. In an embodiment, the therapeutically effective amount of lentiviral particles comprises a plurality of single doses of lentiviral particles. In an embodiment, the therapeutically effective amount of lentiviral particles comprises a single dose of lentiviral particles.

Drawings

FIG. 1 shows an example of a 3-vector lentiviral vector system in circularized form.

FIG. 2 shows an example of a 4-vector lentiviral vector system in circularized form.

FIG. 3 shows a linear map of 8 examples of lentiviral vectors comprising variations of the prothrombin enhancer and the hAAT promoter to regulate PAH expression.

FIGS. 4A and 4B show (FIG. 4A) the immunoblot data comparing PAH levels in Hepa1-6 and (FIG. 4B)293T cells using different enhancer elements with and without 3' UTR.

FIGS. 5A-5C show immunoblot data comparing PAH levels in Hepa1-6 cells with and without (FIG. 5A) rabbit β globin intron, (FIG. 5B) codon optimized PAH sequence, and (FIG. 5C) prothrombin enhancer with HNF1 or HNF1/4 binding sites upstream or downstream.

FIG. 6 shows PAH RNA expression in Hepa1-6 cells transduced with lentiviral vectors expressing PAH via changes in the prothrombin enhancer.

FIG. 7 shows immunoblot data comparing PAH expression levels in Hepa1-6 cells using anti- α 1 trypsin (hAAT) or thyroxine-binding globulin (TBG) promoters.

Figures 8A and 8B show immunoblot data comparing PAH levels in Hepa1-6 cells (figure 8A) or Hep3B cells (figure 8B) with and without rabbit or human β globin intron.

Figure 9 shows immunoblot data for PAH expression in human primary hepatocytes using PAH-expressing lentiviral vectors.

FIGS. 10A-10C show PAH activity determined by measuring phenylalanine levels in cell culture medium (FIGS. 10A and 10C) or in lysates of Hepa1-6 cells transduced with a PAH-expressing lentiviral vector and treated with sepiapterin (BH4 cofactor precursor) 1-6.

FIG. 11 shows Pah after treatment with a lentiviral vector comprising PAH^enu2The Phe level in the blood of the mice decreased.

FIG. 12 shows blood phenylalanine inhibition by L V-Pro-hAAT-PAH.

Figures 13A-13D show PAH protein expression (figure 13A) and PAH RNA expression (13D) following PAH expression in 293 cells delivered using various DJ or AAV/2 serotype vector AAVs; fold changes in PAH protein expression were also analyzed after delivery of AAV/DJ vectors (fig. 13B) and AAV/2 vectors (fig. 13C).

FIG. 14 shows a reduction of Phe levels in neonatal enu2/enu2 mice treated with L V-Pro-hAAT-PAH lentiviral vector therapy directed to PKU.

FIG. 15 shows data from Hep3B cells showing PAH expression after treatment with lentiviral vectors encoding prothrombin-hAAT-PAH-PAH shRNA sequence #1(SEQ ID NO:13) or prothrombin-hAAT-PAH-PAH shRNA sequence #2(SEQ ID NO:14), each targeting the 3' UTR of mRNA expressed from the endogenous Pah gene and inhibiting expression of PAH protein.

Detailed Description

SUMMARY

The present disclosure relates to therapeutic vectors and the delivery of the same to cells. In embodiments, the therapeutic vector comprises a PAH sequence or variant thereof and a liver-specific enhancer. In embodiments, the therapeutic vector further comprises a small RNA that modulates expression of the host (i.e., endogenous) PAH protein.

Definition and interpretation

Unless otherwise indicated, the scientific terms used in this disclosure shall have the meanings commonly understood by those of ordinary skill in the art, and unless otherwise indicated, the singular terms include the plural and the plural include the singular. generally, the nomenclature and techniques used in cell and tissue culture, Molecular Biology, immunology, microbiology, genetics and Protein and nucleic acid chemistry and hybridization herein are those well known and commonly used in the art unless otherwise indicated, the Methods and techniques of this disclosure generally follow conventional Methods as are well known in the art and as described in various general or special references, see, e.g., Sambrook J. and Russd Molecular Cloning: A laboratory Manual, third edition, Cold Spring laboratory Press, Cold Spring Harbor, Inc. (Harbour. Biotechnology handbook. Biotechnology Protocols, Protocols commonly used in the chemistry, Inc.: Methods, Methods and Protocols for Protein synthesis, Methods used in the fields, chemistry & Methods, chemistry and Protocols for Molecular Biology & Science and cell & chemistry, see, Molecular research, Protocols commonly used in the laboratory, Inc. (Cold Spring Harbour, Inc.: Harbour, Molecular research, Molecular Cloning, Molecular research.

As used in the specification and the appended claims, the singular forms "a," "an," and "the" are used interchangeably and include the plural forms and are intended to have each meaning unless the context clearly dictates otherwise. Herein, "and/or" means and encompasses any and all possible and combined deletions of one or more of the listed items as interpreted or otherwise ("or").

All numerical labels, such as pH, temperature, time, concentration and molecular weight, including ranges, are approximate values, which vary (+) or (-), in increments of 0.1. It should be understood that all numerical values given are preceded by the term "about," although not all are explicitly stated. "about" includes the exact value of "X" in addition to minor changes in "X" such as "X + 0.1" or "X-0.1". It is also to be understood that the reagents described herein, although not all explicitly shown, are exemplary only and that equivalents are known in the art.

As used herein, "about" is understood by one of ordinary skill in the art and will vary to some extent depending on the context in which it is used. If the meaning of the word in connection with the context in which it is used is still unclear to a person of ordinary skill in the art, "about" means up to plus or minus 10% of a particular item.

The term "administering" or "administering" an active agent is understood to mean providing the active agent to a subject in need of treatment in a form that can be introduced into the subject in a therapeutically useful form and in a therapeutically effective amount.

As used herein, the term "comprising" or "comprises" is intended to mean that the compositions and methods include the elements mentioned, but not to exclude other elements. When used to define compositions and methods, "consisting essentially of … …" is meant to exclude other elements having any essential meaning for the compositions and methods. "consisting of … …" means that trace elements and essential process steps are excluded more than other ingredients of the claimed composition. Embodiments defined by each of these converted terms are within the scope of the invention. Accordingly, it is intended that the methods and compositions may include additional steps and components (including), or alternatively, may include unimportant steps and compositions (consisting essentially of), or may include only the method steps or compositions (consisting of).

As used herein, "expression," "expressed," or "encoding" refers to the process by which a polynucleotide is transcribed into mRNA and/or the process by which transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Expression may include mRNA splicing or other forms of post-transcriptional or post-translational modification in eukaryotic cells.

The term "adeno-associated viral vector" as used herein refers to a vehicle or transporter for adeno-associated virus. The term "adeno-associated viral vector" may also be referred to herein as an "AAV vector".

The term "adeno-associated virus" as used herein refers to a small virus that produces a mild immune response, is capable of integrating into the host cell genome, and is not pathogenic.

The term "AAV/DJ" (also referred to herein as "AAV-DJ") as used herein is a serotype of AAV vector engineered from different AAV serotypes that mediates higher transduction and infection rates than wild type AAV serotypes.

The term "AAV 2" (also referred to herein as "AAV/2" or "AAV-2") as used herein is a naturally occurring AAV serotype.

The term "AAV-Pro-hAAT-PAH" as used herein refers to an AAV vector comprising a prothrombin enhancer, an hAAT promoter, and PAH sequences.

The abbreviation "ApoE enhancer" as used herein refers to an apolipoprotein E enhancer.

The term "genetic drug" or "genetic drug" as used herein generally refers to a therapeutic agent or therapeutic strategy that focuses on a genetic target to treat a clinical disease or manifestation. The term "gene drug" encompasses gene therapy and the like.

The abbreviation "hAAT" as used herein refers to the hAAT promoter.

The term "hAAT-hPAH-3' UTR" as used herein₂₈₉"may also be referred to herein as U₂₈₉Alternatively referred to as a transgenically expressed truncated hPAH 3'UTR, alternatively referred to as a truncated 3' UTR.

The term "hepatocyte nuclear factor" as used herein refers to the expression of transcription factors primarily in the liver. Types of hepatocyte nuclear factor include, but are not limited to, hepatocyte nuclear factor 1, hepatocyte nuclear factor 2, hepatocyte nuclear factor 3 and hepatocyte nuclear factor 4.

The abbreviation "HNF" as used herein refers to hepatocyte nuclear factor. Correspondingly, HNF1 refers to hepatocyte nuclear factor 1, HNF2 refers to hepatocyte nuclear factor 2, HNF3 refers to hepatocyte nuclear factor 3, and HNF4 refers to hepatocyte nuclear factor 4.

The phrase "HNF binding site" as used herein refers to a region of DNA to which HNF transcription factors can bind. Accordingly, the HNF1 binding site is the DNA region to which HNF1 can bind, while the HNF4 binding site is the DNA region to which HNF4 can bind.

As used herein, the terms "individual," "subject," and "patient" are used interchangeably and refer to any individual mammalian subject, e.g., murine, porcine, bovine, canine, feline, equine, non-human primate, or human primate.

The phrase "rabbit β globin intron" as used herein refers to a nucleic acid fragment within the rabbit β globin gene that is spliced out during RNA maturation and does not encode a protein.

The phrase "human β globin intron" as used herein refers to a nucleic acid fragment within the human β globin gene that is spliced out during RNA maturation and does not encode a protein.

As used herein, the term "L V" refers generally to "lentivirus". As a non-limiting example, reference to "L V-PAH" refers to a lentivirus containing a PAH sequence and expressing PAH.

The term "L V-Pro-hAAT-PAH" as used herein refers to a lentivirus comprising a prothrombin enhancer, an hAAT promoter, and PAH sequences the L V-Pro-hAAT-PAH vector is also referred to as the AGT323 vector.

The term "L V-HNF-Pro-hAAT-PAH" as used herein refers to a lentivirus comprising HNF binding sites, prothrombin enhancer, hAAT promoter and PAH sequences.

The term "L V-Pro-intron-PAH" as used herein refers to a lentivirus comprising prothrombin enhancer, intron and PAH sequences, wherein the intron is the human β globin intron.

The term "L V-Pro-hAAT" as used herein refers to a lentivirus comprising a prothrombin enhancer and a hAAT promoter.

The term "L V-Pro-TBG-PAH" as used herein refers to a lentivirus comprising prothrombin enhancer, thyroxine binding globulin, and PAH sequences.

The term "L V-ApoE-hAAT-PAH-UTR" as used herein refers to a lentivirus comprising an apolipoprotein E enhancer, an hAAT promoter, a PAH sequence and an untranslated region of a gene, wherein the untranslated region is the 3' UTR of a PAH gene.

The term "L V-Pro-hAAT-PAH-shPAH" as used herein refers to a lentivirus comprising a prothrombin enhancer, an hAAT promoter, a PAH sequence, and a shPAH sequence.

Herein, "packaging cell line" refers to any cell line that can be used to express lentiviral particles.

The term "percent identity," as used herein in the context of two or more nucleic acid or polypeptide sequences, refers to a specified percentage of two or more sequences or subsequences that have the same nucleotide or amino acid residues, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms (e.g., B L ASTP and B L ASTN, or other algorithms available to those skilled in the art) or by visual inspection.

The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of humans and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio.

As used herein, "pharmaceutically acceptable carrier" means and includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are physiologically compatible. The compositions may include pharmaceutically acceptable salts, such as acid addition salts or base addition salts (see, e.g., Berge et al (1977) j.pharm.sci.66: 1-19).

The term "phenylalanine hydroxylase" may also be referred to herein as PAH. The term phenylalanine hydroxylase encompasses all wild-type and variant PAH sequences, including nucleotide and peptide sequences. For non-limiting purposes, the term phenylalanine hydroxylase includes SEQ ID NOs 1-4, and also includes variants having at least about 80% identity thereto. Human PAH may also be referred to as hPAH. Human PAH may also be referred to as hPAH.

The term "wild-type hPAH" as used herein may also be referred to as endogenous PAH or "full-length PAH".

The term "phenylketonuria" as used herein, also referred to herein as "PKU", refers to the chronic deficiency of phenylalanine hydroxylase, and all symptoms associated therewith, including mild and classical forms of the disease. Thus, treatment of "phenylketonuria" may include treatment of all or some of the symptoms associated with PKU.

The term "prothrombin enhancer" as used herein is a region of the prothrombin gene to which a protein can bind, which results in transcription of the prothrombin gene.

The abbreviation "Pro" as used herein refers to the prothrombin enhancer.

As used herein, "small RNA" refers to non-coding RNA, typically about 200 nucleotides or less in length, and having silencing or interfering functions. In other embodiments, the small RNA is about 175 nucleotides or less in length, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less. Such RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), double-stranded RNAs (dsRNA), and short hairpin RNAs (shRNAs). The "small RNA" of the present disclosure should be capable of inhibiting or knocking down gene expression of a target gene, typically through a pathway that results in the destruction of the target gene mRNA.

The term "shPAH" as used herein refers to small hairpin RNAs that target PAH.

The abbreviation "lncRNA" as used herein refers to long noncoding RNA.

As used herein, "SEQ ID NO" is synonymous with "sequence ID No".

The term "thyroxine-binding globulin" as used herein is a transporter protein responsible for carrying thyroid hormones in the bloodstream. The abbreviation "TBG" is used herein to denote a nail-like adectin binding globulin.

As used herein, a "therapeutically effective amount" refers to an amount of an active agent herein that is sufficient, in a suitable composition, in a suitable dosage form, to treat or avoid the occurrence of symptoms, progression, or complications seen in a patient of a given abnormality, injury, disease, or disorder. The "therapeutically effective amount" depends on the condition of the patient or its severity, the age, weight, etc. of the subject being treated. The therapeutically effective amount may vary depending on any of a number of factors, including, for example, the route of administration, the condition of the subject, and other factors understood by those skilled in the art.

As used herein, the term "therapeutic vector" includes, but is not limited to, a lentiviral vector or an adeno-associated virus (AAV) vector. Furthermore, as used herein and with reference to lentiviral vector systems, the term "vector" is synonymous with the term "plasmid". For example, 3-vector and 4-vector systems (which include 2-vector and 3-vector packaging systems) can also be referred to as 3-plasmid and 4-plasmid systems.

The term "treatment" or "treating" as used herein generally refers to an intervention that attempts to alter the natural course of the subject being treated, and may be used prophylactically or during clinical pathology. Desirable effects include, but are not limited to, avoiding the occurrence or recurrence of a disease, alleviating symptoms, suppressing, reducing or inhibiting various direct or indirect pathological consequences of a disease, ameliorating or calming a disease state, and causing remission or improving prognosis.

Reference to "treatment" is intended to target and combat a disease state, i.e., to ameliorate or prevent a disease state. Thus, the particular treatment/treatment will depend on the disease state to be targeted and the current or future state of the drug treatment and therapeutic approach. Treatment may have associated toxicity.

The term "truncated" as used herein is also referred to herein as "shortened" or "… … -free".

The term "UTR" as used herein refers to a region of a gene that is either 5 'or 3' to the coding region of the gene.

The term "3 'UTR" as used herein is a "UTR" that is 3' to the coding region of a gene.

The term "variant" as used herein is also referred to herein as an analog or variation. Variants refer to any substitution, deletion or addition to a nucleotide sequence.

It is contemplated herein that optimal alignment of sequences for comparison may be performed, for example, using the local homology algorithm of Smith & Waterman, adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman & Wunsch, J.mol.biol.48:443(1970), the similarity search method of Pearson & L ipman, Proc.Nat 'l.Acad.Sci.USA 85:2444(1988), computer runs using these algorithms (GAP, BESTFIT, FASTA and TFASTA in version 7.0 of the Wisconsin genetic software package, Wisconsin, USA, Madison's city department of sciences drive 575), or by visual inspection as before (see generally bebesul et al, see, supra).

An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the B L AST algorithm, which is described in Altschul et al, J.mol.biol.215: 403-.

Nucleic acid and protein sequences herein may also be used as "query sequences" to search public databases, for example to identify related sequences therefrom such searches may be run using the NB L AST and XB L AST programs (version 2.0) of Altschul et al, 1990, j.mol.biol., 215: 403-10. a B L AST nucleotide search (score 100, word length 12) may be performed using the NB L0 AST program to obtain nucleotide sequences homologous to Nucleic acid molecules herein a B L AST protein search (score 50, word length 3) may be performed using the XB L AST program to obtain amino acid sequences homologous to protein molecules herein for comparison purposes.

Description of the disclosed embodiments and aspects

Within aspects of the disclosure, the viral vector comprises a therapeutic cargo portion, wherein the therapeutic cargo portion comprises a PAH sequence or variant thereof, a promoter, a liver-specific enhancer, wherein the PAH sequence or variant thereof is operatively controlled by the promoter and the liver-specific enhancer.

In embodiments, the liver specific enhancer comprises a prothrombin enhancer, in embodiments, the promoter is a liver specific promoter, in embodiments, the liver specific promoter comprises an hAAT promoter, in embodiments, the therapeutic cargo portion further comprises β globin intron, in embodiments, the therapeutic cargo portion further comprises at least one hepatocyte nuclear factor binding site.

In embodiments, lentiviral vectors are provided comprising a prothrombin enhancer, a hAAT promoter and a PAH sequence (L V-Pro-hAAT-PAH). in embodiments, lentiviral vectors are provided comprising an HNF binding site, a prothrombin enhancer, an hAAT promoter and a PAH sequence (L V-HNF-Pro-hAAT-PAH). in embodiments, the HNF binding site is HNF1 or HNF1/4 binding site in embodiments lentiviral vectors are provided comprising a prothrombin enhancer, an hAAT promoter, an intron and a PAH sequence (L V-Pro-intron-PAH). in embodiments, the intron is a rabbit globin intron in embodiments, human globin intron in embodiments lentiviral vectors are provided

(LV-ApoE-hAAT-PAH-UTR)。

In some embodiments, the PAH sequence or variant thereof is truncated. In embodiments, the portion of the PAH sequence or variant thereof that is truncated is the 3' untranslated region (UTR) of the PAH sequence or variant thereof.

In embodiments, the PAH truncation at the 3'UTR prevents binding of certain regulatory RNAs to the 3' UTR. In embodiments, the regulatory RNA is lncRNA. In embodiments, the regulatory RNA is a microrna. In embodiments, the regulatory RNA is a piRNA. In embodiments, the regulatory RNA is shRNA. In embodiments, the regulatory RNA is an siRNA of 19-25 nucleotides in length. In embodiments, the regulatory RNA is a small RNA sequence comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity to SEQ ID No. 13 or 14.

In embodiments, the PAH sequence comprises SEQ ID NO 1. In embodiments, the PAH sequence comprises a codon optimized PAH sequence (SEQ ID NO: 2). In embodiments, the PAH sequence or variant thereof comprises a truncated 3' UTR (289 nucleotides) (SEQ ID NO: 4). In embodiments, the PAH sequence or variant thereof comprises the 5' UTR (897 nucleotides) (SEQ ID NO: 3).

In embodiments, the PAH sequence or variant thereof comprises a sequence identical to SEQ ID NO 1; 2, SEQ ID NO; 3, SEQ ID NO; or SEQ ID NO. 4, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity.

In embodiments, variants may be prepared against any of the above sequences. In some embodiments, the PAH sequence or variant thereof comprises: 1, SEQ ID NO; 2, SEQ ID NO; 3, SEQ ID NO; or SEQ ID NO 4.

In embodiments, the prothrombin enhancer comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identical to SEQ ID No. 5.

In embodiments, variants may be prepared against the above sequences. In an embodiment, the prothrombin enhancer sequence comprises SEQ ID NO 5.

In embodiments, the hAAT promoter sequence comprises SEQ ID NO 6 in embodiments the sequence of the β globin intron comprises any of SEQ ID NO 7 or 8 in embodiments the sequence of the hepatocyte nuclear factor binding site comprises any of SEQ ID NO 9-12.

In embodiments, the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding at least one predetermined complementary mRNA sequence. In embodiments, the at least one small RNA sequence targets a complementary mRNA sequence containing the full-length UTR. In embodiments, the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence. In embodiments, the at least one small RNA sequence comprises a shRNA. In embodiments, the at least one small RNA sequence is under the control of a first promoter and the PAH sequence or variant thereof is under the control of a second promoter. In an embodiment, the first promoter comprises the H1 promoter. In embodiments, the second promoter comprises a liver-specific promoter. In embodiments, the liver-specific promoter comprises a hAAT promoter. In another aspect, the at least one small RNA sequence comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identical to SEQ ID No. 13 or SEQ ID No. 14.

In embodiments, variants may be prepared against any of the above sequences. In embodiments, at least one small RNA sequence comprises SEQ ID NO 13; or SEQ ID NO 14.

In embodiments, a lentiviral vector is provided comprising a prothrombin enhancer, a hAAT promoter, a PAH sequence, and an shRNA targeting endogenous PAH (L V-Pro-hAAT-PAH-shPAH) in embodiments, the shRNA targets the 3' utr of endogenous PAH in embodiments, the shPAH sequence comprises SEQ ID No. 13 in embodiments, the shPAH sequence comprises SEQ ID No. 14.

In aspects of the disclosure, a lentiviral particle capable of infecting a target cell comprises an envelope protein optimized for infecting the target cell, and any of the viral vectors described herein. In embodiments, the target cell is a hepatocyte, muscle cell, epithelial cell, endothelial cell, neural cell, neuroendocrine cell, endocrine cell, lymphocyte, bone marrow cell, a cell present in a solid organ, or a cell of the hematopoietic lineage, hematopoietic stem cell or precursor hematopoietic stem cell.

In aspects of the disclosure, a method of treating PKU in a subject comprises administering to the subject a therapeutically effective amount of any of the lentiviral particles disclosed herein. In aspects of the disclosure, a method of preventing PKU in a subject comprises administering to the subject a therapeutically effective amount of any of the lentiviral particles disclosed herein. In another aspect of the disclosure, the use of a therapeutically effective amount of any of the lentiviral particles disclosed herein for treating PKU in a subject is disclosed. In embodiments, the method further comprises diagnosing a PKU genotype associated with the PKU phenotype in the subject. In an embodiment, the subject is within uterus. In embodiments, the diagnosis occurs during prenatal screening of the subject or after genetic screening by the parent. In embodiments, the diagnosis occurs in vitro. In an embodiment, the therapeutically effective amount of lentiviral particles comprises a plurality of single doses of lentiviral particles. In an embodiment, the therapeutically effective amount of lentiviral particles comprises a single dose of lentiviral particles.

Within the disclosed aspects, a method of treating PKU in a subject is provided that includes treating a subject having a mutant form of PAH with a therapeutically effective amount of a lentiviral vector comprising exogenous PAH. In an embodiment, the subject is a mammal. In an embodiment, the mammal is a human. In an embodiment, the mammal is a rodent. In embodiments, the rodent is a mouse or a rat. In an embodiment, the mammal is a pig.

In embodiments, the subject is treated with a lentiviral vector. In embodiments, the lentiviral vector comprises a PAH sequence or a variant thereof. In embodiments, the PAH sequence is any one of the PAH sequences or variants described herein.

In embodiments, the lentiviral vector is any of the lentiviral vectors comprising a PAH sequence or variant described herein. In embodiments, the lentiviral vector comprising PAH is a lentiviral vector expressing PAH as shown in figures 1 and 2. In embodiments, the lentiviral vector comprising PAH is a lentiviral vector expressing PAH as shown in figure 3.

In embodiments, the viral vector comprises a prothrombin enhancer, a hAAT promoter, and a PAH sequence (also referred to herein as L V-Pro-hAAT-PAH or AGT 323).

In an embodiment, the lentiviral vector comprises an integrating lentiviral vector. In an embodiment, the integrating lentiviral vector is derived from a lentiviral vector system. In embodiments, the lentiviral vector system comprises separate plasmids encoding the rev gene and the env gene. In an embodiment, the integrating lentiviral vector is derived from a 3-vector lentiviral system. In an embodiment, a 3-vector lentivirus system is shown in FIG. 1. In an embodiment, the integrating lentiviral vector is derived from a 4-vector lentiviral system. In an embodiment, a 4-vector lentiviral vector system is shown in fig. 2.

In embodiments, the subject is treated with an adeno-associated virus (AAV) vector. In embodiments, the AAV vector comprises any one of the AAV vectors disclosed herein. In embodiments, the AAV vector comprises a PAH sequence or a variant thereof. In embodiments, the PAH sequence is any one of the PAH sequences or variants described herein.

In an embodiment, the injection is an intradermal injection. In an embodiment, the injection is an intramuscular injection. In an embodiment, the injection is subcutaneous. In an embodiment, the injection is intravenous.

In embodiments, the methods presented herein further comprise generating a specific titer of the integrated lentiviral vector prior to treating the subject with the lentiviral particle. Specific titers were determined in a test system using lentiviral vector transduction in vitro and cell targets, followed by analysis of chromosomal DNA of the transduced cells by quantitative PCR to measure the frequency of transduced cells and the number of copies of the integrated vector per cell. Titers are expressed as the number of integrated copies that result from transduction into the appropriate number of cells using the appropriate volume of lentiviral vector. In embodiments, the potency is 1x10⁵To 1x10¹⁵Integrated vector copies, e.g. 1X10⁷To 1x10¹³Copy of the integration vector, or 1x10⁹To 1x10¹¹A copy of the vector is integrated. In embodiments, the potency is 1x10¹⁰A copy of the vector is integrated.

In embodiments, generating a particular titer of an integrated lentiviral vector comprises adding a vector system to one or more cells, in embodiments, the one or more cells is a cell line, in embodiments, the cell line is a 293T cell line, in embodiments, the cell line is a He L a cell line, in embodiments, the cell line is a CHO cell line, in embodiments, the cell line is a Hep3B cell line.

In embodiments, the method further comprises measuring Phe levels in the blood after injection of the lentiviral vector comprising PAH.

In aspects of the disclosure, human PAH is expressed in a cell using an AAV-delivered expression system. In embodiments, AAV-2 serotypes are used. In embodiments, AAV-DJ serotypes are used. In embodiments, the AAV vector comprises GFP. In embodiments, the AAV vector may represent any serotype or may be generated from recombinant DNA or other synthetic methods aimed at improving transduction of human hepatocytes.

In embodiments, the human PAH is introduced into an AAV vector. In embodiments, the prothrombin enhancer is introduced into the AAV vector. In embodiments, the hAAT promoter is introduced into an AAV vector. In embodiments, the rabbit globin intron is introduced into an AAV vector. In embodiments, any one or more of human PAH, prothrombin enhancer, hAAT promoter, and rabbit globin intron are introduced into the AAV vector. In embodiments, the viral vector comprises a prothrombin enhancer, a hAAT promoter, and a PAH sequence (AAV-Pro-hAAT-PAH; AGT 323).

In embodiments, the prothrombin enhancer sequence is any one of the prothrombin sequences or variants disclosed herein. In embodiments, the PAH sequence is any one of the PAH sequences or variants described herein. In embodiments, the hAAT sequence is any one of the hAAT sequences or variants disclosed herein. In embodiments, the intron sequence is any of the intron sequences or variants disclosed herein.

In aspects of the disclosure, lentiviral vector therapy is used to treat a subject having a mutated PAH gene. In an embodiment, the subject is a human. In other embodiments, as experimentally shown herein, the subject is a neonatal mouse derived from the Pah mutant mouse line. In embodiments, the mutant mouse line is Pah^enu1. In embodiments, the mutant mouse line is Pah^enu2. In embodiments, the mutant mouse line is Pah^enu3。

In embodiments, the PAH sequence in the lentiviral vector is any PAH sequence or variant described herein and includes those in the PAHvdb, BIODEF, BIOPKU, JAKE or pndbb databases in www.biopku.org.

In an embodiment, the lentiviral vector comprises an integrating lentiviral vector. In an embodiment, the integrating lentiviral vector is derived from a lentiviral vector system. In embodiments, the lentiviral vector system comprises separate plasmids encoding the rev gene and the envelope gene. In an embodiment, the integrating lentiviral vector is derived from a 3-vector lentiviral system. In an embodiment, a 3-vector lentivirus system is shown in FIG. 1. In an embodiment, the integrating lentiviral vector is derived from a 4-vector lentiviral system. In an embodiment, a 4-vector lentiviral vector system is shown in fig. 2.

In aspects of the disclosure, lentiviral expression in cells containing shRNA and PAH inhibits expression of endogenous PAH, but does not inhibit expression of exogenous PAH expressed from a lentiviral vector.

In embodiments, the shRNA-and PAH-containing lentivirus is expressed in a subject in vivo, as described herein. In an embodiment, the subject is a mammal. In an embodiment, the mammal is a human.

In embodiments, the shRNA and PAH-containing lentivirus is expressed in vitro or ex vivo. In embodiments, the lentivirus is expressed in vitro, e.g., in a cell line. In embodiments, the cell line is any of the cell lines described herein or those known to one of ordinary skill in the relevant art. In embodiments, the cell line is the Hep3B cell line.

In embodiments, a lentiviral vector is provided comprising a prothrombin enhancer, an hAAT promoter, a PAH sequence, and an shRNA targeting endogenous PAH (optionally referred to herein as L V-Pro-hAAT-PAH-shPAH).

In embodiments, the prothrombin enhancer sequence comprises any one of the prothrombin sequences or variants disclosed herein. In embodiments, the hAAT promoter comprises any of the hAAT promoter sequences or variants disclosed herein. In embodiments, the PAH sequence comprises any one of the PAH sequences or variants described herein. In embodiments, the shRNA sequence in the lentiviral vector comprises SEQ ID NO 13. In embodiments, the shRNA sequence in the lentiviral vector comprises SEQ ID NO. 14.

Other methods and advantages of the invention described herein will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, illustrating by way of example aspects of the invention.

Phenylketonuria

It is believed that PKU is caused by mutations in PAH and/or PAH cofactors (i.e., BH)₄) Defects in synthesis or regeneration. Notably, a variety of PAH mutations have been shown to affect protein folding in the endoplasmic reticulum, which results in accelerated degradation and/or polymerization due to small deletions (13%) and missense mutations (63%) in the protein structure that diminish or largely eliminate the catalytic activity of the enzyme. Because there are many mutations that may affect PAH function, an effective therapeutic approach for treating PKU would require addressing aberrant PAH and ways in which alternative PAH could be administered.

In general, PKU is divided into three major phenotypic groups based on Phe levels measured at diagnosis, dietary tolerance to Phe, and potential responsiveness to treatment. These groups include classical PKU (Phe >1200 μ Μ), atypical or mild PKU (Phe 600-.

Detection of PKU relies on universal neonatal screening (NBS). One drop of blood collected from the heel (heel stick) was tested for phenylalanine levels in a screen that had to be performed in all 50 states of the united states and is often used in most developed countries.

Gene medicine

Genetic pharmaceuticals include viral vectors used to deliver genetic constructs to host cells for the purpose of disease treatment and prevention.

Genetic constructs may include, but are not limited to, functional genes or portions of genes that are modified or complement to be defective, DNA sequences encoding regulatory proteins, DNA sequences encoding regulatory RNA molecules including antisense, short hairpin RNA, short homologous RNA, long noncoding RNA, small interfering RNA, and the like, as well as decoy sequences encoding RNA or proteins intended to compete for important cytokines to alter disease states. Gene medicine involves the delivery of these therapeutic gene constructs to target cells to provide treatment or amelioration of a particular disease.

The ability to reconstitute PAH activity by delivering a functional PAH gene to the liver in vivo should result in the normal clearance of Phe from the blood, thus eliminating the need for dietary restrictions or frequent enzyme replacement therapy. The efficacy of this treatment should be improved by targeting shRNA against endogenous PAH. Within aspects of the present disclosure, a functional PAH gene or variant thereof may also be delivered in utero if the fetus has been identified as being at risk for PKU genotype. In embodiments, a diagnostic step can be performed to determine whether the fetus is at risk for the PKU phenotype. If the diagnostic step determines that the fetus is at risk for the PKU phenotype, the fetus can be treated using the genetic drugs detailed herein. The treatment may be performed in utero or in vitro.

Therapeutic vectors

According to various aspects and embodiments herein, lentiviral virions (particles) are expressed from a vector system that encodes for the production of essential viral proteins by the virions (viral particles). In various embodiments, a vector comprising a nucleic acid sequence encoding a lentiviral Pol protein is provided for reverse transcription and integration, optionally linked to a promoter. In other embodiments, the Pol protein is expressed from a multi-vector. In other embodiments, vectors containing nucleic acid sequences encoding lentiviral Gag proteins are provided for forming viral capsids, optionally linked to a promoter. In embodiments, the gag nucleic acid sequence is located on another vector separate from at least a portion of the pol nucleic acid sequence.

Various modifications may be made to the vectors described herein for generating particles that further minimize the potential for wildtype revertants, including, but not limited to, deletion of the U3 region of L TR, tat deletion, and Matrix (MA) deletion.

The particle-forming vector preferably does not contain a lentiviral genomic nucleic acid sequence expressing an envelope protein. Preferably, an additional vector is employed that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter. The env vector also does not contain a lentiviral packaging sequence. In one embodiment, the env nucleic acid sequence encodes a lentiviral envelope protein.

For example, env genes encoding envelope proteins targeting the endocytic compartment can be used, such as genes for influenza, VSV-G or similar envelope proteins from human or non-human rhabdovirus isolates, α virus (Simmons forest virus, Sindbis virus), arenavirus (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, dengue virus, hepatitis C virus, GB virus), rhabdovirus (vesicular stomatitis virus, rabies virus), paramyxovirus (mumps or measles) and orthomyxovirus (influenza virus). other envelopes that can preferably be used include endogenous retroviruses from felines and felines, Moloney leukemias such as M L V-E, M L V-A, Gibbs L V, simian virus and baboon virus.

The lentiviral vectors provided herein typically include at least one helper plasmid comprising at least one of the gag, pol, or rev genes. Each of the gag, pol and rev genes may be provided on a separate plasmid, or one or more genes may be provided together on the same plasmid. In one embodiment, the gag, pol and rev genes are located on the same plasmid (e.g., FIG. 1). In other embodiments, the gag and pol genes are on a first plasmid and the rev gene is on a second plasmid (e.g., fig. 2). Thus, both 3-vector and 4-vector systems can be used to produce lentiviruses, as described herein. In embodiments, the therapeutic vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, e.g., a packaging cell line. A non-limiting example of a packaging cell line is the 293T/17HEK cell line. When the therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line, lentiviral particles are ultimately produced.

In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system comprises a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infected cells; and at least one helper plasmid for expressing the gag, pol and rev genes, wherein lentiviral particles are produced by the packaging cell line when the lentiviral vector, the envelope plasmid and the at least one helper plasmid are transfected into the packaging cell line, wherein the lentiviral particles are capable of inhibiting the production of PAH and/or inhibiting the expression of endogenous PAH.

In another aspect, a lentiviral vector, also referred to herein as a therapeutic vector, comprises the elements of a hybrid 5' long terminal repeat (RSV/5 ' L TR) (SEQ ID NOS: 15-16), the Psi sequence (RNA packaging site) (SEQ ID NO:17), the RRE (Rev-responsive element) (SEQ ID NO:18), the cPPT (polypurine tract) (SEQ ID NO:19), the anti- α trypsin promoter (hAAT) (SEQ ID NO:6), the phenylalanine hydroxylase (PAH) (SEQ ID NOS: 1-4, the woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO:20), and the Δ U33 ' L TR (SEQ ID NO: 21). in embodiments, a lentiviral vector, also referred to herein as a therapeutic vector, comprises the elements of a hybrid 5' long terminal repeat (RSV/5 ' L TR) (SEQ ID NO:15-16), the Psi sequence (RNA packaging site) (SEQ ID NO:17), the Rev-responsive element (SEQ ID NO:18), the RRE (Rev-responsive element) (SEQ ID NO: 4834), the RRE (Rev-responsive element) (SEQ ID NO:18), the promoter, the RRE (SEQ ID NO:19), the promoter, the murine promoter (CRNA-shRNA) and Δ U33 ' L ', the promoter, the antisense sequence (SEQ ID NO:5, SEQ ID NO.

In another aspect, the helper plasmid comprises the elements CMV enhancer/chicken β actin enhancer (SEQ ID NO:23), HIV component gag (SEQ ID NO:24), HIV component pol (SEQ ID NO:25), HIV Int (SEQ ID NO:26), HIV RRE (SEQ ID NO:27), and HIV Rev (SEQ ID NO: 28). in another aspect, the helper plasmid may be modified to include a first helper plasmid for expression of the gag and pol genes, and an additional second plasmid for expression of the Rev gene.

In another aspect, the envelope plasmid comprises the following elements: RNA polymerase II promoter (CMV) (SEQ ID NO:29) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 30). In embodiments, the sequence references herein may be modified with sequence variations by substitution, deletion, addition, or mutation.

In various aspects, plasmids for lentiviral packaging are modified by replacing, adding, subtracting or mutating multiple elements without loss of vector function, for example, but not limited to, elongation factor-1 (EF-1), phosphoglycerate kinase (PGK) and ubiquitin C (UbC) promoters can replace similar elements in plasmids in which the packaging system is located SV40 poly A and bGH poly A can replace HIV sequences in rabbit β globin poly A. helper plasmids can be constructed from different HIV strains or clades VSV-G glycoproteins can be replaced with membrane glycoproteins from human endogenous retroviruses, including HERV-W, baboon endogenous retroBaEV, feline endogenous virus (RD114), gibbon ape leukemia virus (GA L V), rabies virus (FUG), lymphocytic choriomeningitis virus (L CMV), Fowl Plague Virus (FPV), Ross river α virus (RRV), murine leukemia virus 10A1(M L) or ebola virus (Ebol V).

Various lentiviral packaging systems are commercially available (e.g., L enti-vpak packaging kits from OriGene technology, Inc. of Rockwell, Md.) and may also be designed as described herein.

In another aspect, adeno-associated virus (AAV) vectors can be used. In embodiments, the AAV vector is an AAV-DJ serotype. In an embodiment, the AAV vector is any one of serotypes 1-11. In an embodiment, the AAV serotype is AAV-2. In embodiments, the AAV vector is a non-native type engineered for optimal transduction of human hepatocytes.

And (3) constructing an AAV vector. In a disclosed aspect, the PAH coding sequence (SEQ ID NOS: 1-4) and the prothrombin enhancer (SEQ ID NO:5) as well as the hAAT promoter (SEQ ID NO:6) are inserted into the pAAV plasmid (Cell Biolabs, san Diego, Calif.). The PAH coding sequence was synthesized by Eurofins Genomics (lewis verval, kentucky) flanked by EcoRI and SalI restriction sites. The pAAV plasmid and PAH sequences were digested and ligated together using EcoRI and SalI enzymes. The insertion of PAH sequences was verified by sequencing. The prothrombin enhancer and hAAT promoter were then synthesized by eurofins genomics (lewis verval, kentucky) flanked by MluI and EcoRI restriction sites. The pAAV plasmid containing the PAH coding sequence and prothrombin enhancer/hAAT promoter sequence was digested and ligated together using MluI and EcoRI enzymes. The insertion of the prothrombin enhancer/hAAT promoter sequence was verified by sequencing.

In addition, a representative AAV plasmid system for expression of PAH may comprise an AAV helper plasmid, an AAV plasmid, and an AAVRev/Cap plasmid the AAV helper plasmid may comprise a left ITR (SEQ ID NO:31), a prothrombin enhancer (SEQ ID NO:5), a human anti- α trypsin promoter (SEQ ID NO:6), PAH elements (SEQ ID NO:1-4), a poly A element (SEQ ID NO:32), and a right ITR (SEQ ID NO:33) the AAV plasmid may comprise a suitable promoter element (SEQ ID NO:23 or SEQ ID NO:29), an E2A element (SEQ ID NO:34), an E4 element (SEQ ID NO:35), a VA RNA element (SEQ ID NO:36), and a poly A element (SEQ ID NO:32) the AAV Rep/Cap plasmid may comprise a suitable promoter element, a Rep element (SEQ ID NO:37), a Cap element (SEQ ID NO:38), and a poly A element (SEQ ID NO: 32).

In embodiments, there is provided an AAV/DJ plasmid comprising a prothrombin enhancer and PAH sequences (AAV/DJ-Pro-PAH). in embodiments, there is provided an AAV/DJ plasmid comprising a prothrombin enhancer, an intron, and PAH sequences (AAV/DJ-Pro-intron-PAH). in embodiments, the intron is a human β globin intron. in embodiments, the intron is a rabbit β globin intron.

In embodiments, an AAV2 plasmid is provided comprising a prothrombin enhancer and a PAH sequence (AAV 2-Pro-PAH). in embodiments, an AAV2 plasmid is provided comprising a prothrombin enhancer, an intron, and a PAH sequence (AAV 2-Pro-intron-PAH). in embodiments, the intron is a human β globin intron.

In embodiments, any of the AAV vectors disclosed herein may comprise sequences that express a regulatory RNA. In embodiments, the regulatory RNA is lncRNA. In embodiments, the regulatory RNA is a microrna. In embodiments, the regulatory RNA is a piRNA. In embodiments, the regulatory RNA is shRNA. In embodiments, the regulatory RNA is a small RNA sequence comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity to seq id No. 13 or 14.

Production of AAV particles. The AAV-PAH plasmid was combined with plasmids pAAV-RC2 (cell Biolabs) and pHelper (cell Biolabs). The pAAV-RC2 plasmid contains Rep and AAV-2 capsid genes, and pHelper contains adenovirus E2A, E4 and VA genes. The AAV capsid is composed of AAV-8(SEQ ID NO:39) or AAV-DJ (SEQ ID NO:40) sequences. To produce AAV particles, these plasmids were expressed in a 1: 1: 1 (pAAV-shFDPS: pAAV-RC 2: pHelper) into 293T cells. To transfect cells in a 150mm dish (BD Falcon Co.), 10 micrograms of each plasmid was added together in 1ml of DMEM. In another tube, 60 microliters of the transfection reagent PEI (1 microgram/ml) (Polysciences Inc.) was added to 1ml DMEM. The two tubes were mixed together and incubated for 15 minutes. The transfection mixture was then added to the cells and the cells were harvested after 3 days. Cells were lysed by freeze/thaw lysis in dry ice/isopropanol. Benzonase nuclease (Sigma) was added to the cell lysate for 30 minutes at 37 degrees celsius. The cell debris was then pelleted by centrifugation at 12,000rpm for 15 minutes at 4 degrees Celsius. The supernatant was collected and then added to the target cells.

Dosage and dosage form

The disclosed vector compositions allow for short, medium, or long term expression of a gene or sequence of interest and episomal maintenance of the disclosed vectors. Thus, the dosage regimen may vary depending on the condition being treated and the method of administration.

In embodiments, the carrier composition can be administered to a subject in need thereof at different doses. In particular, about ≧ 10 can be administered to the subject⁶One infectious dose (1 dose is required to transduce 1 target cell on average). More specifically, about ≧ 10 can be administered to the subject⁷About.gtoreq.10⁸About.gtoreq.10⁹About.gtoreq.10¹⁰About.gtoreq.10¹¹Or about.gtoreq.10¹²Individual infectious dose per kilogram body weight, or any number of doses between the above values. The upper limit of the dose will be determined for each disease indication and will depend on the toxicity/safety profile of each individual product or product batch.

In addition, the carrier compositions of the present disclosure may be administered periodically, for example, once or twice a day, or any other suitable period of time. For example, the carrier composition can be administered to a subject in need thereof weekly, every other week, three weeks, monthly, every other month, every three months, every six months, every nine months, every year, every eighteen months, every two years, every thirty months, or every three years.

In embodiments, the disclosed carrier compositions are administered in the form of a pharmaceutical composition. In embodiments, the pharmaceutical composition may be formulated in a variety of dosage forms, including, but not limited to, nasal, pulmonary, oral, topical (topical), or parenteral dosage forms for clinical use. Each dosage form may contain various solubilizers, disintegrants, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients. The pharmaceutical composition may also be formulated for injection, insufflation, infusion or intradermal exposure. For example, injectable formulations can comprise a carrier disclosed herein in an aqueous or non-aqueous solution at a suitable pH and tonicity.

The disclosed vector compositions can be administered to a subject via direct injection into the liver using guided injection. In some embodiments, the vector may be administered systemically, via arterial or venous circulation. In some embodiments, the carrier composition can be administered to the tissue immediately surrounding the liver (including spleen and pancreas) through a guide cannula. In some embodiments, the carrier composition can be delivered by injection into the portal vein or portal sinus, and can be delivered by injection into the umbilical vein.

The carrier compositions described herein may be administered by a variety of pharmaceutically acceptable methods, such as intranasally, buccally, sublingually, orally, rectally, ocularly, parenterally (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonarily, intravaginally, topically (locally), topically (topically), topically after laceration, topically, transmucosally, by aerosol, in a semi-solid medium such as agarose or gelatin, or by buccal or nasal spray.

Furthermore, the carrier compositions described herein may be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, solutions, emulsions, and suspensions. In addition, the pharmaceutical composition may be a controlled release formulation, a sustained release formulation, an immediate release formulation, or any combination thereof. Also, the pharmaceutical composition may be a transdermal delivery system.

In some embodiments, the pharmaceutical composition may be formulated into a solid dosage form for oral administration, and the solid dosage form may be a powder, a granule, a capsule, a tablet, or a pill. In some embodiments, the solid dosage form may include one or more excipients, such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. In addition, the solid dosage forms may include a lubricant, such as talc or magnesium stearate, in addition to the excipients. In some embodiments, the oral dosage form may be an immediate release or a modified release form. The release-regulated dosage forms include controlled or extended release, enteric release, and the like. Excipients used in modified release dosage forms are well known to those of ordinary skill in the art.

In embodiments, the pharmaceutical composition may be formulated as a sublingual or buccal dosage form. Such dosage forms include sublingual tablets or solution compositions for sublingual administration and buccal tablets placed between the cheek and the gums.

In embodiments, the pharmaceutical composition may be formulated in a nasal dosage form. Such dosage forms of the present disclosure include solutions, suspensions, and gel compositions for nasal delivery.

In embodiments, the pharmaceutical composition may be formulated in a liquid dosage form for oral administration, such as a suspension, emulsion or syrup. In embodiments, the liquid dosage form may include various excipients such as a humectant, a sweetener, an aromatic agent, or a preservative, in addition to a conventional simple diluent such as water and liquid paraffin. In embodiments, the composition may be formulated for administration to a pediatric patient.

In some embodiments, the pharmaceutical compositions may be formulated for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions, or suppositories. In embodiments, the solution or suspension may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate.

The dosage of the pharmaceutical composition may vary depending on the body weight, age, sex, administration time and mode, excretion rate (excretion rate) and severity of the disease of the patient.

In some embodiments, treatment of PKU is achieved by direct injection of a vector construct disclosed herein into the liver using a needle or an intravascular cannula. In embodiments, the carrier composition is administered into the cerebrospinal fluid, blood or lymphatic circulation using intravenous or arterial cannulation or injection, intradermal delivery, intramuscular delivery, or injection into a drainage organ (draining organ) near the liver.

The following examples are given to illustrate aspects of the present invention. It is to be understood, however, that the invention is not limited to the precise conditions or details set forth in these examples. All printed publications cited herein are specifically incorporated herein by reference.